TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3913-5p
miRNA Sequence: UUUGGGACUGAUCUUGAUGUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr12112365 1979 1613 1513 966 934 910 819 635 626 328 12060 --1335
NM_000021chr143965 696 135 1730 --1752
NM_000046chr5112654 2622 2525 2303 2232 1191 722 675 246 85 72 12789 --12749
NM_000084chrX135619 5399 5382 4226 2648 2605 1595 1558 1469 1408 1251 1096 346 44745 4360 1903 1165 32323 1323 897 --
NM_000093chr9112278 2182 2038 1836 1536 658 652 543 339 70 24 21900 1563 1436 --
NM_000112chr584451 4258 4048 2101 1962 1264 581 66 12026 --21987 858
NM_000125chr6114274 3921 3684 3667 3599 3572 3378 1231 875 711 207 ----23864 3626
NM_000167chrX41465 1325 627 25 11346 ----
NM_000189chr212265 32300 2162 251 --21635 202
NM_000192chr121249 1984 --1215
NM_000208chr1994436 3611 3463 3349 2956 1416 730 614 452 11453 13932 --
NM_000212chr1772146 1942 1912 1901 1608 850 743 ----21512 267
NM_000216chrX33055 884 485 ----13324
NM_000222chr452082 1990 1398 297 209 11684 1193 --
NM_000259chr1595745 5400 5081 4972 4628 2250 2119 1207 1072 45442 5047 2419 116 14488 --
NM_000267chr1782945 2863 2826 2394 1054 902 418 296 22801 954 11385 --
NM_000314chr1053294 3209 2673 1178 898 --22497 2203 --
NM_000337chr595894 5792 5430 5127 2654 2634 2431 2129 1883 34800 2317 1131 46282 4865 4670 324 25599 5422
NM_000351chrX73762 2911 2878 1443 1111 801 545 ----14128
NM_000368chr994606 4036 3939 1666 1356 1253 1112 1039 405 24707 379 11689 --
NM_000390chrX72648 2224 1271 964 774 164 51 21002 957 --23230 3220
NM_000393chr252108 2020 1908 1611 472 11481 21401 1304 11860
NM_000408chr242353 1203 1099 951 22193 133 --1644
NM_000439chr572168 2126 2061 2019 1906 1569 974 41833 816 522 324 ----
NM_000448chr1143105 2224 573 149 1845 ----
NM_000452chr1331716 1373 732 ----132
NM_000461chr353631 2912 1793 880 586 1749 --1566
NM_000489chrX32919 2721 1027 12833 33286 3139 2334 13382
NM_000529chr1872266 2057 2047 1906 1655 683 71 12345 --11996
NM_000554chr1972501 2366 873 774 561 223 210 31101 1009 698 12617 13196
NM_000555chrX157820 7484 7115 7011 5902 5757 5326 5035 5003 2629 2595 2188 2176 1296 455 37888 5179 2054 ----
NM_000612chr1153850 2846 837 102 80 2850 87 ----
NM_000618chr1276488 5789 5173 2620 1067 298 159 25549 4241 --15511
NM_000618chr1276488 5789 5173 2620 1067 298 159 25549 4241 --15511
NM_000633chr1894479 4057 3690 3563 3194 1963 1540 835 275 23646 1420 23932 997 --
NM_000641chr1931405 985 238 21451 33 1545 11340
NM_000719chr12146002 5782 5555 4522 4392 4303 4157 4102 2638 1387 792 254 223 49 35910 5308 1922 ----
NM_000767chr1961413 1152 1144 1121 1071 247 1478 --11279
NM_000788chr451188 1063 541 258 35 ------
NM_000793chr14124621 4316 4281 3971 3857 3787 3695 3341 1462 1115 531 240 31608 1276 443 14343 --
NM_000806chr5160 51834 1788 1223 540 353 ----
NM_000814chr1543981 3889 3550 910 43445 3265 3030 1650 ----
NM_000831chr1126005 5947 5635 4713 4117 2502 1685 1638 1415 1090 877 708 36213 5296 1808 1547 --
NM_000868chrX42578 1634 843 798 22172 831 ----
NM_000875chr1576346 5514 4601 2373 1978 960 757 16853 14850 --
NM_000877chr253089 2642 1154 393 258 42191 1922 1213 892 12300 1508
NM_000891chr1743320 3292 1450 1304 63199 2933 1143 1085 687 265 ----
NM_000899chr1274051 3160 1254 936 668 315 271 1467 24340 3105 --
NM_000902chr343181 2915 2752 162 63172 3124 3084 1975 701 486 --13212
NM_000926chr11128494 8317 8191 7715 7384 7076 3278 3115 2548 2016 1139 830 56580 6561 6545 2044 420 --17084
NM_000944chr412167 12221 --11729
NM_001001132chr2121180 1047 11255 --1460
NM_001001331chr352613 2350 1808 1679 500 1255 --1784
NM_001001419chr574742 4492 3999 3558 1326 704 437 24069 1688 11459 --
NM_001001420chr574742 4492 3999 3558 1326 704 437 24069 1688 11459 --
NM_001001433chr2043052 2830 2390 2235 32812 2114 1001 --12351
NM_001001481chr853261 1217 870 536 38 23423 2350 ----
NM_001001664chr233929 2615 405 23228 417 ----
NM_001001669chr592519 2194 2014 2004 1937 1820 672 592 548 ------
NM_001001684chr1762479 1904 1832 1787 1700 121 32137 804 228 ----
NM_001001890chr2153898 3167 1418 1140 1096 34076 2841 412 13721 --
NM_001001928chr22148289 8147 7764 7181 6511 6239 5134 3184 2646 2374 1969 1803 753 620 47886 3281 2438 1082 35308 2104 1018 27997 5812
NM_001001938chr9114040 3802 3462 3120 3079 1442 1058 438 343 277 121 21215 132 12746 --
NM_001001995chrX2555 468 1537 1128 11536
NM_001002026chr362317 1786 1765 1564 922 373 ----1749
NM_001002258chr251997 576 473 268 221 1116 ----
NM_001002860chr1454437 3129 1424 1276 599 21866 492 1998 11112
NM_001002909chr1761755 1710 861 549 529 210 31852 669 647 ----
NM_001003652chr18138176 8042 6847 6643 6362 6297 5701 5276 3021 2397 728 127 21 11053 17587 1275
NM_001003674chr1866881 5827 2179 1199 862 451 36146 4363 2491 --11910
NM_001003675chr1866881 5827 2179 1199 862 451 36146 4363 2491 --11910
NM_001004304chr1252346 1226 1061 103 77 32253 1286 877 1969 11113
NM_001004419chr1222805 340 54073 3948 3520 1334 1253 14279 155
NM_001004441chr551392 1376 1175 1139 228 1204 ----
NM_001005404chr17104493 4289 4268 3521 2922 1609 1240 1028 93 63 1822 ----
NM_001005473chr596239 5700 5372 4924 4838 4336 4016 2631 2406 36210 5388 4539 14988 --
NM_001005502chr12145239 4935 4926 4322 4297 4276 3748 3609 1694 1449 1311 1179 1063 439 35076 4286 145 --23870 683
NM_001006657chr263224 2486 2266 2021 1042 607 1294 ----
NM_001007023chr14124621 4316 4281 3971 3857 3787 3695 3341 1462 1115 531 240 31608 1276 443 14343 --
NM_001007097chr9124852 4500 4485 3594 3515 3507 3466 3287 3252 3119 1834 1821 21961 1795 14586 --
NM_001008408chr7116249 5891 5757 5568 5562 4965 4503 3896 2407 941 442 36208 1460 682 34724 1681 1606 --
NM_001008738chr552929 2382 1893 1093 354 62900 2257 2060 1060 757 485 12748 --
NM_001009554chr454162 3603 3299 3289 697 44264 1511 981 931 --1621
NM_001009554chr454162 3603 3299 3289 697 44264 1511 981 931 --1621
NM_001009571chr731667 644 637 31631 1200 1118 ----
NM_001009899chr3106348 6251 5950 4984 4580 2306 2268 2097 245 227 64566 2295 2233 1585 554 261 ----
NM_001009909chr1163196 3047 2894 2502 2469 240 33478 3374 2641 11464 13866
NM_001010867chr1135926 5703 5167 4529 4394 4122 2077 2071 1798 1711 1584 478 81 35060 4075 1927 22197 270 14645
NM_001010888chrX54086 1417 1255 534 279 31680 670 356 11331 1630
NM_001010891chr5106936 6675 5724 5658 5203 5171 2620 2611 1371 349 66949 6310 5992 5776 4516 2758 --11181
NM_001010895chr92423 397 1326 --11416
NM_001010984chr152323 1938 1888 1685 823 32471 2079 587 21775 380 --
NM_001010986chrX31885 702 429 21607 404 ----
NM_001011513chr473981 3796 2740 1300 1168 689 554 33951 2805 1532 --1973
NM_001011666chr786588 5958 5591 5126 4882 2359 2320 1358 35055 4517 1581 --36259 5191 1558
NM_001011708chr242888 2563 2159 1972 32737 1023 38 12305 2726 619
NM_001012755chrX74427 2016 1407 1305 518 504 139 35068 1443 553 ----
NM_001013031chr1042671 2304 988 459 73352 2925 2917 2734 2502 910 868 --13049
NM_001013620chr12127763 7692 7322 6383 6243 6048 5536 2946 1421 902 755 659 48209 6512 6009 3082 11133 15969
NM_001014797chr10127841 7820 7705 7181 3156 3143 2914 2811 2044 1420 1066 137 47044 2945 999 22 11479 --
NM_001015508chr8--1147 1570 2752 607
NM_001015877chrX52674 2228 874 817 524 22857 2848 ----
NM_001017923chr1441539 1412 1095 672 2625 51 ----
NM_001017970chr1472562 2058 1761 748 723 630 90 12276 ----
NM_001017995chr5134570 4358 4029 3631 3463 3184 1824 1590 1378 691 590 537 98 31937 810 480 24057 3321 --
NM_001018065chr9155489 5000 4906 4767 4385 3973 3888 2262 2237 2220 1426 817 653 374 172 24378 4173 35760 2031 1656 --
NM_001018066chr9155489 5000 4906 4767 4385 3973 3888 2262 2237 2220 1426 817 653 374 172 24378 4173 35760 2031 1656 --
NM_001018067chr1--53455 1859 1817 306 76 --1981
NM_001018068chr1--53455 1859 1817 306 76 --1981
NM_001018069chr1--53455 1859 1817 306 76 --1981
NM_001024647chr12147598 7466 7240 6064 6049 5686 5605 5298 5164 2547 2117 1081 422 85 35592 814 623 12889 --
NM_001024847chr382090 1928 1715 1664 1540 940 547 403 12295 12423 --
NM_001024948chr142856 1003 460 238 2713 544 --13399
NM_001025076chr10145398 5355 5004 4600 4164 3945 2173 2013 1956 1817 1692 1514 1330 120 74697 4320 1911 1901 1097 464 354 --1101
NM_001025077chr10106756 6713 6362 5958 5522 5303 2872 2688 1478 54 56055 5678 2455 1822 1712 172 11459
NM_001025108chr264054 2917 2840 711 251 83 23195 2982 --12942
NM_001025266chr3104516 4442 3803 3412 1958 1492 764 662 438 76 34849 4689 3970 ----
NM_001029858chr663065 2649 1314 1219 1031 758 23015 2412 ----
NM_001030007chr1693837 3567 3500 3486 3024 2624 2547 917 751 32797 2767 140 --13252
NM_001030055chr1464007 3896 1511 1482 1433 580 11462 14644 14384
NM_001031695chr2265171 4608 4505 4005 1551 1124 21565 701 14025 1222
NM_001031804chr1674221 3182 2925 1207 716 583 560 24087 3761 ----
NM_001032394chr641781 898 880 541 21090 751 11136 --
NM_001032395chr641648 765 747 408 2957 618 11003 --
NM_001032999chr20115093 4691 4605 4489 3424 1961 1484 1389 1057 671 531 24774 1616 --14229
NM_001033045chr2104188 4097 4021 3952 3855 3087 2961 513 376 284 2629 304 23221 1379 11495
NM_001033047chr472301 2295 2031 1874 768 171 52 42633 1986 1777 737 --1689
NM_001033087chr2062530 2367 970 682 562 102 --1579 11274
NM_001033576chr1782564 2506 2115 972 945 925 816 600 1245 2503 117 --
NM_001033659chr1731033 428 323 11479 1208 11223
NM_001034954chr1053157 3039 3013 2487 367 12854 ----
NM_001034955chr1053157 3039 3013 2487 367 12854 ----
NM_001034956chr1053157 3039 3013 2487 367 12854 ----
NM_001034957chr1053157 3039 3013 2487 367 12854 ----
NM_001035511chr142143 2085 1768 731 --1430 11371
NM_001035512chr142250 2192 1875 838 --1537 11478
NM_001035513chr142250 2192 1875 838 --1537 11478
NM_001037290chr111654 1315 --1328
NM_001037332chr572154 2003 1929 1859 401 349 336 32582 1886 561 11770 --
NM_001037333chr572154 2003 1929 1859 401 349 336 32582 1886 561 11770 --
NM_001039199chr20114383 3629 3493 3172 1638 1288 1011 806 769 712 235 43789 3744 3118 684 11421 --
NM_001039395chr962355 2342 2072 1767 1533 657 21814 353 11867 --
NM_001039538chr242935 2601 2284 1460 11308 23537 2688 --
NM_001039547chr3177539 7278 6945 5965 5508 5454 5366 3160 2925 2735 2216 2086 2019 1264 1217 520 264 67655 5241 2869 1871 748 245 37405 5643 1195 55838 5759 2831 2332 387
NM_001039585chr153967 3859 1500 1424 189 23745 3541 13495 12992
NM_001039590chrX84015 3695 3223 1204 1155 1044 105 24 23932 1177 ----
NM_001039591chrX84015 3695 3223 1204 1155 1044 105 24 23932 1177 ----
NM_001039618chr1175007 4837 2318 1200 1131 852 176 14671 1581 --
NM_001039690chr16112235 1838 1469 954 592 525 462 450 336 294 195 11816 11924 --
NM_001039693chr273905 3851 1366 1085 549 501 390 21153 522 33143 2960 813 23227 3076
NM_001039709chr20115093 4691 4605 4489 3424 1961 1484 1389 1057 671 531 24774 1616 --14229
NM_001039840chrX74918 4777 3920 1878 1160 930 205 35536 5070 549 ----
NM_001039937chr1344047 3573 1498 582 22875 2588 ----
NM_001040144chr16112235 1838 1469 954 592 525 462 450 336 294 195 11816 11924 --
NM_001040146chr16112235 1838 1469 954 592 525 462 450 336 294 195 11816 11924 --
NM_001040151chr1184348 4308 3936 3325 3204 3078 1025 281 43639 1601 1256 828 12981 --
NM_001040152chr783874 2050 1796 1768 1208 652 385 353 21322 868 14405 --
NM_001040157chr431170 533 236 21950 372 1633 1902
NM_001040284chr16125752 5671 5333 5259 4877 4738 4644 3616 1039 1010 968 133 35343 3736 432 12213 11804
NM_001040441chr175172 5036 4618 1795 1662 941 808 23886 1963 --34395 1912 1058
NM_001040446chr552420 1765 757 560 417 22200 2114 1750 --
NM_001040450chr1562810 2675 2486 1062 648 103 ----12319
NM_001040453chr1562810 2675 2486 1062 648 103 ----12319
NM_001040876chr42636 262 11392 11839 11856
NM_001042404chr11554 ----1545
NM_001042413chr951646 1606 1358 1352 1249 --1496 11391
NM_001042473chr1041538 1439 1337 613 31665 1472 1432 --12017
NM_001042492chr1782945 2863 2826 2394 1054 902 418 296 22801 954 11385 --
NM_001042555chr1254570 3212 3192 3129 720 11495 23777 1486 --
NM_001042599chr277794 7700 5939 5199 2812 555 115 36909 5981 5026 12093 --
NM_001042601chr352615 2054 1307 1164 108 12899 ----
NM_001042603chr1275117 4864 3806 2060 1475 1378 1000 2604 101 13957 --
NM_001042604chr354568 4060 3082 1552 72 34093 3554 3176 1951 --
NM_001042632chr2012370 ----2780 626
NM_001042633chr2012370 ----2780 626
NM_001044385chr273442 3042 1291 1261 754 132 44 43956 3672 1466 268 11482 --
NM_001048183chr1103531 3025 2962 2815 2713 2405 1195 755 289 88 23189 2848 11333 22808 1449
NM_001083621chr1124630 4568 4498 4477 4401 3863 3732 3282 1545 1408 531 132 64485 4131 3539 2999 1070 661 ----
NM_001099678chr365884 5704 4011 2560 2070 180 35015 4386 4205 35310 4899 4670 13932
NM_001100108chr1148037 7029 6721 6556 6445 6223 6213 6081 5441 5385 5121 1750 709 597 37857 1617 164 35575 3307 1073 15689
NM_001106chr398542 8061 7479 7306 7102 3325 1391 1278 356 --18073 17658
NM_001113490chrX63376 3240 2814 2641 2493 582 --13616 22614 949
NM_001128chr1693837 3567 3500 3486 3024 2624 2547 917 751 32797 2767 140 --13252
NM_001148chr441831 1679 768 531 ----11459
NM_001167chrX116042 5942 5535 5454 4182 2385 1790 1504 1175 1165 445 46291 5727 4565 2112 16175 14299
NM_001173chr1464007 3896 1511 1482 1433 580 11462 14644 14384
NM_001204chr2116924 6717 5379 5320 4853 2787 1799 1669 1146 927 559 35105 788 781 37036 5338 4986 1289
NM_001259chr796386 6105 6013 5525 4698 4568 4387 2177 1243 1581 24998 4157 --
NM_001304chr1783673 3618 3605 3304 3114 2957 2497 25 21502 1464 1590 --
NM_001329chr1021604 1299 ----11058
NM_001331chr1162553 1139 784 511 230 163 1596 1192 --
NM_001346chr372715 2502 2418 2003 1917 1863 442 22756 1019 1909 --
NM_001387chr572915 2892 2434 1280 1274 1207 967 22505 1222 --12952
NM_001419chr1963807 1826 766 528 501 435 64731 4722 4585 3827 3370 1879 24805 4788 --
NM_001438chr113003 22343 685 --11179
NM_001482chr152978 640 3728 331 206 1356 --
NM_001527chr6104730 4613 4175 4080 3604 3315 2988 1850 1376 801 34311 3155 656 ----
NM_001543chr5194513 4222 4182 3473 3424 3379 3360 3084 2955 1924 1810 1793 1111 1085 812 541 502 471 242 1916 44025 3296 3129 1787 --
NM_001616chr242847 2337 601 559 1869 13295 --
NM_001650chr1844013 3020 2592 1526 73474 3229 3146 2981 1656 685 195 21538 1065 --
NM_001659chr1262107 1803 1687 799 219 70 --11701 12252
NM_001683chr352613 2350 1808 1679 500 1255 --1784
NM_001689chr251997 576 473 268 221 1116 ----
NM_001695chr863743 3067 1441 1277 1222 152 23132 772 ----
NM_001699chr1951349 534 439 259 244 3670 354 142 11153 --
NM_001743chr22589 569 ----1175
NM_001754chr2153898 3167 1418 1140 1096 34076 2841 412 13721 --
NM_001759chr1253360 1818 990 510 164 1716 --13452
NM_001858chr694398 4157 3778 3566 3361 1724 1707 1354 1016 21874 197 11575 --
NM_001859chr963727 3317 2685 2438 675 539 33267 792 196 11104 13844
NM_001874chr12145239 4935 4926 4322 4297 4276 3748 3609 1694 1449 1311 1179 1063 439 35076 4286 145 --23870 683
NM_001918chr1169301 9272 7817 7315 7023 6924 6746 5941 3140 3107 2905 1900 1643 1510 459 324 89248 6698 5768 3077 1595 1441 575 39 38599 1956 1786 28712 6034
NM_001968chr44908 799 215 146 1752 ----
NM_001969chr1433119 2591 620 1915 13466 12501
NM_001987chr1294331 3289 1669 1514 1503 1353 1269 1197 790 31258 1129 1076 12879 13429
NM_001992chr531722 1548 207 42024 1973 631 101 11857 --
NM_002006chr435020 4890 2072 51467 1208 1131 997 731 31674 1558 158 12193
NM_002025chrX119204 8900 8692 8535 8379 8001 7957 6556 3538 1922 1467 56997 6054 3408 3318 2265 18982 --
NM_002033chr1184073 3824 3766 3166 2643 2611 802 402 31498 909 380 --1720
NM_002048chr961292 531 257 240 135 44 21244 124 ----
NM_002061chr171864 1730 1642 1608 1582 1530 1256 21504 362 ----
NM_002092chr494646 4272 4240 4216 4059 3658 3330 3314 84 14408 13198 1780
NM_002158chr273644 2566 2478 2472 1388 658 371 42795 2710 2577 742 --1209
NM_002187chr51218 ----1893
NM_002203chr583312 3007 2878 2794 2608 549 316 41 13509 ----
NM_002210chr253386 3175 2885 2804 727 21008 817 ----
NM_002223chr1243988 3498 3225 2474 43661 1490 1481 520 ----
NM_002264chr354817 3926 3688 1218 1162 64802 4411 4233 905 687 95 --34125 3666 3616
NM_002270chr555086 4603 4212 3908 139 45464 4756 4015 3444 --128
NM_002285chr264054 2917 2840 711 251 83 23195 2982 --12942
NM_002293chr192643 2347 2262 2165 1828 1798 975 385 356 ------
NM_002310chr575796 5501 5422 2614 2445 628 35 46109 5643 5434 5241 ----
NM_002334chr112801 133 ----11969
NM_002336chr1244228 4102 3613 941 34352 3270 2013 --13871
NM_002374chr242935 2601 2284 1460 11308 23537 2688 --
NM_002387chr574972 4444 3508 3309 1363 518 512 31919 1532 337 23640 526 1614
NM_002451chr943532 3334 2941 1345 23733 2890 11479 1678
NM_002508chr171785 621 524 306 292 285 28 41957 1273 668 341 --11281
NM_002556chr1152024 1844 1401 1330 823 52140 1860 1711 1441 133 ----
NM_002581chr9125591 5309 4757 4673 4620 2101 1926 1742 1340 1223 436 32 33629 264 216 --1254
NM_002594chr2052346 909 785 222 206 --1929 1395
NM_002655chr834495 3916 1191 ----23899 2092
NM_002657chr201482 12653 33151 1232 408 11259
NM_002703chr42288 185 11829 --1750
NM_002719chr1432435 2316 645 62282 2113 1860 377 320 183 ----
NM_002731chr162884 2624 2348 728 284 111 --22791 2698 --
NM_002737chr17105965 5778 5513 5505 4800 4768 4240 2166 924 586 55717 5356 4934 2154 570 1394 --
NM_002829chr941037 878 350 34 --1261 11221
NM_002837chr1293844 3165 3136 3022 2945 1606 1242 897 458 23301 724 22860 489 --
NM_002869chr112860 324 ----1677
NM_002886chr364234 4211 1641 1613 1133 1067 24092 1105 24187 467 14927
NM_002940chr42636 262 11392 11839 11856
NM_003001chr142250 2192 1875 838 --1537 11478
NM_003048chr282689 1937 1927 1117 817 471 438 192 --12361 --
NM_003108chr266787 6183 6126 5938 5771 5366 46376 5390 2087 337 1294 --
NM_003112chr743017 1067 996 824 ----1559
NM_003161chr1753470 2202 875 857 252 23223 576 ----
NM_003189chr182874 2441 2164 1012 696 404 337 277 13048 12652 1267
NM_003199chr1864676 3625 2038 1838 1099 166 35604 5100 2234 --11448
NM_003221chr653543 2567 1593 823 495 43123 2694 1491 998 --23224 3137
NM_003242chr382090 1928 1715 1664 1540 940 547 403 12295 12423 --
NM_003262chr394530 4434 4177 3890 3261 1585 791 586 241 35285 4667 3660 14109 --
NM_003274chr2142467 2382 1906 32 --1998 12148
NM_003298chr3104783 4652 4609 4504 2320 2270 1890 1048 975 584 34590 267 145 14200 --
NM_003342chr1732801 2660 766 32791 1103 596 --13332
NM_003373chr1061524 1417 1297 741 399 248 31443 454 217 167 --
NM_003385chr23926 747 44 1947 137 1771
NM_003392chr374225 3419 1347 620 594 390 33 62835 1572 1410 1184 1082 360 ----
NM_003439chr722407 2271 42521 759 601 440 23495 3064 21095 635
NM_003468chr274331 1570 1282 1046 707 350 326 23648 3515 34184 385 165 --
NM_003478chr1143082 2740 2698 1004 12834 12104 --
NM_003498chr16------22683 1914
NM_003574chr1841987 1232 942 564 55222 5148 4752 3873 1594 1744 15513
NM_003583chr1253946 3177 2678 2597 930 23381 871 --1985
NM_003607chr143658 3031 1150 363 22787 282 11131 22709 376
NM_003615chr343721 3357 1508 1347 --13814 --
NM_003617chr184391 4290 4247 3046 1553 1204 960 127 24267 3439 ----
NM_003759chr464176 3149 1487 1244 650 234 14189 13925 --
NM_003763chr2043052 2830 2390 2235 32812 2114 1001 --12351
NM_003787chr18169 1629 --1561
NM_003884chr341879 1177 599 574 --11236 --
NM_003887chr22680 233 ----11789
NM_003913chr664037 3999 3728 3624 2958 1462 13341 --13566
NM_003930chr762553 2393 1896 796 750 86 21596 1026 22058 869 --
NM_003939chr1073813 3716 2950 2697 2625 2614 323 23898 1340 ----
NM_003948chr442576 1057 781 80 1174 --11003
NM_003958chr653262 2955 2896 1021 537 3990 770 529 13371 11116
NM_003966chr557819 7617 4774 2942 136 37327 5890 500 --26340 5559
NM_003994chr1274051 3160 1254 936 668 315 271 1467 24340 3105 --
NM_004024chr151539 1050 995 617 468 21147 97 1161 11112
NM_004028chr1844013 3020 2592 1526 73474 3229 3146 2981 1656 685 195 21538 1065 --
NM_004035chr1773548 3226 1390 1014 603 406 271 54562 3751 3465 3183 873 11877 11993
NM_004079chr142358 869 307 171 22216 1903 1796 11863
NM_004096chr1042162 2033 1846 211 ----22080 348
NM_004098chr1031261 1142 939 11033 --1186
NM_004113chr311467 1538 --11623
NM_004117chr671903 1826 1748 875 547 531 326 41495 704 617 148 128 --
NM_004124chr1423199 955 42486 2189 1336 1110 ----
NM_004171chr11149099 8857 6028 3864 3678 2945 2442 2333 2063 2054 1478 978 332 302 68962 7464 5967 2197 1771 925 ----
NM_004273chr10104886 4874 4705 4518 4122 3929 3278 3086 1406 1170 64338 4097 3796 3522 1590 1012 14440 14913
NM_004274chr1453088 3035 2869 146 105 21092 165 1277 --
NM_004293chr9103795 3677 3579 3450 3414 2469 2359 1177 936 179 1350 --12654
NM_004331chr852030 1026 767 614 224 1141 1931 --
NM_004338chr1866881 5827 2179 1199 862 451 36146 4363 2491 --11910
NM_004397chr11104319 4187 4102 4074 3877 2812 1254 959 748 195 23737 798 13136 14281
NM_004411chr74638 611 163 44 1794 --1225
NM_004423chr362224 2182 2089 1730 917 250 22321 2264 --11977
NM_004426chr1261692 1619 1390 719 703 472 --31876 1778 101 --
NM_004438chr232250 1267 508 --1732 13132
NM_004464chr444000 3786 3167 1101 31157 732 370 14291 --
NM_004501chr153639 3512 3098 3007 1118 ------
NM_004537chr121582 ----11504
NM_004586chrX44151 3883 1511 1008 34519 4298 654 34278 1762 106 1610
NM_004588chr11143554 3250 3180 3072 2649 1279 1158 1089 1058 944 738 672 470 33 11401 22896 1599 --
NM_004612chr974344 3872 3559 1567 1315 218 151 44883 4247 3427 3171 14294 --
NM_004674chr81400 3611 455 89 --177
NM_004686chr81515 31577 332 51 --122
NM_004719chr1292760 2579 2313 2254 1866 1805 934 800 505 12664 --11051
NM_004745chr8125958 5210 5035 4857 4845 4388 4299 4284 2303 1401 1119 650 34460 2312 923 15565 12519
NM_004804chr2102609 2409 2064 1878 734 665 442 376 370 320 1626 22198 1042 --
NM_004815chr154467 4138 3386 3195 1717 24410 1747 1332 14484
NM_004822chr1793833 3678 2933 2826 2526 2440 688 449 106 33719 1393 915 13419 --
NM_004845chrX84174 3085 3053 1177 772 558 499 449 24155 3221 11102 13181
NM_004863chr14144821 4686 4296 4136 3912 3579 3380 1860 740 718 602 461 340 72 33746 2038 1251 21155 471 34938 4503 1796
NM_004904chr786588 5958 5591 5126 4882 2359 2320 1358 35055 4517 1581 --36259 5191 1558
NM_004932chr52179 24 11367 --1108
NM_004936chr963043 2611 2497 2144 2010 1145 21918 1178 ----
NM_004976chr1194853 4580 4381 3657 3206 1945 1392 890 569 24728 4472 12047 15136
NM_004985chr1254516 4155 3493 699 494 21608 196 13600 --
NM_004992chrX137799 7407 7362 7212 5192 2419 2165 1758 947 863 749 457 94 37955 6315 3101 25798 2333 17062
NM_004992chrX137799 7407 7362 7212 5192 2419 2165 1758 947 863 749 457 94 37955 6315 3101 25798 2333 17062
NM_004999chr674331 3859 3735 1664 1335 914 848 34110 3226 218 ----
NM_005028chr1041438 591 565 184 11478 22259 321 12279
NM_005036chr22148289 8147 7764 7181 6511 6239 5134 3184 2646 2374 1969 1803 753 620 47886 3281 2438 1082 35308 2104 1018 27997 5812
NM_005056chr1275361 5108 4050 3483 1719 1622 1244 2848 345 14201 --
NM_005063chr1033541 1382 281 31137 1026 323 --13604
NM_005065chr1464876 4652 4579 4541 3612 920 84661 3489 1664 1650 1453 900 136 101 14381 --
NM_005093chr20115093 4691 4605 4489 3424 1961 1484 1389 1057 671 531 24774 1616 --14229
NM_005105chr151983 1825 1808 1515 146 22229 762 1508 1186
NM_005121chr1713322 23611 2352 --11388
NM_005156chr9105356 4349 4227 4180 1957 1724 1718 1398 979 676 34578 1710 25 11790 --
NM_005160chr2282717 1798 1749 1536 1267 836 114 47 35084 4752 2648 11119 25293 1375
NM_005188chr11147526 7518 7497 7215 6278 5956 5625 5521 2857 2823 1308 1145 876 325 35106 2565 1865 58005 7429 6259 1966 143 36592 3315 1400
NM_005189chr1752379 922 777 764 75 22350 879 3955 851 176 11980
NM_005197chr1444549 4239 3997 3789 15420 24585 3952 1780
NM_005207chr2272267 1443 1412 830 695 386 46 ----1790
NM_005235chr277794 7700 5939 5199 2812 555 115 36909 5981 5026 12093 --
NM_005238chr1163293 2686 1183 1048 637 42 43113 2809 2437 763 11112 11143
NM_005259chr231368 1279 1272 131 ----
NM_005279chr2181 ----1668
NM_005338chr773607 3472 3457 3143 2684 1187 1133 73723 2547 1442 892 685 498 151 23943 95 12801
NM_005339chr463944 3643 3525 1617 1520 852 11597 1748 --
NM_005385chr332267 901 539 32507 1711 184 ----
NM_005399chr134100 1430 1262 3858 497 337 34083 3838 2783 --
NM_005400chr25973 750 285 208 116 22687 950 1932 12445
NM_005455chr11384 21160 411 --1301
NM_005497chr17175835 5803 5497 5290 5155 4817 4761 4425 4387 4253 4054 2155 1812 1701 1420 1392 190 36161 4496 1877 --14913
NM_005502chr963078 2069 941 731 715 219 22837 2532 ----
NM_005578chr374029 3118 1746 882 783 303 220 24253 2065 13311 --
NM_005611chr1641285 1119 507 189 ----1437
NM_005638chrX61763 1580 1377 1301 611 142 11614 ----
NM_005715chr642629 1135 1008 239 --22430 620 12452
NM_005730chr1273441 3164 2210 1359 1120 328 32 43261 2962 2575 1414 11038 21012 706
NM_005739chr154859 463 399 155 31653 440 55 --12332
NM_005748chr1232703 2418 38 12917 --1896
NM_005754chr521064 202 1766 143 1967
NM_005779chr5103425 3362 2945 2607 2577 991 985 950 734 112 ------
NM_005795chr252603 2143 316 42 22 42974 2591 2385 536 --1960
NM_005797chr1151440 1369 444 107 32 21741 497 ----
NM_005822chr672107 1847 724 552 469 460 440 --1346 --
NM_005828chr17104990 4032 3653 3642 3118 1972 1414 1125 1103 740 14282 --23235 1750
NM_005840chrX77345 5538 5102 4899 2607 924 819 97535 6672 6280 6025 5845 5449 5240 4791 1791 25670 2621 --
NM_005868chr742295 525 437 331 12313 133 --
NM_005898chr1152887 2650 2419 2363 1999 12661 2537 213 --
NM_005901chr18138176 8042 6847 6643 6362 6297 5701 5276 3021 2397 728 127 21 11053 17587 1275
NM_005903chr574742 4492 3999 3558 1326 704 437 24069 1688 11459 --
NM_005906chr61165 11324 --11662
NM_005909chr564302 3466 2959 2846 1451 816 13258 ----
NM_005910chr17103999 3937 3846 3550 3313 2881 1625 1363 1233 1055 22572 212 33646 2869 1109 11226
NM_005935chr485002 4294 3967 3231 2132 1540 237 150 35188 3723 410 --14685
NM_005941chr82862 651 23549 1489 11586 13354
NM_005955chr1135545 5000 4151 3757 2067 1965 1936 1515 1477 1014 1007 837 152 35357 5260 2100 ----
NM_005957chr174681 4629 4112 3703 3436 362 42 --24816 3097 24930 879
NM_006007chr953972 3692 3501 3492 1316 13903 --11540
NM_006011chr15133795 3755 3432 3332 3207 3197 3093 1633 1486 1435 926 574 315 13764 23063 1282 11415
NM_006037chr294477 3300 1840 1356 1307 1167 1157 285 88 1647 13346 1930
NM_006055chr253215 3007 2020 525 83 32823 2452 227 12737 --
NM_006060chr7154291 3901 3890 3523 3322 3086 3079 3047 2987 2909 1694 1549 1492 974 748 1912 24046 1618 1879
NM_006080chr752899 756 190 173 137 22789 422 ----
NM_006095chr442752 1777 1620 1018 43951 1131 954 638 ----
NM_006136chr71479 ----1296
NM_006148chr1752846 2577 2481 951 683 32215 2081 510 --22275 844
NM_006166chr1232516 2048 764 12368 --12313
NM_006197chr82519 458 --12090 11497
NM_006203chr544201 3794 2122 1125 33970 1772 55 13458 --
NM_006206chr442589 2067 1002 124 12824 22346 1788 1993
NM_006224chr1782524 2378 2077 1674 560 400 324 72 --22516 658 --
NM_006252chr157499 6922 5025 4890 318 56112 5348 2564 795 388 --25139 2817
NM_006256chr132486 2397 650 52777 2440 1935 1715 788 ----
NM_006282chr20103997 3925 3156 3124 3061 1302 1236 763 531 320 23291 213 1690 14042
NM_006283chr864198 1831 1358 1077 460 145 34019 3825 325 ----
NM_006306chrX124729 4613 4555 2038 1497 1398 1269 1064 842 435 75 53 23652 1953 14351 --
NM_006330chr831347 651 522 2418 259 ----
NM_006375chrX21545 466 --11283 1605
NM_006379chr7--32197 1852 727 1549 21692 406
NM_006420chr2022477 149 13133 --11275
NM_006434chr1053157 3039 3013 2487 367 12854 ----
NM_006457chr473981 3796 2740 1300 1168 689 554 33951 2805 1532 --1973
NM_006464chr274654 4495 3294 3026 1712 790 352 21878 939 13427 13542
NM_006482chr1253946 3177 2678 2597 930 23381 871 --1985
NM_006517chrX91919 918 862 855 746 729 520 222 32 197 21768 718 22106 162
NM_006538chr263872 3714 2941 2827 2768 653 ----23177 1053
NM_006544chr1435815 5393 3726 32194 1807 1774 15064 --
NM_006546chr17175966 5900 5861 5781 5505 5491 4990 4223 4201 2442 1423 1137 1083 978 590 412 152 35688 5654 4564 ----
NM_006561chr10145398 5355 5004 4600 4164 3945 2173 2013 1956 1817 1692 1514 1330 120 74697 4320 1911 1901 1097 464 354 --1101
NM_006572chr1742207 983 861 261 22997 312 13165 23296 392
NM_006599chr1687966 7072 5869 5270 1428 214 62 37 36267 5831 5075 15108 --
NM_006609chr232074 622 537 1173 --1920
NM_006614chr322748 2685 13677 12611 23207 1054
NM_006626chr93920 225 200 1493 --1160
NM_006628chr1594240 4189 4157 3556 3463 3369 3217 1874 1009 24652 3692 ----
NM_006654chr1254570 3212 3192 3129 720 11495 23777 1486 --
NM_006667chrX3849 737 412 1319 --1473
NM_006729chrX165313 5054 4995 4452 4067 4035 3972 3818 3515 1695 1166 1149 1055 570 417 221 55032 4591 4205 3594 2201 24643 2168 --
NM_006750chr16127944 7882 5763 3001 2172 2000 1354 761 617 561 432 112 53167 2888 2205 1441 1025 15899 11834
NM_006811chr201839 ----1979
NM_006818chr15998 809 698 376 51 3936 651 181 ----
NM_006826chr211234 1254 --1947
NM_006852chr1782867 2767 2544 2457 2249 673 298 232 11896 ----
NM_006888chr1482405 2170 1224 1199 1003 872 837 270 23118 2311 ----
NM_006902chr152964 2539 2493 1339 612 11184 12826 --
NM_006922chr242362 1605 1030 833 2768 485 12243 --
NM_006924chr1784130 4047 3663 2701 1436 1211 982 147 11608 1938 --
NM_006930chr522032 2020 ----21996 738
NM_007008chr2--1807 --1650
NM_007011chr1595972 5545 5411 1399 1306 1114 894 636 493 75079 5042 5002 4964 4885 2682 1385 22402 1834 --
NM_007050chr20108123 7789 7680 5470 2939 2253 1981 1698 1676 143 45585 1164 885 295 --11476
NM_007054chr573703 2861 1331 1196 879 643 414 32897 2476 1488 1473 --
NM_007106chr1332538 1784 699 ----1350
NM_007107chr372185 2071 770 664 639 525 434 11770 1378 --
NM_007114chr342782 2479 1227 72 32315 2075 1075 ----
NM_007125chrY1119 ----1511
NM_007172chr2263069 3036 2506 2049 2040 332 22977 321 ----
NM_007175chr853203 2753 2374 761 220 23621 741 ----
NM_007195chr1851395 1255 1231 1192 119 43274 2704 1422 389 11047 --
NM_007236chr1582448 2377 2051 1834 1596 812 536 446 21732 103 ----
NM_007249chr13129246 9163 8973 8834 7482 6217 3566 2363 1511 1122 595 524 37734 6673 2966 --36659 5894 2059
NM_007271chr651495 473 437 289 84 ------
NM_007287chr343181 2915 2752 162 63172 3124 3084 1975 701 486 --13212
NM_007288chr343181 2915 2752 162 63172 3124 3084 1975 701 486 --13212
NM_007289chr343181 2915 2752 162 63172 3124 3084 1975 701 486 --13212
NM_007292chr1773548 3226 1390 1014 603 406 271 54562 3751 3465 3183 873 11877 11993
NM_007363chrX21017 98 126 --1738
NM_012095chr1063161 3026 2720 687 341 39 31088 419 324 22831 435 --
NM_012104chr1183429 3369 3227 1457 932 839 670 173 --12817 13036
NM_012104chr1183429 3369 3227 1457 932 839 670 173 --12817 13036
NM_012120chr631942 1873 31 43001 2883 2820 2793 ----
NM_012141chr1344047 3573 1498 582 22875 2588 ----
NM_012154chr82751 262 2777 284 --2273 160
NM_012164chr987350 7158 6295 6009 5660 2399 2328 1239 36989 6484 2464 22846 800 --
NM_012214chr2146076 5237 5015 4619 4229 2365 2344 2320 1701 1574 1422 1288 1207 1123 31996 1168 1085 --11538
NM_012234chr333083 1277 228 21186 737 1651 --
NM_012238chr10133 31335 555 524 11491 --
NM_012262chr174547 4351 3643 3355 3344 1220 480 23627 3535 14899 --
NM_012281chr762069 1605 605 327 140 56 ------
NM_012288chr6114954 4856 4792 3641 2215 1888 1865 1519 1387 688 198 --64280 4065 1651 1349 1044 876 1109
NM_012300chr522201 746 11593 --11861
NM_012301chr742255 1758 143 63 42033 1685 1510 201 1903 --
NM_012308chr1182495 2414 2152 1767 958 874 395 201 32602 1649 550 --1511
NM_012309chr1154228 3638 3623 3373 730 54479 4198 4061 1440 528 ----
NM_012316chr1104775 4642 4557 3489 2208 2200 2069 1525 946 607 24891 862 45327 1402 1209 767 15205
NM_012322chr7--1350 --1366
NM_012334chr574104 3767 3001 1598 1503 1161 428 53467 3428 3095 1716 218 24237 720 --
NM_012382chr563856 2997 2847 2751 814 203 11563 23723 349 --
NM_012420chr1052266 2159 2093 1444 777 ----1705
NM_013255chr7108753 7572 6974 6582 6433 6277 5542 3515 2400 1472 98499 8341 7496 6876 6758 5844 1880 1584 197 1615 --
NM_013309chr152829 525 62356 1652 629 501 215 129 ----
NM_013313chr2251199 873 686 388 234 23231 3020 22373 800 1640
NM_013314chr10--2249 47 --175
NM_013341chr242888 2563 2159 1972 32737 1023 38 12305 2726 619
NM_013381chr1252192 854 819 517 377 12186 1841 11940
NM_013989chr14124621 4316 4281 3971 3857 3787 3695 3341 1462 1115 531 240 31608 1276 443 14343 --
NM_013995chrX51031 948 883 742 186 --155 11791
NM_014000chr1061524 1417 1297 741 399 248 31443 454 217 167 --
NM_014016chr311248 ----11479
NM_014021chr133033 2120 1208 13392 --1346
NM_014023chr1072809 2718 2110 1146 946 664 657 ------
NM_014028chr662533 2323 2237 2092 1012 339 22953 2598 12893 12354
NM_014048chr1664003 3886 3480 1892 1480 852 34714 953 635 --15310
NM_014112chr864766 4629 4458 3830 1827 517 45215 4981 4330 1032 11364 24719 415
NM_014155chr1186803 6074 6010 4843 2784 1443 970 445 57051 5513 2480 1890 1507 35418 2553 2404 --
NM_014240chr3103837 3703 3675 3380 3116 2827 858 816 576 194 33519 2576 687 13600 13953
NM_014292chr2231572 1445 615 --21546 464 31371 162 114
NM_014309chr2265161 4598 4495 3995 1541 1114 21555 691 14015 1212
NM_014313chr161608 1043 635 533 115 69 ------
NM_014319chr1241586 446 355 128 ----1147
NM_014331chr4117376 7212 6379 5797 5366 5018 4939 2388 1985 1375 939 57123 5866 4792 2941 2689 15215 --
NM_014333chr1132365 2331 1006 1388 --2984 500
NM_014335chr15--176 --21388 239
NM_014342chr111346 11484 1311 21394 40
NM_014352chr1121175 199 21525 455 --21314 279
NM_014376chr572154 2003 1929 1859 401 349 336 32582 1886 561 11770 --
NM_014382chr331625 1560 456 --11317 1167
NM_014388chr184810 4392 3926 3710 2036 2004 1303 811 46036 2305 2173 797 2993 648 22133 1110
NM_014423chr544771 3418 2037 186 34462 1667 330 13871 --
NM_014494chr1621931 420 22236 216 21523 448 1922
NM_014573chr174723 595 295 199 11570 21624 1327 --
NM_014614chr241205 309 258 185 2409 388 ----
NM_014615chr1652893 2881 2791 557 439 33658 3123 2558 --12459
NM_014616chr342949 580 275 177 32577 101 46 11177 12502
NM_014670chr2160 21619 606 --1425
NM_014701chr1553317 3257 713 116 72 22682 2631 ----
NM_014702chr643517 1388 217 42 23195 863 --12745
NM_014721chr677156 7071 7041 5118 4701 2849 2803 34822 1943 1382 --15701
NM_014730chr1295231 4870 3706 1995 1835 1513 820 591 229 13881 --1188
NM_014730chr1295231 4870 3706 1995 1835 1513 820 591 229 13881 --1188
NM_014732chr16105735 4402 4335 4284 4272 4035 3600 2195 1482 1386 25798 3881 ----
NM_014746chr273674 3234 1577 1536 1529 828 504 23370 3330 11087 --
NM_014747chr1135677 5105 4935 4707 4662 3710 3700 1931 1836 1414 752 471 137 15558 ----
NM_014797chr672733 2600 2527 2444 1059 1031 252 13091 --12848
NM_014803chr1041148 905 732 648 32579 2565 2100 12896 --
NM_014812chr11554 ----1545
NM_014826chr143658 3031 1150 363 22787 282 11131 22709 376
NM_014830chr1253781 3000 1067 507 33 23458 745 12525 13178
NM_014839chr141973 1603 88 70 22460 493 ----
NM_014844chr1463741 2750 2631 470 290 166 54194 3289 1646 1021 345 23171 909 --
NM_014864chr193559 3099 2798 1691 1559 1266 1203 1015 461 53607 1637 1441 883 66 22934 780 --
NM_014870chr1124630 4568 4498 4477 4401 3863 3732 3282 1545 1408 531 132 64485 4131 3539 2999 1070 661 ----
NM_014877chr1777715 7660 6025 5419 5332 2582 1747 26160 5224 26850 5839 16966
NM_014893chrY42253 2085 734 316 21947 344 1149 --
NM_014920chr6121504 1441 1371 1318 1229 1151 1093 1049 996 823 346 234 13440 13774 --
NM_014932chr311972 11379 --11879
NM_014936chr641045 924 498 260 22142 1804 ----
NM_014937chr1031245 1185 862 1156 --11069
NM_014946chr253114 2223 1907 535 232 22639 1147 13034 12032
NM_014982chr1453404 1242 775 46 40 23758 809 ----
NM_014989chr632048 1504 25 2736 576 1144 --
NM_015020chr1683532 2388 1253 1192 584 545 227 218 33706 2485 365 ----
NM_015026chr1231422 1074 55 --13352 24787 3021
NM_015033chr933235 2586 1052 21214 1079 --21174 478
NM_015035chr2066363 5641 5430 5295 4469 258 26720 1488 11782 35546 1890 1809
NM_015059chr15133871 3794 3544 3372 3295 3081 2662 1429 889 796 244 199 153 23590 1024 ----
NM_015064chr1283564 3314 3217 2983 2941 2452 992 478 33430 846 825 1322 --
NM_015074chr163870 3729 3388 1564 998 927 24157 3555 24005 3741 14121
NM_015077chr1764529 4361 4032 2898 1650 1064 11140 --23122 577
NM_015090chr1135913 5879 5811 5680 4879 4820 3865 3843 2408 1376 1368 292 178 35222 4957 569 ----
NM_015097chr331666 458 112 42311 202 80 33 ----
NM_015144chr1643265 1560 824 393 33429 458 288 13493 23366 781
NM_015147chr232859 1288 1068 22900 201 12063 12180
NM_015149chr132047 1350 532 31559 1473 1453 ----
NM_015156chr1464007 2628 1568 643 325 244 33636 2701 197 ----
NM_015192chr2051965 670 248 139 95 22920 2747 ----
NM_015199chr352105 1833 1154 695 619 12928 --12622
NM_015205chr1361289 1149 1068 179 157 151 23701 3566 21849 211 --
NM_015208chr1873968 3832 3720 2896 2833 2784 629 23265 3177 --132
NM_015231chr111740 1325 --1219
NM_015236chr411019 196 --11452
NM_015271chr483948 2926 1334 1290 611 555 123 62 24324 373 23815 3198 --
NM_015310chr8117578 6643 6443 5814 5341 3321 1605 1426 1317 1188 990 11237 17036 26620 5784
NM_015328chr752241 1024 803 478 260 23121 2820 --12524
NM_015347chr121189 32143 1859 1827 --1148
NM_015349chr652893 2212 2117 2023 153 12307 12279 --
NM_015375chr173668 3204 3182 1898 238 141 102 84555 4517 4396 4134 3776 3601 2014 1160 24280 543 23167 971
NM_015382chr141261 2773 588 --1276
NM_015385chr1053157 3039 3013 2487 367 12854 ----
NM_015455chr533326 3139 928 23895 1535 --22938 2566
NM_015458chr844453 3934 974 143 14184 34068 1955 1833 14370
NM_015526chr1951192 997 529 486 92 61277 1226 1079 978 960 269 ----
NM_015535chr294074 4043 3776 3600 3014 2808 1680 1638 1350 53911 3417 3026 2602 1491 14120 11094
NM_015550chr74720 406 380 326 32263 749 308 33194 2757 882 --
NM_015564chr563524 3324 3253 1158 992 688 2710 110 ----
NM_015569chr131825 1385 628 44786 3027 1718 1349 ----
NM_015575chr233398 2382 2287 52622 2533 2373 1206 313 --13359
NM_015640chr1--53455 1859 1817 306 76 --1981
NM_015879chr18168279 7854 7740 7634 7125 7033 6678 6472 6058 6018 3082 2656 2480 2109 1427 913 25334 1491 56377 5536 5196 2622 2613 28600 1717
NM_015886chr865532 4692 1659 683 472 307 65053 4937 1209 661 283 269 12137 --
NM_015906chr153366 3262 3088 1499 763 11159 ----
NM_015975chrX31650 1199 441 1535 21840 239 11468
NM_015995chr1595496 5420 5182 4270 3880 3692 3614 3596 474 24203 2225 1824 12208
NM_016009chr184920 3996 3385 3299 1653 1515 1320 529 13124 13635 13280
NM_016072chr1272430 2371 1992 1501 813 722 696 12185 ----
NM_016076chr152344 1074 880 865 121 21138 655 12128 --
NM_016083chr663610 3566 3040 3021 2908 2864 13295 1248 --
NM_016132chr154661 600 591 175 13338 12364 --
NM_016206chr367352 7159 6804 6294 2950 2236 38701 7642 789 38145 5465 2647 32905 2770 175
NM_016221chr531878 1525 673 128 --11687
NM_016257chr183013 1406 1392 1370 622 365 81 52 12444 12814 13051
NM_016260chr236067 1472 526 56188 5680 4729 2185 1432 --16498
NM_016272chr2252778 2531 2460 866 692 11022 --12126
NM_016297chr242574 2391 758 402 --21287 1001 32688 352 35
NM_016298chr342330 2045 2037 175 22687 2541 1555 12256
NM_016352chr711309 --11067 21135 436
NM_016376chr17114383 4014 3205 3027 2779 2750 1402 1042 827 704 219 44286 3648 3435 351 11109 13278
NM_016395chr1521622 1537 ----1761
NM_016396chr1522288 1119 32986 2160 821 12895 --
NM_016442chr552187 2149 726 255 126 1810 ----
NM_016513chr6121504 1441 1371 1318 1229 1151 1093 1049 996 823 346 234 13440 13774 --
NM_016559chr331482 1399 603 11078 1514 --
NM_016575chr1295224 5114 4562 3993 3381 1475 1373 788 149 34046 1508 516 ----
NM_016577chr384248 4200 4034 3358 3166 2944 2807 72 24548 1390 14540 14185
NM_016626chr1821171 84 11091 --1356
NM_016834chr17103999 3937 3846 3550 3313 2881 1625 1363 1233 1055 22572 212 33646 2869 1109 11226
NM_016835chr17103999 3937 3846 3550 3313 2881 1625 1363 1233 1055 22572 212 33646 2869 1109 11226
NM_016841chr17103999 3937 3846 3550 3313 2881 1625 1363 1233 1055 22572 212 33646 2869 1109 11226
NM_016946chr173228 2916 1451 1326 1291 1270 851 33362 2348 733 --12310
NM_016953chr295944 5861 5769 5377 3697 2105 584 466 108 66027 5306 4582 4164 1766 718 22242 457 12357
NM_017415chr5123534 3477 2860 1732 1668 1559 1331 989 954 937 925 455 33107 1796 1490 13948 --
NM_017420chr142893 793 23535 559 1547 23706 533
NM_017447chr2154124 3147 1623 1117 872 53953 1181 587 219 48 ----
NM_017563chr3126153 6007 5856 5722 5506 5468 5356 5182 1381 1056 666 101 14049 15972 22283 1806
NM_017628chr444306 3895 2093 1738 54741 1114 1011 437 120 23956 1668 --
NM_017637chr9108684 8233 7450 7101 6306 3474 3181 2679 1551 1310 69213 9038 8067 6953 3275 2160 ----
NM_017643chr1752218 2175 693 254 124 11952 ----
NM_017644chr354814 3784 1352 893 699 23908 751 11007 14427
NM_017650chr795506 4748 4322 4092 3824 1503 1154 1014 199 34210 2348 1411 ----
NM_017709chr193666 3599 3371 3019 1654 1253 1003 909 256 24096 1078 --1284
NM_017754chr6114087 4058 3141 1974 1842 1472 1099 922 866 299 206 13711 --1429
NM_017787chr1072844 2567 2511 2444 1803 1039 822 32929 2518 2350 --12372
NM_017813chr865774 5003 4479 2167 2062 1276 35792 2200 108 25380 196 --
NM_017848chrX83950 3732 3010 713 507 337 236 128 54470 4463 4165 3688 1134 --21113 244
NM_017849chr262654 2502 2232 914 881 718 22798 2535 --1352
NM_017896chr2052642 2517 2401 1350 498 1762 ----
NM_017902chr10105406 5254 5196 4757 4441 3632 2088 1829 1116 1071 34536 4416 4157 2661 273 --
NM_017919chr964854 4790 2036 1931 1245 978 74731 4499 3789 2086 1920 1298 589 ----
NM_017954chr731667 644 637 31631 1200 1118 ----
NM_017966chr1181445 1234 1216 981 613 606 557 35 11019 ----
NM_018013chr662967 2473 2354 2257 2178 2163 12613 ----
NM_018036chr1454356 4346 4069 3692 2860 23029 1109 13877 --
NM_018078chr4----129 1821
NM_018085chr1168159 7279 6829 6660 6129 6087 2982 2300 2223 2072 1756 1621 1420 1334 935 90 57962 7319 6536 5884 207 --22431 1876
NM_018121chr1033173 861 430 12193 11968 --
NM_018168chr1421410 231 3472 67 57 1486 11005
NM_018189chr331364 728 334 21297 561 --1522
NM_018243chr483631 3609 3544 3267 2821 2601 1388 864 --22736 478 11163
NM_018247chr652464 2250 1130 1094 50 ------
NM_018263chr231891 1040 284 22479 2038 --12408
NM_018286chr172837 822 1853 --1801
NM_018293chr332949 2288 968 32195 1051 206 ----
NM_018299chr853261 1217 870 536 38 23423 2350 ----
NM_018340chr16114316 4084 3711 3465 3281 3091 1694 1559 358 288 273 74018 3881 3358 1183 1171 887 439 13247 11809
NM_018351chr1283982 3924 3877 3759 1827 1656 1436 1039 31554 904 33 ----
NM_018362chr1183290 2709 2450 1464 473 451 227 165 23426 2781 ----
NM_018364chr122764 530 23296 824 11148 --
NM_018370chr1241723 1589 146 21 1824 --11834
NM_018373chr1496009 4816 4594 3922 2572 1050 754 699 28 35672 3903 1563 12050 --
NM_018374chr784733 4665 3243 2086 1472 870 76 58 11917 --24160 1863
NM_018400chr1184348 4308 3936 3325 3204 3078 1025 281 43639 1601 1256 828 12981 --
NM_018416chr1272599 2488 2135 1974 1613 1053 870 ------
NM_018440chr898159 8088 7643 6683 6166 477 290 275 148 57985 7741 6420 3444 1105 26304 3205 --
NM_018566chr144834 3843 685 64 54287 4059 3446 1956 1229 13193 --
NM_018638chr1235246 3473 1560 33636 1511 67 --1371
NM_018841chr183828 3361 3087 2536 848 544 153 34 53479 1569 634 383 365 1986 --
NM_018958chr1563912 2880 1453 1166 855 198 23362 920 --1880
NM_018970chr721272 711 22654 565 1583 --
NM_018999chr1094171 4125 3862 1619 1065 822 611 327 258 34247 1339 709 ----
NM_019001chr354568 4060 3082 1552 72 34093 3554 3176 1951 --
NM_019041chr691929 925 737 616 345 311 280 224 161 32497 2229 418 ----
NM_019063chr252284 2112 1772 1549 247 31447 799 158 ----
NM_019067chrX154930 4258 4163 3932 3182 3055 1812 1800 1785 1570 781 497 324 190 157 44395 4066 3253 1706 13070 1472
NM_019072chr554018 3314 1447 1225 270 --21709 906 --
NM_019094chr12103606 3437 2826 2607 2503 1459 1357 1301 1013 39 43752 3493 2620 1490 13276 23711 1452
NM_019106chr2293373 2843 2521 2459 2403 2134 1067 94 84 154 13337 22782 302
NM_019610chr14751 312 268 31 41929 1903 1617 821 ----
NM_020122chr285211 4730 4533 4428 3654 1375 918 259 54152 3814 1618 1005 478 25512 4620 13773
NM_020159chr461330 1230 1081 590 431 22 ------
NM_020177chr532727 392 165 --21225 428 --
NM_020200chr1041039 1011 324 181 --11078 3890 219 31
NM_020243chr226765 658 640 281 148 27 ------
NM_020340chr6102200 2061 1827 1630 1400 394 282 151 133 115 1591 12015 --
NM_020341chr202657 619 11907 --11775
NM_020346chr1131472 475 186 ----11450
NM_020348chr1061974 1117 1063 724 649 626 21967 1788 12426 --
NM_020390chr3103512 3234 3130 1818 1224 1040 1008 945 906 859 43358 3123 1332 1178 ----
NM_020443chr1146980 6522 5847 5824 5557 5448 4909 2582 2433 2421 1989 1397 973 458 66680 6599 5992 4921 1451 364 ----
NM_020455chr641781 898 880 541 21090 751 11136 --
NM_020456chr1331752 1720 1657 22224 1886 --21848 1525
NM_020466chr654404 1848 1124 326 201 44615 3629 3214 1805 34838 4724 462 --
NM_020532chr2--1807 --1650
NM_020546chr5103209 2958 2850 2490 2247 1076 525 458 207 107 32867 2773 2137 23095 2665 --
NM_020647chr842031 871 728 340 21874 1506 1511 --
NM_020661chr1231437 1322 503 2337 280 --11858
NM_020673chr20107282 7263 7240 6817 6780 6694 6053 5065 1928 1468 36222 4758 1866 ----
NM_020715chr1452162 2118 1420 700 342 2757 575 ----
NM_020717chrX105034 4712 4550 4385 4136 3931 1661 695 618 110 13260 34846 682 161 14962
NM_020752chr1062511 988 906 539 316 79 32838 1041 469 1924 --
NM_020766chrX74327 3521 3367 2898 2892 1098 523 1121 13728 --
NM_020768chr552024 697 622 601 249 33169 327 58 12183 --
NM_020772chr1776909 6249 5867 5293 2604 2349 1862 ----16981
NM_020774chr1866145 5595 2178 980 952 487 21416 332 11620 --
NM_020776chr1863003 2440 1212 1047 567 114 32542 765 327 12485 --
NM_020779chr263224 2486 2266 2021 1042 607 1294 ----
NM_020830chr282647 2420 2295 2074 2042 1099 1079 624 33224 2877 345 1908 --
NM_020859chr473246 2847 2635 1623 1232 733 43 23793 609 --13423
NM_020918chr1042298 912 265 170 1528 12490 1115
NM_020921chr1462933 2593 1375 1306 206 69 22861 857 ----
NM_020935chr274198 3985 3817 2992 1749 732 191 21184 990 23686 692 --
NM_020940chr1031040 306 69 --1703 12308
NM_020951chr1942379 2166 1723 1550 32025 1885 1583 --11543
NM_020956chr1962994 961 745 690 556 541 61878 1800 1722 1644 1605 1566 --11375
NM_020977chr441831 1679 768 531 ----11459
NM_021005chr1521145 858 1380 --1443
NM_021032chr311467 1538 --11623
NM_021079chr1742563 2044 1104 1070 11263 22336 2073 22454 374
NM_021090chr2254530 4100 1539 1053 952 33225 1944 971 14032 --
NM_021116chr7148978 8314 8136 8027 7932 7700 6989 6110 5958 5560 2449 2158 1982 358 26521 810 27011 6407 --
NM_021156chr2041144 966 297 138 21118 758 1303 --
NM_021629chr384710 4617 3984 3656 3218 1879 1744 894 31995 1503 1215 --23461 3160
NM_021635chr661879 1748 1440 224 190 107 31521 1371 1343 11273 --
NM_021638chr474849 4459 3419 1136 355 324 219 44127 3743 3489 3198 11379 --
NM_021647chr454162 3603 3299 3289 697 44264 1511 981 931 --1621
NM_021813chr6145299 4575 4197 4086 4011 3750 3590 2203 1855 1412 1291 1157 688 21 34054 1662 516 25096 553 188
NM_021912chr1543981 3889 3550 910 43445 3265 3030 1650 ----
NM_021913chr1951349 534 439 259 244 3670 354 142 11153 --
NM_021950chr1152220 1603 831 647 56 31763 1545 390 ----
NM_021961chr11136282 6274 6039 5638 5196 4708 2602 2200 2146 1479 1306 689 416 76154 5598 2753 2627 2293 1877 1599 21760 641 --
NM_021964chr386559 6469 5072 2509 1722 834 485 306 45220 2660 2461 957 ----
NM_022048chr15185517 5293 5233 5081 5056 4771 4186 4163 4067 2432 2382 2074 1624 1574 1445 1195 557 501 44879 4095 3893 1135 --1220
NM_022114chr1104753 4542 3733 3665 3611 3480 3421 1123 194 148 23984 167 --11753
NM_022140chr55783 679 661 264 255 42290 1655 1525 401 12188 12086
NM_022166chr16156102 5566 5227 4954 4518 4493 4090 3965 2231 1920 1519 1388 259 232 37 25587 439 36062 4305 1490 --
NM_022351chr833289 272 207 33738 2869 1295 131 --
NM_022456chr12147598 7466 7240 6064 6049 5686 5605 5298 5164 2547 2117 1081 422 85 35592 814 623 12889 --
NM_022459chr1375863 5712 4209 4199 3859 1683 80 56322 5962 5745 1909 401 --25571 4977
NM_022462chr1992978 2419 1521 1456 758 712 270 199 173 53128 2727 1141 1006 728 ----
NM_022474chr1421890 356 22539 510 1757 12246
NM_022477chr2061743 1387 1216 428 310 216 11352 --21629 1312
NM_022491chr1242456 807 499 174 42826 2409 2195 970 22592 1302 --
NM_022497chr342864 992 255 228 33877 3865 3826 43538 2555 1239 1126 11443
NM_022648chr284415 4246 4060 3656 3637 3304 3039 666 13149 14233 13809
NM_022716chr152808 2383 2337 1183 456 11028 12670 --
NM_022719chr2273228 2623 2394 1088 880 657 332 1778 --22562 1464
NM_022802chr1021604 1299 ----11058
NM_022842chr393188 2529 2519 1091 751 743 366 195 70 32260 975 84 32945 2125 360 --
NM_022898chr1474460 4178 3996 1288 1260 1125 161 24084 1087 24372 707 --
NM_023010chrX2807 730 ----1571
NM_023037chr133839 425 157 1396 --131
NM_023075chr181125 ----1733
NM_023923chr1103531 3025 2962 2815 2713 2405 1195 755 289 88 23189 2848 11333 22808 1449
NM_024007chr51219 11005 --2979 76
NM_024345chr955506 5215 4680 1704 1571 45620 5554 1879 1337 15565 11820
NM_024408chr133532 3277 612 ----21174 1073
NM_024411chr2031287 505 304 2527 520 --11128
NM_024492chr611494 4512 407 170 65 41448 1145 492 150 --
NM_024524chr332654 498 211 2698 511 1178 --
NM_024558chr141786 ----1974
NM_024646chr152896 2763 1576 947 342 33091 3047 1307 --13012
NM_024665chr344587 3132 3052 86 33593 1227 630 ----
NM_024721chr852504 2387 1984 1004 287 1324 --22539 81
NM_024761chr995230 4287 4153 3910 3382 3292 1712 1192 103 44360 3972 3896 822 11827 1844
NM_024770chr2136769 6641 6307 5111 4723 4580 2294 2078 1943 1055 760 672 510 76299 5317 2442 1680 575 381 76 32583 1641 807 --
NM_024834chr1021657 1539 41376 649 612 529 --11675
NM_024884chr1433611 1018 478 21826 1181 1709 1596
NM_024889chr1071163 703 659 645 618 557 130 91230 1215 1119 1104 689 674 604 589 31 --1423
NM_024930chr552252 2047 1790 1781 1758 22146 1916 --12578
NM_024947chr3138677 8172 8140 8079 7835 7422 6677 6548 3360 2862 2346 1926 1057 48309 7633 6730 592 --28742 3060
NM_024949chr494829 4435 4347 4222 4129 4105 3651 3310 785 34178 4047 1610 23085 1618 1500
NM_024963chr7125856 5832 5411 5292 5040 4622 4543 2189 1947 1796 1607 28 44317 2065 1473 1358 25178 4756 14872
NM_024989chr2117686 6561 5872 2299 2267 2205 2011 1959 1839 1316 350 26844 482 --22559 2395
NM_024991chr1053157 3039 3013 2487 367 12854 ----
NM_025054chr81303 23353 1620 --13768
NM_025061chr1991038 985 859 716 432 380 368 73 59 ------
NM_025073chr174188 3983 3597 1762 1532 1503 1382 44117 3653 3301 219 21127 591 23385 1367
NM_025134chr1652062 1653 838 558 516 11685 ----
NM_025146chr342300 2180 1984 768 11891 --1278
NM_025160chr144222 3508 1017 595 --11006 --
NM_025179chr184153 3977 3741 3255 1940 1065 182 62 63281 1912 1495 963 871 506 24849 1904 --
NM_025191chr143045 989 197 71 22916 2416 ----
NM_030579chr1643168 771 747 332 32896 1098 192 13278 13422
NM_030623chr231214 642 43 31621 624 88 --1217
NM_030625chr1042281 1618 736 477 11010 21066 467 --
NM_030647chr776189 4860 4245 1496 1313 989 848 45447 4647 4405 1751 --1906
NM_030648chr474881 4758 4720 3661 1628 1487 209 1610 22190 685 --
NM_030650chr274037 3706 2946 2858 2669 1196 540 23215 150 ----
NM_030674chr1265287 5132 5114 1768 1273 249 85431 4782 4353 4067 3775 3700 1614 1393 24375 1336 --
NM_030755chr1432561 636 311 1499 22259 446 12359
NM_030786chr131403 242 87 21329 649 11470 --
NM_030799chr541728 761 726 423 --1559 22233 677
NM_030806chr198511 8430 7404 7147 3459 3392 2077 1430 122 48949 7708 2094 1253 18990 17484
NM_030918chr1105241 4539 4233 4213 2076 2021 1565 1528 875 743 33311 2086 386 24144 3913 12046
NM_030965chr13600 200 29 ----1795
NM_031208chr162817 657 1987 1263 1373
NM_031418chr1122152 256 42766 2472 2053 644 12608 --
NM_031427chr1495767 4297 4161 2224 1996 1552 1052 522 250 35006 3624 604 23746 1687 14413
NM_031844chr153639 3512 3098 3007 1118 ------
NM_031845chr242935 2601 2284 1460 11308 23537 2688 --
NM_031847chr242935 2601 2284 1460 11308 23537 2688 --
NM_031911chr442449 981 856 50 31910 1736 377 1999 --
NM_031938chr111654 1315 --1328
NM_032012chr974108 3684 3592 1449 1383 1291 1239 44992 4340 3673 1803 24125 1708 --
NM_032013chr2061743 1387 1216 428 310 216 11352 --21629 1312
NM_032018chr13568 183 133 2716 324 ----
NM_032144chr22712 174 ----1529
NM_032160chr1884235 3637 3297 2703 2692 2674 1621 854 23866 3577 13827 --
NM_032199chr10143838 3693 3331 3267 3214 2885 2606 1349 1335 1023 720 609 598 220 13787 23393 124 --
NM_032208chr24626 296 281 252 21400 942 11413 --
NM_032236chr11213 2945 116 --1150
NM_032307chr93787 306 173 1904 --2752 423
NM_032321chr22331 277 23278 2775 --12883
NM_032373chr1074840 4292 4054 3920 2125 706 564 35035 1879 1048 32312 1698 311 21004 233
NM_032449chr172642 2170 2131 2084 501 355 189 11878 22433 1073 22758 774
NM_032457chr443095 2740 601 234 11483 --1649
NM_032458chrX53004 2558 1204 1147 854 23187 3178 ----
NM_032682chr343604 3020 2975 427 23093 580 --1855
NM_032731chr1731459 1072 985 3300 291 269 1519 --
NM_032968chrX43689 2812 600 67 24130 3295 14140 --
NM_032969chrX43689 2812 600 67 24130 3295 14140 --
NM_032973chrY53681 2807 2644 600 67 24122 3290 14132 --
NM_033020chr153366 3262 3088 1499 763 11159 ----
NM_033055chr1--1178 --1893
NM_033103chr1921132 488 31093 957 101 --1474
NM_033133chr1793680 3621 3529 3512 3317 1331 1045 546 198 13265 23149 707 --
NM_033143chr444331 4117 3498 1432 31488 1063 701 24622 2873 --
NM_033181chr663610 3566 3040 3021 2908 2864 13295 1248 --
NM_033221chr9132698 2649 2475 2431 1981 1887 1132 810 763 727 637 579 355 31765 792 395 --12591
NM_033224chr7127942 7149 6715 6546 5852 5700 5550 5117 3198 1652 280 262 96852 6262 5760 5376 5080 4907 2230 2073 1618 36443 5238 200 15354
NM_033225chr863031 2866 2506 2420 2095 612 1209 13072 --
NM_033238chr1551851 1070 1017 596 87 52393 631 616 560 476 22462 766 1189
NM_033285chr864084 3012 2831 1271 645 319 12771 ----
NM_033360chr1254637 4276 3614 820 615 21729 317 13721 --
NM_033389chr17104780 4742 4457 4141 4129 1507 1367 841 640 571 24019 1485 ----
NM_033429chr1572633 2500 795 593 482 472 279 --11999 11126
NM_033505chr265176 5039 4906 1990 1493 252 55292 4437 2376 631 544 1791 --
NM_033512chr822902 2661 12130 --12709
NM_033637chr1073813 3716 2950 2697 2625 2614 323 23898 1340 ----
NM_033644chr522201 746 11593 --11861
NM_033645chr522201 746 11593 --11861
NM_033656chr21125690 5336 4686 4318 4150 2388 2353 2279 1274 1081 965 596 25871 4103 14912 --
NM_052849chr152867 282 ----2769 715
NM_052879chr1253523 2593 1535 1053 202 33785 3105 161 ----
NM_052885chr1283455 3099 1900 1504 1389 1115 921 313 23017 529 --1797
NM_052917chr263329 3114 2894 2715 2619 739 13296 1511 --
NM_052918chr1042870 2503 1187 658 83551 3124 3116 2933 2701 2278 1109 1067 --13248
NM_053016chr9117696 7656 7159 7122 6611 6170 3154 2661 1957 1529 1192 26257 5563 16754 16870
NM_053023chr1183067 2365 705 673 654 634 328 284 --1785 --
NM_053043chr7116249 5891 5757 5568 5562 4965 4503 3896 2407 941 442 36208 1460 682 34724 1681 1606 --
NM_057175chr452342 2170 2153 1940 1843 1620 1695 --
NM_078487chr953346 2914 2800 2447 2313 22221 2067 ----
NM_080632chrX2807 730 ----1571
NM_080669chr17114429 4131 3467 3429 3279 3259 1287 1217 1164 674 407 14919 13611 --
NM_080676chr2062530 2367 970 682 562 102 --1579 11274
NM_080717chr121249 1984 --1215
NM_080792chr2021735 51 31925 1409 639 --21918 1498
NM_080836chr20104550 4371 3958 3842 3727 3472 1884 983 129 64 22941 974 1682 13208
NM_080867chr1473683 3658 3329 1840 1690 1498 748 33818 1918 1244 11707 14402
NM_130387chr33885 103 97 11248 ----
NM_130468chr152779 531 ----1495
NM_133170chr20108123 7789 7680 5470 2939 2253 1981 1698 1676 143 45585 1164 885 295 --11476
NM_133264chr1793943 3408 3330 2950 2926 2711 1167 145 97 1215 --11347
NM_133265chrX63376 3240 2814 2641 2493 582 --13616 22614 949
NM_133334chr483993 3967 3894 2510 2082 1793 1773 494 35886 4130 1328 --16240
NM_133372chr552929 2382 1893 1093 354 62900 2257 2060 1060 757 485 12748 --
NM_133443chr1641493 804 663 48 11549 21760 1647 11383
NM_133496chr184533 4414 3904 3014 2966 1557 361 112 63563 3159 2854 1489 1274 931 ----
NM_133646chr265391 5356 3815 3620 3547 399 24702 4066 25159 3418 2678 559
NM_138270chrX32919 2721 1027 12833 33286 3139 2334 13382
NM_138286chr1943219 1332 1230 1198 34285 2978 1365 --11325
NM_138288chr1422255 1734 11482 11592 11444
NM_138323chr153983 737 362 1354 ----
NM_138444chr1374343 3679 1687 695 470 425 77 ----11217
NM_138468chr2115662 5447 3883 2349 2214 2148 2110 1804 1387 1290 1062 46196 2463 2049 744 22082 1521 34293 3998 1637
NM_138473chr12134922 4766 4638 4384 4369 4287 3154 1973 1395 1160 815 728 162 44137 4075 3240 345 ----
NM_138576chr1474460 4178 3996 1288 1260 1125 161 24084 1087 24372 707 --
NM_138621chr263872 3714 2941 2827 2768 653 ----23177 1053
NM_138713chr1687966 7072 5869 5270 1428 214 62 37 36267 5831 5075 15108 --
NM_138714chr1687966 7072 5869 5270 1428 214 62 37 36267 5831 5075 15108 --
NM_138731chr1443845 3831 271 132 ----11517
NM_138799chr262107 1993 1708 1663 303 239 3417 403 369 ----
NM_138959chr1136772 6100 5276 5267 4930 4395 4294 2178 2114 2045 1005 678 232 25380 609 21973 788 --
NM_138971chr1183429 3369 3227 1457 932 839 670 173 --12817 13036
NM_138971chr1183429 3369 3227 1457 932 839 670 173 --12817 13036
NM_138972chr1183429 3369 3227 1457 932 839 670 173 --12817 13036
NM_138972chr1183429 3369 3227 1457 932 839 670 173 --12817 13036
NM_138973chr1183429 3369 3227 1457 932 839 670 173 --12817 13036
NM_138973chr1183429 3369 3227 1457 932 839 670 173 --12817 13036
NM_139246chr972301 1727 1633 581 538 303 24 42054 1543 401 246 ----
NM_139279chr292390 2192 1333 942 914 718 656 325 90 11327 --1831
NM_139283chr1232296 2116 102 31724 583 40 1885 --
NM_144567chr151841 1746 971 905 33 32757 1979 1003 12599 --
NM_144571chr474837 2263 1538 1194 1001 836 732 46371 5287 478 324 --11458
NM_144590chr1052392 1066 542 474 292 --22419 2093 2412 377
NM_144721chr492501 2128 2114 1725 1089 1074 612 261 22 22397 1841 ----
NM_144973chr1274826 4582 3962 3922 1661 1407 1395 43765 3607 3399 1899 13314 --
NM_145176chr642456 1362 1312 312 12814 21375 204 --
NM_145206chr1042431 2051 1284 980 ----33211 2932 1064
NM_145207chr465243 4935 4548 3553 3361 723 95369 4542 3543 3373 2049 1978 1644 1392 954 14609 --
NM_145259chr275705 5284 4936 4302 2796 2567 558 46379 5752 1377 976 --26352 5533
NM_145320chr74720 406 380 326 32263 749 308 33194 2757 882 --
NM_145321chr74720 406 380 326 32263 749 308 33194 2757 882 --
NM_145322chr74720 406 380 326 32263 749 308 33194 2757 882 --
NM_145698chr1041538 1439 1337 613 31665 1472 1432 --12017
NM_145799chrX82406 2354 1143 1086 470 373 271 259 22924 2053 1868 --
NM_145800chrX1118 1988 1280 1130
NM_145802chrX167 1937 1229 179
NM_152253chr2293941 3933 3859 3506 2734 1424 1272 965 650 43715 3211 624 303 13049 --
NM_152263chr1104862 4594 4038 2257 1934 1354 1263 1124 988 556 45811 5773 2393 1238 24995 4172 14288
NM_152280chr153176 3076 2470 347 291 42675 1361 1172 483 --12995
NM_152375chr162462 2222 2194 2081 1972 743 32013 475 439 22279 236 --
NM_152388chr273442 3042 1291 1261 754 132 44 43956 3672 1466 268 11482 --
NM_152409chr542260 1378 1278 270 33482 106 54 12653 11176
NM_152422chr941462 1407 1297 735 2687 338 ----
NM_152423chrX--21240 435 11207 11162
NM_152424chrX114555 4296 3619 3228 3062 1345 1282 1208 1199 707 668 24129 2997 ----
NM_152455chr1552788 743 649 547 61 2969 682 --1642
NM_152475chr1992188 1898 1866 1803 1710 255 223 160 44 22032 923 2939 475 21994 1680
NM_152519chr252037 1939 1581 867 769 22085 1698 ----
NM_152529chr2104188 4097 4021 3952 3855 3087 2961 513 376 284 2629 304 23221 1379 11495
NM_152622chr563502 3316 3230 473 332 270 21195 1172 13325 11224
NM_152624chr555776 5065 2911 1953 1408 37217 6513 2298 65464 2575 2560 1747 929 29 --
NM_152629chr951646 1606 1358 1352 1249 --1496 11391
NM_152636chr1142716 2337 861 314 31996 948 615 --22571 840
NM_152641chr1252891 2820 2418 2053 685 22435 2248 --11983
NM_152699chr393185 3176 2840 2772 2517 1240 1076 1035 890 22355 374 ----
NM_152733chr6116264 6221 5810 5758 4998 4304 2455 2360 1067 191 160 1638 35554 1051 216 --
NM_152756chr563652 3521 3352 1561 650 167 23455 62 13646 --
NM_152787chrX52502 1039 981 567 301 31501 904 398 13101 --
NM_152866chr1152220 1603 831 647 56 31763 1545 390 ----
NM_152903chr1342766 2601 1803 688 32694 427 98 --1804
NM_152924chr1595972 5545 5411 1399 1306 1114 894 636 493 75079 5042 5002 4964 4885 2682 1385 22402 1834 --
NM_153029chr1683792 3629 2928 1514 665 620 438 106 63895 3086 1380 1090 1043 991 ----
NM_153050chr2254530 4100 1539 1053 952 33225 1944 971 14032 --
NM_153051chr2254530 4100 1539 1053 952 33225 1944 971 14032 --
NM_153188chr555086 4603 4212 3908 139 45464 4756 4015 3444 --128
NM_153207chr1233517 2924 1608 --12989 11593
NM_153234chr572759 2543 2443 509 220 212 117 11918 ----
NM_153262chr173200 2094 795 154 77 53 47 43011 2670 2242 579 ----
NM_153607chr5----1718 13176
NM_153619chr1543305 2754 2463 773 4927 544 511 224 1879 --
NM_153645chr2263069 3036 2506 2049 2040 332 22977 321 ----
NM_153712chr253455 2705 2447 1120 770 2190 162 --13823
NM_153825chr41342 21290 1263 1514 11608
NM_153828chr2--1807 --1650
NM_170679chr521337 1325 1170 --21301 43
NM_172070chr232052 1605 299 21542 138 ----
NM_172071chr1137349 7245 6889 6879 6211 5649 5357 5121 4587 4529 2872 2817 36 35500 2429 567 12125 --
NM_172127chr471410 1384 830 315 243 161 81 1760 ----
NM_172128chr471366 1340 786 271 199 117 37 1716 ----
NM_173167chr1782564 2506 2115 972 945 925 816 600 1245 2503 117 --
NM_173172chr241130 498 406 321 1193 --1119
NM_173214chr1687966 7072 5869 5270 1428 214 62 37 36267 5831 5075 15108 --
NM_173468chr434791 4103 100 24976 3725 --13685
NM_173511chr273881 2905 1523 1491 1319 578 239 33866 613 372 --13626
NM_173536chr453983 3452 1643 530 514 24575 3661 15133 --
NM_173582chr1185931 5709 5258 4162 2521 2147 1803 1266 45375 1730 1515 801 25537 1399 --
NM_173602chr1232920 2852 2332 22447 806 --13616
NM_173611chr15--1181 --164
NM_173642chr1148759 8659 8461 7996 7837 7498 7223 7179 6978 6879 6704 6684 6148 1677 38870 8728 1069 36698 2848 213 28491 2964
NM_173694chrX41951 768 495 38 21673 470 ----
NM_173808chr164270 4198 3678 3037 2724 1030 23918 1206 --11778
NM_174916chr1551960 1913 1863 1789 262 2749 486 ----
NM_175058chr1131047 248 81 1388 --21315 898
NM_175623chr12147598 7466 7240 6064 6049 5686 5605 5298 5164 2547 2117 1081 422 85 35592 814 623 12889 --
NM_175624chr12147693 7561 7335 6159 6144 5781 5700 5393 5259 2642 2212 1176 517 180 35687 909 718 12984 --
NM_175625chr12147693 7561 7335 6159 6144 5781 5700 5393 5259 2642 2212 1176 517 180 35687 909 718 12984 --
NM_175736chr12167132 7125 6765 6746 6298 5890 5560 5202 4851 3005 2321 1940 864 442 106 42 47545 5283 2956 1831 36268 2156 1710 --
NM_175861chr1295691 5400 3952 3801 3650 2375 1908 876 579 55958 4878 4675 4633 1365 --1348
NM_175907chr1892637 2119 1111 948 912 374 280 265 55 1549 22743 2535 --
NM_175921chr554283 3686 2885 1651 1338 22722 1118 --168
NM_176871chr892558 2288 2143 1343 1264 1235 951 621 491 12074 --22941 428
NM_177968chr252060 1927 1640 531 105 11807 --12175
NM_177990chr202657 619 11907 --11775
NM_177995chr941462 1407 1297 735 2687 338 ----
NM_178011chr1032691 1017 582 23069 3007 12356 --
NM_178013chr1492972 2696 2634 2103 1193 1079 461 428 155 42678 2612 974 133 ----
NM_178037chr1283564 3314 3217 2983 2941 2452 992 478 33430 846 825 1322 --
NM_178038chr1283564 3314 3217 2983 2941 2452 992 478 33430 846 825 1322 --
NM_178039chr1283199 2949 2852 2618 2576 2087 627 113 33065 481 460 ----
NM_178040chr1283199 2949 2852 2618 2576 2087 627 113 33065 481 460 ----
NM_178151chrX157820 7484 7115 7011 5902 5757 5326 5035 5003 2629 2595 2188 2176 1296 455 37888 5179 2054 ----
NM_178152chrX157820 7484 7115 7011 5902 5757 5326 5035 5003 2629 2595 2188 2176 1296 455 37888 5179 2054 ----
NM_178153chrX157820 7484 7115 7011 5902 5757 5326 5035 5003 2629 2595 2188 2176 1296 455 37888 5179 2054 ----
NM_178509chr1752803 2645 1122 680 329 43895 3748 3651 1017 1661 --
NM_178539chr1261918 1707 515 413 373 130 ------
NM_178586chr1432435 2316 645 62282 2113 1860 377 320 183 ----
NM_181077chr15--11907 --11671
NM_181481chr1866881 5827 2179 1199 862 451 36146 4363 2491 --11910
NM_181482chr1866881 5827 2179 1199 862 451 36146 4363 2491 --11910
NM_181483chr1866881 5827 2179 1199 862 451 36146 4363 2491 --11910
NM_181486chr121249 1984 --1215
NM_181504chr543573 3423 909 203 12867 12762 13592
NM_181521chr16107238 6816 6228 5632 5545 4611 2024 1523 558 144 --11654 16662
NM_181523chr543573 3423 909 203 12867 12762 13592
NM_181524chr543573 3423 909 203 12867 12762 13592
NM_181672chrX21793 1317 11452 --11589
NM_181673chrX21793 1317 11452 --11589
NM_181787chr863707 3628 2986 2698 2432 2366 43005 2947 2600 352 12832 --
NM_182314chrX21545 466 --11283 1605
NM_182493chr16144893 4860 4798 4786 3744 3465 3359 1747 1700 1602 1144 818 630 181 25027 1954 --23289 1395
NM_182503chr684779 4152 4144 3804 3514 2251 2150 1082 ----12016
NM_182507chr12122100 2039 1641 1500 938 889 843 721 675 391 237 228 ----11593
NM_182515chr19116661 6551 5149 5067 4708 4574 4345 2360 956 824 712 36416 5776 5285 15246 34822 1932 122
NM_182620chr1782166 2104 2082 1596 1565 1502 660 291 32128 2030 1729 ----
NM_182898chr786588 5958 5591 5126 4882 2359 2320 1358 35055 4517 1581 --36259 5191 1558
NM_182899chr786588 5958 5591 5126 4882 2359 2320 1358 35055 4517 1581 --36259 5191 1558
NM_182948chr162884 2624 2348 728 284 111 --22791 2698 --
NM_183004chr1433119 2591 620 1915 13466 12501
NM_183078chr653168 2861 2802 927 443 3896 676 435 13277 11022
NM_183397chr20144968 4886 4771 4259 3171 1873 1738 1014 913 898 444 380 337 300 35064 1583 283 ----
NM_194247chr284247 4199 3958 3771 3199 3167 2885 811 53576 3389 1328 734 584 13298 24129 91
NM_194314chr175556 5334 4385 1427 448 339 108 14930 12172 15418
NM_194434chr1841987 1232 942 564 55222 5148 4752 3873 1594 1744 15513
NM_197941chr562966 2955 2699 1895 1880 1070 32763 2609 2555 ----
NM_198081chr652665 2358 2305 279 45 12802 21890 987 --
NM_198212chr732168 945 805 ----11515
NM_198320chr12145239 4935 4926 4322 4297 4276 3748 3609 1694 1449 1311 1179 1063 439 35076 4286 145 --23870 683
NM_198395chr521064 202 1766 143 1967
NM_198468chr672832 1668 1298 1248 999 898 58 64266 3448 3302 2960 1798 1546 23091 650 21278 1026
NM_198485chr342540 476 464 399 32441 1942 445 2579 527 --
NM_198569chr641648 765 747 408 2957 618 11003 --
NM_198581chr2127486 6530 6501 5226 5165 4961 4929 2745 2633 2010 1785 670 57271 6668 6300 5724 5396 15795 15684
NM_198595chr474849 4459 3419 1136 355 324 219 44127 3743 3489 3198 11379 --
NM_198715chr176203 6118 5625 4834 4343 867 556 32285 2014 880 ----
NM_198896chr112860 324 ----1677
NM_198900chr12167132 7125 6765 6746 6298 5890 5560 5202 4851 3005 2321 1940 864 442 106 42 47545 5283 2956 1831 36268 2156 1710 --
NM_198935chr2072952 2914 2431 1301 922 393 277 1707 ----
NM_198990chr753009 2318 1256 1246 1197 33228 2598 508 11156 22142 777
NM_199040chr12103606 3437 2826 2607 2503 1459 1357 1301 1013 39 43752 3493 2620 1490 13276 23711 1452
NM_199044chr152249 2209 449 400 198 42986 2583 2008 737 12350 12489
NM_199188chr1253523 2593 1535 1053 202 33785 3105 161 ----
NM_199190chr1253523 2593 1535 1053 202 33785 3105 161 ----
NM_199324chr453225 3218 3208 562 541 32830 2681 429 ----
NM_199421chr1473683 3658 3329 1840 1690 1498 748 33818 1918 1244 11707 14402
NM_199436chr253114 2223 1907 535 232 22639 1147 13034 12032
NM_199454chr1104753 4542 3733 3665 3611 3480 3421 1123 194 148 23984 167 --11753
NM_199462chr173668 3204 3182 1898 238 141 102 84555 4517 4396 4134 3776 3601 2014 1160 24280 543 23167 971
NM_201263chr132029 1718 1607 31925 1918 523 11515 1626
NM_201428chr1141390 1349 591 112 ----11200
NM_201429chr1141390 1349 591 112 ----11200
NM_201430chr1141316 1275 517 38 ----11126
NM_201516chr73940 901 578 ----1340
NM_203350chr11279 1306 --1196
NM_203364chr1121218 238 ----1264
NM_203391chrX41465 1325 627 25 11346 ----
NM_203463chr244690 4411 3029 1650 23618 3019 123 --
NM_206594chr113003 22343 685 --11179
NM_206595chr113003 22343 685 --11179
NM_206832chr172322 68 ----1259
NM_206855chr684374 2289 2215 1629 1569 1513 733 280 34208 1533 320 --14052
NM_206909chr8117578 6643 6443 5814 5341 3321 1605 1426 1317 1188 990 11237 17036 26620 5784
NM_207012chr1063161 3026 2720 687 341 39 31088 419 324 22831 435 --
NM_207043chr122184 373 32303 2046 587 21959 736 1324
NM_207044chr122184 373 32303 2046 587 21959 736 1324
NM_207047chr122184 373 32303 2046 587 21959 736 1324
NM_207303chr1073949 2911 1244 1083 1022 989 329 2755 131 ----
NM_207321chr1041081 834 771 436 1178 1254 --
NM_207352chr472334 2169 767 601 322 290 224 32199 933 460 12678 1420
NM_207372chr1072340 2184 1776 959 414 182 176 177 12174 --
NM_207396chr151326 1217 620 484 212 51771 1242 1173 653 349 11603 1309
NM_207406chr466050 5648 4008 1489 1139 39 25393 450 22261 48 12286
NM_207520chr2--1807 --1650
NM_207521chr2--1807 --1650
NM_207577chr1182915 2522 2464 2421 2184 1897 1801 132 32512 2435 358 ----
NM_212558chr933616 2752 1453 73889 3425 3168 3026 2666 1398 1198 ----
NM_213589chr285476 4541 4086 3959 3390 1640 1547 258 24151 1520 1930 14111
NM_213606chr1092474 1801 961 843 761 749 358 352 104 22051 1670 11935 --