TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3916
miRNA Sequence: AAGAGGAAGAAAUGGCUGGUUCUCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5262 24 ------
NM_000021chr1451047 885 787 692 131 1799 2899 36 --
NM_000024chr52447 370 --1213 --
NM_000037chr831660 923 831 --22192 138 11918
NM_000038chr521582 1323 ----1284
NM_000044chrX284 56 --1171 1109
NM_000051chr1131224 769 683 --1816 --
NM_000052chrX93384 2827 2360 2329 857 791 698 610 99 22802 2515 13320 12233
NM_000061chrX3153 61 33 ------
NM_000067chr8--1686 ----
NM_000068chr19----31511 1495 1179 --
NM_000075chr121253 ----1196
NM_000081chr11702 ------
NM_000084chrX156127 6011 5940 5853 5563 5367 4854 2115 2097 1995 1497 907 827 817 721 1635 106920 6274 5863 5859 5821 5443 5411 1634 1047 177 12345
NM_000088chr1741239 1175 997 367 --2971 147 --
NM_000089chr72704 660 --5105 70 67 64 50 --
NM_000090chr23937 619 162 --156 --
NM_000092chr2103410 3154 3114 1632 1532 1487 702 157 149 117 --2595 483 14471
NM_000093chr952126 2108 2087 1744 966 --32275 2130 952 --
NM_000097chr351186 963 874 842 109 ------
NM_000103chr1551029 1018 985 833 36 ------
NM_000104chr241087 614 593 169 --183 --
NM_000109chrX32048 913 526 ----32139 2029 594
NM_000110chr111047 ----11000
NM_000112chr5105189 5130 5003 4816 4374 3701 3434 1634 753 127 --11784 35483 3894 796
NM_000125chr6114272 4022 3522 1719 1494 1447 1220 1160 513 181 174 21575 438 43680 1631 1599 1505 --
NM_000129chr62973 442 ------
NM_000133chrX41258 522 504 353 21322 1177 1126 1511
NM_000138chr1562291 1992 1846 1763 904 192 --12316 --
NM_000141chr1061314 1093 1035 992 967 308 ------
NM_000142chr421501 1093 --11086 11185
NM_000153chr1441673 1621 1419 39 --21445 536 --
NM_000161chr1431218 393 117 --31709 1470 193 --
NM_000163chr542372 2109 1999 894 ------
NM_000165chr621485 298 --31551 1144 1094 --
NM_000167chrX31343 685 468 --1697 --
NM_000168chr773322 3219 3142 3036 2575 2430 2203 1446 52833 2374 2339 325 147 12649
NM_000170chr91479 ----1438
NM_000175chr19126 --143 --
NM_000176chr523457 1324 --21099 344 22474 535
NM_000178chr20134 --151 --
NM_000183chr21101 1380 ----
NM_000189chr231924 833 43 --235 29 --
NM_000192chr1221179 320 --21390 1340 --
NM_000196chr162385 62 --1546 --
NM_000202chrX93780 2637 2548 2490 2484 2438 2416 1586 1155 21437 1048 23973 1253 --
NM_000208chr19114259 4130 3987 3516 3304 3176 1369 1361 762 561 239 --113948 3553 1886 1883 1877 1749 1396 801 727 515 52 --
NM_000212chr17102010 1923 1899 1810 921 637 543 362 333 289 --21685 1682 --
NM_000214chr2011543 --1675 --
NM_000217chr12114937 4186 3986 3404 3351 2064 2031 1102 971 769 656 25229 678 74965 3594 3448 2076 1955 715 218 21524 957
NM_000221chr23921 230 212 ------
NM_000237chr831519 754 273 11226 11444 --
NM_000238chr71152 ------
NM_000240chrX3838 425 419 1629 21937 670 --
NM_000245chr7----1823 12148
NM_000248chr342213 776 712 356 --22140 41 198
NM_000252chrX11382 1411 ----
NM_000258chr3----1246 --
NM_000259chr15166009 5963 5542 5398 4970 3907 3883 2473 2029 1992 1932 1870 977 652 535 407 --65042 5035 4926 4020 1011 692 --
NM_000264chr9113288 3132 3092 2143 1340 1263 1061 901 790 749 600 1577 12215 22334 683
NM_000266chrX2936 204 1880 1208 --
NM_000267chr1783457 3443 3289 1130 1123 895 766 391 --13320 1208
NM_000276chrX51445 793 646 449 408 22004 155 1237 --
NM_000278chr1051702 1638 1628 1594 1542 --11567 --
NM_000281chr10127 ------
NM_000284chrX71933 1907 1714 1659 1498 608 267 ----2520 407
NM_000286chr171309 ----1639
NM_000289chr12171 --1107 1337
NM_000297chr482012 1883 1601 1361 1344 290 193 131 --31917 1630 418 --
NM_000310chr151261 989 178 168 71 --31242 1238 502 --
NM_000314chr1052691 2680 1059 896 125 --22276 346 --
NM_000325chr41163 --1560 --
NM_000332chr6146504 6213 5950 5800 5522 5471 4693 2852 2760 2306 2296 2136 1773 100 26433 291 56371 4886 1689 608 434 --
NM_000335chr341827 1765 845 408 --11699 --
NM_000337chr5116468 6257 5179 5125 5101 4971 4161 2632 777 409 206 --25278 1092 11152
NM_000340chr341370 1149 1138 71 ----1293
NM_000345chr43865 792 95 ------
NM_000346chr1761945 1588 1336 1225 705 416 1433 71978 1579 611 140 137 134 131 --
NM_000354chrX----1244 --
NM_000362chr2253545 2900 2883 844 369 23630 1105 2820 275 --
NM_000367chr652178 1566 1455 816 213 ------
NM_000368chr9104272 4240 3587 3082 1907 712 313 285 267 133 --1289 --
NM_000369chr1431933 716 482 --31782 1411 1337 --
NM_000378chr111111 ------
NM_000379chr241270 1172 352 26 1514 ----
NM_000390chrX33447 820 148 --11166 --
NM_000391chr1181580 1461 1182 1147 595 548 507 215 --31667 527 275 --
NM_000393chr24740 715 598 306 --31583 1324 360 --
NM_000399chr102818 168 1735 ----
NM_000406chr41405 13053 52685 1973 530 284 205 22692 719
NM_000408chr282339 807 751 547 528 513 291 230 12527 42819 2745 2124 1334 12096
NM_000430chr1752654 2522 510 469 100 --22531 37 --
NM_000435chr197879 304 260 249 100 77 58 --6864 807 280 276 82 66 1183
NM_000439chr5102057 1612 1562 1029 765 734 438 134 113 42 11765 22436 727 --
NM_000441chr752353 1433 928 72 52 12127 11444 --
NM_000448chr11102667 2495 2156 1317 1199 1009 958 759 637 457 ----12114
NM_000449chr151355 1044 473 458 117 21319 945 11019 --
NM_000451chrX62002 1930 1768 588 461 423 --1316 --
NM_000452chr1351887 1820 1686 804 434 --11309 --
NM_000460chr3199 --2494 379 --
NM_000461chr354353 4339 3582 1094 988 --33100 1458 991 21763 938
NM_000462chr1521391 1301 1231 ----
NM_000474chr7----1529 --
NM_000478chr12648 490 --2698 249 --
NM_000480chr1151630 1078 616 491 357 --2270 93 --
NM_000484chr212432 292 ------
NM_000489chrX73217 3002 2476 1128 426 206 171 --73156 1097 1056 794 694 687 294 12481
NM_000492chr7----2473 467 11120
NM_000493chr62791 239 148 1385 --
NM_000500chr62153 119 144 ----
NM_000503chr851859 1715 1557 1468 1326 --41719 1504 1384 1320 --
NM_000522chr71216 --2158 136 --
NM_000523chr22823 266 --1135 --
NM_000525chr11--11503 ----
NM_000527chr1942323 824 551 190 1456 3275 253 194 --
NM_000530chr12712 245 --11091 --
NM_000533chrX61903 1380 748 441 411 110 --1333 127
NM_000536chr112542 236 ------
NM_000544chr6_cox_hap1123283 3134 2934 2747 2552 1109 1075 1015 913 493 280 27 12624 13262 1985
NM_000555chrX277832 7548 7113 6976 6325 6105 5868 5692 5657 5603 5447 5264 4829 3046 3039 2891 2775 2307 2269 1962 1618 1528 1000 950 342 232 174 13026 96961 5932 5818 5815 5542 5528 2896 1357 446 1785
NM_000575chr221148 234 179 --11042
NM_000578chr231791 1633 542 11726 11513 --
NM_000582chr4293 23 ------
NM_000587chr591362 1184 980 450 267 196 155 119 96 --21192 101 --
NM_000595chr61101 --1627 --
NM_000599chr2144312 4164 4104 3994 3981 3877 3467 3296 2854 2837 1670 1087 1021 829 24275 571 53894 1414 1025 676 609 --
NM_000600chr72278 40 190 145 --
NM_000610chr1152261 996 715 686 604 1789 12946 --
NM_000615chr1172901 2417 2193 2160 1959 1219 189 ----32504 2463 136
NM_000617chr126817 697 585 448 175 21 --22149 1615 --
NM_000618chr12165785 5651 5640 4306 4063 2614 2329 2173 1906 1823 1279 1186 763 745 416 49 11741 45301 4478 806 349 --
NM_000618chr12165785 5651 5640 4306 4063 2614 2329 2173 1906 1823 1279 1186 763 745 416 49 11741 45301 4478 806 349 --
NM_000620chr1262023 1986 1399 501 408 159 12049 2328 68 11880
NM_000627chr23903 679 135 ----1199
NM_000633chr1865228 3377 2106 1924 1668 870 14451 ----
NM_000635chr1951635 1581 1048 292 271 --11238 --
NM_000680chr8276 56 ------
NM_000684chr101199 11118 41249 500 235 232 --
NM_000686chrX21495 117 --41357 521 362 302 --
NM_000693chr1531573 486 23 --31139 152 107 --
NM_000706chr122646 637 --1829 --
NM_000719chr1296278 5928 5197 4562 2380 2359 2344 2175 997 16308 32164 1107 915 --
NM_000721chr141989 1838 1686 32 12705 22242 2117 --
NM_000723chr1761543 1391 493 309 255 112 ------
NM_000724chr1031528 1452 380 ------
NM_000726chr231349 1062 251 ------
NM_000729chr31217 ------
NM_000756chr81356 --1403 --
NM_000794chr521060 774 ------
NM_000795chr113906 312 109 --4920 896 377 323 --
NM_000801chr2041130 994 902 198 --1187 --
NM_000806chr551785 1630 1547 117 33 --1564 --
NM_000807chr41284 ------
NM_000809chr4249140 8794 8649 8612 8506 8106 8028 7828 7802 7778 7411 7142 6759 6434 5609 3603 3347 3223 2842 2527 1540 1432 632 441 --88560 7147 6837 6816 6335 5935 3654 1530 67062 6968 5698 5631 2250 2232
NM_000812chr4189 --138 --
NM_000813chr5175329 5296 5011 3810 3519 2129 2113 2104 1855 1847 1772 1696 1632 1166 1054 528 38 15052 34642 2079 372 13607
NM_000814chr1573397 3010 1362 1312 560 523 149 13844 --22698 1098
NM_000816chr52519 172 186 ----
NM_000817chr22984 457 ------
NM_000818chr101474 133 177 --
NM_000820chr13--1242 1106 --
NM_000824chr43385 274 56 ------
NM_000826chr431859 1794 957 22405 2029 12056 --
NM_000827chr562401 2031 1803 1024 824 424 --21711 184 21028 775
NM_000829chr1172044 2017 1941 1929 1742 733 104 ------
NM_000831chr185861 5626 1695 972 805 553 373 205 1715 36234 5530 764 15643
NM_000833chr1661543 1336 1282 1264 1124 380 ----1406
NM_000834chr1271296 346 316 214 206 194 110 ------
NM_000838chr662736 2031 2008 1091 331 238 ----22189 1928
NM_000840chr71455 ------
NM_000842chr11----1654 1205
NM_000844chr321068 803 ------
NM_000859chr531300 584 563 ------
NM_000860chr451489 1139 496 324 112 --21502 662 --
NM_000861chr351907 1029 998 597 572 --42588 1897 1732 719 --
NM_000864chr131122 954 793 ------
NM_000870chr581517 655 632 587 557 519 248 94 --1153 --
NM_000872chr1061443 1321 1070 1003 149 70 ----11366
NM_000875chr15125840 4999 4572 2678 1579 1395 1147 955 634 608 339 152 --87025 5743 4897 1399 1130 811 332 181 26419 2385
NM_000876chr631258 447 376 --11396 --
NM_000883chr72618 119 ------
NM_000883chr72618 119 ------
NM_000891chr1751278 991 919 662 322 12950 63268 3255 2658 1072 585 440 --
NM_000895chr121156 --134 --
NM_000898chrX3775 164 33 --1781 --
NM_000899chr1283505 3094 3000 2719 2687 1705 464 384 --33371 1685 1546 11725
NM_000901chr441923 564 250 121 12571 11702 --
NM_000902chr353081 2822 655 274 217 22042 66 22806 1292 --
NM_000903chr1631530 598 23 11405 1290 --
NM_000905chr7----1126 --
NM_000912chr853418 2757 778 280 32 22838 218 23434 252 12332
NM_000914chr6--198 1138 --
NM_000917chr102875 22 ------
NM_000919chr52545 239 --155 --
NM_000921chr121132 ------
NM_000927chr72421 117 --1576 --
NM_000933chr2041703 1649 317 176 11445 11385 190
NM_000935chr31953 11135 21046 819 --
NM_000938chr4----1139 --
NM_000944chr452212 1780 1771 1654 696 11604 32374 1813 699 --
NM_000945chr261918 1703 1496 540 284 177 --62030 1862 1707 526 111 41 11402
NM_000949chr56780 731 300 151 118 44 ------
NM_000950chrX53547 3377 2417 2302 506 1847 23401 1168 --
NM_000958chr511209 11024 2973 481 --
NM_000961chr2093766 3668 3120 2682 953 706 667 441 130 13189 12580 --
NM_000962chr992742 2302 2058 2025 1999 1243 1041 726 180 1791 42637 2333 928 600 --
NM_000963chr132275 1863 101 --2762 714 --
NM_000965chr311060 --2386 257 --
NM_000966chr123997 931 884 --1341 --
NM_000983chr14522 413 372 342 --21306 491 --
NM_000990chr1172508 1358 1148 1045 142 67 45 1389 33948 3761 3598 1872
NM_001001132chr2131498 1339 264 ------
NM_001001323chr1242867 2135 2108 789 12800 22789 2650 --
NM_001001331chr322478 1860 --22291 166 --
NM_001001344chrX22116 280 --22182 731 --
NM_001001389chr1152261 996 715 686 604 1789 12946 --
NM_001001390chr1152261 996 715 686 604 1789 12946 --
NM_001001391chr1152261 996 715 686 604 1789 12946 --
NM_001001392chr1152307 1042 761 732 650 1835 12992 --
NM_001001395chr1222235 768 11130 2937 757 --
NM_001001396chr1103981 3872 3735 3446 1692 1584 1513 1325 1016 576 --134093 4090 3828 3682 3666 3540 2980 1192 1050 873 868 615 296 --
NM_001001419chr5114506 4302 4086 3732 3555 3497 1974 1791 1645 1624 623 14602 44475 4169 1932 671 --
NM_001001420chr5114506 4302 4086 3732 3555 3497 1974 1791 1645 1624 623 14602 44475 4169 1932 671 --
NM_001001433chr2043142 2649 698 198 22739 524 12947 1486
NM_001001481chr893418 3218 3086 2929 2783 2699 2628 723 328 11092 42740 2702 2546 126 --
NM_001001484chr1082422 1646 959 872 358 296 148 117 --12474 2856 595
NM_001001522chr111432 ------
NM_001001523chr12536 253 21329 998 183 --
NM_001001549chr752883 2568 1904 1791 733 --31909 1795 782 1712
NM_001001550chr752883 2568 1904 1791 733 --31909 1795 782 1712
NM_001001555chr752883 2568 1904 1791 733 --31909 1795 782 1712
NM_001001556chr154594 556 495 85 11571 31137 421 409 --
NM_001001557chr852225 1587 1448 400 342 --1276 --
NM_001001664chr263786 1577 1222 1059 430 171 ------
NM_001001668chr1953371 3158 2842 1220 316 --23185 3132 --
NM_001001709chr92928 80 ------
NM_001001713chr213360 336 23 ------
NM_001001787chr1----2195 187 --
NM_001001790chr9161 --1358 --
NM_001001791chr1021546 280 ------
NM_001001890chr21103991 3475 2998 2980 2941 2877 2864 2853 2764 1110 --34270 4249 2823 12832
NM_001001933chr11179 ------
NM_001001936chr102976 480 11093 21140 999 --
NM_001001938chr9123571 3473 3440 3347 2898 1642 1540 1289 1212 1089 1056 129 --73351 3339 3075 1599 1563 1236 317 --
NM_001001971chr1011167 1516 31237 1094 60 --
NM_001001974chr1022298 1622 --31915 1814 49 --
NM_001001994chrX1562 ------
NM_001001995chrX31515 1444 534 ------
NM_001001996chrX1562 ------
NM_001002027chr17----199 --
NM_001002031chr12----159 --
NM_001002233chr852124 1813 1726 1432 776 --11445 --
NM_001002243chr2----2936 37 --
NM_001002252chr122227 28 ------
NM_001002255chr6------1123
NM_001002269chr91161 ------
NM_001002294chr1----2312 305 --
NM_001002295chr101822 --1447 --
NM_001002296chr85964 457 365 356 80 --198 --
NM_001002762chr1072909 2508 2377 2257 968 522 379 --22635 937 --
NM_001002811chr141491 1222 623 182 ------
NM_001002812chr141491 1222 623 182 ------
NM_001002812chr141491 1222 623 182 ------
NM_001002838chrX41786 403 239 76 --21208 80 11798
NM_001002843chr152847 387 ------
NM_001002860chr14134005 3992 3569 3366 3318 2924 1861 1704 1678 1496 1372 619 517 13545 54597 1880 1683 317 272 14022
NM_001002876chr22----1408 --
NM_001002909chr1781718 1642 1590 1578 769 371 228 207 --31491 750 335 --
NM_001002914chr1741252 1220 825 228 ------
NM_001003652chr18128493 7163 6415 6315 5973 5912 5709 3455 2921 2227 455 49 16220 118412 8247 8173 7879 6831 6133 6129 5581 5578 5335 1501 17308
NM_001003665chr133552 2333 168 --31399 1394 816 --
NM_001003674chr18126049 5133 4704 4695 4687 4546 2560 2025 1148 994 553 447 12516 46560 2314 1632 148 --
NM_001003675chr18126049 5133 4704 4695 4687 4546 2560 2025 1148 994 553 447 12516 46560 2314 1632 148 --
NM_001003676chr114758 267 259 162 ------
NM_001003681chr2261763 1637 1567 1449 258 77 --21911 1486 --
NM_001003688chr431120 822 437 --1803 11194
NM_001003712chr1273910 1256 1208 1119 787 538 411 ------
NM_001003786chr173664 554 118 --1612 --
NM_001003787chr173664 554 118 --1612 --
NM_001003788chr173664 554 118 --1612 --
NM_001003790chr83910 705 627 ----2617 291
NM_001003791chr83910 705 627 ----2617 291
NM_001003792chr31419 --1440 --
NM_001003793chr31419 --1440 --
NM_001003800chr9113288 3134 2681 1510 1326 1220 1163 820 678 572 397 1297 ----
NM_001003805chr14167 ------
NM_001003809chr182342 62 ------
NM_001003810chr42585 346 ------
NM_001003891chr223247 126 84 ------
NM_001003937chr231430 1100 140 --31492 1105 690 --
NM_001003940chr15133819 2981 2761 2540 2508 2396 1253 1175 1049 1010 861 337 287 --2179 136 1650
NM_001003942chr15133819 2981 2761 2540 2508 2396 1253 1175 1049 1010 861 337 287 --2179 136 1650
NM_001003943chr15133823 2985 2765 2544 2512 2400 1257 1179 1053 1014 865 341 291 --2183 140 1654
NM_001004023chr11158 ------
NM_001004051chrX--1304 ----
NM_001004065chr983982 3387 3350 2953 1382 788 634 486 --43032 2510 1039 516 --
NM_001004127chr131635 1820 1127 --
NM_001004196chr311093 ------
NM_001004304chr12103225 3074 1976 1252 1104 1014 928 683 604 553 --1816 --
NM_001004317chr632842 1348 1027 21736 928 11640 23704 29
NM_001004329chr121155 1494 2380 347 --
NM_001004342chr1275813 5602 5351 5076 4747 4621 4565 4387 4201 3747 2148 1874 1483 1423 1032 979 846 813 794 782 767 752 743 715 682 669 277 --61476 1411 771 729 721 699 1646
NM_001004356chr411544 ------
NM_001004358chr411544 ------
NM_001004360chr211410 --21743 283 --
NM_001004419chr12104589 4434 4252 4235 4092 4062 3452 1507 1327 521 --33533 1374 847 14104
NM_001004720chr21104 --2669 243 1960
NM_001004722chr21273 --2838 412 11129
NM_001005158chr31389 ------
NM_001005159chr31389 ------
NM_001005217chr42362 73 --163 --
NM_001005242chr1251591 1366 1357 1072 669 1111 2564 369 --
NM_001005266chr151188 --2486 210 --
NM_001005267chr151188 --2486 210 --
NM_001005268chr151188 --2486 210 --
NM_001005269chr151188 --2486 210 --
NM_001005271chr1741126 275 177 150 --21169 1045 --
NM_001005273chr1741126 275 177 150 --21169 1045 --
NM_001005335chr19----2100 46 154
NM_001005366chr124768 621 395 185 ------
NM_001005368chr10252 25 --1143 --
NM_001005375chrY51885 1473 1395 255 95 ------
NM_001005386chr231882 851 605 --1458 3688 253 50
NM_001005404chr17113752 3603 3502 3189 3010 1222 1144 971 541 223 59 --53666 3658 3241 3221 1078 --
NM_001005463chr1092087 1845 998 861 841 652 245 228 193 ------
NM_001005473chr5116497 6448 6306 5299 5194 4999 4890 2600 2372 1475 151 26349 318 55213 5187 2435 2284 2110 --
NM_001005474chr3----1184 --
NM_001005527chr331207 320 230 --3924 402 386 --
NM_001005612chrX1185 1149 140 --
NM_001005746chr231349 1062 251 ------
NM_001005747chr231349 1062 251 ------
NM_001005753chr282151 2062 1703 1440 789 662 130 37 11677 22066 1901 --
NM_001005781chr21426 ------
NM_001005782chr23875 220 38 ------
NM_001005845chr841688 201 189 33 1368 136 --
NM_001005849chr17------2151 120
NM_001006115chr352754 2125 1893 1746 828 --3313 110 33 --
NM_001006605chr121129 947 --11116 --
NM_001006605chr121129 947 --11116 --
NM_001006610chr16--1769 1860 1383
NM_001006612chrX1380 --174 --
NM_001006613chrX1380 --174 --
NM_001006614chrX1380 --174 --
NM_001006617chr951303 940 911 529 334 --21264 393 --
NM_001006619chr951303 940 911 529 334 --21264 393 --
NM_001006620chr951303 940 911 529 334 --21264 393 --
NM_001006621chr951303 940 911 529 334 --21264 393 --
NM_001006623chr272472 2277 2223 1717 361 331 311 2753 133 --1834
NM_001006636chr22885 366 ------
NM_001006656chr1941695 1498 558 541 --2526 84 --
NM_001006657chr2102738 2534 2249 2109 1040 900 889 599 498 308 --1234 2581 461
NM_001006665chr13764 508 188 ------
NM_001006684chrX1124 --1407 --
NM_001006938chrX179 2590 570 1500 --
NM_001007024chr1773926 3459 3114 3091 1721 958 428 --64238 3916 3734 3586 1507 178 --
NM_001007025chr1773926 3459 3114 3091 1721 958 428 --64238 3916 3734 3586 1507 178 --
NM_001007067chr82342 46 1674 21059 999 2793 257
NM_001007068chr82342 46 1674 21059 999 2793 257
NM_001007069chr82342 46 1674 21059 999 2793 257
NM_001007070chr82342 46 1674 21059 999 2793 257
NM_001007097chr9144098 4076 4021 3974 3828 3158 1830 1792 1582 1166 690 614 323 266 11680 64025 3872 3838 3821 3502 1357 --
NM_001007098chr15859 318 299 230 116 1193 ----
NM_001007099chr12746 622 --1762 --
NM_001007100chr12746 622 --1762 --
NM_001007102chr631501 1429 357 --31467 1177 619 --
NM_001007156chr1591884 1641 1518 737 644 452 326 222 85 --1674 --
NM_001007226chr1741261 1030 1010 436 ----11427
NM_001007227chr1741261 1030 1010 436 ----11427
NM_001007228chr1741261 1030 1010 436 ----11427
NM_001007229chr1741261 1030 1010 436 ----11427
NM_001007230chr1741261 1030 1010 436 ----11427
NM_001007237chr132565 1937 384 --42736 2191 403 57 --
NM_001007245chr71184 ------
NM_001007246chr2131896 1535 120 --21202 628 --
NM_001007267chr21132 ------
NM_001007277chr113776 426 252 ------
NM_001007464chr6----1120 --
NM_001007466chr6104915 4456 1963 1914 1841 1590 1484 1178 996 842 11328 35031 310 302 --
NM_001007471chr93673 79 53 ------
NM_001007527chr51668 ----188
NM_001007538chr1321215 1169 11750 31561 1537 106 126
NM_001007544chr1--134 1505 --
NM_001007553chr141190 1011 443 146 --1437 --
NM_001007559chr181490 1838 ----
NM_001007793chr10168 --1101 125
NM_001007794chr13689 582 540 ------
NM_001008220chr551035 706 651 546 303 13554 23822 549 --
NM_001008222chrX51168 1057 1002 890 536 --11335 --
NM_001008225chr74577 223 172 125 ----174
NM_001008239chr18103511 3394 3297 2354 1412 701 558 144 53 46 11011 3302 211 23 --
NM_001008272chr32291 95 ------
NM_001008273chr32291 95 ------
NM_001008388chr45397 134 106 91 21 --1816 --
NM_001008391chr115283 211 201 177 159 ------
NM_001008392chr3113573 3390 3000 2820 2736 2709 2623 1344 1278 992 798 --2950 304 --
NM_001008408chr7146203 5796 5617 5308 3932 2428 2269 1519 1457 1022 467 439 222 53 --36177 4824 831 12236
NM_001008410chr251525 1397 798 752 608 2830 808 ----
NM_001008495chr832187 1538 513 --31735 1514 826 32015 1520 870
NM_001008539chr8124422 4235 4207 4080 3975 1758 1632 1305 1019 952 731 713 23397 1551 55302 5065 1981 1280 1099 --
NM_001008541chr1042272 1799 320 95 1535 31940 1776 326 --
NM_001008541chr1042272 1799 320 95 1535 31940 1776 326 --
NM_001008564chr132401 145 ------
NM_001008660chr114979 532 445 111 1374 21413 1409 --
NM_001008701chr19102977 2755 2494 2477 1195 1179 1019 613 504 435 --62897 2847 2803 2740 874 602 --
NM_001008708chr23592 565 490 ------
NM_001008723chr102394 204 ------
NM_001008726chr1421617 409 ----11733
NM_001008738chr552897 2427 2345 1032 482 ------
NM_001008777chr171610 --1210 --
NM_001008860chr152694 582 --1617 --
NM_001008892chr152694 582 --1617 --
NM_001008894chr152694 582 --1617 --
NM_001008925chr493438 3231 3124 1146 947 928 655 239 59 1665 12737 1416
NM_001008938chr112388 173 --1370 --
NM_001009185chr51259 --2623 567 1161
NM_001009554chr464577 4183 3951 2909 1502 1380 13432 43889 1760 432 370 23976 457
NM_001009554chr464577 4183 3951 2909 1502 1380 13432 43889 1760 432 370 23976 457
NM_001009555chr43508 355 24 --11269 --
NM_001009565chr21442 --123 --
NM_001009566chr151063 961 529 520 222 ------
NM_001009569chr1021229 119 --2607 523 --
NM_001009571chr771735 1597 1563 1487 1114 376 235 11173 41714 1569 654 190 --
NM_001009899chr3166436 5839 5393 5372 5294 5085 4617 4500 4480 4391 4068 2509 870 689 628 131 22347 1238 54981 1976 1963 1876 1733 --
NM_001009923chr20----1580 1691
NM_001009955chr1----1447 --
NM_001009955chr1----1447 --
NM_001009959chr251962 903 598 534 394 11698 32509 2468 869 --
NM_001009993chr2114326 3733 3662 3475 1662 1601 1131 939 818 498 465 --64277 3057 2880 969 790 99 --
NM_001010853chr61918 1457 22528 512 1477
NM_001010854chr141716 --1182 --
NM_001010857chr1----1107 --
NM_001010861chr162774 2689 2642 2487 2204 305 --32741 1718 712 --
NM_001010862chrX63106 2683 2599 2146 1101 92 --22605 199 --
NM_001010867chr1126682 6273 5949 5832 5799 5771 2321 2231 1973 964 641 200 --21964 1596 --
NM_001010876chr6162 ------
NM_001010888chrX64095 3739 3285 3014 1298 167 23799 266 63707 3494 1577 1210 388 382 33891 3711 1632
NM_001010891chr576934 6505 6439 6261 6250 5648 2006 11682 12130 --
NM_001010895chr941447 520 497 48 --21999 689 --
NM_001010908chr10----1644 --
NM_001010924chr1031199 456 51 --11211 --
NM_001010927chr6133 --1568 --
NM_001010971chr13835 298 216 ------
NM_001010984chr152468 988 909 820 542 1812 1280 --
NM_001010986chrX41831 399 392 126 --21982 637 --
NM_001011513chr484017 3007 2703 2591 1529 931 923 347 12904 53782 2931 1636 1633 1111 13165
NM_001011537chr332015 461 266 --1542 --
NM_001011546chr20149 ------
NM_001011553chr7--1400 --1758
NM_001011645chrX284 56 --1171 1109
NM_001011666chr7146360 6123 6093 5472 4732 4718 2098 1632 1573 662 579 233 109 55 25869 4763 55044 4710 1964 1790 610 --
NM_001011708chr262763 2745 1174 1161 1078 347 22808 2027 31954 1126 797 --
NM_001011713chr1421383 342 --21163 638 --
NM_001011720chr82304 167 ----1388
NM_001011885chr1511323 ------
NM_001012264chr145770 733 699 690 84 1182 3671 607 240 --
NM_001012267chr921495 1488 1639 ----
NM_001012333chr112320 253 ------
NM_001012334chr112320 253 ------
NM_001012393chr11165046 4655 4089 3913 3365 2064 2042 1494 1397 1349 955 946 624 597 321 292 24848 1608 74563 3532 2048 1706 1309 890 284 --
NM_001012398chr162958 744 --1895 --
NM_001012410chr3----2488 460 --
NM_001012415chr92215 86 ------
NM_001012420chr1542349 2295 1990 1174 11019 21109 984 22638 734
NM_001012423chr1532349 2295 1174 11019 21109 984 22638 734
NM_001012426chr653200 3103 1174 949 897 13421 33148 1049 923 12740
NM_001012427chr653200 3103 1174 949 897 13421 33148 1049 923 12740
NM_001012514chr251094 962 907 830 453 --3136 45 37 --
NM_001012516chr251094 962 907 830 453 --3136 45 37 --
NM_001012642chr1562023 1790 1659 506 154 29 12107 11998 --
NM_001012732chr431093 1007 148 146 ----
NM_001012751chr1051607 1260 777 708 425 11317 11293 --
NM_001012755chrX105074 4669 4569 3185 1571 1094 1060 983 296 182 45080 3198 1123 103 14388 34340 4076 285
NM_001012968chrX62687 1821 814 488 461 346 12714 62235 1937 1758 949 664 329 11104
NM_001012977chrX81169 500 483 320 284 191 175 154 --1205 --
NM_001012979chrX----129 --
NM_001012989chrX154 --158 --
NM_001012993chr951380 1273 431 420 283 --41318 1187 1156 834 --
NM_001013031chr1052621 1303 863 402 115 --3453 247 244 11070
NM_001013406chr711391 ----11730
NM_001013415chr431425 1062 635 --1311 --
NM_001013438chr31270 --1940 --
NM_001013439chr31116 --1786 --
NM_001013620chr12128277 5908 2361 2097 1899 1874 1732 1509 859 806 504 350 38361 3125 709 36289 1736 1590 1727
NM_001013635chr1241183 1168 1157 286 --21045 861 --
NM_001013690chr1262396 2045 1770 776 395 386 --51740 1617 1541 461 406 22372 2170
NM_001013699chr12------1464
NM_001013739chr71281 ------
NM_001013843chr151144 ------
NM_001014286chr13----125 --
NM_001014336chr122379 90 --1232 --
NM_001014380chr13115816 4895 4365 4173 4011 2134 2004 1676 976 735 329 15532 31699 653 566 15319
NM_001014431chr143972 120 88 ------
NM_001014432chr143972 120 88 ------
NM_001014434chr12641 34 1191 138 1100
NM_001014435chr163429 87 41 ------
NM_001014764chr171164 ------
NM_001014797chr10117740 7198 5586 5520 5476 3152 3024 2259 2183 2177 1048 11220 87916 7408 7232 1145 509 500 275 200 --
NM_001014831chr191626 --1263 --
NM_001014832chr191626 --1263 --
NM_001014834chr191626 --1263 --
NM_001014835chr191626 --1263 --
NM_001015048chr1462934 2477 2186 930 755 240 21247 593 33068 1195 1143 --
NM_001015049chr1462934 2477 2186 930 755 240 21247 593 33068 1195 1143 --
NM_001015053chr1731230 1119 266 1130 21264 569 --
NM_001015508chr82701 101 --1710 --
NM_001015877chrX62246 2050 1968 1138 659 641 12157 53078 3004 1025 814 489 1387
NM_001015880chr1061651 1265 1132 494 458 421 ------
NM_001015881chrX2455 362 ------
NM_001015882chr93947 736 111 ------
NM_001015887chr351518 1482 1158 318 97 1515 11403 --
NM_001017365chr1----153 --
NM_001017366chr1----153 --
NM_001017367chr1----153 --
NM_001017371chr211085 --11074 --
NM_001017395chr393141 3075 2974 1353 1298 812 531 239 145 32781 2714 267 33221 2490 899 --
NM_001017396chr261877 1487 1378 765 707 436 --11982 --
NM_001017405chr44967 356 267 66 ------
NM_001017424chr121857 524 149 1270 11505
NM_001017425chr121857 524 149 1270 11505
NM_001017440chr7247645 7612 6998 6700 6551 6250 6239 6054 6018 5909 5757 5471 3177 2819 2729 2237 1680 1627 1169 847 828 734 508 71 16834 77988 7559 5701 2577 2511 2491 2343 16571
NM_001017523chr1231782 1738 1586 --31896 1478 1323 --
NM_001017916chr1782042 1789 1712 1508 1390 178 167 39 11571 51511 1404 813 679 603 --
NM_001017917chr1782042 1789 1712 1508 1390 178 167 39 11571 51511 1404 813 679 603 --
NM_001017926chr851819 1762 1409 1152 36 ----21241 271
NM_001017962chr102875 22 ------
NM_001017963chr142967 898 --148 --
NM_001017973chr5----174 --
NM_001017974chr5----174 --
NM_001017999chr172291 1961 1890 1694 391 376 302 --12153 12024
NM_001017999chr172291 1961 1890 1694 391 376 302 --12153 12024
NM_001018000chr172291 1961 1890 1694 391 376 302 --12153 12024
NM_001018000chr172291 1961 1890 1694 391 376 302 --12153 12024
NM_001018001chr172291 1961 1890 1694 391 376 302 --12153 12024
NM_001018025chrX2254 35 --1693 --
NM_001018037chr92488 210 --41407 1300 539 320 --
NM_001018050chr2283400 2566 2452 2402 2135 1372 687 332 1353 11121 --
NM_001018052chr2283400 2566 2452 2402 2135 1372 687 332 1353 11121 --
NM_001018053chr181859 1800 1330 548 520 373 334 156 1669 31902 1544 1261 --
NM_001018054chr111024 --21229 1068 11258
NM_001018056chr9192 --196 --
NM_001018064chr942140 1782 1589 167 --2241 214 --
NM_001018065chr9175905 5685 5631 5443 5433 5297 4895 3956 3875 3739 3721 1667 1422 1375 843 572 544 --35080 3961 420 14778
NM_001018066chr9175905 5685 5631 5443 5433 5297 4895 3956 3875 3739 3721 1667 1422 1375 843 572 544 --35080 3961 420 14778
NM_001018067chr184889 4511 3509 1256 1247 1026 865 263 --34830 2109 31 --
NM_001018068chr184889 4511 3509 1256 1247 1026 865 263 --34830 2109 31 --
NM_001018069chr184889 4511 3509 1256 1247 1026 865 263 --34830 2109 31 --
NM_001018072chr1231782 1738 1586 --31896 1478 1323 --
NM_001018074chr523457 1324 --21099 344 22474 535
NM_001018075chr523457 1324 --21099 344 22474 535
NM_001018076chr523457 1324 --21099 344 22474 535
NM_001018077chr523457 1324 --21099 344 22474 535
NM_001018091chr1562901 2183 960 694 652 98 --1433 12339
NM_001018100chr153694 290 67 ------
NM_001018108chr15102155 1901 1566 783 700 595 588 276 155 77 1471 2861 687 1789
NM_001018111chr763393 2519 1435 912 711 554 13589 63599 3526 3068 1400 976 189 --
NM_001020658chr121487 1366 ------
NM_001020658chr121487 1366 ------
NM_001023567chr1521787 576 1212 1992 --
NM_001023587chr361177 851 845 759 714 199 1987 148 --
NM_001024024chr141272 --2763 168 --
NM_001024070chr141268 --2759 164 --
NM_001024094chr523457 1324 --21099 344 22474 535
NM_001024218chr144850 650 562 322 --1230 --
NM_001024226chr1128 --1936 --
NM_001024227chr1128 --1936 --
NM_001024228chr1128 --1936 --
NM_001024401chr1662843 2813 2269 2063 1897 1038 12883 22449 2071 --
NM_001024455chrX112449 2196 2176 2141 1702 1066 968 951 835 389 362 --42692 2454 1903 767 --
NM_001024463chr156849 401 366 257 154 55 --1738 --
NM_001024465chr6--161 ----
NM_001024601chr1136 ------
NM_001024649chr5102889 2302 2196 1834 932 912 895 883 857 542 --32960 1019 34 11925
NM_001024660chr341523 1217 1117 108 ------
NM_001024666chrX1448 ------
NM_001024668chr122794 667 --1176 --
NM_001024680chr241521 1466 1229 1165 ------
NM_001024808chr1252361 2015 892 862 402 1321 52206 1904 982 822 86 12637
NM_001024847chr381643 1627 952 932 688 612 499 228 11531 ----
NM_001024855chr331904 155 69 --11435 --
NM_001024858chr14122759 2502 2014 1993 1111 806 682 397 303 284 239 71 --12417 --
NM_001024934chr65473 126 104 63 47 ------
NM_001024935chr65473 126 104 63 47 ------
NM_001024936chr65473 126 104 63 47 ------
NM_001024937chr174482 289 197 180 1593 ----
NM_001024948chr163488 3293 3146 2391 1272 708 ----1430
NM_001025068chr34288 143 133 82 --1660 --
NM_001025069chr34288 143 133 82 --1660 --
NM_001025076chr10175923 5238 4799 4691 4657 4385 4272 2451 2443 2386 2364 1711 1669 1389 1108 581 392 11545 64980 4339 3958 3830 2214 1288 25524 4044
NM_001025077chr10207281 6596 6157 6049 6015 5743 5630 3027 2747 2466 1939 1750 1389 1325 1225 1051 949 272 249 221 12903 56338 5697 5316 5188 2646 26882 5402
NM_001025079chr3153727 3538 3489 3357 2920 2707 2674 2654 2545 2525 1510 1309 1107 939 778 --53501 3143 2556 907 700 --
NM_001025081chr1861327 1181 1144 1032 478 244 --1455 --
NM_001025090chr1861327 1181 1144 1032 478 244 --1455 --
NM_001025092chr1861327 1181 1144 1032 478 244 --1455 --
NM_001025101chr1861327 1181 1144 1032 478 244 --1455 --
NM_001025105chr521389 57 --41413 1380 1022 984 --
NM_001025107chr1122711 2490 2436 2153 2048 1753 855 705 499 479 100 71 11671 2337 302 12537
NM_001025107chr1122711 2490 2436 2153 2048 1753 855 705 499 479 100 71 11671 2337 302 12537
NM_001025108chr232965 1079 119 13315 42684 1270 1192 878 1633
NM_001025201chr21744 --2526 516 --
NM_001025202chr71281 ------
NM_001025233chr1252757 2432 2042 623 68 --21849 423 --
NM_001025252chr843120 2671 1217 424 1358 32271 371 125 1214
NM_001025253chr843120 2671 1217 424 1358 32271 371 125 1214
NM_001025266chr3134886 4836 4666 4397 3558 3044 1391 1275 920 487 358 157 69 --24310 3359 --
NM_001025356chr1292550 2189 2025 1930 1908 1173 430 394 126 1369 22011 1965 --
NM_001025366chr621709 603 --11519 --
NM_001025366chr621709 603 --11519 --
NM_001025367chr621709 603 --11519 --
NM_001025367chr621709 603 --11519 --
NM_001025368chr621709 603 --11519 --
NM_001025368chr621709 603 --11519 --
NM_001025369chr621725 619 --11535 --
NM_001025369chr621725 619 --11535 --
NM_001025370chr621709 603 --11519 --
NM_001025370chr621709 603 --11519 --
NM_001025389chr1151630 1078 616 491 357 --2270 93 --
NM_001025390chr1151630 1078 616 491 357 --2270 93 --
NM_001025579chr1721130 972 1467 2863 289 --
NM_001025580chrX114120 4034 4027 3741 1700 989 464 373 354 331 259 13719 33632 3028 398 --
NM_001025595chr441596 1557 1110 237 --31386 1118 223 --
NM_001025596chr113206 127 38 --1471 --
NM_001025603chr151355 1044 473 458 117 21319 945 11019 --
NM_001025777chr23515 378 231 --11108 21035 256
NM_001025780chr911376 1581 134 --
NM_001029858chr652948 2720 2117 941 891 1621 42224 2154 539 507 --
NM_001029859chr1142413 2269 312 174 ------
NM_001029863chr631195 1129 615 1803 32629 2174 1158 --
NM_001029871chr20141805 740 568 329 316 292 280 236 208 191 113 100 89 73 --2271 241 2395 184
NM_001029875chr582615 2594 2457 2235 1922 1168 1117 117 --21172 528 12136
NM_001029882chr1193 --1596 --
NM_001029882chr1193 --1596 --
NM_001029955chr473366 3281 2722 1269 569 477 209 --1233 --
NM_001029976chr82150 53 --142 --
NM_001029998chr481461 1350 1338 1005 576 549 524 461 ------
NM_001030001chr141326 ------
NM_001030006chr1772416 2156 878 772 696 614 538 --22625 777 --
NM_001030007chr1693805 3629 3156 2951 1285 1111 774 443 183 --52983 2542 2470 411 235 13721
NM_001030019chr7159 ------
NM_001030055chr1444728 4031 986 146 --21179 125 --
NM_001030272chr111419 1436 ----
NM_001030273chr111419 1436 ----
NM_001030287chr1----1869 --
NM_001031677chr53483 344 65 --1407 --
NM_001031679chr1273479 2758 1247 557 523 359 235 --1132 12853
NM_001031690chr7152827 2776 2461 2391 2245 2116 2061 2040 1222 1127 961 833 411 356 132 --32571 983 450 --
NM_001031694chr13905 697 265 --1618 154
NM_001031694chr13905 697 265 --1618 154
NM_001031695chr22135328 5076 4984 4926 4712 4458 4128 3934 3851 1869 812 619 488 31422 1245 831 54465 3918 1512 825 599 2481 192
NM_001031700chr431848 1825 894 --42311 1831 1708 635 1228
NM_001031702chr3187 1652 ----
NM_001031710chr721020 163 ------
NM_001031716chr21324 199 1112 --
NM_001031723chr41461 1160 ----
NM_001031732chr4103609 3504 2891 2783 2768 2438 2261 1077 544 272 --23641 332 --
NM_001031738chr23435 117 54 ----1457
NM_001031804chr1674420 3660 2760 1226 1146 647 385 12995 94213 3644 2858 2765 1033 1022 635 442 439 13522
NM_001031812chr53557 474 415 --21879 310 1182
NM_001031855chrX159 ------
NM_001032221chr941530 1441 1350 162 --21657 81 --
NM_001032279chr113373 294 284 ------
NM_001032280chr631686 1338 1194 --31177 636 604 --
NM_001032282chr81487 --21091 242 1367
NM_001032283chr121408 ------
NM_001032284chr121408 ------
NM_001032289chrX3334 204 193 ------
NM_001032296chr1382725 2278 2015 1871 912 838 59 42 12852 32804 754 35 --
NM_001032363chr181875 1592 1534 906 856 479 254 53 --31557 179 93 --
NM_001032363chr181875 1592 1534 906 856 479 254 53 --31557 179 93 --
NM_001032380chr1061308 1231 493 443 224 130 ----11482
NM_001032393chrX3717 167 148 --1779 --
NM_001032394chr631939 534 307 --22637 1023 --
NM_001032395chr631806 401 174 --22504 890 --
NM_001032999chr20165385 4749 4514 4453 3800 3411 1729 1331 1257 1163 1092 957 913 711 528 201 --34117 801 258 --
NM_001033025chr161252 1242 1228 1216 506 202 --1359 11524
NM_001033045chr274158 4075 3988 3853 3833 1158 120 1262 13492 --
NM_001033047chr462348 2247 2174 2059 64 44 --12275 12459
NM_001033049chr2162252 1516 929 777 558 326 1730 32303 1632 934 --
NM_001033057chr331839 1832 1785 11751 22041 332 1366
NM_001033059chr692002 1550 1442 648 639 548 336 223 206 11503 ----
NM_001033087chr2072730 2261 2157 1323 677 551 136 1124 22894 270 22696 203
NM_001033088chr152394 340 ------
NM_001033117chr3154925 4852 4789 4695 4554 4523 4483 4302 4290 4039 3571 3549 1480 491 331 --84686 4043 3927 3885 3658 3497 1613 318 14805
NM_001033506chr11--127 ----
NM_001033507chr131505 1490 708 ------
NM_001033551chr1742754 1105 328 255 --1185 --
NM_001033557chr221157 38 --21300 1296 --
NM_001033561chr178828 797 785 774 720 297 178 168 ------
NM_001033576chr1772741 2655 2516 2203 1753 160 144 11789 21739 763 --
NM_001033578chr822387 2070 --1954 22171 148
NM_001033659chr1711501 --21457 1443 --
NM_001033723chr862478 1989 1792 947 744 245 --12181 11973
NM_001033756chr621643 537 --11453 --
NM_001033756chr621643 537 --11453 --
NM_001033910chr162171 1759 1731 637 212 119 --1278 --
NM_001033925chr1031875 1747 1341 1165 --1545
NM_001033952chr112244 110 --173 --
NM_001033953chr112131 45 ------
NM_001034025chr12--155 1882 --
NM_001034837chr52624 136 1660 3210 207 200 --
NM_001034838chr52624 136 1660 3210 207 200 --
NM_001034845chr43462 300 93 ------
NM_001034850chr521302 427 11521 11308 11057
NM_001034852chr141234 --22044 409 --
NM_001034853chrX2961 745 ------
NM_001034954chr1043194 2016 1101 427 --12973 --
NM_001034955chr1043194 2016 1101 427 --12973 --
NM_001034956chr1043194 2016 1101 427 --12973 --
NM_001034957chr1043194 2016 1101 427 --12973 --
NM_001035chr131196 311 159 --2292 65 --
NM_001035003chr44926 910 284 186 ------
NM_001035004chr44926 910 284 186 ------
NM_001035005chr18164 --2649 207 --
NM_001035254chr972459 2396 2256 962 830 557 229 --22508 40 --
NM_001035260chr1021509 455 1488 --1216
NM_001035511chr192136 2125 1874 1447 713 596 343 218 166 21849 1470 22035 1757 --
NM_001035512chr1102243 2232 1981 1554 820 703 450 325 273 114 21956 1577 22142 1864 --
NM_001035513chr1102243 2232 1981 1554 820 703 450 325 273 114 21956 1577 22142 1864 --
NM_001035521chr2--1796 --1670
NM_001037131chr241005 440 373 219 ------
NM_001037132chr721477 230 1448 32139 2034 282 134
NM_001037133chr721477 230 1448 32139 2034 282 134
NM_001037164chr731784 476 199 --141 --
NM_001037165chr7138925 8108 7666 7528 6558 6524 5530 3132 2474 2453 1820 1041 271 13017 25535 245 16599
NM_001037174chr261900 1779 614 248 234 184 11825 3834 603 356 --
NM_001037317chr162774 2689 2642 2487 2204 305 --32741 1718 712 --
NM_001037331chr182359 304 --1202 --
NM_001037332chr572252 1835 776 518 299 257 194 ------
NM_001037333chr572252 1835 776 518 299 257 194 ------
NM_001037334chr1872402 2062 1740 898 792 426 298 ------
NM_001037339chr161804 1624 675 629 542 370 --11461 --
NM_001037340chr161804 1624 675 629 542 370 --11461 --
NM_001037341chr161804 1624 675 629 542 370 --11461 --
NM_001037341chr161804 1624 675 629 542 370 --11461 --
NM_001037494chr12----1242 1259
NM_001037495chr12----1242 1259
NM_001037533chr12255 221 ----1260
NM_001037535chrX31472 1436 404 --1522 1539
NM_001037536chrX31472 1436 404 --1522 1539
NM_001037540chrX31472 1436 404 --1522 1539
NM_001037553chr2164880 4772 1906 753 562 384 --35157 4448 310 13572
NM_001037582chr411705 ------
NM_001037738chr5--1111 1198 --
NM_001037872chr21530 ------
NM_001037954chr11102989 2639 2518 1185 892 756 678 649 225 154 --1719 --
NM_001038493chr231098 1041 571 11478 ----
NM_001038640chr15--2280 86 --144
NM_001038702chr521879 117 --12787 --
NM_001038707chr131711 682 614 22244 294 22213 649 --
NM_001038707chr131711 682 614 22244 294 22213 649 --
NM_001039029chr1221859 151 ------
NM_001039199chr2064878 4836 3334 3150 1174 38 24022 850 84518 4204 4009 3814 3154 3049 1789 1656 13825
NM_001039348chr24906 727 312 232 ----11098
NM_001039349chr24906 727 312 232 ----11098
NM_001039350chr711226 --21384 692 --
NM_001039395chr952340 2310 709 698 610 --1440 1955
NM_001039459chr75744 461 325 200 95 ------
NM_001039479chr1452044 1554 970 471 277 1895 ----
NM_001039538chr273614 3314 2559 2282 1297 922 818 11333 33574 2715 795 13217
NM_001039570chr2274115 3529 3473 1309 431 191 101 1403 34093 692 78 --
NM_001039571chr2274115 3529 3473 1309 431 191 101 1403 34093 692 78 --
NM_001039574chr14935 691 684 283 ------
NM_001039577chr173958 3522 2873 1757 1643 175 148 --21501 282 --
NM_001039583chr222514 131 ------
NM_001039584chr222514 131 ------
NM_001039585chr153742 3475 3463 1025 202 11636 21231 966 198
NM_001039590chrX53205 1524 1163 1030 830 21019 401 12944 --
NM_001039591chrX53205 1524 1163 1030 830 21019 401 12944 --
NM_001039618chr1184751 4153 3771 2224 1108 540 482 232 --13902 15016
NM_001039690chr1651897 874 211 169 152 12048 11715 --
NM_001039709chr20165385 4749 4514 4453 3800 3411 1729 1331 1257 1163 1092 957 913 711 528 201 --34117 801 258 --
NM_001039711chr11892 179 2886 841 --
NM_001039712chr11892 179 2886 841 --
NM_001039762chr1051948 1744 1677 1558 642 --12251 --
NM_001039771chr1451019 952 886 804 434 --150 --
NM_001039772chr11163 ------
NM_001039802chr141365 1234 1039 431 ------
NM_001039840chrX115922 5533 5066 4324 4264 4016 2309 1525 1287 958 84 11182 64589 2376 2342 1676 962 126 23728 1278
NM_001039888chr14791 727 662 560 ------
NM_001039916chr1271012 471 170 156 138 83 53 11040 ----
NM_001039917chr1271012 471 170 156 138 83 53 11040 ----
NM_001039918chr1271012 471 170 156 138 83 53 11040 ----
NM_001039919chr1271012 471 170 156 138 83 53 11040 ----
NM_001039920chr1271012 471 170 156 138 83 53 11040 ----
NM_001039937chr13154164 3874 3193 3054 2999 2911 2736 2704 2683 2546 841 245 168 139 38 --33680 2930 2860 1862
NM_001039960chr1251481 1316 1124 445 332 11264 61750 1321 1255 322 269 249 --
NM_001040001chr692064 2037 1550 1376 1324 1272 652 634 333 1484 ----
NM_001040002chr1731174 1067 84 --1483 --
NM_001040057chr7----1203 --
NM_001040058chr4293 23 ------
NM_001040060chr4293 23 ------
NM_001040092chr8------1159
NM_001040100chr341055 959 926 84 1117 ----
NM_001040101chr431342 439 378 1252 --11175
NM_001040108chr1453317 3302 2019 1205 475 1553 53311 2540 2412 2110 1255 1532
NM_001040110chr721364 1270 --11753 --
NM_001040142chr22950 918 --12014 1523
NM_001040143chr22950 918 --12014 1523
NM_001040144chr1651897 874 211 169 152 12048 11715 --
NM_001040146chr1651897 874 211 169 152 12048 11715 --
NM_001040147chr182242 113 --199 1708
NM_001040151chr11154389 4261 3769 3680 3662 3629 3120 3090 2996 2904 2893 2884 854 820 311 13027 43996 3271 2932 824 11456
NM_001040152chr755078 3299 1705 1270 341 13852 25095 3798 1191
NM_001040157chr432641 878 568 --1248 12891
NM_001040159chr42201 76 ------
NM_001040167chr711187 --21104 379 --
NM_001040172chr581517 655 632 587 557 519 248 94 --1153 --
NM_001040173chr581517 655 632 587 557 519 248 94 --1153 --
NM_001040181chr32963 804 11010 1734 --
NM_001040182chr32963 804 11010 1734 --
NM_001040183chr32963 804 11010 1734 --
NM_001040199chr32963 804 11010 1734 --
NM_001040200chr32963 804 11010 1734 --
NM_001040202chr442052 1827 1668 320 1539 2554 104 --
NM_001040214chr682312 1883 1745 837 418 346 276 207 ----1622
NM_001040260chr42896 391 11099 21029 433 --
NM_001040261chr42896 391 11099 21029 433 --
NM_001040272chr94456 447 285 81 12346 21664 178 1551
NM_001040273chr1082097 2065 1841 1325 650 462 424 359 12110 ----
NM_001040284chr16155846 5587 5273 5175 5137 4591 4125 3923 1311 1093 964 691 603 304 27 11064 2934 746 --
NM_001040402chr441017 782 179 97 22916 2460 32798 2572 793 1805
NM_001040429chr1342530 2259 1443 43 --11204 --
NM_001040439chr161542 1102 ----
NM_001040441chr1104138 3349 2055 1596 1562 1279 1266 1161 269 249 15121 ----
NM_001040446chr572092 2033 945 686 604 356 347 --1833 --
NM_001040450chr1542305 1887 378 335 11846 12285 --
NM_001040453chr1542305 1887 378 335 11846 12285 --
NM_001040455chr1161303 1239 483 415 289 47 --1255 --
NM_001040458chr52607 479 --1271 --
NM_001040619chr131183 1029 224 --31319 131 70 --
NM_001040624chr8102450 2338 2322 2173 2082 2066 1913 1878 1862 135 --22071 56 --
NM_001040625chr8102450 2338 2322 2173 2082 2066 1913 1878 1862 135 --22071 56 --
NM_001040626chr8102450 2338 2322 2173 2082 2066 1913 1878 1862 135 --22071 56 --
NM_001040627chr8102450 2338 2322 2173 2082 2066 1913 1878 1862 135 --22071 56 --
NM_001040628chr8102450 2338 2322 2173 2082 2066 1913 1878 1862 135 --22071 56 --
NM_001040629chr8102450 2338 2322 2173 2082 2066 1913 1878 1862 135 --22071 56 --
NM_001040630chr8102450 2338 2322 2173 2082 2066 1913 1878 1862 135 --22071 56 --
NM_001040633chr72697 126 ------
NM_001040647chr731783 484 268 --1553 1784
NM_001040648chr731783 484 268 --1553 1784
NM_001040653chr362523 1926 274 240 76 39 --11750 --
NM_001040665chr7115034 4855 4451 4365 4249 4164 3990 1895 1680 1451 151 13091 41727 1461 1199 511 13514
NM_001040666chr74736 557 153 67 ------
NM_001040694chr112347 140 ------
NM_001040697chr111513 ------
NM_001040708chr821030 377 --1972 --
NM_001040709chr1102456 2348 2281 2126 1885 1632 948 898 819 548 --32133 973 74 1736
NM_001040712chr953209 2526 987 807 61 --13256 --
NM_001042353chr204583 395 377 370 182 1408 --
NM_001042355chr16104929 4305 4067 3836 3646 1871 1764 1161 503 367 1822 44671 4220 3923 2144 14310
NM_001042370chr1------1231
NM_001042383chr3143353 2894 2787 2637 2491 2446 2314 1375 1361 1129 1106 567 242 196 12286 42390 1311 1273 169 12503
NM_001042388chr185846 762 352 311 228 --1109 --
NM_001042403chr12124 1289 ----
NM_001042404chr13405 173 124 ------
NM_001042406chr61128 11163 1903 --
NM_001042412chr16104929 4305 4067 3836 3646 1871 1764 1161 503 367 1822 44671 4220 3923 2144 14310
NM_001042413chr943732 1444 1102 193 14071 3567 529 199 --
NM_001042424chr4112743 2580 2413 2288 763 649 634 558 480 345 269 --13093 --
NM_001042425chr631686 1338 1194 --31177 636 604 --
NM_001042453chrX31368 1323 658 1535 ----
NM_001042459chr3156 ------
NM_001042473chr1021677 1408 --21907 767 --
NM_001042475chr6----1314 --
NM_001042476chr1682193 1971 1785 1749 1634 368 322 83 --11827 --
NM_001042481chr1472566 2066 995 658 493 446 94 --12179 --
NM_001042486chr2051527 1389 1218 412 77 --2462 249 --
NM_001042492chr1783457 3443 3289 1130 1123 895 766 391 --13320 1208
NM_001042494chr1563807 3630 3578 3416 1274 583 21333 823 3899 753 660 12701
NM_001042495chr1563807 3630 3578 3416 1274 583 21333 823 3899 753 660 12701
NM_001042496chr1563807 3630 3578 3416 1274 583 21333 823 3899 753 660 12701
NM_001042497chr1563807 3630 3578 3416 1274 583 21333 823 3899 753 660 12701
NM_001042498chrX4341 330 125 101 ------
NM_001042506chrX81179 500 483 320 284 191 175 154 --1205 11462
NM_001042510chr842110 1499 1347 451 141 1432 --
NM_001042511chr842110 1499 1347 451 141 1432 --
NM_001042533chr333068 2616 95 12669 22648 1053 --
NM_001042537chrX2678 408 12033 52327 2027 497 435 303 1183
NM_001042539chr163365 355 240 --11070 --
NM_001042550chr91166 --41643 1638 1425 124 --
NM_001042555chr12144343 4287 4166 3553 3378 1894 1843 1295 1279 897 779 554 535 93 24160 463 --23972 1568
NM_001042573chr1732053 1921 1537 ------
NM_001042599chr2187709 7024 6439 5976 5755 5040 3035 2808 2443 1910 1587 1524 964 894 743 348 216 81 46133 2164 1959 870 97618 7587 7574 5562 5442 5366 352 224 68 1679
NM_001042601chr3103034 3017 2999 2896 2332 2323 820 503 343 35 --1357 13298
NM_001042603chr12104698 3909 3898 1562 1542 1432 1337 460 238 205 21825 176 74776 1949 1785 1738 1570 1202 146 --
NM_001042604chr3114566 4313 4267 3929 3618 3508 3463 1870 1383 1148 1073 1791 44321 3754 467 32 --
NM_001042632chr2042239 1926 1672 251 --12313 --
NM_001042633chr2042239 1926 1672 251 --12313 --
NM_001042646chr371671 1385 556 306 222 106 48 --3763 318 311 --
NM_001042681chr1132616 2428 2398 2386 2281 2248 2194 2159 1980 988 568 313 305 1105 21872 1788 --
NM_001042682chr1132616 2428 2398 2386 2281 2248 2194 2159 1980 988 568 313 305 1105 21872 1788 --
NM_001042682chr1132616 2428 2398 2386 2281 2248 2194 2159 1980 988 568 313 305 1105 21872 1788 --
NM_001042683chr621368 169 --31730 1153 582 --
NM_001042728chr123997 931 884 --1341 --
NM_001042749chrX31717 756 347 2726 627 11919 1102
NM_001042750chrX31717 756 347 2726 627 11919 1102
NM_001042751chrX31717 756 347 2726 627 11919 1102
NM_001042762chr75936 895 878 831 43 ------
NM_001043318chr1493946 3771 3473 3165 1596 1537 1139 969 884 12945 34138 3884 3536 --
NM_001044305chr661648 1531 1392 1279 640 46 --1284 --
NM_001044385chr264070 3708 3668 3065 2488 265 --22742 780 --
NM_001044387chr1974072 3850 3486 1322 1184 854 199 --24164 2583 --
NM_001044388chr1974072 3850 3486 1322 1184 854 199 --24164 2583 --
NM_001044722chr53557 474 415 --21879 310 1182
NM_001044723chr53557 474 415 --21879 310 1182
NM_001046chr52463 370 1974 32810 255 219 --
NM_001049chr1472354 1561 770 602 331 289 267 ------
NM_001068chr3258 50 ------
NM_001069chr6--1139 ----
NM_001074chr4193 ------
NM_001077628chr15681 484 211 173 63 ------
NM_001078chr12230 71 --1603 --
NM_001079874chr11268 --2435 318 --
NM_001083620chr431857 1792 956 22403 2027 12054 --
NM_001083621chr193372 3276 1318 1178 1171 1026 756 524 212 --24348 745 24158 810
NM_001095chr1271840 1721 1520 1493 1268 707 161 --1121 --
NM_001099678chr385990 5702 5574 5237 4652 4495 4180 635 25125 2114 35841 2479 1741 11066
NM_001100108chr1158328 8238 7873 7766 7492 6775 6719 6441 5851 5175 1613 1537 1420 1220 1154 17893 88321 5271 2970 2752 1671 1206 1086 806 1838
NM_001106chr3209044 8359 8210 8164 8100 7399 6609 6273 3642 3448 3381 2199 1988 1839 1721 1195 953 522 462 316 21602 711 129587 8437 7571 7299 7165 3385 2804 2663 2204 1015 480 341 27717 5967
NM_001111chr1122711 2490 2436 2153 2048 1753 855 705 499 479 100 71 11671 2337 302 12537
NM_001113490chrX43054 2273 1175 571 --32953 2478 771 1913
NM_001116chr1693036 2315 2192 2162 2142 1962 1936 408 180 --12601 1466
NM_001117chr1832071 1587 654 --11844 22008 1851
NM_001119chr451494 1425 1306 446 205 11375 11261 11363
NM_001121chr102565 352 --1631 --
NM_001122679chr5262 24 ------
NM_001126chr12933 328 ------
NM_001127chr223842 750 75 --1853 --
NM_001128chr1693805 3629 3156 2951 1285 1111 774 443 183 --52983 2542 2470 411 235 13721
NM_001135chr153664 261 82 ------
NM_001140chr174247 224 200 194 --2241 229 --
NM_001144chr1631189 1050 242 --1195 --
NM_001146chr882319 1995 1917 1757 1674 1574 522 415 --1898 --
NM_001147chr8191 --1390 --
NM_001148chr421498 329 ----11512
NM_001159chr2------1234
NM_001167chrX44661 2533 2235 1501 --34561 2537 770 22493 1442
NM_001172chr142613 296 ------
NM_001173chr1444728 4031 986 146 --21179 125 --
NM_001174chrX32009 1578 430 --2378 54 --
NM_001178chr111419 1436 ----
NM_001186chr2183216 2526 1139 646 559 439 155 37 13297 12160 2137 109
NM_001191chr2041213 1126 479 42 ------
NM_001198chr672244 2226 2175 2039 1901 1639 433 ----12306
NM_001200chr2041112 1060 866 224 --1796 --
NM_001204chr2177383 6715 5368 5344 5221 5197 4802 2671 2201 2113 2030 1747 1325 1299 1044 797 576 11491 62974 2440 1351 1183 682 491 22065 1762
NM_001205chr51413 ------
NM_001206chr972866 2783 2405 2088 2057 1932 305 --1149 --
NM_001219chr771734 1554 1391 350 154 147 25 --3898 633 274 --
NM_001221chr42110 102 132 ----
NM_001233chr742222 2132 1867 787 --21727 935 1568
NM_001235chr112603 588 --1592 --
NM_001237chr42801 291 --1811 1358
NM_001237chr42801 291 --1811 1358
NM_001238chr192117 52 ------
NM_001241chr22239 168 --11620 1128
NM_001241chr22239 168 --11620 1128
NM_001256chr1772889 2328 2110 1171 1032 745 442 --12333 --
NM_001257chr1651503 440 261 213 188 1197 ----
NM_001259chr7165988 5915 5856 4823 4769 4696 4633 4617 4473 2542 1936 1506 1060 1024 577 125 35432 1631 1299 55948 2206 1607 1601 916 11621
NM_001261chr921121 439 --143 --
NM_001262chr11252 --1233 --
NM_001263chr41442 --1127 --
NM_001268chr132770 69 --1254 11038
NM_001269chr14269 162 149 128 --1155 --
NM_001270chr51807 1104 1858 --
NM_001271chr1582999 2793 2781 2520 2457 2224 1106 734 --32295 1237 765 --
NM_001273chr124586 381 101 46 --155 --
NM_001274chr11162 ------
NM_001278chr10187 1825 --1963
NM_001280chr191614 ------
NM_001282chr1772416 2156 878 772 696 614 538 --22625 777 --
NM_001283chr75679 465 431 109 66 --1684 --
NM_001284chr52383 375 --1457 --
NM_001286chr152911 2902 1829 802 791 12921 42747 2191 1833 737 --
NM_001290chr43999 850 280 --2319 151 --
NM_001293chr111387 1437 199 --
NM_001300chr102447 349 ------
NM_001304chr17103811 2489 2370 2349 2339 1460 1199 176 140 99 --156 1468
NM_001310chr1282997 2745 2336 2098 1060 701 534 515 --12057 --
NM_001315chr671778 1527 1449 784 307 266 106 11939 32179 1544 812 --
NM_001316chr202333 94 1374 1365 --
NM_001319chr193436 185 31 --11069 --
NM_001326chr11--1480 144 --
NM_001329chr1011635 11231 --1293
NM_001331chr11142229 2212 2185 2164 1899 1869 1746 1145 1070 939 671 226 170 83 12649 52452 2334 2067 1960 77 --
NM_001332chr531266 571 80 --31160 1140 452 --
NM_001338chr21----244 39 --
NM_001343chr561687 1209 638 617 595 138 1151 ----
NM_001351chr361864 1447 1369 526 439 160 ------
NM_001356chrX12496 --1755 --
NM_001358chr41403 --1354 --
NM_001364chr11144485 4468 4443 4176 3868 3708 3338 3308 3219 3187 3114 3102 1786 918 33373 3267 3235 64369 3298 3281 3247 3171 896 11091
NM_001365chr171163 --2500 124 --
NM_001380chr102993 132 11035 ----
NM_001383chr172273 85 1559 ----
NM_001386chr8102411 1916 1682 1618 1587 872 841 736 725 72 --3780 352 80 --
NM_001387chr5142923 2899 2784 2622 2515 2276 2209 1036 924 892 788 739 673 140 --1794 --
NM_001388chr172706 148 ------
NM_001389chr211477 --1541 --
NM_001390chr1873642 2672 1343 1129 881 314 28 21378 1216 32558 1454 1000 --
NM_001391chr182306 37 --11018 --
NM_001392chr18165 ----122
NM_001394chr82572 125 ------
NM_001395chrX2992 195 ------
NM_001396chr2131132 1037 229 1495 ----
NM_001406chr1791516 1359 666 532 467 275 247 241 162 1392 31244 436 386 --
NM_001407chr33564 555 421 11385 11211 --
NM_001408chr141494 1442 1384 1070 --11095 --
NM_001412chrX63376 3220 3047 2954 2933 1190 11413 23705 3652 --
NM_001415chrX1142 --21250 53 --
NM_001417chr1251960 1936 1214 523 24 11870 31356 568 35 --
NM_001419chr19104582 4008 3941 3351 3099 1861 1088 921 833 433 --1486 1224
NM_001420chr1932526 2225 1193 ------
NM_001421chrX31678 1635 1396 1547 11681 --
NM_001422chr1141168 1098 204 129 --2209 90 --
NM_001423chr1231990 1565 756 1163 11594 21662 768
NM_001426chr21590 1230 2570 534 --
NM_001427chr791604 828 822 805 771 758 751 735 729 --3788 779 776 --
NM_001429chr224903 416 234 110 --2888 43 --
NM_001431chr641254 807 444 166 --21137 449 --
NM_001438chr1113000 2466 831 523 373 319 248 218 205 194 160 1311 121035 494 489 484 472 459 444 365 258 236 230 212 --
NM_001439chr161252 1242 1228 1216 506 202 --1359 11524
NM_001448chrX41442 501 311 158 11651 ----
NM_001449chrX71081 511 490 444 275 264 131 ------
NM_001451chr1631235 1167 190 --179 --
NM_001453chr63652 611 383 11211 1328 --
NM_001455chr684878 4614 4408 3925 3147 1731 628 239 --44252 3299 603 402 24376 3288
NM_001461chr14619 596 389 216 --2392 143 --
NM_001463chr21168 --3815 705 150 --
NM_001478chr128947 863 855 818 797 342 181 122 --2936 133 --
NM_001482chr15----2719 375 --
NM_001483chr731096 1065 211 ------
NM_001493chrX3185 169 68 --2247 209 1691
NM_001494chr101674 ------
NM_001495chr88982 936 919 904 811 800 780 285 --41046 930 300 155 --
NM_001497chr932381 983 642 --22423 1964 --
NM_001498chr611109 --4456 444 429 412 2985 926
NM_001511chr41529 1146 ----
NM_001518chr71458 --1845 --
NM_001521chr2--1796 --1670
NM_001523chr193248 114 93 ------
NM_001527chr644745 4134 3763 201 13612 24804 1148 24428 1187
NM_001530chr1431163 983 211 --21100 24 --
NM_001533chr19----2100 46 154
NM_001540chr7296 87 ------
NM_001542chr132565 1937 384 --42736 2191 403 57 --
NM_001543chr594827 4719 4621 4237 4218 1874 1805 1681 704 --23289 3264 13701
NM_001546chr631244 1193 223 --21481 486 --
NM_001550chr71184 ------
NM_001552chr1731037 327 220 --31098 790 419 --
NM_001555chrX1102 --2255 30 --
NM_001560chrX52296 1972 1048 624 48 12080 32126 1761 872 --
NM_001584chr1161012 985 874 494 229 76 --11022 --
NM_001587chrX51445 793 646 449 408 22004 155 1237 --
NM_001609chr1084337 4110 3670 3595 3396 2784 1110 483 --23688 166 13675
NM_001614chr17----1481 --
NM_001614chr17----1481 --
NM_001616chr252977 2964 2536 831 358 --13138 --
NM_001617chr281290 1231 1221 1111 835 477 422 35 ------
NM_001621chr762970 1869 1173 892 718 525 1333 ----
NM_001621chr762970 1869 1173 892 718 525 1333 ----
NM_001622chr32365 261 ------
NM_001629chr133255 239 88 ------
NM_001634chr692002 1550 1442 648 639 548 336 223 206 11503 ----
NM_001635chr72875 297 1956 1319 --
NM_001650chr1883847 3626 2874 1619 1521 612 554 57 1354 ----
NM_001654chrX2424 416 --1160 --
NM_001655chr1141580 1531 1477 131 3656 325 302 21604 728 --
NM_001656chr521792 614 11458 ----
NM_001658chr1128 --1936 --
NM_001659chr12162626 2507 2433 2264 2207 2083 2045 1019 744 734 719 673 359 342 316 161 12670 42097 913 403 81 12233
NM_001660chr32804 220 ----1649
NM_001661chr173533 209 24 --2627 292 --
NM_001662chr73152 105 93 --1285 --
NM_001663chr144701 552 416 333 --5868 400 192 164 95 --
NM_001664chr34989 921 223 197 ------
NM_001665chr112486 151 --1136 --
NM_001668chr152281 1790 1526 594 259 --31971 1920 93 --
NM_001674chr1----1869 --
NM_001677chr1----2833 825 --
NM_001678chr17101728 1646 1634 1627 1357 585 565 557 495 135 1739 31412 1406 1361 11709
NM_001679chr32276 168 ------
NM_001682chr1242581 1849 1822 503 12514 32503 2364 1126 --
NM_001683chr322478 1860 --22291 166 --
NM_001684chr1113698 3589 3452 3163 1553 1409 1301 1230 1042 733 293 --123810 3807 3545 3399 3383 3257 2697 909 767 590 585 332 --
NM_001690chr332499 315 73 --42103 1696 181 32 21938 216
NM_001693chr821180 418 11070 21192 62 --
NM_001695chr874218 3710 3582 1387 869 283 96 --44089 4086 3713 1015 --
NM_001699chr1941725 1663 1233 161 ------
NM_001701chr931508 1014 57 1260 ----
NM_001702chr81568 --1553 --
NM_001704chr61450 --1555 1532
NM_001709chr1142704 882 337 228 --12353 --
NM_001714chr121363 --3468 200 88 --
NM_001717chr152609 443 ------
NM_001718chr6--11313 --11380
NM_001731chr124748 307 274 70 --2919 341 --
NM_001735chr9----176 --
NM_001740chr163494 468 430 --1499 --
NM_001741chr112244 110 --173 --
NM_001742chr711172 11528 ----
NM_001743chr23149 137 88 ------
NM_001746chr5102889 2302 2196 1834 932 912 895 883 857 542 --32960 1019 34 11925
NM_001748chr121005 938 ------
NM_001753chr761407 591 556 228 167 140 --31326 683 43 --
NM_001754chr21103991 3475 2998 2980 2941 2877 2864 2853 2764 1110 --34270 4249 2823 12832
NM_001755chr1642104 661 342 165 1924 1524 21943 420
NM_001759chr12135047 4939 4509 3759 3522 1965 1852 1413 1265 1185 1043 605 52 --94288 4117 3418 1952 1888 1417 887 710 55 --
NM_001768chr261293 1186 1145 1059 451 90 --147 --
NM_001773chr181388 1322 1229 1211 1179 1093 586 61 1550 11185 --
NM_001777chr3153727 3538 3489 3357 2920 2707 2674 2654 2545 2525 1510 1309 1107 939 778 --53501 3143 2556 907 700 --
NM_001783chr194383 152 106 84 ------
NM_001788chr7--1400 --1758
NM_001790chr52366 287 --2311 266 --
NM_001791chr141365 1234 1039 431 ------
NM_001798chr121243 --3787 736 730 --
NM_001800chr194194 186 173 86 --175 --
NM_001806chr19----31115 984 929 22928 441
NM_001810chr205769 662 222 216 206 1113 1567 --
NM_001822chr21744 --2526 516 --
NM_001829chr41617 1103 1872 --
NM_001830chrX63204 2910 2523 1583 1390 1099 --43157 1367 1346 980 23359 672
NM_001839chr14729 704 562 34 --2153 146 --
NM_001854chr121500 256 --11108 --
NM_001858chr641202 1094 409 40 25009 1307 1288 --
NM_001873chr42192 138 --1651 --
NM_001891chr4----1341 --
NM_001892chr521389 57 --41413 1380 1022 984 --
NM_001893chr171280 1355 ----
NM_001895chr2061003 424 382 361 296 275 ------
NM_001904chr3----2873 307 --
NM_001913chr7----1633 --
NM_001914chr183360 300 265 ------
NM_001915chr1782042 1789 1712 1508 1390 178 167 39 11571 51511 1404 813 679 603 --
NM_001918chr1149245 9038 7014 6707 5951 5738 5674 5614 3716 3666 3129 2762 1438 769 48258 7210 6486 3367 35826 3480 1085 18275
NM_001920chr12------1648
NM_001921chr431093 1007 148 146 ----
NM_001923chr114611 198 82 67 --1473 1486
NM_001933chr1461151 983 521 282 228 55 1906 11016 --
NM_001935chr231001 923 357 ------
NM_001936chr711226 --21384 692 --
NM_001938chr111923 --1361 130
NM_001942chr1851876 1773 1347 632 241 --2711 199 --
NM_001945chr531353 1000 305 --11138 11121
NM_001946chr123953 773 185 --3787 357 54 11002
NM_001949chr6103044 2303 2150 1270 530 521 401 317 310 94 13199 ----
NM_001951chr81127 ------
NM_001954chr63521 268 215 2620 281 ----
NM_001955chr641121 979 220 101 ----1894
NM_001963chr42660 559 ----1780
NM_001964chr52246 172 --196 --
NM_001965chr22135 78 --1435 --
NM_001969chr1461311 1103 666 524 307 49 --11086 --
NM_001973chr11155 1275 ----
NM_001975chr123790 225 184 --4688 239 233 229 1755
NM_001977chr44617 374 215 45 --1162 --
NM_001978chr83868 171 108 ------
NM_001980chr1232167 1914 248 --21981 698 --
NM_001981chr132320 1734 156 12159 42205 1738 1471 40 1507
NM_001982chr124268 259 229 68 --2317 200 --
NM_001987chr12124274 4153 3919 3492 3310 2953 1314 1114 628 276 244 137 13436 44106 1476 611 502 11604
NM_001990chr1136 --2138 130 --
NM_001994chr1151 ------
NM_001995chr43314 286 49 --2579 140 1331
NM_001999chr51118 --31335 1249 542 --
NM_002006chr4175432 5238 5188 4875 4845 4678 4632 4155 3906 2211 1228 662 557 524 476 465 318 --55497 5448 3719 1185 446 21506 1436
NM_002009chr1542293 1961 1806 868 --287 69 --
NM_002015chr1342325 2191 1260 142 11180 22594 150 12106
NM_002017chr1111409 ----1174
NM_002023chr161298 524 508 478 287 130 ------
NM_002024chrX31684 1434 697 --11788 --
NM_002025chrX198869 7876 7775 7559 7440 6784 6585 6307 6085 2364 1381 1200 1077 1049 917 796 777 238 99 27549 3392 119256 8440 8435 8040 7450 6990 6170 2212 1158 1136 1099 --
NM_002026chr241035 1020 1012 192 --193 --
NM_002033chr1163836 1623 1468 514 264 103 33306 3024 60 1814 --
NM_002035chr1893715 1457 1409 1071 853 774 639 441 432 --23121 924 --
NM_002037chr6----1321 --
NM_002040chr2192746 2268 2171 2144 2090 1213 1026 447 89 --52225 1269 1060 907 851 12366
NM_002044chr154594 556 495 85 11571 31137 421 409 --
NM_002045chr32124 69 --2349 148 --
NM_002048chr91196 --1444 --
NM_002051chr101822 --1447 --
NM_002054chr21409 ------
NM_002056chr22813 579 ------
NM_002061chr131580 205 35 ----1268
NM_002062chr63507 468 210 1426 --11519
NM_002063chrX1359 ------
NM_002069chr731652 1443 1194 --11614 --
NM_002071chr182682 668 1638 ----
NM_002072chr93787 754 370 --2938 224 --
NM_002074chr131357 229 146 --31615 507 490 --
NM_002076chr1283176 2843 2375 1183 1115 1025 786 160 12183 1306 1227
NM_002077chr981936 1917 1636 1552 1377 843 783 762 1294 31691 868 511 --
NM_002086chr17132291 2066 2059 2046 2009 1835 1789 498 437 374 275 256 244 12226 1282 --
NM_002089chr41534 1146 ----
NM_002092chr464805 4118 3930 3116 1796 1266 11472 24969 4920 --
NM_002094chr162158 74 ------
NM_002103chr19----2755 205 --
NM_002107chr11480 --156 --
NM_002111chr4113264 3199 3139 3049 2901 2447 2428 1469 1019 541 279 --1551 --
NM_002114chr6167 ------
NM_002126chr1754027 3589 3392 2662 1250 1534 54185 3198 646 550 213 13594
NM_002129chr41142 ------
NM_002131chr631341 1006 43 --1950 --
NM_002137chr761874 1811 1725 731 380 317 --21894 963 1441
NM_002138chr42585 346 ------
NM_002140chr92960 205 --21079 132 --
NM_002141chr7170 --147 --
NM_002145chr17124 --3297 155 152 1159
NM_002146chr1731407 1388 438 1450 ----
NM_002147chr171226 --1726 --
NM_002148chr21658 ------
NM_002158chr253616 3609 2418 434 305 --22915 310 --
NM_002167chr11344 ------
NM_002181chr23751 495 120 --1755 --
NM_002187chr521310 1140 ------
NM_002188chr53695 217 128 ------
NM_002193chr231423 562 59 ------
NM_002198chr5----1293 130
NM_002199chr41166 --2885 77 --
NM_002202chr5----1815 --
NM_002203chr574057 3545 3005 2832 2632 928 378 42617 1558 1032 855 62596 1534 1003 828 824 597 13880
NM_002207chr32121 85 ----1205
NM_002210chr241406 997 978 73 --33036 2501 2494 --
NM_002214chr7155729 4632 4469 3640 3525 3482 2243 1805 1570 1517 1471 1041 872 643 284 12202 44648 3967 3529 3465 34885 4623 3985
NM_002222chr32918 545 --11036 --
NM_002223chr1263919 3860 3434 3290 650 322 --13942 --
NM_002224chr63732 703 286 ------
NM_002227chr11810 --1190 --
NM_002228chr111196 1882 ----
NM_002230chr177892 826 745 323 122 106 44 --2982 169 --
NM_002232chr131268 210 198 11254 11392 --
NM_002234chr123706 133 124 ----1164
NM_002235chr1251468 1304 1251 1056 60 --11112 --
NM_002240chr21365 51 26 ------
NM_002241chr182358 2343 2265 2086 967 934 619 121 --62938 1019 943 858 43 28 --
NM_002245chr1----1639 --
NM_002247chr1022240 688 --1432 12331
NM_002249chr11449 --1454 --
NM_002252chr2134 --2172 26 --
NM_002253chr441210 994 226 204 1155 ----
NM_002254chr251742 881 579 406 161 1173 42063 2052 785 278 --
NM_002264chr3114797 4463 4218 3427 3120 1838 1159 764 586 484 57 23336 1595 34573 4212 3703 21122 571
NM_002266chr171172 ----165
NM_002267chr1342230 2073 2022 348 --32155 2062 1786 --
NM_002270chr594953 4208 4115 4038 4004 1983 1666 1573 691 12003 55125 4916 4256 3730 1029 22179 1611
NM_002271chr1331518 795 298 --1122 160
NM_002274chr173303 277 253 1313 ----
NM_002285chr232965 1079 119 13315 42684 1270 1192 878 1633
NM_002293chr162410 1773 1735 499 126 103 22175 1712 42634 2381 1094 1050 --
NM_002294chrX1166 ------
NM_002296chr111564 21097 460 ----
NM_002298chr1351447 1374 663 549 237 ------
NM_002310chr5185640 5497 5480 5162 4144 4012 2396 2190 1882 1827 1807 1619 1284 1267 1045 971 455 359 25028 507 65818 5417 4434 4044 4041 1818 --
NM_002314chr741072 893 169 62 ------
NM_002317chr51292 --1302 --
NM_002332chr122634 180 --1620 1747
NM_002333chr1931183 254 84 ------
NM_002334chr1161512 1321 684 407 286 35 143 ----
NM_002336chr1244967 1691 1422 1280 11310 1933 3851 721 548
NM_002345chr12----1557 --
NM_002349chr221598 1554 --1269 --
NM_002350chr821156 292 --1918 --
NM_002353chr15622 188 181 109 84 ------
NM_002355chr1281093 1056 996 909 176 145 66 30 1947 --1195
NM_002356chr662609 1982 1946 253 174 39 --32827 270 257 --
NM_002358chr41479 --2266 153 --
NM_002359chr1793824 3074 2950 2730 1121 1079 118 96 81 --21616 741 --
NM_002361chr19178 1222 ----
NM_002373chr1541270 1226 481 72 147 ----
NM_002374chr273614 3314 2559 2282 1297 922 818 11333 33574 2715 795 13217
NM_002375chr372067 2058 1829 1607 1515 775 342 ------
NM_002376chr141597 1102 ----
NM_002382chr143940 495 58 --31061 519 111 --
NM_002385chr1861327 1181 1144 1032 478 244 --1455 --
NM_002387chr5113587 3300 3130 1265 843 750 690 424 414 372 301 34178 3167 400 ----
NM_002391chr112320 253 ------
NM_002397chr542096 1937 1739 276 --12067 --
NM_002398chr21440 ------
NM_002399chr1571333 1319 1075 1018 970 542 70 1900 11313 --
NM_002401chr1722266 411 1560 ----
NM_002406chr53859 746 298 ------
NM_002408chr141727 131 ----
NM_002409chr22112880 2634 2342 2190 2135 1218 1060 968 909 871 753 --33159 2364 724 --
NM_002430chr2282561 2194 2057 1763 1750 722 353 58 125 3824 438 40 2296 138
NM_002442chr1221724 1112 1444 ----
NM_002444chrX111663 1437 1380 1361 753 641 464 391 373 221 41 --21383 225 --
NM_002445chr891470 1159 1113 505 313 211 160 99 29 11676 11434 11478
NM_002451chr983752 3261 2939 2837 2730 1201 656 271 13402 1490 13373
NM_002460chr693237 2520 2513 2369 1442 1273 1100 994 594 --31085 811 34 --
NM_002469chr121312 171 ----
NM_002473chr2231032 453 368 --1183 --
NM_002480chr122574 500 1529 ----
NM_002481chr1287560 7379 7225 6708 6699 6666 6556 6148 5926 5581 5482 5356 5342 5142 4891 3122 3093 3025 2856 2641 1655 1505 982 700 650 629 404 185 21702 1644 95092 4973 2964 2389 998 691 686 551 162 --
NM_002486chr942284 269 243 99 --12275 21624 760
NM_002487chr15--1638 ----
NM_002492chr3134 ------
NM_002494chr41175 --154 --
NM_002499chr1552314 2046 913 901 870 1587 2986 695 --
NM_002500chr21931 1215 ----
NM_002501chr1993927 3197 1649 1173 1148 616 354 183 80 --43804 1602 1249 33 --
NM_002505chr661511 1339 1311 1269 540 41 --31583 1450 569 --
NM_002507chr1731744 1394 120 1674 ----
NM_002508chr171983 1681 1580 1573 546 478 86 1180 2510 24 --
NM_002509chr203728 693 627 --2701 697 --
NM_002514chr831122 856 806 1457 --11186
NM_002515chr1431541 1263 660 31842 212 41 ----
NM_002516chr193233 107 50 --132 --
NM_002518chr2----41165 977 400 203 --
NM_002519chr1171388 1367 1303 1219 1104 972 387 --11058 --
NM_002520chr5178 ------
NM_002522chr17113463 2537 2526 2446 1366 1098 979 512 385 206 77 --33137 2957 394 --
NM_002524chr11262 ------
NM_002526chr61581 --1295 --
NM_002536chrX41438 1103 1069 129 --1265 --
NM_002545chr11165046 4655 4089 3913 3365 2064 2042 1494 1397 1349 955 946 624 597 321 292 24848 1608 74563 3532 2048 1706 1309 890 284 --
NM_002546chr8399 67 28 ------
NM_002547chrX43561 741 358 195 11659 23081 66 --
NM_002556chr11131986 1969 1840 1785 1770 1661 1624 1527 1453 864 757 295 98 --21357 870 --
NM_002563chr331118 750 199 --1256 1343
NM_002568chr81437 --1309 --
NM_002570chr1541165 366 200 60 --1826 --
NM_002572chr11276 38 ------
NM_002575chr181113 1207 ----
NM_002576chr112225 87 1909 ----
NM_002577chr3123793 3604 3120 2947 2882 985 902 894 778 466 445 136 23727 1544 52965 1538 1527 1512 409 --
NM_002581chr945315 4707 2150 566 12141 45583 5221 1475 667 14294
NM_002585chr11137 --170 --
NM_002586chr651569 1290 1101 303 288 --3374 317 236 --
NM_002588chr551769 1682 1238 669 486 --41797 1393 1297 385 --
NM_002594chr2041592 762 491 116 21642 1622 ----
NM_002595chr1261751 1642 719 410 215 119 ------
NM_002600chr161804 1624 675 629 542 370 --11461 --
NM_002603chr8----1146 --
NM_002605chr155990 468 355 84 38 ------
NM_002608chr2251539 1253 1108 622 259 --11582 --
NM_002612chr72657 89 1678 ----
NM_002613chr16145380 5324 4897 4686 4129 4122 3621 3334 2115 1943 1859 1415 1354 1104 14972 12119 11263
NM_002616chr17----147 --
NM_002618chr2161 ------
NM_002622chr53688 86 26 --1619 --
NM_002623chr202800 67 ------
NM_002628chr33862 440 431 --1388 --
NM_002629chr102881 668 ------
NM_002633chr1----4474 385 381 224 --
NM_002636chr61222 1391 1437 --
NM_002641chrX21643 526 ------
NM_002645chr1111983 1768 22631 2307 22690 1126
NM_002646chr122176 1740 --2789 186 11966
NM_002648chr641207 974 328 237 --1240 --
NM_002655chr874489 4405 4185 4079 1517 1491 1235 --11737 --
NM_002657chr20153581 3239 3231 2464 1528 1339 1273 1146 980 949 924 778 529 514 315 23741 3197 43395 2512 1446 290 --
NM_002669chr4----121 --
NM_002670chr341619 1242 436 423 ----11442
NM_002674chr12----1162 --
NM_002687chr1441324 496 432 73 ------
NM_002690chr8----1104 --
NM_002693chr151149 --2311 305 --
NM_002698chr19102592 2583 2343 2323 2304 2245 2221 1130 199 77 --42297 2278 1966 326 --
NM_002699chr141461 1255 536 496 --21385 1382 --
NM_002701chr6197 ------
NM_002705chr163661 259 79 ------
NM_002706chr2----2583 579 --
NM_002707chr2------179
NM_002709chr273573 3520 3236 3109 2568 1031 990 --12396 --
NM_002710chr122218 123 --1226 --
NM_002711chr7----3734 331 106 --
NM_002714chr63981 446 192 ------
NM_002715chr52913 836 --1279 --
NM_002716chr1193697 3532 3497 3487 3345 3274 722 376 195 12351 63504 3296 3149 2834 2776 1449 --
NM_002718chr352324 2199 1879 889 103 1307 ----
NM_002719chr1432245 1762 618 --12352 --
NM_002721chr93498 360 42 ------
NM_002726chr62449 173 ------
NM_002729chr102253 111 ------
NM_002730chr1941174 909 308 104 --41359 1192 462 242 --
NM_002731chr1102620 2573 842 773 679 666 275 254 238 103 --32798 2730 279 2908 302
NM_002734chr174916 439 239 28 --1654 --
NM_002736chr721894 752 --1115 --
NM_002738chr1621076 240 ----11155
NM_002742chr141537 ------
NM_002745chr22174456 4121 4072 3310 2946 2760 1547 1536 1313 1044 606 386 336 319 197 180 119 11655 54460 3422 3102 1694 56 13028
NM_002747chr1831505 645 561 ----1511
NM_002748chr152274 33 ------
NM_002752chr51437 ------
NM_002753chr42297 164 ------
NM_002755chr151843 ------
NM_002763chr12513 139 --1155 --
NM_002764chrX7889 805 730 697 679 630 214 ------
NM_002776chr1981489 773 736 686 642 376 194 80 --1315 --
NM_002790chr1126 ------
NM_002796chr12101 78 ------
NM_002815chr17123 ------
NM_002819chr1941478 1106 1019 328 ------
NM_002821chr63558 178 156 ----1253
NM_002823chr2----1581 --
NM_002824chr122397 129 ------
NM_002827chr2031482 1193 185 11270 ----
NM_002829chr921026 271 --127 --
NM_002833chr155627 499 412 320 39 ----11163
NM_002835chr71672 ------
NM_002836chr201180 ------
NM_002837chr1284170 3587 3540 3013 1740 1263 821 611 12871 31438 744 199 --
NM_002839chr953209 2526 987 807 61 --13256 --
NM_002840chr151217 519 326 284 62 --31380 386 295 --
NM_002843chr11103267 3131 2545 2107 911 889 771 758 736 642 12340 ----
NM_002844chr631362 366 301 --11163 --
NM_002847chr721505 1346 185 1458 --
NM_002850chr1941007 945 769 236 --11144 --
NM_002855chr11103456 3201 3121 2710 1477 1032 814 654 386 190 --33508 3065 1024 --
NM_002858chr131179 554 358 ------
NM_002859chr1281747 1613 1443 1246 666 531 411 335 --21794 1321 --
NM_002867chr11162 --1471 --
NM_002868chr12122406 2256 2032 1907 1750 1659 887 564 412 329 310 265 12073 72410 2331 2266 2092 1990 1933 538 --
NM_002869chr1182167 1706 856 820 595 453 392 27 1512 11765 --
NM_002874chr942354 2056 2002 1880 12424 1261 --
NM_002880chr32565 76 ----2762 729
NM_002882chr22----342 37 28 --
NM_002886chr384821 4667 3659 3365 1862 1348 542 242 --55032 3303 1866 1141 582 --
NM_002890chr5175 ------
NM_002892chr1441609 1433 1315 157 --1235 --
NM_002893chrX3338 282 125 ------
NM_002897chr21589 ------
NM_002902chr152679 36 ------
NM_002906chr1162045 720 442 427 410 28 --11611 --
NM_002911chr1921459 1402 --3552 346 324 --
NM_002912chr63794 359 202 ------
NM_002918chr192902 302 ------
NM_002924chr13590 517 204 --1237 --
NM_002926chr421172 130 --1324 --
NM_002938chr451995 1504 1305 1286 497 11477 41916 1663 216 151 --
NM_002941chr321316 1239 --1130 --
NM_002942chr31274 --1177 --
NM_002945chr173647 591 59 1569 ----
NM_002953chr13764 508 188 ------
NM_002956chr123942 926 895 11180 1886 --
NM_002959chr183794 3070 2851 1584 1432 1112 501 248 --33335 2858 794 --
NM_002968chr163906 239 98 --1927 --
NM_002970chrX159 ------
NM_002971chr32743 73 --31022 366 180 --
NM_002977chr233274 957 92 --22248 718 --
NM_002979chr12746 622 --1762 --
NM_002994chr461965 604 519 372 152 141 ------
NM_002995chr12795 141 --1116 --
NM_002996chr1661876 1820 1220 779 487 244 --1631 --
NM_002998chr822255 700 --31719 788 404 --
NM_003001chr1102243 2232 1981 1554 820 703 450 325 273 114 21956 1577 22142 1864 --
NM_003010chr1752432 1816 1686 1496 502 22381 707 22230 1945 --
NM_003011chr94659 589 380 45 --3473 388 31 1139
NM_003012chr872995 2980 2803 2408 1930 1141 613 --21237 944 12972
NM_003013chr41634 ------
NM_003014chr741512 1378 941 38 11185 ----
NM_003016chr1782042 1686 1576 1418 784 769 713 424 ------
NM_003017chr611043 1172 11377 --
NM_003026chr93382 185 29 --1955 --
NM_003027chr153363 307 88 ------
NM_003029chr131431 1131 43 --11504 --
NM_003030chr321359 762 11775 ----
NM_003031chr16--1769 1860 1383
NM_003034chr12117694 7634 7276 7044 7032 6549 5446 2578 1491 722 631 18112 76326 5968 5310 5285 2086 1033 635 18103
NM_003036chr13998 498 257 ------
NM_003042chr331776 535 363 --31767 856 412 11735
NM_003043chr363812 3752 3057 1181 419 382 --24331 4228 --
NM_003045chr13104669 4390 4198 3696 3660 1540 364 337 278 261 --23175 1530 24688 2021
NM_003046chr8124422 4235 4207 4080 3975 1758 1632 1305 1019 952 731 713 23397 1551 55302 5065 1981 1280 1099 --
NM_003051chr111697 --31948 1706 1545 --
NM_003060chr551200 921 871 473 113 11036 21071 815 1192
NM_003068chr84315 203 84 41 --1277 --
NM_003069chrX--1763 ----
NM_003074chr382199 1740 1608 1464 857 848 146 72 --2290 106 --
NM_003076chr1261691 1639 1404 610 472 167 --11180 --
NM_003077chr174848 587 225 157 1685 ----
NM_003081chr2071157 1146 763 437 390 177 63 --1267 --
NM_003088chr7----3716 326 295 --
NM_003091chr202233 54 ------
NM_003093chr6----1178 --
NM_003100chr51454 ------
NM_003104chr1521185 281 --2987 90 --
NM_003107chr642218 1861 1731 662 --11056 --
NM_003108chr2157028 6468 5684 5461 5253 4969 4438 2582 2264 2000 1874 1419 1036 259 52 36073 4622 676 64784 1843 1805 1764 1061 27 36303 5008 283
NM_003110chr171753 11050 ----
NM_003111chr211085 --11074 --
NM_003112chr773218 2362 1015 649 533 467 216 12670 --21047 414
NM_003113chr22881 69 ------
NM_003115chr11464 ------
NM_003128chr2102631 2406 1961 1936 1131 880 400 273 100 30 --31893 1135 909 --
NM_003131chr682113 1958 1766 791 522 504 372 207 --21962 1880 --
NM_003133chr12961 769 --2334 279 --
NM_003137chr671395 733 506 349 312 276 97 41858 748 627 295 2618 70 --
NM_003139chr112804 51 ------
NM_003140chrY147 --1108 --
NM_003142chr21228 ------
NM_003144chr61861 --2841 328 --
NM_003145chr15308 128 104 46 24 ------
NM_003149chr341538 1101 590 303 --31041 580 532 --
NM_003150chr1742045 942 321 233 11852 ----
NM_003152chr1741174 892 303 23 ------
NM_003153chr12--139 1190 --
NM_003155chr862806 2419 2325 2236 2119 617 --42528 2255 2228 260 --
NM_003156chr11173 --11219 --
NM_003161chr17103505 3461 3220 2192 1198 1158 1144 362 249 237 --1635 --
NM_003162chr21237 --1999 --
NM_003164chr112545 435 --1439 --
NM_003165chr951629 1540 1449 1214 261 --21756 180 --
NM_003170chr172118 82 ------
NM_003173chrX11380 11228 ----
NM_003178chr371873 1591 856 596 405 296 156 --1212 --
NM_003179chrX31447 415 376 ------
NM_003180chr192323 265 --1100 --
NM_003184chr82231 66 --126 --
NM_003185chr2041106 826 493 465 11349 ----
NM_003186chr111432 ------
NM_003188chr62858 831 --1159 --
NM_003189chr172844 2425 2295 1356 1336 673 556 --12836 --
NM_003194chr61554 ------
NM_003199chr18105097 4640 4468 4037 3710 1696 922 714 587 50 --24086 1494 --
NM_003202chr511762 2700 571 ----
NM_003203chr271840 1687 764 564 374 341 85 --154 21883 1702
NM_003204chr1751736 1332 1284 1165 119 ------
NM_003214chr641199 1018 461 46 --1962 --
NM_003216chr2293335 3208 2816 2259 2043 1333 636 507 413 12974 21337 777 --
NM_003217chr1262031 1699 1655 1600 528 385 --258 36 2253 135
NM_003220chr631686 1338 1194 --31177 636 604 --
NM_003221chr6183518 3461 3430 3371 3243 2952 2896 2865 2775 1647 1624 1213 1028 985 957 595 547 526 13892 33622 3540 801 --
NM_003223chr16121 ----1310
NM_003224chr203856 764 132 ----2151 116
NM_003234chr372431 2146 1685 1485 861 733 482 11696 1682 --
NM_003236chr293444 3240 3158 2395 2150 1225 1019 327 62 22364 517 11297 22648 2257
NM_003239chr1431046 836 723 --1150 --
NM_003242chr381643 1627 952 932 688 612 499 228 11531 ----
NM_003243chr131195 934 253 ------
NM_003244chr181341 ------
NM_003246chr1531760 663 108 --21318 251 --
NM_003247chr63639 133 86 --11634 --
NM_003253chr2131611 560 223 ------
NM_003257chr1511060 11215 ----
NM_003262chr3105059 4261 4150 3612 3390 3257 1349 1275 1232 789 --23772 3705 --
NM_003269chr611115 --2360 354 --
NM_003274chr2142768 2407 489 204 --11836 12773
NM_003285chr13543 519 361 --1349 --
NM_003286chr2031109 795 333 11121 ----
NM_003288chr2041540 1364 1134 388 --11585 --
NM_003290chr1931021 236 184 --278 57 --
NM_003292chr151742 1709 713 182 163 1532 1592 --
NM_003297chr12------1209
NM_003298chr3135819 4918 4827 4238 4068 3834 2311 1405 1207 869 799 177 126 34795 4361 780 46012 5362 5091 4253 24150 3817
NM_003300chr143445 328 42 ------
NM_003304chr311246 ------
NM_003309chr62508 148 11882 31752 585 132 --
NM_003320chr11134167 4159 4061 3583 3329 2753 1598 1243 1017 986 680 161 83 13576 33545 3013 2772 --
NM_003324chr1221397 224 --1387 --
NM_003326chr162523 2143 1960 546 296 75 12479 ----
NM_003336chrX2926 130 1769 ----
NM_003337chr52688 449 --11238 11444
NM_003338chr1011952 ------
NM_003339chr5165 ------
NM_003340chr42331 177 --21192 64 --
NM_003342chr1762569 1214 1099 1017 688 540 --42692 2542 1290 985 21000 433
NM_003345chr162416 198 --1498 --
NM_003348chr1271597 1566 1395 1211 403 129 54 --11378 --
NM_003350chr8----2922 209 --
NM_003352chr23875 220 38 ------
NM_003359chr41938 --1914 --
NM_003363chr32553 521 ------
NM_003369chr114691 581 370 118 1666 12572 --
NM_003370chr192215 32 ------
NM_003373chr1081950 1808 1759 1495 612 524 497 370 11557 21386 364 11583
NM_003374chr52580 198 ------
NM_003375chr10------1322
NM_003376chr621709 603 --11519 --
NM_003376chr621709 603 --11519 --
NM_003378chr7----2422 418 --
NM_003383chr9192 --196 --
NM_003387chr262418 1811 929 402 371 83 11863 42189 1855 1151 381 --
NM_003390chr1141061 737 203 90 --1888 --
NM_003392chr373610 3314 2709 2690 1048 459 357 --53935 3389 3152 1522 1022 --
NM_003394chr123665 222 78 ------
NM_003400chr21669 --129 --
NM_003403chr14178 ------
NM_003404chr2031757 1442 1363 --1594 --
NM_003406chr821811 1743 31758 1751 1446 21737 1596 1542
NM_003407chr191576 --1580 --
NM_003409chr182921 176 ----1328
NM_003410chrX33078 1238 411 1330 22592 2078 --
NM_003411chrY31502 665 367 1315 1674 --
NM_003412chr352843 2674 2284 1064 120 --21035 189 --
NM_003413chrX4790 455 246 181 11902 2794 256 --
NM_003418chr33313 64 26 --155 --
NM_003442chr11147 ------
NM_003453chr132677 569 ------
NM_003454chr1631365 1196 1132 --1238 --
NM_003458chr3133843 3819 3735 3452 3406 3241 2801 2510 2493 1318 1288 525 191 --42921 1016 946 932 13785
NM_003463chr653230 3133 2358 982 444 ------
NM_003468chr2103039 3029 3016 2951 2726 1490 1394 1126 997 172 --11398 --
NM_003469chr2134 --2161 63 --
NM_003470chr1651732 1332 531 421 157 --11619 --
NM_003472chr62522 230 --21130 87 --
NM_003473chr1031096 829 180 11089 1231 --
NM_003474chr1041986 1466 790 780 ------
NM_003478chr1123079 2372 22544 2358 31210 349 339 --
NM_003481chr123509 499 361 --1108 --
NM_003482chr1272757 2487 1996 922 775 573 196 11781 22124 540 --
NM_003483chr1262775 2127 1182 880 622 499 22798 702 52786 2066 1054 1040 540 12878
NM_003487chr17288 76 --122 --
NM_003489chr2173366 2782 2630 1117 928 750 610 1687 --12556
NM_003503chr121318 203 --2924 471 --
NM_003505chr7101638 1568 1280 1213 776 697 574 385 133 103 ------
NM_003507chr251805 1680 598 325 103 ------
NM_003508chr7----1303 --
NM_003525chr6--145 ----
NM_003532chr6139 ------
NM_003549chr3128 ------
NM_003557chr14396 317 171 150 11301 4527 524 441 180 193
NM_003559chr1792753 2503 1481 1289 989 841 642 598 245 13546 33116 2411 2407 --
NM_003563chr1741261 1030 1010 436 ----11427
NM_003564chr12168 108 --1236 --
NM_003566chr1253240 3185 2126 454 360 1167 42543 2276 503 491 1976
NM_003574chr1874749 3714 3493 2051 1772 1238 437 35332 479 251 33499 694 42 --
NM_003576chr1382725 2278 2015 1871 912 838 59 42 12852 32804 754 35 --
NM_003580chr82375 182 ----1596
NM_003581chr21104 --2669 243 1960
NM_003582chr11158 ------
NM_003583chr1281202 1099 1043 849 793 774 671 398 --43209 1339 807 784 21239 547
NM_003587chr6137 ------
NM_003590chr252868 2709 1112 632 228 2574 98 23690 1528 --
NM_003597chr252053 1719 1704 911 615 --22299 73 --
NM_003603chr421902 449 --12120 --
NM_003607chr194251 4083 3883 3852 3029 1610 1423 1190 54 --21587 1375 --
NM_003613chr152126 25 ----1575
NM_003615chr393697 3002 2980 2889 2711 2568 926 885 817 1477 1980 13853
NM_003617chr1104544 4523 4501 1592 1519 1479 1130 672 210 43 23356 3272 34642 4553 658 --
NM_003618chr211003 --1963 --
NM_003620chr172925 805 --11108 --
NM_003621chr111506 ------
NM_003622chr121650 --1712 1219
NM_003627chr111421 ------
NM_003629chr163189 2986 2290 1109 910 29 22490 184 21328 828 --
NM_003632chr173760 287 89 ------
NM_003633chr521652 943 12088 32613 2303 1756 --
NM_003644chr17196361 5945 5793 5083 4906 4482 4344 2179 2147 2025 1475 1348 1253 1055 751 714 545 485 355 12471 32460 2171 1699 11358
NM_003655chr172574 538 ----1487
NM_003656chr32166 28 ------
NM_003660chr192671 641 1313 1260 1266
NM_003663chr382524 2500 2176 2124 1110 446 339 272 --22621 848 1925
NM_003664chr51354 ------
NM_003670chr34982 926 222 34 --11000 11356
NM_003671chr993090 2994 2924 2763 2754 2337 2270 1203 816 --1735 13080
NM_003672chr12502 50 --2784 32 --
NM_003677chr1221499 861 --3743 737 421 --
NM_003680chr12251 27 ------
NM_003685chr194931 802 364 23 ------
NM_003688chrX1263 ------
NM_003692chr91317 ------
NM_003701chr131703 ------
NM_003705chr22693 119 --1796 --
NM_003711chr5183 ------
NM_003713chr121368 608 11184 1703 --
NM_003714chr583094 2770 2540 2456 2275 844 265 31 --12684 --
NM_003716chr33829 716 702 ------
NM_003718chr7----1549 --
NM_003722chr362664 2470 2096 765 660 287 --21800 104 1697
NM_003728chr41650 --1251 --
NM_003735chr551769 1682 1238 669 486 --41797 1393 1297 385 --
NM_003736chr551769 1682 1238 669 486 --41797 1393 1297 385 --
NM_003737chr112418 363 ------
NM_003743chr241613 921 583 106 21763 519 ----
NM_003746chr12----1242 1259
NM_003749chr132834 653 --3348 340 337 12018
NM_003750chr102969 812 ------
NM_003758chr1531615 1525 1275 21018 1009 41358 1127 75 70 11499
NM_003758chr1531615 1525 1275 21018 1009 41358 1127 75 70 11499
NM_003759chr4124048 3518 3510 3144 3054 2610 1268 815 428 376 320 280 13074 13388 --
NM_003763chr2043142 2649 698 198 22739 524 12947 1486
NM_003768chr141827 591 316 300 --21744 196 --
NM_003774chr1293292 3226 2690 2358 1266 1187 785 737 251 --53342 3312 2417 2175 717 --
NM_003778chr3--1678 1128 --
NM_003783chr11279 ------
NM_003784chr182242 113 --199 1708
NM_003787chr1821513 622 --11701 11489
NM_003794chr3----3718 431 21 --
NM_003796chr192461 208 ------
NM_003798chr9--173 ----
NM_003799chr18104450 4104 3632 3382 3351 1812 1249 1236 754 722 --31508 889 84 --
NM_003800chr662281 2002 1584 1531 917 182 1765 32398 2055 423 --
NM_003816chr821302 398 ------
NM_003822chr142620 2537 1268 423 --32023 1975 497 12843
NM_003825chr152210 193 1100 21394 1142 --
NM_003829chr93453 163 144 --1196 --
NM_003850chr131210 ----1517
NM_003860chr112313 144 177 ----
NM_003861chr1452899 2570 2107 859 241 32743 2058 1987 52854 2709 2026 575 369 1603
NM_003862chr51333 ------
NM_003870chr15112048 1997 1985 1976 1705 1626 238 229 150 76 58 11775 1279 1485
NM_003872chr282979 2711 2002 1197 932 538 527 242 --32224 434 76 21879 891
NM_003873chr1051835 1001 744 311 127 ------
NM_003877chr123928 239 177 --1689 1698
NM_003884chr32293 149 11690 --1716
NM_003885chr1742016 1933 1902 1694 --32501 2308 716 11030
NM_003887chr262303 1924 1631 446 347 336 1113 1489 --
NM_003888chr1581459 1325 1253 1235 1152 524 381 364 --41305 1098 343 58 --
NM_003895chr2131578 773 303 12067 21352 215 --
NM_003902chr11593 --2670 125 --
NM_003908chr2021032 453 --21342 443 --
NM_003909chr862759 2398 2096 1018 969 921 --22978 1885 1120
NM_003913chr684052 3926 3526 2690 1570 495 464 95 12905 44170 3743 3208 1581 --
NM_003916chrX11327 --2950 262 --
NM_003919chr7----172 --
NM_003921chr11337 --2724 227 --
NM_003922chr152430 30 ------
NM_003924chr441209 662 650 201 11380 11404 --
NM_003927chr183774 724 445 ------
NM_003930chr732033 2004 1714 --2160 26 --
NM_003931chr65473 126 104 63 47 ------
NM_003932chr2231861 1803 698 11734 21935 1852 --
NM_003934chr921165 334 ------
NM_003938chr195985 961 395 208 183 ------
NM_003939chr10133895 3428 3089 2677 1495 1383 1195 900 888 738 635 289 281 44026 3464 2861 240 43103 1054 691 651 --
NM_003941chr732031 2009 534 22252 187 ----
NM_003947chr341232 415 240 102 --1205 --
NM_003948chr441946 843 112 55 32678 2523 704 32622 2198 1975 12426
NM_003953chr172632 2345 2200 2150 876 824 575 --22265 307 --
NM_003954chr1721219 277 ----11176
NM_003958chr6143894 3658 3649 3103 3088 2992 2639 2506 875 741 512 427 282 70 1888 53741 3030 1328 867 685 --
NM_003966chr5207206 7141 6787 6016 5856 5322 4781 2960 2737 2690 2682 2643 2566 2050 1947 1875 1858 1425 890 42 --106633 6420 5241 2741 2723 2718 2711 2342 2338 390 --
NM_003971chr17268 41 ------
NM_003980chr631062 590 216 --165 --
NM_003983chr16154395 4272 4145 4048 3840 3289 3179 2874 2789 1300 1219 1145 981 471 452 1867 64457 3691 1616 1042 456 402 --
NM_003986chr113308 127 104 ------
NM_003987chr1051702 1638 1628 1594 1542 --11567 --
NM_003988chr1051779 1715 1705 1671 1619 --11644 --
NM_003989chr1051638 1574 1564 1530 1478 --11503 --
NM_003990chr1051638 1574 1564 1530 1478 --11503 --
NM_003994chr1283505 3094 3000 2719 2687 1705 464 384 --33371 1685 1546 11725
NM_003998chr4----2497 158 --
NM_004006chrX32048 913 526 ----32139 2029 594
NM_004007chrX32048 913 526 ----32139 2029 594
NM_004009chrX32048 913 526 ----32139 2029 594
NM_004010chrX32048 913 526 ----32139 2029 594
NM_004011chrX32048 913 526 ----32139 2029 594
NM_004012chrX32048 913 526 ----32139 2029 594
NM_004013chrX32048 913 526 ----32139 2029 594
NM_004014chrX32048 913 526 ----32139 2029 594
NM_004015chrX32048 913 526 ----32139 2029 594
NM_004016chrX31962 827 440 ----32053 1943 508
NM_004017chrX32048 913 526 ----32139 2029 594
NM_004018chrX31962 827 440 ----32053 1943 508
NM_004019chrX152 198 1332 --
NM_004020chrX32048 913 526 ----32139 2029 594
NM_004021chrX31962 827 440 ----32053 1943 508
NM_004022chrX31962 827 440 ----32053 1943 508
NM_004023chrX31962 827 440 ----32053 1943 508
NM_004027chr2172 ------
NM_004028chr1883847 3626 2874 1619 1521 612 554 57 1354 ----
NM_004035chr1774645 4411 3934 3828 3319 1095 556 --35188 1076 251 --
NM_004040chr221208 1027 11145 11166 --
NM_004050chr1492332 2287 2001 870 762 745 609 585 535 12315 1967 --
NM_004055chr1182214 1431 796 663 554 537 208 98 1525 --11721
NM_004056chr81392 ------
NM_004059chr94433 164 124 53 ------
NM_004061chr51643 --2534 146 1577
NM_004063chr84959 921 827 660 1123 ----
NM_004067chr711067 --21585 1257 --
NM_004071chr21270 ------
NM_004075chr122572 84 ------
NM_004077chr1251234 1100 998 374 177 ------
NM_004080chr73603 567 550 --21483 299 --
NM_004081chrY51885 1473 1395 255 95 ------
NM_004085chrX1280 --1806 --
NM_004086chr14--1151 1638 --
NM_004087chr351350 1337 574 459 283 --31510 69 24 --
NM_004089chrX2455 362 ------
NM_004093chr1322379 1310 12177 ----
NM_004094chr1442843 1088 553 434 ------
NM_004096chr1051341 824 778 668 437 --61536 781 652 643 186 140 --
NM_004098chr1031181 978 806 11192 ----
NM_004100chr642568 2371 378 361 11961 12574 --
NM_004105chr24906 727 312 232 ----11098
NM_004112chr1731765 1639 1212 --1556 --
NM_004113chr341745 70 51 21 11967 32017 764 153 --
NM_004114chrX2368 257 --1795 165
NM_004115chr131139 ------
NM_004116chr22451 138 --1410 --
NM_004124chr1493456 2730 2279 629 519 354 232 199 131 23174 2323 1689 --
NM_004130chr32646 460 ------
NM_004136chr1532361 2190 166 --1486 1912
NM_004161chr281392 1363 1316 1034 509 458 348 22 ------
NM_004162chr351039 466 325 265 33 --21127 1002 --
NM_004169chr172238 155 ------
NM_004170chr921346 327 --1420 --
NM_004171chr11329451 9332 9281 9225 9216 9199 9031 8769 8506 8299 8240 8211 7816 7148 7011 6861 6532 6424 5899 3522 2804 2776 2464 2440 1705 1645 1448 1179 1168 406 298 217 28885 1112 46579 6319 6192 3173 17396
NM_004175chr22130 --1106 --
NM_004180chr22459 245 ------
NM_004185chr13625 165 80 --1635 --
NM_004187chrX51339 1286 432 362 59 ------
NM_004193chr103400 194 49 --1404 --
NM_004199chr5----174 --
NM_004200chr1162074 1197 1095 1055 922 243 --23231 2885 --
NM_004210chr1091866 1606 1351 845 579 573 265 88 36 21563 117 1393 --
NM_004215chr82368 215 ------
NM_004229chrX3695 668 346 --11530 22173 1617
NM_004231chr71266 ------
NM_004232chr1862899 1512 1178 980 883 302 1676 11516 11067
NM_004235chr91749 1218 ----
NM_004236chr151374 1479 1426 --
NM_004239chr14----1124 --
NM_004241chr101117 ------
NM_004252chr174693 509 152 63 ------
NM_004255chr15------1112
NM_004261chr1128 --1773 --
NM_004263chr271637 1411 1348 518 429 148 107 --1694 --
NM_004268chr1141226 1217 939 300 ------
NM_004272chr531754 586 471 1649 11814 --
NM_004274chr1463119 3048 2988 216 176 160 11028 1319 13191
NM_004277chr631173 179 168 ------
NM_004279chr751897 1737 1459 537 179 12334 21940 799 --
NM_004290chr541160 521 411 299 11035 21120 879 --
NM_004293chr953793 3462 2701 2688 2460 ------
NM_004295chr1731175 1069 440 ------
NM_004296chr1483970 3952 3222 1509 1410 1027 239 85 --13432 --
NM_004301chr3----130 1238
NM_004302chr1242458 2286 2187 389 ------
NM_004304chr23377 287 24 ------
NM_004308chr1171894 1809 1744 1688 609 57 31 --1189 --
NM_004311chr1072756 2729 2051 1256 1220 1191 848 --42977 2947 341 225 --
NM_004316chr12----11185 --
NM_004319chr1102549 2537 2519 2506 2379 1996 651 557 459 163 --62929 2489 2424 1085 850 708 12459
NM_004320chr16172 ------
NM_004323chr9122570 2469 2343 2254 2039 2017 865 818 649 616 194 85 --32169 2067 2031 --
NM_004326chr171150 1140 1038 924 799 342 325 --3992 804 760 --
NM_004329chr1021444 112 21258 1033 1555 --
NM_004330chr152776 306 ------
NM_004331chr812614 ----1905
NM_004338chr18126049 5133 4704 4695 4687 4546 2560 2025 1148 994 553 447 12516 46560 2314 1632 148 --
NM_004342chr772308 2287 2132 2106 1702 1635 1454 11733 ----
NM_004349chr831078 915 58 ----11267
NM_004352chr162522 176 1119 ----
NM_004354chr41237 --1867 --
NM_004356chr111455 ------
NM_004369chr21216 ----1644
NM_004370chr641458 677 648 592 --11830 --
NM_004371chr13962 620 189 --1142 --
NM_004374chr8124 --1108 --
NM_004379chr231500 1243 595 ------
NM_004380chr1622409 2209 --1647 1737
NM_004384chr53557 474 415 --21879 310 1182
NM_004385chr52685 664 --1679 --
NM_004386chr1991913 1895 1831 1470 803 186 155 140 45 --21975 1653 --
NM_004389chr21230 --1589 --
NM_004392chr1351831 1645 555 169 91 --22655 348 --
NM_004393chr322337 255 ------
NM_004395chr5----4714 698 230 181 --
NM_004397chr1163755 1670 1352 570 410 73 --44169 3226 941 763 --
NM_004405chr23917 403 320 ----1932
NM_004411chr71581 ------
NM_004414chr21183 --1484 --
NM_004417chr5----2594 130 1598
NM_004420chr1152198 2088 1591 612 458 --11553 11542
NM_004423chr3102520 2442 2242 2180 2141 1696 1014 784 707 370 --52454 2249 1095 220 56 --
NM_004426chr123790 591 538 --21615 196 --
NM_004427chr141114 424 407 255 --1780 --
NM_004429chrX61168 1030 960 940 556 59 ------
NM_004430chr872608 2585 2186 1065 1043 895 796 --12235 --
NM_004432chr932051 1568 369 --1408 --
NM_004433chr171726 1484 627 549 313 256 198 --11294 --
NM_004437chr172663 2418 2298 1406 489 361 188 --43267 1234 1046 574 1171
NM_004438chr243201 2530 352 225 1795 1926 --
NM_004439chr4123 ------
NM_004440chr64593 438 386 282 --31621 1568 413 --
NM_004441chr361272 1206 497 414 386 170 --11195 --
NM_004442chr12634 30 1470 21588 357 --
NM_004444chr73639 570 548 ------
NM_004446chr1265 33 ------
NM_004447chr123731 454 253 ------
NM_004449chr211586 --11110 --
NM_004450chr142324 251 1404 ----
NM_004454chr322011 1547 31729 887 510 21929 661 --
NM_004457chr241079 606 188 98 --11633 --
NM_004458chrX21688 467 11943 1845 12311
NM_004459chr1721790 1259 --31660 1515 1338 --
NM_004468chr12541 58 ------
NM_004472chr5151 ------
NM_004474chr13924 649 404 --2691 653 --
NM_004480chr141701 --1179 1533
NM_004481chr1102469 2454 2290 2110 1816 1731 818 735 258 206 --12016 1984
NM_004482chr23753 659 42 --1759 1765
NM_004484chrX2333 52 --1305 --
NM_004485chr1103212 2892 2812 2780 2758 2751 1065 443 152 28 --43861 2764 2681 180 --
NM_004492chr15134 ------
NM_004493chrX2140 32 --143 --
NM_004494chr151081 1066 808 271 239 1123 1815 --
NM_004496chr1431163 308 290 --11153 --
NM_004497chr191539 --1591 --
NM_004501chr183586 3299 2894 1623 1248 488 357 34 --1120 --
NM_004504chr242825 2484 2006 1923 1516 1500 --
NM_004505chr1752029 1515 1385 422 356 ------
NM_004506chr62257 144 ------
NM_004514chr1752810 2626 1927 806 436 11199 1587 --
NM_004519chr81163 1248 1193 --
NM_004527chr1731174 1067 84 --1483 --
NM_004529chr941413 1110 1034 233 1574 ----
NM_004535chr2021726 1581 --21493 347 --
NM_004554chr142595 112 ----11500
NM_004561chr11----21849 689 --
NM_004566chr1072460 2138 1803 1017 854 549 94 --11665 --
NM_004573chr152217 49 --1773 --
NM_004575chr451461 579 266 190 36 --21260 52 --
NM_004576chr5----1288 --
NM_004583chr175750 492 259 242 132 ------
NM_004586chrX74911 4683 4454 4017 3813 1939 849 33656 2178 1952 35153 1243 154 15140
NM_004588chr1173609 3246 3178 3092 2644 1630 1084 --43452 3096 2925 2801 13676
NM_004593chr31896 ----1774
NM_004595chrX1102 --1115 --
NM_004598chr5143105 2920 2785 2678 2121 1126 1105 1048 939 868 817 759 422 98 12928 43023 2565 2562 268 --
NM_004600chr1--21333 1083 41553 1508 1042 541 1231
NM_004602chr2021426 1299 --1561 --
NM_004603chr73386 304 139 ------
NM_004612chr9134808 4550 3815 1612 1521 1468 1356 1271 828 443 190 35 28 --1114 13247
NM_004615chrX1787 ------
NM_004619chr162171 1759 1731 637 212 119 --1278 --
NM_004620chr113564 147 53 ------
NM_004630chr1161103 1046 939 891 250 241 --41131 1040 960 256 --
NM_004631chr111024 --21229 1068 11258
NM_004637chr331288 1115 80 --21329 1156 --
NM_004639chr6124 --1100 --
NM_004641chr1021229 119 --2607 523 --
NM_004643chr14----2728 537 --
NM_004645chr171536 --2746 276 --
NM_004654chrY----164 126
NM_004655chr173993 875 504 ------
NM_004656chr33956 248 152 --1395 --
NM_004660chrY32207 1492 751 --12082 --
NM_004663chr1561244 1204 1166 616 411 243 ----11458
NM_004667chr151222 ------
NM_004670chr1061651 1265 1132 494 458 421 ------
NM_004673chr121493 477 --11157 --
NM_004685chr131319 --42025 1979 1109 559 --
NM_004686chr871778 1560 635 568 437 348 310 --1614 1680
NM_004687chr1762002 1736 1385 274 77 52 1183 ----
NM_004690chr64808 667 653 154 ------
NM_004697chr921058 56 --21062 791 --
NM_004703chr1742345 1830 294 282 --1529 --
NM_004705chr111188 --3725 606 222 --
NM_004709chrX61570 1548 1438 1297 450 179 --2233 221 --
NM_004710chr173779 384 256 ------
NM_004715chr182707 97 --1691 --
NM_004716chr114810 783 104 34 --2858 715 --
NM_004718chr2--1648 155 --
NM_004719chr1232452 1109 189 --22715 2533 32727 1984 1113
NM_004723chr11237 --11031 --
NM_004725chr1021289 1204 --21322 478 11246
NM_004726chrX115321 5167 4490 4002 3837 3714 3640 1676 1501 1086 734 34702 569 295 23485 144 --
NM_004730chr522003 1928 12122 1528 --
NM_004734chr1353117 2717 2426 1045 596 --32289 2281 655 12159
NM_004736chr161856 1428 1416 622 458 52 --1184 --
NM_004739chr112660 538 --1454 --
NM_004742chr341567 302 263 127 --2656 362 --
NM_004744chr463529 2931 2688 1577 316 188 --1709 --
NM_004745chr8156922 6491 6178 5999 4953 4906 4430 4397 4293 2244 2018 1556 1481 1152 277 15018 26601 4296 46962 6634 4871 1925
NM_004746chr182342 62 ------
NM_004748chr1543935 3425 1360 1242 12936 23572 1312 1303
NM_004757chr4--1113 ----
NM_004758chr172756 417 --31129 317 162 1972
NM_004760chr731611 742 267 --22211 626 12434
NM_004762chr1751856 1482 1286 96 52 11491 2283 232 --
NM_004764chr123212 204 164 ------
NM_004768chr1--1322 152 --
NM_004772chr541402 1351 1273 506 --11361 --
NM_004774chr1772847 2688 2445 2322 1954 429 214 --62488 2398 2147 1118 898 338 --
NM_004779chr54915 530 243 224 1890 2498 493 1906
NM_004783chr16--1520 ----
NM_004785chr16----1493 --
NM_004788chr1132042 966 719 --91910 1863 911 351 291 285 97 87 67 --
NM_004789chr9----2375 361 --
NM_004792chr2--173 ----
NM_004796chr1452449 2006 1815 1615 330 12300 12250 --
NM_004797chr393248 3216 3200 3004 741 715 555 521 459 --73273 3232 3224 3208 3191 2877 633 12756
NM_004798chr2083534 2409 1262 929 863 691 345 289 --32577 333 306 --
NM_004801chr241446 1161 456 175 --182 --
NM_004805chr211413 --2913 115 --
NM_004815chr1114427 4377 4336 4036 3900 3760 3691 3509 3242 1570 146 13894 2887 858 --
NM_004821chr54623 611 510 188 --3628 594 586 --
NM_004822chr1743701 3082 2468 527 --23914 926 --
NM_004824chr641016 486 392 384 ------
NM_004831chr191696 --2755 720 1927
NM_004834chr283418 3103 2806 2731 325 308 140 66 --1160 --
NM_004836chr22725 99 ------
NM_004839chr153180 171 151 --3618 452 76 --
NM_004841chr141150 978 879 741 --3803 717 323 --
NM_004845chrX63913 2919 1118 1085 697 159 --123938 3717 3322 3070 2953 2939 2913 2887 2874 2868 2841 2831 --
NM_004857chr1474697 4008 3664 1919 1397 1225 1126 13456 43392 3306 1586 366 --
NM_004859chr1732405 854 251 --12155 --
NM_004863chr14154620 4015 3687 3629 3577 3545 3511 3322 1841 1136 1121 1030 714 671 649 --45095 3926 629 191 23327 654
NM_004866chr574755 4016 3544 3532 1658 153 47 14653 31009 817 404 --
NM_004869chr181159 --11214 --
NM_004871chr1773926 3459 3114 3091 1721 958 428 --64238 3916 3734 3586 1507 178 --
NM_004873chr1462934 2477 2186 930 755 240 21247 593 33068 1195 1143 --
NM_004874chr81526 --1122 --
NM_004879chr113654 304 130 ------
NM_004884chr1541652 1416 418 223 11456 ----
NM_004887chr53970 947 123 --21005 299 --
NM_004891chr21170 ------
NM_004896chr1041424 621 609 370 1403 --1131
NM_004897chr102263 77 --3928 640 144 --
NM_004898chr472842 2754 2744 2609 1957 1950 629 32415 2138 537 22273 696 12591
NM_004902chr201212 ------
NM_004904chr7146360 6123 6093 5472 4732 4718 2098 1632 1573 662 579 233 109 55 25869 4763 55044 4710 1964 1790 610 --
NM_004905chr12932 875 ------
NM_004906chr6----1561 --
NM_004912chr711391 ----11730
NM_004922chr101844 --21004 664 --
NM_004924chr193874 159 74 --1348 --
NM_004926chr1441347 679 546 69 --51780 1748 1495 1318 214 --
NM_004930chr12275 219 --150 --
NM_004932chr53660 519 91 --1532 11415
NM_004938chr941042 448 262 97 1378 21103 152 --
NM_004939chr21155 ------
NM_004947chr332598 847 277 --41605 688 429 248 1258
NM_004952chr11777 ------
NM_004953chr31300 ------
NM_004956chr7103145 3074 3040 3015 2855 1135 889 878 816 630 13127 142 11840
NM_004961chrX51297 551 523 244 197 --1572 --
NM_004964chr13484 203 48 --2524 83 --
NM_004968chr72642 634 ------
NM_004972chr94895 867 209 171 --11078 --
NM_004973chr631224 1160 492 --31067 551 120 --
NM_004976chr1174826 4447 4194 1481 1398 1354 56 1636 65195 4188 3593 3568 3560 1846 --
NM_004978chr1101598 1354 1347 1283 1260 501 477 409 222 47 ------
NM_004979chrX5804 388 188 51 31 --31054 1049 1035 --
NM_004985chr1273703 1799 1585 1429 1339 896 553 --34205 2964 666 33689 480 178
NM_004992chrX257980 7687 7523 7162 7088 7075 7047 6984 6805 6311 5774 5699 5317 3078 2621 2456 2369 2292 2236 2048 1306 1274 1256 933 61 25382 957 76376 6170 5671 3060 1829 1801 1216 --
NM_004992chrX257980 7687 7523 7162 7088 7075 7047 6984 6805 6311 5774 5699 5317 3078 2621 2456 2369 2292 2236 2048 1306 1274 1256 933 61 25382 957 76376 6170 5671 3060 1829 1801 1216 --
NM_004993chr1441369 1244 1016 991 --1553 --
NM_004995chr143618 372 127 ------
NM_004996chr1661714 1210 1189 577 541 494 ------
NM_004999chr6114437 4257 3654 3221 2983 1593 1384 1228 533 275 268 2314 235 --14472
NM_005010chr721477 230 1448 32139 2034 282 134
NM_005011chr721364 1270 --11753 --
NM_005020chr73555 86 64 --3566 529 78 --
NM_005021chr62276 107 --2149 143 --
NM_005023chr511539 ------
NM_005028chr1032244 2035 826 1777 12252 --
NM_005030chr161267 ------
NM_005040chr11----2333 29 --
NM_005044chrX63725 3675 3031 1355 516 93 1256 23714 124 13024
NM_005045chr73848 729 28 ------
NM_005056chr12114942 4153 4142 1806 1786 1676 1581 704 482 449 195 22069 420 75020 2193 2029 1982 1814 1446 390 --
NM_005060chr12536 253 21329 998 183 --
NM_005063chr10123433 3275 3243 2679 1421 1389 990 443 386 264 238 210 1220 72454 1199 956 677 673 200 24 --
NM_005065chr1495343 5114 3758 3685 2030 1645 1194 636 321 --11978 34885 2003 1904
NM_005066chr1--1718 1199 --
NM_005067chr3------1392
NM_005068chr611147 11462 ----
NM_005076chr1104231 3736 3214 2914 2764 2685 2669 2641 1257 1187 --24159 3611 --
NM_005077chr92372 346 ------
NM_005078chr1521471 326 --21452 1173 --
NM_005079chr843120 2671 1217 424 1358 32271 371 125 1214
NM_005080chr222944 299 1783 1737 --
NM_005087chr31116 --1786 --
NM_005088chrX3911 268 181 1231 ----
NM_005093chr20165385 4749 4514 4453 3800 3411 1729 1331 1257 1163 1092 957 913 711 528 201 --34117 801 258 --
NM_005095chr172173 2048 1373 876 807 245 96 ------
NM_005096chrX61114 1011 417 204 167 118 2441 145 ----
NM_005097chr10179 ------
NM_005099chr131311 1253 133 --1517 --
NM_005105chr151981 1533 745 683 28 --11913 --
NM_005109chr3112565 2527 2475 2228 2036 1785 620 364 249 155 140 --12113 11971
NM_005110chr51557 --3640 530 182 --
NM_005112chr41781 --31036 860 173 176
NM_005116chr20144316 4231 4098 3859 3442 1487 1469 983 968 685 445 406 304 54 --1375 --
NM_005119chr131066 432 255 ------
NM_005121chr1752996 2386 892 438 81 --13259 --
NM_005124chr62217 132 --1140 --
NM_005126chr332207 848 369 ----11953
NM_005128chr212640 510 --1653 1661
NM_005133chr113373 294 284 ------
NM_005134chr185846 762 352 311 228 --1109 --
NM_005135chr1563807 3630 3578 3416 1274 583 21333 823 3899 753 660 12701
NM_005151chr1872402 2062 1740 898 792 426 298 ------
NM_005153chr161105 1752 ----
NM_005154chr151466 ------
NM_005156chr9104741 4706 4320 4101 4076 1930 1624 1510 1417 957 1623 33798 3643 1151 --
NM_005157chr971955 1924 1329 715 603 407 201 --31749 1584 370 --
NM_005159chr1532134 1945 598 1436 11906 --
NM_005160chr22126093 5781 5743 5642 4915 4640 4271 2637 2104 1149 880 550 16059 ----
NM_005163chr143972 120 88 ------
NM_005168chr211761 1404 11300 --
NM_005175chr17----199 --
NM_005176chr12----159 --
NM_005180chr1021219 544 --1241 --
NM_005181chr82778 60 --1653 --
NM_005182chr163429 87 41 ------
NM_005184chr1961410 1121 180 173 49 34 --2350 216 --
NM_005186chr112575 105 ------
NM_005187chr1641654 1438 1322 380 21310 374 2410 344 --
NM_005188chr11237987 7870 6911 6788 5929 5692 5659 5586 5551 5488 5456 5437 3076 2922 2789 2782 2617 2258 1642 1426 1363 1141 632 37264 1920 585 96033 5973 3141 3128 2465 2311 1383 1228 86 27131 3284
NM_005197chr14106095 5509 5469 5080 1734 1715 1585 904 306 169 1757 114992 4949 4808 4532 4374 1738 1494 1471 1457 1262 141 15379
NM_005206chr172981 410 --1414 --
NM_005207chr2231274 292 55 13304 22417 77 13169
NM_005215chr183759 510 169 ------
NM_005219chr561566 1348 1122 465 338 288 11283 3413 131 92 --
NM_005222chr78960 613 271 258 201 185 171 142 1632 4390 220 214 189 --
NM_005224chr193699 458 245 --1578 --
NM_005227chr1--1458 ----
NM_005229chrX2411 201 ------
NM_005230chr122391 241 ------
NM_005233chr382184 2164 1800 1780 825 588 510 255 11007 ----
NM_005235chr2187709 7024 6439 5976 5755 5040 3035 2808 2443 1910 1587 1524 964 894 743 348 216 81 46133 2164 1959 870 97618 7587 7574 5562 5442 5366 352 224 68 1679
NM_005238chr1132962 2657 2434 13042 32578 2175 1399 --
NM_005241chr341316 982 456 389 --21087 958 --
NM_005252chr141541 --1305 --
NM_005254chr154978 494 452 328 --11087 --
NM_005256chr111245 ------
NM_005257chr1851286 1172 1156 552 382 --21270 352 1886
NM_005259chr21993 ------
NM_005261chr81417 ----1271
NM_005264chr102170 68 --1146 --
NM_005268chr1----1225 --
NM_005271chr1041001 862 32 22 1264 194 --
NM_005277chr441415 1285 640 240 11330 11603 --
NM_005278chrX1562 ------
NM_005279chr22176 49 ------
NM_005296chrX3983 217 37 ------
NM_005302chr7178 --1302 --
NM_005308chr101161 ----1348
NM_005311chr752883 2568 1904 1791 733 --31909 1795 782 1712
NM_005313chr1531123 1008 394 1363 --1149
NM_005316chr112953 942 ----1959
NM_005318chr224875 171 142 62 1953 31164 860 73 --
NM_005324chr1741745 1587 1456 320 --1634 1464
NM_005328chr82589 249 1556 2699 593 150
NM_005329chr1672262 2242 2068 1977 1719 1575 936 --1884 --
NM_005334chrX61656 587 544 488 453 128 1572 4242 145 139 30 --
NM_005336chr232152 1878 843 --22029 407 --
NM_005339chr463540 1593 1166 754 426 40 14069 2813 664 --
NM_005342chrX11928 22518 865 12542 12046
NM_005347chr9--11447 ----
NM_005348chr142967 898 --148 --
NM_005349chr41483 ------
NM_005358chr1341856 1356 672 506 ------
NM_005359chr18116357 6197 6026 5345 5234 5102 4985 4382 4351 829 250 25963 1953 76461 5056 4368 4365 1896 771 185 --
NM_005374chr17112427 2400 2094 1919 1804 1782 1534 700 690 614 390 --22363 2107 --
NM_005375chr64805 390 163 66 ------
NM_005378chr23827 757 323 ------
NM_005380chr131316 1300 1174 ------
NM_005385chr372502 2421 2151 2104 1985 1936 898 --11073 --
NM_005386chr201590 --1698 --
NM_005387chr113261 236 183 1601 --1205
NM_005388chr941668 559 80 28 --31603 1344 73 --
NM_005389chr63680 672 208 --123 --
NM_005392chr961726 1362 1187 1180 490 205 --11192 11672
NM_005397chr763393 2519 1435 912 711 554 13589 63599 3526 3068 1400 976 189 --
NM_005398chr102951 264 11436 ----
NM_005399chr1114345 4242 3782 2789 2765 1326 1209 1067 902 705 576 33480 2926 487 32801 1083 561 1581
NM_005400chr282803 2761 2259 2140 1962 956 883 656 --52972 2752 2675 2669 2250 --
NM_005402chr721602 1426 1389 41868 1747 1373 334 --
NM_005407chr1481276 409 307 300 290 249 238 200 11251 11286 1101
NM_005409chr4------11078
NM_005410chr5--2752 619 --1598
NM_005412chr121490 --1182 --
NM_005413chr23430 365 77 ------
NM_005415chr21236 ----1268
NM_005430chr128997 898 862 848 811 405 382 150 --1950 --
NM_005433chr1842750 2374 689 90 12810 22194 309 --
NM_005436chr1063795 3244 888 703 417 74 14088 23474 2809 --
NM_005437chr1031033 915 420 --1116 11107
NM_005439chr123509 390 183 --174 --
NM_005440chr17113283 3266 2936 2846 2484 2329 826 703 385 186 167 --1393 --
NM_005442chr32545 71 1137 ----
NM_005443chr41125 --2472 467 --
NM_005445chr101125 ------
NM_005455chr111157 --31435 1223 743 --
NM_005458chr972417 2232 2187 1882 1704 249 214 12162 ----
NM_005460chr52146 74 --1100 --
NM_005461chr2021532 286 ------
NM_005465chr131633 1596 820 ------
NM_005474chr1731230 1119 266 1130 21264 569 --
NM_005475chr1283016 2874 2755 2031 1076 339 204 85 11133 12051 --
NM_005476chr941443 208 149 29 ------
NM_005477chr1542108 743 47 24 12430 238 31 --
NM_005477chr1542108 743 47 24 12430 238 31 --
NM_005479chr1041207 1013 618 303 --11589 --
NM_005483chr19--1365 ----
NM_005487chr2261763 1637 1567 1449 258 77 --21911 1486 --
NM_005488chr225715 668 229 121 76 --1661 --
NM_005493chr6--1270 ----
NM_005494chr71662 ------
NM_005499chr19172 ------
NM_005501chr17147 ------
NM_005502chr942343 2208 2179 2139 --32802 2250 54 --
NM_005503chr152322 260 ------
NM_005504chr12266591 6180 5805 5604 5392 5367 4494 4370 4347 4282 2521 2445 2053 2040 1766 1707 1683 1626 1578 1545 616 547 488 289 268 151 --24754 4287 25192 4293
NM_005509chr531708 429 323 178 --1402
NM_005512chr1141478 1285 1266 557 --21523 134 11302
NM_005513chr351465 1227 561 204 24 11108 --129
NM_005517chr11350 --1251 21369 1336
NM_005520chr51771 --1726 --
NM_005522chr731006 346 107 11284 2285 111 --
NM_005524chr3----1328 --
NM_005530chr1541295 1200 1170 387 2561 455 41470 1449 1188 313 --
NM_005537chr13----1130 1849
NM_005539chr1031108 1055 348 ------
NM_005541chr241190 1061 1025 994 ------
NM_005542chr721336 638 --11710 --
NM_005544chr23954 755 120 158 ----
NM_005552chr142184 88 --1167 1536
NM_005561chr132855 100 --3370 49 45 --
NM_005562chr151457 676 520 492 421 11710 ----
NM_005563chr13835 578 24 ------
NM_005565chr52469 132 --1193 1138
NM_005566chr112432 76 ------
NM_005570chr182820 473 --11041 --
NM_005573chr51253 --2601 145 2664 102
NM_005578chr3155111 4965 4776 4760 4672 4369 3742 3415 1974 1952 1735 1603 1448 991 103 --64796 4788 4764 3873 1921 485 2954 855
NM_005584chr131572 ----1114
NM_005593chr12129 1449 3438 199 196 --
NM_005595chr13876 305 177 ------
NM_005596chr995811 5182 4915 4106 3946 2463 2008 811 91 14234 25918 2510 --
NM_005599chr121362 154 11190 21313 529 --
NM_005604chr632174 820 707 1189 2775 576 --
NM_005607chr82868 148 149 1714 --
NM_005610chr11215 --2287 45 --
NM_005611chr16183 ----1924
NM_005613chr121842 305 --32136 1598 868 11608
NM_005618chr6----2630 34 --
NM_005625chr82342 46 1674 21059 999 2793 257
NM_005626chr1----2206 152 --
NM_005627chr61211 ------
NM_005634chrX3624 454 239 ------
NM_005637chr181490 1838 ----
NM_005638chrX61720 1518 1299 680 507 120 ----11406
NM_005639chr1231495 212 83 11278 ----
NM_005647chrX63223 868 822 640 588 544 13304 1843 --
NM_005655chr81487 --21091 242 1367
NM_005659chr222384 373 ------
NM_005660chrX138 ------
NM_005662chr81115 --181 --
NM_005665chr154452 4336 3659 1472 352 13050 13107 --
NM_005668chr564354 3011 2837 1609 578 534 23309 2847 ----
NM_005669chr532202 1753 955 12290 1350 --
NM_005684chr11283 --1139 --
NM_005686chr161546 1451 1424 1135 287 33 ------
NM_005688chr31100 --31021 483 403 --
NM_005707chr152318 141 ------
NM_005708chr132376 337 ------
NM_005711chr5----2441 250 --
NM_005715chr642299 2034 1003 430 --22248 193 --
NM_005717chr12943 223 1166 1103 --
NM_005721chr21859 ------
NM_005722chr231882 851 605 --1458 3688 253 50
NM_005725chr13883 876 389 --31585 671 438 --
NM_005730chr1283405 3286 980 791 729 684 424 345 12585 33064 2951 1153 --
NM_005731chr22355 271 ------
NM_005734chr112710 203 --1644 --
NM_005736chr1011540 --1989 --
NM_005737chr262897 2879 2818 2264 1065 382 --32861 2056 1796 --
NM_005738chr731784 476 199 --141 --
NM_005739chr1581880 1788 1557 1524 897 535 491 324 --41807 868 454 175 --
NM_005746chr742696 2073 1955 1867 --12662 --
NM_005748chr1243350 3244 1072 473 1318 32548 2298 1256 --
NM_005749chr17------1515
NM_005751chr7----147 --
NM_005752chr1621127 275 --2852 263 --
NM_005754chr521187 269 --1467 --
NM_005756chrX31378 1028 561 --1485 --
NM_005759chr2124698 3634 3397 3022 1892 1722 939 560 451 389 356 327 13247 33892 3517 534 --
NM_005761chr12137 ------
NM_005765chrX1575 ------
NM_005766chr132547 351 1977 259 54 --
NM_005768chr12170 --1576 --
NM_005776chr141295 ----1852
NM_005778chr31197 1483 ----
NM_005779chr53848 771 26 --63400 3147 777 728 434 319 1800
NM_005780chr1321032 714 --1796 --
NM_005783chr21420 1227 ----
NM_005786chr1821267 886 --2990 93 --
NM_005789chr1782166 2063 1944 1916 1531 436 342 205 1198 1467 --
NM_005796chr163252 45 34 ------
NM_005801chr17264 39 ------
NM_005802chr92257 110 ----1530
NM_005808chr3113573 3390 3000 2820 2736 2709 2623 1344 1278 992 798 --2950 304 --
NM_005813chr22991 985 --1312 --
NM_005814chr141446 941 128 74 --11093 11264
NM_005822chr681844 1645 684 451 371 275 116 36 11770 21697 820 --
NM_005826chr1161 --1174 --
NM_005828chr17134588 4224 3777 3738 3271 2024 1969 1928 1601 1505 737 444 260 14702 83751 3744 1681 1647 577 339 244 234 --
NM_005832chr321272 60 11035 1255 --
NM_005834chrX1237 --1181 --
NM_005839chr11802 --2379 376 1299
NM_005840chrX237392 6898 6272 5608 5467 2687 2495 2448 2406 1713 1436 1077 922 914 721 617 583 572 501 481 202 180 32 34717 2159 1949 87207 6522 6188 4804 621 566 527 494 2682 399
NM_005841chr46928 917 873 733 158 114 --1152 --
NM_005843chr241938 1831 1538 512 --21588 1325 21774 266
NM_005852chr1741126 275 177 150 --21169 1045 --
NM_005857chr141440 602 569 367 11405 ----
NM_005859chr52523 444 --1183 11490
NM_005862chr3--1968 ----
NM_005863chr104572 492 192 68 --21423 283 --
NM_005864chr144711 680 282 159 ------
NM_005866chr92864 674 --1678 --
NM_005875chr3--147 ----
NM_005876chr21701 ------
NM_005880chr16----11228 --
NM_005882chr44967 356 267 66 ------
NM_005884chr191626 --1263 --
NM_005885chr551072 226 178 59 44 ------
NM_005895chr1274157 4038 2821 1593 1070 1031 394 --22577 1089 --
NM_005896chr24808 776 631 282 --1643 --
NM_005898chr1163090 2764 2073 954 831 252 12720 12229 11244
NM_005900chr431120 822 437 --1803 11194
NM_005901chr18128493 7163 6415 6315 5973 5912 5709 3455 2921 2227 455 49 16220 118412 8247 8173 7879 6831 6133 6129 5581 5578 5335 1501 17308
NM_005903chr5114506 4302 4086 3732 3555 3497 1974 1791 1645 1624 623 14602 44475 4169 1932 671 --
NM_005904chr1831042 594 73 --2143 140 11055
NM_005906chr641310 1068 385 56 ------
NM_005907chr631283 490 175 4682 540 355 188 161 21629 442
NM_005909chr584089 3906 3284 3255 2830 524 161 53 --22712 1294 --
NM_005910chr1764009 2983 1011 867 313 284 --43885 3527 3001 297 --
NM_005911chr221032 100 --11182 11201
NM_005916chr73124 103 31 ------
NM_005920chr183586 3319 3050 2898 2421 1474 1138 21 --53056 2972 2903 1444 104 1848
NM_005923chr62525 59 ------
NM_005924chr731167 980 835 ------
NM_005927chr54913 871 312 201 --31004 295 176 --
NM_005933chr1182760 2421 2353 2246 2132 727 341 223 --42835 2071 1948 731 12482
NM_005934chr1962130 1968 939 545 147 73 --41832 1827 1724 945 --
NM_005935chr4115217 4192 4138 4071 3852 3565 2099 1932 1756 1527 882 34352 3391 3218 25280 1767 --
NM_005937chr17124009 3859 3600 3529 3274 2623 2576 1114 1107 676 506 462 13652 ----
NM_005938chrX21080 222 1902 ----
NM_005941chr863606 2804 1312 353 221 213 13327 2327 257 12947
NM_005943chr651412 1120 192 107 59 1162 21398 1139 --
NM_005944chr311093 ------
NM_005955chr1134838 4649 4492 4342 4266 4149 3394 2036 1815 1630 1490 904 813 35169 1535 1165 44966 4609 4564 771 14347
NM_005962chr1042272 1799 320 95 1535 31940 1776 326 --
NM_005962chr1042272 1799 320 95 1535 31940 1776 326 --
NM_005964chr1741297 1042 495 98 ------
NM_005966chr242315 2045 1579 24 1954 ----
NM_005967chr122555 544 --1105 --
NM_005969chr114989 920 474 227 --1221 --
NM_005977chr132867 320 ------
NM_005982chr142229 195 ------
NM_005986chr1382559 2171 2079 1798 1785 1035 805 378 --12260 1735
NM_005990chr5122751 2583 2191 2183 2062 1966 1080 917 734 534 333 61 --12641 --
NM_005996chr1251358 1254 624 375 174 --1105 11051
NM_006007chr944468 4148 2886 2748 --11593 --
NM_006011chr15134212 4158 4046 3925 3700 3676 3605 3455 3364 3322 3185 2827 1528 13886 23827 3020 13930
NM_006015chr121245 206 --21258 155 --
NM_006016chr621834 270 ----12185
NM_006020chr1481307 1231 1167 1089 483 446 263 21 1519 21073 297 --
NM_006022chr132421 346 11030 ----
NM_006033chr1832277 1737 314 --2830 104 --
NM_006036chr242058 819 425 177 1384 --12293
NM_006037chr2114822 4770 4328 3522 3124 3079 3000 1598 1354 644 25 --54697 4097 3560 3128 1648 --
NM_006038chr2041823 1612 1456 1401 11652 11827 1322
NM_006039chr171309 --11050 --
NM_006040chr1661392 1066 886 567 531 265 ----11108
NM_006041chr171207 ------
NM_006047chr2052574 2529 1404 919 887 1751 12745 --
NM_006048chr141231 914 895 496 --21206 1116 --
NM_006051chr54230 213 103 67 ------
NM_006054chr1171380 1113 1058 524 452 148 139 ------
NM_006055chr252958 965 424 409 222 12987 22434 2418 43089 3059 755 464
NM_006060chr794285 3886 3750 3240 3126 1068 959 926 892 --33776 3311 2724 --
NM_006064chrX4396 373 327 307 --1110 --
NM_006067chr16----21022 889 --
NM_006079chr63300 287 45 ------
NM_006080chr723022 607 --32987 888 289 --
NM_006089chrX51818 1782 1425 488 445 --3588 576 73 --
NM_006090chr13689 582 540 ------
NM_006091chr1561771 1747 1396 1385 1251 552 1646 --11631
NM_006094chr872219 2106 1913 1558 685 420 320 --21758 669 --
NM_006095chr474358 3843 3520 3183 2803 1655 1618 14502 33006 1524 915 --
NM_006106chr1173475 2629 1243 983 559 412 155 1141 32400 422 311 12508
NM_006113chr11268 --2435 318 --
NM_006129chr81532 ------
NM_006134chr2151579 1466 1376 1272 1116 --31345 1315 28 --
NM_006135chr151441 1044 572 181 21 ----11007
NM_006136chr721170 466 ----1263
NM_006139chr252439 1865 689 322 134 --1406 1561
NM_006142chr11175 --1473 --
NM_006147chr13496 476 23 1312 --2410 100
NM_006148chr1782954 2596 763 623 507 314 184 76 12445 42071 1954 222 159 --
NM_006154chr1552851 2226 1920 819 632 --1746 --
NM_006157chr111379 ------
NM_006158chr841582 1324 569 358 11819 1172 --
NM_006159chr121565 --1646 --
NM_006160chr1741384 327 236 210 --21577 635 --
NM_006161chr52270 188 --1239 --
NM_006166chr1242589 2552 1661 843 11724 ----
NM_006167chr862039 952 940 841 202 143 12327 42029 971 617 607 --
NM_006177chr142900 76 ------
NM_006178chr17101498 1394 1376 1289 1085 1058 526 452 254 161 21005 109 --21479 1040
NM_006180chr942140 1782 1589 167 --2241 214 --
NM_006183chr122530 446 1107 ----
NM_006185chr113657 244 89 ------
NM_006186chr22910 820 ------
NM_006190chr221093 951 160 1904 --
NM_006191chr122716 640 --2694 83 --
NM_006194chr142532 141 --1183 --
NM_006195chr951399 1263 1145 579 516 --21361 1267 --
NM_006197chr821765 137 --21833 498 12042
NM_006198chr212247 230 --1215 --
NM_006201chrX31098 853 427 --1821 --
NM_006202chr1961885 1389 1243 598 95 73 --1474 --
NM_006203chr575119 3980 3832 2229 1960 1619 945 34085 1972 1654 33743 3492 345 --
NM_006206chr431115 405 23 --12428 1804
NM_006209chr8------1159
NM_006212chr1164539 3784 3504 1879 1843 1648 1424 1008 947 758 486 460 429 329 189 102 12166 3660 648 643 11328
NM_006216chr2161 ------
NM_006224chr1772140 1800 939 907 867 135 116 --31917 1618 914 --
NM_006226chr23440 357 52 ------
NM_006237chr1362145 2113 737 727 155 143 11675 32133 1424 68 --
NM_006238chr661972 1819 338 263 222 181 --51864 311 281 267 231 --
NM_006241chr351585 913 830 598 75 1855 22177 904 1972
NM_006242chr2031594 113 94 1165 2790 758 --
NM_006243chr12962 728 --3897 738 313 --
NM_006245chr65862 833 381 341 175 1335 ----
NM_006246chr144852 471 446 321 ------
NM_006251chr563350 3194 3019 2853 2420 483 --11036 11285
NM_006252chr197495 6543 5538 5343 2460 1539 1479 960 792 11870 46703 6547 4804 2861 --
NM_006256chr141810 1738 465 165 --22733 2383 --
NM_006257chr10----178 --
NM_006265chr841312 968 335 128 ------
NM_006267chr22751 580 1522 31843 1788 330 1662
NM_006268chr1161028 979 866 736 354 83 1398 2244 45 --
NM_006275chr2042485 1908 1728 84 ----1529
NM_006281chr81224 ------
NM_006281chr81224 ------
NM_006282chr20104767 4657 4639 4248 4226 3789 2963 1652 1131 935 --44726 3394 1002 315 --
NM_006283chr8134415 4030 4015 3105 3085 1497 1285 1096 894 602 360 348 47 24386 1895 23569 1884 --
NM_006288chr1131138 950 62 --1269 --
NM_006292chr112183 34 --256 48 --
NM_006293chr152887 173 ------
NM_006298chr682987 2843 2728 2226 994 634 559 362 32671 2207 241 ----
NM_006300chr1972341 1905 1806 1658 1510 501 216 --22286 612 --
NM_006301chr123506 462 254 ------
NM_006306chrX95916 5880 4989 4417 4365 1722 1467 909 266 --14781 12093
NM_006310chr1721278 99 --11159 --
NM_006313chr1231373 1051 497 1130 --1298
NM_006315chr444219 3370 1348 223 --43429 3362 3193 1499 21509 1252
NM_006317chr57667 639 603 118 104 91 48 --2782 607 --
NM_006320chr42302 290 --4322 316 311 295 --
NM_006321chr342186 1627 877 661 --1163 --
NM_006323chr4----1488 --
NM_006325chr121232 --1315 --
NM_006327chr103265 79 53 187 ----
NM_006330chr841345 1026 571 256 --1648 --
NM_006335chr12809 330 ------
NM_006336chr961425 1334 1240 1230 274 148 --1404 --
NM_006345chr441032 515 492 72 --1330 --
NM_006350chr5133 1331 ----
NM_006352chr111945 --31949 1926 218 --
NM_006357chr22128 45 --1470 --
NM_006358chr2251162 946 451 358 50 ------
NM_006359chrX2678 408 12033 52327 2027 497 435 303 1183
NM_006361chr1771694 1387 744 690 571 524 150 --21992 416 --
NM_006364chr142906 373 --2911 64 --
NM_006366chr631009 935 188 11191 21037 865 --
NM_006367chr14820 781 196 111 --1675 2442 84
NM_006369chr12357 128 --2119 99 --
NM_006375chrX41478 442 390 220 1509 31483 1403 101 1618
NM_006378chr961026 1013 464 191 140 69 --31030 182 154 --
NM_006379chr752026 1826 814 624 264 --21776 344 --
NM_006380chr1734257 2745 404 12755 23974 3314 --
NM_006382chr171270 ------
NM_006386chr2272439 2084 1675 789 545 458 284 1709 71859 1660 1512 189 100 76 65 --
NM_006389chr1191292 858 519 502 434 396 380 290 173 --41219 1062 410 112 --
NM_006393chr10134108 3982 3658 3230 3223 2970 2831 1233 1161 867 607 573 386 22920 1333 2255 119 1872
NM_006405chr14373 41 31 ------
NM_006407chr341120 1112 895 474 ----1560
NM_006408chr71265 ----1981
NM_006409chr71230 ------
NM_006411chr65901 689 124 95 43 1350 ----
NM_006416chr62672 25 ------
NM_006420chr2043342 2355 1336 762 --22770 2585 --
NM_006421chr8--1871 2828 92 --
NM_006422chr12267 29 ------
NM_006430chr24542 485 201 76 --2508 97 --
NM_006431chr121211 ------
NM_006434chr1043194 2016 1101 427 --12973 --
NM_006439chr41215 --2448 354 --
NM_006449chr241576 1545 1529 793 --123 --
NM_006451chr541033 724 382 343 1310 1346 11107
NM_006457chr484017 3007 2703 2591 1529 931 923 347 12904 53782 2931 1636 1633 1111 13165
NM_006459chr1031615 1311 633 --21943 226 --
NM_006460chr1751406 1363 539 241 172 --1223 --
NM_006463chr2------1603
NM_006464chr2102990 2967 2943 1875 1779 1664 1491 680 589 293 41553 1543 1073 170 74477 3240 1618 1607 1115 449 252 14425
NM_006465chr15101994 1909 1785 1697 853 843 799 722 483 270 1870 ----
NM_006469chr121406 1292 --11442 --
NM_006471chr18131 --163 --
NM_006478chr22142 --148 --
NM_006482chr1281202 1099 1043 849 793 774 671 398 --43209 1339 807 784 21239 547
NM_006488chr23921 230 212 ------
NM_006489chr1431541 1263 660 31842 212 41 ----
NM_006496chr131892 1239 690 --21248 490 --
NM_006503chr192112 46 ------
NM_006510chr661020 854 743 668 411 157 1148 2868 351 --
NM_006516chr141028 642 363 123 --11433 --
NM_006517chrX72157 2073 1969 1496 612 587 215 ----1601
NM_006519chr6392 85 27 151 ----
NM_006520chrX3457 344 57 ------
NM_006526chr202715 79 --31888 821 460 1466
NM_006527chr4----1102 --
NM_006532chr1932027 1775 1466 --11538 --
NM_006534chr2042804 2387 1173 560 1511 23210 3202 32809 1285 411
NM_006540chr82188 25 ------
NM_006544chr1442133 1459 1058 433 33685 1272 262 45343 4279 2210 1364 26003 38
NM_006546chr17176518 6276 6224 5949 5829 5422 5121 4382 4350 2643 2512 2438 2151 2143 1555 418 333 36528 6198 4666 44646 4596 2287 1673 --
NM_006547chr742075 1851 1682 1672 --2606 317 --
NM_006548chr3----11199 11710
NM_006549chr1272970 2339 2054 2021 1986 722 698 --32864 2443 144 --
NM_006557chr911767 --11124 --
NM_006558chr81495 --1389 --
NM_006559chr121243 119 --2398 135 --
NM_006560chr113206 127 38 --1471 --
NM_006561chr10175923 5238 4799 4691 4657 4385 4272 2451 2443 2386 2364 1711 1669 1389 1108 581 392 11545 64980 4339 3958 3830 2214 1288 25524 4044
NM_006565chr164884 358 70 33 --11105 --
NM_006570chr92133 123 158 1386 --
NM_006572chr1773397 2982 2399 2186 744 604 406 11370 ----
NM_006578chr1551547 1287 1262 1228 389 --31334 700 421 11579
NM_006591chr113562 501 373 --2628 384 --
NM_006595chr1121860 75 11495 22065 435 --
NM_006599chr16268152 8053 7389 7292 7180 7070 7063 6926 6834 6433 6400 5864 5150 5141 3223 3153 2575 2561 2541 2242 1756 1745 1677 671 378 294 17496 117850 7569 7565 7411 5586 5382 1787 1737 1704 1437 816 --
NM_006601chr123895 317 47 --3981 777 454 --
NM_006602chr204333 275 202 43 ------
NM_006603chrX31717 756 347 2726 627 11919 1102
NM_006609chr232355 2158 58 1966 42887 2388 512 131 12981
NM_006614chr362674 2257 1368 849 361 161 ----12563
NM_006618chr161381 1154 1111 211 130 64 --41319 991 524 501 1510
NM_006621chr161698 601 415 335 210 90 1675 51664 1605 786 95 81 --
NM_006622chr53485 219 34 ------
NM_006624chr1011435 ------
NM_006626chr941889 1790 1701 911 --3838 792 255 --
NM_006628chr1574237 4094 3856 1740 1288 1278 45 11420 53992 1808 1308 388 80 --
NM_006629chr1842511 1768 1049 1004 --12446 --
NM_006633chr51776 ------
NM_006644chr13125 --1569 --
NM_006650chr551035 706 651 546 303 13554 23822 549 --
NM_006651chr461506 1446 1371 958 553 204 --2558 250 --
NM_006654chr12144343 4287 4166 3553 3378 1894 1843 1295 1279 897 779 554 535 93 24160 463 --23972 1568
NM_006662chr161132 1326 ----
NM_006670chr63217 159 142 ------
NM_006681chr4171 ------
NM_006682chr732871 182 55 --11034 --
NM_006695chr171290 ------
NM_006698chr2061293 1254 1141 564 426 392 --3956 461 445 --
NM_006699chr192722 2605 2580 2446 2288 2080 1971 454 398 --42741 2506 697 655 --
NM_006700chr123781 576 38 ------
NM_006703chr6199 --1183 --
NM_006706chr52295 257 --1620 --
NM_006708chr64977 387 371 117 --41271 535 283 152 11197
NM_006709chr62103 57 --1293 --
NM_006710chr23949 840 113 --1323 --
NM_006717chr973305 3127 2636 2534 2441 2275 1163 ------
NM_006722chr342213 776 712 356 --22140 41 198
NM_006726chr41447 21137 68 21082 917 --
NM_006729chrX105338 4878 4850 4787 4470 4442 4336 3524 1343 924 13612 23930 3904 34565 3438 1555
NM_006732chr1992060 1837 1796 1526 818 662 556 413 177 ------
NM_006735chr72362 44 1120 197 --
NM_006738chr1574558 3748 3208 2901 1831 1199 629 --23871 3013 --
NM_006742chr1651984 1833 1495 590 423 --1138 --
NM_006746chrX31472 1436 404 --1522 1539
NM_006749chr821168 888 --11109 --
NM_006750chr16187890 7819 7608 7330 7304 6735 6516 6255 6071 5467 5238 3175 3162 2771 1802 1750 974 815 1990 65414 4904 3184 2680 682 369 15192
NM_006751chr22237 39 ----1894
NM_006756chr821293 148 --1277 --
NM_006761chr17----1698 --
NM_006763chr141934 1712 1445 1436 1463 1863 11589
NM_006766chr872402 1757 1645 607 446 203 162 22265 1651 32626 1844 735 --
NM_006772chr691699 1639 1447 1286 1247 519 306 202 26 --31721 1105 32 --
NM_006775chr611168 --1410 --
NM_006777chrX32836 2178 776 --32438 1055 815 --
NM_006778chr62389 184 31679 424 27 11924 --
NM_006783chr13280 49 --1251 --
NM_006788chr1871755 830 712 561 512 361 111 --21519 130 --
NM_006790chr51150 --1380 --
NM_006791chr152460 167 --1175 --
NM_006805chr5------1162
NM_006807chr172359 108 ------
NM_006811chr202922 836 2990 378 ----
NM_006814chr2062638 2251 2011 835 828 262 11781 ----
NM_006815chr1231027 390 79 --31019 301 293 --
NM_006818chr18868 792 667 648 364 242 94 73 --2177 63 --
NM_006819chr111336 ------
NM_006823chr84993 534 311 251 ------
NM_006825chr124855 719 188 43 ------
NM_006826chr241251 162 61 30 --2471 433 --
NM_006827chr1443394 3199 965 445 --52263 1064 969 469 345 --
NM_006828chr6145 ------
NM_006832chr141216 ------
NM_006846chr5189 ------
NM_006851chr1282775 2751 2442 1161 938 887 751 646 32307 792 702 42806 2407 2200 847 --
NM_006852chr1782728 2633 2360 2225 942 932 844 690 --42364 2353 1921 1111 --
NM_006854chr741838 1788 1438 413 ------
NM_006856chr1241078 1035 402 354 --11139 1967
NM_006861chr1251374 493 151 112 69 --21501 1385 --
NM_006870chr20149 ------
NM_006873chr273241 3064 1327 1045 553 373 362 --73244 2868 2677 2506 1131 729 710 11284
NM_006874chr421214 1127 ------
NM_006876chr111532 ------
NM_006884chr321359 762 11775 ----
NM_006885chr16114214 3866 3511 3440 3408 2815 2757 1364 1100 1040 257 12698 53114 1698 1515 1094 1067 --
NM_006887chr22462 185 --1198 --
NM_006888chr1453297 3128 2901 548 21 --11196 --
NM_006894chr1----2312 305 --
NM_006898chr22736 187 ------
NM_006908chr711103 --11308 --
NM_006913chr6--1437 ----
NM_006914chr921430 248 1586 21166 1094 --
NM_006915chrX2715 350 --32472 2223 250 --
NM_006920chr221964 1957 182 ----
NM_006922chr222335 865 1663 ----
NM_006924chr1763763 3527 1380 1208 870 577 12849 --152
NM_006930chr531868 1847 1280 --21917 559 --
NM_006931chr1252096 485 429 290 204 --31529 867 116 --
NM_006937chr17------2151 120
NM_006939chr14--1436 --1917
NM_006940chr1261401 1386 1245 637 553 88 --4759 543 488 472 --
NM_006943chr2062958 2820 644 397 357 285 --53307 3298 2948 880 669 --
NM_006947chr481449 1394 1253 1179 681 503 431 152 21286 263 11679 --
NM_006950chrX7775 698 313 213 133 64 44 ------
NM_006955chr1013416 --11241 1549
NM_006958chr82150 53 --142 --
NM_006973chr10252 25 --1143 --
NM_006979chr6----1554 --
NM_006981chr962788 2171 513 160 99 33 22922 658 32913 2633 503 1522
NM_006987chr1731228 1054 174 ------
NM_006988chr2121125 1036 --1784 --
NM_006990chr161783 798 614 246 162 38 --31568 299 184 --
NM_006996chr1--11455 123 --
NM_006997chr10167 1452 1124 --
NM_006999chr55593 399 325 241 143 11654 ----
NM_007007chr1274328 4246 3668 3543 3174 1545 1419 1541 34731 4333 2945 --
NM_007010chr1721469 1180 11388 --11215
NM_007011chr15196472 5881 5869 5846 5297 4628 4580 4530 2677 2652 2149 1986 1572 1559 1434 1396 982 206 38 25494 823 21922 533 24358 1909
NM_007013chr82165 135 --21010 411 --
NM_007017chr51811 ------
NM_007023chr221079 263 ------
NM_007024chr33584 137 56 ------
NM_007026chr17179 --1471 --
NM_007033chr142306 2279 220 72 --12075 --
NM_007034chr12750 219 1840 ----
NM_007036chr51844 ------
NM_007039chr1442050 1680 1580 1562 1304 ----
NM_007042chr342586 2087 1696 314 --12491 --
NM_007043chr1262168 1777 1604 1472 413 36 --1692 --
NM_007050chr20116865 6487 6330 5347 5301 5132 1737 1615 1519 1452 745 56619 5994 3155 1529 420 55906 2719 2349 1632 218 --
NM_007052chrX1229 --1620 --
NM_007054chr553629 3265 3189 3027 704 187 33581 3518 3434 21044 1013
NM_007064chr341523 1217 1117 108 ------
NM_007067chr1771588 1161 1056 533 317 304 109 31559 1170 346 41360 1219 1131 75 --
NM_007073chr693814 3651 3417 3276 3267 1129 926 353 234 --13775 --
NM_007078chr1051974 1134 751 616 494 12198 2151 84 11149
NM_007084chr132602 401 --21197 409 --
NM_007106chr1362837 2726 2402 2371 387 150 12117 12652 1677
NM_007107chr34757 428 369 285 --12083 1516
NM_007114chr342994 2202 1071 249 --12071 1541
NM_007118chr5228 21 --1674 --
NM_007124chr631768 1441 408 11835 1215 --
NM_007125chrY2381 347 ----1291
NM_007129chr134855 663 369 337 ------
NM_007144chr1731274 1128 24 181 2481 469 --
NM_007145chr1931257 1150 952 ------
NM_007146chr1752446 2187 1096 377 140 --1220 --
NM_007147chr192251 69 1984 11072 --
NM_007158chr141190 1011 443 146 --1437 --
NM_007159chr3184 --188 --
NM_007166chr114979 532 445 111 1374 21413 1409 --
NM_007170chr1183 ------
NM_007172chr2252994 2555 507 425 284 --22032 79 --
NM_007174chr1242324 1782 925 782 --2421 406 --
NM_007175chr863255 2782 2302 277 92 72 --33304 2447 737 --
NM_007184chr32455 162 2558 74 ----
NM_007185chr12807 220 1974 1794 --
NM_007187chr133991 887 699 --1932 --
NM_007189chr71561 11381 1418 --
NM_007191chr12----1159 --
NM_007192chr1441112 1043 1015 32 --2273 85 --
NM_007195chr1893436 3232 2993 2571 2543 2488 1495 893 532 175 22892 919 11142
NM_007200chr1574558 3748 3208 2901 1831 1199 629 --23871 3013 --
NM_007202chr175681 647 604 541 71 --1612 --
NM_007203chr983982 3387 3350 2953 1382 788 634 486 --43032 2510 1039 516 --
NM_007207chr13795 601 274 --2811 287 --
NM_007212chr131897 541 346 --42299 2293 1620 173 1216
NM_007214chr62550 253 ------
NM_007217chr31280 ------
NM_007221chr12428 404 ------
NM_007222chr851819 1762 1409 1152 36 ----21241 271
NM_007232chr202977 326 ------
NM_007236chr1592132 950 835 680 658 506 409 402 233 1768 ----
NM_007238chr2064326 4288 4085 3881 416 337 24777 3787 --13148
NM_007245chr162757 123 ------
NM_007249chr13219174 8945 8614 8016 7728 7548 7458 7408 7359 7270 6959 6951 6880 6332 6308 6210 5820 5744 3750 2605 267 28686 1885 49107 8984 2425 1355 11398
NM_007250chrX----3599 371 78 --
NM_007260chr14805 732 167 118 ------
NM_007269chr1------1439
NM_007275chr33394 328 310 --1439 --
NM_007276chr72795 695 --1262 21143 221
NM_007278chr17----2342 141 --
NM_007281chr4----1188 --
NM_007285chr162502 154 --1459 --
NM_007286chr542006 855 747 214 12040 22125 333 --
NM_007287chr353081 2822 655 274 217 22042 66 22806 1292 --
NM_007288chr353081 2822 655 274 217 22042 66 22806 1292 --
NM_007289chr353081 2822 655 274 217 22042 66 22806 1292 --
NM_007292chr1774645 4411 3934 3828 3319 1095 556 --35188 1076 251 --
NM_007294chr172998 83 2991 402 21154 1054 --
NM_007295chr172998 83 2991 402 21154 1054 --
NM_007296chr172998 83 2991 402 21154 1054 --
NM_007297chr172998 83 2991 402 21154 1054 --
NM_007298chr172998 83 2991 402 21154 1054 --
NM_007299chr172998 83 2991 402 21154 1054 --
NM_007300chr172998 83 2991 402 21154 1054 --
NM_007302chr172998 83 2991 402 21154 1054 --
NM_007303chr172998 83 2991 402 21154 1054 --
NM_007304chr172998 83 2991 402 21154 1054 --
NM_007305chr172998 83 2991 402 21154 1054 --
NM_007313chr971955 1924 1329 715 603 407 201 --31749 1584 370 --
NM_007320chr193313 250 237 ------
NM_007327chr93918 761 22 ------
NM_007331chr442254 1900 1777 828 1497 12342 12510
NM_007341chr213360 336 23 ------
NM_007345chr1872169 2083 1675 587 382 249 201 --2894 495 --
NM_007350chr1254086 3417 1425 961 483 13440 64462 3644 3617 3234 1340 160 --
NM_007358chr121949 1514 11831 21268 728 --
NM_007362chr351572 1477 1090 1078 35 --11198 --
NM_007363chrX294 23 --1753 --
NM_007365chr1132087 1660 1579 865 842 821 799 727 675 544 524 376 176 --2869 555 --
NM_007372chr17--2727 284 1884 --
NM_007373chr1031764 682 563 --21221 326 --
NM_007374chr14----1449 --
NM_007375chr162150 1128 631 431 416 289 12322 12363 --
NM_012064chr1241173 1120 339 213 11143 21106 153 --
NM_012069chrX62703 946 893 402 132 82 12646 42550 2523 1000 227 --
NM_012074chr143823 814 239 ----11022
NM_012081chr543636 3438 2383 289 --13161 1899
NM_012082chr81942 ------
NM_012086chr2157 ------
NM_012090chr121066 367 1934 ----
NM_012092chr25429 200 116 70 48 --2697 453 11444
NM_012095chr1073435 2500 1414 1404 1313 1109 1045 13370 23511 2139 --
NM_012096chr363337 2566 2450 2402 2337 351 --11478 21236 606
NM_012097chr261900 1779 614 248 234 184 11825 3834 603 356 --
NM_012102chr1132616 2428 2398 2386 2281 2248 2194 2159 1980 988 568 313 305 1105 21872 1788 --
NM_012104chr1153079 2483 1441 1381 1159 11085 32464 1035 338 1312
NM_012104chr1153079 2483 1441 1381 1159 11085 32464 1035 338 1312
NM_012111chr14----1182 --
NM_012117chr12----128 --
NM_012120chr672877 1940 1835 948 939 916 528 ----12114
NM_012129chr762164 1830 1005 981 875 835 1486 31836 722 92 1552
NM_012137chr1122742 2552 2378 2162 1910 1887 937 588 541 441 346 80 42207 2056 989 498 22137 445 --
NM_012141chr13154164 3874 3193 3054 2999 2911 2736 2704 2683 2546 841 245 168 139 38 --33680 2930 2860 1862
NM_012153chr1172461 2453 2436 2374 2360 1789 871 11772 31611 687 95 --
NM_012154chr81825 ------
NM_012156chr20103348 2913 2906 2837 2824 2549 2486 2330 888 806 --83330 3162 3147 2894 2889 658 461 273 --
NM_012158chr1321672 190 1350 ----
NM_012160chr61197 --1490 --
NM_012161chr431182 1032 349 --1176 1467
NM_012164chr9147145 7038 6807 6695 6192 6163 5355 2968 2858 1792 1213 1145 807 448 46925 6897 6216 5524 46677 6283 5693 1192 --
NM_012175chr11285 57 2803 251 1221 --
NM_012180chr41167 1671 1537 1544
NM_012189chr18----1472 --
NM_012192chr112810 131 --11489 --
NM_012193chr11104898 4420 3451 3333 1532 1488 729 709 523 26 --104700 4694 3575 3348 1880 1873 1817 1556 685 673 24346 3459
NM_012199chr1174609 4054 3955 3827 3637 2878 1802 1541 1524 1482 1375 1151 1084 1070 939 751 130 --94231 3302 3269 2953 2930 2924 1871 1441 637 12966
NM_012210chr951225 1131 1045 966 387 --2423 26 11013
NM_012214chr2136436 6213 5910 5450 4074 2519 2419 2374 2167 2003 884 701 529 14056 76367 5453 4926 2525 1992 891 859 --
NM_012215chr1071674 1665 1335 1297 698 376 338 --1228 1731
NM_012223chr231309 1074 246 --138 1251
NM_012232chr17102047 2039 2025 1915 1886 1805 1674 380 63 31 --32029 1442 51 --
NM_012234chr3113533 3337 1429 1384 1275 1180 1064 437 418 405 92 ------
NM_012236chr13905 697 265 --1618 154
NM_012238chr1021707 1238 --11353 --
NM_012242chr10130 --1288 --
NM_012244chr1481657 1647 1640 1624 1425 1404 1291 34 --11161 --
NM_012247chr101950 ------
NM_012248chr16----1256 --
NM_012249chr242229 1365 1112 162 --31288 1244 39 13227
NM_012250chr112144 49 --157 1226
NM_012252chr7104723 3611 2119 1519 1003 861 822 730 460 396 --43726 3720 3560 212 13352
NM_012255chr20273 28 ------
NM_012257chr741017 870 229 170 ------
NM_012259chr651460 951 941 343 164 --2427 175 11296
NM_012262chr1124397 3905 3368 3342 2061 1939 1533 1286 1074 774 652 388 13715 44287 2007 1681 873 --
NM_012266chr931078 434 315 ------
NM_012281chr742152 651 632 516 ------
NM_012286chrX2448 173 ------
NM_012287chr3104142 3791 3629 3115 2755 1549 1321 911 746 343 24491 664 24093 1582 --
NM_012288chr6175384 4967 4923 4644 4537 4520 3934 3574 3492 2228 2041 2017 1293 864 182 158 29 13882 85442 5070 3967 3740 347 219 174 163 --
NM_012290chr241709 1467 459 154 ------
NM_012294chr723025 191 11197 11476 --
NM_012296chr11113425 3196 3018 2885 2679 2641 1471 844 193 100 82 1301 ----
NM_012297chr452349 871 546 321 301 --1822 --
NM_012298chr33706 306 219 ------
NM_012300chr582083 1814 1714 683 481 244 190 167 --3591 552 405 --
NM_012301chr741871 1770 1411 316 --149 2878 809
NM_012302chr121095 119 ------
NM_012304chr5112475 2332 2092 1883 943 875 445 277 153 146 108 11709 42326 1757 923 235 --
NM_012307chr181680 184 1871 --
NM_012308chr1141924 1764 582 192 --22301 587 1141
NM_012309chr11154956 4489 4238 4193 3630 3369 3132 1982 1948 1125 1051 908 496 445 394 13840 34020 3743 1609 14071
NM_012316chr1153732 3686 3540 3487 1918 1711 1682 1310 1283 942 410 400 377 362 242 14184 94274 1923 1316 1102 1096 1093 1090 1087 977 --
NM_012318chr421384 1280 ------
NM_012323chr2211576 --2151 96 --
NM_012325chr2041250 160 128 35 --21545 1294 --
NM_012326chr2177 ------
NM_012329chr1721056 610 --31197 1047 361 --
NM_012330chr1021159 243 --21694 194 --
NM_012333chr161295 1246 1185 571 466 335 11481 31539 1192 615 --
NM_012334chr574056 3567 3463 2885 531 404 154 --13422 11410
NM_012338chr731220 1036 914 --1454 --
NM_012340chr201178 ------
NM_012342chr101534 --2495 148 --
NM_012345chr1341889 1858 743 501 11868 1155 --
NM_012382chr554041 3046 2885 1458 201 24201 3664 44439 3395 3343 582 --
NM_012384chr2032374 511 218 --21862 1551 --
NM_012395chr753056 2806 2127 525 403 23165 3104 53195 3117 2371 2286 176 --
NM_012398chr1962920 2783 846 787 731 368 --12172 --
NM_012399chr2251804 1658 733 569 307 --31365 1343 498 --
NM_012402chr114367 240 115 86 1420 ----
NM_012405chr153784 3557 3117 529 121 ------
NM_012407chr222514 131 ------
NM_012412chr73825 221 28 ------
NM_012414chr11180 --1115 --
NM_012417chr173230 110 69 ------
NM_012420chr1082273 2030 1751 1426 773 714 599 309 ------
NM_012428chr153730 285 85 --2701 250 --
NM_012433chr21275 ------
NM_012448chr1782158 1020 946 685 674 239 86 30 --42554 913 732 501 11572
NM_012453chr771335 516 475 222 175 135 75 --11425 --
NM_012454chr6133 --1568 --
NM_012461chr143584 192 65 1480 ----
NM_012463chr121151 11612 --1338
NM_012465chr1072984 2746 2336 624 394 290 110 --53032 2869 2845 843 477 22800 357
NM_012471chrX61839 1799 1388 318 304 52 ------
NM_012479chr752706 2575 1972 1752 828 --32370 793 649 22665 2022
NM_012482chr1--133 ----
NM_013227chr153664 261 82 ------
NM_013230chrY51608 588 565 484 283 244 27 ----
NM_013231chr1484327 4288 3873 3864 3434 3211 1198 319 --11427 23624 1448
NM_013233chr22395 87 1210 ----
NM_013236chr2241056 790 434 180 160 1387 --
NM_013242chr162330 45 ------
NM_013243chr1561469 959 468 311 232 163 ------
NM_013245chr164719 645 575 225 --1649 --
NM_013248chr20----1210 --
NM_013254chr121719 1285 1611 --
NM_013255chr7188602 8467 7545 7329 7112 6922 6528 6405 6258 6129 5937 5840 5694 2613 2575 2003 1206 155 23270 527 47966 6969 6870 5485 17166
NM_013257chr822387 2070 --1954 22171 148
NM_013259chr32291 95 ------
NM_013261chr4103424 3241 3015 2970 2922 2776 2624 1517 1064 99 12729 32284 788 678 --
NM_013269chr12104516 4361 4179 4162 4019 3989 3379 1434 1254 448 --33460 1301 774 14031
NM_013272chr151153 ------
NM_013275chr162607 323 1198 1637 1615
NM_013277chr122818 172 --31014 973 309 1350
NM_013281chr2021188 263 ------
NM_013283chr51671 --1890 --
NM_013293chr7191 --139 --
NM_013296chr13480 164 65 --127 --
NM_013305chr181699 --3919 858 620 --
NM_013309chr1542679 2431 1929 899 11820 ----
NM_013313chr2253520 3069 1156 180 24 13239 32547 965 292 --
NM_013316chr751042 802 788 132 53 ------
NM_013341chr262763 2745 1174 1161 1078 347 22808 2027 31954 1126 797 --
NM_013351chr172222 113 --1715 --
NM_013354chr811405 ------
NM_013357chr82866 71 --188 --
NM_013363chr3161 ------
NM_013364chrX21967 1642 --31993 1945 1421 --
NM_013368chr193466 117 30 ------
NM_013372chr15123179 3084 2963 2770 2280 2214 936 496 467 443 393 362 12810 32823 2363 2141 11041
NM_013374chr342056 1020 939 750 --1387 --
NM_013381chr1242138 2112 852 270 --1214 1200
NM_013396chr211307 1971 11046 --
NM_013400chr741062 1028 969 343 --1843 --
NM_013411chr172481 1987 1849 1750 1737 1093 777 ------
NM_013423chrX1971 --197 --
NM_013427chrX1971 --197 --
NM_013433chr1921662 1343 --21785 1774 --
NM_013434chr221739 584 ------
NM_013434chr221739 584 ------
NM_013437chr81235 --1556 --
NM_013438chr931436 1418 1294 ----11354
NM_013443chr941111 893 301 79 ------
NM_013444chrX5988 344 275 249 185 --21139 217 1267
NM_013446chr741348 1255 146 84 ------
NM_013448chr143649 604 173 ----1641
NM_013449chr1282262 696 634 626 323 187 174 154 --72439 2299 2113 1186 639 589 338 --
NM_013450chr23352 115 30 1845 ----
NM_013937chr63295 115 103 --2900 725 --
NM_013952chr232335 1793 623 ------
NM_013953chr232335 1793 623 ------
NM_013958chr82475 334 --1146 --
NM_013959chr82475 334 --1146 --
NM_013961chr82475 334 --1146 --
NM_013962chr82475 334 --1146 --
NM_013979chr51413 ------
NM_013992chr232335 1793 623 ------
NM_013993chr63521 268 215 2620 281 ----
NM_013994chr63521 268 215 2620 281 ----
NM_013999chr1731211 1104 121 --1520 --
NM_014000chr1081950 1808 1759 1495 612 524 497 370 11557 21386 364 11583
NM_014005chr562932 2458 2231 823 654 638 1312 31043 616 321 --
NM_014007chr92835 174 ------
NM_014011chr212552 --31755 570 483 --
NM_014015chr161648 ------
NM_014016chr31348 ------
NM_014021chr153442 2968 1146 917 644 --33347 3258 282 --
NM_014023chr1021952 222 12276 11848 --
NM_014030chr1721137 421 1832 ----
NM_014031chr52238 118 ------
NM_014034chr621131 404 1264 2980 258 1198
NM_014038chr71295 ------
NM_014043chr32282 252 --11488 --
NM_014044chr21163 ------
NM_014048chr1643468 3458 2027 255 --34923 4780 1121 --
NM_014055chr12----1463 --
NM_014057chr941495 604 502 477 11048 21114 453 --
NM_014059chr13122 --1256 --
NM_014079chr32839 167 ------
NM_014089chr132401 145 ------
NM_014106chr1562038 1920 1906 957 936 333 --11895 --
NM_014112chr8105150 4815 4590 3512 3323 1900 1683 977 711 528 1685 24380 3334 --
NM_014117chr1662717 2529 2263 2247 1968 766 --1846 --
NM_014141chr733454 1532 428 13236 65054 4199 3503 3495 498 434 21895 1185
NM_014145chr20----1580 1691
NM_014149chr71592 --1557 --
NM_014155chr11147555 5972 5660 4689 2779 2338 2182 2156 1496 1096 988 868 545 83 46868 1833 1222 258 15373 15787
NM_014166chr1331154 943 807 --1822 --
NM_014178chr14127 --1382 --
NM_014181chr22858 825 --22196 876 --
NM_014182chr123723 479 73 194 ----
NM_014184chr1----1112 --
NM_014186chr1162115 1963 603 580 456 197 1731 32164 1813 203 22247 1804
NM_014189chr451494 1425 1306 446 205 11375 11261 11363
NM_014190chr451846 1777 1658 557 319 11727 21613 1154 11715
NM_014212chr122900 85 --1617 --
NM_014216chr1451351 658 491 481 138 --1111 --
NM_014217chr121857 524 149 1270 11505
NM_014223chr14727 637 507 78 --1195 1214
NM_014231chr12102042 1955 1928 1907 1794 1702 1479 474 132 52 --31590 1585 736 --
NM_014232chr17121491 1377 1254 652 512 499 412 383 347 291 275 61 --3406 401 356 --
NM_014232chr17121491 1377 1254 652 512 499 412 383 347 291 275 61 --3406 401 356 --
NM_014238chr1731706 1293 35 --21372 311 --
NM_014240chr373088 2919 2664 1243 658 635 223 13581 74087 2876 1050 805 508 411 206 1150
NM_014243chr421954 172 --12093 --
NM_014245chr33188 131 101 ------
NM_014246chr2272269 2240 2027 1708 789 577 413 ------
NM_014250chr2261763 1637 1567 1449 258 77 --21911 1486 --
NM_014253chrX3812 553 539 1332 ----
NM_014258chr20143 ------
NM_014267chr113869 676 324 --2337 241 --
NM_014268chr1831233 563 279 11123 21317 51 --
NM_014270chr19169 --173 --
NM_014271chrX1591 --1344 --
NM_014278chr4------1324
NM_014279chr94818 358 247 161 --1631 --
NM_014280chr14801 712 263 74 ------
NM_014283chr12995 289 ----1327
NM_014285chr94820 306 199 154 1422 ----
NM_014288chr1----1214 --
NM_014289chrX----21078 124 11153
NM_014294chr821335 1237 21148 464 ----
NM_014299chr19102042 1771 1450 736 652 283 273 122 82 49 1863 1383 --
NM_014305chr131219 ------
NM_014309chr22135318 5066 4974 4916 4702 4448 4118 3924 3841 1859 802 609 478 31412 1235 821 54455 3908 1502 815 589 2471 182
NM_014316chr1682193 1971 1785 1749 1634 368 322 83 --11827 --
NM_014319chr12----21378 72 --
NM_014323chr22--2702 394 ----
NM_014329chr16----1280 --
NM_014331chr4157245 6458 6196 6122 6087 5854 5389 5310 5166 5064 4928 3043 2744 2467 2099 21856 300 46200 3091 2424 1062 27518 2627
NM_014332chrX2368 156 ------
NM_014333chr1162819 853 438 424 358 236 --41103 896 578 327 --
NM_014335chr151284 11004 11103 --
NM_014342chr1121479 1265 --11386 --
NM_014344chr113840 697 225 --1175 --
NM_014345chr64950 933 273 163 --1168 1939
NM_014351chr2231092 578 81 ------
NM_014352chr113963 251 141 --1509 --
NM_014361chr11----1178 --
NM_014363chr132471 453 ------
NM_014365chr122166 51 --2665 350 --
NM_014368chr951915 851 400 288 213 --21796 1614 --
NM_014372chr121629 115 --1373 --
NM_014374chr741062 1028 969 343 --1843 --
NM_014376chr572252 1835 776 518 299 257 194 ------
NM_014381chr1453317 3302 2019 1205 475 1553 53311 2540 2412 2110 1255 1532
NM_014382chr321656 199 11122 1488 --
NM_014392chr431342 439 378 1252 --11175
NM_014393chr872310 947 752 259 229 218 50 2788 270 2234 174 --
NM_014397chr951436 1078 329 218 61 --11425 --
NM_014400chr194458 343 60 39 ------
NM_014405chr1732259 703 339 --41942 1899 1593 526 --
NM_014408chr14600 583 561 534 ------
NM_014410chr181343 ----1348
NM_014411chr752051 1306 1243 758 111 1163 41994 1549 1482 1328 1781
NM_014415chr311631 --21218 396 --
NM_014417chr191384 --2953 90 --
NM_014421chr431390 737 345 12143 ----
NM_014423chr5115041 4384 2170 2130 2107 1792 1164 1152 1133 114 33 23468 1512 24688 1955 23691 599
NM_014426chr202543 207 ------
NM_014432chr621307 1120 11093 --1140
NM_014445chr331695 1550 153 ----11961
NM_014447chr441595 1556 1109 237 --31385 1117 223 --
NM_014452chr651000 297 214 184 177 --167 --
NM_014454chr621099 684 ----1128
NM_014455chr11431 --1144 --
NM_014456chr1031915 320 225 ------
NM_014458chr141180 1104 879 255 --133 --
NM_014469chr112293 256 ------
NM_014478chr731783 484 268 --1553 1784
NM_014488chr111623 --1509 --
NM_014491chr711043 --5204 201 198 195 192 --
NM_014494chr1682049 1894 1668 1617 412 314 305 109 --1346 --
NM_014496chrX1253 --1278 --
NM_014504chr731728 1494 803 --52033 1993 1837 1379 278 --
NM_014505chr12----1381 --
NM_014506chr921228 619 ----11663
NM_014515chr121116 --21048 255 1217
NM_014517chr341799 1234 1225 778 --21734 1617 --
NM_014521chr241742 1665 1471 46 11440 ----
NM_014552chr23597 575 128 --1564 --
NM_014554chr1262017 1971 1785 692 552 263 --31682 1662 166 --
NM_014562chr22561 99 ------
NM_014570chr222226 208 --140 --
NM_014572chr1351743 1502 1376 1266 1166 --11129 1673
NM_014574chr1421000 454 --4332 329 326 320 --
NM_014575chr31536 --1493 --
NM_014584chr1411038 --31617 1614 1356 --
NM_014588chr203252 206 46 --3753 739 108 1603
NM_014591chr1021091 76 21324 902 ----
NM_014592chr52624 136 1660 3210 207 200 --
NM_014603chr1741687 1516 1265 650 ------
NM_014604chr171148 --2637 194 --
NM_014606chr481259 1004 432 385 375 362 267 37 1508 51115 1032 985 975 466 1403
NM_014607chr21445 --139 --
NM_014608chr15----145 --
NM_014612chr9197 ------
NM_014613chr582695 2656 2041 1907 1221 888 755 493 --32305 1225 951 22678 589
NM_014614chr231322 1259 404 ------
NM_014616chr333429 2747 40 23419 387 1875 1627
NM_014618chr91443 --1405 --
NM_014620chr121194 --2128 120 --
NM_014621chr21211 ------
NM_014630chr15113767 3673 3500 2926 2721 2469 1219 898 850 541 344 32475 1097 1043 1928 --
NM_014634chr2273208 2752 2724 2662 450 50 32 --22264 738 --
NM_014636chr9114140 3300 3113 1729 1700 1351 1019 873 836 649 472 13283 --24180 3497
NM_014637chr831371 559 115 ------
NM_014644chr11127 ----1663
NM_014646chr1872459 2202 2035 648 244 140 70 11995 1486 --
NM_014647chr16182 --2197 191 11573
NM_014653chr1241733 1597 540 93 ------
NM_014659chr156849 401 366 257 154 55 --1738 --
NM_014660chr72849 130 --1263 --
NM_014661chr1082620 1549 1348 1273 1254 825 552 503 ------
NM_014665chr873688 3516 2864 2434 2351 2285 298 11163 23293 364 --
NM_014666chr5----1420 --
NM_014667chr362384 2351 2312 894 747 324 --2683 376 --
NM_014670chr211077 1253 ----
NM_014674chr393844 3669 3164 2925 2768 2625 1601 941 613 --63325 3292 3257 2509 1087 175 --
NM_014676chr121487 1366 ------
NM_014677chr8101165 1109 1056 1032 1017 1010 913 500 349 106 --1343 --
NM_014682chr832270 536 250 ------
NM_014683chr1741885 1691 1657 807 --22013 1896 11361
NM_014686chr1942457 2103 658 136 ----12266
NM_014689chr21412 ----1540
NM_014690chr7152827 2776 2461 2391 2245 2116 2061 2040 1222 1127 961 833 411 356 132 --32571 983 450 --
NM_014701chr1533239 2218 871 31214 1184 376 12536 12361
NM_014702chr683334 3291 3191 2460 2223 1010 524 89 --22333 994 --
NM_014705chr741904 1374 258 223 --21914 767 --
NM_014707chr741879 1778 1626 476 --22291 481 162
NM_014709chr21473 ------
NM_014711chr1651702 1501 1471 809 707 --21958 160 --
NM_014720chr1031346 735 63 --2356 127 --
NM_014721chr697492 5957 5377 5336 5032 1958 1428 538 259 --47164 6826 6506 5360 --
NM_014723chr2063212 3205 2923 2660 2619 2296 --32338 996 714 --
NM_014726chr174493 412 38 30 --11009 --
NM_014729chr831693 881 773 1193 1212 --
NM_014730chr12235191 5057 4853 4822 4762 4679 4325 4222 4062 3947 3785 3591 3379 3232 1488 1320 1063 892 877 785 552 237 210 1898 104285 4159 3648 3516 3427 3417 811 758 343 244 11330
NM_014730chr12235191 5057 4853 4822 4762 4679 4325 4222 4062 3947 3785 3591 3379 3232 1488 1320 1063 892 877 785 552 237 210 1898 104285 4159 3648 3516 3427 3417 811 758 343 244 11330
NM_014731chr2041354 1225 279 143 1121 11799 --
NM_014733chr51799 --21932 586 --
NM_014735chrX52109 1775 1708 1506 730 --31491 1450 516 --
NM_014742chr2071658 1513 1122 573 399 319 238 ------
NM_014743chr463204 3058 2423 2010 1113 318 --52720 2462 592 141 101 12956
NM_014746chr294063 3775 3042 2815 1639 1444 823 716 482 --44379 3980 781 286 --
NM_014747chr1165774 5472 5354 5286 5020 4887 4538 4396 3771 3734 3685 3508 1302 790 726 415 15509 45123 4002 3979 2030 24050 701
NM_014751chr831682 860 384 --3779 763 676 --
NM_014752chr1141378 447 404 27 ------
NM_014755chr283441 3211 3155 1690 1272 1184 992 211 13251 43368 3068 1284 1108 --
NM_014756chr112388 173 --1370 --
NM_014757chr562364 1760 1619 1572 1542 749 12205 41802 951 851 543 22317 918
NM_014759chr851498 1272 526 278 167 --2269 84 --
NM_014761chr1641031 283 184 69 ------
NM_014764chr121514 1403 2463 275 1267
NM_014765chr142075 1862 540 473 --12500 --
NM_014767chr1083572 2650 2620 2386 2333 2249 1351 1285 --2954 320 --
NM_014772chr18113310 3128 3012 2996 2840 2463 2217 1457 955 925 273 --13437 --
NM_014774chr183121 2318 2200 2142 2135 2009 1140 774 186 63299 2840 2323 1077 283 276 11281
NM_014776chr12122962 2726 2623 2483 2450 2425 2230 1111 1057 969 950 24 12131 1576 --
NM_014779chr311006 --2816 157 --
NM_014781chr831203 387 274 ------
NM_014782chrX1113 --1283 --
NM_014784chr141113 398 384 23 --11117 --
NM_014786chr1111123 --21230 822 --
NM_014787chr141800 843 174 143 1949 12102 --
NM_014795chr221277 1045 --3484 472 424 --
NM_014800chr75744 461 325 200 95 ------
NM_014802chr1231101 1021 73 ------
NM_014803chr1052095 786 439 396 361 22542 2010 1859 --
NM_014807chr113659 341 31 ------
NM_014810chr183439 3391 2927 2638 2625 2604 659 540 --13158 12651
NM_014812chr13405 173 124 ------
NM_014819chr532133 774 53 --21815 1666 32212 1782 1728
NM_014820chr341902 1471 1425 587 --1626 11895
NM_014824chr1151885 1528 1329 407 211 ------
NM_014826chr194251 4083 3883 3852 3029 1610 1423 1190 54 --21587 1375 --
NM_014827chr141227 1077 254 158 --1349 --
NM_014829chr562389 1915 1897 840 764 716 1225 ----
NM_014830chr1252873 2833 2675 1572 733 --43407 3401 2654 727 --
NM_014832chr1341453 1319 603 448 --12094 11763
NM_014836chr1061308 1231 493 443 224 130 ----11482
NM_014838chr2242741 2733 1083 701 --11863 --
NM_014839chr1102567 2316 2274 1784 959 671 654 603 530 293 12015 22320 744 --
NM_014840chr12122924 2738 2543 2514 2439 2317 2294 1011 833 417 329 181 --12201 --
NM_014841chr62966 128 --1421 --
NM_014844chr1464157 3286 3121 2982 1574 1170 14098 13836 --
NM_014847chr12205 33 ------
NM_014849chr131106 913 59 ------
NM_014850chr3154925 4852 4789 4695 4554 4523 4483 4302 4290 4039 3571 3549 1480 491 331 --84686 4043 3927 3885 3658 3497 1613 318 14805
NM_014853chr1711501 11155 ----
NM_014858chr12848 139 11206 2783 411 --
NM_014859chr1761291 1122 988 395 326 94 --1200 --
NM_014860chr241911 1792 668 77 --31650 738 638 --
NM_014862chr1593055 3010 1470 1363 1315 1159 1134 895 873 24140 3669 54085 4078 1475 1272 399 14007
NM_014870chr193372 3276 1318 1178 1171 1026 756 524 212 --24348 745 24158 810
NM_014872chr93953 603 224 --21675 1553 --
NM_014873chr174849 4154 3821 3764 3752 667 561 1402 ----
NM_014874chr151710 752 736 454 383 --21854 285 --
NM_014876chr2271936 1749 1725 1601 1528 763 45 --22204 2051 12126
NM_014877chr17136993 6318 6290 5916 4964 2955 2890 2688 2556 2504 2452 907 865 27198 501 37601 1866 956 36839 1566 1155
NM_014878chr9145 --1125 --
NM_014881chr102131 37 ------
NM_014887chr134879 718 591 204 1814 1850 --
NM_014890chr3156 ------
NM_014892chr62552 524 --1136 --
NM_014893chrY2880 428 11989 1773 1751
NM_014897chr1753101 2257 2079 1093 81 12045 33072 525 367 --
NM_014898chr192530 280 --2422 22 --
NM_014900chr2--1315 1284 --
NM_014901chr531998 749 288 ------
NM_014902chr2051527 1389 1218 412 77 --2462 249 --
NM_014903chr121432 --4955 377 367 326 22396 1792
NM_014904chr1093912 3156 2452 1337 1252 778 375 327 245 1119 33303 3145 748 --
NM_014905chr251626 1601 1375 688 133 --21445 657 1719
NM_014906chr1723920 3370 53953 3749 3610 1338 1004 23938 2931 --
NM_014912chr1053253 3104 2883 1124 612 --12672 --
NM_014914chr241005 440 373 219 ------
NM_014917chr12832 695 --1869 --
NM_014918chr1531321 1134 188 1132 31282 1067 530 --
NM_014920chr673597 3548 3223 3121 2542 2533 539 --2337 127 --
NM_014921chr19102977 2755 2494 2477 1195 1179 1019 613 504 435 --62897 2847 2803 2740 874 602 --
NM_014923chr132593 227 ------
NM_014924chr1421968 530 --147 12175
NM_014925chr125755 611 246 235 198 --2688 683 --
NM_014926chr31742 --11032 --
NM_014932chr32710 64 --31576 1465 677 --
NM_014934chr1343842 3638 1281 273 --12531 --
NM_014936chr652796 2131 920 716 147 12304 32773 2574 302 --
NM_014938chr1262168 2049 1934 589 495 253 --1812 --
NM_014939chr1831352 1192 464 ------
NM_014944chr151063 961 529 520 222 ------
NM_014945chr581863 1336 1283 484 329 244 229 79 --1178 --
NM_014946chr263063 1082 818 417 388 276 12252 1576 13020
NM_014947chr122811 445 --12047 --
NM_014949chr141013 850 153 40 ------
NM_014950chr141601 11781 21083 605 --
NM_014952chr1532027 585 275 --4832 575 551 504 --
NM_014953chr1344148 3377 500 461 --13836 --
NM_014959chr1983474 2819 1441 1407 1313 1148 883 188 22336 1171 31424 1355 221 --
NM_014961chr441938 1817 825 188 31766 749 462 11606 --
NM_014964chr1762372 2228 2060 1705 777 246 --1973 --
NM_014969chr14819 455 411 322 ------
NM_014974chr103709 491 310 --21751 418 --
NM_014977chr143444 352 153 --1501 --
NM_014978chr1021294 288 --11576 --
NM_014982chr14124322 3753 3722 2138 2108 1414 1142 895 671 596 524 153 --55196 4032 3593 2082 450 14099
NM_014988chr442499 859 311 124 1443 12586 --
NM_014989chr631715 1362 560 --11277 --
NM_014990chr141274 --1151 --
NM_014991chr412148 --42503 2376 2249 605 --
NM_014992chr143876 728 106 ------
NM_014994chr153781 762 199 11964 ----
NM_014996chr361046 916 869 416 208 75 1318 ----
NM_014997chr7152891 2861 2582 2353 2267 2241 1946 1083 968 861 797 653 252 208 191 21858 55 21032 318 --
NM_015000chr1243091 2260 2218 1892 --21140 1041 12397
NM_015001chr11968 --3632 271 264 1168
NM_015002chr1262161 2015 1703 795 415 375 --42244 1922 674 426 --
NM_015005chr1431623 1616 301 --11332 11779
NM_015008chr393141 3075 2974 1353 1298 812 531 239 145 32781 2714 267 33221 2490 899 --
NM_015013chr11215 165 ----
NM_015017chr1----1131 --
NM_015018chr6----186 --
NM_015020chr1693676 3506 3295 1473 1384 1085 932 690 355 23353 1416 33724 788 608 --
NM_015023chr171778 1673 1553 1433 1272 1217 613 11468 --11569
NM_015024chr841402 1379 1372 104 ----11338
NM_015025chr222032 1757 --1855 --
NM_015026chr12144619 4585 4576 4479 4466 4441 4286 3756 3526 3291 3167 1716 1071 66 1124 44566 4554 4445 1342 14603
NM_015032chr1362765 2588 1934 1837 806 426 --32800 898 25 --
NM_015037chr101265 ------
NM_015039chr193513 3430 3344 3136 2861 1499 856 678 79 13551 31524 1339 61 21507 198
NM_015040chr273033 2525 2466 2176 681 636 86 ----23324 777
NM_015042chr15124262 3638 3607 3472 3440 2875 2805 1244 1082 912 240 198 --54297 4286 4245 1335 1118 14254
NM_015044chr1653258 2065 1079 801 267 23100 573 22626 2493 --
NM_015045chr1032165 1504 149 --1460 --
NM_015046chr962395 2142 1778 746 453 336 1259 --11999
NM_015051chr943376 1341 412 142 --11123 --
NM_015052chr74969 415 196 93 --41126 1100 1094 492 1173
NM_015055chr1162885 2730 2523 962 605 429 --31019 732 715 --
NM_015057chr131204 ------
NM_015061chr91917 1238 ----
NM_015064chr12122837 2701 2650 1443 1050 1038 911 895 820 714 362 297 ------
NM_015068chr743930 1245 557 122 12704 23947 2650 11479
NM_015069chr16----1493 --
NM_015070chr13----1144 21569 1152
NM_015071chr5145165 4963 4656 4151 2176 2166 1599 1270 995 789 766 653 620 267 --34322 2086 79 --
NM_015072chr142480 205 --1396 --
NM_015074chr174524 4289 3148 3131 1744 1738 1677 11904 53788 893 457 358 65 --
NM_015075chrX52245 2048 1597 195 181 --11572 --
NM_015076chr684475 4224 4174 2960 978 318 240 165 34006 3635 959 33662 3151 1460 --
NM_015079chr1593181 2664 2433 2166 1241 460 236 192 121 ------
NM_015080chr113373 175 118 --3933 388 385 --
NM_015082chr532396 875 481 ------
NM_015086chr1261458 1392 1047 96 89 65 --21370 81 --
NM_015087chr1342655 2275 2231 79 22090 154 ----
NM_015090chr1155435 5135 4846 4723 4710 4620 2437 2354 2226 2098 1152 757 655 582 477 --36037 773 419 --
NM_015091chr14--1779 ----
NM_015092chr1674470 4322 3908 3620 3482 1376 996 --23614 3013 23545 2984
NM_015093chr6--125 2749 679 --
NM_015094chr2244374 3393 1229 1126 --21805 609 --
NM_015097chr372305 2293 1865 1519 914 907 90 ----11511
NM_015100chr181891 1715 1564 1318 737 626 617 610 ------
NM_015107chrX42373 1518 1494 312 ----21559 1541
NM_015110chr94895 495 411 197 ----11758
NM_015115chr441017 782 179 97 22916 2460 32798 2572 793 1805
NM_015125chr193448 137 105 ------
NM_015129chrX41685 1464 1442 323 --2141 78 --
NM_015130chr411290 1541 31231 1195 61 11267
NM_015132chr72275 62 --41754 1751 728 152 11577
NM_015133chr161542 1102 ----
NM_015137chr882549 2460 2369 2301 1713 597 561 554 ------
NM_015138chr1562671 988 819 471 168 60 1391 4753 492 478 69 --
NM_015141chr341023 820 381 226 --2707 612 --
NM_015143chr41238 11074 11130 --
NM_015149chr151434 1346 530 471 214 --21754 1680 --
NM_015151chr212308 146 ------
NM_015153chr64741 678 304 185 --1791 --
NM_015155chr1052929 2572 2523 2327 584 12768 23308 139 --
NM_015156chr14113517 3429 3154 2994 2624 2568 1063 886 861 633 175 --33360 1620 912 --
NM_015157chr1141005 926 445 415 --1275 --
NM_015158chr93751 201 188 1801 1771 --
NM_015170chr832355 781 769 --12015 --
NM_015172chr12597 435 21656 1050 ----
NM_015176chr131417 1167 635 11590 ----
NM_015180chr142884 181 --1124 --
NM_015185chrX82731 2632 2322 2241 911 633 590 553 12391 --1830
NM_015191chr1132731 838 168 --22570 1853 --
NM_015192chr2042987 1893 503 312 ----22913 445
NM_015194chr1772031 1818 1690 1548 1326 751 142 --21670 175 --
NM_015197chr1473152 3127 3111 853 597 352 267 --12921 --
NM_015199chr352313 2288 2173 1973 1067 12909 32579 1961 1954 12707
NM_015200chr462435 1992 1910 1771 1610 177 --32269 518 156 --
NM_015202chr1641389 1365 1172 612 --11708 --
NM_015206chr1593616 2977 2611 1219 1071 832 615 505 434 12999 12443 --
NM_015208chr1843359 1362 1255 448 1845 1508 --
NM_015209chr172291 1961 1890 1694 391 376 302 --12153 12024
NM_015215chr143029 550 332 256 12411 22128 309 --
NM_015225chr932867 2706 2649 1556 2843 380 1947
NM_015226chr16123454 3286 3276 3199 3011 1370 921 873 826 435 345 325 --41241 881 329 180 13140
NM_015227chr2153301 2507 512 133 87 --33489 3259 473 --
NM_015230chr431436 655 272 --11763 11596
NM_015234chr631144 1022 272 ------
NM_015236chr441331 980 226 216 1114 ----
NM_015239chr91459 ------
NM_015247chr16104929 4305 4067 3836 3646 1871 1764 1161 503 367 1822 44671 4220 3923 2144 14310
NM_015250chr951590 1436 386 378 251 ------
NM_015252chr25606 597 228 161 153 1622 3883 738 337 --
NM_015256chr51259 --2623 567 1161
NM_015260chr1911005 --21582 1554 --
NM_015263chr153984 403 359 --11130 --
NM_015265chr212152 --12466 --
NM_015267chr1251345 885 354 224 47 --11450 --
NM_015268chr3293 55 --1120 1259
NM_015271chr4104349 3096 2922 1636 860 700 638 609 151 60 33011 448 208 12788 11267
NM_015272chr16----21682 517 1180
NM_015275chr1211604 --32137 1593 1582 21780 818
NM_015277chr1841549 1399 305 31 --11831 --
NM_015278chr673479 3252 1259 378 209 164 72 --32963 2204 537 --
NM_015282chr272558 2487 2037 1108 930 721 407 ------
NM_015285chr1852598 2276 1608 645 73 21824 39 1528 --
NM_015288chr593661 3390 3200 3001 2507 2355 966 853 204 --53616 2720 2688 979 176 --
NM_015291chr143024 2578 1028 874 22488 118 63156 3056 2752 279 214 146 --
NM_015296chr1321039 400 ------
NM_015299chr1483812 3730 3495 3400 3293 3243 1272 747 12528 1371 22817 1080
NM_015305chr1481893 1820 608 464 269 175 155 29 --11555 --
NM_015310chr8178025 7959 7882 7789 7341 6223 5887 3188 3002 2799 1712 1516 1263 1232 1149 985 275 17996 97466 6679 3234 2821 2739 2676 2621 1363 288 11534
NM_015313chr11134432 3657 3462 3432 3327 3239 1470 1262 790 709 684 603 168 --33449 3187 3123 --
NM_015314chr721651 435 1722 11922 --
NM_015315chr5103436 3219 2333 2185 2172 997 963 582 547 208 --62769 2437 2243 2177 1035 737 1240
NM_015317chr272708 2464 2372 2125 2086 1942 1115 --1459 12870
NM_015320chr241013 377 356 61 --2387 91 --
NM_015321chr1974915 4877 4741 4306 3651 3139 438 --34292 1890 921 --
NM_015323chr641370 1137 299 197 1666 ----
NM_015326chr182552 2482 2070 1988 1138 1015 1009 855 --42166 2027 937 728 --
NM_015327chr14967 507 467 372 11259 ----
NM_015328chr7112817 2323 2317 2009 1190 779 671 617 599 405 54 --21137 318 22782 2431
NM_015335chr12102448 1912 1002 400 329 196 134 94 36 21 --12441 --
NM_015336chr1242446 2092 89 68 --1916 --
NM_015338chr2031845 1687 1450 --2753 419 --
NM_015339chr202193 77 ------
NM_015344chr821916 1616 --3678 403 193 12156
NM_015345chr682761 2530 2417 1994 646 453 208 184 31017 978 690 1500 12461
NM_015346chr1481611 1565 604 524 465 339 100 80 ----21736 192
NM_015349chr642256 2069 1920 544 1206 12129 --
NM_015355chr1721516 614 162 1589 --
NM_015358chr212918 842 ----1374
NM_015359chr8132746 2708 2668 2240 2208 2048 1919 1836 821 741 527 310 232 2840 343 2291 237 --
NM_015361chr21335 ------
NM_015365chrX114120 4034 4027 3741 1700 989 464 373 354 331 259 13719 33632 3028 398 --
NM_015375chr1114853 4846 3830 3540 1690 1589 1492 1425 1409 576 40 ------
NM_015378chr162988 2674 2145 1813 815 668 22909 412 ----
NM_015381chr2252080 1533 1439 1330 101 1813 1746 --
NM_015382chr141516 ------
NM_015384chr51119 ------
NM_015385chr1043194 2016 1101 427 --12973 --
NM_015387chr222083 1743 ------
NM_015388chr63264 235 29 --1269 --
NM_015393chr463452 2887 1126 475 149 139 13436 33727 1227 485 --
NM_015394chr1252085 1963 1581 889 449 --21636 198 1747
NM_015396chr331485 190 79 --1270 --
NM_015397chr961865 1564 1513 1278 308 53 1364 --11404
NM_015401chr122782 292 154 ----
NM_015416chr122794 667 --1176 --
NM_015426chr31582 ----1448
NM_015428chr1941695 1498 558 541 --2526 84 --
NM_015429chr3--11003 ----
NM_015435chr831326 1024 503 ------
NM_015436chr493257 3050 2943 1251 965 766 747 474 58 1484 22556 1314 1235
NM_015441chr11324 ------
NM_015443chr1741450 1030 274 215 --1573 11278
NM_015444chr31657 --2613 107 --
NM_015446chr1----11456 1345
NM_015455chr5104033 3866 3393 3350 1369 1245 1002 406 386 323 --31529 1289 606 1266
NM_015457chr112234 69 --1353 --
NM_015458chr884869 4842 4584 4433 3622 1515 141 56 --55266 1861 1820 1507 314 14354
NM_015460chr331870 1586 723 ------
NM_015463chr21776 ------
NM_015464chr72257 92 --1178 --
NM_015465chr52758 487 ------
NM_015466chr3--1192 ----
NM_015472chr31127 ------
NM_015472chr31127 ------
NM_015475chr23744 406 217 ------
NM_015483chr71974 ------
NM_015484chr12801 164 ----1964
NM_015485chr1----1103 --
NM_015488chr221635 1488 21376 1183 ----
NM_015493chr1952143 2100 1491 1430 77 --21688 567 --
NM_015497chr153243 119 69 1349 ----
NM_015503chr161586 ------
NM_015508chr321556 1120 --11549 --
NM_015509chr1261540 1530 1413 1364 439 92 --21282 1152 --
NM_015511chr2061135 1058 949 753 164 74 --2983 314 --
NM_015514chr141409 --1435 --
NM_015520chr352537 2530 2483 1890 1881 12449 22739 1030 11064
NM_015523chr112191 64 ------
NM_015525chr62883 176 --1253 --
NM_015527chr162776 514 ------
NM_015531chr111127 ------
NM_015534chr1288 31 --11045 1787
NM_015535chr284129 4053 3598 3511 2879 1339 1205 122 --1208 --
NM_015541chr311002 --11160 --
NM_015542chr101249 1504 ----
NM_015548chr63879 304 29 ------
NM_015550chr792910 2672 2260 2243 1412 769 642 151 37 --23300 2728 --
NM_015554chr1542781 2631 1966 1913 --22698 501 --
NM_015559chr181110 --1690 --
NM_015564chr532867 739 448 12599 22641 1042 --
NM_015565chr2121776 120 21514 1429 --11591
NM_015567chr135516 494 413 379 128 --2368 220 1170
NM_015568chr2053726 3205 3185 2745 1730 --24350 785 22877 872
NM_015569chr194715 4667 4403 3397 1928 1724 490 483 352 24092 1942 21932 494 13687
NM_015570chr731761 733 238 11450 ----
NM_015571chr62950 356 12504 --1767
NM_015575chr232346 675 649 --5653 390 387 352 140 1371
NM_015576chr352755 2279 2240 232 211 21824 622 22376 1035 12403
NM_015578chr1932091 1370 461 --11922 --
NM_015601chr102839 337 1220 ----
NM_015602chr171362 694 688 455 358 321 248 11203 11591 11541
NM_015604chr143608 214 119 --1238 --
NM_015607chr11200 --1159 --
NM_015609chr132577 479 464 --22336 1925 --
NM_015635chr931941 621 173 --42199 876 347 194 --
NM_015638chr204670 511 238 86 ------
NM_015640chr184889 4511 3509 1256 1247 1026 865 263 --34830 2109 31 --
NM_015645chr113359 314 306 ------
NM_015649chr191122 ------
NM_015651chr961790 720 713 303 270 75 --21737 521 --
NM_015652chr103629 224 183 ------
NM_015660chr7----2273 220 --
NM_015670chr171474 --283 78 --
NM_015676chr14179 --1331 --
NM_015678chr1351646 1455 1296 1200 539 --11211 --
NM_015680chr24604 581 547 479 --1590 --
NM_015686chrX42382 2083 1920 1776 --1419 --
NM_015691chrX42454 1109 367 194 --12905 12946
NM_015694chr72252 132 ------
NM_015695chr64504 490 131 66 --62152 1839 1802 558 547 532 --
NM_015704chr22----144 --
NM_015711chr193849 694 267 --1654 --
NM_015716chr174482 289 197 180 1593 ----
NM_015719chr195738 243 202 152 145 ------
NM_015723chr71703 ----1527
NM_015831chr73891 333 105 141 ----
NM_015833chr2162252 1516 929 777 558 326 1730 32303 1632 934 --
NM_015834chr212863 127 --2914 243 --
NM_015840chr1122711 2490 2436 2153 2048 1753 855 705 499 479 100 71 11671 2337 302 12537
NM_015841chr1122711 2490 2436 2153 2048 1753 855 705 499 479 100 71 11671 2337 302 12537
NM_015850chr852266 2121 1796 350 185 --12131 --
NM_015865chr1821064 1019 --1156 --
NM_015872chr141454 1335 1258 131 --1466 --
NM_015874chr41483 ------
NM_015878chr822209 96 ------
NM_015879chr18148456 8297 7969 7029 6649 5625 3306 3113 3058 2794 2719 2411 1424 939 1458 45615 1484 677 134 17061
NM_015886chr874786 4061 3598 2060 1434 1363 171 --45191 5160 130 118 15264
NM_015888chr133249 2912 515 --12746 --
NM_015889chr223247 126 84 ------
NM_015891chr612047 ----1580
NM_015901chr102855 319 ----1295
NM_015906chr1104480 4200 4032 3720 1472 1419 884 746 542 279 24612 4055 21869 1742 --
NM_015912chr8102490 2095 2036 1943 1806 1738 1685 1673 946 527 ----1730
NM_015913chr12543 519 --2569 212 --
NM_015948chr62399 159 ------
NM_015952chr6----1120 --
NM_015955chr21160 --1130 --
NM_015957chr113374 353 147 --1304 --
NM_015959chr111445 --3725 617 27 --
NM_015960chr101243 165 188 --
NM_015974chr132455 29 ------
NM_015981chr552184 638 546 424 246 22809 1212 22497 1079 --
NM_015984chr11159 --1384 --
NM_015987chr123275 119 54 ------
NM_015995chr15115242 5129 4573 3973 3449 1498 1441 1266 1187 1144 249 24767 889 159 --
NM_016002chr1--153 174 1731
NM_016009chr164245 4223 3320 3110 1937 222 13856 31734 1612 662 --
NM_016018chr852675 2179 2070 464 38 --22812 1999 --
NM_016019chr72383 161 --1387 1884
NM_016021chr682387 2050 764 535 464 273 259 212 --22161 115 --
NM_016022chr151073 876 773 146 93 1704 1728 --
NM_016025chr1632004 1831 1811 ------
NM_016026chr1441065 992 373 280 ------
NM_016032chrX51168 1057 1002 890 536 --11335 --
NM_016041chr172309 70 --2387 313 --
NM_016057chr1251122 1029 522 373 31 --1188 --
NM_016059chr63356 329 28 --1180 --
NM_016061chr251542 1449 1360 1106 552 ------
NM_016072chr1221880 1691 --31933 894 559 --
NM_016073chr151296 --2421 150 --
NM_016075chr1362644 2595 1962 836 140 23 1913 32817 2416 565 --
NM_016076chr153016 2186 1955 1134 829 181 42967 2259 586 245 12231
NM_016079chr282151 2062 1703 1440 789 662 130 37 11677 22066 1901 --
NM_016083chr643251 1216 772 612 --33840 3672 2795 --
NM_016090chr1111050 --11080 --
NM_016096chr842110 1499 1347 451 141 1432 --
NM_016099chr85964 457 365 356 80 --198 --
NM_016104chr6----1120 --
NM_016107chr521048 991 1447 ----
NM_016120chrX2324 147 --1287 --
NM_016125chr171572 ------
NM_016127chr81721 --160 --
NM_016131chr252326 1497 757 184 107 --3741 545 46 --
NM_016132chr1542808 877 754 305 --32525 1251 508 12479
NM_016139chr71275 ------
NM_016141chr33810 100 66 ------
NM_016146chr111169 --1258 --
NM_016147chr115946 873 382 232 85 ------
NM_016152chr311060 --2386 257 --
NM_016156chr1152251 1743 1586 529 462 --32270 2219 938 --
NM_016162chr125844 670 307 260 32 ------
NM_016169chr10113247 3098 2558 2329 2315 1178 1002 728 615 454 343 1880 63265 2808 2646 1290 495 474 12988
NM_016194chr1551547 1287 1262 1228 389 --31334 700 421 11579
NM_016201chr382281 2170 1440 501 456 230 45 35 --11451 1838
NM_016203chr72697 126 ------
NM_016206chr3198633 8582 8050 7209 7196 6464 5454 3377 3326 2981 2972 1747 1593 1505 873 784 610 247 211 12877 88111 8072 7278 7269 3388 2178 1605 1252 16839
NM_016213chr15169 ------
NM_016217chr643044 2929 1269 394 --32902 838 94 --
NM_016224chr671786 1470 755 487 478 287 39 --21805 741 11530
NM_016226chr121130 --1350 --
NM_016227chr12995 289 ----1327
NM_016230chr61143 123 ----
NM_016231chr171670 --11080 --
NM_016235chr1641527 1267 1040 323 --21217 34 --
NM_016248chr1384016 3446 3224 3170 1403 1138 633 391 13467 23998 3580 22844 214
NM_016252chr22943 797 ------
NM_016255chr653214 3157 1107 973 660 --22264 1239 --
NM_016257chr193254 3170 3089 2543 1199 500 329 142 126 33005 2401 214 22315 1025 12207
NM_016258chr11733 --1553 --
NM_016260chr2137333 6526 6307 6063 5973 5182 5074 2865 2709 2351 1256 477 82 21977 1112 47586 2464 2215 1049 26312 5939
NM_016269chr44949 733 320 67 --2873 863 --
NM_016271chr1842371 2088 1727 331 ------
NM_016272chr22132562 2529 2488 2424 2002 1908 1738 962 851 789 679 362 108 22554 2442 ----
NM_016277chr641636 1526 1227 1146 1206 ----
NM_016279chr5173 ------
NM_016281chr124909 893 881 185 1233 1859 --
NM_016282chr9----31757 1481 675 --
NM_016284chr163730 387 79 ------
NM_016287chr181852 1612 1425 601 322 261 197 106 1688 52065 1798 1653 518 267 --
NM_016289chr232291 1906 1723 --1205 --
NM_016300chr3237 26 ------
NM_016303chrX1380 --174 --
NM_016308chr11720 --21771 369 --
NM_016315chr251820 1424 1348 146 132 --1221 --
NM_016316chr21530 ------
NM_016319chr122707 261 1157 1557 --
NM_016320chr112274 91 --11094 1249
NM_016322chr982506 2359 2147 1121 629 578 381 82 --32935 1011 634 --
NM_016329chr31389 ------
NM_016333chr163193 102 62 ------
NM_016338chr55983 972 863 397 190 ------
NM_016353chr86977 937 843 741 269 145 21890 1882 2876 502 --
NM_016357chr122215 139 ------
NM_016374chr131143 568 189 11367 ----
NM_016374chr131143 568 189 11367 ----
NM_016376chr1773848 3064 3004 2869 1543 710 500 22905 2672 13491 --
NM_016396chr1572883 2527 2489 2384 2048 1969 957 21197 651 32064 528 364 12307
NM_016410chr91181 --2202 104 --
NM_016418chr22103741 3594 3321 3137 3022 2827 2512 2427 2380 277 --33526 316 258 --
NM_016422chr1173140 3054 2293 2018 1053 880 692 1532 1677 --
NM_016424chr1751477 724 308 153 51 ----1729
NM_016436chr2061942 927 557 535 417 237 --1455 --
NM_016441chr242365 962 691 187 ----1636
NM_016442chr542185 2147 1960 699 ----1313
NM_016448chr11425 1297 21374 686 --
NM_016454chr152331 129 ------
NM_016463chr51118 ------
NM_016470chr20----1489 --
NM_016483chr34278 247 227 220 --1321 --
NM_016485chr632165 1828 783 ------
NM_016486chr11353 ------
NM_016487chr6192 ------
NM_016499chr111124 2211 179 ----
NM_016506chr114522 276 219 36 ------
NM_016507chr1752823 2811 969 139 60 12220 73099 3095 857 791 757 555 33 1458
NM_016513chr673597 3548 3223 3121 2542 2533 539 --2337 127 --
NM_016519chr41551 ----1365
NM_016522chr1141455 1330 1090 1077 11142 ----
NM_016525chr92959 649 ------
NM_016530chr1583427 3384 1606 1503 1326 587 246 54 --23857 3421 13292
NM_016531chr473629 3230 2787 754 588 529 338 1174 11012 --
NM_016542chrX31368 1323 658 1535 ----
NM_016544chr2