TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3911
miRNA Sequence: UGUGUGGAUCCUGGAGGAGGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr1431051 926 423 1909 188 --
NM_000024chr52460 377 ------
NM_000037chr852460 1771 977 625 44 42108 1828 562 73 12349 1685
NM_000042chr172101 33 ----122
NM_000068chr1941273 1251 400 100 21280 1020 ----
NM_000080chr174782 641 203 126 ------
NM_000084chrX76454 5027 4536 4391 1362 880 89 22800 2086 11677 --
NM_000091chr282596 2183 2117 1948 1111 887 349 237 22060 838 ----
NM_000092chr264377 3467 3405 3282 834 501 11063 1573 11044
NM_000109chrX62602 1988 897 876 603 542 1620 ----
NM_000115chr1362705 1905 1653 863 836 482 12046 11065 21766 289
NM_000129chr621297 986 1147 ----
NM_000163chr512207 22294 592 ----
NM_000168chr73851 624 505 32819 2727 1148 11234 --
NM_000176chr543078 1164 361 284 33869 2516 1276 ----
NM_000212chr1742493 2056 1888 992 --1858 12036
NM_000216chrX32864 1501 853 --13142 1375
NM_000217chr1264240 3989 3505 1808 593 280 ------
NM_000245chr721904 1739 22036 878 132 --
NM_000248chr343086 2997 1039 1010 --22571 443 --
NM_000259chr1545704 4551 4075 368 --11920 --
NM_000267chr1743327 2927 2196 989 23020 684 ----
NM_000289chr122371 50 --166 --
NM_000314chr1052709 1116 757 401 162 ------
NM_000318chr852857 2759 2387 1932 809 12535 12886 --
NM_000321chr1351771 1628 1290 1155 99 ------
NM_000330chrX42145 2068 1854 375 21544 71 ----
NM_000332chr6146887 6095 5683 4896 2431 2176 2144 1798 1718 857 806 716 275 183 12522 24764 1138 --
NM_000337chr586405 5815 5802 5758 3992 2414 2082 1070 35243 5048 352 ----
NM_000358chr53122 101 64 --1472 --
NM_000362chr2242563 2298 1025 925 22221 916 ----
NM_000368chr944260 3026 1153 807 44450 3233 1759 685 14727 --
NM_000369chr1461647 1640 1543 1442 1302 620 --1247 --
NM_000393chr231719 777 57 ------
NM_000408chr223460 3359 --1567 1926
NM_000421chr171231 ----1134
NM_000428chr1462520 2203 1686 835 550 344 ------
NM_000430chr1722443 250 --32391 791 761 --
NM_000448chr1142998 2515 2425 2041 --11187 12791
NM_000452chr13--11764 --1835
NM_000461chr323740 757 --24013 2877 --
NM_000484chr21----1834 1178
NM_000489chrX73419 2965 2663 999 284 267 126 --22258 944 1782
NM_000492chr7----11024 11546
NM_000503chr831695 272 263 ------
NM_000555chrX77666 6388 5584 3132 2286 808 194 23097 333 ----
NM_000596chr71417 ----2186 130
NM_000612chr1143705 3396 249 104 2886 287 --12879
NM_000615chr1172662 2402 2243 2222 838 456 375 22650 1171 12784 --
NM_000618chr1246296 5837 5580 822 14520 1657 1437
NM_000618chr1246296 5837 5580 822 14520 1657 1437
NM_000620chr1261942 1910 1835 1619 841 605 --1619 --
NM_000663chr1652999 2918 2909 2162 809 1503 1984 --
NM_000676chr173474 89 41 ------
NM_000719chr12166480 6472 6452 6434 5977 5971 5798 4671 4664 4164 2152 2106 1856 1237 922 601 36443 5227 4709 ----
NM_000724chr102706 637 --188 --
NM_000767chr194612 555 374 250 11381 ----
NM_000782chr203292 246 82 ------
NM_000793chr1433267 738 73 25020 3140 1152 --
NM_000806chr531892 1679 774 ----11276
NM_000813chr555332 3878 3418 2156 1451 34273 4263 4251 24727 1572 1820
NM_000814chr1583996 3057 2916 2829 1535 1372 1284 859 12576 ----
NM_000824chr41908 ----1267
NM_000826chr441941 681 607 573 ------
NM_000827chr522347 1817 --12416 --
NM_000829chr1142282 2196 437 78 11820 ----
NM_000831chr155126 5022 942 377 85 46063 1287 1097 612 --14748
NM_000834chr1241128 1107 1085 199 ------
NM_000838chr63861 275 50 1369 12165 --
NM_000866chr351903 1668 1170 1155 366 ------
NM_000868chrX22371 397 ----2906 479
NM_000875chr1566458 5530 5318 4681 2736 89 --22722 1670 --
NM_000899chr1253996 1477 1013 1007 117 23750 3212 ----
NM_000901chr442113 1019 557 300 --2104 53 --
NM_000903chr1641567 1453 1043 107 --1976 1277
NM_000912chr862840 2669 2315 1043 555 421 ----1198
NM_000926chr11159411 9335 8823 8077 7569 5918 5837 3569 3251 2982 2540 2304 1591 960 276 27811 7242 13764 13778
NM_000933chr2041787 484 426 205 --1712 --
NM_000945chr21123 ----1463
NM_000957chr11454 --2514 402 --
NM_000961chr2093880 3717 3367 2938 1098 979 566 286 23 --12882 --
NM_000964chr174987 481 322 80 11096 ----
NM_000990chr1163840 3806 3399 675 422 82 12901 ----
NM_001001323chr1232592 353 50 --12577 --
NM_001001331chr342529 1933 1757 662 ------
NM_001001342chr102510 207 --11076 --
NM_001001395chr1232119 966 821 --164 --
NM_001001396chr172707 1712 1671 597 261 192 50 ------
NM_001001419chr584989 3464 3312 3218 1410 1314 161 120 14128 --14386
NM_001001420chr584989 3464 3312 3218 1410 1314 161 120 14128 --14386
NM_001001481chr832503 2238 831 11221 ----
NM_001001484chr1022001 535 1646 123 --
NM_001001549chr762190 2107 2012 1084 933 802 --21850 545 --
NM_001001550chr762190 2107 2012 1084 933 802 --21850 545 --
NM_001001555chr762190 2107 2012 1084 933 802 --21850 545 --
NM_001001664chr251453 1190 1063 312 109 13777 --13624
NM_001001668chr1963913 3202 2633 1263 797 676 --14155 11382
NM_001001684chr1742168 751 236 220 --1955 --
NM_001001995chrX51233 435 403 325 276 ------
NM_001002032chr173710 580 265 --1747 --
NM_001002814chr863759 3746 3394 2762 2704 1369 13568 --1848
NM_001002838chrX31192 526 500 ------
NM_001002860chr14114454 4339 4307 4051 1748 1160 844 719 566 358 110 --13192 --
NM_001002909chr1752096 1808 863 662 597 1612 ----
NM_001002926chr782032 1849 1767 537 480 287 271 42 ----1956
NM_001003407chr1074977 4780 4699 3404 3346 1515 252 --31565 483 238 --
NM_001003408chr1074977 4780 4699 3404 3346 1515 252 --31565 483 238 --
NM_001003652chr18108503 7806 6624 5794 3023 2924 2615 2261 2150 713 --12066 36517 1268 1006
NM_001003674chr18136725 6565 6547 6263 6064 4491 2599 2501 2044 1758 1213 1187 92 11225 ----
NM_001003675chr18136725 6565 6547 6263 6064 4491 2599 2501 2044 1758 1213 1187 92 11225 ----
NM_001003712chr1274056 3036 2492 1619 1393 273 251 13227 1163 --
NM_001003760chr65873 836 485 329 105 --1350 --
NM_001003800chr973210 2836 2656 1515 1144 1022 864 --11130 --
NM_001003940chr1543822 3657 2831 21 --1544 --
NM_001003942chr1543822 3657 2831 21 --1544 --
NM_001003943chr1543826 3661 2835 25 --1548 --
NM_001004065chr972696 2570 775 660 614 521 262 ----13543
NM_001004304chr1243275 2668 2200 532 ------
NM_001004317chr642766 1757 1122 79 ------
NM_001004328chr1252253 2048 1645 1503 605 --2810 299 12379
NM_001004342chr1115975 4371 4209 3990 3905 2169 1981 920 419 176 44 1860 21342 1328 --
NM_001004346chr43904 148 98 ------
NM_001004722chr24402 346 340 188 --178 1824
NM_001005366chr121234 2743 228 ----
NM_001005375chrY21592 188 ----1718
NM_001005463chr1072482 2390 1899 1676 429 239 23 ------
NM_001005473chr575851 4052 1652 1560 1438 629 507 15029 35469 5408 4975 25100 1399
NM_001005476chr22714 473 1615 ----
NM_001005502chr1295258 4630 3978 857 426 386 152 111 26 13934 14967 11724
NM_001005505chr33533 287 73 11129 11227 --
NM_001006115chr342451 1037 187 158 --1396 --
NM_001006605chr121005 291 --1965 1738
NM_001006605chr121005 291 --1965 1738
NM_001006610chr163783 771 49 ------
NM_001006623chr241794 900 827 35 ------
NM_001006684chrX--1458 --1199
NM_001007023chr1433267 738 73 25020 3140 1152 --
NM_001007024chr1764211 3642 3556 596 469 370 --22712 42 --
NM_001007025chr1764211 3642 3556 596 469 370 --22712 42 --
NM_001007098chr1145 2796 371 ----
NM_001007237chr142675 2637 2612 278 ------
NM_001007246chr2111612 11842 ----
NM_001007271chr105750 435 390 211 180 ------
NM_001007559chr1831772 361 205 ------
NM_001008392chr332466 2360 835 23188 847 --1444
NM_001008401chr1931482 1169 476 --1309 11463
NM_001008408chr7126218 5695 5421 5281 4967 2518 1862 1808 1433 1111 381 216 24683 782 25730 2247 --
NM_001008491chr251903 1895 1329 477 215 --1116 11316
NM_001008492chr251903 1895 1329 477 215 --1116 11316
NM_001008529chr1731281 1106 182 11121 --1380
NM_001008738chr521955 281 ----1706
NM_001008801chr1972162 1614 840 661 556 480 235 1253 6673 647 589 408 380 320 --
NM_001009185chr52774 303 --1544 --
NM_001009552chr83388 157 136 ------
NM_001009554chr4134093 3369 3183 3009 1852 1818 1637 1530 1385 1367 849 672 593 23400 1347 12887 --
NM_001009554chr4134093 3369 3183 3009 1852 1818 1637 1530 1385 1367 849 672 593 23400 1347 12887 --
NM_001009555chr441364 1303 713 399 1296 ----
NM_001009571chr741669 1415 1098 560 ----11580
NM_001009880chr2254699 4086 705 588 160 --34815 3595 421 --
NM_001009909chr1131524 943 107 1139 1420 --
NM_001009959chr242602 1709 862 544 12341 ----
NM_001009960chr772248 2226 1059 1050 620 572 315 11989 2146 64 --
NM_001009993chr254223 3989 3128 1815 56 --12832 --
NM_001010000chr1863536 3278 3121 2525 872 770 --12211 --
NM_001010846chr1113959 3922 3883 3220 3190 2945 2919 1108 847 689 516 --1703 --
NM_001010853chr653282 2194 1212 797 272 13009 ----
NM_001010861chr122077 343 12732 1569 1892
NM_001010888chrX33694 3100 223 11354 --11059
NM_001010891chr555235 2322 1533 1363 302 12472 ----
NM_001010986chrX32240 2184 93 11893 ----
NM_001011537chr342386 857 669 101 ------
NM_001011666chr775241 4145 2478 1474 1243 816 495 11092 ----
NM_001011713chr1411022 ----2395 35
NM_001011885chr15--31153 243 26 ----
NM_001012264chr143875 639 354 ------
NM_001012267chr971939 545 489 460 345 316 98 ------
NM_001012329chr152382 2240 2197 811 611 ------
NM_001012393chr1184974 4342 4306 4236 3476 1908 560 42 21883 329 44611 3923 3134 62 --
NM_001012420chr151634 175 12625 --
NM_001012423chr151634 175 12625 --
NM_001012426chr663423 2695 2142 868 263 77 --22106 862 --
NM_001012427chr663423 2695 2142 868 263 77 --22106 862 --
NM_001012751chr1021730 210 11848 ----
NM_001012753chr1991024 998 940 502 418 290 208 150 66 ------
NM_001012755chrX93148 1967 1954 1063 1030 1018 810 436 217 --14767 13496
NM_001012761chr542514 1651 342 171 1674 12526 --
NM_001012968chrX3452 308 156 ------
NM_001012977chrX149 ----21433 873
NM_001013031chr1032578 1215 761 --22571 469 --
NM_001013406chr751683 1522 1394 203 32 ------
NM_001013620chr12107979 6081 3183 2384 1777 1707 1697 1561 1150 55 16886 47960 6347 3213 1010 --
NM_001013693chr152593 2326 2317 1810 626 --12649 --
NM_001013693chr152593 2326 2317 1810 626 --12649 --
NM_001013717chr53962 251 156 2163 62 1479 --
NM_001014797chr1097881 7036 6036 5782 1182 833 736 85 54 46654 5591 2402 2281 22888 2171 17691
NM_001015053chr171645 21254 77 11044 --
NM_001015877chrX32111 844 47 --21109 356 --
NM_001015887chr351628 1539 1503 1379 1347 ------
NM_001017395chr343358 712 455 91 ------
NM_001017396chr2--1820 --139
NM_001017424chr131847 1388 594 ------
NM_001017425chr131847 1388 594 ------
NM_001017440chr777330 2989 2181 1158 975 891 702 15425 16324 22852 77
NM_001017995chr594662 4547 4134 4091 4047 3445 1706 1154 838 13069 24435 3910 190
NM_001018004chr154521 222 115 24 1648 ----
NM_001018006chr154521 222 115 24 1648 ----
NM_001018007chr154521 222 115 24 1648 ----
NM_001018020chr154521 222 115 24 1648 ----
NM_001018050chr2253478 3199 2704 1309 570 12318 ----
NM_001018052chr2253478 3199 2704 1309 570 12318 ----
NM_001018054chr1152 1586 --11427
NM_001018057chr1141465 1195 301 187 ----1442
NM_001018065chr9115863 5290 4936 4850 4820 4797 1865 1145 858 346 142 11055 15211 --
NM_001018066chr9115863 5290 4936 4850 4820 4797 1865 1145 858 346 142 11055 15211 --
NM_001018067chr184577 4477 4149 3925 1767 1373 1225 1001 24751 174 1124 1456
NM_001018068chr184577 4477 4149 3925 1767 1373 1225 1001 24751 174 1124 1456
NM_001018069chr184577 4477 4149 3925 1767 1373 1225 1001 24751 174 1124 1456
NM_001018074chr543078 1164 361 284 33869 2516 1276 ----
NM_001018075chr543078 1164 361 284 33869 2516 1276 ----
NM_001018076chr543078 1164 361 284 33869 2516 1276 ----
NM_001018077chr543078 1164 361 284 33869 2516 1276 ----
NM_001020658chr131515 321 154 1291 ----
NM_001020658chr131515 321 154 1291 ----
NM_001023567chr1532468 902 461 175 ----
NM_001024094chr543078 1164 361 284 33869 2516 1276 ----
NM_001024401chr1652687 2525 1957 926 347 42422 976 261 233 21775 404 --
NM_001024455chrX82293 826 775 624 561 545 377 72 21867 749 ----
NM_001024647chr12117430 7365 7211 6962 6346 6153 6082 5725 2830 2433 1320 47663 3094 1075 361 --36132 5624 2497
NM_001024649chr542212 1153 1040 935 --1453 --
NM_001024660chr3127 1473 --11280
NM_001024808chr1252585 2269 2083 1092 1013 12578 12302 22325 1911
NM_001024809chr174987 481 322 80 11096 ----
NM_001024847chr341778 1742 566 365 1485 ----
NM_001024855chr321891 370 --11862 --
NM_001024947chr52999 887 ------
NM_001024956chr11105044 4617 4356 3722 2338 2270 1732 1289 1272 859 1597 15202 22025 89
NM_001025068chr331649 1572 463 ----11226
NM_001025069chr331649 1572 463 ----11226
NM_001025076chr1054718 4661 4534 1642 1612 25690 4253 14345 34729 4299 1351
NM_001025077chr1086076 6019 5892 4785 3000 2970 542 97 27048 5611 15703 36087 5657 2709
NM_001025079chr383661 2885 1466 1166 929 708 626 445 --1859 --
NM_001025100chr1863353 2979 2547 1421 360 295 1878 ----
NM_001025108chr283930 2872 1606 1456 914 867 244 40 23677 334 --13402
NM_001025233chr1262138 1854 1759 1038 396 245 ------
NM_001025266chr3144237 4214 4148 4001 1928 1865 1734 1655 979 635 507 409 376 36 11251 --14446
NM_001025356chr1262767 2360 2339 2241 668 506 11007 --12894
NM_001025366chr651690 1546 1182 108 94 1350 ----
NM_001025366chr651690 1546 1182 108 94 1350 ----
NM_001025367chr651690 1546 1182 108 94 1350 ----
NM_001025367chr651690 1546 1182 108 94 1350 ----
NM_001025368chr651690 1546 1182 108 94 1350 ----
NM_001025368chr651690 1546 1182 108 94 1350 ----
NM_001025369chr651706 1562 1198 124 110 1366 ----
NM_001025369chr651706 1562 1198 124 110 1366 ----
NM_001025370chr651690 1546 1182 108 94 1350 ----
NM_001025370chr651690 1546 1182 108 94 1350 ----
NM_001025580chrX21317 62 --14126 11436
NM_001025595chr421058 624 ----1506
NM_001025777chr251221 1144 1037 314 117 ----1470
NM_001029858chr623000 384 13241 11290 --
NM_001029863chr632001 1289 133 22151 2125 --32667 2221 2196
NM_001029875chr562950 2935 2512 1077 348 268 2619 81 ----
NM_001030006chr1742259 1732 1653 650 1487 22034 293 --
NM_001030007chr1662690 2596 1335 1188 1167 270 12670 21231 251 --
NM_001030055chr1444096 720 553 105 ------
NM_001031623chr621339 433 ----11529
NM_001031679chr1262859 2734 2546 2230 626 238 --22209 1253 --
NM_001031685chr13283 216 84 ------
NM_001031690chr762930 2832 2090 997 639 60 22855 2768 ----
NM_001031695chr2254640 4428 2146 1251 889 15245 24591 541 11738
NM_001031732chr493203 2787 2772 2630 735 693 384 276 199 ------
NM_001031804chr1694315 4274 3872 2918 780 426 296 206 162 2176 147 13555 --
NM_001032293chr17--1124 --1666
NM_001032999chr2094866 4679 3496 3306 1734 1516 1326 642 569 1931 35172 4073 3913 23267 1874
NM_001033045chr243599 1628 1610 152 ------
NM_001033087chr203919 754 356 33241 2506 370 ----
NM_001033117chr384451 4000 1739 1606 888 336 282 74 24336 4320 14089 14072
NM_001033551chr1754103 3375 1274 900 805 3936 812 787 43807 3296 626 93 --
NM_001033557chr21943 11387 ----
NM_001033602chr1372573 2451 2405 2379 2232 2048 1944 --21854 1772 --
NM_001033723chr851711 1042 753 662 594 ----12502
NM_001033756chr641624 1480 42 28 1284 ----
NM_001033756chr641624 1480 42 28 1284 ----
NM_001034845chr41528 --1980 --
NM_001034954chr1022338 519 11049 ----
NM_001034955chr1022338 519 11049 ----
NM_001034956chr1022338 519 11049 ----
NM_001034957chr1022338 519 11049 ----
NM_001035003chr421192 311 11207 ----
NM_001035004chr421192 311 11207 ----
NM_001037132chr731904 859 757 --22041 324 --
NM_001037133chr731904 859 757 --22041 324 --
NM_001037164chr721306 74 11501 --1720
NM_001037165chr7138760 8481 7680 7134 5827 5460 3511 3162 1523 1170 1009 932 78 15607 22024 1132 --
NM_001037174chr222116 1953 1730 21888 1719 --
NM_001037317chr122077 343 12732 1569 1892
NM_001037332chr582092 1941 1625 946 915 634 622 198 2804 550 ----
NM_001037333chr582092 1941 1625 946 915 634 622 198 2804 550 ----
NM_001037339chr12655 618 ----1474
NM_001037340chr12655 618 ----1474
NM_001037341chr12655 618 ----1474
NM_001037341chr12655 618 ----1474
NM_001037535chrX21135 481 ----11065
NM_001037536chrX21135 481 ----11065
NM_001037540chrX21135 481 ----11065
NM_001037582chr43494 357 22 --11357 --
NM_001037954chr1143241 2776 2187 605 1688 ----
NM_001039199chr2063481 3418 3244 1764 690 469 --11805 --
NM_001039350chr76704 412 380 316 118 39 --11521 --
NM_001039538chr21850 --2739 725 13069
NM_001039547chr397827 7393 7104 5012 2548 2005 1117 1093 270 --15354 --
NM_001039569chr232813 2519 526 22866 2794 ----
NM_001039580chr4105013 3679 3600 3452 3244 2018 1511 1444 913 762 14287 23479 1318 11619
NM_001039590chrX54007 3882 3622 1445 461 --1666 1315
NM_001039591chrX54007 3882 3622 1445 461 --1666 1315
NM_001039618chr1155963 5216 4921 1402 1092 15180 14874 --
NM_001039709chr2094866 4679 3496 3306 1734 1516 1326 642 569 1931 35172 4073 3913 23267 1874
NM_001039762chr1021606 604 --12081 --
NM_001039840chrX85239 5020 3757 2079 1584 1290 1270 924 35699 4225 1316 14474 --
NM_001039888chr12238 151 2131 72 1512 --
NM_001039937chr1373620 3326 3058 1130 1112 1025 131 ------
NM_001040002chr1731322 1104 225 --1110 --
NM_001040092chr81305 1426 ----
NM_001040142chr292180 2075 1684 876 722 515 435 377 222 ----1582
NM_001040143chr292180 2075 1684 876 722 515 435 377 222 ----1582
NM_001040152chr744292 1972 1891 264 1946 33650 1052 65 13432
NM_001040159chr43499 304 31 ------
NM_001040214chr632197 1603 140 ----21770 430
NM_001040272chr9137 --12064 1118
NM_001040284chr1675114 4697 2118 1784 1041 649 95 --24647 4159 --
NM_001040429chr1343428 2952 598 518 23089 419 ----
NM_001040441chr155024 4958 1013 430 101 ------
NM_001040446chr542230 2046 1863 607 --1700 --
NM_001040450chr1512335 1172 ----
NM_001040453chr1512335 1172 ----
NM_001040665chr794759 4530 4049 3185 1847 1359 1303 1176 166 --11614 --
NM_001040712chr951175 908 739 437 179 171 13046 1952
NM_001042404chr141389 1215 524 505 --11790 --
NM_001042413chr994090 3500 1600 1333 1273 1220 1096 823 538 23509 2544 12607 --
NM_001042424chr482996 2974 2616 2433 2348 1314 882 258 12037 ----
NM_001042453chrX41781 694 326 302 ------
NM_001042473chr1051718 1574 565 324 74 1167 ----
NM_001042486chr2021146 348 2599 483 1308 --
NM_001042492chr1743327 2927 2196 989 23020 684 ----
NM_001042506chrX149 ----11395
NM_001042510chr822115 1697 --1361 --
NM_001042511chr822115 1697 --1361 --
NM_001042555chr12104655 3964 3674 3306 1453 1244 1115 528 425 231 ------
NM_001042599chr255595 5356 2830 898 746 --17782 15827
NM_001042601chr351215 1081 414 151 55 ------
NM_001042681chr162678 1956 1907 1647 946 572 --2717 339 1155
NM_001042682chr162678 1956 1907 1647 946 572 --2717 339 1155
NM_001042682chr162678 1956 1907 1647 946 572 --2717 339 1155
NM_001043318chr1493717 3665 3259 2759 1443 1420 1405 755 506 1341 ----
NM_001044385chr234021 3535 519 13243 ----
NM_001046chr542131 747 362 194 12956 ----
NM_001083620chr441939 680 606 572 ------
NM_001096chr172807 154 ----1179
NM_001099678chr376309 5631 4678 4140 2375 1276 223 ------
NM_001100108chr177691 7394 7242 6931 6435 1184 508 1184 12653 --
NM_001106chr398557 8029 5930 3854 3190 2117 1871 1860 678 --28661 8545 25971 1363
NM_001113490chrX42658 2462 915 326 13223 12367 --
NM_001116chr1673028 2776 2634 2119 1209 687 609 --12794 12133
NM_001121chr1051716 1655 550 301 60 ------
NM_001128chr1662690 2596 1335 1188 1167 270 12670 21231 251 --
NM_001141chr17144 1153 ----
NM_001148chr431554 616 190 2890 203 11407 --
NM_001149chr1031330 403 176 11387 --1122
NM_001153chr23700 320 292 --168 --
NM_001156chr101191 ----1512
NM_001167chrX66255 5626 5291 2475 2328 2143 15056 ----
NM_001172chr144566 300 198 28 1680 ----
NM_001173chr1444096 720 553 105 ------
NM_001174chrX31420 706 81 --1765 11934
NM_001186chr2163156 2573 2296 2281 354 168 ------
NM_001191chr2071416 458 233 222 194 175 54 ------
NM_001198chr631964 1846 878 ------
NM_001202chr14--5100 93 65 56 43 ----
NM_001204chr2137133 7086 6459 6305 4731 2134 2050 1972 1366 979 612 580 179 16632 13077 --
NM_001218chr1542751 2302 876 612 155 12229 --
NM_001219chr751995 1745 1606 455 60 32170 531 318 ----
NM_001241chr232062 1933 343 ----1286
NM_001241chr232062 1933 343 ----1286
NM_001256chr17------22343 608
NM_001257chr1661473 1221 961 612 105 40 11349 ----
NM_001259chr795741 5036 4538 4395 4211 3917 2146 1623 1561 46043 2067 1480 1089 14990 --
NM_001271chr1542303 2207 687 650 22913 1149 ----
NM_001282chr1742259 1732 1653 650 1487 22034 293 --
NM_001289chrX41623 1260 397 374 11335 ----
NM_001290chr42351 219 ----11005
NM_001292chr157831 439 420 345 253 221 132 1290 1895 --
NM_001310chr1253107 3030 2888 606 200 12230 2742 320 1898
NM_001315chr631966 1669 457 12076 ----
NM_001329chr1041301 650 420 336 11376 ----
NM_001332chr541346 1253 1021 113 ----11220
NM_001343chr531443 1378 351 11661 ----
NM_001351chr31100 ----1622
NM_001362chr1441014 384 295 157 --1212 --
NM_001364chr1142988 1789 1714 403 --1940 --
NM_001386chr85624 516 267 230 164 1214 --11791
NM_001390chr1893464 2866 2787 2572 2380 1047 543 158 22 1103 --13277
NM_001396chr2142334 2135 553 258 12458 ----
NM_001397chr152425 1955 1011 278 117 12243 ----
NM_001401chr951577 1263 1086 361 290 ------
NM_001415chrX51399 585 442 226 104 1255 ----
NM_001419chr1964823 3876 3819 3473 352 98 1804 --1781
NM_001421chrX11154 1362 11271 --
NM_001427chr731596 1352 491 ----1399
NM_001431chr62870 82 ----21004 940
NM_001438chr173513 3469 2719 637 603 224 164 ------
NM_001452chr62633 232 1111 ----
NM_001518chr731044 989 957 ----11158
NM_001542chr142675 2637 2612 278 ------
NM_001543chr583650 3253 1818 804 568 356 284 56 13383 1550 14283
NM_001621chr74257 250 125 98 --12540 --
NM_001621chr74257 250 125 98 --12540 --
NM_001626chr1942970 2652 2576 1294 11380 12322 22824 285
NM_001650chr1863984 3582 3320 2951 2743 848 ------
NM_001663chr141131 1929 11762 --
NM_001682chr1222306 67 --12291 11065
NM_001683chr342529 1933 1757 662 ------
NM_001690chr3--22478 959 ----
NM_001695chr863163 3028 2741 2727 1178 345 33642 1337 1281 13362 --
NM_001701chr921100 991 21454 96 11342 11385
NM_001704chr63615 508 383 ------
NM_001709chr1132202 750 148 --22016 757 --
NM_001717chr152138 65 --11106 --
NM_001718chr661357 1078 1017 854 534 499 ------
NM_001746chr542212 1153 1040 935 --1453 --
NM_001759chr1284518 3706 3659 1758 933 616 593 38 ------
NM_001777chr383661 2885 1466 1166 929 708 626 445 --1859 --
NM_001789chr351600 1291 425 220 148 ------
NM_001799chr5------1115
NM_001858chr665093 4811 3399 1640 528 208 13836 11180 --
NM_001859chr963902 3121 3015 2742 1304 1070 13591 11459 --
NM_001874chr1295258 4630 3978 857 426 386 152 111 26 13934 14967 11724
NM_001918chr1178538 8509 8438 8114 6732 6347 6299 6277 6211 6069 5812 5776 3271 2718 1858 1729 1148 27539 6009 48414 7729 7660 2330 --
NM_001936chr76704 412 380 316 118 39 --11521 --
NM_001939chrX93603 3369 2945 2718 1392 1064 734 426 103 11433 1702 --
NM_001955chr62759 38 ----2414 322
NM_001957chr43839 614 117 --12058 --
NM_001969chr1473501 3083 1542 1497 1407 1195 113 ----1184
NM_001977chr421190 486 ----11080
NM_001987chr12--11017 --14076
NM_001991chr1741720 1695 100 62 --1383 11395
NM_002006chr495350 3961 3919 2023 1529 1312 528 406 31 1568 24169 3730 25274 1404
NM_002024chrX42104 1483 686 56 ------
NM_002025chrX106437 6414 5701 2225 1415 1214 1091 956 844 303 35975 3693 612 27710 904 16019
NM_002035chr1833776 1238 410 --11403 --
NM_002061chr141610 1244 759 168 ------
NM_002074chr121488 106 11397 21371 1206 --
NM_002080chr161872 ----168
NM_002092chr475006 4678 4439 4304 3549 2014 1627 1330 ----
NM_002126chr1773807 3343 3236 1037 998 520 67 ------
NM_002182chr352689 2214 714 701 273 --1782 --
NM_002203chr574118 3954 2776 1552 1488 1359 989 13413 1622 --
NM_002207chr33602 179 64 ----1788
NM_002210chr253469 2630 1399 729 650 11327 ----
NM_002211chr102757 52 --11074 --
NM_002214chr795535 4953 4024 3737 2204 1731 1548 968 930 ------
NM_002223chr1253908 3879 3131 1048 618 21206 224 --11540
NM_002232chr141256 1138 981 892 11050 ----
NM_002234chr123212 97 69 ------
NM_002254chr261965 1815 908 413 393 387 --11980 12189
NM_002264chr354902 3855 3124 488 106 34384 3876 1272 21367 265 --
NM_002270chr565417 5100 1846 1476 496 257 1535 ----
NM_002285chr283930 2872 1606 1456 914 867 244 40 23677 334 --13402
NM_002290chr6----11357 11029
NM_002310chr596288 4016 2278 1075 946 807 522 513 207 ------
NM_002313chr1074977 4780 4699 3404 3346 1515 252 --31565 483 238 --
NM_002336chr1273834 3763 3750 3703 3126 1380 1295 --24194 694 --
NM_002342chr123606 180 81 --1422 --
NM_002355chr1241377 1065 913 348 154 ----
NM_002359chr1744124 3642 2723 1506 23663 3573 23358 1517 --
NM_002360chr7112443 2435 2115 1894 1883 1807 1638 746 489 207 139 ------
NM_002374chr21850 --2739 725 13069
NM_002390chr1772089 1501 730 578 432 210 134 --11792 21993 1585
NM_002442chr1211107 --21732 1534 --
NM_002481chr196889 6344 5832 5674 5380 3029 2808 2004 154 15853 37533 5394 328 27697 5640
NM_002505chr641315 1166 1078 441 --11352 --
NM_002507chr174292 200 75 33 --2769 431 --
NM_002518chr23940 903 240 ------
NM_002519chr1121271 266 11120 1611 --
NM_002522chr1763443 2694 1052 590 315 244 ------
NM_002526chr631332 392 354 21094 478 ----
NM_002545chr1184974 4342 4306 4236 3476 1908 560 42 21883 329 44611 3923 3134 62 --
NM_002581chr9135573 5065 4276 3975 3648 2103 2081 1373 954 945 831 68 47 34814 364 285 54746 1450 1006 520 100 1913
NM_002586chr641598 1325 503 332 1340 ----
NM_002594chr2062145 2137 1961 1768 453 63 1360 ----
NM_002595chr1221528 124 --1111 --
NM_002600chr12655 618 ----1474
NM_002605chr153979 852 416 --11111 --
NM_002613chr1684901 4690 3968 3789 3724 1779 1126 1045 34764 1073 175 1965 --
NM_002629chr105888 840 640 93 84 ------
NM_002645chr1151965 1174 1106 987 406 ----12959
NM_002655chr8135302 5195 5165 5045 4683 4519 4141 4105 4083 1938 911 847 256 13612 ----
NM_002670chr331444 1106 26 ------
NM_002703chr461775 1736 1436 519 423 65 ----1376
NM_002706chr21226 1670 ----
NM_002709chr253537 3310 973 174 111 ------
NM_002714chr62815 378 ----127
NM_002718chr352560 2274 2038 1762 559 --1256 1311
NM_002734chr1732019 1394 847 ------
NM_002736chr731634 1573 238 1414 ----
NM_002737chr1775617 5302 4965 4832 4444 2214 109 45337 4638 4203 886 1327 --
NM_002745chr22114162 3212 3060 1663 1475 1424 1227 1049 597 370 342 --1917 --
NM_002822chr1221595 231 --1256 --
NM_002827chr2071469 1239 432 396 288 223 59 --11398 --
NM_002834chr1243246 2909 2802 243 ----23502 3330
NM_002839chr951175 908 739 437 179 171 13046 1952
NM_002840chr131109 159 71 ------
NM_002841chr32713 660 ----1197
NM_002843chr1162977 2525 2289 2113 543 349 --12121 --
NM_002844chr651315 1299 1290 925 328 1225 ----
NM_002849chr12--2300 252 1743 --
NM_002855chr1193318 2883 2866 2692 1154 756 436 364 54 11213 22277 1126 23338 1201
NM_002867chr13219 112 43 ------
NM_002869chr1142072 748 364 165 11868 ----
NM_002874chr931805 91 24 --131 22170 207
NM_002890chr52996 268 --2216 108 --
NM_002906chr1151546 748 459 387 243 --1405 --
NM_002956chr1231363 1024 1011 ------
NM_002959chr154335 3960 3370 3008 148 2683 552 23798 3248 --
NM_002971chr31754 11207 1395 --
NM_002999chr2061918 1405 764 500 413 306 ------
NM_003010chr1712176 22065 193 ----
NM_003012chr872412 1008 949 505 244 172 165 185 ----
NM_003017chr651319 1237 1129 879 383 ------
NM_003028chr913707 72857 1500 1445 1379 1311 1152 551 41417 1351 1283 383 31429 1363 1295
NM_003031chr163783 771 49 ------
NM_003032chr322418 1958 2800 221 11808 --
NM_003071chr331627 664 576 ------
NM_003074chr322049 1472 1584 2667 27 --
NM_003076chr122485 249 --21383 633 --
NM_003099chr15126432 4060 2641 2620 2608 2294 1673 1633 1153 923 508 177 15214 14101 11077
NM_003107chr622091 1603 11834 --1630
NM_003108chr2107286 6795 6075 5805 5698 5490 2843 2769 2743 1709 ------
NM_003112chr723158 2932 23125 2301 1221 --
NM_003118chr541780 1718 1456 663 12039 1212 --
NM_003128chr252516 1868 1829 854 531 12340 1521 --
NM_003144chr642163 1813 1764 1649 ----22055 889
NM_003149chr351555 1487 1279 92 65 ------
NM_003154chr4392 66 60 ------
NM_003155chr822355 2089 11937 --22372 898
NM_003161chr1742993 2371 1342 1264 13309 12930 12346
NM_003199chr1845526 5508 4625 3759 21731 78 1310 --
NM_003200chr19--1104 31680 96 90 --
NM_003221chr633402 1431 1199 23911 1053 23447 3190 13612
NM_003236chr242831 2650 2602 688 12468 1310 23206 965
NM_003242chr341778 1742 566 365 1485 ----
NM_003255chr1732276 753 557 --1476 12183
NM_003262chr395210 4562 4319 3293 1615 884 409 381 277 14022 1602 --
NM_003269chr631181 1099 891 ------
NM_003270chrX2170 125 ------
NM_003298chr3115927 5780 5703 5391 5082 4073 1774 1730 1720 99 53 15674 ----
NM_003304chr341158 1029 434 377 ------
NM_003319chr2----258 27 --
NM_003320chr1134333 1175 465 13969 12698 --
NM_003325chr222588 43 ------
NM_003339chr551327 522 244 100 28 ----11365
NM_003342chr1762895 2753 2626 2607 2214 311 --12470 --
NM_003344chr731644 1236 209 --1648 --
NM_003345chr16------2185 91
NM_003347chr2241778 581 440 139 --22236 1730 --
NM_003370chr193317 176 170 1101 --139
NM_003376chr651690 1546 1182 108 94 1350 ----
NM_003376chr651690 1546 1182 108 94 1350 ----
NM_003392chr363765 3214 3122 1250 924 421 --11028 14066
NM_003404chr204688 582 496 121 ------
NM_003406chr82644 592 1472 ----
NM_003410chrX180 1405 --12578
NM_003411chrY31568 385 75 1374 ----
NM_003412chr363038 2963 2383 884 874 611 3849 104 51 ----
NM_003413chrX11488 ----1549
NM_003423chr1952284 1026 771 108 65 --12551 12642
NM_003430chr1941607 663 541 289 --1414 --
NM_003441chr471027 863 544 513 429 219 50 1351 1978 --
NM_003457chr17--1124 --1666
NM_003458chr353278 2504 529 472 112 --23935 3201 12534
NM_003463chr663170 3120 2679 923 518 105 33105 2102 392 ----
NM_003466chr232442 767 526 173 22002 579 --
NM_003468chr264035 3931 3444 3357 2729 1158 23221 1430 ----
NM_003471chr362275 2153 1909 818 581 365 11507 12135 12320
NM_003483chr1232370 404 212 22229 719 ----
NM_003485chr1441356 1232 1023 27 11148 ----
NM_003489chr2132467 1014 465 11187 --13183
NM_003505chr731866 652 231 2685 438 11420 --
NM_003506chr8----11280 1169
NM_003566chr1232904 345 324 22984 771 ----
NM_003569chr63493 258 116 ------
NM_003583chr1252442 2429 1361 977 820 1309 11016 --
NM_003590chr263668 3414 3378 3346 1625 1610 ----11488
NM_003593chr172280 65 1189 1489 --
NM_003607chr173470 1711 1479 1193 967 398 352 13956 1168 --
NM_003615chr353802 3060 3006 688 386 --11350 --
NM_003617chr1103925 3811 1919 1679 1331 1210 156 113 75 47 25011 3116 13251 11506
NM_003618chr22939 917 21090 192 ----
NM_003624chr1931344 375 142 1109 11256 --
NM_003628chr22714 473 1615 ----
NM_003629chr152944 2389 1222 82 45 --12240 11247
NM_003631chr10----1114 1145
NM_003633chr542572 2256 2234 721 --1436 --
NM_003663chr343257 2933 2558 927 --1576 --
NM_003672chr11399 --1223 --
NM_003679chr133165 2855 1013 13207 ----
NM_003681chr21116215 5433 4641 4635 4272 2462 2143 1893 1738 1438 1253 14465 ----
NM_003692chr94321 288 222 208 ------
NM_003713chr131339 652 360 ------
NM_003714chr52748 99 32886 909 364 22565 36 --
NM_003722chr342710 1891 1828 590 ------
NM_003743chr222152 645 ----1566
NM_003749chr1332121 2034 864 --1625 --
NM_003758chr151368 11463 ----
NM_003758chr151368 11463 ----
NM_003759chr443599 3586 1725 1454 23315 1416 ----
NM_003774chr1262782 2727 2263 2205 197 156 1374 ----
NM_003787chr1831135 640 130 --1604 --
NM_003822chr152765 801 562 247 229 --22753 2128 --
NM_003872chr232538 2452 743 1178 22745 730 --
NM_003873chr1011842 12498 --1642
NM_003895chr211116 --21397 709 --
NM_003899chr1342582 2003 689 490 --22406 2380 --
NM_003908chr2041388 1362 556 490 11277 11356 --
NM_003913chr643730 3114 265 57 ----12760
NM_003916chrX--1143 11462 21480 41
NM_003941chr74821 557 520 189 12413 ----
NM_003949chr1751921 1487 1387 1245 233 1812 --11987
NM_003953chr152533 1917 1744 229 80 32083 1783 850 ----
NM_003958chr653748 1421 1186 1053 162 11502 ----
NM_003966chr5197685 7491 7167 6739 6561 6553 6435 5478 5104 2798 2611 2515 2457 2304 1393 815 430 411 313 13053 42480 1904 1125 585 --
NM_003971chr171617 1106 ----
NM_003972chr1021361 1335 11209 ----
NM_003994chr1253996 1477 1013 1007 117 23750 3212 ----
NM_004004chr131365 ----11276
NM_004006chrX62602 1988 897 876 603 542 1620 ----
NM_004007chrX62602 1988 897 876 603 542 1620 ----
NM_004009chrX62602 1988 897 876 603 542 1620 ----
NM_004010chrX62602 1988 897 876 603 542 1620 ----
NM_004011chrX62602 1988 897 876 603 542 1620 ----
NM_004012chrX62602 1988 897 876 603 542 1620 ----
NM_004013chrX62602 1988 897 876 603 542 1620 ----
NM_004014chrX62602 1988 897 876 603 542 1620 ----
NM_004015chrX62602 1988 897 876 603 542 1620 ----
NM_004016chrX62516 1902 811 790 517 456 1534 ----
NM_004017chrX62602 1988 897 876 603 542 1620 ----
NM_004018chrX62516 1902 811 790 517 456 1534 ----
NM_004020chrX62602 1988 897 876 603 542 1620 ----
NM_004021chrX62516 1902 811 790 517 456 1534 ----
NM_004022chrX62516 1902 811 790 517 456 1534 ----
NM_004023chrX62516 1902 811 790 517 456 1534 ----
NM_004028chr1863984 3582 3320 2951 2743 848 ------
NM_004034chr101191 ----1512
NM_004035chr1794896 4243 3743 3353 1957 1549 1016 782 331 --34878 4620 623 --
NM_004061chr52274 267 190 ----
NM_004078chr13848 272 21 1110 ----
NM_004079chr172968 2723 1979 1844 1799 956 378 22402 679 12701 --
NM_004081chrY21592 188 ----1718
NM_004087chr351830 1698 1497 142 32 21883 116 ----
NM_004093chr1343191 2278 442 379 --23238 555 --
NM_004100chr621784 1006 12376 --185
NM_004124chr1422929 48 --1852 --
NM_004156chr83388 157 136 ------
NM_004161chr241615 1324 1072 121 ------
NM_004162chr31919 1306 2499 330 --
NM_004171chr11129341 8496 6853 6716 6552 6500 3848 3495 2661 2589 1303 559 58861 7109 3414 3330 1009 ----
NM_004183chr111290 2768 85 196 --
NM_004187chrX41343 1055 497 396 11454 ----
NM_004225chr831159 1078 425 --21009 520 --
NM_004232chr1863920 3589 3359 3249 3017 1396 11455 ----
NM_004274chr1453122 2808 2562 2228 2143 12824 --1182
NM_004293chr963599 3592 2539 1540 1260 657 --33441 3192 991 --
NM_004296chr1453359 2774 755 387 190 12542 23882 66 12611
NM_004302chr1252735 2702 2615 2033 253 12557 ----
NM_004321chr252530 1408 616 472 160 --12731 1416
NM_004323chr942496 1673 869 134 12485 ----
NM_004329chr1031428 1042 126 ------
NM_004338chr18136725 6565 6547 6263 6064 4491 2599 2501 2044 1758 1213 1187 92 11225 ----
NM_004339chr2151552 1442 1395 508 51 --31389 494 384 --
NM_004342chr772271 1818 1589 1457 820 670 299 ------
NM_004380chr1642299 1938 1750 1687 1577 ----
NM_004392chr1342389 1835 575 149 ------
NM_004397chr1153862 3469 3079 2802 1247 --1715 --
NM_004404chr251903 1895 1329 477 215 --1116 11316
NM_004412chr10175865 5828 5721 5539 4604 4542 4505 4068 3934 3705 2388 2082 1936 1757 1392 616 318 15381 15213 --
NM_004429chrX31503 1253 70 --11268 --
NM_004433chr131649 1542 450 ----11752
NM_004437chr163348 2956 2673 2235 1128 546 13111 --1945
NM_004438chr252797 2086 2059 1155 979 11250 23124 783 --
NM_004440chr631729 1523 511 ----1766
NM_004447chr1221108 1009 ----1927
NM_004454chr332194 1628 1539 11845 ----
NM_004457chr221367 554 ------
NM_004482chr2------1333
NM_004491chr1943916 3272 647 301 ------
NM_004494chr131209 514 208 ----21090 822
NM_004501chr163995 3292 3051 253 95 47 11461 ----
NM_004504chr222397 264 --11990 --
NM_004506chr62706 602 1156 ----
NM_004514chr1762421 2141 2104 1886 470 168 2506 186 ----
NM_004523chr1041595 1077 1001 345 ------
NM_004527chr1731322 1104 225 --1110 --
NM_004535chr2041218 1141 65 37 ------
NM_004538chrX1573 1273 ----
NM_004566chr1052287 1630 470 395 282 --1596 1621
NM_004586chrX64134 3964 3336 1719 1333 816 11232 23330 897 --
NM_004598chr5103246 3071 3040 2430 981 963 702 536 472 370 ------
NM_004602chr2031071 1042 542 --1304 --
NM_004608chr162365 95 1347 1141 --
NM_004612chr934602 4128 1321 11723 14555 --
NM_004614chr1652075 764 739 661 324 1439 ----
NM_004631chr1152 1586 --11427
NM_004637chr341303 506 265 35 2169 158 11013 --
NM_004654chrY41406 1082 1030 957 1326 --1318
NM_004655chr171320 1286 --1999
NM_004660chrY2470 53 --12067 --
NM_004711chr2253449 2879 846 687 437 --153 --
NM_004717chr72631 239 1384 ----
NM_004726chrX75273 4086 2155 1983 1574 202 131 --15686 14819
NM_004730chr541900 1795 1613 177 --11393 --
NM_004734chr1372891 2206 2115 1088 945 845 660 --1805 21108 1062
NM_004736chr141383 883 487 45 2742 647 1890 --
NM_004745chr875543 5528 1683 1349 620 238 169 25403 4597 26259 4260 24717 699
NM_004748chr1533848 3285 1554 11259 ----
NM_004760chr75749 718 344 256 35 --12185 --
NM_004772chr531075 283 225 2340 309 1213 --
NM_004774chr1762817 2774 2326 2237 1195 1037 12874 ----
NM_004775chr1831612 1538 127 --12102 --
NM_004776chr2053262 3105 2284 290 243 1380 1467 187
NM_004788chr1172465 2459 1101 969 917 739 518 ------
NM_004794chrX------198
NM_004796chr145723 385 313 34 21 --151 11796
NM_004798chr2053312 3048 1396 995 424 ----1782
NM_004801chr231255 298 231 11186 11533 11205
NM_004805chr241269 1063 274 35 --1311 --
NM_004807chr242113 1792 1687 111 ------
NM_004808chr1063342 3141 2922 2235 2067 591 --22418 146 --
NM_004815chr1134916 4891 4665 4531 4503 4473 4312 3332 3324 3124 1945 1719 1625 23400 468 --14244
NM_004822chr1753987 1540 1532 1318 135 11452 --12796
NM_004834chr243030 2895 2559 943 23169 1297 ----
NM_004840chrX51997 1800 1530 726 356 11843 ----
NM_004841chr151002 951 724 198 102 ----3984 862 843
NM_004845chrX54165 3492 664 391 26 1224 ----
NM_004850chr22282 257 --11111 --
NM_004859chr1742940 2390 2127 177 --1185 --
NM_004863chr1475223 4894 4085 1532 1199 391 82 35028 3231 321 24639 4029 --
NM_004866chr574971 4915 4759 1064 605 238 65 14693 ----
NM_004871chr1764211 3642 3556 596 469 370 --22712 42 --
NM_004884chr1541739 1608 578 264 ------
NM_004887chr51728 --1330 11039
NM_004897chr102287 124 ------
NM_004898chr472557 2425 2417 2314 2171 2084 1143 ------
NM_004904chr775241 4145 2478 1474 1243 816 495 11092 ----
NM_004912chr751683 1522 1394 203 32 ------
NM_004926chr1461624 1509 1327 1246 61 54 1536 ----
NM_004929chr821175 268 ----1580
NM_004930chr13682 232 202 1133 2704 225 --
NM_004932chr541694 1121 363 321 --11504 --
NM_004976chr1184809 4598 4294 4129 3552 2000 514 85 --14832 --
NM_004978chr151227 1190 582 451 167 ------
NM_004985chr1294108 3528 3181 3042 1805 1390 1042 671 536 ----13162
NM_004992chrX96625 6479 3406 2691 1908 1334 614 579 422 11885 --15534
NM_004992chrX96625 6479 3406 2691 1908 1334 614 579 422 11885 --15534
NM_004999chr674312 3549 3145 2826 2756 1126 83 ----14320
NM_005010chr731904 859 757 --22041 324 --
NM_005016chr12121 ----1125
NM_005020chr72167 90 1397 ----
NM_005028chr1031744 941 605 1446 11885 --
NM_005056chr1274624 4618 4096 4079 1145 1011 288 14054 ----
NM_005063chr1043141 2622 1426 1270 1660 ----
NM_005065chr1463269 1896 1883 1279 630 618 25333 4420 1543 --
NM_005067chr33980 92 82 --1713 --
NM_005093chr2094866 4679 3496 3306 1734 1516 1326 642 569 1931 35172 4073 3913 23267 1874
NM_005109chr32932 385 ----141
NM_005116chr2083784 3487 3344 3106 3034 3000 2874 95 1827 11667 --
NM_005126chr32851 259 --21440 712 --
NM_005137chr2242128 1782 332 115 31869 286 106 12173 --
NM_005156chr953936 3561 487 218 98 ------
NM_005164chr1231918 1667 816 ------
NM_005181chr81207 --1108 1355
NM_005188chr11117489 5299 5173 5148 2769 2151 1922 1258 1086 777 98 ----28285 1722
NM_005191chr351436 1255 1191 1064 926 ------
NM_005197chr1495859 5407 5084 4200 2490 2443 1246 585 338 --36077 5633 1210 --
NM_005204chr101250 1689 --170
NM_005206chr172933 519 ----184
NM_005229chrX41203 504 193 173 ------
NM_005235chr255595 5356 2830 898 746 --17782 15827
NM_005259chr231543 1136 486 ----1381
NM_005311chr762190 2107 2012 1084 933 802 --21850 545 --
NM_005324chr1741537 707 574 157 1387 21981 788 --
NM_005329chr1632279 1770 946 21776 725 1591 --
NM_005333chrX61265 1220 1017 903 798 117 ------
NM_005338chr753848 3460 1523 164 107 --1785 1970
NM_005339chr433563 3550 3337 21252 635 ----
NM_005359chr1863950 2567 1578 1555 1451 354 --25081 4053 --
NM_005374chr1762334 2150 667 403 336 294 11763 ----
NM_005376chr121035 255 --21127 877 --
NM_005385chr332522 557 202 1591 ----
NM_005399chr184428 4092 3377 2712 1540 1142 604 570 --22905 1102 --
NM_005402chr7135 11261 ----
NM_005413chr2--1141 --1159
NM_005426chr13283 216 84 ------
NM_005433chr1821916 66 ------
NM_005436chr1033985 557 181 ----1662
NM_005440chr1763356 3287 2947 2305 2110 657 1422 11271 --
NM_005455chr121640 715 --1685 --
NM_005458chr941983 680 217 46 --1630 --
NM_005474chr171645 21254 77 11044 --
NM_005475chr1232849 2277 489 --2474 452 12158
NM_005502chr963309 3157 2992 2686 753 305 ------
NM_005503chr151865 21072 22 --2811 801
NM_005509chr541711 388 327 300 ------
NM_005539chr103544 308 135 ------
NM_005542chr771895 756 702 598 548 520 209 ------
NM_005562chr131340 454 179 11654 ----
NM_005570chr1841199 879 185 170 ------
NM_005573chr51574 ----1185
NM_005578chr3104956 3943 3540 3499 3204 1611 1499 1338 1210 182 --34032 815 232 --
NM_005596chr985764 5698 4680 4418 4195 2352 1560 1377 16010 11479 12408
NM_005598chr131417 1196 298 ------
NM_005604chr632565 2166 738 1517 ----
NM_005613chr122234 1876 --2362 101 11649
NM_005637chr1831772 361 205 ------
NM_005639chr1261918 1853 1756 1699 1428 268 2608 570 ----
NM_005650chr2251314 550 262 188 116 ------
NM_005668chr553832 3583 3222 2815 811 1657 11290 11153
NM_005688chr351108 978 971 836 189 ------
NM_005715chr652377 2172 786 577 125 11740 ----
NM_005725chr152243 1899 1596 1579 1502 1689 ----
NM_005736chr1031582 1427 607 ----11411
NM_005738chr721306 74 11501 --1720
NM_005746chr752633 2153 1958 632 265 ------
NM_005748chr1242483 2324 109 76 11221 12458 12606
NM_005759chr254466 4150 3707 1879 493 ------
NM_005779chr593254 3084 2494 1268 1201 1014 150 114 55 12996 12948 12423
NM_005786chr1811288 ----11247
NM_005789chr174712 624 221 110 1658 ----
NM_005797chr1151620 1553 1131 438 176 1652 ----
NM_005807chr13688 248 170 ------
NM_005808chr332466 2360 835 23188 847 --1444
NM_005828chr1764849 4779 4205 3844 1300 716 11735 ----
NM_005840chrX127598 6852 6774 6723 6486 5476 5078 4826 2136 1331 710 413 25435 1254 --12913
NM_005843chr251641 1561 663 268 145 1517 ----
NM_005853chr16------1171
NM_005866chr93335 327 233 155 --1846
NM_005880chr163347 207 150 --141 1251
NM_005898chr1153060 2747 473 367 306 22488 544 --12078
NM_005901chr18108503 7806 6624 5794 3023 2924 2615 2261 2150 713 --12066 36517 1268 1006
NM_005903chr584989 3464 3312 3218 1410 1314 161 120 14128 --14386
NM_005909chr5114304 4015 3565 3194 2961 2604 1178 1021 674 550 202 --14083 --
NM_005920chr143691 3674 617 446 ----13805
NM_005935chr453393 1580 1215 990 395 ------
NM_005955chr185025 4248 3819 3658 1997 1517 1305 146 14775 24236 1360 --
NM_005989chr721610 1400 ----1460
NM_006007chr983990 3781 3453 3206 2856 1093 794 463 --13576 --
NM_006011chr1573402 3338 3167 1226 641 576 49 --33381 3103 3074 --
NM_006016chr642322 2022 521 85 1542 ----
NM_006022chr133804 775 82 ----11034
NM_006030chr33533 287 73 11129 11227 --
NM_006033chr1821483 517 --1236 11943
NM_006037chr2104875 4457 4111 4028 3659 3277 3005 1551 999 442 ----14204
NM_006047chr2083384 2876 2811 2223 2145 1248 696 127 1275 1652 --
NM_006054chr1111454 11515 ----
NM_006060chr744425 4014 3064 829 23500 3104 23838 2703 11287
NM_006080chr732901 2289 1859 22809 2682 1920 --
NM_006095chr484033 3647 3392 3359 2755 1705 1598 1106 --11380 --
NM_006106chr113633 195 70 1658 23277 1173 --
NM_006139chr262893 2606 1922 725 364 233 ------
NM_006148chr1762454 2447 2326 785 769 38 32660 656 355 ----
NM_006154chr1552942 2789 2087 841 255 ----1275
NM_006155chr251903 1895 1329 477 215 --1116 11316
NM_006158chr831674 304 241 11142 ----
NM_006162chr1861353 1164 361 344 131 56 ------
NM_006194chr144890 448 345 294 1265 ----
NM_006196chr2------1116
NM_006203chr584918 2007 1674 1161 821 716 553 87 11635 14843 21213 1189
NM_006209chr81305 1426 ----
NM_006224chr1742455 745 519 509 22045 1936 ----
NM_006226chr22134 91 11062 ----
NM_006237chr1331926 721 601 ----12032
NM_006241chr342443 1959 888 78 11870 --1837
NM_006251chr562599 1027 792 780 647 487 ----13253
NM_006252chr1117585 7215 6933 6777 6686 6048 5545 2588 1994 302 218 25503 2713 22403 1883 11195
NM_006256chr11866 12003 --1428
NM_006258chr1041555 1537 1382 527 2499 484 ----
NM_006268chr112451 98 1964 11017 --
NM_006282chr2084319 3868 3189 1868 1594 1420 862 107 1407 1930 --
NM_006283chr874864 4582 3976 3414 3273 1348 585 1516 ----
NM_006290chr631958 1643 641 ----11653
NM_006300chr1972042 1515 843 766 537 345 279 --1921 1600
NM_006306chrX85472 4483 3762 1761 1387 1374 1264 351 21833 253 12301 --
NM_006313chr1231308 1157 77 ------
NM_006315chr454176 3396 3218 3020 199 24135 1231 1148 14197
NM_006321chr342243 1914 504 62 ------
NM_006323chr41691 ----1242
NM_006335chr1--11020 1200 --
NM_006345chr45362 337 243 83 62 --1520 --
NM_006366chr631199 530 475 1922 1223 --
NM_006367chr13745 235 220 --2373 37 --
NM_006379chr752292 1975 1898 1782 412 ------
NM_006380chr1764334 3670 3594 1746 1568 226 ------
NM_006390chr1231327 1317 49 --21641 1606 --
NM_006393chr1043112 1543 701 675 23784 3087 --23080 1141
NM_006407chr321371 262 11405 ----
NM_006411chr62366 50 1296 1656 --
NM_006431chr12------1181
NM_006434chr1022338 519 11049 ----
NM_006454chr472985 2554 2399 825 618 90 44 22654 705 1234 1472
NM_006465chr1522025 908 11735 22355 710 11713
NM_006469chr1--11049 1297 --
NM_006482chr1252442 2429 1361 977 820 1309 11016 --
NM_006516chr12658 291 21341 1293 ----
NM_006517chrX3768 429 271 --1618 12163
NM_006524chr74802 423 364 168 --1701 --
NM_006526chr2051900 1603 1419 836 805 ------
NM_006534chr2063371 3112 2611 1163 799 694 ------
NM_006537chr154481 406 59 33 ------
NM_006546chr17106571 5879 5345 4316 2454 1520 803 774 675 304 15273 ----
NM_006549chr1252953 2187 2118 936 70 ----11182
NM_006561chr1054718 4661 4534 1642 1612 25690 4253 14345 34729 4299 1351
NM_006587chr4135 --11067 --
NM_006591chr1151926 1296 632 469 351 ------
NM_006595chr1121340 653 1795 11471 --
NM_006599chr1677329 7232 7164 6716 6317 6155 2355 22640 2078 --17663
NM_006614chr352963 2447 669 300 47 22903 1243 ----
NM_006621chr141853 1801 1730 649 2161 40 ----
NM_006628chr1564253 4183 3950 3363 1439 771 1822 11099 13778
NM_006629chr1862092 1137 980 887 244 57 11775 ----
NM_006654chr12104655 3964 3674 3306 1453 1244 1115 528 425 231 ------
NM_006668chr142423 414 --1154 --
NM_006675chr1283153 2498 2432 2378 2367 1076 344 325 ------
NM_006717chr933209 2321 2157 2477 470 --1869
NM_006720chr1074977 4780 4699 3404 3346 1515 252 --31565 483 238 --
NM_006722chr343086 2997 1039 1010 --22571 443 --
NM_006726chr441269 361 337 74 11122 ----
NM_006729chrX125383 5111 4887 4650 4603 4082 3787 3721 2123 2113 1689 1249 --25519 4377 13635
NM_006734chr611316 21154 1126 132 --
NM_006742chr1641499 1323 1232 427 147 --1452
NM_006746chrX21135 481 ----11065
NM_006749chr84853 818 287 153 21121 80 ----
NM_006763chr111415 164 11726 --
NM_006766chr832110 317 206 1632 11790 --
NM_006777chrX32283 2032 106 22655 788 12857 --
NM_006788chr1852144 1877 783 422 137 --1468 --
NM_006790chr53423 79 35 ------
NM_006795chr11190 11359 11544 11469
NM_006826chr21402 --21144 135 1385
NM_006827chr1432773 775 165 ------
NM_006838chr1221445 79 --1543 1584
NM_006851chr1252761 2492 2454 952 44 ------
NM_006885chr1644125 519 362 293 33532 3134 762 --13540
NM_006888chr1412376 1211 --2674 155
NM_006902chr141347 1061 837 43 --11280 --
NM_006912chr11323 --32377 416 352 1970
NM_006915chrX52182 2036 1908 1864 383 ------
NM_006918chr11105044 4617 4356 3722 2338 2270 1732 1289 1272 859 1597 15202 22025 89
NM_006920chr251877 1641 1534 529 374 1547 ----
NM_006924chr1734192 3900 155 --1232 --
NM_006941chr222768 248 --11069 11161
NM_006943chr20113317 3121 2438 2401 2346 2148 1277 821 787 781 585 ------
NM_006981chr932745 2643 599 --12157 --
NM_007006chr1643394 3045 2170 680 ------
NM_007011chr1596555 6499 6060 5346 5265 2588 2168 703 109 56202 4818 4511 2359 2260 --16051
NM_007030chr565031 4980 1664 1271 445 276 --23153 1114 14389
NM_007034chr121009 908 ------
NM_007036chr54946 693 176 167 ------
NM_007042chr322402 2345 ----1266
NM_007050chr20117718 6807 6798 5125 5091 2103 1592 1349 670 572 145 37390 7193 1444 17761 25194 1363
NM_007054chr563051 2928 2794 2519 1046 164 ------
NM_007064chr3127 1473 --11280
NM_007106chr134960 898 874 130 --1447 --
NM_007114chr353196 2419 641 557 429 ------
NM_007146chr1782191 2164 2078 2062 1940 1805 745 426 ------
NM_007150chrX11753 1847 12164 2754 504
NM_007173chr1152340 2220 1959 879 480 ------
NM_007187chr133977 710 192 ------
NM_007189chr761504 1383 1274 1012 516 92 ------
NM_007203chr972696 2570 775 660 614 521 262 ----13543
NM_007212chr132201 2146 545 ------
NM_007219chr204879 762 754 358 --1722 --
NM_007231chrX102473 2374 2351 2263 2064 1773 779 407 256 131 ------
NM_007235chr122477 96 --182 --
NM_007236chr1532429 1628 784 22083 278 ----
NM_007249chr13108363 8103 7757 7552 7534 6640 3452 2206 2025 80 28838 6103 16501 --
NM_007292chr1794896 4243 3743 3353 1957 1549 1016 782 331 --34878 4620 623 --
NM_007331chr462570 2229 411 320 306 53 1405 12205 --
NM_007353chr712446 32459 931 271 ----
NM_007362chr371541 1142 1122 555 457 371 300 --11482 --
NM_007373chr10--21160 23 11117 --
NM_007375chr142340 2102 1042 622 --1995 --
NM_012072chr2074007 3414 3168 2897 1085 777 84 43196 2935 1386 821 ----
NM_012081chr533404 686 555 --23739 349 --
NM_012095chr1043352 3014 396 251 22152 121 1552 --
NM_012096chr383361 2703 2657 2487 1324 1047 460 333 11384 ----
NM_012097chr222116 1953 1730 21888 1719 --
NM_012102chr162678 1956 1907 1647 946 572 --2717 339 1155
NM_012104chr1153602 3441 904 369 42 11267 ----
NM_012104chr1153602 3441 904 369 42 11267 ----
NM_012108chr42503 188 1153 ----
NM_012137chr132209 1845 767 2707 38 ----
NM_012141chr1373620 3326 3058 1130 1112 1025 131 ------
NM_012153chr1142559 1824 594 423 ------
NM_012193chr1154212 4080 2169 1744 1491 35294 4500 645 --11003
NM_012199chr113507 1291 23241 647 --
NM_012218chr1932541 768 120 --22409 287 --
NM_012224chr421011 459 1959 --1794
NM_012234chr343760 3581 1073 392 33006 2906 1231 12917 --
NM_012238chr1011512 ------
NM_012243chr13904 641 79 ------
NM_012249chr263453 2905 2338 2302 1165 508 23429 338 --12188
NM_012259chr61106 188 1239 --
NM_012262chr154838 3572 3191 1789 71 ----1738
NM_012288chr674972 4403 3650 3481 2289 903 186 14655 ----
NM_012294chr7103803 3642 3400 3143 3130 1575 1298 951 420 127 11462 ----
NM_012297chr452595 2116 742 187 175 ------
NM_012301chr761994 1950 1518 1416 106 93 ------
NM_012308chr1172587 2141 628 527 465 143 103 ------
NM_012309chr11114936 4580 4573 4500 4405 4116 3901 3821 3027 786 153 2586 217 13254 --
NM_012316chr144193 4001 3565 1108 21957 105 45220 4917 4606 4448 11542
NM_012319chr182996 893 ------
NM_012333chr12564 126 ------
NM_012405chr183833 3104 2935 1318 381 295 256 82 21495 1155 32888 2437 682 --
NM_012417chr172606 147 2241 177 ----
NM_012461chr143722 574 482 ------
NM_012464chr472301 2158 2008 1107 468 275 261 22766 2367 1771 --
NM_012479chr742077 953 602 222 ----12682
NM_012482chr11653 --183 --
NM_013230chrY31379 1310 711 11545 1121 --
NM_013231chr1413511 24321 3757 24376 458 13419
NM_013238chr1321664 720 1281 ----
NM_013246chr112763 229 1379 ----
NM_013253chr1141465 1195 301 187 ----1442
NM_013261chr453690 3159 2719 2488 727 --11451 11357
NM_013267chr123382 92 63 152 ----
NM_013279chr1142149 895 735 26 --1153 --
NM_013286chr353600 3528 3283 3029 1156 1545 13559 --
NM_013309chr1532198 1034 246 --12312 1553
NM_013336chr361882 1741 1678 1609 1581 479 ------
NM_013354chr811299 138 ----
NM_013372chr1512094 ----13073
NM_013374chr353030 2829 2554 308 138 --22484 165 --
NM_013381chr1232286 2178 1922 11857 ----
NM_013382chr1442160 747 320 202 ------
NM_013423chrX1382 --1104 1896
NM_013427chrX1382 --1104 1896
NM_013433chr1941525 1472 422 404 ----1708
NM_013434chr231894 1825 779 31481 419 125 --11628
NM_013434chr231894 1825 779 31481 419 125 --11628
NM_013437chr821108 963 ------
NM_013449chr1242678 2627 2408 149 --12810 12726
NM_013951chr232442 767 526 173 22002 579 --
NM_013952chr232519 844 603 1150 32079 656 27 --
NM_013953chr232519 844 603 1150 32079 656 27 --
NM_013989chr1433267 738 73 25020 3140 1152 --
NM_013992chr232519 844 603 1150 32079 656 27 --
NM_013999chr1731359 1141 262 --1147 --
NM_014007chr941290 1256 1239 949 ----1823
NM_014016chr311710 --180 1441
NM_014021chr143307 3198 2577 48 ----22196 546
NM_014023chr1052811 2409 1882 1023 134 --1848 --
NM_014028chr642628 1178 822 581 ------
NM_014033chr1262339 1928 1811 824 592 421 ------
NM_014048chr16105142 4995 4375 3803 3623 3461 1860 1096 895 193 25162 3876 34189 2007 1483 --
NM_014057chr9140 11148 ----
NM_014112chr875175 4632 3517 2079 1554 980 286 --14554 1743
NM_014155chr1157078 5530 2044 1401 106 17455 ----
NM_014157chr1663449 2704 281 254 170 146 11481 ----
NM_014178chr142514 489 ------
NM_014181chr232950 2526 2389 --22321 694 --
NM_014191chr12----2800 249 1695
NM_014208chr4------1302
NM_014217chr131847 1388 594 ------
NM_014233chr1721828 854 --1364 --
NM_014240chr32360 216 23022 1409 23072 1223 21272 1162
NM_014253chrX2849 720 11782 22085 1968 --
NM_014289chrX51430 1141 145 106 81 ------
NM_014294chr831489 1219 1087 ----1313
NM_014309chr2254630 4418 2136 1241 879 15235 24581 531 11728
NM_014325chr1241771 595 385 150 ------
NM_014331chr495764 5069 5042 4997 2648 2371 959 739 302 --37371 2170 1222 --
NM_014333chr1152728 2722 2643 2213 566 12394 ----
NM_014351chr2231100 407 348 11444 1232 --
NM_014376chr582092 1941 1625 946 915 634 622 198 2804 550 ----
NM_014379chr82793 158 --1854 1661
NM_014393chr821974 316 --1360 --
NM_014423chr564745 4310 2020 1514 642 37 1728 55418 5363 3611 1224 516 21498 603
NM_014426chr203641 587 136 ------
NM_014445chr321681 210 1514 1183 --
NM_014447chr421057 624 ----1506
NM_014452chr62897 290 1387 1474 --
NM_014456chr101588 11770 --1707
NM_014473chr53456 428 410 1400 ----
NM_014494chr1612030 1228 12223 --
NM_014521chr241799 659 446 136 ------
NM_014548chr1511518 2448 116 ----
NM_014571chr183037 2437 2092 1131 766 565 557 441 11868 ----
NM_014572chr1351298 703 375 362 345 ----21493 490
NM_014607chr242000 1695 1598 1552 ------
NM_014613chr542981 2930 2050 1924 --22457 1990 --
NM_014614chr241356 1277 1219 157 --149 --
NM_014630chr1563398 2803 2772 1133 859 586 ------
NM_014635chr22351 112 11222 ----
NM_014636chr974086 3691 3428 3337 2657 1242 252 1565 11532 --
NM_014647chr1621980 1575 ----1496
NM_014665chr873392 1340 954 574 199 175 89 1894 13328 22568 2249
NM_014670chr221268 299 --11650 --
NM_014676chr131515 321 154 1291 ----
NM_014683chr1731816 1764 706 --1793 --
NM_014686chr1942541 2119 446 311 --1428 1825
NM_014690chr762930 2832 2090 997 639 60 22855 2768 ----
NM_014701chr1543351 3001 2885 518 13402 --11005
NM_014705chr742105 1832 1797 601 ------
NM_014707chr74891 774 412 268 ----11695
NM_014711chr1631377 529 263 --1146 --
NM_014712chr163607 98 25 ------
NM_014721chr676878 6372 5549 1431 1216 917 795 15887 16666 15745
NM_014729chr842009 1658 1541 510 ------
NM_014730chr1224858 82 --14966 11918
NM_014730chr1224858 82 --14966 11918
NM_014733chr51535 --1198 1623
NM_014739chr654118 3309 3003 417 378 ----12560
NM_014741chr1122138 1882 11578 ----
NM_014743chr432259 2083 2043 --21059 802 --
NM_014746chr294005 3923 3455 2972 2898 2840 1034 965 121 ------
NM_014747chr165777 5189 4672 4514 537 268 14196 12224 --
NM_014752chr1111283 11557 --21858 453
NM_014755chr284199 3844 3392 3231 919 858 846 132 --21470 71 --
NM_014764chr121295 --11235 --
NM_014766chr753764 3213 1279 526 348 1798 ----
NM_014767chr1033044 2504 1483 --21264 255 23664 349
NM_014776chr1263170 2730 2019 1969 986 86 ----1739
NM_014787chr152707 2015 1939 1807 907 ------
NM_014790chr52379 178 1159 ----
NM_014795chr21381 2533 390 ----
NM_014798chr1721815 1588 --1360 --
NM_014804chr1731196 215 33 ----1359
NM_014810chr152614 2530 2432 498 245 --12346 12830
NM_014812chr141389 1215 524 505 --11790 --
NM_014819chr531555 866 386 21742 961 ----
NM_014824chr1141781 1364 700 600 ------
NM_014826chr173470 1711 1479 1193 967 398 352 13956 1168 --
NM_014829chr542308 2147 947 635 --1690 11963
NM_014830chr1221449 557 11242 32604 609 210 --
NM_014839chr112118 --11659 --
NM_014850chr384451 4000 1739 1606 888 336 282 74 24336 4320 14089 14072
NM_014873chr164755 4277 3969 1601 1490 414 11745 ----
NM_014876chr2251941 858 724 558 67 --11765 --
NM_014877chr17117689 7662 6057 5623 5376 4706 2928 2461 1888 716 398 26453 1300 15743 --
NM_014891chr741530 1228 1072 652 1395 ----
NM_014893chrY1753 22056 413 --11860
NM_014897chr1753203 2343 2304 2022 485 ------
NM_014899chr572993 2861 2702 2163 1124 690 673 ------
NM_014902chr2021146 348 2599 483 1308 --
NM_014903chr122524 441 11731 ----
NM_014904chr1043270 3179 1428 90 --11176 --
NM_014906chr1754022 3254 3209 2529 1635 --23508 2703 --
NM_014909chr142575 230 11494 13914 --
NM_014926chr32751 207 11040 ----
NM_014935chr142765 237 56 47 ----1199
NM_014939chr18129 ----1457
NM_014953chr13104227 4151 3866 3850 3788 3238 3033 2964 2894 2747 13940 --11151
NM_014961chr41558 21880 1700 --12040
NM_014962chr2032673 1966 653 ------
NM_014978chr1041533 711 508 425 ----11398
NM_014982chr1464991 4889 2005 1848 1032 864 --11858 --
NM_014989chr621871 492 ----31508 362 275
NM_014991chr422333 2175 12465 12124 --
NM_014994chr1552043 1855 941 475 217 1613 ----
NM_015000chr1283059 3031 2243 1901 1120 612 463 133 ------
NM_015002chr1252200 788 667 202 79 --1779 --
NM_015008chr343358 712 455 91 ------
NM_015020chr1663388 1297 960 521 413 78 13666 ----
NM_015025chr242732 2581 1967 194 ------
NM_015026chr1233855 3258 451 13923 --11794
NM_015032chr1342635 2184 2156 1823 32431 178 151 ----
NM_015033chr982653 2230 2145 2087 1245 1110 790 106 --1725 1361
NM_015035chr20115802 5751 5684 5283 4944 4482 4337 2467 1794 485 87 --1979 --
NM_015039chr154303 2894 2645 644 172 43382 1083 927 689 24159 1102 --
NM_015042chr1583695 2987 2921 1701 1125 896 568 447 --12792 12899
NM_015044chr1642980 2935 810 634 12093 --12684
NM_015051chr943043 2367 1371 523 12661 1472 --
NM_015052chr741153 1080 972 319 ----1275
NM_015057chr133517 128 23 ------
NM_015059chr1563554 3232 2597 1104 892 185 23975 766 11411 1780
NM_015068chr763144 1298 1073 955 824 743 --32502 1259 1166 --
NM_015071chr5106021 5865 5691 5444 5029 4934 4578 4465 4407 4292 11760 36135 2171 1480 --
NM_015075chrX5832 825 769 581 442 21816 1471 2553 456 1201
NM_015076chr653995 3025 981 832 475 ----11607
NM_015077chr1754501 2956 2923 1628 617 11429 24708 3899 14455
NM_015082chr552530 2402 1763 718 345 ------
NM_015090chr1105212 5203 5009 4881 3777 2324 1818 1033 999 298 36102 5857 3791 55747 4406 3893 2243 511 15943
NM_015092chr1644575 3547 2986 83 1822 ----
NM_015094chr2231331 555 142 24592 3558 14042 --
NM_015110chr932354 2053 875 --11731 --
NM_015137chr862506 2005 1926 622 566 301 ----1378
NM_015138chr1542607 2330 2300 393 --12558 --
NM_015144chr1663819 3740 790 589 345 323 11178 11010 --
NM_015156chr1443803 2889 815 218 ------
NM_015158chr92647 150 --1626 --
NM_015163chr1451331 1275 1246 1237 611 1603 ----
NM_015178chr882660 2620 1943 1926 1895 547 487 69 --1472 --
NM_015192chr2042943 1107 981 198 22698 722 1123 --
NM_015199chr322366 2074 12771 ----
NM_015205chr13204978 4307 4173 4167 3739 3725 3612 3208 1931 1783 1584 1187 1102 1083 819 565 521 508 336 105 75301 3664 3430 3357 3316 1323 1299 --15060
NM_015213chr113620 598 277 ------
NM_015215chr152588 2533 2006 1091 595 ----12967
NM_015216chr541416 951 621 539 ------
NM_015225chr963106 2572 1191 685 591 361 32833 1168 495 11204 --
NM_015233chr1372573 2451 2405 2379 2232 2048 1944 --21854 1772 --
NM_015256chr52774 303 --1544 --
NM_015264chr2254699 4086 705 588 160 --34815 3595 421 --
NM_015265chr252243 1716 1677 1006 544 11776 ----
NM_015267chr1211658 1271 21683 561 11731
NM_015271chr414241 11410 1849 --
NM_015275chr1262020 1900 1720 820 797 316 11680 ----
NM_015278chr662445 2434 836 650 635 469 32830 2281 771 1658 --
NM_015282chr262938 2866 1931 897 458 244 --12851 --
NM_015288chr573421 3321 3234 2755 2729 448 209 --1161 12742
NM_015296chr1341233 864 458 48 ------
NM_015299chr1463977 3619 3360 2742 844 151 --1764 12532
NM_015305chr142786 692 1225 21719 1340 11415
NM_015310chr8147061 6573 6522 5185 2804 2680 2613 2079 1966 1805 1588 1465 1072 909 12917 27434 6748 --
NM_015313chr1174435 4196 3416 3164 1240 171 65 13669 11290 --
NM_015315chr562338 2134 1337 844 660 190 --12603 --
NM_015317chr232541 549 396 12208 ----
NM_015323chr631690 263 252 ----1229
NM_015326chr112058 11943 --1587
NM_015328chr732433 2113 675 12745 1354 1463
NM_015335chr126656 441 218 114 89 71 ------
NM_015336chr1251992 561 293 250 72 21729 754 184 --
NM_015345chr692752 2260 2060 822 751 721 361 199 164 ------
NM_015347chr1222613 2557 12388 12656 12598
NM_015355chr172805 651 ------
NM_015365chrX21317 62 --14126 11436
NM_015375chr144878 4352 4059 278 1612 ----
NM_015385chr1022338 519 11049 ----
NM_015387chr221599 87 ----1353
NM_015393chr473222 3196 3034 2812 2684 935 540 21133 976 13805 --
NM_015401chr1211038 1828 --1399
NM_015443chr1731164 329 101 1200 ----
NM_015455chr543613 3463 2501 468 --23204 391 1330
NM_015458chr895011 4729 4468 4341 3807 1555 1445 1367 614 43862 3781 1538 505 11328 14785
NM_015493chr1972197 1624 824 691 579 495 98 --22094 1465 12083
NM_015508chr321201 982 --1261 11374
NM_015520chr342111 151 77 63 ----12826
NM_015526chr1931099 422 285 11120 --1317
NM_015541chr331287 421 412 --1514 --
NM_015550chr753128 2569 1364 1252 1159 12818 13559 1914
NM_015555chr621339 433 ----11529
NM_015557chr151259 809 254 79 52 ----1233
NM_015564chr532992 593 305 23409 1296 --13106
NM_015568chr2074251 4208 4192 3994 686 631 579 ------
NM_015569chr1104349 3519 3497 1858 1407 1296 1109 867 463 405 1388 ----
NM_015576chr322316 967 ----11162
NM_015609chr132693 876 400 --11860 --
NM_015635chr91258 1827 ----
NM_015640chr184577 4477 4149 3925 1767 1373 1225 1001 24751 174 1124 1456
NM_015651chr9--1889 2418 242 1234
NM_015678chr1331090 120 91 --1575 11155
NM_015686chrX2531 32 11825 22296 413 --
NM_015695chr64589 483 454 369 11691 ----
NM_015852chr762540 2292 1431 1060 1017 774 3692 440 356 23289 791 21195 188
NM_015881chr1141465 1195 301 187 ----1442
NM_015886chr844312 2211 2127 2087 35220 3926 1332 --11704
NM_015888chr132254 1231 1209 138 22973 2502 --
NM_015906chr134820 4464 1109 14445 11456 23488 440
NM_015995chr15104175 3623 1869 1305 1148 1038 941 794 678 101 35201 4657 3420 14154 --
NM_016009chr154885 4844 4440 3301 1757 ------
NM_016018chr842831 2421 440 63 12141 ----
NM_016019chr74766 413 186 66 ------
NM_016025chr1641396 1388 254 72 --133 --
NM_016028chr11------142
NM_016040chr142462 2433 2057 742 --12684 --
NM_016059chr61960 2385 254 ----
NM_016081chr441965 1846 527 501 12004 ----
NM_016083chr663255 3212 3024 1552 1471 161 22839 278 ----
NM_016096chr822115 1697 --1361 --
NM_016107chr52901 78 11187 --11055
NM_016124chr121273 476 1233 ----
NM_016147chr112894 307 ----1906
NM_016156chr1172341 2317 2091 1565 523 262 188 21622 691 ----
NM_016192chr2--2232 49 --192
NM_016206chr358209 6092 3058 2990 1983 37541 1616 343 48422 8340 2150 1833 15828
NM_016231chr17----11158 1353
NM_016260chr297193 6388 5426 4950 2823 2245 1581 1096 703 15141 17136 --
NM_016271chr1812268 11615 11484 --
NM_016272chr2211984 11880 1370 11965
NM_016320chr1131008 930 447 147 141 --
NM_016322chr952522 2243 2196 1237 833 1555 --1806
NM_016337chr14--2387 147 --1474
NM_016396chr1512291 22627 317 ----
NM_016418chr2262982 2792 2561 1490 965 145 ------
NM_016422chr1163025 2200 1177 655 631 558 1774 1962 --
NM_016424chr1741394 736 626 270 1634 11353 --
NM_016436chr2031723 912 564 1655 ----
NM_016510chr25725 291 277 263 221 3306 250 236 ----
NM_016530chr1553925 3324 1527 985 87 ------
NM_016531chr454039 3423 2864 532 151 ------
NM_016542chrX41781 694 326 302 ------
NM_016544chr272509 1588 1579 1200 313 210 22 --11126 --
NM_016545chr11658 1738 ----
NM_016577chr374480 4323 3947 3815 3585 2809 1565 24131 1675 --1388
NM_016588chr6136 ----1255
NM_016591chr521192 68 1836 --2352 131
NM_016596chr1211038 1828 --1399
NM_016598chr321125 171 11302 21485 41 --
NM_016603chr561874 1859 1536 1411 716 200 3695 688 614 ----
NM_016604chr531196 505 231 ----1197
NM_016605chr542681 2383 2099 621 130 ----
NM_016613chr442385 1753 675 480 1530 1460 --
NM_016620chr121023 71 1938 ----
NM_016626chr1811594 ------
NM_016631chr213901 855 378 1807 1353 --
NM_016824chr1051716 1655 550 301 60 ------
NM_016929chr674254 3419 3393 3326 3222 1618 1168 1292 1394 --
NM_016936chr1611581 ----1719
NM_016950chr43499 304 31 ------
NM_016952chr1153872 2826 2618 1498 826 13839 22897 2721 --
NM_016953chr2156094 6079 5624 4613 4532 4478 4096 3950 3912 1915 1702 1429 1214 811 479 14672 ----
NM_017420chr1443383 3162 2741 921 33479 2578 1148 ----
NM_017423chr421511 498 --1802 12085
NM_017447chr2153991 3894 1096 774 566 13643 23858 818 --
NM_017452chr2031071 1042 542 --1304 --
NM_017453chr2031071 1042 542 --1304 --
NM_017454chr2031071 1042 542 --1304 --
NM_017519chr63508 400 289 --21336 1213 --
NM_017522chr1152 1586 --11427
NM_017551chr1042186 2131 1659 398 21885 87 --12647
NM_017563chr375047 5000 4110 3945 1114 1078 227 11672 14861 --
NM_017590chr2222576 1726 ------
NM_017594chr953114 3091 2331 1008 474 --1156 --
NM_017628chr485157 4922 2004 1503 1253 1133 924 351 14138 1576 24065 1750
NM_017629chr131606 1228 468 ------
NM_017632chr42377 85 ----1146
NM_017633chr633738 3151 1333 --11208 --
NM_017634chr841454 1351 520 181 ------
NM_017635chr11--1321 1501 1291
NM_017637chr9118953 8720 7216 6729 6213 5993 3481 2053 1718 1578 888 18873 ----
NM_017643chr1732284 2014 1041 ----22324 749
NM_017644chr394779 3816 2025 1738 1545 881 77 63 30 --14817 13313
NM_017645chr91953 --12294 12491
NM_017650chr785639 4577 4142 3960 2093 1931 1535 1444 --11139 --
NM_017658chr1454185 3817 2947 1756 464 ------
NM_017664chr1341094 1071 694 204 ------
NM_017666chrX31821 1455 903 186 ----
NM_017671chr2062259 1719 650 617 417 26 21542 504 ----
NM_017694chr221511 22 --11492 --
NM_017709chr163643 3612 3059 2720 166 24 --1248 --
NM_017715chr73750 666 248 --1585 --
NM_017728chr1763080 2121 1922 690 287 276 12574 ----
NM_017737chr11212 ----1166
NM_017740chr161219 1110 11364 --
NM_017745chrX------1526
NM_017776chrX31414 225 158 1310 ----
NM_017778chr8--11197 11156 21208 611
NM_017784chr32450 163 --11209 1235
NM_017787chr1072680 2079 1872 1777 1767 983 195 11121 ----
NM_017801chr332209 1913 766 1274 ----
NM_017811chr971981 750 407 309 298 200 101 ------
NM_017813chr865357 4225 2094 1350 290 32 25694 481 --1316
NM_017826chr133604 302 276 1198 123 --
NM_017848chrX44511 1218 1178 775 ------
NM_017849chr283126 2861 1168 1145 430 409 241 226 13118 11982 22669 1121
NM_017893chr1051367 479 379 192 183 --1107 --
NM_017902chr1053859 3692 2139 1948 1485 1687 3972 887 50 --
NM_017915chr122185 113 1461 ----
NM_017919chr985240 5163 5010 5003 4237 2194 1260 350 --24486 4471 12315
NM_017944chr1143082 2305 1224 135 22894 1956 12681 --
NM_017954chr741669 1415 1098 560 ----11580
NM_018000chr241805 1659 1548 130 ------
NM_018014chr241272 1106 1038 217 ------
NM_018045chr132352 782 183 ----12128
NM_018084chr272850 2587 2267 2221 1333 683 635 ------
NM_018092chr1621234 64 21397 496 ----
NM_018128chr1741372 1153 526 398 --11047 --
NM_018155chr341304 884 453 156 13198 12538 --
NM_018157chr1242988 2525 2041 490 ------
NM_018172chr1191391 1359 1285 1021 580 528 476 424 372 124 ----
NM_018178chr162060 1293 415 208 196 156 1235 ----
NM_018182chr1732148 601 21 --22128 914 12188
NM_018195chr111571 --22109 26 --
NM_018200chr1532145 648 32 11694 ----
NM_018222chr1131659 1219 372 --11704 --
NM_018225chr934615 4504 3910 15058 13660 --
NM_018227chr432582 2505 2438 --1203 --
NM_018243chr4113477 3194 2888 2687 2506 2490 1587 1401 951 806 699 12517 23411 469 --
NM_018247chr62837 271 ------
NM_018254chr132451 1623 1552 --12408 --
NM_018260chr191400 1166 2233 207 --
NM_018293chr362651 2164 1940 1062 421 231 ------
NM_018299chr832503 2238 831 11221 ----
NM_018363chr103332 317 67 --1251 --
NM_018364chr193639 3492 3205 1250 1183 1130 974 434 133 ------
NM_018374chr744257 3690 1959 1931 33350 1979 484 1621 1655
NM_018403chr363271 3074 2984 2763 1432 742 --22749 968 --
NM_018429chr512623 2715 506 --1789
NM_018439chr1852580 1914 1899 1615 54 --11803 --
NM_018440chr888224 7939 6730 5635 5368 3293 1744 983 23239 904 11946 1492
NM_018444chr811476 1651 1382 --
NM_018448chr123955 487 196 140 11237 --
NM_018452chr6_random42846 2529 952 913 1554 --11456
NM_018469chr1741507 1356 982 273 --2541 432 --
NM_018482chr842525 1839 790 269 --21762 30 --
NM_018509chr1761725 1604 1478 1243 1181 439 21500 525 ----
NM_018561chr62629 123 1828 ----
NM_018566chr155047 1687 1329 1124 194 140 11899 14008
NM_018640chr1232119 966 821 --164 --
NM_018644chr112345 306 22113 450 --1825
NM_018650chr151988 1501 899 719 210 ------
NM_018667chr1672453 2069 683 428 262 254 239 22264 1971 ----
NM_018689chr1562377 2258 2216 1675 663 394 ------
NM_018697chr792358 2268 2180 1727 1674 1613 761 374 204 ----11930
NM_018717chr442778 1150 159 24 1802 1925 21006 195
NM_018718chr732121 1612 745 11839 21790 703 --
NM_018841chr163871 3856 2901 2811 1330 1198 --1525 --
NM_018976chr1292859 2493 2394 2081 2002 1156 1138 536 297 ------
NM_018999chr1084675 4596 4110 3654 3551 1621 1004 361 ------
NM_019004chr792356 2003 1867 1609 1530 919 562 530 476 --21786 283 --
NM_019008chr2243772 3571 3122 508 1674 23130 880 --
NM_019022chr1852618 2342 2240 2070 1996 ----1154
NM_019027chr42763 667 132 --21674 90
NM_019045chrX2719 629 ------
NM_019063chr21835 --11576 --
NM_019079chr13900 864 333 ------
NM_019084chr1021929 1923 --12569 1482
NM_019087chr531428 1274 419 ------
NM_019091chr22270 211 1147 11013 --
NM_019106chr2243290 3259 1221 904 23161 26 12118 141
NM_019116chr161723 1507 13349 --
NM_019117chrX53428 3319 2814 2793 1230 22832 2644 13213 12882
NM_019590chr1061263 963 596 207 74 59 ----11031
NM_019596chr2182653 2540 2368 1989 1048 705 442 33 159 1673 --
NM_019610chr141841 1816 1414 345 --1863 --
NM_019613chr1731058 300 131 1990 1317 --
NM_019903chr1051716 1655 550 301 60 ------
NM_020120chr251221 1144 1037 314 117 ----1470
NM_020122chr265912 5543 5451 5038 4453 1239 25438 1808 1269 --
NM_020148chr18112520 2505 2247 1921 1915 1890 871 469 463 417 147 --12221 --
NM_020150chr1041853 1404 394 55 --1177 --
NM_020156chr73613 490 132 1497 ----
NM_020159chr43564 178 117 --11674 --
NM_020177chr532389 733 465 23339 975 ----
NM_020178chr1721014 909 2249 185 ----
NM_020182chr2043554 3056 1194 271 ----13047
NM_020198chr1731312 492 52 11546 ----
NM_020205chr11860 12432 13488 --
NM_020248chr152382 2240 2197 811 611 ------
NM_020310chr1722217 1062 ----180
NM_020336chr2053456 2861 858 521 205 --1603 12937
NM_020337chr432941 1098 521 22514 230 12190 --
NM_020338chr1053185 2768 2297 1497 101 --43415 2275 229 31 12981
NM_020342chr232309 943 269 --12149 --
NM_020346chr111698 --11168 11141
NM_020348chr1072411 2352 1862 1742 1725 1030 253 12227 ----
NM_020379chr13363 225 202 2917 213 ----
NM_020390chr343205 1209 1072 530 14448 13462 --
NM_020416chr442452 998 916 337 ----11087
NM_020420chrY21592 188 ----1718
NM_020429chr752806 2118 1040 865 492 1274 11093 --
NM_020432chr732293 921 618 ------
NM_020440chr123284 699 23056 2578 11075 --
NM_020449chrX3704 656 212 --1255 --
NM_020452chr111774 21877 144 21618 1357 --
NM_020465chr161668 1573 --21712 1379
NM_020466chr6104868 4683 4499 4185 4112 3579 3480 3263 1416 609 --23446 3088 --
NM_020475chr842397 1708 914 562 32045 1765 499 12286 1622
NM_020476chr842397 1708 914 562 32045 1765 499 12286 1622
NM_020477chr842397 1708 914 562 32045 1765 499 12286 1622
NM_020478chr852460 1771 977 625 44 42108 1828 562 73 12349 1685
NM_020480chr842397 1708 914 562 32045 1765 499 12286 1622
NM_020640chr331925 783 679 1888 ----
NM_020647chr812310 ----11597
NM_020655chr1681433 1291 1024 952 942 334 272 136 ------
NM_020686chr1652999 2918 2909 2162 809 1503 1984 --
NM_020692chr144870 750 163 94 ----2306 117
NM_020699chr154952 4897 4236 1827 1463 1106 23399 196 --
NM_020703chr15492 444 434 400 217 ------
NM_020711chr242602 1709 862 544 12341 ----
NM_020713chr2053009 2669 2409 2398 40 12484 ----
NM_020717chrX84918 4130 4119 3988 3500 3469 3459 237 11575 ----
NM_020718chr16106134 4934 4228 4134 2514 2363 2321 2273 1539 988 14867 ----
NM_020727chr2134001 2989 1189 --11581 13745
NM_020728chr712344 22042 1042 ----
NM_020732chr63508 400 289 --21336 1213 --
NM_020734chr1242468 2175 1073 385 ------
NM_020739chr1533848 3285 1554 11259 ----
NM_020742chrX22479 1928 1431 ----
NM_020752chr1031955 1889 792 12165 ----
NM_020755chr621646 1551 11400 ----
NM_020766chrX44529 4405 2818 34 ------
NM_020768chr53880 709 177 --21009 906 21112 1001
NM_020772chr1778600 8593 8423 8208 5257 2525 696 55744 2870 2100 1426 234 ----
NM_020792chr341102 840 134 47 ------
NM_020796chr582800 2724 2679 2408 2250 1193 410 241 1332 22925 2671 12074
NM_020802chr1163232 1295 1053 769 485 321 11220 12624 --
NM_020803chr431542 1525 1506 ------
NM_020810chr1442621 2608 1198 939 --1858 --
NM_020819chr63428 313 280 ------
NM_020830chr262162 1068 965 702 205 74 1770 2527 25 --
NM_020841chr1274056 3036 2492 1619 1393 273 251 13227 1163 --
NM_020845chr1242268 2260 569 138 1144 1882 --
NM_020854chr1811147 11376 --1551
NM_020859chr453746 3011 1020 736 347 ----13619
NM_020870chr431995 1387 896 21483 243 --139
NM_020899chr1762511 2449 2028 886 831 814 --1101 11920
NM_020917chr1932931 2511 886 13596 32500 801 530 --
NM_020918chr1053284 2626 2242 1439 565 11187 --12317
NM_020919chr221115 471 --1922 --
NM_020922chrX31192 526 500 ------
NM_020935chr274474 4426 4292 2962 1511 1363 735 23208 1402 --1784
NM_020940chr1022794 2331 ------
NM_020948chr143563 3270 2947 620 ----23484 2314
NM_020951chr1941916 1614 391 40 22170 767 ----
NM_020956chr1953953 3595 1130 895 375 ------
NM_020962chr153974 774 175 11985 180 --
NM_020964chr1884376 4093 3521 3155 1855 1045 812 241 14669 14749 --
NM_020975chr1041443 762 318 208 11725 ----
NM_020977chr431554 616 190 2890 203 11407 --
NM_020987chr1031330 403 176 11387 --1122
NM_020993chr1252585 2269 2083 1092 1013 12578 12302 22325 1911
NM_021007chr292180 2075 1684 876 722 515 435 377 222 ----1582
NM_021012chr1783203 1976 1185 1103 906 845 636 485 ------
NM_021033chr1353365 2174 721 253 105 --1904 12377
NM_021061chr884252 4163 3845 3507 1725 1590 792 402 13153 11122 --
NM_021072chr52933 134 32621 2264 1738 ----
NM_021079chr1733143 2758 714 12710 --187
NM_021088chr2--1820 --139
NM_021090chr2234929 1916 451 11057 11702 13143
NM_021106chr9--2734 661 131 --
NM_021111chr921130 360 1127 ----
NM_021120chrX42941 2920 2803 397 --12351 1584
NM_021132chr1021190 96 --1262 1289
NM_021159chr451603 1332 1108 631 88 11458 --1319
NM_021180chr12734 62 168 182 --
NM_021183chrX41647 738 220 27 1143 ----
NM_021202chr2041925 969 406 213 --22890 1149 --
NM_021220chr20----131 1302
NM_021255chr142685 671 --11453 --
NM_021629chr333612 3206 121 14477 14812 --
NM_021647chr4134093 3369 3183 3009 1852 1818 1637 1530 1385 1367 849 672 593 23400 1347 12887 --
NM_021705chr641315 1166 1078 441 --11352 --
NM_021783chrX72208 2098 1902 1664 1518 174 105 --2421 234 --
NM_021813chr6105524 5190 4658 4381 4115 3904 627 478 270 191 11669 --25447 29
NM_021911chr555332 3878 3418 2156 1451 34273 4263 4251 24727 1572 1820
NM_021912chr1583996 3057 2916 2829 1535 1372 1284 859 12576 ----
NM_021935chr32297 37 1389 ----
NM_021943chr621787 688 21479 632 --1712
NM_021949chrX7901 352 342 275 90 65 50 1216 11988 22142 1956
NM_021961chr1186832 6333 5612 5204 5139 4862 2867 1726 27040 106 --12962
NM_021964chr376612 6004 4291 4099 2342 868 259 ------
NM_021967chr53508 341 53 ----1972
NM_022048chr1585425 4335 4206 4171 2518 2206 1455 302 14313 ----
NM_022049chr131864 1615 1314 ----1328
NM_022062chr1131880 1373 1217 11697 ----
NM_022085chr651455 1301 516 168 41 ------
NM_022105chr204597 478 254 237 1507 1545 --
NM_022118chr132220 123 ------
NM_022130chr53988 348 96 11033 ----
NM_022166chr1664269 4092 2323 2309 1680 1098 34547 1805 831 14380 --
NM_022169chr1121044 134 21484 402 ----
NM_022170chr741462 1149 668 564 ------
NM_022456chr12117430 7365 7211 6962 6346 6153 6082 5725 2830 2433 1320 47663 3094 1075 361 --36132 5624 2497
NM_022459chr1376294 6279 5149 2190 1401 410 266 35517 4424 1095 12019 25838 1166
NM_022461chr321075 202 --11019 --
NM_022465chr1232559 333 125 --2797 557 --
NM_022473chr1573925 3916 3067 2847 1165 228 49 21614 64 13437 --
NM_022475chr41178 2560 88 ----
NM_022477chr2041248 244 203 56 11571 ----
NM_022482chr2021935 1774 1477 1962 --
NM_022650chr52996 268 --2216 108 --
NM_022716chr131191 905 681 --11124 --
NM_022739chr172356 221 --1304 --
NM_022744chr162476 367 --21101 988 1849
NM_022749chr831208 144 78 11058 136 --
NM_022755chr952547 2472 1939 701 223 22408 485 12648 1608
NM_022758chr6113080 2837 2298 2155 1974 1216 1189 1082 951 547 92 11037 ----
NM_022763chr31700 32624 466 37 ----
NM_022781chr932982 1251 174 ------
NM_022802chr1041301 650 420 336 11376 ----
NM_022821chr12155 85 2403 347 ----
NM_022824chr531852 1381 715 --2475 459 --
NM_022826chr231175 1033 805 ------
NM_022831chr151819 1486 706 603 177 11164 ----
NM_022841chr1552605 2356 2050 943 247 ------
NM_022893chr222589 749 ------
NM_022898chr1463509 1726 1520 1379 97 25 22943 1078 24231 3090 --
NM_022910chr161668 1573 --21712 1379
NM_022912chr251911 763 324 145 91 ------
NM_022918chr1171877 1351 764 505 391 268 201 ------
NM_022978chr53508 341 53 ----1972
NM_023072chr1941159 1023 985 208 ------
NM_023929chr821731 702 1227 ----
NM_024007chr533160 2822 2072 --1904 --
NM_024017chr171625 11240 1358 2417 397
NM_024019chr441053 434 119 24 1985 196 --
NM_024046chr351189 1075 1035 377 119 ------
NM_024090chr4181 21658 1286 11629 --
NM_024103chr1951367 1361 397 378 41 21165 456 21813 327 --
NM_024294chr6113080 2837 2298 2155 1974 1216 1189 1082 951 547 92 11037 ----
NM_024295chr861559 1379 411 170 104 38 ----11313
NM_024345chr975956 5186 5104 5006 4784 4500 4090 33776 2462 923 11231 12318
NM_024408chr123709 1157 --21313 377 --
NM_024416chr9140 11148 ----
NM_024513chr373203 2976 2895 1127 710 246 33 11454 ----
NM_024524chr342262 2052 362 203 ------
NM_024528chrX------162
NM_024545chr22524 517 1745 ----
NM_024551chr1242399 2090 1008 306 1585 ----
NM_024551chr1242399 2090 1008 306 1585 ----
NM_024569chr152610 1994 1821 306 157 32160 1860 927 ----
NM_024613chr84690 194 185 148 ------
NM_024626chr141682 1555 457 54 --1444 --
NM_024638chr372508 2278 2062 1719 628 610 154 --132 --
NM_024639chr642153 694 508 202 --1352 --
NM_024646chr1103904 3587 3384 3212 1299 819 811 687 360 278 --1239 --
NM_024665chr343792 3715 3641 1889 --14590 --
NM_024670chr1021532 411 1371 ----
NM_024689chrX41139 250 134 88 1414 ----
NM_024692chr231789 1649 1200 ------
NM_024698chr1151229 1088 976 374 346 2405 392 --1147
NM_024700chr11214 ----1922
NM_024704chr201809 --21072 154 --
NM_024713chr151176 --1525 11250
NM_024721chr822714 2152 ----12373
NM_024740chr1193829 3486 3216 3083 2887 1299 1095 570 523 21532 1233 2382 268 --
NM_024761chr994772 4478 4081 3462 3294 1303 932 611 269 --34756 4371 1072 1293
NM_024770chr2136498 6481 5860 5802 5507 5267 4984 4819 4562 4549 4170 1285 1218 24758 4396 ----
NM_024798chr1542248 2210 129 64 ------
NM_024817chr1585752 5461 5292 5133 4316 4104 1324 1172 12192 15210 13907
NM_024824chr142348 70 ------
NM_024834chr103494 429 78 145 ----
NM_024887chr11408 2677 578 11574 --
NM_024909chr641420 1013 512 499 --11144 --
NM_024913chr731161 578 223 21279 107 ----
NM_024920chr431062 273 208 ------
NM_024944chr21----1850 1524
NM_024947chr3138580 8380 7995 7589 7454 7159 7089 7064 5867 3497 2207 1047 153 --1130 --
NM_024949chr4104662 3606 3515 3312 3067 1331 683 529 314 139 23104 742 13357 --
NM_024953chr1232698 2094 469 ----12536
NM_024989chr2108027 7469 7434 7081 5958 2465 2331 2013 1338 390 --15487 --
NM_024991chr1022338 519 11049 ----
NM_025054chr863584 3549 1004 949 860 243 13328 ----
NM_025073chr184677 3811 1849 1248 834 456 295 161 ------
NM_025126chr12--1233 2586 507 --
NM_025134chr1631948 1918 450 ------
NM_025138chr133980 486 283 ------
NM_025140chr12166 --2153 107 --
NM_025147chr221019 380 ----1353
NM_025152chr1462005 1477 1442 1244 486 160 ----11501
NM_025160chr194156 3441 3259 1623 1394 1363 1251 806 630 ------
NM_025179chr1114406 4192 4079 3983 3903 3267 3015 1929 1631 1057 51 1777 ----
NM_025187chr1631336 441 409 --1401 --
NM_025191chr152355 1313 801 474 216 13077 ----
NM_025221chr421192 311 11207 ----
NM_025222chr352270 2134 2066 871 489 ----1359
NM_025236chr65739 609 176 168 129 1638 196 --
NM_025250chr7102455 2258 1015 805 507 401 351 313 294 211 ------
NM_030569chr1062914 2188 2036 1255 626 207 1505 ----
NM_030576chr1762384 2360 2352 2176 939 916 ------
NM_030579chr1643503 2548 1153 274 13720 ----
NM_030621chr1443856 2829 1026 518 1636 ----
NM_030625chr1022602 415 --12102 2422 394
NM_030627chr533889 2612 678 ----13219
NM_030634chr152231 1892 1750 977 432 ----22190 443
NM_030647chr735647 2154 161 24207 1995 35308 1904 1094 --
NM_030648chr464614 4052 3834 1349 362 286 24556 4025 13436 --
NM_030650chr253250 3061 2822 2613 230 1519 ----
NM_030664chr1022001 535 1646 123 --
NM_030670chr1251819 1442 796 127 40 11528 ----
NM_030671chr1251819 1442 796 127 40 11528 ----
NM_030674chr1295693 5408 4815 1972 1758 1522 635 397 260 35363 728 55 11885 --
NM_030755chr1421189 139 ----1571
NM_030758chr2251205 1041 590 435 145 ------
NM_030759chr101528 187 ----
NM_030761chr172413 1997 1711 941 796 421 345 --12543 11958
NM_030762chr1241756 1729 523 201 11942 --1219
NM_030806chr1118132 6381 5732 3499 3331 3167 1920 1710 1503 1403 124 36391 6369 3127 32395 1593 1225 --
NM_030810chr651455 1301 516 168 41 ------
NM_030816chr122669 2461 13510 --23338 2689
NM_030817chr1263413 3311 2741 2708 1515 1200 ------
NM_030821chr42326 319 ------
NM_030885chr342083 2021 1813 1442 ------
NM_030938chr172984 294 1322 1143 --
NM_030949chr63480 425 292 ----1442
NM_030952chr121291 1129 --21303 263 --
NM_030953chr5----11559 11403
NM_030962chr111548 ----21329 179
NM_030964chr543546 2286 1370 741 --13314 --
NM_030972chr19142 --3543 149 123 --
NM_031268chr1684901 4690 3968 3789 3724 1779 1126 1045 34764 1073 175 1965 --
NM_031289chr122932 37 --1740 1769
NM_031296chr441693 937 731 668 12518 ----
NM_031309chr872347 2225 2154 2039 1749 1737 695 22055 1860 --1861
NM_031362chr282522 2109 2043 1874 1037 813 275 163 21986 764 ----
NM_031365chr282658 2245 2179 2010 1173 949 411 299 22122 900 ----
NM_031366chr282658 2245 2179 2010 1173 949 411 299 22122 900 ----
NM_031372chr421294 496 11317 --1379
NM_031412chr122449 159 1138 ----
NM_031417chr192792 329 --1235 12056
NM_031427chr1445431 5353 1998 1798 ----14096
NM_031442chrX43155 2607 2369 883 22647 980 --1867
NM_031445chr263224 2345 1374 592 325 309 22415 369 ----
NM_031453chr1072618 2346 1948 1690 871 833 213 ------
NM_031459chr151651 1441 247 142 101 ------
NM_031461chr831964 1482 258 ----11998
NM_031468chr777330 2989 2181 1158 975 891 702 15425 16324 22852 77
NM_031469chr643404 2892 1634 98 --13041 22714 593
NM_031483chr2042777 2395 679 578 ----1539
NM_031844chr163995 3292 3051 253 95 47 11461 ----
NM_031845chr21850 --2739 725 13069
NM_031847chr21850 --2739 725 13069
NM_031886chr1952414 2226 899 890 30 ------
NM_031935chr121057 120 ----127
NM_031937chr22246 37 --170 --
NM_031989chr12121 ----1125
NM_031992chr741462 1149 668 564 ------
NM_032013chr2041248 244 203 56 11571 ----
NM_032017chr151504 658 650 570 144 12006 ----
NM_032021chr1121047 112 1805 ----
NM_032047chr342331 2104 940 572 1279 ----
NM_032102chr1162537 2428 1225 819 199 120 ------
NM_032109chr541239 1081 446 380 1601 ----
NM_032128chr41907 1919 197 --
NM_032145chr641843 1339 661 581 --11753 --
NM_032153chr362557 2501 2407 2108 1771 320 ------
NM_032160chr1854038 3897 3809 2858 1689 1398 11609 --
NM_032186chr121023 71 1938 ----
NM_032189chr13184780 4109 3975 3969 3541 3527 3414 1733 1585 1386 989 904 885 621 367 323 310 138 75103 3466 3232 3159 3118 1125 1101 --14862
NM_032199chr1043438 2463 1356 878 --23003 749 --
NM_032221chr2051277 801 790 102 84 --11289 --
NM_032229chr1331121 917 389 --155 --
NM_032233chr143891 864 61 ------
NM_032242chr342394 2026 640 197 23093 838 ----
NM_032256chr122379 226 --1413 --
NM_032271chr1671190 1153 1139 1127 539 357 69 1979 ----
NM_032288chr342386 857 669 101 ------
NM_032291chr1--2445 157 ----
NM_032295chr73420 262 234 --31236 1094 32 --
NM_032320chr112682 40 ----1277
NM_032352chr1431006 521 358 --1950 --
NM_032373chr1075372 4294 2069 1921 1040 416 376 14236 --15268
NM_032423chr1961573 1537 1458 1404 1036 150 --172 1471
NM_032436chr134881 755 658 27 ------
NM_032439chr1011362 ----11659
NM_032440chr1032016 464 231 --11080 --
NM_032457chr452589 2465 1467 1196 324 --11245 1701
NM_032458chrX32441 1174 377 --2686 256 --
NM_032466chr831125 559 51 ------
NM_032468chr831125 559 51 ------
NM_032482chr1952166 1100 1079 841 518 12070 ----
NM_032491chr1241254 1228 828 21 --11311 --
NM_032499chr151130 1698 ----
NM_032505chr332570 846 709 12487 ----
NM_032509chr832090 1022 621 ------
NM_032521chr2032323 640 528 --1970 --
NM_032538chr672859 2528 2431 2328 1766 414 65 ------
NM_032560chr142801 74 2231 65 ----
NM_032569chr1621456 623 ----1270
NM_032590chr121406 2915 400 ----
NM_032682chr323596 1079 1889 --2976 871
NM_032711chr1744124 3642 2723 1506 23663 3573 23358 1517 --
NM_032727chr1061665 1623 1032 516 466 255 --1436 --
NM_032737chr1932307 1794 411 1515 1942 122
NM_032741chr62366 50 1296 1656 --
NM_032777chr831274 1008 37 11333 --11420
NM_032788chr221134 110 --2208 122 --
NM_032801chr112992 170 1973 12309 11015
NM_032804chr1041958 1929 1728 649 --11819 --
NM_032813chr131902 11053 ----
NM_032817chr1062914 2188 2036 1255 626 207 1505 ----
NM_032818chr942278 2202 1864 677 11778 ----
NM_032833chr152597 2211 1748 710 617 ------
NM_032837chr1742046 1472 492 291 ------
NM_032873chr11104413 3629 2849 2819 2807 1732 1202 1043 986 614 1551 2129 79 --
NM_032906chr41252 1772 ----
NM_032932chr17115932 5568 5468 4783 4703 4502 2352 1641 368 95 89 36184 4257 2193 35445 1176 203 1963
NM_032968chrX93821 3780 3148 3015 2962 1466 1180 676 135 23388 3312 ----
NM_032969chrX93821 3780 3148 3015 2962 1466 1180 676 135 23388 3312 ----
NM_032973chrY93813 3772 3143 3010 2957 1466 1180 676 135 33383 3307 1062 ----
NM_032975chr1893464 2866 2787 2572 2380 1047 543 158 22 1103 --13277
NM_032980chr1893464 2866 2787 2572 2380 1047 543 158 22 1103 --13277
NM_032983chr753230 2879 2532 812 536 1469 1837 --
NM_032999chr731044 989 957 ----11158
NM_033000chr731044 989 957 ----11158
NM_033001chr731044 989 957 ----11158
NM_033014chr9140 11148 ----
NM_033020chr134820 4464 1109 14445 11456 23488 440
NM_033030chr271261 1116 299 285 264 195 134 ------
NM_033058chr82618 259 1890 ----
NM_033087chr93598 489 153 --11073 --
NM_033129chr202668 452 1682 51607 476 292 183 42 1651
NM_033132chr133752 477 55 1546 ----
NM_033133chr1733723 2586 793 --22753 731 --
NM_033138chr772271 1818 1589 1457 820 670 299 ------
NM_033139chr772271 1818 1589 1457 820 670 299 ------
NM_033140chr772271 1818 1589 1457 820 670 299 ------
NM_033157chr772271 1818 1589 1457 820 670 299 ------
NM_033181chr663255 3212 3024 1552 1471 161 22839 278 ----
NM_033221chr932294 647 132 --3588 293 37 11896
NM_033224chr797776 7445 7302 6554 5977 5802 2564 2000 1680 ------
NM_033225chr872872 2538 2058 2009 1945 513 37 32650 2373 192 1947 --
NM_033274chr543426 3393 791 773 --2623 131 --
NM_033285chr841611 1448 1340 926 --11383 13371
NM_033290chrX43731 3529 1055 689 ------
NM_033300chr1152 1586 --11427
NM_033326chr1141720 832 479 95 11766 ----
NM_033342chr5189 ----1109
NM_033360chr1284229 3649 3302 3163 1511 1163 792 657 ----13283
NM_033425chr1143241 2776 2187 605 1688 ----
NM_033429chr1552593 1144 877 729 465 21083 348 13047 --
NM_033503chr1543822 3657 2831 21 --1544 --
NM_033551chr562338 2134 1337 844 660 190 --12603 --
NM_033624chr1252200 788 667 202 79 --1779 --
NM_033626chrX31822 1362 733 11700 ----
NM_033656chr2165540 5463 4737 2000 842 412 11204 ----
NM_052832chr852891 1128 932 574 522 ----32134 586 447
NM_052851chr1342060 1934 1695 893 1461 ----
NM_052867chr1321382 405 11044 ----
NM_052879chr1243869 3133 2500 1243 12812 --11033
NM_052885chr1284305 3434 1625 1377 896 577 179 100 13106 14505 --
NM_052886chr821405 278 21739 730 11733 1493
NM_052896chr121892 1828 2428 323 12143 12466
NM_052898chr821619 357 --1562 2651 614
NM_052905chr241774 1533 569 54 ------
NM_052906chr22114769 3340 3289 3119 1954 1743 1703 896 743 664 132 1563 24717 4575 --
NM_052910chr1331526 1411 590 21993 1964 2539 367 --
NM_052917chr253340 1140 818 689 453 22791 466 22778 2770 --
NM_052927chr522053 1583 ------
NM_052934chr131981 426 56 --1559 --
NM_052954chr212897 216 1381 11997 --
NM_052978chr1431319 1190 42 1649 1152 11920
NM_053023chr1182653 2606 2224 2141 2013 956 728 663 12290 12206 12933
NM_053042chr421241 640 12280 ----
NM_053043chr7126218 5695 5421 5281 4967 2518 1862 1808 1433 1111 381 216 24683 782 25730 2247 --
NM_053056chr1152913 2212 2027 2003 1927 12300 ----
NM_053064chr1463067 2964 2508 2163 917 86 1581 22803 182 --
NM_054025chr112345 306 22113 450 --1825
NM_057159chr951577 1263 1086 361 290 ------
NM_057169chr1263170 2730 2019 1969 986 86 ----1739
NM_057170chr1263170 2730 2019 1969 986 86 ----1739
NM_058170chr11383 ----21493 1372
NM_058172chr44738 448 196 48 ----11833
NM_058241chr241962 1833 923 243 ----1186
NM_058241chr241962 1833 923 243 ----1186
NM_058243chr192291 55 ----1330
NM_078469chr1021216 435 ----1423
NM_078476chr631404 1224 617 1155 --1646
NM_080546chr922184 1993 11976 --1771
NM_080616chr206718 535 526 513 207 133 ------
NM_080650chr1531182 804 311 ------
NM_080669chr1754215 3568 927 688 168 21363 212 24320 4305 --
NM_080676chr203919 754 356 33241 2506 370 ----
NM_080743chr651978 1802 639 185 24 ----1811
NM_080759chr1342389 1835 575 149 ------
NM_080760chr1342389 1835 575 149 ------
NM_080796chr204597 478 254 237 1507 1545 --
NM_080867chr1494943 4918 3964 3715 1593 1097 953 703 88 11196 --13522
NM_080872chr873113 3053 2678 1460 1317 1172 550 --1230 --
NM_130387chr331116 422 247 ----1876
NM_130391chr951175 908 739 437 179 171 13046 1952
NM_130392chr951175 908 739 437 179 171 13046 1952
NM_130393chr951175 908 739 437 179 171 13046 1952
NM_130436chr2142334 2135 553 258 12458 ----
NM_130438chr2152911 2712 1130 835 185 13035 ----
NM_130440chr131109 159 71 ------
NM_130446chr343270 1665 761 356 21603 109 --14160
NM_130795chr9--2734 661 131 --
NM_130797chr76704 412 380 316 118 39 --11521 --
NM_130846chr12--2300 252 1743 --
NM_130847chr1175347 5226 5076 3705 2105 1913 994 15716 45403 4277 4113 1171 --
NM_130850chr14--5100 93 65 56 43 ----
NM_130851chr14--5100 93 65 56 43 ----
NM_133170chr20117718 6807 6798 5125 5091 2103 1592 1349 670 572 145 37390 7193 1444 17761 25194 1363
NM_133264chr1783884 3696 3316 3251 1469 1109 866 257 --13956 11447
NM_133265chrX42658 2462 915 326 13223 12367 --
NM_133329chr221889 1601 ----11565
NM_133330chr482996 2974 2616 2433 2348 1314 882 258 12037 ----
NM_133331chr482996 2974 2616 2433 2348 1314 882 258 12037 ----
NM_133334chr455979 4025 834 766 484 14967 25242 4499 12112
NM_133335chr482996 2974 2616 2433 2348 1314 882 258 12037 ----
NM_133370chr493203 2787 2772 2630 735 693 384 276 199 ------
NM_133372chr521955 281 ----1706
NM_133378chr2----258 27 --
NM_133432chr2----258 27 --
NM_133437chr2----258 27 --
NM_133445chr943744 2486 1099 368 1946 --1939
NM_133473chr1951720 1371 631 553 430 --11836 --
NM_133496chr184146 3389 3259 3055 1132 962 342 165 ------
NM_133638chr521075 547 --11156 --
NM_133646chr245507 4375 4030 1196 34870 2199 1601 --12232
NM_134427chr9--2734 661 131 --
NM_138270chrX73419 2965 2663 999 284 267 126 --22258 944 1782
NM_138333chr932485 1647 403 --1390 --
NM_138338chr2253478 3199 2704 1309 570 12318 ----
NM_138423chr1531854 299 273 ----1735
NM_138426chr721898 576 --2910 656 --
NM_138457chr663423 2695 2142 868 263 77 --22106 862 --
NM_138468chr2125751 5173 4722 4241 2429 1956 1943 1820 1810 1680 1337 156 26266 90 ----
NM_138473chr1274255 3999 3470 3131 460 232 37 13178 14865 24725 1868
NM_138494chr772248 2226 1059 1050 620 572 315 11989 2146 64 --
NM_138559chr241262 1096 1028 207 ------
NM_138571chr61476 1482 ----
NM_138576chr1463509 1726 1520 1379 97 25 22943 1078 24231 3090 --
NM_138578chr2071416 458 233 222 194 175 54 ------
NM_138713chr1677329 7232 7164 6716 6317 6155 2355 22640 2078 --17663
NM_138714chr1677329 7232 7164 6716 6317 6155 2355 22640 2078 --17663
NM_138731chr1473434 2688 2586 1342 698 347 127 ------
NM_138735chr231237 298 231 11186 11515 11205
NM_138771chr721356 1234 ----1115
NM_138773chr52758 131 1636 2912 646 --
NM_138782chr511631 ----1374
NM_138799chr251846 597 266 220 198 ------
NM_138804chr25806 702 645 612 57 ------
NM_138927chr211836 1318 ----
NM_138970chr145723 385 313 34 21 --151 11796
NM_138971chr1153602 3441 904 369 42 11267 ----
NM_138971chr1153602 3441 904 369 42 11267 ----
NM_138972chr1153602 3441 904 369 42 11267 ----
NM_138972chr1153602 3441 904 369 42 11267 ----
NM_138973chr1153602 3441 904 369 42 11267 ----
NM_138973chr1153602 3441 904 369 42 11267 ----
NM_139012chr631966 1669 457 12076 ----
NM_139015chr121555 ----1587
NM_139057chr1582962 2292 2037 1837 942 531 199 83 1658 ----
NM_139071chr122485 249 --21383 633 --
NM_139072chr2141 ------
NM_139076chr43929 298 164 11062 ----
NM_139132chr1131008 930 447 147 141 --
NM_139136chr123418 388 97 ------
NM_139159chr1941243 1068 283 25 --21016 839 --
NM_139167chr84415 111 58 22 ------
NM_139207chr1231606 1456 517 ------
NM_139246chr941983 763 691 146 --1140 --
NM_139279chr242909 2551 1191 705 --22195 328 11297
NM_139283chr1242336 961 462 82 ------
NM_139319chr1221537 373 --2467 55 --
NM_139323chr204688 582 496 121 ------
NM_144488chr9--2734 661 131 --
NM_144489chr9--2734 661 131 --
NM_144567chr142372 2068 477 141 ------
NM_144571chr486738 4840 4720 2664 2252 1689 620 526 26937 775 ----
NM_144599chr1584445 4319 4213 4094 3438 3370 1456 976 24918 954 11296 --
NM_144617chr195607 357 222 197 24 ------
NM_144632chr231902 922 798 1445 --1460
NM_144633chr341471 1344 1324 392 ------
NM_144664chr1142588 2507 2167 1937 ------
NM_144778chr1332614 1748 330 ------
NM_144964chr93847 452 433 ------
NM_144973chr1264347 4143 4103 3536 1997 137 13543 --24063 608
NM_145005chr93987 816 741 ------
NM_145011chr1051946 1836 1672 822 673 1300 --161
NM_145025chr61233 --21172 938 1895
NM_145049chr51107 1271 ----
NM_145117chr1152649 2236 352 200 63 21056 502 ----
NM_145176chr683175 2860 2664 2470 1173 899 665 284 23001 1082 1917 --
NM_145206chr1032353 715 662 1487 --1878
NM_145207chr454911 4273 4068 985 850 --23241 1517 25382 4375
NM_145244chr441347 460 301 139 ------
NM_145259chr246259 6152 5872 1213 2879 702 25287 1860 26028 4996
NM_145263chr422405 2207 22164 135 ----
NM_145276chr192412 145 11099 ----
NM_145284chrX3841 356 83 11018 --1114
NM_145307chr1051372 1215 1178 1007 991 ------
NM_145320chr753128 2569 1364 1252 1159 12818 13559 1914
NM_145321chr753128 2569 1364 1252 1159 12818 13559 1914
NM_145322chr753128 2569 1364 1252 1159 12818 13559 1914
NM_145341chr101588 11770 --1707
NM_145686chr243030 2895 2559 943 23169 1297 ----
NM_145687chr243030 2895 2559 943 23169 1297 ----
NM_145690chr82644 592 1472 ----
NM_145698chr1051718 1574 565 324 74 1167 ----
NM_145735chr131784 1359 2940 799 --
NM_145799chrX53099 2525 2417 2098 305 12216 1860 --
NM_145808chr783037 2324 2261 2075 641 373 358 52 ------
NM_145909chr621358 201 --2516 66 --
NM_147150chr972696 2570 775 660 614 521 262 ----13543
NM_147156chr1021362 948 --11117 --
NM_147157chr93335 327 233 155 --1846
NM_147181chr421192 311 11207 ----
NM_147182chr421192 311 11207 ----
NM_147183chr421192 311 11207 ----
NM_147192chr141468 1201 168 144 1175 ----
NM_147223chr232335 1509 828 ----1749
NM_147233chr222152 645 ----1566
NM_148955chr15126432 4060 2641 2620 2608 2294 1673 1633 1153 923 508 177 15214 14101 11077
NM_152227chr203641 587 136 ------
NM_152261chr1251967 1699 337 329 27 --1974 --
NM_152271chr83822 256 230 ------
NM_152277chr541839 1375 619 28 --21492 645 --
NM_152289chr1951621 1432 690 482 462 ------
NM_152344chr172367 242 ------
NM_152352chr1882988 2636 2560 1981 1926 1914 1241 287 ------
NM_152371chr131571 1309 202 21545 167 --11901
NM_152388chr234021 3535 519 13243 ----
NM_152400chr431987 1737 439 ------
NM_152406chr54580 449 356 71 ------
NM_152409chr543087 921 584 477 ------
NM_152424chrX34227 3670 268 --14329 13255
NM_152437chr1282422 2334 2059 1786 1626 503 271 171 1287 --1208
NM_152475chr1931930 835 282 12386 1689 --
NM_152529chr243599 1628 1610 152 ------
NM_152538chr351628 1539 1503 1379 1347 ------
NM_152556chr762551 2389 2214 1856 1575 930 ------
NM_152563chr1191391 1359 1285 1021 580 528 476 424 372 124 ----
NM_152570chr91280 ----1202
NM_152586chr10277 31 ------
NM_152588chr1241604 1398 1277 682 --21528 689 --
NM_152594chr1541760 1597 1525 613 1118 ----
NM_152605chr1941316 1122 105 21 --2523 274 --
NM_152608chr152598 2489 2404 633 236 11574 ----
NM_152613chr2231009 855 457 --21230 292 --
NM_152624chr575481 5344 5325 5068 4975 1559 1334 ------
NM_152629chr994090 3500 1600 1333 1273 1220 1096 823 538 23509 2544 12607 --
NM_152636chr1142626 2527 1129 406 --1151 --
NM_152641chr1252875 2706 1885 51 45 --1317 --
NM_152660chr12985 407 ------
NM_152688chr6------160
NM_152722chr1131702 1570 499 1273 11398 --
NM_152733chr6106036 5977 5716 5530 2557 2182 1927 1438 1012 418 25259 2563 ----
NM_152737chr671957 1411 832 598 425 214 130 ------
NM_152745chr7--1856 2225 106 --
NM_152749chr72455 316 11121 ----
NM_152754chr732560 718 664 --12925 23577 2428
NM_152756chr554046 3360 3165 362 126 ------
NM_152787chrX53570 1577 1539 1262 958 1745 ----
NM_152826chr15126432 4060 2641 2620 2608 2294 1673 1633 1153 923 508 177 15214 14101 11077
NM_152838chr2083384 2876 2811 2223 2145 1248 696 127 1275 1652 --
NM_152857chr62846 123 --186 --
NM_152858chr62846 123 --186 --
NM_152890chr121278 879 ------
NM_152924chr1596555 6499 6060 5346 5265 2588 2168 703 109 56202 4818 4511 2359 2260 --16051
NM_152945chr2------1181
NM_152996chr14613 544 234 47 12085 11914 --
NM_152999chr794759 4530 4049 3185 1847 1359 1303 1176 166 --11614 --
NM_153029chr16103831 3798 3754 3375 3342 3334 2746 2654 234 59 13984 23517 821 12602
NM_153038chr21771 ----1105
NM_153050chr2234929 1916 451 11057 11702 13143
NM_153051chr2234929 1916 451 11057 11702 13143
NM_153184chr34479 402 191 113 --1225 --
NM_153186chr92647 150 --1626 --
NM_153188chr565417 5100 1846 1476 496 257 1535 ----
NM_153207chr1243903 3479 1610 1272 13097 22761 222 --
NM_153208chr163742 374 219 --1273 --
NM_153273chr342451 1037 187 158 --1396 --
NM_153333chrX--1458 --1199
NM_153343chr441933 1642 1511 490 1750 1416 --
NM_153350chr1671277 646 618 529 408 293 271 1226 ----
NM_153365chr442570 2281 2103 428 12267 ----
NM_153487chr634607 3849 3561 54707 4418 3746 3500 230 157 --
NM_153499chr1263051 2285 2216 1034 168 54 ------
NM_153500chr1263051 2285 2216 1034 168 54 ------
NM_153605chr341624 1348 1038 99 ------
NM_153607chr542522 1143 1086 427 22957 347 --11103
NM_153619chr1542501 1398 1111 111 12916 1348 --
NM_153620chr731375 1239 659 ------
NM_153689chr262384 2194 1944 1877 1556 572 --12241 --
NM_153705chr1142316 2013 307 39 ------
NM_153748chr123418 388 97 ------
NM_153756chr151758 1641 479 385 111 ------
NM_153757chr4--2360 346 ----
NM_153809chr92540 165 ------
NM_153810chr1073373 1812 1765 1716 580 408 245 14753 11156 --
NM_153812chr132251 1886 416 --11602 --
NM_153836chr222019 1786 1204 ----
NM_170665chr1264159 3535 3121 1536 719 90 --12881 --
NM_170692chr151002 951 724 198 102 ----3984 862 843
NM_170706chr154303 2894 2645 644 172 43382 1083 927 689 24159 1102 --
NM_170719chr133980 486 283 ------
NM_170731chr1132202 750 148 --22016 757 --
NM_170732chr1132202 750 148 --22016 757 --
NM_170733chr1132202 750 148 --22016 757 --
NM_170734chr1132202 750 148 --22016 757 --
NM_170735chr1132202 750 148 --22016 757 --
NM_170769chr65739 609 176 168 129 1638 196 --
NM_171998chrX71896 1849 1607 1599 733 408 274 ------
NM_172058chr831695 272 263 ------
NM_172059chr831695 272 263 ------
NM_172060chr831695 272 263 ------
NM_172070chr231772 1496 273 ------
NM_172071chr197452 6954 6204 5544 5250 2820 1656 1003 178 --26123 4985 --
NM_172103chr621784 1006 12376 --185
NM_172105chr621784 1006 12376 --185
NM_172127chr441535 715 678 306 1631 11964 1247
NM_172128chr441491 671 634 262 1587 11920 1203
NM_172159chr362275 2153 1909 818 581 365 11507 12135 12320
NM_172160chr362275 2153 1909 818 581 365 11507 12135 12320
NM_172216chr1252953 2187 2118 936 70 ----11182
NM_172225chr141468 1201 168 144 1175 ----
NM_172226chr1263051 2285 2216 1034 168 54 ------
NM_172240chr121553 --11098 191
NM_172344chr221889 1601 ----11565
NM_172387chr1851306 1117 314 297 84 ------
NM_172388chr1861353 1164 361 344 131 56 ------
NM_172389chr1861353 1164 361 344 131 56 ------
NM_173075chr441795 1697 618 51 --11519 21254 280
NM_173156chr15868 626 496 313 35 173 --1512
NM_173198chr932745 2643 599 --12157 --
NM_173200chr932745 2643 599 --12157 --
NM_173214chr1677329 7232 7164 6716 6317 6155 2355 22640 2078 --17663
NM_173216chr322418 1958 2800 221 11808 --
NM_173217chr322418 1958 2800 221 11808 --
NM_173355chr22423 175 --1106 --
NM_173359chr331833 560 440 11334 1332 --
NM_173454chr153979 852 416 --11111 --
NM_173468chr474873 1963 1926 1550 1207 741 657 ------
NM_173469chr1531238 1215 964 ------
NM_173472chr32207 32 --195 --
NM_173495chrX32359 1955 1729 11034 --22001 217
NM_173511chr242944 1555 1230 944 ----11295
NM_173515chr6------2652 385
NM_173531chr19103718 3464 3264 2966 2725 370 363 322 279 161 ------
NM_173536chr444161 4040 3689 3492 ----14533
NM_173582chr1164647 4494 1694 1686 1479 427 15059 25575 4001 --
NM_173595chr1285245 3621 3423 1776 1656 1521 1454 160 1755 22009 405 --
NM_173602chr1243088 1043 1032 344 11182 12773 --
NM_173631chr1941145 1113 1078 872 1533 4404 379 321 157 --
NM_173632chr1973289 2602 2541 308 225 141 59 22835 410 41308 720 638 484 --
NM_173642chr197730 7688 5962 5947 2656 2387 1897 649 609 48418 8358 2986 1903 ----
NM_173644chr2051941 1733 1596 1433 1313 ------
NM_173667chr542332 380 143 136 21948 512 ----
NM_173694chrX42306 2250 1585 159 11959 ----
NM_173808chr164463 3639 2717 1615 806 285 1722 23886 424 --
NM_173809chr102510 207 --11076 --
NM_173822chr231906 1555 79 --11746 --
NM_173833chr841217 448 129 102 11298 ----
NM_173851chr853666 2727 2550 853 471 --23941 1421 --
NM_174902chr1161727 1651 1389 262 248 24 ------
NM_174911chr863384 3223 2706 967 929 672 13175 23740 1220 --
NM_174921chr42937 465 ----1822
NM_174934chr1143584 2732 2307 358 23528 2316 ----
NM_175077chr2081267 1232 1204 937 565 540 458 62 ------
NM_175623chr12117430 7365 7211 6962 6346 6153 6082 5725 2830 2433 1320 47663 3094 1075 361 --36132 5624 2497
NM_175624chr12117525 7460 7306 7057 6441 6248 6177 5820 2925 2528 1415 37758 1170 456 --36227 5719 2592
NM_175625chr12117525 7460 7306 7057 6441 6248 6177 5820 2925 2528 1415 37758 1170 456 --36227 5719 2592
NM_175733chr1121733 608 --12074 1462
NM_175736chr12127469 7182 6242 6068 5980 5727 5394 2305 2211 1381 1351 574 37071 1594 1052 12788 14789
NM_175748chr1471956 1920 429 386 216 174 78 ------
NM_175767chr561830 1500 1416 1317 1179 457 1652 ----
NM_175852chr173067 3028 2794 2437 2089 1157 696 12073 ----
NM_175854chr1342407 1740 340 90 --12506 --
NM_175861chr1285904 5292 3938 3669 1955 1866 839 75 ----12293
NM_175863chr63508 400 289 --21336 1213 --
NM_175866chr11431 ----160
NM_175907chr1862582 1856 1823 1114 1063 889 11132 ----
NM_175910chr192338 203 2870 675 11584 --
NM_176081chr10175865 5828 5721 5539 4604 4542 4505 4068 3934 3705 2388 2082 1936 1757 1392 616 318 15381 15213 --
NM_176083chr10175865 5828 5721 5539 4604 4542 4505 4068 3934 3705 2388 2082 1936 1757 1392 616 318 15381 15213 --
NM_176814chr721268 291 --11198 --
NM_176863chr174712 624 221 110 1658 ----
NM_176871chr832977 2275 1296 12869 --13107
NM_177414chr131339 652 360 ------
NM_177438chr1443856 2829 1026 518 1636 ----
NM_177969chr21226 1670 ----
NM_177972chr1134333 1175 465 13969 12698 --
NM_177974chr1531854 299 273 ----1735
NM_177977chr1751921 1487 1387 1245 233 1812 --11987
NM_177985chr222116 1953 1730 21888 1719 --
NM_178006chr1342060 1934 1695 893 1461 ----
NM_178007chr1342060 1934 1695 893 1461 ----
NM_178011chr1052946 2938 2502 2074 1305 --1182 --
NM_178123chr23369 94 76 ------
NM_178135chr431264 1050 81 ------
NM_178140chr542457 2378 2128 414 22565 2184 12736 --
NM_178151chrX77666 6388 5584 3132 2286 808 194 23097 333 ----
NM_178152chrX77666 6388 5584 3132 2286 808 194 23097 333 ----
NM_178153chrX77666 6388 5584 3132 2286 808 194 23097 333 ----
NM_178509chr1783205 3194 2951 2864 809 794 733 718 22972 570 ----
NM_178566chr931821 686 230 ------
NM_178585chr422333 2175 12465 12124 --
NM_178815chr1022066 573 --1540 --
NM_178864chr111577 ----1436
NM_181332chrX22479 1928 1431 ----
NM_181349chr752806 2118 1040 865 492 1274 11093 --
NM_181351chr1172662 2402 2243 2222 838 456 375 22650 1171 12784 --
NM_181356chr61802 2721 258 ----
NM_181358chr144230 3765 3015 744 ------
NM_181443chr2032673 1966 653 ------
NM_181453chr22351 112 11222 ----
NM_181458chr241098 927 475 270 ------
NM_181481chr18136725 6565 6547 6263 6064 4491 2599 2501 2044 1758 1213 1187 92 11225 ----
NM_181482chr18136725 6565 6547 6263 6064 4491 2599 2501 2044 1758 1213 1187 92 11225 ----
NM_181483chr18136725 6565 6547 6263 6064 4491 2599 2501 2044 1758 1213 1187 92 11225 ----
NM_181492chr2251252 488 200 126 54 ------
NM_181504chr564074 3085 2636 800 195 145 1267 ----
NM_181523chr564074 3085 2636 800 195 145 1267 ----
NM_181524chr564074 3085 2636 800 195 145 1267 ----
NM_181571chr10--1254 21026 777 --
NM_181659chr2063371 3112 2611 1163 799 694 ------
NM_181659chr2063371 3112 2611 1163 799 694 ------
NM_181701chr932107 473 118 1337 11675 --
NM_181706chr1142310 2057 1924 457 ------
NM_181712chr142052 1714 774 206 ------
NM_181784chr282301 2255 2168 1980 1698 211 197 32 ----1218
NM_181828chr2262982 2792 2561 1490 965 145 ------
NM_181829chr2262982 2792 2561 1490 965 145 ------
NM_181830chr2262982 2792 2561 1490 965 145 ------
NM_181832chr2262997 2807 2576 1505 980 160 ------
NM_181836chr522415 371 2932 919 --12374
NM_181838chr551327 522 244 100 28 ----11365
NM_181876chr442452 998 916 337 ----11087
NM_181897chr352560 2274 2038 1762 559 --1256 1311
NM_182503chr695171 5010 4823 4648 3984 3470 2208 982 922 14465 ----
NM_182524chr44728 695 469 219 ----1658
NM_182526chr1493115 2736 2409 2141 2105 2078 999 746 733 --12093 --
NM_182527chr2252078 791 683 627 54 1399 ----
NM_182557chr1142089 2050 420 313 1648 1457 --
NM_182697chr731644 1236 209 --1648 --
NM_182718chr10--1254 21026 777 --
NM_182719chr10--1254 21026 777 --
NM_182724chr10--1254 21026 777 --
NM_182725chr10--1254 21026 777 --
NM_182762chr764688 4348 4214 3936 1757 1220 24371 404 35995 4968 523 --
NM_182765chr1041943 1663 935 273 --1216 11910
NM_182769chr10--1254 21026 777 --
NM_182770chr10--1254 21026 777 --
NM_182771chr10--1254 21026 777 --
NM_182772chr10--1254 21026 777 --
NM_182797chr2041807 504 446 225 ------
NM_182830chr1412232 ----11946
NM_182848chr134574 506 244 55 --1615 --
NM_182850chr10--1254 21026 777 --
NM_182898chr775241 4145 2478 1474 1243 816 495 11092 ----
NM_182899chr775241 4145 2478 1474 1243 816 495 11092 ----
NM_182907chr631964 1846 878 ------
NM_182920chr311468 ----1163
NM_182925chr541236 331 267 209 41573 1291 644 390 ----
NM_182964chr1152649 2236 352 200 63 21056 502 ----
NM_182970chr2053977 3933 3724 2891 214 13008 ----
NM_182976chr1------1115
NM_183004chr1473501 3083 1542 1497 1407 1195 113 ----1184
NM_183006chr2021146 348 2599 483 1308 --
NM_183060chr10--1254 21026 777 --
NM_183078chr663654 1534 1327 1092 959 68 11408 ----
NM_183376chr1512274 2859 179 --11650
NM_183422chr133804 775 82 ----11034
NM_194071chr763831 3524 1639 1621 771 692 21570 686 31211 1140 1113 --
NM_194247chr294487 3859 2888 2815 2801 1735 839 412 141 ----11708
NM_194259chr16------2185 91
NM_194260chr16------2185 91
NM_194261chr16------2185 91
NM_194271chr12--1233 2586 507 --
NM_194278chr1493717 3665 3259 2759 1443 1420 1405 755 506 1341 ----
NM_194286chr12106062 5922 4514 4389 1751 1332 1307 1015 893 777 25052 4963 15343 --
NM_194291chr822816 2104 ------
NM_194313chr951849 1799 1638 1609 107 1696 ----
NM_194314chr154498 2103 1608 1261 1100 14290 25337 4639 --
NM_194317chr272690 2587 2542 2378 2339 694 55 12669 1233 --
NM_194328chr932982 1251 174 ------
NM_194329chr932982 1251 174 ------
NM_194330chr932982 1251 174 ------
NM_194332chr932982 1251 174 ------
NM_194439chr441232 470 402 208 ----1522
NM_194454chr751683 1522 1394 203 32 ------
NM_194455chr751683 1522 1394 203 32 ------
NM_194456chr751683 1522 1394 203 32 ------
NM_197970chr271261 1116 299 285 264 195 134 ------
NM_198066chr1472707 2570 2420 2280 1203 97 48 32196 1928 458 ----
NM_198128chr1812268 11615 11484 --
NM_198158chr343086 2997 1039 1010 --22571 443 --
NM_198159chr343086 2997 1039 1010 --22571 443 --
NM_198173chr12734 62 168 182 --
NM_198174chr12734 62 168 182 --
NM_198177chr343086 2997 1039 1010 --22571 443 --
NM_198178chr343086 2997 1039 1010 --22571 443 --
NM_198240chr1231363 1024 1011 ------
NM_198268chr144230 3765 3015 744 ------
NM_198269chr144230 3765 3015 744 ------
NM_198270chrX52806 2245 2144 1303 192 1445 ----
NM_198320chr1295258 4630 3978 857 426 386 152 111 26 13934 14967 11724
NM_198336chr771807 668 614 510 460 432 121 ------
NM_198392chr652169 1913 1477 564 194 ------
NM_198399chr331649 1572 463 ----11226
NM_198400chr1552942 2789 2087 841 255 ----1275
NM_198484chr396241 6219 5162 4800 4350 2473 2209 1583 209 12342 12290 11381
NM_198485chr352131 1686 857 70 34 ------
NM_198503chr131836 1648 1537 ------
NM_198549chr132891 2203 710 1390 --12487
NM_198562chr342079 1587 334 89 12289 ----
NM_198581chr2107165 7060 6699 6562 6149 5427 5290 4993 4679 135 12434 ----
NM_198712chr11454 --2514 402 --
NM_198713chr11454 --2514 402 --
NM_198715chr186025 5529 5033 4091 4041 1038 966 920 33924 1169 353 --12448
NM_198793chr383657 2881 1462 1162 925 704 622 441 --1855 --
NM_198830chr172807 154 ----1179
NM_198834chr1772313 2213 1863 821 599 544 200 11857 ----
NM_198836chr1772313 2213 1863 821 599 544 200 11857 ----
NM_198837chr1772313 2213 1863 821 599 544 200 11857 ----
NM_198838chr1772313 2213 1863 821 599 544 200 11857 ----
NM_198839chr1772313 2213 1863 821 599 544 200 11857 ----
NM_198844chr174834 662 338 56 ------
NM_198859chr364916 4781 4596 4478 1928 751 ------
NM_198896chr1142072 748 364 165 11868 ----
NM_198900chr12127469 7182 6242 6068 5980 5727 5394 2305 2211 1381 1351 574 37071 1594 1052 12788 14789
NM_198990chr722343 499 --22248 1298 1969
NM_198991chr182597 147 ------
NM_198993chr1721612 367 11123 193 --
NM_199000chr751900 1813 1747 1696 1579 --12015 1656
NM_199072chr752569 2479 978 928 165 1801 ----
NM_199131chr1043151 3116 2265 2250 12616 ----
NM_199132chr1972162 1614 840 661 556 480 235 1253 6673 647 589 408 380 320 --
NM_199169chr2043554 3056 1194 271 ----13047
NM_199170chr2043554 3056 1194 271 ----13047
NM_199171chr2043554 3056 1194 271 ----13047
NM_199188chr1243869 3133 2500 1243 12812 --11033
NM_199190chr1243869 3133 2500 1243 12812 --11033
NM_199320chr442295 2169 1969 414 22262 105 ----
NM_199320chr442295 2169 1969 414 22262 105 ----
NM_199321chr174834 662 338 56 ------
NM_199324chr443141 970 604 137 ------
NM_199421chr1494943 4918 3964 3715 1593 1097 953 703 88 11196 --13522
NM_199423chr1621340 1287 21121 974 1434 --
NM_199462chr144878 4352 4059 278 1612 ----
NM_199482chr221599 87 ----1353
NM_199511chr32853 756 --181 --
NM_199512chr32853 756 --181 --
NM_201266chr232538 2452 743 1178 22745 730 --
NM_201269chr121023 71 1938 ----
NM_201278chr1172341 2317 2091 1565 523 262 188 21622 691 ----
NM_201279chr232538 2452 743 1178 22745 730 --
NM_201281chr1172341 2317 2091 1565 523 262 188 21622 691 ----
NM_201412chr16------145
NM_201413chr21----1834 1178
NM_201414chr21----1834 1178
NM_201428chr1111454 11515 ----
NM_201429chr1111454 11515 ----
NM_201430chr1111380 11441 ----
NM_201520chr1721489 1309 --1311 11809
NM_201567chr351600 1291 425 220 148 ------
NM_201568chr15868 626 496 313 35 173 --1512
NM_201569chr15868 626 496 313 35 173 --1512
NM_201570chr102706 637 --188 --
NM_201571chr102706 637 --188 --
NM_201572chr102706 637 --188 --
NM_201590chr102706 637 --188 --
NM_201593chr102706 637 --188 --
NM_201596chr102706 637 --188 --
NM_201597chr102706 637 --188 --
NM_203327chr2083784 3487 3344 3106 3034 3000 2874 95 1827 11667 --
NM_203342chr163348 2956 2673 2235 1128 546 13111 --1945
NM_203343chr163348 2956 2673 2235 1128 546 13111 --1945
NM_203349chr1541818 1408 304 22 --11370 --
NM_203372chr221367 554 ------
NM_203394chr1232377 1868 640 --1117 --
NM_203446chr214926 790 504 491 --12207 --
NM_203451chr1342297 2224 568 430 22105 1977 --1225
NM_203458chr183831 3727 3674 3313 2384 1529 736 180 13154 ----
NM_203459chr131019 702 224 ------
NM_203462chr43911 728 22 1686 ----
NM_203504chr452595 2116 742 187 175 ------
NM_203505chr452595 2116 742 187 175 ------
NM_205860chr152765 801 562 247 229 --22753 2128 --
NM_205861chr11408 2677 578 11574 --
NM_206594chr173513 3469 2719 637 603 224 164 ------
NM_206595chr173513 3469 2719 637 603 224 164 ------
NM_206853chr644066 3451 894 876 --13006 --
NM_206854chr665327 4712 3508 3276 2155 2137 --14267 --
NM_206855chr646292 5677 4473 4241 2638 593 25232 4184 --
NM_206866chr2163156 2573 2296 2281 354 168 ------
NM_206876chr253537 3310 973 174 111 ------
NM_206907chr562599 1027 792 780 647 487 ----13253
NM_206909chr8147061 6573 6522 5185 2804 2680 2613 2079 1966 1805 1588 1465 1072 909 12917 27434 6748 --
NM_206925chr1542751 2302 876 612 155 12229 --
NM_206933chr142555 2400 2131 1911 2543 75 ----
NM_207012chr1043352 3014 396 251 22152 121 1552 --
NM_207015chr332127 196 42 ------
NM_207043chr122259 617 --1872 1200
NM_207044chr122259 617 --1872 1200
NM_207047chr122259 617 --1872 1200
NM_207304chr1332501 1635 217 ------
NM_207306chr173951 2900 1377 841 625 136 45 ------
NM_207322chr1572151 1973 1773 697 357 210 168 1257 ----
NM_207396chr151780 1764 1346 548 244 ------
NM_207406chr4105932 5639 5107 4287 2361 1337 1176 1141 755 746 --24807 2424 1112
NM_207422chrX11039 ----1164
NM_207577chr1142466 2095 1951 179 12103 --12684
NM_207660chr142348 70 ------
NM_207661chr142348 70 ------
NM_207662chr142348 70 ------
NM_212460chr721306 74 11501 --1720
NM_212467chr1532241 920 389 --11755 --
NM_212471chr1732019 1394 847 ------
NM_212472chr1732019 1394 847 ------
NM_212558chr943814 3618 2708 475 --23477 91 1945
NM_213589chr265110 3521 1755 1749 749 652 --14223 --
NM_213594chr1241254 1228 828 21 --11311 --
NM_213606chr101481 ----12452