TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3919
miRNA Sequence: GCAGAGAACAAAGGACUCAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51864 ------
NM_000021chr144988 923 901 798 ----140
NM_000024chr51216 ------
NM_000045chr6299 63 ------
NM_000051chr11103507 2824 2335 2163 866 818 769 729 683 193 12946 11373 --
NM_000052chrX113410 3318 3285 3250 3129 2801 2680 623 612 547 98 --33321 3206 908 --
NM_000061chrX133 1308 --1157
NM_000067chr82685 110 --1229 --
NM_000068chr1911503 ----11432
NM_000074chrX2771 634 --1342 --
NM_000075chr122195 72 185 ----
NM_000081chr131828 1362 328 ----1505
NM_000084chrX196289 6178 6011 5863 5449 5443 5411 5369 5357 4808 2710 2256 2186 2047 1917 907 498 175 161 24973 600 36921 6275 1426 --
NM_000088chr1741052 1008 360 322 1181 ----
NM_000089chr7272 50 --1683 --
NM_000090chr22626 162 1366 --1304
NM_000091chr292861 2719 2565 1988 1042 982 360 161 84 --21884 214 --
NM_000092chr2104470 4096 3630 3496 3410 3133 3113 1777 1338 702 --31737 1409 1385 --
NM_000093chr972251 2124 2111 1959 964 892 385 ------
NM_000096chr33954 778 660 ------
NM_000097chr35993 878 783 767 488 --11040 --
NM_000108chr731608 524 317 ----2321 29
NM_000109chrX82417 2302 2159 2038 2019 1738 562 343 ------
NM_000110chr14999 932 212 114 ----1217
NM_000112chr5145479 5294 5003 4245 3893 1947 1789 1582 1564 795 772 518 504 392 1785 75192 4817 4208 3927 3702 1476 763 --
NM_000115chr13102717 2710 2312 2159 2016 1809 1635 895 333 31 --11684 --
NM_000125chr6124271 4022 4016 3806 3731 3522 3015 2605 1719 1603 1574 220 13149 12649 --
NM_000127chr8----1338 --
NM_000133chrX2412 124 --21262 356 --
NM_000138chr1522140 906 32270 2098 1625 1138 --
NM_000139chr1172584 2495 2194 241 211 149 91 ------
NM_000141chr1041128 1093 1035 205 ------
NM_000151chr1751722 1385 1375 1211 587 21849 332 ----
NM_000158chr32455 49 1633 1448 --
NM_000161chr1441495 1393 713 391 ------
NM_000163chr532396 2108 1999 --12085 --
NM_000165chr661699 1548 1092 1085 646 297 ----11150
NM_000167chrX61777 678 647 470 440 381 ----1578
NM_000168chr7103036 2764 2707 2648 2586 2430 2350 2341 483 327 --23373 2321 12789
NM_000173chr172410 388 --1121 --
NM_000175chr19143 ----1238
NM_000176chr573457 1396 1374 567 392 382 344 ----13490
NM_000183chr23379 326 31 ------
NM_000192chr123454 443 324 1613 ----
NM_000208chr19133948 3553 1888 1880 1853 1751 1178 1152 1034 543 513 337 136 --11370 --
NM_000210chr272351 1766 1669 843 424 399 34 --12304 --
NM_000212chr1742384 2006 1699 637 --11811 1670
NM_000214chr2041155 607 156 53 21459 295 ----
NM_000217chr12215228 4967 4657 4184 3640 3403 3349 3251 2074 1856 1762 1560 1523 1409 1102 768 677 656 433 350 251 33535 2107 1921 22077 1563 11577
NM_000222chr441888 737 70 46 1133 11907 --
NM_000223chr171123 --1126 --
NM_000227chr181305 ------
NM_000232chr462934 2266 2101 914 294 217 --22644 1277 --
NM_000237chr831582 1519 720 --1755 11446
NM_000240chrX81935 1482 840 628 423 373 305 22 1260 --11939
NM_000242chr1072342 2156 2056 1775 495 479 380 ------
NM_000248chr3102986 2748 2477 2412 2138 2027 952 936 710 82 1270 11046 --
NM_000252chrX31382 1273 410 ------
NM_000253chr42755 280 179 ----
NM_000259chr15105854 5764 5274 4923 4438 4377 1932 1633 1009 692 24522 4086 --11994
NM_000264chr9133287 3094 3011 2990 2215 2124 1265 1156 901 747 682 576 435 ------
NM_000266chrX2879 222 --2209 187 --
NM_000267chr1763211 2524 897 765 204 190 --11322 11089
NM_000268chr2283737 3466 2456 2389 1308 1267 231 198 --11083 1219
NM_000271chr181678 --1254 --
NM_000276chrX62143 1751 1725 646 598 235 1843 --12263
NM_000278chr1082260 1692 1669 1653 1638 557 514 390 --11568 --
NM_000280chr1121013 790 ------
NM_000286chr173910 809 139 ------
NM_000289chr12----1310 --
NM_000293chr163642 330 323 ----1646
NM_000297chr4121914 1654 1630 1588 1363 1298 818 777 509 460 186 111 ------
NM_000304chr171887 ----11083
NM_000310chr131242 1148 475 2924 876 ----
NM_000313chr321088 198 199 ----
NM_000314chr1072579 2568 1133 1053 895 590 125 12561 22750 2156 11137
NM_000315chr111225 1106 ----
NM_000319chr1221178 251 2334 204 11181 --
NM_000321chr1351768 1605 1552 722 352 ------
NM_000325chr4--1583 1561 --
NM_000328chrX1324 184 ----
NM_000329chr11913 1591 ----
NM_000330chrX42113 2042 1523 248 1163 1281 --
NM_000332chr6307074 6986 6904 6369 6163 6103 5673 5516 5025 4970 4914 4445 2789 2760 2733 2474 2404 2107 1891 1771 1643 1497 1240 1200 866 733 606 432 290 116 36656 4788 993 56408 6372 6217 2245 435 27055 5473
NM_000335chr321765 843 ------
NM_000337chr5136509 6029 5970 5254 4237 4084 2258 1708 1680 1379 1149 838 411 11080 56624 5710 5257 4927 4162 --
NM_000338chr1531111 821 172 ----11092
NM_000340chr361553 1497 1369 493 396 276 --11154 1965
NM_000345chr41218 11052 ----
NM_000346chr17111972 1945 1794 1590 1421 1380 611 574 432 361 128 --41580 1482 1383 1328 --
NM_000362chr2263336 1280 884 237 198 102 ------
NM_000368chr963586 3316 1648 1011 598 369 23400 349 ----
NM_000369chr1471931 1782 1563 1413 1394 1339 153 1765 --11344
NM_000378chr114374 328 277 183 11150 ----
NM_000386chr171594 1763 ----
NM_000390chrX83302 3277 3017 2099 1057 413 389 349 13112 21170 392 --
NM_000396chr13477 444 178 --1526 --
NM_000399chr104964 750 734 392 ----1820
NM_000408chr2112817 2707 2669 2290 2121 769 749 503 435 291 223 ----1773
NM_000411chr2192560 1301 1235 332 162 129 116 110 81 12986 2165 121 --
NM_000412chr33299 268 90 ------
NM_000415chr12--1749 ----
NM_000421chr175310 286 262 250 59 ------
NM_000427chr12180 173 ------
NM_000430chr1763125 3083 3077 3002 2529 349 12511 33757 2532 2523 1422
NM_000435chr196864 345 280 260 105 62 --167 --
NM_000439chr572296 2048 1566 750 404 251 127 --22075 642 --
NM_000441chr741441 927 299 94 32357 1478 586 11434 --
NM_000447chr12158 99 ------
NM_000448chr11123069 2975 2919 2665 2494 2159 2111 2017 1031 984 805 522 ------
NM_000449chr151375 987 571 457 93 --166 --
NM_000450chr171672 1591 1276 378 317 265 88 ----11676
NM_000451chrX72144 2012 1928 1922 1854 1832 440 --21675 589 --
NM_000458chr171583 --1586 --
NM_000461chr3124265 4073 3715 3621 3146 3097 2809 1673 937 914 896 788 --2855 87 --
NM_000462chr1531327 277 172 --21718 588 1306
NM_000474chr73665 513 133 --1677 --
NM_000478chr13696 302 249 1652 ----
NM_000484chr2151054 955 883 432 292 1681 1785 1887
NM_000489chrX123339 2889 2738 2413 1264 1113 1092 792 691 537 496 384 1571 12282 --
NM_000492chr721117 471 ------
NM_000493chr641101 783 238 47 --1819 1114
NM_000495chrX31042 925 206 1860 ----
NM_000503chr881857 1713 1630 1559 1502 1318 1243 417 ----11635
NM_000517chr16--189 ----
NM_000522chr72949 158 ------
NM_000523chr22826 133 11041 ----
NM_000525chr1131483 1080 158 ------
NM_000530chr131071 381 274 --1688 --
NM_000533chrX101607 1581 1379 1299 1227 441 404 166 84 26 11912 ----
NM_000536chr112490 112 1251 ----
NM_000538chr1351519 1379 1367 563 300 --1579 --
NM_000539chr321012 302 11312 ----
NM_000555chrX217850 6793 6686 6517 5894 5522 5349 5286 2986 2894 2773 2644 2442 2355 2040 2020 1909 1357 1022 843 444 25515 2297 56964 5529 1537 1433 447 --
NM_000558chr16--190 ----
NM_000573chr192061 1871 1625 721 616 488 345 320 182 1101 32305 2236 476 --
NM_000575chr231015 454 143 1889 21019 732 11150
NM_000587chr541283 1192 1035 982 --1268 --
NM_000594chr61638 ------
NM_000595chr61625 --1628 --
NM_000596chr71181 ------
NM_000598chr751528 1402 1076 237 105 1509 --1176
NM_000599chr2134597 4532 4312 4274 4217 3936 3892 3467 1695 1029 1015 999 236 13070 11006 23452 3363
NM_000601chr7--1337 1159 --
NM_000610chr1172837 2641 2518 1850 996 159 129 1199 ----
NM_000611chr11157037 6886 6741 6437 6122 5670 5493 4761 2749 2510 2284 1921 1643 374 57 --21477 307 26134 1287
NM_000615chr11122901 2790 2578 2503 2417 2038 1958 1082 685 665 522 135 11019 1999 1904
NM_000617chr1262327 1866 1788 1758 1556 814 1216 --1562
NM_000618chr12136599 5640 4472 2634 2328 2172 2060 1908 1827 1719 1264 1181 430 35663 2393 353 14191 --
NM_000618chr12136599 5640 4472 2634 2328 2172 2060 1908 1827 1719 1264 1181 430 35663 2393 353 14191 --
NM_000620chr1252038 1625 491 326 212 21701 374 1329 --
NM_000633chr18104884 4868 4487 3436 3399 3377 1666 583 453 293 --21897 500 --
NM_000651chr192061 1871 1625 721 616 488 345 320 182 1101 32305 2236 476 --
NM_000675chr222257 51 ----1821
NM_000678chr201227 ------
NM_000679chr5123 --1156 --
NM_000683chr41510 1450 ----
NM_000684chr104812 279 237 215 1344 1259 --
NM_000685chr32169 145 ------
NM_000685chr32169 145 ------
NM_000686chrX31467 1419 495 21384 306 --2181 110
NM_000693chr1561737 1142 1131 608 534 244 185 ----
NM_000701chr1167 ------
NM_000702chr142257 1992 1682 1629 ----1276
NM_000719chr12186630 5928 4979 4658 4616 4549 2162 1799 1766 1557 1373 1344 1281 885 847 750 727 123 --11382 --
NM_000721chr192679 2642 2623 1989 1871 390 320 227 34 ------
NM_000724chr1061522 1299 580 531 180 78 ------
NM_000726chr241113 1071 1062 249 11078 ----
NM_000729chr31215 ------
NM_000739chr74643 583 524 86 ------
NM_000756chr82403 356 1390 ----
NM_000788chr461138 1057 925 573 175 87 ------
NM_000800chr511674 --1160 --
NM_000801chr2031129 902 744 --1710 --
NM_000806chr541845 1784 1258 560 1568 ----
NM_000807chr4122 ------
NM_000809chr4359322 9287 8562 8555 8496 8105 7827 7801 7422 7413 7059 6998 6783 6772 6746 6433 6260 6212 6022 6009 5932 5789 5630 3654 3625 3225 2297 2175 1989 1540 1527 1429 856 665 85 13412 13660 38500 5613 634
NM_000810chr151217 ------
NM_000811chr5159 --2217 44 --
NM_000813chr5185546 5485 4902 4332 4127 3606 2054 1838 1774 1723 1664 1566 1537 1367 1257 1053 528 468 11950 ----
NM_000814chr15113665 3397 3009 2974 2798 2694 1676 1202 1118 764 318 1468 2598 561 11314
NM_000817chr251094 1032 997 986 183 ------
NM_000818chr10132 2382 128 ----
NM_000820chr132241 35 1272 ----
NM_000826chr492054 1643 847 785 438 415 341 262 208 --22444 2057 --
NM_000827chr5112586 2563 2452 2400 2353 2030 1803 1709 977 381 197 1290 41793 1712 980 209 --
NM_000828chrX42038 1975 877 369 --1685 1335
NM_000829chr1151941 1780 1740 628 89 ------
NM_000831chr1106073 5671 5595 5530 4304 4156 4023 1958 963 315 --15627 --
NM_000833chr1641558 1282 405 379 11356 ----
NM_000838chr652795 1968 1908 1819 1758 --1239 --
NM_000840chr71454 ------
NM_000842chr113512 484 201 1254 ----
NM_000844chr341068 803 735 77 --1378 --
NM_000857chr43487 102 49 ------
NM_000859chr541723 1114 582 167 21272 225 11535 11593
NM_000861chr371897 1735 1028 897 572 222 102 11826 ----
NM_000865chr61191 ------
NM_000868chrX5946 307 299 266 57 22106 512 22513 72 --
NM_000870chr591525 1517 1206 1148 1140 556 427 269 94 1279 2386 249 --
NM_000872chr1041260 1141 546 253 --3573 535 155 --
NM_000875chr15257041 7025 6961 6834 6757 5741 5538 5480 4995 4881 2801 2449 2384 1961 1832 1677 1525 1508 1344 1297 1128 955 811 342 332 --45744 4573 1131 153 26750 2830
NM_000876chr631394 1257 376 ------
NM_000891chr17113422 3257 3250 3130 2949 2701 2407 655 594 583 322 22574 2380 23520 1060 --
NM_000899chr1282719 2685 1724 1687 1451 1390 463 421 24020 3665 13097 --
NM_000900chr12----134 --
NM_000901chr4102536 2298 2025 1922 1732 1700 1003 868 443 336 ------
NM_000902chr353080 2822 674 268 65 21179 1028 22482 2344 --
NM_000903chr1641092 367 262 98 11062 1601 --
NM_000908chr52140 41 --2519 28 --
NM_000912chr883464 3431 3345 2855 2837 2632 675 217 22797 2726 22609 1361 23438 2759
NM_000917chr104915 764 171 21 ------
NM_000919chr52543 531 ------
NM_000922chr1121037 778 31126 1100 444 ----
NM_000926chr11259422 9288 8761 8416 8215 8094 7987 7900 7877 7787 7670 5730 3755 2616 2535 2410 2322 1572 1355 1345 1294 1115 836 216 165 19079 68630 7260 6098 3049 2721 1333 28470 6000
NM_000933chr2041648 1444 686 481 ------
NM_000935chr341231 1134 985 341 165 --1486
NM_000938chr41136 ------
NM_000941chr71278 --1372 --
NM_000944chr442378 2314 676 653 ------
NM_000945chr292027 1941 1862 1401 1324 282 177 109 84 151 1112 --
NM_000949chr54953 922 589 42 ------
NM_000950chrX93631 3403 3338 1217 1006 717 470 235 140 ------
NM_000958chr53478 268 32 --1484 1975
NM_000959chr1103989 3941 3796 3220 2888 1378 1300 1187 976 707 --21315 1190 1711
NM_000961chr2084037 2737 2578 953 922 223 129 75 --23671 668 --
NM_000962chr92874 287 1389 195 --
NM_000964chr17149 --152 --
NM_000965chr31358 2322 261 ----
NM_000966chr1221077 997 1362 ----
NM_000972chr9----122 --
NM_000983chr1101617 1573 1365 1334 491 449 372 341 167 81 --31309 414 176 11280
NM_001001132chr2131002 939 578 --1392 --
NM_001001323chr12143219 3111 3064 3038 2870 2846 2787 2650 2449 2123 2107 680 458 387 23054 2656 ----
NM_001001330chr104974 829 472 155 ------
NM_001001331chr342740 2480 827 408 12114 3725 618 167 22322 440
NM_001001342chr1051505 1425 970 353 322 --3468 398 325 1182
NM_001001344chrX82596 2191 2108 2006 832 357 343 140 ------
NM_001001389chr1172837 2641 2518 1850 996 159 129 1199 ----
NM_001001390chr1172837 2641 2518 1850 996 159 129 1199 ----
NM_001001391chr1172837 2641 2518 1850 996 159 129 1199 ----
NM_001001392chr1182883 2687 2564 1896 1887 1042 205 175 1245 ----
NM_001001395chr1262796 2303 2235 2073 425 45 12642 1369 --
NM_001001396chr1124095 4052 3980 3670 3522 2848 2714 1513 1328 1192 815 290 21565 1524 31051 1001 847 1298
NM_001001419chr5165230 4994 4473 4402 4304 4119 4085 3665 3654 2094 2031 1977 1790 1626 581 117 13267 74750 4219 3844 2040 1894 1004 432 14477
NM_001001420chr5165230 4994 4473 4402 4304 4119 4085 3665 3654 2094 2031 1977 1790 1626 581 117 13267 74750 4219 3844 2040 1894 1004 432 14477
NM_001001433chr2063081 2945 2552 725 485 408 12923 22948 2474 --
NM_001001436chr163686 557 118 ------
NM_001001481chr893344 2929 2836 2823 2704 1371 1064 1052 991 2732 74 22839 2547 --
NM_001001483chr112374 340 ------
NM_001001484chr1052420 1523 618 419 295 --11954 22476 150
NM_001001520chr191147 ------
NM_001001522chr111431 ------
NM_001001549chr7122782 2618 2608 2570 2515 2389 2376 1962 1789 1746 1146 711 --32576 1968 411 --
NM_001001550chr7122782 2618 2608 2570 2515 2389 2376 1962 1789 1746 1146 711 --32576 1968 411 --
NM_001001555chr7122782 2618 2608 2570 2515 2389 2376 1962 1789 1746 1146 711 --32576 1968 411 --
NM_001001556chr1581627 1137 1076 495 409 401 177 61 11167 ----
NM_001001557chr862224 2038 760 521 274 261 11598 1781 --
NM_001001560chr221531 ------
NM_001001664chr273359 3019 1326 1220 1058 430 95 13509 --12675
NM_001001701chr442136 1985 1683 1476 --12194 --
NM_001001702chr571564 1550 1442 1418 1343 744 270 --21647 29 --
NM_001001715chr131401 --1116 --
NM_001001740chr11277 ------
NM_001001740chr11277 ------
NM_001001787chr12198 174 ------
NM_001001790chr93355 342 64 1103 ----
NM_001001852chr222872 179 ------
NM_001001870chr172803 767 --1812 --
NM_001001890chr21174254 3988 3645 3606 3203 3119 3103 2877 2821 2755 1466 1193 1175 859 653 631 592 --23225 1075 --
NM_001001924chr881923 1771 1649 1410 1351 1323 842 807 129 2754 684 --
NM_001001925chr881923 1771 1649 1410 1351 1323 842 807 129 2754 684 --
NM_001001931chr881923 1771 1649 1410 1351 1323 842 807 129 2754 684 --
NM_001001933chr1------1488
NM_001001936chr1061092 1070 1059 480 392 269 1879 1208 --
NM_001001938chr993445 3345 3337 3326 1533 1241 1137 326 85 34001 1131 1075 21614 358 --
NM_001001974chr1082300 2209 2159 1812 1635 751 290 184 ------
NM_001001994chrX184 --1563 --
NM_001001995chrX51785 1658 1586 1444 179 1475 ----
NM_001001996chrX184 --1563 --
NM_001002006chr25897 796 228 131 56 1190 1119 1617
NM_001002026chr3102363 2225 1699 928 796 686 544 247 165 133 --1430 11644
NM_001002032chr173106 60 40 ------
NM_001002233chr862124 1804 1445 629 341 32 ------
NM_001002243chr22275 241 ------
NM_001002255chr63129 120 39 ------
NM_001002257chr2143164 3118 2582 2350 2265 1437 1290 1278 1096 922 889 762 619 298 1183 1793 12357
NM_001002259chr12170 ------
NM_001002265chr103747 137 131 ------
NM_001002266chr103747 137 131 ------
NM_001002275chr14571 457 447 415 ------
NM_001002295chr103904 826 796 ------
NM_001002759chr101587 130 ----
NM_001002814chr863855 3644 1445 629 341 32 --23879 3860 --
NM_001002838chrX31389 615 405 1243 ----
NM_001002843chr1511088 --1971 --
NM_001002860chr14184647 4597 4451 4417 3759 3544 3331 3226 3062 1880 1834 1709 1539 1312 1174 447 315 272 1215 1318 13723
NM_001002909chr1772132 2112 2015 1586 747 509 192 1500 12018 --
NM_001003406chr2223061 51 ------
NM_001003407chr10184714 4674 4071 3995 3702 3676 3576 3482 3284 3240 1227 1075 1061 1029 975 732 617 289 44794 4486 1776 1740 14295 14803
NM_001003408chr10184714 4674 4071 3995 3702 3676 3576 3482 3284 3240 1227 1075 1061 1029 975 732 617 289 44794 4486 1776 1740 14295 14803
NM_001003652chr18258579 8245 8173 7988 7305 7191 6309 6288 6195 5939 5910 5678 5639 5368 3120 2940 2869 2847 2453 1793 1784 1659 1582 1164 647 37699 5989 2666 88367 6419 6134 5710 2809 2635 549 456 38249 7451 1597
NM_001003665chr14962 802 167 88 --2102 92 1822
NM_001003674chr1895632 5621 5291 4967 4698 4522 2515 446 134 2872 141 17035 --
NM_001003675chr1895632 5621 5291 4967 4698 4522 2515 446 134 2872 141 17035 --
NM_001003679chr182221 2070 1740 1706 1578 883 549 270 --12224 --
NM_001003681chr2221528 252 --11450 --
NM_001003688chr441191 816 801 439 --1339 --
NM_001003694chr33572 101 44 ------
NM_001003712chr12174025 3905 3617 3387 2964 2894 2879 2704 2504 1594 1569 1160 1137 1045 807 409 320 13101 ----
NM_001003760chr673573 3527 3354 2741 2471 701 420 23267 2322 13578 11361
NM_001003790chr86764 708 631 288 244 136 ------
NM_001003791chr86764 708 631 288 244 136 ------
NM_001003792chr351234 1124 488 440 32 ----1334
NM_001003793chr351234 1124 488 440 32 ----1334
NM_001003800chr973136 2908 2681 1510 1311 1222 1162 23620 686 33499 3104 2525 --
NM_001003937chr271633 1575 1530 1490 1430 611 140 ----11402
NM_001003940chr1583588 3262 2981 2458 1253 863 649 175 1140 2338 180 --
NM_001003942chr1583588 3262 2981 2458 1253 863 649 175 1140 2338 180 --
NM_001003943chr1583592 3266 2985 2462 1257 867 653 179 1144 2342 184 --
NM_001004019chr31372 ------
NM_001004065chr9123981 3823 3813 3307 3030 2849 2508 1425 516 485 339 28 33616 3136 2738 23816 3033 12512
NM_001004106chr51243 ------
NM_001004127chr13170 ------
NM_001004303chr11573 ------
NM_001004303chr11573 ------
NM_001004304chr1263272 2308 2113 1255 928 813 --11245 --
NM_001004317chr684431 3801 3701 605 594 453 436 23 22781 1476 ----
NM_001004329chr1271142 994 947 509 493 347 155 ----1502
NM_001004342chr1236104 6042 6022 5953 5800 5789 5353 5093 4684 4568 4333 1897 1819 1752 1476 1195 846 782 731 721 715 669 151 31640 1520 983 36015 5023 4377 14749
NM_001004354chr94994 666 358 47 ------
NM_001004360chr261857 1743 520 452 350 280 --1205 --
NM_001004419chr1284582 4234 3882 3452 1481 1408 1327 847 14030 44435 4255 3424 522 14094
NM_001004441chr571605 1413 511 225 200 185 85 11082 11368 --
NM_001004720chr23975 950 783 --1105 --
NM_001004722chr231144 1119 952 --1274 --
NM_001005158chr32398 126 131 1390 --
NM_001005159chr32398 126 131 1390 --
NM_001005242chr125562 520 232 110 59 --1373 1566
NM_001005266chr151716 1622 ----
NM_001005267chr151716 1622 ----
NM_001005268chr151716 1622 ----
NM_001005269chr151716 1622 ----
NM_001005271chr1731172 1048 140 ------
NM_001005273chr1731172 1048 140 ------
NM_001005366chr126960 768 753 620 150 49 127 ----
NM_001005375chrY71883 1853 1741 1655 1382 1372 200 ------
NM_001005386chr262362 1556 971 684 103 41 164 ----
NM_001005404chr17174481 4356 3756 3679 3666 3655 3602 3427 3362 3188 1143 751 734 223 187 179 149 23686 545 14359 --
NM_001005417chr11214 ------
NM_001005463chr1062082 1860 1848 1710 652 227 --1409 11688
NM_001005473chr5176497 6412 5803 5287 5191 4999 4856 4089 2581 2435 2328 2286 2112 1408 365 317 277 21271 102 25140 5037 --
NM_001005474chr351493 1471 508 368 184 --11245 --
NM_001005476chr23707 135 33 ------
NM_001005505chr331697 407 379 --11700 --
NM_001005527chr351181 979 329 233 171 ------
NM_001005609chrX73347 3055 2926 1488 909 833 559 --23830 243 --
NM_001005732chr212631 68 ------
NM_001005733chr212588 68 1230 ----
NM_001005746chr241113 1071 1062 249 11078 ----
NM_001005747chr241113 1071 1062 249 11078 ----
NM_001005751chr101355 --1148 --
NM_001005753chr272317 2304 2122 2069 1676 788 547 1935 32030 1844 131 --
NM_001005781chr22424 383 ------
NM_001005782chr24873 832 61 22 1112 ----
NM_001005849chr173126 117 39 ------
NM_001005861chr33791 724 185 ------
NM_001005910chr31595 166 ----
NM_001005911chr31595 166 ----
NM_001006115chr382757 2626 2578 2358 1748 1726 313 110 1328 ----
NM_001006600chr572389 2061 1979 1824 1751 568 428 --1823 12393
NM_001006610chr161762 1802 122 --
NM_001006612chrX3402 379 180 ------
NM_001006613chrX3402 379 180 ------
NM_001006614chrX3402 379 180 ------
NM_001006617chr941306 1280 1266 383 --21235 444 --
NM_001006619chr941306 1280 1266 383 --21235 444 --
NM_001006620chr941306 1280 1266 383 --21235 444 --
NM_001006621chr941306 1280 1266 383 --21235 444 --
NM_001006626chr74643 583 524 86 ------
NM_001006627chr74643 583 524 86 ------
NM_001006628chr74643 583 524 86 ------
NM_001006629chr74643 583 524 86 ------
NM_001006630chr74643 583 524 86 ------
NM_001006631chr74643 583 524 86 ------
NM_001006632chr74643 583 524 86 ------
NM_001006634chr162639 217 --174 --
NM_001006636chr21396 ------
NM_001006656chr193605 540 84 ----21697 338
NM_001006681chrX1119 ------
NM_001006682chrX1119 ------
NM_001006683chrX1119 ------
NM_001006684chrX3418 404 43 171 --160
NM_001006938chrX1789 ----181
NM_001006939chr101744 ------
NM_001007024chr17124103 3837 3734 3436 3285 3113 2979 2957 999 883 388 192 23137 1559 53599 3092 293 206 179 14381
NM_001007025chr17124103 3837 3734 3436 3285 3113 2979 2957 999 883 388 192 23137 1559 53599 3092 293 206 179 14381
NM_001007067chr831056 787 256 --151 1985
NM_001007068chr831056 787 256 --151 1985
NM_001007069chr831056 787 256 --151 1985
NM_001007070chr831056 787 256 --151 1985
NM_001007072chr15--135 191 --
NM_001007075chr4----1947 --
NM_001007097chr9154076 3870 3848 3833 3821 3552 3500 3184 1932 1906 1203 976 488 323 266 13537 25000 125 11893
NM_001007098chr15850 738 713 299 61 2213 135 1821 --
NM_001007099chr11810 --1904 --
NM_001007100chr11810 --1904 --
NM_001007102chr671605 1431 1270 598 377 357 245 11334 11182 1602
NM_001007156chr1551974 1641 679 326 85 ------
NM_001007237chr182816 2718 2697 2461 2103 1936 403 241 --52737 2466 2381 336 58 11912
NM_001007245chr7246 27 --1185 --
NM_001007246chr2161888 1298 1228 523 459 403 --41930 1394 528 121 11206
NM_001007250chr13932 658 35 --11026 --
NM_001007257chr141256 1059 527 468 ------
NM_001007267chr23862 826 158 ----198
NM_001007277chr114770 425 375 278 1256 1363 --
NM_001007278chr13145184 5158 4549 4413 4083 3747 3677 3328 3295 1634 927 875 818 26 11619 25025 1298 --
NM_001007466chr6175165 4783 4572 4510 4411 3970 3290 2001 1841 1589 1327 1181 1057 995 442 362 304 24760 1305 35125 4559 4513 11876
NM_001007527chr51677 ------
NM_001007538chr1361644 1323 1298 731 350 162 ----11171
NM_001007544chr12465 33 ------
NM_001007546chr231451 1081 403 --11241 --
NM_001007553chr151164 1141 828 441 431 --11200 --
NM_001007559chr1831929 1539 1412 --11619 --
NM_001007793chr102279 24 --2109 102 --
NM_001007794chr15766 760 688 582 126 --136 --
NM_001008220chr542691 1087 54 44 ------
NM_001008222chrX3885 152 114 1178 1117 --
NM_001008225chr73678 603 577 ------
NM_001008226chr1541780 1624 1122 197 --11166 --
NM_001008239chr18173736 3688 3394 2956 2755 2717 2678 2663 1228 1194 1005 930 686 567 541 213 56 --43798 2357 805 368 --
NM_001008388chr43814 396 104 --129 1287
NM_001008391chr115590 181 161 122 105 ------
NM_001008392chr383459 3031 2712 1278 797 515 439 234 21369 764 43391 2821 2624 1049 --
NM_001008401chr1961512 1458 1449 1331 1294 1093 ------
NM_001008405chr72670 583 ------
NM_001008407chr751649 1641 1499 1472 1393 21828 1584 ----
NM_001008408chr7126202 5505 5495 5172 5068 5054 2561 2235 1522 1334 1173 222 25807 2081 56178 5929 4738 888 301 1930
NM_001008495chr882180 2124 1841 1733 1699 1537 310 270 --52077 1819 1423 422 165 --
NM_001008528chr1791858 1823 1778 1475 1205 1120 614 224 71 11535 ----
NM_001008529chr1731311 820 354 ------
NM_001008539chr8125325 5099 4465 3875 3422 1979 1883 1550 1304 1107 1060 955 15383 45066 4236 1100 1092 --
NM_001008540chr21130 ------
NM_001008541chr1062010 1965 823 637 326 275 ----11834
NM_001008541chr1062010 1965 823 637 326 275 ----11834
NM_001008564chr1392288 2229 2128 1963 1747 857 204 174 63 11935 11428 --
NM_001008566chr221190 1482 --1433
NM_001008660chr1171413 1280 1048 983 489 441 264 --11051 --
NM_001008661chr12289 27 1343 ----
NM_001008662chr12289 27 1343 ----
NM_001008701chr1952918 2902 2878 2819 2797 --32848 2804 2157 1604
NM_001008707chr142296 78 ------
NM_001008708chr22594 241 ------
NM_001008723chr102486 204 ------
NM_001008738chr5102840 2664 2626 2423 2181 1040 1032 903 173 84 --1697 --
NM_001008777chr171614 --1211 --
NM_001008783chr64901 746 722 249 ----195
NM_001008784chr33219 43 22 ------
NM_001008800chr12178 89 ------
NM_001008801chr1972185 2138 2129 2011 1983 1770 1455 ------
NM_001008883chr12178 89 ------
NM_001008895chr1351377 547 231 210 77 11307 11168 --
NM_001008925chr4123428 3115 3048 2860 2849 2804 2731 2457 1098 799 743 642 11214 160 22739 219
NM_001009185chr54614 565 258 158 1571 ----
NM_001009552chr82547 100 ------
NM_001009554chr483950 3871 2986 2944 1765 906 493 266 13281 ----
NM_001009554chr483950 3871 2986 2944 1765 906 493 266 13281 ----
NM_001009555chr421650 1137 11422 --1137
NM_001009565chr22441 223 ------
NM_001009566chr141063 399 225 28 ------
NM_001009567chr103450 159 84 --1582 --
NM_001009571chr791708 1596 1566 1172 1127 1114 656 632 123 11533 31449 352 326 --
NM_001009814chr131248 ------
NM_001009880chr2274887 4258 3337 3203 1563 1144 250 --34930 1268 1218 --
NM_001009881chr12553 470 ------
NM_001009882chr12553 470 ------
NM_001009894chr1261265 1139 499 247 106 78 11223 11142 --
NM_001009899chr3165828 5735 5017 4617 4046 2503 2471 1878 1864 1736 1179 1169 1122 907 870 579 25406 994 35840 5548 2415 15395
NM_001009909chr1163844 3319 3250 1134 959 53 1646 13466 2732 486
NM_001009959chr282237 1726 897 867 761 600 499 380 --22510 2106 --
NM_001009960chr732352 757 553 --22585 1122 --
NM_001009993chr254326 3665 3222 1807 818 23779 3676 32881 791 570 --
NM_001010846chr1133779 3448 3227 2875 1730 1368 1303 930 920 911 626 569 448 44214 4203 1771 1074 23520 3142 13043
NM_001010853chr683062 2652 2525 2152 456 238 108 49 12822 12144 --
NM_001010854chr141182 1215 ----
NM_001010861chr122688 2553 12471 32775 2160 200 12646
NM_001010862chrX92998 2685 2474 2261 2037 828 685 542 397 --1976 --
NM_001010867chr196106 6055 5799 5374 2047 1908 1594 317 199 26485 2641 ----
NM_001010876chr6161 ------
NM_001010888chrX214405 4204 3887 3815 3798 3762 3739 3704 3581 3491 3167 3014 1631 1577 1496 1015 825 478 400 386 23 ----23481 3429
NM_001010891chr5206933 6746 6505 6443 6238 6111 5092 4801 2344 2226 2051 1434 1079 957 938 918 743 699 664 391 36691 4657 993 36560 6405 5785 --
NM_001010895chr9111999 1944 1595 1558 1531 1447 689 581 544 105 46 --21298 416 --
NM_001010908chr102637 617 --2652 573 --
NM_001010917chr1042232 2017 1742 1717 --22068 101 --
NM_001010924chr102799 456 ------
NM_001010927chr62566 364 --1569 --
NM_001010932chr7--1337 1159 --
NM_001010971chr13964 937 689 3765 713 245 2706 677 --
NM_001010980chr193229 2562 2261 1229 773 609 521 232 74 43476 2407 136 124 --12806
NM_001010984chr1102467 2394 2296 2022 958 820 778 761 226 73 21755 256 1991 --
NM_001010986chrX42173 1660 934 126 --11596 --
NM_001010989chr161465 --1561 --
NM_001010990chr161465 --1561 --
NM_001011513chr4144066 3784 3486 3164 2974 2857 2758 2666 2589 1599 1528 1109 919 343 11559 --12961
NM_001011515chr44949 390 126 116 ----11135
NM_001011516chr44949 390 126 116 ----11135
NM_001011537chr332217 2136 459 11994 22220 259 --
NM_001011551chrX3178 98 32 ------
NM_001011553chr73960 399 233 ------
NM_001011663chr105847 818 436 360 316 4999 957 695 297 31046 674 319 --
NM_001011666chr7226093 5863 5092 5042 4718 4710 4439 4323 4236 2576 2442 2408 2244 1962 1790 1339 1150 627 607 507 232 59 25142 1285 56299 4735 4648 279 243 --
NM_001011708chr241952 1126 1078 934 2115 72 --11956
NM_001011713chr1451578 1223 1160 641 212 --11384 1416
NM_001011720chr831471 1423 27 ----1586
NM_001011724chr131211 ------
NM_001011725chr131211 ------
NM_001011885chr1581528 1417 1394 1323 1142 393 363 126 ------
NM_001012264chr144770 735 688 190 ------
NM_001012267chr9----184 --
NM_001012279chr62135 91 ------
NM_001012329chr142273 2217 2146 456 1288 1459 --
NM_001012333chr111322 ------
NM_001012334chr111322 ------
NM_001012337chr3189 ------
NM_001012393chr11205146 5074 5030 5020 5014 4573 4082 4056 3364 2067 1497 1435 1349 1245 955 531 460 292 125 92 --23661 105 --
NM_001012398chr1641053 957 895 743 --1715 1270
NM_001012410chr32488 460 1364 ----
NM_001012418chr6104219 3913 3774 3698 3689 3570 3332 3209 2886 668 34193 4108 598 24222 1388 --
NM_001012420chr1562819 2637 2463 2219 222 178 1828 1582 32067 2043 1128
NM_001012423chr1562819 2637 2463 2219 222 178 1828 1582 32067 2043 1128
NM_001012426chr673420 3120 3064 2739 1174 888 468 --23149 421 --
NM_001012427chr673420 3120 3064 2739 1174 888 468 --23149 421 --
NM_001012507chr6141 ------
NM_001012514chr261093 1059 434 196 61 42 --1245 --
NM_001012516chr261093 1059 434 196 61 42 --1245 --
NM_001012643chr19173 1531 3511 194 153 --
NM_001012732chr421154 1093 11219 ----
NM_001012751chr1061607 1360 1316 1291 776 425 21467 161 --21935 1739
NM_001012754chr1322004 94 31995 1895 1802 ----
NM_001012755chrX135076 4667 4372 4365 4339 4073 3249 1798 1183 1167 1122 1038 983 1730 35050 4647 74 13897
NM_001012761chr562614 2568 2358 2334 1028 784 ----1195
NM_001012968chrX122713 2635 2300 2233 1889 1755 947 934 531 521 460 433 --12688 1951
NM_001012977chrX61370 1326 485 320 174 154 21318 1272 ----
NM_001012979chrX------131
NM_001012989chrX1456 ------
NM_001012990chrX1264 --1315 --
NM_001013031chr1073323 3179 1058 861 546 537 249 2960 806 22622 454 1262
NM_001013398chr751528 1402 1076 237 105 1509 --1176
NM_001013399chr641010 357 152 105 ------
NM_001013415chr461585 1105 1030 374 308 301 --1479 --
NM_001013437chr18398 82 58 ------
NM_001013438chr31184 ------
NM_001013439chr32335 30 ------
NM_001013620chr12178443 8360 8020 7558 7188 7042 6501 5794 3364 2994 2792 1782 1660 1592 995 350 93 57022 6293 2838 1878 1058 38278 7443 938 25160 2363
NM_001013635chr1261096 1043 345 257 187 39 --1866 --
NM_001013690chr12112169 2045 1938 1926 1738 1617 1539 812 461 404 395 --1387 11543
NM_001013703chr151414 ------
NM_001013843chr155791 363 217 143 114 ------
NM_001014380chr13165531 5456 5382 5314 5274 5225 5123 4365 3550 2035 1548 1061 1001 975 936 25 24767 1615 34205 1952 654 34904 3926 1997
NM_001014434chr14807 645 96 43 ------
NM_001014797chr10207951 7156 5742 5608 5519 2875 2842 2798 2551 2179 1667 1577 1542 1392 830 517 498 415 275 197 11522 27917 5058 27322 521
NM_001014809chr4--1933 1142 1327
NM_001014811chr113169 120 107 ------
NM_001014812chr152351 182 ----1387
NM_001014831chr192631 542 ------
NM_001014832chr192631 542 ------
NM_001014834chr192631 542 ------
NM_001014835chr192631 542 ------
NM_001014839chr12909 127 ----1137
NM_001014841chr12909 127 ----1137
NM_001015045chr442376 2336 2081 782 --21758 389 --
NM_001015048chr1483150 3066 2933 2454 2293 1046 930 542 11278 11196 12269
NM_001015049chr1483150 3066 2933 2454 2293 1046 930 542 11278 11196 12269
NM_001015053chr1771615 1453 1264 1119 543 526 55 ------
NM_001015877chrX162629 2579 2509 2451 2156 2049 1173 1136 1022 901 641 483 301 222 74 60 --11981 --
NM_001015880chr1061459 1370 625 457 262 50 239 27 --11189
NM_001015881chrX31289 194 55 ------
NM_001017365chr1150 ------
NM_001017366chr1150 ------
NM_001017367chr1150 ------
NM_001017369chr43874 303 162 2920 880 ----
NM_001017371chr231406 1154 412 ------
NM_001017395chr373077 2693 2668 2295 523 143 88 13207 12626 --
NM_001017396chr281886 1877 1489 1343 873 809 707 436 ------
NM_001017405chr45960 733 352 269 100 ------
NM_001017420chr881454 1378 1103 940 438 332 302 224 --11365 --
NM_001017424chr141604 1410 321 48 21323 183 21441 469 1214
NM_001017425chr141604 1410 321 48 21323 183 21441 469 1214
NM_001017434chr13518 127 120 --122 --
NM_001017440chr7248279 8186 8014 7986 7644 7610 7557 7428 7383 7166 7059 6876 6833 6570 5701 5474 2072 1679 1486 681 621 426 397 232 12628 67080 7064 6253 2470 2332 908 12318
NM_001017523chr1241331 1175 623 613 --11897 --
NM_001017923chr1461691 1555 1066 1039 592 347 1307 21452 434 --
NM_001017926chr831513 1238 267 2307 79 --31766 1204 403
NM_001017928chr3--1111 --1269
NM_001017962chr104915 764 171 21 ------
NM_001017963chr143898 144 76 ------
NM_001017967chr164926 807 118 40 ------
NM_001017969chr92422 184 --1670 --
NM_001017970chr1422137 433 --32072 1074 441 --
NM_001017977chr1167 ------
NM_001017979chr43729 292 96 1686 1275 --
NM_001017992chr551345 1337 584 444 222 41265 1219 1105 1088 2461 225 --
NM_001017995chr594813 4175 3796 3127 2972 2950 1480 1451 238 --23295 2975 --
NM_001017999chr1112070 2053 2023 1770 1701 897 756 318 300 258 249 --22074 1952 --
NM_001017999chr1112070 2053 2023 1770 1701 897 756 318 300 258 249 --22074 1952 --
NM_001018000chr1112070 2053 2023 1770 1701 897 756 318 300 258 249 --22074 1952 --
NM_001018000chr1112070 2053 2023 1770 1701 897 756 318 300 258 249 --22074 1952 --
NM_001018001chr1112070 2053 2023 1770 1701 897 756 318 300 258 249 --22074 1952 --
NM_001018004chr153740 670 29 1551 ----
NM_001018006chr153740 670 29 1551 ----
NM_001018007chr153740 670 29 1551 ----
NM_001018009chr351150 984 907 356 350 --1829 --
NM_001018020chr153740 670 29 1551 ----
NM_001018037chr971464 1103 1077 969 506 318 229 11411 21467 321 --
NM_001018053chr191630 1544 1434 1342 1329 1249 605 413 256 --21903 551 --
NM_001018054chr131229 1033 206 11013 ----
NM_001018056chr9190 1527 ----
NM_001018064chr992140 1776 1341 839 310 260 245 214 194 21906 796 ----
NM_001018065chr9125975 5905 5685 5166 5054 4995 4775 4252 1583 1421 842 544 15447 11962 --
NM_001018066chr9125975 5905 5685 5166 5054 4995 4775 4252 1583 1421 842 544 15447 11962 --
NM_001018067chr175150 4534 2109 1348 1249 963 864 ----13983
NM_001018068chr175150 4534 2109 1348 1249 963 864 ----13983
NM_001018069chr175150 4534 2109 1348 1249 963 864 ----13983
NM_001018072chr1241331 1175 623 613 --11897 --
NM_001018074chr573457 1396 1374 567 392 382 344 ----13490
NM_001018075chr573457 1396 1374 567 392 382 344 ----13490
NM_001018076chr573457 1396 1374 567 392 382 344 ----13490
NM_001018077chr573457 1396 1374 567 392 382 344 ----13490
NM_001018089chr1553872 3603 2644 2591 279 22518 438 --22901 2638
NM_001018090chr15132715 2594 2525 2506 2238 2225 2151 1983 1925 1871 422 327 283 --32011 1071 552 --
NM_001018091chr15132825 2704 2635 2616 2348 2335 2261 2093 2035 1981 532 437 393 --32121 1181 662 --
NM_001018100chr152689 255 --1258 --
NM_001018102chr15132715 2594 2525 2506 2238 2225 2151 1983 1925 1871 422 327 283 --32011 1071 552 --
NM_001018108chr152687 491 --1495 --
NM_001018159chr162122 106 ------
NM_001018160chr162122 106 ------
NM_001020658chr131247 1166 1144 ------
NM_001020658chr131247 1166 1144 ------
NM_001020818chr19131905 1704 1612 1537 562 467 451 269 263 135 79 62 41 --21520 485 --
NM_001020819chr19131905 1704 1612 1537 562 467 451 269 263 135 79 62 41 --21520 485 --
NM_001020820chr19131905 1704 1612 1537 562 467 451 269 263 135 79 62 41 --21520 485 --
NM_001020821chr19131905 1704 1612 1537 562 467 451 269 263 135 79 62 41 --21520 485 --
NM_001023567chr1562211 1737 1548 312 222 178 --1585 --
NM_001023587chr33986 845 810 11130 ----
NM_001024094chr573457 1396 1374 567 392 382 344 ----13490
NM_001024218chr141321 --1813 --
NM_001024226chr13993 936 206 ------
NM_001024227chr13993 936 206 ------
NM_001024228chr13993 936 206 ------
NM_001024372chr882070 2014 1997 1783 731 540 532 367 --1455 11811
NM_001024401chr1642882 2501 2086 2071 --11103 --
NM_001024455chrX52692 1641 1013 279 40 ----1391
NM_001024463chr153985 257 153 --1203 1403
NM_001024647chr12157447 6677 6070 6038 5850 4695 1211 979 918 805 552 463 295 181 148 16933 16174 11351
NM_001024649chr5132958 2788 2582 2511 2204 2031 2022 1118 1021 930 640 284 206 --22920 2461 --
NM_001024660chr361523 1429 1351 1262 510 360 ----21219 110
NM_001024666chrX4649 484 451 250 --158 --
NM_001024668chr12----2795 703 --
NM_001024680chr251521 1468 1351 1294 1228 2712 33 1180 --
NM_001024688chr8102124 2115 1992 1874 1855 1796 1719 789 524 157 --11492 --
NM_001024808chr1262130 1963 1794 982 413 320 --42020 1966 893 811 12208
NM_001024809chr17149 --152 --
NM_001024847chr372344 2250 1643 1558 955 895 612 --1933 1501
NM_001024855chr331694 1492 1335 --1156 --
NM_001024934chr62473 99 ------
NM_001024935chr62473 99 ------
NM_001024936chr62473 99 ------
NM_001024937chr171288 ----1491
NM_001024948chr173256 3234 2756 2575 1261 516 328 11304 23489 271 --
NM_001024956chr11195720 5656 5564 5431 5032 4956 4887 4518 4319 3777 3716 1930 1796 1744 1723 1684 1622 1568 58 25509 5437 21162 615 --
NM_001025068chr331694 1336 724 ------
NM_001025069chr331694 1336 724 ------
NM_001025076chr10166174 5922 5887 5473 5292 5067 4272 4041 3958 2473 2067 1892 1387 1055 345 331 41950 1292 144 133 34804 1576 835 13823
NM_001025077chr10177532 7280 7245 6831 6650 6425 5630 5399 5316 4986 4953 2745 2413 1703 1689 1324 1225 32650 1502 1491 46162 2934 2193 950 15181
NM_001025079chr3123901 3501 3143 3008 2919 2818 2707 2693 2620 1392 947 777 24042 786 13439 1952
NM_001025105chr571407 1352 1243 1090 1079 1054 245 --11392 11415
NM_001025107chr1112438 2240 2155 2100 1799 1779 947 475 252 112 99 --22391 172 --
NM_001025107chr1112438 2240 2155 2100 1799 1779 947 475 252 112 99 --22391 172 --
NM_001025108chr2123596 3464 3050 2888 2604 1347 1278 1268 1195 1079 979 949 43881 3666 771 279 2837 231 11312
NM_001025109chr181060 930 731 428 385 370 330 52 --2924 223 11150
NM_001025201chr27743 545 528 516 508 192 137 --2676 632 --
NM_001025203chr21--1122 ----
NM_001025204chr21--1122 ----
NM_001025233chr12112722 2231 2042 1847 1727 1711 785 584 458 423 280 ----22434 742
NM_001025234chr111154 --123 --
NM_001025235chr111154 --123 --
NM_001025236chr111154 --123 --
NM_001025237chr111154 --123 --
NM_001025238chr111154 --123 --
NM_001025239chr111154 --123 --
NM_001025248chr1571258 1116 937 509 424 194 43 --31120 833 197 --
NM_001025249chr1571258 1116 937 509 424 194 43 --31120 833 197 --
NM_001025252chr872671 2616 2044 1049 469 424 393 1386 ----
NM_001025253chr872671 2616 2044 1049 469 424 393 1386 ----
NM_001025266chr3124945 4666 4637 4308 3356 1309 1275 357 201 182 157 93 --23045 904 --
NM_001025356chr12112997 2979 2955 2937 2027 1151 1118 926 828 341 313 --1321 22034 239
NM_001025366chr641799 431 321 275 ------
NM_001025366chr641799 431 321 275 ------
NM_001025367chr641799 431 321 275 ------
NM_001025367chr641799 431 321 275 ------
NM_001025368chr641799 431 321 275 ------
NM_001025368chr641799 431 321 275 ------
NM_001025369chr641815 447 337 291 ------
NM_001025369chr641815 447 337 291 ------
NM_001025370chr641799 431 321 275 ------
NM_001025370chr641799 431 321 275 ------
NM_001025579chr1741190 861 844 287 ------
NM_001025580chrX74038 3092 3080 1520 1257 305 35 13685 1313 --
NM_001025595chr441108 1100 635 266 --11041 11149
NM_001025596chr113432 331 202 --2472 377 1129
NM_001025603chr151375 987 571 457 93 --166 --
NM_001025777chr251399 1094 1032 515 175 ----170
NM_001025780chr9155 --2551 223 --
NM_001029839chr341506 1119 590 236 ------
NM_001029840chr341506 1119 590 236 ------
NM_001029858chr693156 2694 2119 1184 834 700 620 410 62 42779 2293 1065 676 12699 12156
NM_001029863chr652493 1161 980 802 486 ------
NM_001029871chr2091805 453 394 316 274 246 165 121 23 11734 2569 143 --
NM_001029875chr542955 2614 697 107 --32870 1091 529 --
NM_001029882chr13594 565 212 --1622 --
NM_001029882chr13594 565 212 --1622 --
NM_001029976chr8156 ------
NM_001029998chr42437 431 --11306 --
NM_001030006chr1752433 2156 591 538 289 ------
NM_001030007chr16123807 3757 3627 3221 2978 2745 1451 784 534 395 372 25 --2587 412 12515
NM_001030055chr14214724 4660 4612 4366 4048 3837 3798 3640 3481 1858 1617 1113 1077 942 710 627 559 387 321 292 123 1129 44051 3361 3077 1117 --
NM_001030059chr10----181 --
NM_001030287chr121090 208 --11142 --
NM_001031623chr651116 482 342 151 72 --21163 555 --
NM_001031679chr12123576 3478 3158 2979 2849 2826 2811 1247 522 287 265 129 ----1272
NM_001031685chr13340 280 42 ------
NM_001031690chr772911 2666 1117 994 981 661 448 --22890 451 --
NM_001031695chr22185076 4894 4743 4622 4458 4211 1512 1481 1244 1052 862 787 628 497 463 240 213 200 34873 4524 505 54634 4558 4082 3852 1811 1174
NM_001031700chr472490 2313 1828 1807 1624 578 225 --1427 --
NM_001031702chr32820 86 ------
NM_001031710chr74882 862 690 148 ------
NM_001031711chr551821 1687 1534 1434 183 ------
NM_001031712chr61160 ------
NM_001031716chr21373 21131 961 ----
NM_001031717chr31878 --139 1722
NM_001031723chr41386 --147 --
NM_001031732chr483609 2593 2437 2285 1256 1057 798 269 13233 22990 2501 --
NM_001031738chr22407 56 ------
NM_001031743chr6----1159 --
NM_001031746chr102327 307 --1280 --
NM_001031804chr16114189 4070 3639 2994 2856 2785 2767 1720 1292 632 436 --23347 477 --
NM_001031812chr571881 1579 557 409 179 161 72 --12263 --
NM_001031855chrX1189 ------
NM_001032221chr951788 1441 1418 586 274 --11658 --
NM_001032279chr112372 284 ------
NM_001032280chr641634 1203 684 392 --1637 --
NM_001032282chr841303 1091 489 474 11222 ----
NM_001032283chr12----1409 --
NM_001032284chr12----1409 --
NM_001032288chr203526 372 82 --11506 --
NM_001032289chrX3845 334 119 ------
NM_001032293chr172224 45 --1545 --
NM_001032296chr1362873 2703 2297 2278 2198 2140 --1928 12000
NM_001032363chr131671 900 177 31695 331 269 ----
NM_001032363chr131671 900 177 31695 331 269 ----
NM_001032380chr1051478 558 443 290 152 1328 11309 --
NM_001032393chrX4497 164 154 148 ------
NM_001032394chr692708 2589 2563 2458 2096 1050 599 536 290 12748 22566 526 --
NM_001032395chr692575 2456 2430 2325 1963 917 466 403 157 12615 22433 393 --
NM_001032999chr2084100 3790 3343 1255 1167 799 710 164 23326 1713 25239 202 1803
NM_001033044chr171566 1537 1394 1299 1269 448 424 11520 21355 152 --
NM_001033045chr2104178 4156 3960 3940 3895 3570 1739 1555 1139 969 1102 --13899
NM_001033047chr462604 2275 2174 865 373 66 --1149 --
NM_001033049chr2162023 1954 1702 776 557 236 --12253 --
NM_001033056chr171566 1537 1394 1299 1269 448 424 11520 21355 152 --
NM_001033057chr371885 1750 1588 1389 455 363 330 11653 11833 --
NM_001033059chr652045 1522 774 546 478 --21443 224 --
NM_001033085chr2----140 --
NM_001033087chr20123225 3057 2963 2843 2732 2194 2157 2004 784 549 268 260 --12895 1710
NM_001033117chr3144924 4804 4589 4486 3656 3256 3233 3043 1868 1511 1270 1080 495 331 --64291 4242 3928 3888 3236 581 13660
NM_001033503chr51479 --1367 --
NM_001033507chr141899 1700 729 708 1771 --156
NM_001033518chr742235 682 568 238 2664 618 22747 1963 --
NM_001033519chr742235 682 568 238 2664 618 22747 1963 --
NM_001033520chr742235 682 568 238 2664 618 22747 1963 --
NM_001033557chr251309 1243 1190 1138 65 --21301 32 --
NM_001033561chr177797 785 719 586 172 124 89 --1591 --
NM_001033576chr1782774 2516 2385 2148 1741 761 330 287 --12374 1146
NM_001033578chr842128 2084 394 144 ------
NM_001033602chr1352738 2400 2267 1874 452 21075 802 ----
NM_001033659chr1721412 1394 1401 ----
NM_001033723chr8102571 2539 2303 2179 1806 1790 951 860 575 553 1366 12575 --
NM_001033756chr641733 365 255 209 ------
NM_001033756chr641733 365 255 209 ------
NM_001033925chr1041901 1665 538 216 11919 ----
NM_001034837chr51624 1183 1137 --
NM_001034838chr51624 1183 1137 --
NM_001034841chr1675524 5462 4364 1668 1546 1354 378 21814 1084 34821 3876 3818 14713
NM_001034845chr441409 1139 1101 450 11186 11198 1464
NM_001034850chr551653 1387 1302 609 331 31600 1393 190 ----
NM_001034852chr144568 409 372 234 --1572 --
NM_001034954chr1063192 2671 1988 1101 854 773 12119 43177 1158 875 860 1719
NM_001034955chr1063192 2671 1988 1101 854 773 12119 43177 1158 875 860 1719
NM_001034956chr1063192 2671 1988 1101 854 773 12119 43177 1158 875 860 1719
NM_001034957chr1063192 2671 1988 1101 854 773 12119 43177 1158 875 860 1719
NM_001034996chr3132 ------
NM_001035chr131039 527 289 --2121 66 --
NM_001035003chr421280 389 ------
NM_001035004chr421280 389 ------
NM_001035254chr912443 --2963 41 12447
NM_001035260chr1031375 487 428 ----1295
NM_001035267chr121233 ------
NM_001035511chr1102124 2107 2047 2035 1872 1754 1469 554 343 166 21925 654 11760 21996 624
NM_001035512chr1112231 2214 2154 2142 1979 1861 1576 661 450 273 58 22032 761 11867 22103 731
NM_001035513chr1112231 2214 2154 2142 1979 1861 1576 661 450 273 58 22032 761 11867 22103 731
NM_001035521chr21795 ----1528
NM_001037131chr2------1444
NM_001037132chr752263 1737 465 447 33 --1107 --
NM_001037133chr752263 1737 465 447 33 --1107 --
NM_001037163chr72939 60 ------
NM_001037164chr761910 1783 547 523 509 39 --142 --
NM_001037165chr7168881 8169 8110 7391 7377 6730 6686 6042 5980 5660 3016 2058 1902 1841 1279 577 16316 57667 7397 3133 580 236 12476
NM_001037172chr331364 983 509 21289 535 21338 448 --
NM_001037277chr111097 11556 11328 --
NM_001037278chr111097 11556 11328 --
NM_001037281chr161118 ------
NM_001037317chr122688 2553 12471 32775 2160 200 12646
NM_001037331chr181721 --1207 --
NM_001037334chr1831577 314 189 32215 841 631 2955 901 11951
NM_001037339chr13675 546 515 ------
NM_001037340chr13675 546 515 ------
NM_001037341chr13675 546 515 ------
NM_001037341chr13675 546 515 ------
NM_001037494chr122240 211 ------
NM_001037495chr122240 211 ------
NM_001037535chrX81474 1364 1168 538 525 445 227 169 --177 --
NM_001037536chrX81474 1364 1168 538 525 445 227 169 --177 --
NM_001037540chrX81474 1364 1168 538 525 445 227 169 --177 --
NM_001037553chr21115157 4940 4352 4298 3571 3528 3279 1495 424 310 102 21451 1166 ----
NM_001037631chr21241 11086 ----
NM_001037633chr52291 139 ------
NM_001037637chr5----1250 --
NM_001037808chr16--1150 ----
NM_001037872chr22138 111 129 ----
NM_001037954chr11103338 2989 2518 2286 1377 1184 998 750 717 159 11115 4933 861 720 459 22526 468
NM_001038493chr231477 1424 1040 --1547 11569
NM_001038640chr152946 267 1898 1653 --
NM_001038702chr592762 2309 1830 1757 964 869 854 274 257 --3840 504 160 --
NM_001038707chr182243 2155 1926 1563 682 621 573 293 --22196 1971 --
NM_001038707chr182243 2155 1926 1563 682 621 573 293 --22196 1971 --
NM_001039029chr1251987 1899 1863 231 151 1438 ----
NM_001039199chr20144983 4971 4664 4166 3867 3812 3343 3148 1656 1579 1240 1090 42 33 35054 4796 1255 2940 48 24838 3816
NM_001039350chr721226 611 --1550 --
NM_001039465chr141149 --1102 --
NM_001039479chr14132347 2231 2201 2116 2090 2072 2037 2002 970 687 642 407 38 12298 12045 11828
NM_001039538chr2183569 3410 3213 2915 2715 2487 2292 2281 1332 1296 1232 1222 1061 982 922 843 145 88 1377 21064 796 --
NM_001039547chr3217222 6716 5946 5007 2917 2611 2438 2014 1999 1940 1777 1649 1640 1464 1298 827 819 760 650 417 409 28010 6158 57871 6721 6386 6167 838 36984 5213 1517
NM_001039550chr21722 1249 1696 --
NM_001039569chr2113286 2732 2667 2345 2293 2234 2222 978 706 427 411 --1124 --
NM_001039570chr2294675 4103 3632 1670 694 680 402 393 250 2263 38 --182
NM_001039571chr2294675 4103 3632 1670 694 680 402 393 250 2263 38 --182
NM_001039574chr14938 684 359 350 --1286 --
NM_001039577chr1114502 3522 3170 1713 1703 1692 1643 1571 1533 946 282 11577 11502 1150
NM_001039585chr1114246 4198 4053 3477 3145 2575 1635 1557 1444 1233 964 1223 21572 1447 1968
NM_001039590chrX83275 3204 3189 2724 1091 859 336 291 --52560 1117 993 485 66 12817
NM_001039591chrX83275 3204 3189 2724 1091 859 336 291 --52560 1117 993 485 66 12817
NM_001039618chr11105879 5849 5390 5042 3902 2222 2190 1650 1342 216 33802 2295 206 65840 1990 1345 1289 1109 390 34697 3926 938
NM_001039690chr1692395 2383 2134 1848 1725 871 331 289 169 ------
NM_001039693chr294052 3640 3451 1643 1548 1425 1334 1197 986 1301 ----
NM_001039709chr2084100 3790 3343 1255 1167 799 710 164 23326 1713 25239 202 1803
NM_001039711chr13781 303 78 ------
NM_001039712chr13781 303 78 ------
NM_001039762chr1052377 2253 2012 1948 774 --1208 --
NM_001039802chr131395 1147 23 --11381 --
NM_001039840chrX155921 5588 5544 5066 4760 4740 3865 2016 1285 1277 1060 956 572 363 105 15476 45554 5344 3927 2062 --
NM_001039916chr1251056 949 934 86 55 1973 --1162
NM_001039917chr1251056 949 934 86 55 1973 --1162
NM_001039918chr1251056 949 934 86 55 1973 --1162
NM_001039919chr1251056 949 934 86 55 1973 --1162
NM_001039920chr1251056 949 934 86 55 1973 --1162
NM_001039937chr13143874 3334 3139 3053 2888 2858 2754 2708 2676 2652 1568 746 303 166 --13979 189
NM_001039960chr1271431 1400 1253 1142 448 320 263 --1333 1324
NM_001040001chr691833 1690 1376 1324 1272 386 335 269 121 --11718 --
NM_001040057chr731193 201 101 ------
NM_001040092chr81156 --1440 --
NM_001040100chr36785 518 490 178 142 116 --1308 --
NM_001040101chr431341 1198 1059 ----1349
NM_001040110chr741619 1608 256 29 21860 1428 21623 187 --
NM_001040135chr71724 ------
NM_001040142chr272241 2099 1723 1652 1534 522 423 12254 ----
NM_001040143chr272241 2099 1723 1652 1534 522 423 12254 ----
NM_001040144chr1692395 2383 2134 1848 1725 871 331 289 169 ------
NM_001040146chr1692395 2383 2134 1848 1725 871 331 289 169 ------
NM_001040147chr181705 --1446 1596
NM_001040151chr11103872 3090 3026 2998 2935 2904 1349 835 729 600 22815 1310 13272 --
NM_001040152chr755095 5078 1605 1565 1176 21274 418 24591 4526 11350
NM_001040153chr13196 ------
NM_001040157chr4112641 2632 2490 2308 2155 2149 2104 282 248 68 24 ------
NM_001040158chr52417 400 ------
NM_001040159chr431488 1125 1119 ----1351
NM_001040167chr741211 1102 943 379 --1902 --
NM_001040172chr591525 1517 1206 1148 1140 556 427 269 94 1279 2386 249 --
NM_001040173chr591525 1517 1206 1148 1140 556 427 269 94 1279 2386 249 --
NM_001040181chr32769 727 --1385 --
NM_001040182chr32769 727 --1385 --
NM_001040183chr32769 727 --1385 --
NM_001040199chr32769 727 --1385 --
NM_001040200chr32769 727 --1385 --
NM_001040214chr632247 1537 1487 ----11541
NM_001040272chr921746 176 ------
NM_001040284chr16215465 5135 4665 4591 4395 4175 4124 2333 1984 1634 1587 1510 1316 1304 1187 1107 1063 878 844 690 602 55277 3952 1574 1497 1244 130 15593
NM_001040402chr4132922 2796 2578 2572 2543 2459 2446 2035 782 758 721 179 97 22345 320 1836 --
NM_001040409chr261053 1007 708 689 318 152 1993 2915 796 --
NM_001040429chr1393356 2735 2530 2424 2259 553 174 157 33 1356 ----
NM_001040440chr54675 649 452 81 ------
NM_001040441chr1105120 4925 3531 2127 1595 1562 1279 1160 685 296 1144 24240 3575 15375
NM_001040446chr572637 2300 954 875 520 402 359 --52693 2097 920 799 662 1260
NM_001040450chr1552471 1865 993 880 643 2970 412 ----
NM_001040453chr1552471 1865 993 880 643 2970 412 ----
NM_001040455chr1151340 1302 1238 483 458 ------
NM_001040610chr15297 24 ------
NM_001040619chr131540 1028 658 --11592 172
NM_001040633chr72839 49 ------
NM_001040653chr3102638 2465 1966 1781 830 822 816 791 93 39 1232 42624 1988 1927 1784 --
NM_001040665chr7195033 4933 4857 4722 4670 4653 4339 4249 4044 1895 1885 1844 1459 1436 1225 675 511 196 149 ----2913 389
NM_001040666chr74735 635 559 41 ------
NM_001040708chr831086 939 376 11034 ----
NM_001040709chr172281 2126 1932 1883 1786 368 74 2289 117 32534 899 551 --
NM_001040712chr983520 3236 3174 2526 2409 2347 1075 807 --33571 3386 2712 --
NM_001040876chr441429 717 497 365 --21443 191 --
NM_001042355chr16185399 5275 5185 4782 4669 4596 4309 4218 4065 3591 1857 1606 1338 607 558 398 369 107 --34221 3924 550 21873 1163
NM_001042357chr1051535 1491 1299 463 133 ------
NM_001042358chr1051535 1491 1299 463 133 ------
NM_001042360chr1051535 1491 1299 463 133 ------
NM_001042363chr1051535 1491 1299 463 133 ------
NM_001042383chr3132959 2748 2593 2502 2390 2317 1375 1360 1129 944 368 241 167 23259 3203 22638 170 12466
NM_001042388chr182910 846 ------
NM_001042389chr1051535 1491 1299 463 133 ------
NM_001042390chr1051535 1491 1299 463 133 ------
NM_001042392chr1051535 1491 1299 463 133 ------
NM_001042395chr1051535 1491 1299 463 133 ------
NM_001042399chr122490 343 1355 ----
NM_001042404chr132013 1550 304 1358 ----
NM_001042410chr22174 73 ------
NM_001042412chr16185399 5275 5185 4782 4669 4596 4309 4218 4065 3591 1857 1606 1338 607 558 398 369 107 --34221 3924 550 21873 1163
NM_001042413chr993650 3327 1443 1237 1102 567 527 197 134 --11320 21467 1243
NM_001042424chr473291 1138 829 648 572 514 411 1843 --12254
NM_001042425chr641634 1203 684 392 --1637 --
NM_001042453chrX41434 1131 658 109 ------
NM_001042454chr161354 ------
NM_001042465chr1041113 210 131 49 ------
NM_001042466chr1041113 210 131 49 ------
NM_001042473chr1042167 1905 1687 401 --22171 1624 --
NM_001042475chr6----1112 --
NM_001042479chrX72098 1961 1727 1646 506 332 213 21485 390 ----
NM_001042480chrX72098 1961 1727 1646 506 332 213 21485 390 ----
NM_001042481chr1492569 2246 2177 1919 864 453 446 119 69 12206 ----
NM_001042486chr2061371 1218 530 513 460 76 --11183 --
NM_001042492chr1763211 2524 897 765 204 190 --11322 11089
NM_001042494chr15113873 3807 3592 2700 1258 1078 822 742 660 514 34 --12396 --
NM_001042495chr15113873 3807 3592 2700 1258 1078 822 742 660 514 34 --12396 --
NM_001042496chr15113873 3807 3592 2700 1258 1078 822 742 660 514 34 --12396 --
NM_001042497chr15113873 3807 3592 2700 1258 1078 822 742 660 514 34 --12396 --
NM_001042498chrX3982 256 124 ------
NM_001042506chrX51062 485 320 174 154 11283 ----
NM_001042510chr842110 1958 843 82 --1433 1825
NM_001042511chr842110 1958 843 82 --1433 1825
NM_001042517chr133660 251 162 ----1849
NM_001042533chr3103239 3070 2648 2614 2215 1053 954 757 728 333 --42574 750 347 316 --
NM_001042537chrX72473 2361 2325 676 495 484 301 192 22328 498 --
NM_001042539chr1621116 319 ------
NM_001042543chr461524 1506 1120 433 188 61 11128 ----
NM_001042548chr23796 237 154 ------
NM_001042550chr951835 1641 393 240 122 21704 1536 11644 --
NM_001042555chr12184757 4451 4433 4342 4159 3971 3949 3865 3577 3524 2954 1894 1837 1565 1198 856 778 642 23343 1316 2859 810 1119
NM_001042573chr1782052 1971 1913 1865 376 245 239 161 21856 454 ----
NM_001042599chr2277582 7574 7359 7279 7031 6605 6579 6476 6163 6044 5975 5626 5142 5040 2926 2913 2376 2082 1427 1111 893 550 535 493 357 344 318 35585 5446 5382 55756 965 337 225 69 45019 2671 1747 1117
NM_001042601chr3103145 2895 2838 2077 1174 914 354 342 88 34 --13151 13019
NM_001042603chr12145039 4776 4296 4122 1947 1935 1917 1502 1305 1154 647 527 175 149 34897 4269 1166 43941 1563 1342 208 11951
NM_001042604chr3144415 4325 4313 4223 3932 3660 3132 3034 1644 1564 1189 1073 467 34 --23619 1516 14442
NM_001042632chr2042547 2313 2237 512 ------
NM_001042633chr2042547 2313 2237 512 ------
NM_001042646chr34814 597 533 313 --1107 11673
NM_001042681chr1132616 2247 2147 2100 1885 1870 1859 1788 999 917 566 298 116 12364 1799 --
NM_001042682chr1132616 2247 2147 2100 1885 1870 1859 1788 999 917 566 298 116 12364 1799 --
NM_001042682chr1132616 2247 2147 2100 1885 1870 1859 1788 999 917 566 298 116 12364 1799 --
NM_001042683chr681844 1719 1629 1397 1298 1156 734 302 21734 1190 11707 11160
NM_001042728chr1221077 997 1362 ----
NM_001042749chrX81917 1716 626 399 347 218 99 39 --11741 11848
NM_001042750chrX81917 1716 626 399 347 218 99 39 --11741 11848
NM_001042751chrX81917 1716 626 399 347 218 99 39 --11741 11848
NM_001042762chr73878 45 29 ------
NM_001042784chr4285 21 ------
NM_001043318chr1463005 1478 1138 766 668 110 13348 13625 1971
NM_001044305chr62461 96 --11393 --
NM_001044385chr283811 3790 3668 2869 861 846 831 264 --24071 2682 32701 795 453
NM_001044387chr1984164 3484 3423 3412 2615 2581 1322 375 ----14074
NM_001044388chr1984164 3484 3423 3412 2615 2581 1322 375 ----14074
NM_001044722chr571881 1579 557 409 179 161 72 --12263 --
NM_001044723chr571881 1579 557 409 179 161 72 --12263 --
NM_001046chr552967 2820 2103 783 108 --2892 222 --
NM_001048183chr133582 3421 1033 ------
NM_001071775chr1331819 770 296 --11479 --
NM_001077628chr13636 268 210 --1656 --
NM_001078chr13753 707 698 --1604 --
NM_001079874chr151970 1711 1620 676 107 11418 ----
NM_001083620chr492052 1642 846 784 437 414 340 261 207 --22442 2055 --
NM_001094chr173818 697 664 --1821 --
NM_001095chr1261812 1268 1208 392 183 166 --11554 --
NM_001099678chr3125561 5496 2482 2463 2246 1848 1758 1497 1065 994 784 491 46108 4646 2410 565 36277 5499 2043 11491
NM_001100108chr1248238 8225 8004 7892 7627 5984 5754 5232 5194 5144 3183 3069 2910 2756 2491 2209 1796 1668 1613 1537 1279 1203 1021 986 36358 6005 38 58322 7878 6989 1087 809 --
NM_001104548chr11127 --1162 --
NM_001106chr3279580 8749 8163 7927 7671 7318 7272 7259 7163 6878 6612 6285 3909 3641 3241 2802 2676 2645 2510 2463 2446 1732 1471 1306 1238 854 341 17575 78446 8101 7166 3675 2941 2805 896 36744 3452 3119
NM_001111chr1112438 2240 2155 2100 1799 1779 947 475 252 112 99 --22391 172 --
NM_001113490chrX73054 2908 2692 1012 984 645 569 12780 12481 --
NM_001116chr1652598 2392 2315 1998 444 --1409 --
NM_001117chr184635 559 544 161 --32189 1592 822 21630 645
NM_001119chr431533 446 377 ------
NM_001121chr1011317 ------
NM_001122chr92181 161 ------
NM_001122679chr51864 ------
NM_001123chr101335 --1684 --
NM_001125chr361937 1876 1744 190 64 36 --2308 54 --
NM_001126chr14795 756 326 194 ------
NM_001128chr16123807 3757 3627 3221 2978 2745 1451 784 534 395 372 25 --2587 412 12515
NM_001144chr1621371 195 11164 1169 --
NM_001146chr832242 1899 589 --11577 --
NM_001148chr421980 138 --21884 443 --
NM_001149chr1031309 464 423 ------
NM_001153chr23596 326 64 ------
NM_001154chr41461 1171 ----
NM_001157chr101204 ----1256
NM_001163chr94954 879 759 280 ------
NM_001167chrX176784 6706 6678 4725 2531 2325 2208 1918 1862 1501 1458 1248 979 770 513 368 338 45704 1134 1075 161 26750 6464 --
NM_001173chr14214724 4660 4612 4366 4048 3837 3798 3640 3481 1858 1617 1113 1077 942 710 627 559 387 321 292 123 1129 44051 3361 3077 1117 --
NM_001177chr1232263 2220 218 11560 12224 --
NM_001186chr2183296 3119 2678 2440 2160 1092 410 36 --12377 13007
NM_001187chr21--1571 ----
NM_001191chr2021181 161 11433 2346 43 --
NM_001198chr652244 2226 2170 1599 490 11643 32250 1893 477 --
NM_001200chr2041154 1081 996 798 --11043 11062
NM_001201chr4163939 3847 3633 3595 3388 3375 3014 2995 2804 2597 1439 1191 862 648 467 239 23248 191 23526 3391 1323
NM_001204chr2287737 7637 7578 7072 6839 6714 6609 5567 5421 5241 5195 4728 2974 2453 2154 2113 1997 1746 1571 1553 1532 1470 1299 909 769 682 489 426 45225 1714 1376 1061 47079 6616 1806 597 37294 6843 1046
NM_001206chr9102971 2866 2788 2405 2023 1931 804 486 304 127 2244 232 12454 --
NM_001207chr5----1250 --
NM_001218chr1562164 1716 1095 450 418 68 12576 32429 1018 98 --
NM_001219chr741672 744 630 272 1158 2819 275 --
NM_001222chr1031320 393 190 --1509 --
NM_001233chr742411 935 829 173 12230 3876 790 48 --
NM_001239chr52126 116 ------
NM_001241chr252426 1884 1817 1618 480 1882 11621 --
NM_001241chr252426 1884 1817 1618 480 1882 11621 --
NM_001253chr61219 ------
NM_001254chr1731011 171 145 --3925 774 424 --
NM_001256chr17132891 2807 2331 2190 2173 1999 1816 1171 1052 1041 975 263 252 22754 751 52949 2810 2603 2334 256 --
NM_001257chr1631441 1232 139 --1290 --
NM_001259chr7235465 5350 4963 4762 4726 4710 4695 4062 2411 2077 2035 1969 1649 1618 1605 1505 1298 1082 1024 803 616 367 300 11739 35121 1878 620 --
NM_001260chr132343 64 ------
NM_001265chr132942 333 --2704 224 --
NM_001268chr134830 778 151 69 1722 1781 --
NM_001270chr55414 232 129 34 25 ------
NM_001271chr1573094 2520 2224 1237 695 665 348 23185 906 1766 --
NM_001273chr122375 55 ------
NM_001278chr1021057 453 ------
NM_001280chr192689 190 1471 1692 --
NM_001282chr1752433 2156 591 538 289 ------
NM_001283chr72708 526 --1432 --
NM_001284chr53505 455 228 ------
NM_001286chr152289 2204 2194 737 353 --12753 1199
NM_001288chr6137 ------
NM_001290chr46905 854 824 163 153 144 --1429 --
NM_001293chr113561 464 127 ------
NM_001299chr192492 485 ------
NM_001304chr17133814 3688 3202 3176 2786 2439 1162 883 855 493 465 352 242 33254 3211 780 53536 3076 1115 355 141 --
NM_001305chr75828 778 619 166 30 --1769 --
NM_001310chr1282651 2639 2478 1230 978 905 347 118 32782 2453 938 22060 516 12959
NM_001313chr4--1933 1142 1327
NM_001315chr622060 175 22150 272 1813 12181
NM_001316chr202365 319 ------
NM_001319chr192838 435 --1322 11071
NM_001326chr11------1370
NM_001329chr1031637 1230 95 ------
NM_001330chr163713 686 172 1964 3131 73 63 --
NM_001331chr11132830 2721 2331 2202 2065 1958 1898 1793 471 285 225 149 81 --31768 1125 1073 12770
NM_001332chr53637 79 62 ------
NM_001338chr2141185 869 255 229 --1956 --
NM_001343chr581686 1528 1208 1100 641 595 176 95 1604 11700 --
NM_001346chr35870 756 629 337 120 22268 1962 11002 1311
NM_001347chr4138 --1611 --
NM_001349chr2193 ------
NM_001351chr351862 1832 1714 1356 1346 11173 ----
NM_001356chrX22244 1573 12030 --11849
NM_001357chr11230 ------
NM_001358chr41126 ------
NM_001362chr1421005 304 ------
NM_001364chr11124366 3870 3776 3655 3274 3247 3234 3109 3101 1679 339 268 34472 3329 3204 23366 3282 11305
NM_001365chr173782 578 497 --1581 --
NM_001379chr19128 ------
NM_001380chr104993 679 299 130 ----1684
NM_001383chr173538 289 84 ------
NM_001385chr84341 323 279 150 ----1144
NM_001386chr8102096 2065 1915 1682 832 780 736 431 401 68 --31591 756 434 11713
NM_001387chr5102718 2101 2088 2049 1036 931 813 788 739 589 23006 2626 2603 189 1637
NM_001388chr172678 128 1710 ----
NM_001389chr215576 552 539 479 443 --1178 --
NM_001391chr1841032 306 109 36 ------
NM_001395chrX4981 898 782 213 --1216 --
NM_001396chr2151131 1119 960 819 407 12820 12319 12004
NM_001399chrX73347 3055 2926 1488 909 833 559 --23830 243 --
NM_001400chr181062 1011 921 493 428 354 238 77 11317 ----
NM_001401chr921302 1091 ------
NM_001406chr1771658 1624 1266 1239 405 384 364 21352 279 1667 --
NM_001407chr321644 1300 --2486 271 --
NM_001412chrX103580 3400 2952 2942 2871 2529 1412 721 537 207 23416 1025 --135
NM_001415chrX41824 1549 677 142 1697 ----
NM_001416chr173175 112 43 --1178 1116
NM_001417chr1251959 1661 1356 35 23 ------
NM_001418chr11----1296 --
NM_001418chr11----1296 --
NM_001419chr19164818 4449 4316 4006 3940 3906 3873 3747 1240 1135 1088 955 773 432 112 62 24054 1338 12990 --
NM_001420chr1962773 2408 2235 2225 2181 293 --11194 --
NM_001421chrX61769 1637 1450 1396 1162 546 --21643 439 --
NM_001422chr1141167 917 87 37 ------
NM_001423chr12101661 1580 1551 1493 1296 767 721 529 412 162 --11922 --
NM_001426chr22545 229 --2548 535 --
NM_001427chr771948 1935 1755 1467 822 781 247 --11951 --
NM_001429chr222766 41 --1891 --
NM_001430chr241449 558 494 297 --11572 1163
NM_001431chr661254 932 881 854 458 247 --1290 --
NM_001438chr1173304 3249 3098 517 505 454 391 372 338 317 286 255 247 236 230 207 184 --1279 --
NM_001440chr852664 1990 818 686 653 1947 12496 --
NM_001448chrX71650 1293 1158 549 310 157 62 1410 ----
NM_001449chrX61022 520 218 130 107 65 --150 --
NM_001451chr162973 829 ------
NM_001452chr61588 ------
NM_001453chr661473 1457 657 610 465 193 11344 ----
NM_001454chr171622 ------
NM_001455chr6124719 4410 4375 4281 3977 3147 1922 1486 1334 631 605 596 23929 412 41489 1374 1272 447 14285
NM_001463chr29707 335 304 260 229 175 168 161 150 ------
NM_001482chr154820 717 324 157 ----1161
NM_001483chr761064 796 722 348 138 36 1215 ----
NM_001491chr672733 2565 1805 980 670 461 300 22661 524 11740 1389
NM_001493chrX1588 ------
NM_001494chr102751 239 ------
NM_001495chr831041 930 298 --2793 158 --
NM_001497chr9132809 2597 2477 2170 2064 1888 982 829 544 500 371 354 60 1680 22471 1965 --
NM_001498chr661108 984 542 427 410 372 --2149 113 --
NM_001521chr21795 ----1528
NM_001525chr11104 ------
NM_001527chr6174860 4802 4059 3611 1662 1340 1310 1186 1148 1094 772 513 407 197 175 149 65 1290 24792 478 1635
NM_001530chr1451109 1070 210 181 73 ------
NM_001540chr7195 ------
NM_001542chr182816 2718 2697 2461 2103 1936 403 241 --52737 2466 2381 336 58 11912
NM_001543chr594580 3534 3287 3258 1627 1503 1491 960 600 13559 23290 297 13025
NM_001546chr651236 481 265 223 185 --41482 1194 487 190 --
NM_001550chr7246 27 --1185 --
NM_001552chr1731095 220 102 ----1792
NM_001553chr4182 ------
NM_001560chrX62624 2530 2301 2079 1761 1046 --2942 337 11974
NM_001570chr351486 1417 1355 419 218 --11220 --
NM_001584chr11101179 1097 874 459 444 286 228 105 76 55 ------
NM_001587chrX62143 1751 1725 646 598 235 1843 --12263
NM_001604chr1121013 790 ------
NM_001608chr21752 1174 --1249
NM_001609chr1043685 3320 1085 164 ----12884
NM_001614chr172645 498 1243 --1618
NM_001614chr172645 498 1243 --1618
NM_001616chr263138 2380 2281 1074 1046 1013 12583 23419 85 --
NM_001620chr113729 555 541 --1666 --
NM_001621chr7112968 2847 2280 1871 1172 632 606 562 348 332 312 12336 ----
NM_001621chr7112968 2847 2280 1871 1172 632 606 562 348 332 312 12336 ----
NM_001629chr132287 90 ----1257
NM_001634chr652045 1522 774 546 478 --21443 224 --
NM_001642chr1151141 1094 850 264 172 ------
NM_001650chr18144101 3847 3678 3091 2961 2872 2550 1619 1523 1375 1242 1071 477 353 --22915 1324 13628
NM_001655chr1162187 1535 1357 773 726 232 11520 3729 235 132 42085 1948 188 113
NM_001656chr571927 1791 1342 817 417 342 242 ------
NM_001658chr13993 936 206 ------
NM_001659chr12112669 2555 2515 2490 2232 2181 1019 746 676 448 316 1657 1692 --
NM_001660chr31802 ------
NM_001662chr71152 --1295 --
NM_001663chr1472732 2605 2459 830 185 162 95 ----1703
NM_001664chr341061 991 920 283 --11015 1746
NM_001665chr112150 134 ----1138
NM_001668chr151836 1821 736 646 71 --12285 --
NM_001674chr121090 208 --11142 --
NM_001677chr15836 812 397 296 136 --1937 --
NM_001678chr1751779 1706 1650 1370 642 --11362 --
NM_001681chr121722 --1257 1540
NM_001682chr12152933 2825 2778 2752 2584 2560 2501 2364 2163 1837 1821 1043 394 172 101 22768 2370 ----
NM_001683chr342740 2480 827 408 12114 3725 618 167 22322 440
NM_001684chr1103812 3769 3697 3387 3239 2565 1230 1045 909 532 21282 1241 3768 718 564 --
NM_001690chr352343 1699 360 294 95 11667 ----
NM_001693chr851190 1104 988 247 52 1358 11113 21194 1029
NM_001695chr8153892 3868 3581 3408 3345 3298 1707 1574 1419 1272 1255 1243 1015 195 160 1465 32662 1710 1552 --
NM_001699chr191330 --41626 1442 1234 162 --
NM_001701chr941507 1495 243 57 ------
NM_001702chr82561 551 ------
NM_001704chr61529 --1556 --
NM_001706chr33937 391 369 ------
NM_001709chr1162704 2610 2551 2285 885 856 12225 1793 --
NM_001714chr122576 85 ----2470 202
NM_001716chr1121489 1404 ----11408
NM_001717chr1541511 1326 205 77 ------
NM_001718chr631312 1244 1001 ------
NM_001719chr20----141 --
NM_001722chr81646 1507 ----
NM_001730chr1331509 625 603 ------
NM_001730chr1331509 625 603 ------
NM_001731chr123916 691 666 --1342 --
NM_001735chr9173 ------
NM_001740chr163497 477 210 ------
NM_001742chr731840 1631 411 ------
NM_001743chr23488 147 57 --160 --
NM_001745chr55911 463 294 232 107 ----1161
NM_001746chr5132958 2788 2582 2511 2204 2031 2022 1118 1021 930 640 284 206 --22920 2461 --
NM_001752chr111416 ------
NM_001754chr21174254 3988 3645 3606 3203 3119 3103 2877 2821 2755 1466 1193 1175 859 653 631 592 --23225 1075 --
NM_001755chr1682210 2103 810 690 432 417 345 279 11435 12038 --
NM_001759chr12165047 4981 4291 4191 4115 3521 3470 3414 3343 2073 1983 1920 1885 1411 1045 57 14302 43276 1110 845 77 15263
NM_001761chr167700 689 676 291 266 214 143 ------
NM_001773chr151426 1296 1097 1061 418 --31290 1000 589 11516
NM_001777chr3123901 3501 3143 3008 2919 2818 2707 2693 2620 1392 947 777 24042 786 13439 1952
NM_001781chr121137 --1664 --
NM_001785chr11307 ------
NM_001788chr73960 399 233 ------
NM_001789chr361443 1218 1178 474 411 60 ------
NM_001790chr54388 351 311 111 --2371 356 --
NM_001791chr131395 1147 23 --11381 --
NM_001792chr181919 1308 1279 --
NM_001797chr161187 1800 ----
NM_001798chr1241074 903 728 243 1325 ----
NM_001799chr5------1190
NM_001800chr192185 75 ------
NM_001806chr19112956 2927 2891 2486 1154 1115 981 929 805 437 313 12789 21159 129 --
NM_001810chr203701 602 66 --1568 --
NM_001812chr42274 80 --1126 --
NM_001819chr202260 205 --1209 --
NM_001822chr27743 545 528 516 508 192 137 --2676 632 --
NM_001826chr1--166 ----
NM_001829chr42915 857 ------
NM_001830chrX93494 3196 2781 2604 1557 1356 1346 1216 671 1621 21270 1102 --
NM_001833chr92273 93 ------
NM_001839chr13702 562 283 --1158 --
NM_001843chr12184 ------
NM_001844chr121146 ------
NM_001845chr1351249 548 540 377 50 --1257 --
NM_001854chr121468 1014 1532 2554 275 --
NM_001855chr92121 40 ----1817
NM_001858chr6125008 4221 4012 3908 3349 1942 1849 1779 1306 1252 907 870 1379 13635 --
NM_001859chr983078 2994 2931 884 855 232 207 100 1174 23046 2970 --
NM_001872chr132407 383 ------
NM_001873chr43649 472 192 ------
NM_001875chr21741 --21068 772 1341
NM_001880chr2----1243 --
NM_001881chr102345 112 ------
NM_001882chr52441 182 ------
NM_001884chr51443 1567 ----
NM_001891chr43324 299 77 ------
NM_001892chr571407 1352 1243 1090 1079 1054 245 --11392 11415
NM_001894chr2221053 51 1957 1157 1149
NM_001895chr204998 849 274 176 --21236 852 --
NM_001901chr621083 111 1726 ----
NM_001904chr32307 188 ------
NM_001913chr72635 624 ------
NM_001916chr81182 ------
NM_001918chr1159244 9000 8950 8840 8274 7070 6532 6485 5829 3131 2226 1437 1052 974 769 27261 853 --16709
NM_001920chr122309 217 ------
NM_001921chr421154 1093 11219 ----
NM_001923chr113596 482 197 1652 ----
NM_001931chr1151223 1198 803 433 86 ------
NM_001935chr24874 357 329 246 ----1890
NM_001936chr721226 611 --1550 --
NM_001938chr121718 634 1182 --11816
NM_001939chrX63133 3078 1481 613 446 265 ------
NM_001942chr1871966 1878 1601 1498 1453 1346 197 --1244 11974
NM_001945chr531366 1356 1120 21379 349 ----
NM_001946chr125996 785 332 185 54 --183 --
NM_001948chr1571258 1116 937 509 424 194 43 --31120 833 197 --
NM_001949chr643198 3003 2395 2150 1447 32803 2796 792 --
NM_001951chr81142 ------
NM_001954chr63730 636 619 ------
NM_001955chr62424 222 1338 ----
NM_001957chr472105 1846 1431 1419 833 414 194 12154 --190
NM_001962chr52236 127 ------
NM_001964chr52432 175 ------
NM_001967chr3175 --180 --
NM_001968chr4----1659 --
NM_001969chr14113411 3311 3239 3045 2835 1101 1090 1079 665 515 229 23924 699 13224 --
NM_001973chr11269 1159 ----
NM_001977chr43376 242 165 --1296 --
NM_001981chr192203 1781 1732 1595 1570 1496 461 185 154 --11684 12322
NM_001982chr1231186 202 137 ------
NM_001987chr12114273 4106 3866 3491 2966 1544 1479 1332 1117 609 137 --13869 11712
NM_001990chr14138 130 107 99 ------
NM_001995chr451518 1226 1007 599 330 1361 ----
NM_001998chr31372 ------
NM_001999chr531522 466 114 --1551 --
NM_002006chr4145831 5583 5495 5450 5418 4874 4155 3904 3753 3716 1582 1435 1399 1006 15101 41053 971 558 466 14286
NM_002009chr1592566 2542 2292 2151 826 288 80 62 46 ----22785 1071
NM_002010chr13--1393 ----
NM_002014chr122471 113 --1618 --
NM_002015chr13103304 3241 2969 2592 2501 1179 813 672 381 105 22404 983 42973 2595 1335 484 --
NM_002017chr1141413 311 133 101 ------
NM_002023chr131499 352 132 11233 ----
NM_002024chrX2348 262 --31685 807 288 11407
NM_002025chrX259256 9217 8883 8040 7555 7346 6986 6953 6881 6787 6583 6266 6235 6168 5874 5822 5660 2374 1129 1120 1097 1047 214 127 99 47611 6730 3490 1773 56890 6852 2365 1114 778 11980
NM_002026chr27995 902 826 756 191 95 39 ------
NM_002028chr1451339 913 196 123 26 --1466 --
NM_002030chr1961263 1211 1156 1145 351 77 ------
NM_002031chr62567 255 --1645 --
NM_002035chr18173723 3092 3060 1192 1070 639 521 496 488 480 472 464 456 441 368 328 224 34009 3691 649 33122 2700 526 1812
NM_002040chr21113153 2745 2362 2222 2143 2089 1258 1028 765 401 91 1915 33108 2413 667 --
NM_002044chr1581627 1137 1076 495 409 401 177 61 11167 ----
NM_002048chr92840 549 ------
NM_002051chr103904 826 796 ------
NM_002054chr23485 296 134 ------
NM_002056chr23873 288 260 ------
NM_002061chr151579 1204 738 220 111 ------
NM_002062chr661448 1106 626 585 509 209 ------
NM_002063chrX2976 257 ------
NM_002065chr171566 1537 1394 1299 1269 448 424 11520 21355 152 --
NM_002067chr191275 --1248 --
NM_002069chr771675 1611 1368 1222 584 253 62 31397 1245 759 11617 --
NM_002071chr183682 670 637 ------
NM_002072chr99949 942 803 758 674 368 329 309 74 --1796 --
NM_002074chr181645 1611 1247 1237 1099 253 247 197 1555 21530 599 --
NM_002076chr12103287 2236 2230 1053 1025 786 272 255 214 109 22574 48 11016 --
NM_002077chr932008 1511 527 1612 146 --
NM_002080chr165817 248 237 111 36 --21014 700 --
NM_002081chr231752 1642 178 --11452 --
NM_002082chr51206 ------
NM_002084chr53853 333 271 ------
NM_002086chr1772059 1834 1791 1783 598 374 280 ------
NM_002092chr4124522 4070 3929 3880 3440 1726 1614 1471 1268 1026 352 268 21292 1233 43960 3412 1822 1151 --
NM_002094chr16174 --183 --
NM_002095chr82269 257 ------
NM_002103chr193733 723 39 --1206 --
NM_002107chr12429 56 ------
NM_002111chr493199 2883 2861 2783 2569 548 541 170 147 ------
NM_002114chr62386 111 1439 1497 288 55
NM_002126chr17103559 3194 3135 3086 2662 1447 1172 1020 461 389 185 53816 3551 2623 1659 1251 --
NM_002128chr1342539 838 498 28 1332 ----
NM_002129chr41394 --1143 --
NM_002130chr541620 553 267 174 ------
NM_002131chr641300 1098 380 352 --11345 --
NM_002135chr12------1513
NM_002136chr122698 211 ------
NM_002137chr761850 936 688 379 295 282 ----32047 1815 323
NM_002139chrX--1570 ----
NM_002140chr93793 174 55 --11080 --
NM_002141chr73601 536 45 ------
NM_002143chr13749 743 571 ------
NM_002146chr1731452 1093 399 --21382 576 --
NM_002148chr22661 114 ------
NM_002149chr22642 501 --1795 --
NM_002156chr21376 ------
NM_002158chr2123710 3382 3213 2952 2899 1504 736 570 434 364 115 41 43761 3578 2968 1362 23398 1189 13623
NM_002160chr94572 558 221 184 --1189 --
NM_002165chr20--1308 ----
NM_002166chr26537 509 259 242 187 24 --133 --
NM_002167chr11439 ------
NM_002182chr382682 2585 2265 2175 954 571 409 308 1217 1234 1863
NM_002190chr611162 2839 526 ----
NM_002192chr71499 182 1625 --
NM_002193chr221431 155 ------
NM_002196chr2091060 1044 907 782 714 400 334 260 146 ------
NM_002196chr2091060 1044 907 782 714 400 334 260 146 ------
NM_002198chr51192 1622 ----
NM_002199chr44888 855 166 75 181 ----
NM_002201chr151111 ------
NM_002202chr531029 813 370 1993 ----
NM_002204chr17143 --11358 --
NM_002205chr121929 --1344 --
NM_002207chr32121 53 ------
NM_002210chr243456 3355 2494 1303 53153 3114 2189 1277 327 12487 1898
NM_002211chr104913 841 352 255 --1714 1917
NM_002214chr7175643 5466 4854 4650 4198 3970 3951 3754 3686 3532 3523 3463 1070 982 670 651 643 14075 35730 4837 3466 --
NM_002221chr172185 2155 1171 861 829 492 419 --22754 2143 1696
NM_002222chr341344 1169 1081 916 ----1428
NM_002223chr1283942 3217 3015 2936 2897 2712 547 395 13741 22956 651 23862 2800
NM_002226chr143153 143 94 --1366 --
NM_002228chr12881 493 11202 1775 --
NM_002229chr193495 456 371 ------
NM_002230chr175982 826 745 179 31 ------
NM_002232chr151392 1263 1253 379 198 ------
NM_002233chr111456 ------
NM_002234chr122170 161 --3675 604 528 --
NM_002235chr1231601 1468 1249 11438 1348 --
NM_002240chr215552 96 71 65 26 --176 --
NM_002241chr172322 1942 985 934 557 515 123 1438 --12170
NM_002242chr272032 1454 1323 1295 496 80 59 ----11300
NM_002245chr12639 629 ------
NM_002247chr1052327 2240 832 527 436 --12117 --
NM_002252chr22170 26 --1173 --
NM_002253chr4174 11091 ----
NM_002254chr292276 2052 2039 1513 792 663 443 376 275 1542 ----
NM_002264chr3175050 4871 4217 3703 3422 3335 3075 1957 1665 1074 937 806 764 563 520 316 180 --24957 2024 14243
NM_002265chr17----1332 --
NM_002266chr172250 64 ------
NM_002267chr1352391 1857 1786 473 111 --1981 --
NM_002268chr321779 1244 1520 1749 --
NM_002270chr5125349 4677 4037 4002 2166 2002 1986 1813 1681 1608 1229 1198 --23853 1598 --
NM_002271chr1382229 2153 1572 884 532 420 297 244 --22264 70 12083
NM_002274chr173355 312 255 1281 ----
NM_002285chr2123596 3464 3050 2888 2604 1347 1278 1268 1195 1079 979 949 43881 3666 771 279 2837 231 11312
NM_002293chr192470 2409 2392 1939 1711 1091 984 717 669 11893 ----
NM_002294chrX3166 115 53 ------
NM_002296chr191696 1648 1563 1498 1170 448 371 119 84 1328 11593 --
NM_002310chr5166623 6438 5947 5815 5662 5639 4144 2400 2073 1882 1830 1807 689 592 358 231 21666 1023 32222 1620 337 14048
NM_002313chr10184714 4674 4071 3995 3702 3676 3576 3482 3284 3240 1227 1075 1061 1029 975 732 617 289 44794 4486 1776 1740 14295 14803
NM_002314chr71169 --1905 --
NM_002317chr51375 ------
NM_002333chr1921215 254 ------
NM_002336chr12164331 3368 3249 3099 1804 1773 1339 1279 1265 1216 933 821 718 672 545 186 13093 11692 11159
NM_002345chr123703 648 520 1561 142 --
NM_002349chr251554 1489 1063 547 267 --1270 11041
NM_002350chr831155 1031 292 1878 1443 --
NM_002351chrX2429 32 11412 ----
NM_002355chr1261309 1276 1151 1070 373 192 --1184 --
NM_002356chr682670 2516 2378 1954 1003 270 173 38 11018 1349 --
NM_002359chr1774299 3493 2898 958 118 85 29 11083 --12967
NM_002360chr742392 2332 2254 1918 --22660 2352 --
NM_002374chr2183569 3410 3213 2915 2715 2487 2292 2281 1332 1296 1232 1222 1061 982 922 843 145 88 1377 21064 796 --
NM_002375chr332234 786 762 11712 31608 1516 500 --
NM_002376chr143596 558 164 ------
NM_002382chr143936 523 109 1881 21166 281 --
NM_002387chr5145039 4784 4177 3910 3758 3229 1660 1404 1267 1247 1102 562 349 273 13576 23847 1316 13134
NM_002391chr111322 ------
NM_002397chr562161 2065 1941 1737 258 34 ------
NM_002398chr211385 21449 1149 1378 --
NM_002399chr1511315 1382 ----
NM_002402chr751210 470 369 305 110 ----1345
NM_002408chr143671 588 93 ------
NM_002409chr2253157 3010 2367 1088 661 --13160 --
NM_002428chr1651417 431 374 225 190 ------
NM_002430chr22112525 2358 930 822 751 722 464 441 431 421 135 22468 2106 1833 11002
NM_002438chr103450 159 84 --1582 --
NM_002442chr1251745 1726 1530 1428 1112 ----11642
NM_002444chrX31429 1385 225 --21362 231 --
NM_002449chr53413 362 194 1857 21019 925 --
NM_002451chr9112938 2498 1054 958 874 857 844 490 406 365 271 11094 23785 2840 1848
NM_002455chr1132 ------
NM_002460chr693605 1520 1246 975 952 944 855 811 25 22968 709 12334 13181
NM_002465chr121229 ------
NM_002467chr81420 ------
NM_002469chr121415 ------
NM_002473chr223986 366 350 --1458 --
NM_002480chr1211400 --1167 --
NM_002482chr12132 75 --1670 --
NM_002485chr8102124 2115 1992 1874 1855 1796 1719 789 524 157 --11492 --
NM_002486chr942270 1616 1600 268 --1244 --
NM_002487chr152637 316 131 ----
NM_002489chr72447 271 ------
NM_002493chr91277 --173 --
NM_002499chr1572233 1829 1544 903 854 769 326 1509 12416 --
NM_002500chr22866 203 ------
NM_002501chr1994107 3949 1602 1532 1247 1197 878 597 183 --44000 3930 2905 1250 13131
NM_002505chr661450 1338 1310 1145 597 572 --31586 1512 1289 --
NM_002508chr141606 1553 512 179 ------
NM_002509chr201701 --2632 287 --
NM_002514chr851185 1122 1093 806 456 ------
NM_002515chr1461841 1766 1622 1544 211 193 11609 192 --
NM_002516chr19130 ------
NM_002518chr231194 203 149 --11206 --
NM_002519chr1141268 1219 1058 600 1150 11105 --
NM_002520chr5152 ------
NM_002522chr1783921 3160 3131 2957 496 389 362 79 1629 1207 1366
NM_002524chr11411 --1249 --
NM_002531chr2022158 315 31981 418 228 21950 318 --
NM_002536chrX31103 570 201 --2266 49 --
NM_002537chr1531025 424 395 --1431 --
NM_002539chr2197 ------
NM_002543chr1231453 1388 311 137 167 --
NM_002544chr171233 ------
NM_002545chr11205146 5074 5030 5020 5014 4573 4082 4056 3364 2067 1497 1435 1349 1245 955 531 460 292 125 92 --23661 105 --
NM_002546chr81580 --1604 --
NM_002547chrX124220 4172 3793 3782 3561 3081 1378 1354 1043 804 738 142 --13376 13579
NM_002553chr72496 388 --194 --
NM_002556chr1182013 1986 1890 1351 864 856 636 297 --21970 1532 --
NM_002563chr33342 256 29 --1285 --
NM_002568chr82329 313 ------
NM_002569chr1521480 1349 ------
NM_002572chr114351 337 292 76 ------
NM_002575chr182106 95 ------
NM_002576chr1131232 1050 401 --2870 417 --
NM_002577chr3184054 3893 3866 3793 3726 3598 3227 3120 2955 2949 1510 1433 965 930 425 409 197 39 --13941 1138
NM_002581chr985581 5495 4293 1981 1563 1473 1413 429 11659 45362 5320 3729 3488 15585
NM_002585chr12137 70 --1148 --
NM_002586chr691639 1569 1041 632 374 317 302 248 146 --11021 --
NM_002588chr531767 1682 1297 ------
NM_002590chr131214 ------
NM_002592chr20--140 2128 82 --
NM_002594chr2082084 1641 1621 1613 1588 761 249 242 2459 332 1798 --
NM_002595chr1271845 1754 1716 1581 1318 1274 80 --21814 218 --
NM_002600chr13675 546 515 ------
NM_002605chr1551231 925 468 355 267 11074 ----
NM_002607chr751287 1152 874 393 123 ------
NM_002609chr541863 750 318 131 --1400 --
NM_002610chr282826 2631 2311 2183 1136 643 609 358 --22788 816 --
NM_002613chr16105275 4971 4182 3666 3416 1930 1415 754 616 232 33876 3507 3285 15254 --
NM_002618chr2------1478
NM_002623chr20199 ------
NM_002628chr351140 1031 442 107 94 1335 1764 --
NM_002631chr1----193 --
NM_002633chr13504 469 385 ------
NM_002639chr1831217 83 54 --2377 38 --
NM_002641chrX51962 1830 1771 634 394 1475 2329 143 --
NM_002643chr2----126 --
NM_002645chr1193155 2857 2796 2687 2429 2378 2334 2305 334 22786 655 ----
NM_002646chr152195 1963 1370 833 541 1669 ----
NM_002648chr621210 968 1440 ----
NM_002649chr761445 1355 1060 557 392 225 11228 1335 --
NM_002655chr8104078 3808 3387 3341 1732 1543 1354 1148 443 101 31964 1701 1211 14490 --
NM_002657chr20123854 3230 3093 2992 2463 1440 980 948 923 842 778 315 --23562 1340 --
NM_002658chr101646 --1262 1929
NM_002669chr4235 21 ------
NM_002670chr361614 1486 1458 1208 1182 297 --1470 --
NM_002687chr14--11115 133 11156
NM_002693chr151308 --1325 --
NM_002698chr1992583 2533 2366 2350 2245 2234 1995 1962 885 ------
NM_002699chr131461 498 272 11325 11346 --
NM_002702chr128937 931 818 797 699 396 331 162 1290 ----
NM_002703chr431279 725 218 21650 739 11669 21784 149
NM_002706chr23592 526 473 134 1584 --
NM_002707chr22352 306 ----139
NM_002709chr293518 2970 2391 2290 1294 1282 1251 907 154 ----11394
NM_002710chr122973 354 --2960 219 --
NM_002711chr74732 615 331 104 ------
NM_002714chr621008 981 ----1159
NM_002715chr561161 1080 1004 816 469 244 ----21246 281
NM_002716chr11143697 3679 3344 3002 2834 2776 1447 991 855 731 722 397 376 156 --12551 --
NM_002718chr372385 2199 1724 941 504 306 49 ------
NM_002719chr1492379 2243 2076 2006 1906 618 567 507 41 --12079 --
NM_002720chr162243 229 --1249 --
NM_002721chr92187 56 --133 --
NM_002725chr173863 3549 3252 3240 300 95 79 --11779 --
NM_002729chr101561 --1112 --
NM_002730chr1921190 29 ------
NM_002731chr192573 2138 1948 905 824 794 773 299 238 22739 2297 23082 2974 1462
NM_002734chr1742053 1811 239 27 21923 1720 1421 --
NM_002736chr731963 856 486 --2753 94 11975
NM_002737chr17176303 6227 6144 6091 5787 5464 5366 5100 4460 4396 4316 4138 2187 1390 1069 803 421 --34075 704 508 16125
NM_002738chr1651151 1134 808 308 32 1720 1321 1110
NM_002739chr193671 532 512 ------
NM_002740chr392795 2386 2358 2194 2145 1932 968 466 127 ------
NM_002742chr14----195 --
NM_002745chr22164448 3804 3522 3422 3100 3025 1552 1396 1334 1038 890 680 605 339 295 144 11165 ----
NM_002747chr1851752 1505 1481 588 93 ------
NM_002748chr1541215 274 152 25 ------
NM_002755chr15184 ----1369
NM_002756chr173801 693 664 ------
NM_002758chr172140 127 2550 94 ----
NM_002763chr13197 163 155 ------
NM_002764chrX1354 --2894 357 --
NM_002767chr171513 --1471 --
NM_002776chr19--1362 2774 195 --
NM_002778chr1041113 210 131 49 ------
NM_002796chr1180 ------
NM_002811chr163357 125 78 --1408 --
NM_002814chrX2634 106 ------
NM_002815chr17180 ------
NM_002822chr1231856 618 410 1636 11556 --
NM_002823chr22570 236 ------
NM_002825chr72608 582 --1466 --
NM_002827chr2021291 449 ------
NM_002828chr184993 837 691 623 1767 ----
NM_002829chr941080 432 402 71 ------
NM_002833chr1541143 502 335 109 11494 --1341
NM_002834chr1284114 3646 3076 1489 1210 973 736 658 12667 23301 739 --
NM_002835chr72692 672 1480 1306 --
NM_002837chr12114497 3837 3540 3397 2870 1565 1459 1111 892 372 96 13413 33993 3400 1387 13656
NM_002838chr121093 317 1463 1240 --
NM_002839chr983520 3236 3174 2526 2409 2347 1075 807 --33571 3386 2712 --
NM_002840chr131587 456 265 ------
NM_002841chr31501 ------
NM_002843chr11133266 3131 1145 915 892 839 757 734 684 655 506 319 22 12779 22546 107 1529
NM_002844chr651163 551 512 365 300 ------
NM_002845chr181529 ------
NM_002846chr2264 46 ------
NM_002847chr731505 1488 262 1462 ----
NM_002848chr1251083 1066 942 907 88 1821 21134 403 --
NM_002850chr1941147 774 445 128 ------
NM_002851chr71571 --1260 1638
NM_002855chr1131058 817 766 --23113 2451 11026
NM_002857chr1132546 2467 1946 1865 1831 1762 1691 954 534 359 296 228 202 32424 2391 24 12561 11088
NM_002858chr121016 528 1930 11359 --
NM_002865chr8150 ------
NM_002867chr11471 --3302 163 143 --
NM_002868chr1272328 2299 2088 874 836 411 309 11714 12093 --
NM_002869chr1172090 2022 1955 1380 391 279 265 1725 21401 1383 1599
NM_002874chr942353 591 546 405 21961 1006 12003 1353
NM_002880chr34806 761 728 163 --165 --
NM_002881chr231119 223 127 ------
NM_002882chr22292 22 ------
NM_002886chr3145192 5032 4892 4669 3524 3438 1860 1506 1198 546 459 416 409 225 33423 3313 1156 1586 --
NM_002890chr51800 1905 ----
NM_002892chr1431664 1608 159 --31667 1656 1437 --
NM_002893chrX3281 118 25 ------
NM_002895chr203969 848 775 ------
NM_002897chr24592 561 552 542 ----172
NM_002906chr1182189 1609 830 442 426 410 253 190 1532 31612 926 271 --
NM_002911chr1961679 573 550 397 340 331 1350 ----
NM_002912chr61788 1170 ----
NM_002922chr11627 ------
NM_002923chr1142 1641 ----
NM_002924chr11201 --1591 --
NM_002928chr141484 1307 1057 266 --11364 --
NM_002931chr61213 1315 175 --
NM_002938chr441566 733 562 209 --11947 --
NM_002940chr441429 717 497 365 --21443 191 --
NM_002941chr32601 316 ------
NM_002942chr33516 289 179 ----1921
NM_002943chr151189 ------
NM_002945chr172768 715 --1888 --
NM_002946chr11513 ------
NM_002948chr361173 1161 1019 916 278 204 --1903 --
NM_002956chr1251441 1090 925 508 226 --1947 --
NM_002957chr963733 3570 2560 1129 738 173 13838 196 --
NM_002958chr33791 724 185 ------
NM_002959chr1114362 4234 3605 2853 2753 1584 608 500 262 233 117 24132 2688 34415 2861 1460 23529 1130
NM_002968chr1641045 697 351 143 ------
NM_002970chrX3329 318 59 1349 ----
NM_002971chr381158 1084 1065 763 743 404 382 75 ------
NM_002977chr273355 2686 2612 2282 2168 720 192 ------
NM_002979chr11810 --1904 --
NM_002994chr441577 1479 1338 676 169 158 --
NM_002996chr163779 634 526 11314 11221 --
NM_002998chr882253 2148 1723 1702 702 480 162 81 ------
NM_003001chr1112231 2214 2154 2142 1979 1861 1576 661 450 273 58 22032 761 11867 22103 731
NM_003010chr1722228 698 11789 11946 --
NM_003011chr981660 1648 1369 659 473 216 136 44 21137 1091 1389 --
NM_003013chr4157 ------
NM_003014chr751184 956 939 170 147 --2959 173 --
NM_003015chr101723 ------
NM_003016chr1782041 2025 2003 1685 1578 767 757 370 ----1715
NM_003017chr62890 171 ------
NM_003026chr91374 ----1979
NM_003027chr152392 174 197 ----
NM_003028chr942912 2680 358 245 1729 12927 12831
NM_003030chr341859 1618 1601 1349 --1712 --
NM_003031chr162762 628 1802 122 --
NM_003034chr12258102 8041 7981 7957 7864 7804 7693 6896 6330 6317 5966 5614 5590 5500 5484 5283 5262 4928 2916 2607 1673 944 911 483 51 15302 68044 7013 5969 5286 3167 1792 --
NM_003036chr14998 928 496 176 ------
NM_003042chr341767 856 534 363 ------
NM_003043chr384276 4226 3812 3756 2775 1457 1177 304 11538 1307 14107
NM_003045chr13134854 4786 4775 4684 4389 4214 3173 2013 2004 1929 1046 1017 337 ----1263
NM_003046chr8125325 5099 4465 3875 3422 1979 1883 1550 1304 1107 1060 955 15383 45066 4236 1100 1092 --
NM_003051chr181950 1912 1563 804 729 664 565 552 --21915 1712 --
NM_003060chr551202 1035 874 813 472 ------
NM_003068chr84987 313 277 83 ------
NM_003069chrX4762 580 256 188 --1569 1645
NM_003070chr93788 766 698 --1775 --
NM_003071chr361834 1695 1502 1395 1379 364 --11758 --
NM_003074chr392103 1912 1545 1534 757 530 409 103 91 22117 164 2802 291 1539
NM_003075chr121337 ------
NM_003077chr172684 578 ------
NM_003079chr172200 98 --1203 --
NM_003081chr206430 328 265 193 177 62 --11006 --
NM_003082chr143555 196 186 ----140
NM_003093chr6187 ------
NM_003095chr123377 327 281 ------
NM_003099chr15155597 2465 2209 2138 1976 1896 1426 1306 1085 756 702 612 549 496 187 15296 25620 334 25006 797
NM_003100chr51324 ------
NM_003101chr131645 626 607 ------
NM_003104chr1551271 1232 1022 956 90 --11074 --
NM_003106chr34907 887 704 251 ------
NM_003107chr652328 1730 1053 895 425 ------
NM_003108chr2186466 6203 6072 5215 5146 5051 5004 4782 4670 4450 4438 2131 1801 1757 1051 548 366 27 35533 5121 468 36233 2125 2001 25428 4971
NM_003110chr1731096 774 752 ------
NM_003111chr231406 1154 412 ------
NM_003112chr782853 2783 1015 951 515 407 355 121 --22871 2636 1359
NM_003113chr22806 25 1324 ----
NM_003114chr83646 558 195 --2776 310 --
NM_003128chr241893 400 85 30 --2910 587 --
NM_003129chr81281 ------
NM_003131chr672265 1878 1757 1567 790 228 72 --11881 --
NM_003133chr12356 137 --2839 280 --
NM_003136chr144155 128 101 71 ------
NM_003137chr642230 2205 497 379 1644 22233 507 --
NM_003140chrY1101 --1109 --
NM_003144chr652136 839 648 619 178 --12139 1342
NM_003145chr13469 308 106 ------
NM_003146chr112378 22 ------
NM_003149chr371657 1625 1432 1043 572 537 468 11547 --11593
NM_003150chr1751851 1788 571 510 402 21827 148 12046 1235
NM_003151chr2----162 --
NM_003152chr173801 243 23 --1789 11176
NM_003155chr892530 2419 2324 2260 2228 1093 853 552 115 ----12121
NM_003156chr112354 319 1516 21355 529 11378
NM_003161chr17103349 3008 2875 2667 2602 1197 1129 1117 1069 637 --12309 12364
NM_003162chr21165 1261 11002 --
NM_003170chr171118 1460 ----
NM_003173chrX31227 545 268 ------
NM_003174chr102335 201 ------
NM_003176chr13326 319 230 ------
NM_003176chr13326 319 230 ------
NM_003178chr362154 872 595 498 210 110 --21874 213 --
NM_003179chrX2269 118 ------
NM_003184chr81959 1985 ----
NM_003185chr2041033 496 322 162 --1994 --
NM_003186chr111431 ------
NM_003188chr62857 162 ------
NM_003189chr173256 3194 3042 2998 2769 2148 382 --33266 948 173 --
NM_003194chr64548 465 437 39 ------
NM_003198chr11275 ------
NM_003199chr1895452 5175 4640 3737 3690 799 713 343 231 44593 4427 2085 1209 24089 1495 --
NM_003204chr1761763 1376 1363 1331 1284 600 ------
NM_003206chr64443 117 89 83 ------
NM_003211chr1231261 533 271 ------
NM_003216chr22123091 3006 2461 2315 2110 2082 1337 1029 848 687 576 376 22410 483 ----
NM_003217chr1231906 1783 586 --11700 --
NM_003220chr641634 1203 684 392 --1637 --
NM_003221chr6114131 3891 3846 3540 3424 3283 3211 1436 1135 985 261 --34125 3244 1355 --
NM_003222chr2041195 1090 276 179 ----1286
NM_003223chr165724 715 697 682 288 ------
NM_003234chr362322 1483 855 674 530 348 1328 1717 --
NM_003242chr372344 2250 1643 1558 955 895 612 --1933 1501
NM_003243chr131195 933 438 ------
NM_003244chr181464 ------
NM_003246chr1581975 1898 1759 1716 1462 1316 1310 112 21698 342 21319 116 --
NM_003247chr682034 1865 1772 1534 1436 1290 289 86 --11766 --
NM_003253chr2131859 1345 1284 1649 --11621
NM_003255chr1762439 2098 2075 1985 1866 1056 22626 2138 1464 12066
NM_003257chr1571385 1330 1214 1060 904 566 348 --1898 --
NM_003259chr191129 ------
NM_003262chr3164931 3909 3775 3708 3390 3309 1535 1448 1385 1333 1273 1196 487 417 98 50 14098 24051 1408 14217
NM_003269chr621258 354 ------
NM_003270chrX1364 --1751 --
NM_003271chr111154 --123 --
NM_003274chr21112772 2715 2583 2123 1885 1836 853 693 503 408 203 --1802 --
NM_003275chr93458 196 121 ------
NM_003285chr14547 514 338 169 --135 --
NM_003286chr204972 839 333 127 ------
NM_003288chr2011133 ----2498 381
NM_003290chr1921171 57 ----11023
NM_003291chr131204 ------
NM_003292chr131442 655 117 1729 ----
NM_003297chr12----2334 39 --
NM_003298chr3186066 5909 5895 5712 5700 5607 5427 5097 4794 4725 4360 4236 3834 2115 2032 1262 1093 520 23853 758 15820 --
NM_003299chr12162 ------
NM_003300chr142447 326 ------
NM_003304chr361412 1246 501 419 260 123 ------
NM_003305chr42349 281 ------
NM_003311chr111257 ------
NM_003314chr51472 ------
NM_003317chr143869 175 104 --1789 1875
NM_003318chr61202 --1205 --
NM_003319chr22931 348 2644 74 ----
NM_003320chr11104127 3575 3543 3328 3011 1287 1243 999 842 232 12975 11254 --
NM_003326chr192579 2534 2347 2333 2114 1066 749 634 214 12019 22503 880 --
NM_003337chr521441 339 ------
NM_003338chr1021961 1954 1140 1398 --
NM_003339chr531568 1506 278 ------
NM_003340chr421192 75 ------
NM_003342chr1773073 2868 2695 2170 2023 1016 391 13135 2986 543 --
NM_003344chr751603 1506 1434 1339 355 --11099 1705
NM_003347chr2281903 1678 1648 480 384 267 219 146 --11851 --
NM_003348chr1261564 1415 1375 1351 1112 61 ------
NM_003349chr203526 372 82 --11506 --
NM_003350chr831012 995 207 --1925 --
NM_003352chr24873 832 61 22 1112 ----
NM_003358chr91123 ------
NM_003359chr431138 1026 910 --11125 --
NM_003367chr193483 437 155 ------
NM_003369chr1142570 2504 2255 862 12478 ----
NM_003370chr192596 214 ------
NM_003371chr932162 764 34 1751 22166 1868 --
NM_003373chr1051952 1807 1284 364 196 --11942 --
NM_003375chr10----1157 --
NM_003376chr641799 431 321 275 ------
NM_003376chr641799 431 321 275 ------
NM_003378chr71413 --1423 --
NM_003379chr621011 438 ------
NM_003380chr102313 91 ------
NM_003383chr9190 1527 ----
NM_003385chr21724 ------
NM_003387chr272939 2416 2026 1154 488 405 370 ----12328
NM_003390chr1131060 886 439 11100 ----
NM_003392chr3174353 3933 3923 3609 3386 3339 3260 3150 2777 2690 1745 1707 1213 866 542 350 259 31650 1042 237 31713 1523 460 --
NM_003394chr121508 ------
NM_003400chr23615 124 27 --2154 30 --
NM_003403chr142329 299 --1754 1592
NM_003404chr2021868 1853 --1628 --
NM_003405chr222673 575 ------
NM_003406chr851869 1757 1561 1452 1308 --21911 1238 --
NM_003407chr192574 69 ------
NM_003410chrX73077 2622 2592 2078 1116 1102 621 11242 1633 11198
NM_003411chrY41152 672 185 139 --11646 11123
NM_003412chr3122841 2676 2273 2099 1948 1121 459 357 348 342 326 207 --21942 351 --
NM_003413chrX91989 1825 1713 794 692 377 265 244 180 ------
NM_003418chr32163 53 ----257 32
NM_003432chr53547 496 230 ------
NM_003439chr732649 2154 1245 --11269 22856 1311
NM_003445chr191822 --1112 --
NM_003453chr134696 680 305 217 ------
NM_003454chr1621363 1355 ------
NM_003455chr1131671 1299 1238 ----11359
NM_003457chr172224 45 --1545 --
NM_003458chr3213855 3847 3839 3735 3713 3697 3550 3246 2924 2630 2520 1622 1019 953 946 932 921 856 281 190 62 ------
NM_003463chr623032 1018 ------
NM_003467chr21130 ------
NM_003468chr2124321 4128 3340 3038 2994 1392 1305 1118 675 527 261 225 11315 34324 1541 679 1370
NM_003469chr23484 445 63 ------
NM_003470chr1641588 1371 1213 315 11792 1158 --
NM_003471chr352335 1643 572 441 205 --21566 1487 1137
NM_003472chr651336 521 434 268 90 11074 11131 --
NM_003474chr1062383 2018 1790 1544 842 775 22209 358 1460 --
NM_003478chr11103352 3275 2855 2374 2258 2155 639 467 337 121 1203 13038 --
NM_003482chr1261777 1732 834 549 523 229 ------
NM_003483chr12152956 2877 2817 2715 2705 2471 2376 2066 1180 1040 1029 967 883 540 288 12238 32811 2660 199 --
NM_003488chr175949 649 406 185 116 1157 ----
NM_003489chr2183075 2842 2129 1238 1029 846 627 273 --22631 849 --
NM_003496chr72794 672 1291 ----
NM_003498chr1662762 2491 2248 1009 645 590 11057 1968 12533
NM_003503chr14947 820 474 382 ----1207
NM_003505chr731300 611 331 11767 11639 --
NM_003506chr871349 1206 1174 1112 534 270 94 --21144 358 11159
NM_003507chr241583 1381 1328 93 --31563 757 144 11510
NM_003557chr1111391 1377 1300 1071 529 474 437 356 171 89 44 2445 370 --1541
NM_003558chr91264 1617 ----
NM_003564chr11111 ------
NM_003565chr1231680 1407 242 --21410 695 --
NM_003566chr1293494 3239 3119 2125 733 643 501 454 357 12297 1748 --
NM_003567chr12395 56 ------
NM_003568chr14305 248 235 119 ----1239
NM_003569chr65594 572 531 193 175 --1486 --
NM_003573chr191267 ------
NM_003574chr18135657 5320 4517 3995 3941 1677 1124 962 694 509 280 40 28 --21703 285 --
NM_003576chr1362873 2703 2297 2278 2198 2140 --1928 12000
NM_003581chr23975 950 783 --1105 --
NM_003583chr12163764 3574 3442 3053 2907 2669 2523 1471 1336 1257 1072 1043 800 792 782 681 --1785 11343
NM_003586chr161487 --1617 --
NM_003589chr1351377 547 231 210 77 11307 11168 --
NM_003590chr272945 2580 1428 1321 473 261 63 --22710 1004 --
NM_003591chr101277 --1119 --
NM_003592chr71449 ------
NM_003593chr173662 521 195 ------
NM_003595chr221190 1482 --1433
NM_003597chr262297 1795 485 444 325 159 12303 11507 --
NM_003601chr4146 ------
NM_003603chr462117 2068 1979 1811 1423 470 11906 1662 --
NM_003607chr194278 4082 3792 3293 3181 3060 2973 1610 912 23518 2655 13884 11589
NM_003613chr151213 --1507 --
NM_003615chr3183849 3695 3464 3054 2978 2741 2564 2489 994 978 926 885 833 530 494 476 302 292 33102 1188 185 33021 818 246 32656 1292 773
NM_003618chr251206 1015 963 388 222 --1246 --
NM_003620chr171722 2271 247 ----
NM_003621chr111508 1146 ----
NM_003622chr1252092 500 424 215 44 1628 21776 1751 --
NM_003624chr1921351 1181 1562 ----
NM_003626chr1141374 1281 1236 1004 ------
NM_003628chr23707 135 33 ------
NM_003629chr193036 3023 2986 2489 1326 850 183 77 42 23251 1258 130 22376 830
NM_003632chr173804 299 290 ------
NM_003633chr572611 2384 2158 1756 1015 942 607 32174 565 412 22387 2049 --
NM_003636chr1150 --1595 --
NM_003637chr131528 1489 1098 11208 21295 1141 --
NM_003642chr2----140 --
NM_003644chr17136236 5729 5442 4394 4234 2544 2175 2147 1863 1697 1357 1029 501 25144 219 26271 1100 --
NM_003646chr111605 ------
NM_003651chr121173 1549 ----
NM_003654chr112590 265 1162 2789 712 --
NM_003659chr21384 1815 1113 --
NM_003660chr192292 263 ------
NM_003663chr3113058 3045 2523 2437 1143 1110 922 846 776 432 271 33425 2741 1364 12608 11283
NM_003664chr51469 ----1487
NM_003668chr12148 1333 ----
NM_003670chr351473 1353 1168 985 543 ------
NM_003671chr993294 3090 2994 2924 2804 2798 2519 2246 460 --2740 393 --
NM_003672chr141519 587 104 34 ------
NM_003677chr123743 737 421 12042 11888 1890
NM_003679chr193150 3012 2424 2402 1323 1205 1188 322 141 --32405 1191 38 1274
NM_003685chr194929 838 269 207 1396 ----
NM_003688chrX160 ------
NM_003692chr93382 245 174 ------
NM_003701chr132710 392 ------
NM_003702chr82814 665 ------
NM_003704chr41674 ------
NM_003705chr22306 121 ------
NM_003711chr5139 ------
NM_003713chr13700 633 436 11465 ----
NM_003714chr573092 2455 2422 2359 859 267 48 1627 ----
NM_003716chr33950 715 232 --188 --
NM_003718chr74549 477 434 49 ------
NM_003722chr362675 2546 2486 1797 656 559 --1569 --
NM_003725chr123440 309 106 ------
NM_003735chr531767 1682 1297 ------
NM_003736chr531767 1682 1297 ------
NM_003743chr22518 195 --2789 200 2751 73
NM_003746chr122240 211 ------
NM_003749chr1372239 2217 2139 936 907 342 100 ----11692
NM_003750chr105967 847 825 812 98 --2702 206 --
NM_003752chr16--1150 ----
NM_003758chr1531358 1017 1008 ----11646
NM_003758chr1531358 1017 1008 ----11646
NM_003759chr4104048 3073 1267 1110 977 813 540 280 273 111 --11660 13563
NM_003760chr13788 542 265 --1251 --
NM_003762chr13942 190 103 --11448 --
NM_003763chr2063081 2945 2552 725 485 408 12923 22948 2474 --
NM_003768chr111720 --11745 --
NM_003769chr122263 23 ------
NM_003772chr1151333 382 294 70 51 --173 1338
NM_003774chr12123128 2835 2576 2439 2415 2358 2212 2173 2122 1186 503 451 23330 883 1740 1773
NM_003778chr32677 139 --141 --
NM_003779chr11485 --1420 --
NM_003780chr11214 ------
NM_003783chr111056 1141 ----
NM_003784chr181705 --1446 1596
NM_003787chr1881731 1699 1485 1454 1188 1148 683 635 --41702 1301 1268 1191 --
NM_003794chr34869 429 128 21 ------
NM_003796chr192461 129 --1578 1210
NM_003797chr11----1160 --
NM_003798chr9124 ----1136
NM_003799chr18124465 4104 4046 3879 2988 2883 2811 2800 1126 1084 753 650 13936 185 13263
NM_003800chr692050 2037 2011 2000 1582 1546 1530 921 792 1490 --22237 961
NM_003816chr861302 1044 370 88 73 62 ----11502
NM_003821chr8153 --1113 --
NM_003822chr153092 2842 2620 882 828 ------
NM_003825chr1561394 1142 613 287 205 152 11098 1163 --
NM_003829chr94773 490 188 139 ------
NM_003831chr1851549 1461 702 607 227 1648 --11760
NM_003842chr852268 1961 1817 1725 1718 --21594 50 --
NM_003846chr15620 513 313 222 94 --1235 --
NM_003850chr132212 80 ------
NM_003858chr143615 48 28 ------
NM_003861chr1472901 2742 2709 2026 617 600 296 11890 ----
NM_003864chr4----175 --
NM_003870chr1582106 1374 1345 553 493 236 221 72 --21977 280 11353
NM_003872chr272795 2789 1986 868 641 434 272 --32003 347 243 --
NM_003873chr1092393 2295 2270 1014 1001 592 518 329 126 --1949 --
NM_003877chr123926 689 315 ------
NM_003883chr5137 ------
NM_003884chr361737 1715 1318 713 386 245 ----11641
NM_003885chr17122343 2314 2306 2160 2016 1906 1697 781 716 615 591 377 --1395 12516
NM_003887chr241630 1606 749 112 ------
NM_003888chr1551714 1483 639 324 50 11598 159 --
NM_003895chr2162066 2049 1530 772 697 215 1385 11581 --
NM_003899chr1362612 2081 1747 599 123 22 1637 12484 --
NM_003901chr10112686 2678 2668 2580 1044 1004 853 660 470 336 272 22165 1773 1380 --
NM_003902chr12725 189 ------
NM_003905chr162122 106 ------
NM_003906chr21144 ------
NM_003907chr31329 ------
NM_003913chr6134167 3978 3524 3359 1569 1560 1240 1131 1113 1098 692 556 152 34247 3813 1694 ----
NM_003916chrX31095 954 262 --1231 --
NM_003919chr7167 --196 --
NM_003922chr15130 --1179 --
NM_003924chr451538 1402 1229 1140 650 --11242 --
NM_003927chr1831021 772 688 --11026 --
NM_003930chr752285 2137 2109 1996 708 1122 12425 --
NM_003931chr62473 99 ------
NM_003932chr2291779 1363 1311 1171 769 698 490 323 297 11613 11402 1327
NM_003934chr9101260 1176 1164 1155 1095 917 903 404 238 148 --1353 --
NM_003936chr22840 277 ------
NM_003939chr10124025 4019 3532 3275 3100 2936 1493 1232 890 689 644 635 --2991 692 --
NM_003941chr7102493 2107 2101 2009 1865 1714 441 413 380 58 --1366 --
NM_003947chr351267 1000 414 240 207 21055 405 21233 103 --
NM_003948chr452620 2510 2398 2236 1975 1637 22623 425 1134
NM_003949chr1731742 256 187 ------
NM_003953chr182900 1107 955 872 827 662 574 266 --1812 --
NM_003954chr1721475 1175 --1280 --
NM_003955chr1711391 1392 ----
NM_003957chr1141097 906 850 762 ------
NM_003958chr6123879 3202 3088 2782 2635 1267 874 865 846 836 282 70 --42707 1270 1075 430 13032
NM_003966chr5297609 7174 6631 6611 6420 6413 6024 6014 5853 5236 5041 3042 2805 2754 2725 2705 2658 2651 2643 2342 1822 1649 1424 1207 1147 1106 890 642 331 46175 2858 1041 76 14912 47367 2929 392 260
NM_003968chr31252 ------
NM_003972chr104895 418 368 48 ------
NM_003973chr3132 ------
NM_003980chr66912 578 417 281 172 101 --1273 --
NM_003982chr142291 40 --189 --
NM_003983chr16124482 4224 4145 3710 3454 1299 1045 981 923 915 892 400 --14458 21119 404
NM_003987chr1082260 1692 1669 1653 1638 557 514 390 --11568 --
NM_003988chr1082337 1769 1746 1730 1715 634 591 467 --11645 --
NM_003989chr1082196 1628 1605 1589 1574 493 450 326 --11504 --
NM_003990chr1082196 1628 1605 1589 1574 493 450 326 --11504 --
NM_003993chr11317 ------
NM_003994chr1282719 2685 1724 1687 1451 1390 463 421 24020 3665 13097 --
NM_003995chr92216 188 ------
NM_003998chr41480 --1589 1499
NM_004001chr14571 457 447 415 ------
NM_004006chrX82417 2302 2159 2038 2019 1738 562 343 ------
NM_004007chrX82417 2302 2159 2038 2019 1738 562 343 ------
NM_004009chrX82417 2302 2159 2038 2019 1738 562 343 ------
NM_004010chrX82417 2302 2159 2038 2019 1738 562 343 ------
NM_004011chrX82417 2302 2159 2038 2019 1738 562 343 ------
NM_004012chrX82417 2302 2159 2038 2019 1738 562 343 ------
NM_004013chrX82417 2302 2159 2038 2019 1738 562 343 ------
NM_004014chrX82417 2302 2159 2038 2019 1738 562 343 ------
NM_004015chrX82417 2302 2159 2038 2019 1738 562 343 ------
NM_004016chrX82331 2216 2073 1952 1933 1652 476 257 ------
NM_004017chrX82417 2302 2159 2038 2019 1738 562 343 ------
NM_004018chrX82331 2216 2073 1952 1933 1652 476 257 ------
NM_004020chrX82417 2302 2159 2038 2019 1738 562 343 ------
NM_004021chrX82331 2216 2073 1952 1933 1652 476 257 ------
NM_004022chrX82331 2216 2073 1952 1933 1652 476 257 ------
NM_004023chrX82331 2216 2073 1952 1933 1652 476 257 ------
NM_004024chr121449 567 --11501 172
NM_004028chr18144101 3847 3678 3091 2961 2872 2550 1619 1523 1375 1242 1071 477 353 --22915 1324 13628
NM_004035chr1795183 4207 4197 3905 3826 1625 1163 539 523 --14412 11078
NM_004036chr2--1582 ----
NM_004037chr12109 83 --1103 --
NM_004040chr221164 1144 --21167 860 1263
NM_004041chr112221 86 ------
NM_004050chr142912 684 11725 1586 12172
NM_004056chr81895 ------
NM_004059chr9170 157 ----
NM_004061chr51593 1561 ----
NM_004071chr21268 ------
NM_004075chr123579 404 137 1437 2587 573 --
NM_004080chr751483 1320 602 548 195 21287 74 ----
NM_004081chrY71883 1853 1741 1655 1382 1372 200 ------
NM_004086chr142638 630 ------
NM_004087chr391756 1555 611 462 341 136 58 44 24 --32061 1511 47 --
NM_004089chrX31289 194 55 ------
NM_004090chr17113396 3163 3148 2792 2450 2303 2135 1100 806 697 225 --13360 12745
NM_004093chr1353135 2860 2382 2357 2311 12078 13142 --
NM_004094chr1483069 2219 1871 1088 960 890 483 410 1287 ----
NM_004096chr1071896 1799 1639 702 675 647 249 --21978 1643 --
NM_004097chr21304 ------
NM_004099chr941618 845 794 84 11573 11973 21900 453
NM_004100chr652212 1858 1835 708 555 ----12391
NM_004103chr86838 828 801 768 750 713 ------
NM_004113chr341946 1784 766 694 ------
NM_004114chrX5795 502 471 455 256 --21184 505 --
NM_004115chr13----2140 121 --
NM_004116chr22410 138 1455 ----
NM_004117chr652222 1731 1623 820 744 ------
NM_004119chr132617 128 ------
NM_004124chr1483516 3153 3129 2240 1406 900 628 231 --43457 2177 1384 522 --
NM_004126chr71255 ------
NM_004130chr3--151 1575 1648
NM_004132chr1031190 987 923 ------
NM_004134chr52651 600 ------
NM_004136chr1522909 2190 --22883 2364 --
NM_004145chr192863 379 --1296 --
NM_004156chr82547 100 ------
NM_004157chr32565 262 --1748 --
NM_004161chr221032 21 ----11250
NM_004162chr311002 --2936 399 --
NM_004163chr181113 --1118 --
NM_004169chr172153 132 ------
NM_004170chr941910 1468 598 137 ------
NM_004171chr11289596 8884 8595 8205 7738 7393 7096 7083 6713 6702 6579 6549 6002 3703 3519 3175 2831 2464 2316 2250 1934 1705 709 646 297 216 184 79 49285 7834 6416 3312 58770 6193 2834 2605 2346 11647
NM_004175chr223175 106 35 ----1179
NM_004180chr22506 182 1463 1136 --
NM_004181chr41281 --1345 --
NM_004183chr11------1720
NM_004187chrX21338 362 165 ----
NM_004200chr1153234 2842 1091 347 241 11161 ----
NM_004202chrY2568 65 ------
NM_004205chr111518 ------
NM_004209chr1621172 468 ------
NM_004215chr82409 213 ------
NM_004219chr5152 ------
NM_004225chr841384 995 609 600 ------
NM_004228chr19----1132 --
NM_004229chrX82170 1734 1713 1544 693 670 321 153 21927 790 31533 1520 875 --
NM_004231chr72266 71 ------
NM_004232chr18163522 3475 3381 3207 3179 2899 2772 2457 1177 1063 980 931 912 628 598 189 13569 33724 760 654 --
NM_004236chr154501 478 429 374 ------
NM_004238chr22218 60 ------
NM_004239chr14------1126
NM_004240chr191229 186 ----
NM_004242chr61322 ------
NM_004251chrX1235 ------
NM_004252chr171135 ------
NM_004253chr92951 671 ------
NM_004261chr121021 785 1379 11024 --
NM_004263chr241124 487 343 222 31352 152 111 11624 --
NM_004267chr31557 ------
NM_004268chr111967 ----1306
NM_004272chr551397 1280 1263 778 648 31888 1676 1640 --11816
NM_004273chr1053744 3483 3226 1388 54 --31870 1561 736 --
NM_004274chr14113188 2903 2889 2534 1173 1039 848 547 317 216 175 22461 234 12537 --
NM_004277chr651483 1226 646 579 246 21132 172 2476 152 --
NM_004279chr71173 1868 2704 350 1181
NM_004281chr102406 173 ------
NM_004282chr62670 652 --181 --
NM_004283chr19--2740 319 ----
NM_004285chr1136417 5854 5377 5248 4636 1988 1810 1729 1587 1461 1384 783 686 15628 11696 11558
NM_004288chr23768 384 298 1274 1978 --
NM_004290chr551247 1034 521 506 297 21012 361 21125 1072 --
NM_004293chr983792 3705 2701 2688 1342 1094 979 121 22404 2336 21113 627 --
NM_004295chr1721090 1068 11294 ----
NM_004296chr1453970 2975 2729 1505 513 1636 23986 242 --
NM_004299chrX296 21 ------
NM_004302chr1272938 2601 2282 2166 665 191 92 --12188 --
NM_004305chr2166 ------
NM_004308chr114601 419 215 187 --2190 32 --
NM_004311chr1063039 2781 2756 1979 1200 612 2180 76 ----
NM_004313chr171369 1425 1418 --
NM_004316chr1221105 254 ------
NM_004319chr182491 2474 2467 2214 2006 697 555 235 1726 --11087
NM_004323chr9122588 2549 2492 2301 2256 2169 2086 2070 206 193 162 61 --3380 297 238 12019
NM_004326chr161115 992 965 758 457 367 --41029 407 371 326 --
NM_004329chr1041257 954 345 198 ------
NM_004330chr153926 438 59 ------
NM_004331chr892124 2088 1752 1688 902 890 866 729 264 1753 11831 --
NM_004337chr892261 1979 1948 1912 1839 1632 1502 897 258 --21982 86 21916 1561
NM_004338chr1895632 5621 5291 4967 4698 4522 2515 446 134 2872 141 17035 --
NM_004341chr22235 26 ------
NM_004342chr762307 1982 1618 644 410 254 --12133 --
NM_004343chr19176 1215 ----
NM_004349chr851266 1127 1078 421 229 ------
NM_004354chr44826 614 576 236 ------
NM_004360chr1641950 1641 329 99 21489 1447 11953 --
NM_004369chr24509 216 199 66 ----1517
NM_004370chr631840 1511 646 32180 1490 60 --21447 835
NM_004371chr12140 114 ------
NM_004379chr241243 104 98 86 ------
NM_004380chr1682519 2412 726 493 288 236 201 76 ----1649
NM_004384chr571881 1579 557 409 179 161 72 --12263 --
NM_004385chr53683 251 243 1500 2720 667 --
NM_004389chr23730 567 31 ------
NM_004392chr13122647 2576 2484 1870 1817 1668 929 693 554 325 168 129 --1516 --
NM_004393chr371787 1578 1503 1460 401 365 158 12024 12364 --
NM_004395chr53701 528 179 ------
NM_004397chr11114169 3777 2994 2808 2748 1670 674 547 533 137 78 13759 31545 1012 263 --
NM_004405chr22995 400 1234 ----
NM_004407chr42877 721 ----1920
NM_004408chr91518 ------
NM_004411chr73706 581 218 ------
NM_004414chr2121230 300 --1304 11368
NM_004415chr63595 308 279 --2612 598 --
NM_004419chr1021018 972 ------
NM_004420chr1142339 1940 1555 1530 11768 3613 459 393 --
NM_004423chr382242 2141 1095 840 768 666 370 267 32703 2231 2147 ----
NM_004426chr1291634 1232 709 684 645 537 498 426 194 --21580 197 --
NM_004427chr15975 477 421 298 180 11141 11023 --
NM_004428chr11548 --2802 760 --
NM_004429chrX61463 1449 1370 940 566 544 --11034 --
NM_004430chr831852 1698 1045 --12070 1801
NM_004431chr12845 110 ------
NM_004432chr962389 2194 1888 842 307 88 1636 12408 31714 414 259
NM_004433chr141292 680 524 407 ------
NM_004434chr142296 78 ------
NM_004437chr1153330 3267 3238 2921 2469 2426 2298 1406 1048 1029 986 919 653 310 203 13390 1667 --
NM_004438chr253199 3168 3148 1129 352 --2676 240 --
NM_004440chr631972 1663 573 --11622 --
NM_004441chr371195 1079 1066 863 813 405 384 ------
NM_004442chr151588 1117 1065 594 357 --1588 --
NM_004447chr1241168 872 228 95 ----1458
NM_004449chr21----1936 --
NM_004454chr372172 1966 1933 1609 661 248 140 --12150 --
NM_004457chr241631 1593 608 190 ----1257
NM_004458chrX62573 2308 2302 843 774 467 1939 11988 12396
NM_004459chr1772034 1899 1595 1510 799 549 457 ------
NM_004464chr4144298 4250 3470 3221 3092 3083 2950 1533 1005 892 657 460 429 33 11142 1187 1312
NM_004468chr1161 ------
NM_004472chr53596 439 54 ------
NM_004474chr14686 653 383 239 --1925 --
NM_004480chr143691 674 260 1705 ----
NM_004481chr172676 2409 1818 978 649 583 504 --12457 12100
NM_004482chr26911 777 672 175 127 39 ------
NM_004484chrX3333 305 83 ----1353
NM_004485chr1103863 3856 3742 3228 2935 2894 2751 862 535 150 --34378 3815 2806 23827 33
NM_004491chr1933592 3062 827 34243 3967 44 24089 3899 --
NM_004496chr1421193 1153 ------
NM_004497chr193681 589 539 ----1593
NM_004500chr1471718 1674 1282 776 571 335 41 --11587 --
NM_004501chr1104086 3299 1164 1149 993 900 560 491 151 65 1537 14089 12896
NM_004502chr171388 ------
NM_004503chr122634 601 ------
NM_004504chr2102987 2483 2192 2044 1925 1895 1056 926 538 296 23052 999 22197 857 11907
NM_004505chr1731683 1326 552 ------
NM_004506chr63498 256 143 ------
NM_004514chr1762953 2431 2164 806 440 21 --1837 11929
NM_004520chr53756 745 276 1508 1759 --
NM_004523chr1061290 1232 1162 570 545 223 --31510 1356 452 --
NM_004525chr231343 1093 212 ------
NM_004528chr1173 ------
NM_004529chr951110 966 342 235 164 --11150 --
NM_004535chr2021472 1366 --1478 1254
NM_004537chr1251447 1362 1210 393 363 11093 1396 11299
NM_004538chrX2735 310 --1738 --
NM_004540chr211777 ------
NM_004549chr1131567 1555 1534 2569 48 ----
NM_004550chr11140 ------
NM_004554chr1421508 373 11691 11770 --
NM_004566chr1072302 1663 1624 854 358 245 36 --22461 2305 11832
NM_004571chr2193400 2737 2619 2313 1286 322 230 156 137 23371 3355 1766 --
NM_004573chr152771 200 --150 --
NM_004575chr431347 1126 50 11465 1522 1585
NM_004576chr51286 --2289 70 --
NM_004577chr72662 548 ------
NM_004578chr12770 90 --2874 225 --
NM_004583chr172748 184 --1726 --
NM_004586chrX105153 5116 4841 4330 3812 3655 1991 1383 501 488 --1358 11204
NM_004588chr1164024 3452 2922 2890 2644 2596 --1920 --
NM_004592chr122243 200 1155 ----
NM_004598chr5103325 3279 3104 3020 1076 1001 938 789 422 271 --1871 11107
NM_004599chr223514 454 44 ------
NM_004600chr161505 1493 1332 1263 1009 367 1608 --11046
NM_004602chr2061298 1155 973 599 561 503 184 ----
NM_004612chr9214613 4549 4532 4459 4097 4074 4043 3524 3497 3244 1583 1486 1467 1278 1174 1089 1024 593 213 193 33 --34050 764 161 --
NM_004615chrX4800 787 670 168 166 ----
NM_004617chr36549 425 362 139 70 52 ------
NM_004622chr271712 1564 553 523 372 288 117 1707 ----
NM_004626chr113526 475 456 --1529 --
NM_004627chr212511 177 ------
NM_004630chr1131103 746 252 --31210 1132 244 --
NM_004631chr131229 1033 206 11013 ----
NM_004634chr33572 101 44 ------
NM_004635chr34944 848 182 93 ------
NM_004637chr32986 345 --11209 --
NM_004639chr61100 --188 --
NM_004640chr6--1153 ----
NM_004643chr142582 548 --2572 553 --
NM_004645chr173284 278 188 --1750 --
NM_004651chrX3337 80 47 ------
NM_004654chrY2476 439 --165 --
NM_004657chr251129 1023 426 341 221 1280 ----
NM_004660chrY22164 2082 ----21955 1779
NM_004663chr1571454 1164 1087 1053 1011 616 413 --1605 --
NM_004664chr121266 ------
NM_004670chr1061459 1370 625 457 262 50 239 27 --11189
NM_004671chr183129 78 49 ------
NM_004673chr131143 1114 252 --11442 --
NM_004681chrY1153 1108 --136
NM_004685chr1362022 1976 1106 866 556 508 ------
NM_004686chr851534 677 612 412 378 --21608 1561 1616
NM_004687chr1741587 842 742 540 11744 ----
NM_004694chr172706 296 ------
NM_004696chr11764 --2840 797 --
NM_004697chr921062 387 --198 --
NM_004701chr153161 122 46 ------
NM_004703chr1752344 2024 1976 1829 955 11763 2725 362 --
NM_004705chr113723 235 91 --1726 1332
NM_004709chrX51569 1254 256 226 179 ----11299
NM_004710chr171778 --1385 --
NM_004711chr2223418 3235 ------
NM_004713chr143750 551 260 ------
NM_004714chr191225 ------
NM_004715chr182691 651 ------
NM_004716chr114877 856 785 36 --1891 --
NM_004717chr751554 1337 1175 571 434 ------
NM_004719chr1282906 2894 2713 2137 1896 1096 722 644 12566 ----
NM_004723chr131028 691 683 1781 ----
NM_004724chr111484 1382 --180
NM_004725chr1071500 1387 1245 1202 1116 396 347 11056 21330 1323 1499
NM_004726chrX165303 4853 4814 4331 4297 4004 3837 3712 3485 1674 1659 622 568 346 142 54 --25170 1087 --
NM_004730chr572121 2003 1987 1603 1468 539 528 ------
NM_004733chr32547 155 --1238 --
NM_004734chr13103116 3080 2958 2768 2716 2285 2158 1044 650 252 --22307 600 12291
NM_004736chr181840 782 621 559 452 203 173 29 --21404 790 11932
NM_004737chr2241207 903 185 124 ------
NM_004738chr2032556 839 744 22433 2127 1910 --
NM_004739chr112658 454 ------
NM_004742chr341866 1810 1651 1623 1187 31568 1376 1250 11545
NM_004744chr4103880 3764 3756 3683 3586 2974 1045 933 449 315 22764 181 32818 2689 1578 --
NM_004745chr8146961 6667 6514 6491 5452 5129 4397 2664 1967 1291 1112 859 828 81 14515 25640 4431 16001
NM_004747chr1071646 1503 1422 1349 332 269 66 11267 21579 1284 --
NM_004748chr15134179 3976 3796 3383 2900 2840 2745 2572 1360 1312 1246 1236 252 2634 469 12846 --
NM_004757chr42622 275 ------
NM_004759chr162063 1821 454 401 355 292 ------
NM_004760chr7102433 2217 1975 1610 965 742 624 567 535 312 11797 ----
NM_004768chr111069 11155 ----
NM_004772chr531358 1275 1112 --179 --
NM_004774chr1772682 2154 2145 1998 1118 865 335 --23049 217 13180
NM_004775chr1862361 2178 1560 652 166 104 --12022 21478 108
NM_004776chr20102747 2411 2132 1211 1123 1024 658 494 485 235 22958 1150 21224 528 --
NM_004779chr571340 1081 905 889 357 246 92 1385 --1503
NM_004781chr141621 1493 1277 1122 ----1461
NM_004781chr141621 1493 1277 1122 ----1461
NM_004787chr4126 --1150 --
NM_004788chr11102055 1907 1850 909 719 351 99 90 74 67 --21895 498 --
NM_004789chr93373 359 32 --1376 --
NM_004791chr132728 120 1128 138 --
NM_004794chrX147 ------
NM_004795chr1341949 338 249 209 --1371 11511
NM_004796chr1482383 2299 2206 1899 1840 1697 1668 64 --1440 --
NM_004797chr3113575 3267 3228 3212 3194 3122 3004 2859 2753 1246 459 12523 33140 2422 2263 1743
NM_004798chr20153619 3534 3412 3101 2574 2564 2445 921 716 635 429 360 348 333 129 13165 --2931 693
NM_004799chr11429 --125 --
NM_004801chr251594 1568 1160 1054 592 ------
NM_004805chr21323 11192 11414 --
NM_004807chr221834 622 1913 ----
NM_004815chr174381 4367 4155 3893 1664 1294 442 34587 3465 417 21571 1120 11471
NM_004817chr91604 ------
NM_004820chr83350 79 69 ------
NM_004821chr55745 618 609 586 539 --1595 1829
NM_004822chr1793903 3766 3213 3086 3052 2446 1507 1347 765 12567 ----
NM_004824chr63986 485 301 --2304 206 --
NM_004831chr194770 695 444 159 --1438 --
NM_004834chr2103102 3072 3046 2845 1352 1326 501 196 186 140 22350 333 2702 658 --
NM_004835chr32169 145 ------
NM_004835chr32169 145 ------
NM_004836chr22957 215 --1222 --
NM_004837chr111097 11556 11328 --
NM_004839chr152621 455 2637 502 2539 181 --
NM_004840chrX52406 848 818 144 138 11659 32372 397 88 --
NM_004841chr131045 796 743 11020 ----
NM_004842chr641615 669 571 28 --1103 --
NM_004844chr351150 984 907 356 350 --1829 --
NM_004845chrX183925 3715 3379 2955 2948 2926 2893 2880 2870 2857 2837 2827 2803 2660 1441 1317 1118 159 1885 12942 --
NM_004856chr15--1572 ----
NM_004857chr14124696 4136 3233 3108 2916 2909 1472 1225 1200 1058 1023 51 13310 24644 4083 --
NM_004859chr1742404 264 249 127 --1698 --
NM_004860chr171394 ------
NM_004863chr14165315 5197 5189 5137 5122 4619 4098 3762 3604 3341 1307 1263 1136 970 626 309 ----11219
NM_004866chr5104980 4521 4015 3313 3168 1650 709 543 345 46 --24586 3176 13367
NM_004867chrX4594 505 457 232 1259 --1236
NM_004869chr1851697 586 339 318 38 --21597 564 --
NM_004871chr17124103 3837 3734 3436 3285 3113 2979 2957 999 883 388 192 23137 1559 53599 3092 293 206 179 14381
NM_004873chr1483150 3066 2933 2454 2293 1046 930 542 11278 11196 12269
NM_004879chr114648 303 253 156 1134 1241 --
NM_004884chr1531652 417 291 --11271 11287
NM_004887chr531132 883 120 1718 ----
NM_004888chr931032 882 296 --1434 1345
NM_004891chr21214 ------
NM_004893chr52417 400 ------
NM_004895chr12591 502 ------
NM_004896chr1031290 402 343 1613 --1210
NM_004897chr105926 829 144 114 27 --1840 --
NM_004898chr452754 2728 1997 1159 536 --22676 1951 --
NM_004902chr205835 721 290 212 38 --1565 --
NM_004904chr7226093 5863 5092 5042 4718 4710 4439 4323 4236 2576 2442 2408 2244 1962 1790 1339 1150 627 607 507 232 59 25142 1285 56299 4735 4648 279 243 --
NM_004905chr14896 273 179 169 ------
NM_004906chr63559 150 135 --1138 --
NM_004922chr1041004 844 145 111 ------
NM_004923chr11--1150 1530 1180
NM_004924chr1961044 1035 927 832 168 103 --1875 --
NM_004926chr1441780 1491 1259 677 --11787 --
NM_004929chr831150 143 83 1334 --21370 1246
NM_004930chr11219 --2607 70 --
NM_004932chr541691 1414 156 59 --31751 533 92 --
NM_004937chr1751971 927 536 345 242 22058 594 --1510
NM_004941chr172460 120 ------
NM_004947chr362386 2220 1851 1603 686 252 1706 11691 --
NM_004953chr3------1314
NM_004955chr63615 462 98 1587 ----
NM_004956chr7104249 3683 3103 2854 2788 1839 1135 461 87 76 21597 634 21124 48 --
NM_004958chr1------136
NM_004961chrX51365 1297 1201 551 157 --1573 --
NM_004964chr12559 75 --184 --
NM_004969chr101230 192 ----
NM_004972chr95903 822 799 457 169 ------
NM_004973chr651257 1159 1065 117 93 --21395 552 --
NM_004975chr203774 323 244 --21002 82 --
NM_004976chr11125195 4188 3593 3568 3558 3537 3463 3411 3264 1579 1518 1352 44240 3961 1374 316 11457 --
NM_004978chr131601 1347 510 --1495 --
NM_004981chr223429 394 290 ------
NM_004982chr123763 267 150 1631 1766 --
NM_004985chr12144324 3933 3701 3685 3109 2962 2886 2751 1339 894 602 300 255 21 23082 911 12965 --
NM_004992chrX177687 7240 7075 7008 6729 6254 5707 5168 3058 1306 1265 1234 1216 506 251 189 124 15588 58376 7019 6989 5428 2052 16639
NM_004992chrX177687 7240 7075 7008 6729 6254 5707 5168 3058 1306 1265 1234 1216 506 251 189 124 15588 58376 7019 6989 5428 2052 16639
NM_004993chr14101244 1016 990 603 551 538 362 297 245 233 11318 2569 369 1555
NM_004995chr1431491 484 127 ------
NM_004996chr1671788 1680 1633 1513 1464 1210 540 21311 428 ----
NM_004999chr6164471 4388 4273 4256 3692 3135 1593 1384 1293 1062 925 834 695 657 313 234 --41229 1065 660 197 13656
NM_005006chr23794 787 360 --183 --
NM_005010chr752263 1737 465 447 33 --1107 --
NM_005011chr741619 1608 256 29 21860 1428 21623 187 --
NM_005016chr122362 32 172 2365 259 --
NM_005017chr3259 34 ------
NM_005020chr73554 521 194 ------
NM_005023chr531385 616 186 ----1464
NM_005026chr151896 1777 1750 1704 551 12022 ----
NM_005028chr1052272 2118 1753 826 776 1205 ----
NM_005040chr117481 359 333 197 90 71 31 ------
NM_005044chrX64271 3416 3262 2845 1353 122 --64276 4087 3904 3783 3446 125 12924
NM_005045chr74846 675 58 26 --1865 --
NM_005054chr261733 1722 1411 1310 1280 114 21316 1272 1316 --
NM_005056chr12155283 5020 4540 4366 2191 2179 2161 1746 1549 1398 891 771 419 393 31 35141 4513 1410 44185 1807 1586 452 12195
NM_005057chr131796 1692 25 1402 --11169
NM_005063chr10163242 3128 2951 1474 1421 961 951 826 813 796 677 364 341 303 202 133 --23740 3276 --
NM_005065chr14135342 5274 5254 4986 4810 4285 2163 1975 1401 1193 980 945 252 34277 3762 1134 2691 258 --
NM_005066chr12218 209 ------
NM_005067chr3----1974 --
NM_005068chr641373 1219 442 26 138 21410 533 1446
NM_005076chr174159 3609 3145 2966 1377 1051 198 13255 33801 3612 2686 12671
NM_005078chr1551744 1470 415 334 316 ------
NM_005079chr872671 2616 2044 1049 469 424 393 1386 ----
NM_005080chr223737 726 302 ------
NM_005087chr32335 30 ------
NM_005093chr2084100 3790 3343 1255 1167 799 710 164 23326 1713 25239 202 1803
NM_005094chr92263 185 ------
NM_005095chr122182 1498 11683 3808 650 201 --
NM_005096chrX51081 1013 440 258 144 11258 1418 --
NM_005097chr102350 36 --1223 --
NM_005099chr12136 26 11297 ----
NM_005102chr23796 237 154 ------
NM_005104chr61555 ------
NM_005105chr16771 553 273 266 158 28 ------
NM_005109chr372563 2043 1970 1702 1014 481 53 12261 31909 1788 484 --
NM_005110chr52637 523 --1183 1559
NM_005112chr461034 863 412 149 82 75 ------
NM_005113chr142508 39 182 ----
NM_005114chr42438 170 ------
NM_005116chr20104474 4436 4355 4101 3525 3062 1732 765 685 375 14279 1144 --
NM_005119chr151000 990 838 448 254 --11003 --
NM_005120chrX----1228 --
NM_005121chr1783690 3424 2891 2793 2384 1409 1364 440 --12596 --
NM_005124chr64682 324 140 114 ----1873
NM_005126chr351949 691 670 640 131 ------
NM_005128chr212653 611 --1614 --
NM_005133chr112372 284 ------
NM_005134chr182910 846 ------
NM_005135chr15113873 3807 3592 2700 1258 1078 822 742 660 514 34 --12396 --
NM_005141chr42170 71 ------
NM_005151chr1831577 314 189 32215 841 631 2955 901 11951
NM_005153chr161751 1256 ----
NM_005154chr151502 --1568 --
NM_005155chr62440 259 ----1649
NM_005156chr9205244 4709 4307 4099 3785 3643 3578 3572 3452 1965 1930 1595 1444 1416 1145 959 599 584 509 194 24745 3287 33371 1447 1152 1588
NM_005157chr951911 1819 1624 368 219 --11925 11567
NM_005159chr1572282 2142 2005 1900 894 596 435 --11660 2790 581
NM_005160chr22196516 6439 6405 5939 5635 5475 4941 4376 4241 2306 2028 1571 1381 1148 533 449 406 397 208 76201 5309 5253 5042 4365 2234 769 46794 5507 4944 215 1506
NM_005168chr291786 1759 1616 1494 1373 1312 1240 496 473 ------
NM_005171chr122420 263 ------
NM_005178chr191404 ------
NM_005180chr1041551 270 239 115 --31220 545 242 --
NM_005181chr83735 689 218 --2738 336 --
NM_005184chr19134 --11288 --
NM_005188chr11278356 7833 7615 7317 6033 5454 5439 3281 3230 3141 3076 2788 2782 2651 2203 2164 1919 1770 1750 1555 1409 1322 1139 1047 714 613 118 35208 2335 1669 67085 5977 5932 5693 2588 2261 --
NM_005189chr1752521 2326 1623 1583 244 ------
NM_005190chr641010 357 152 105 ------
NM_005197chr14216179 5378 4990 4861 4473 4456 4407 4374 4339 4011 3845 2176 1738 1485 1474 1454 1445 1188 756 124 97 35746 5244 1240 75921 5912 3858 1716 1477 988 172 --
NM_005201chr321121 35 ------
NM_005202chr142264 927 197 173 ------
NM_005206chr1741296 895 414 207 ------
NM_005207chr2273483 3382 495 420 221 118 75 13509 33665 1223 423 --
NM_005214chr21204 11049 ----
NM_005219chr571663 731 482 399 337 291 131 --31349 1123 414 --
NM_005220chr1711458 ------
NM_005222chr710962 908 631 388 271 257 232 205 175 142 ------
NM_005229chrX21253 400 --2209 202 --
NM_005233chr392414 2299 2183 2018 773 669 645 510 433 ------
NM_005235chr2277582 7574 7359 7279 7031 6605 6579 6476 6163 6044 5975 5626 5142 5040 2926 2913 2376 2082 1427 1111 893 550 535 493 357 344 318 35585 5446 5382 55756 965 337 225 69 45019 2671 1747 1117
NM_005238chr1172656 2578 2173 1374 1164 1038 605 21255 935 ----
NM_005239chr2151762 1390 1304 769 357 1401 ----
NM_005241chr351264 1067 946 454 389 ------
NM_005244chr201630 ----1513
NM_005245chr4----172 --
NM_005249chr142708 111 ------
NM_005252chr143698 539 303 --1495 --
NM_005254chr1551346 1227 1186 466 300 1955 --1496
NM_005256chr111795 ------
NM_005257chr1831192 885 456 ------
NM_005259chr221416 345 ------
NM_005261chr81988 ------
NM_005264chr102949 68 ------
NM_005268chr11228 ------
NM_005271chr102862 94 --1365 --
NM_005275chr6139 ------
NM_005277chr471803 1693 1606 1466 1287 620 204 --1148 11645
NM_005278chrX184 --1563 --
NM_005279chr22809 120 --1254 --
NM_005281chr1171 1346 ----
NM_005302chr72463 299 ------
NM_005308chr101347 --1417 --
NM_005311chr7122782 2618 2608 2570 2515 2389 2376 1962 1789 1746 1146 711 --32576 1968 411 --
NM_005313chr1551121 936 362 272 146 ------
NM_005316chr112956 789 11058 1423 1793
NM_005318chr2271264 1164 895 852 416 71 61 --148 1420
NM_005324chr1741701 1302 631 255 ------
NM_005327chr45578 318 231 221 82 ------
NM_005328chr84786 734 699 555 --2569 231 --
NM_005329chr1652130 1975 1791 796 534 ------
NM_005336chr231966 1889 906 ------
NM_005339chr4144068 3538 3425 3362 2962 1430 1324 1166 1122 922 813 774 224 89 11135 23900 665 1926
NM_005342chrX72597 1881 958 864 572 327 318 22404 885 12825 12544
NM_005347chr951446 1183 682 311 181 11703 ----
NM_005348chr143898 144 76 ------
NM_005349chr42606 483 ------
NM_005359chr18206472 5435 5355 5056 5007 4438 4370 4362 4182 4163 2493 2465 2390 2085 1952 1893 1873 1775 1353 824 34390 4376 4312 25237 4994 --
NM_005369chrX4671 602 476 152 --2648 594 --
NM_005370chr1951210 1146 1138 859 525 1917 ----
NM_005373chr131682 474 236 31233 498 247 21465 57 --
NM_005375chr62902 389 ------
NM_005378chr22558 327 ------
NM_005382chr81170 ------
NM_005385chr372500 2417 1836 898 693 339 240 1670 22052 1937 1548
NM_005386chr20------1700
NM_005387chr113714 236 183 --2587 262 --
NM_005388chr961305 691 676 400 337 255 --1100 --
NM_005392chr971726 1354 1212 618 560 490 204 ------
NM_005398chr1041411 1155 498 479 1974 11032 --
NM_005399chr1164000 3781 3624 3559 3337 3102 2789 2767 1614 1328 1080 897 486 472 267 55 --24004 1284 --
NM_005400chr2112975 2761 2675 2669 2245 1962 1217 956 659 415 326 --11003 12643
NM_005402chr741418 1376 1163 1153 --11157 --
NM_005406chr1831539 1095 61 11583 1136 193
NM_005407chr1471338 1154 424 387 198 98 29 --3239 215 137 --
NM_005409chr441101 1075 415 112 --11005 --
NM_005410chr53593 308 245 ------
NM_005412chr123495 224 173 1502 ----
NM_005414chr3----1204 --
NM_005415chr23681 671 267 ----1562
NM_005426chr13340 280 42 ------
NM_005429chr43288 242 32 ------
NM_005433chr1862260 529 487 313 92 63 --12118 1694
NM_005436chr1093471 3447 3228 2809 2789 1186 888 818 703 14105 53836 3536 3450 538 79 --
NM_005437chr10101455 1118 1104 1032 435 420 272 89 81 31 ----11236
NM_005439chr122376 187 --1510 --
NM_005443chr44553 474 440 66 --180 --
NM_005445chr101265 ------
NM_005450chr171161 ------
NM_005455chr131671 1433 1223 1747 21536 1198 --
NM_005458chr932286 1789 1703 22317 967 32188 1883 1558 11533
NM_005460chr54494 149 135 98 --1512 --
NM_005461chr2061962 1572 1474 1451 695 286 1357 21595 748 --
NM_005465chr122044 1554 --11561 --
NM_005471chr571323 1254 1181 498 327 87 52 ------
NM_005474chr1771615 1453 1264 1119 543 526 55 ------
NM_005475chr1242891 2498 592 339 --12052 --
NM_005476chr9129 21143 200 21187 260 --
NM_005477chr1562429 806 743 512 33 26 ------
NM_005477chr1562429 806 743 512 33 26 ------
NM_005479chr102602 518 ----11591
NM_005487chr2221528 252 --11450 --
NM_005493chr62770 164 --1311 --
NM_005494chr74603 500 473 231 ------
NM_005497chr1774125 2433 1573 1429 981 771 608 1626 35821 1206 984 --
NM_005501chr17----11171 --
NM_005502chr9103055 2950 2799 2567 2553 2485 1241 1155 1101 973 ------
NM_005504chr12226620 6573 6277 6180 5867 5189 4752 4552 4493 4419 4376 4370 4274 2248 1950 1807 1707 1478 688 545 451 327 --2781 92 11482
NM_005509chr551194 431 310 282 77 ----11220
NM_005512chr1142037 1526 1285 1266 21966 581 1135 --
NM_005520chr52206 177 ------
NM_005521chr10----1808 --
NM_005522chr731256 556 86 --1228 --
NM_005524chr31278 ------
NM_005530chr1541218 385 313 131 ------
NM_005539chr1021107 486 ------
NM_005542chr751926 1710 1431 1402 85 ----11574
NM_005544chr21974 ------
NM_005545chr15--1722 --1510
NM_005546chr572235 2095 2050 1991 952 803 238 ------
NM_005552chr144533 206 149 88 ------
NM_005558chr13713 407 252 ------
NM_005561chr1321004 87 5398 346 321 296 270 150 1372
NM_005562chr131219 1095 680 11520 11309 1369
NM_005563chr15673 341 249 234 200 --1579 --
NM_005570chr1831128 220 103 ------
NM_005573chr53663 603 289 ------
NM_005574chr113485 479 23 ------
NM_005575chr55704 551 257 179 118 ----2561 169
NM_005576chr152298 196 ------
NM_005578chr3235110 5032 4967 4820 4671 4511 3742 3399 3370 3347 1952 1938 1793 1663 1272 991 951 806 712 487 457 330 97 22049 1961 13434 13417
NM_005584chr131230 1595 ----
NM_005585chr151289 ------
NM_005587chr151760 ------
NM_005593chr124508 433 201 107 --1212 --
NM_005595chr12868 829 ------
NM_005596chr9155951 5744 5705 5525 5180 5081 4952 4932 4777 4579 2460 2333 1773 811 620 --26263 2514 15920
NM_005599chr161467 1098 999 532 432 154 --21363 1221 --
NM_005604chr662369 2293 946 574 492 102 --22402 2282 22176 822
NM_005607chr84918 714 249 48 ------
NM_005610chr16942 284 226 213 155 42 ------
NM_005613chr191809 1785 1698 1595 1363 866 657 651 497 --11859 2870 231
NM_005625chr831056 787 256 --151 1985
NM_005626chr11204 1210 ----
NM_005627chr61116 1235 --1365
NM_005637chr1831929 1539 1412 --11619 --
NM_005638chrX51520 1479 1225 1197 162 --1249 --
NM_005639chr122214 21 ------
NM_005647chrX63303 2749 2357 843 534 132 23388 2227 23143 547 --
NM_005650chr2221158 1089 ------
NM_005652chr162393 75 --21254 1091 --
NM_005655chr841303 1091 489 474 11222 ----
NM_005657chr151159 ------
NM_005659chr223420 388 363 ------
NM_005662chr82386 367 ------
NM_005664chr153780 247 119 --1978 --
NM_005665chr1134928 4789 4715 4335 4205 3566 3417 3338 3289 3104 829 350 175 24426 3467 11782 13570
NM_005668chr5104566 4161 3495 3438 3202 2846 1717 1168 1122 34 1582 34391 1689 1573 21383 39
NM_005671chr82466 411 ------
NM_005682chr1631338 1321 1034 ------
NM_005686chr141466 1451 1426 494 ----11580
NM_005688chr32485 29 --1516 --
NM_005704chr11950 11133 ----
NM_005708chr133336 111 62 ------
NM_005711chr53438 312 248 --11028 --
NM_005715chr652351 2246 1968 203 191 22593 745 32249 1786 52 --
NM_005717chr141247 1019 850 103 ------
NM_005719chr12----1194 --
NM_005721chr261072 880 857 798 253 197 155 11075 --
NM_005722chr262362 1556 971 684 103 41 164 ----
NM_005724chr151177 ------
NM_005725chr172468 2350 1871 1828 1631 1585 228 11892 --1815
NM_005730chr12123408 3366 3295 3285 2709 2628 1238 791 769 728 645 541 32746 828 496 23065 981 --
NM_005731chr22354 270 ------
NM_005734chr111188 ------
NM_005736chr1021540 1059 130 11062 11038
NM_005737chr2102897 2852 2763 2555 2262 2255 2054 1854 1065 158 12592 22880 2819 --
NM_005738chr761910 1783 547 523 509 39 --142 --
NM_005739chr1592408 2325 2286 2194 1738 897 868 343 173 11528 32411 2289 377 --
NM_005740chr225835 826 815 122 111 ------
NM_005742chr25623 531 273 78 31 1279 ----
NM_005746chr772695 2456 2226 2147 1818 825 138 --12074 --
NM_005748chr12113478 3350 2589 2546 2296 1256 887 599 458 317 207 --32549 2299 755 --
NM_005749chr171746 --1569 --
NM_005751chr72348 66 ------
NM_005754chr551250 1187 1169 1140 390 1816 --21011 471
NM_005756chrX81491 1471 1459 1439 1378 1077 1032 464 2328 198 --11476
NM_005759chr2164549 3996 3889 3856 3628 3592 3572 3515 3078 1864 1393 1041 621 560 446 188 13727 ----
NM_005765chrX2156 128 ------
NM_005766chr1361278 1221 976 367 349 226 ----1549
NM_005768chr122670 573 ------
NM_005778chr31394 ------
NM_005779chr5143679 3295 3145 2925 2744 2653 2504 1427 796 725 441 393 362 25 --1320 --
NM_005782chr171107 ------
NM_005783chr22633 226 --2158 38 --
NM_005786chr1881266 1028 990 417 184 159 127 113 --1965 --
NM_005789chr1792043 1916 1613 1331 462 436 340 241 117 11312 ----
NM_005796chr161398 ------
NM_005797chr1171548 1302 1118 727 575 384 76 1479 179 --
NM_005798chr13145184 5158 4549 4413 4083 3747 3677 3328 3295 1634 927 875 818 26 11619 25025 1298 --
NM_005808chr383459 3031 2712 1278 797 515 439 234 21369 764 43391 2821 2624 1049 --
NM_005813chr2112669 2224 2193 1692 990 919 780 588 545 312 259 --172 --
NM_005819chr1133455 3426 3179 3129 2848 2207 1362 1082 1036 924 372 359 128 --23429 2998 --
NM_005822chr662123 818 371 275 269 238 ------
NM_005826chr11449 ----1601
NM_005828chr17154831 4693 4238 3742 3414 1969 1723 1604 1396 922 579 566 443 354 232 --35060 1069 545 --
NM_005832chr381107 1051 935 495 424 257 232 50 ------
NM_005834chrX1179 ------
NM_005839chr14701 369 357 192 ------
NM_005840chrX267451 7205 6965 6897 6637 6522 6274 6188 6001 5813 5608 4890 4739 4716 3008 1713 1594 1077 913 679 601 564 481 177 71 31 17486 42449 2407 622 374 26579 2497
NM_005842chr133586 121 41 ------
NM_005843chr251937 1509 1323 573 265 --1702 21540 1237
NM_005850chr12163 46 ------
NM_005852chr1731172 1048 140 ------
NM_005853chr16129 ------
NM_005857chr161145 948 917 565 370 43 31157 229 34 ----
NM_005859chr52522 183 ----11141
NM_005862chr32938 787 --1272 --
NM_005863chr1051261 281 212 135 67 11285 21424 387 --
NM_005864chr142282 128 --1712 --
NM_005868chr77995 675 611 580 558 506 258 1172 --12347
NM_005871chr104433 184 67 28 ------
NM_005875chr32354 46 ------
NM_005880chr1651228 1062 653 570 33 1614 ----
NM_005882chr45960 733 352 269 100 ------
NM_005884chr192631 542 ------
NM_005885chr52451 59 ------
NM_005895chr1263579 2925 2575 539 306 85 13605 --13478
NM_005896chr26757 641 281 226 156 135 --167 --
NM_005898chr1142754 2582 2249 1243 ----1789
NM_005899chr174974 446 330 299 --1333 --
NM_005900chr441191 816 801 439 --1339 --
NM_005901chr18258579 8245 8173 7988 7305 7191 6309 6288 6195 5939 5910 5678 5639 5368 3120 2940 2869 2847 2453 1793 1784 1659 1582 1164 647 37699 5989 2666 88367 6419 6134 5710 2809 2635 549 456 38249 7451 1597
NM_005902chr1584509 3675 3261 1429 1081 1072 1009 333 21655 457 11492 1148
NM_005903chr5165230 4994 4473 4402 4304 4119 4085 3665 3654 2094 2031 1977 1790 1626 581 117 13267 74750 4219 3844 2040 1894 1004 432 14477
NM_005904chr1871473 1441 1136 1044 412 137 104 1180 ----
NM_005907chr661662 1561 1282 1249 661 250 --165 --
NM_005909chr5103584 3376 2712 1707 1186 607 542 523 248 73 --13907 13780
NM_005910chr17104063 3983 3885 3787 3527 2820 1479 1077 1011 306 ------
NM_005911chr231180 1089 530 1997 ----
NM_005917chr2--157 ----
NM_005920chr1113767 3586 3408 3319 2972 2947 1222 845 739 532 231 13916 12906 --
NM_005922chr62483 33 ------
NM_005924chr721129 929 ------
NM_005927chr53898 490 295 2831 180 ----
NM_005933chr1162246 2196 2131 2069 768 725 --12072 --
NM_005934chr1972575 2379 1724 668 601 545 235 1368 11835 11024
NM_005935chr4165275 4921 4351 4238 3851 3825 3775 3712 3674 3268 2092 1526 1456 1383 563 471 13414 35218 1782 1084 14710
NM_005937chr1794161 4108 4019 3529 2784 1515 1485 947 505 --21503 1115 11646
NM_005938chrX1221 ------
NM_005940chr223771 726 78 ------
NM_005941chr8104197 1342 1314 825 442 434 426 418 375 24 33878 948 557 21232 232 13968
NM_005943chr621137 58 --11068 --
NM_005952chr161110 ------
NM_005953chr161103 ------
NM_005955chr1135155 4966 4864 3625 3394 2155 1850 1045 902 887 767 376 137 34535 3906 3372 23932 181 11632
NM_005962chr1062010 1965 823 637 326 275 ----11834
NM_005962chr1062010 1965 823 637 326 275 ----11834
NM_005964chr1721449 382 ------
NM_005966chr21953 --22424 25 --
NM_005967chr122689 484 ------
NM_005968chr19153 ------
NM_005977chr131322 1695 1830 --
NM_005986chr1392359 2258 2097 2062 2040 804 718 296 242 22291 2083 1299 22301 2262
NM_005990chr572606 2191 2062 1965 1080 480 365 12562 32752 2500 62 11799
NM_005997chr12117 29 ------
NM_005998chr12178 89 ------
NM_006003chr19130 ------
NM_006007chr984481 4466 4458 3315 517 364 312 88 13001 23333 475 192
NM_006011chr15154044 3998 3885 3726 3609 3458 3192 2904 1350 1266 1131 921 359 277 109 12842 1112 --
NM_006012chr192193 184 ------
NM_006015chr141112 1034 200 155 1250 11088 --
NM_006016chr651676 1447 1416 889 518 1294 11589 1709
NM_006022chr1341029 1017 979 346 ------
NM_006024chr73370 198 173 1124 ----
NM_006029chr142718 50 183 ----
NM_006030chr331697 407 379 --11700 --
NM_006033chr1851745 1737 1621 1604 720 1564 21607 595 --
NM_006035chr1411255 ------
NM_006036chr252456 2290 2160 341 177 1790 22417 1831 --
NM_006037chr2204841 4769 4728 4697 4377 3761 3562 3526 3502 3403 3393 3122 2977 1445 1353 504 449 152 41 25 11652 23808 1732 32981 1618 719
NM_006038chr2061880 855 713 341 335 274 11815 11534 --
NM_006039chr171224 --21051 363 --
NM_006040chr1621105 533 ------
NM_006043chr161260 1626 ----
NM_006047chr2093335 2782 2573 2528 1403 1213 1021 493 470 --11216 12851
NM_006048chr111193 ------
NM_006054chr1161506 1464 1311 1056 527 138 ------
NM_006055chr2153088 3056 3018 2807 2575 2431 2416 1237 1161 940 837 752 461 409 43 22725 1195 --1450
NM_006063chr21199 ------
NM_006064chrX2372 112 ------
NM_006067chr1651020 947 742 656 267 ----1951
NM_006076chr73948 919 655 ------
NM_006079chr61698 ------
NM_006080chr752377 2029 932 693 609 --2775 292 1890
NM_006089chrX61820 1710 487 272 222 73 --1589 --
NM_006090chr15766 760 688 582 126 --136 --
NM_006094chr862219 2106 1755 1727 419 320 12349 1947 11491
NM_006095chr4164357 3935 3777 3669 3519 3414 3182 2917 1702 1617 1604 1524 1376 856 555 228 1827 1728 --
NM_006096chr871465 1400 1327 1165 659 459 39 ------
NM_006099chr14826 227 215 147 ------
NM_006100chr31149 ----1247
NM_006106chr11103471 3425 3306 3150 2924 2396 1354 1242 552 238 --23252 1357 --
NM_006107chr173524 492 471 1464 ----
NM_006108chr1152077 1750 1565 572 422 21653 159 ----
NM_006113chr151970 1711 1620 676 107 11418 ----
NM_006122chr1562789 2331 2250 872 789 580 --2877 139 --
NM_006133chr1112472 --1676 --
NM_006134chr2161577 1561 1375 323 162 116 1640 11566 --
NM_006135chr161311 1028 541 231 171 125 --2197 182 --
NM_006136chr771339 516 464 377 237 223 38 --1923 --
NM_006139chr21133 11948 --12572
NM_006141chr1612172 ----176
NM_006145chr194980 875 732 56 --1414 --
NM_006147chr13191 97 27 ------
NM_006148chr17142904 2642 2595 2444 2366 2292 1957 1144 763 314 250 220 138 86 ------
NM_006153chr31231 --2450 234 --
NM_006154chr1562224 1905 984 913 746 362 12150 12391 --
NM_006158chr841680 1327 567 211 ------
NM_006159chr124646 538 44 27 ------
NM_006160chr1731630 210 24 ------
NM_006161chr5--1251 ----
NM_006162chr1821750 1183 ------
NM_006166chr1252588 2544 1806 843 101 11948 --11818
NM_006177chr1411128 1993 3901 191 77 --
NM_006178chr1741561 1392 526 108 --11379 --
NM_006180chr992140 1776 1341 839 310 260 245 214 194 21906 796 ----
NM_006183chr121433 --1138 --
NM_006185chr114656 621 249 89 ------
NM_006186chr251257 1208 1159 819 121 --21162 479 21263 1247
NM_006190chr23999 838 239 ------
NM_006191chr124692 638 311 300 1855 1695 --
NM_006194chr142333 181 11327 ----
NM_006195chr931267 984 439 ------
NM_006196chr23252 66 33 ------
NM_006197chr8102220 2039 1968 1833 1764 1757 839 756 500 224 ------
NM_006202chr1971703 1558 1546 1527 1242 471 147 --1141 --
NM_006203chr5175472 5382 4814 4482 4254 4098 3978 3816 3789 3489 3451 1971 1962 1705 943 674 489 --14428 --
NM_006206chr431795 1113 803 --21928 408 --
NM_006209chr81156 --1440 --
NM_006216chr25519 443 249 153 109 ------
NM_006223chrX3534 65 44 ------
NM_006224chr1752385 2122 912 736 298 1947 1915 --
NM_006226chr231030 887 65 11382 1441 --
NM_006228chr81398 ------
NM_006235chr1181975 1628 1309 1270 495 394 379 351 --31978 1945 1929 11965
NM_006237chr1342131 1894 1640 907 1371 --1157
NM_006241chr392253 1956 1945 1839 1723 904 817 597 323 21848 1731 21998 567 1532
NM_006243chr1----1117 1317
NM_006245chr62862 686 11053 1749 --
NM_006246chr142504 391 --177 --
NM_006251chr593182 2965 2871 2531 2420 1282 965 501 24 --1419 --
NM_006252chr1196372 6235 6227 6090 6022 2997 2861 2692 2231 2144 1869 1479 1257 1060 1010 801 533 53 21 47607 6728 4752 902 47347 7043 2962 915 25924 1585
NM_006256chr132731 2378 75 --12424 --
NM_006258chr102595 264 1601 1194 148
NM_006259chr45693 650 226 100 76 1890 1298 --
NM_006265chr831541 442 117 2412 173 ----
NM_006267chr241788 1755 1193 521 --1686 --
NM_006268chr1131168 244 45 --21038 355 --
NM_006275chr2052383 2135 1908 1744 839 --2972 198 11748
NM_006281chr841145 922 352 224 ------
NM_006281chr841145 922 352 224 ------
NM_006282chr20114720 4662 4390 4343 3347 3021 995 712 424 339 312 1683 32964 1264 460 --
NM_006283chr8114638 4154 3628 3526 3240 3084 1583 1497 821 351 47 33671 3658 3614 ----
NM_006287chr2112383 2210 2092 1887 916 807 537 164 115 76 68 1588 22614 234 --
NM_006288chr111272 ----2276 64
NM_006298chr652842 2780 2203 1184 632 21283 200 12577 12552
NM_006300chr19102340 2281 2235 2225 1907 1806 809 499 452 256 --1109 --
NM_006306chrX75874 4795 3872 1987 1780 1662 59 24377 3995 11665 --
NM_006310chr1751186 1178 1161 435 101 2886 273 ----
NM_006313chr1221607 1050 ------
NM_006315chr484025 3191 2747 1724 1652 1496 1478 852 1724 43430 3363 1620 1308 13195
NM_006319chr164758 750 707 145 --1163 --
NM_006320chr461122 328 318 306 286 77 --1959 --
NM_006321chr352184 2177 685 160 154 12262 32117 2001 1487 1273
NM_006323chr42711 486 --1489 --
NM_006330chr841532 646 571 250 --11364 --
NM_006333chr21253 --1453 --
NM_006335chr13392 143 23 --1331 --
NM_006336chr941333 1276 1228 231 ------
NM_006346chr133473 193 51 ----157
NM_006348chr72771 324 ----1806
NM_006350chr5144 ------
NM_006352chr151929 1891 1881 831 533 1484 1437 1554
NM_006353chr631451 942 451 --1218 1274
NM_006354chr31254 --168 --
NM_006357chr2--1396 ----
NM_006359chrX72473 2361 2325 676 495 484 301 192 22328 498 --
NM_006364chr141346 --2483 450 --
NM_006366chr63847 461 148 ------
NM_006367chr1169 --3676 112 23 --
NM_006369chr14438 415 117 99 ------
NM_006371chr395292 5216 4638 4378 3350 2111 1933 1040 100 13414 55203 4645 2059 647 54 --
NM_006372chr61500 ------
NM_006377chr931229 818 90 1274 ----
NM_006378chr961411 1030 462 292 182 152 ----11015
NM_006379chr762176 1964 1771 814 262 160 ------
NM_006380chr17103963 3763 3662 3376 3311 2965 2959 1515 1229 524 --12693 12747
NM_006386chr2292461 1944 1856 1831 1675 1523 503 105 87 11546 --1383
NM_006389chr1131400 1309 519 31016 479 283 1383 --
NM_006391chr112326 232 --1333 --
NM_006393chr1094107 3279 3157 2919 1332 1259 1163 386 211 34096 3952 3671 24202 3682 11485
NM_006399chr141300 ------
NM_006401chr92507 342 ------
NM_006403chr631856 1805 1691 ------
NM_006405chr143230 73 31 ------
NM_006407chr351303 1257 1204 474 271 ------
NM_006411chr64857 661 349 127 1883 3862 669 392 --
NM_006415chr961260 1081 997 911 312 289 1109 ----
NM_006416chr63764 647 567 --1651 --
NM_006419chr43739 669 542 ----1237
NM_006420chr2083414 2862 2830 2585 2491 2357 2261 295 22659 58 31337 1156 449 32981 2188 254
NM_006421chr841192 1165 923 828 --193 --
NM_006422chr12164 ------
NM_006430chr21106 2400 223 ----
NM_006434chr1063192 2671 1988 1101 854 773 12119 43177 1158 875 860 1719
NM_006439chr43448 354 213 ------
NM_006449chr271757 1599 1529 791 523 433 108 --31994 1604 485 1378
NM_006451chr52840 324 --11042 --
NM_006457chr4144066 3784 3486 3164 2974 2857 2758 2666 2589 1599 1528 1109 919 343 11559 --12961
NM_006459chr1031639 1615 570 --21327 458 --
NM_006460chr1741793 640 212 181 --21796 1491 --
NM_006465chr1522302 1699 --1484 1724
NM_006467chr541978 1876 1741 102 179 22221 2076 --
NM_006469chr131442 1405 1291 ------
NM_006471chr18161 ----1291
NM_006475chr13------1158
NM_006482chr12163764 3574 3442 3053 2907 2669 2523 1471 1336 1257 1072 1043 800 792 782 681 --1785 11343
NM_006483chr191225 ------
NM_006484chr191225 ------
NM_006489chr1461841 1766 1622 1544 211 193 11609 192 --
NM_006494chr194339 214 155 48 ------
NM_006495chr17154 ------
NM_006496chr171773 1719 697 690 564 507 409 --11224 --
NM_006497chr171814 ------
NM_006504chr1052886 2821 2706 2577 226 --21910 105 22825 999
NM_006510chr66857 668 396 295 251 147 --11021 1650
NM_006513chr12225 38 ------
NM_006516chr121079 561 --21534 1364 --
NM_006517chrX62073 1495 1482 612 591 401 11504 1639 --
NM_006519chr6292 84 1287 ----
NM_006520chrX41563 1519 509 344 ----1560
NM_006526chr2082016 1888 1709 883 819 495 463 284 11906 21401 822 12020
NM_006527chr4----2704 103 --
NM_006529chr471515 1497 1111 670 424 179 52 11119 ----
NM_006534chr2083346 3200 2862 2512 2478 2286 951 410 12531 22583 323 13009
NM_006538chr274039 3278 2808 2765 589 167 109 22900 552 52876 2813 1360 1001 234 --
NM_006540chr831541 1444 190 ------
NM_006544chr14185975 5301 4764 4526 4279 3802 2442 2141 1924 1728 1520 1457 1361 1318 913 670 540 261 11074 35080 2256 1467 22212 567
NM_006546chr17156616 6223 6106 5949 5827 5817 5647 5474 5113 4839 4665 4641 4386 2642 2514 12012 24597 2288 26590 5335
NM_006547chr751850 1808 1698 852 159 31485 186 128 --31684 1629 1312
NM_006548chr361518 1203 587 563 538 388 --1372 --
NM_006549chr1282794 2776 2597 2138 1986 1100 782 125 1750 12971 --
NM_006557chr941660 1124 623 431 --21531 1446 --
NM_006558chr83446 387 71 ------
NM_006559chr14975 398 254 117 --1257 --
NM_006560chr113432 331 202 --2472 377 1129
NM_006561chr10166174 5922 5887 5473 5292 5067 4272 4041 3958 2473 2067 1892 1387 1055 345 331 41950 1292 144 133 34804 1576 835 13823
NM_006565chr1641102 842 78 69 --2845 34 --
NM_006571chr81238 138 ----
NM_006572chr1783427 3397 2939 2538 2222 2184 633 581 1590 31054 145 52 22750 2523
NM_006574chr31111 ----1119
NM_006575chr1421455 1147 --1156 --
NM_006577chr221015 285 ------
NM_006578chr1541328 1264 698 231 --11371 2702 348
NM_006587chr441052 492 463 190 11236 11443 --
NM_006591chr1181899 1722 1553 1424 1329 643 151 124 1235 1502 --
NM_006595chr1131993 647 180 ----11419
NM_006599chr16278263 7916 7813 7569 7409 6756 6398 6152 5952 5910 5746 5380 5137 2784 2436 2377 2067 1779 1754 1744 1735 1681 1607 1591 938 813 388 11793 68153 6254 5201 2964 1585 672 55384 3227 2774 2543 1713
NM_006601chr122859 320 11137 148 --
NM_006602chr203849 301 274 ------
NM_006603chrX81917 1716 626 399 347 218 99 39 --11741 11848
NM_006609chr2112884 2631 2513 2507 2313 2285 2158 696 528 131 74 32037 596 62 22999 1988 --
NM_006612chr171416 ------
NM_006614chr3133546 3289 3050 2804 2788 2674 2562 1277 1106 848 705 651 360 1389 23465 1347 --
NM_006618chr161389 1330 993 521 503 337 1158 ----
NM_006620chr66936 877 773 670 355 27 --1691 --
NM_006621chr191881 1615 1603 1354 786 688 278 264 78 --21667 336 --
NM_006624chr1051837 740 601 565 431 --21991 1831 11686
NM_006625chr1----1447 --
NM_006625chr1----1447 --
NM_006625chr1----1447 --
NM_006626chr952136 2098 1981 100 58 22563 142 11009 --
NM_006628chr1574142 3990 3764 3440 1806 1304 497 11818 --21862 1188
NM_006629chr1842391 1825 1048 648 22298 2252 ----
NM_006633chr51547 --1777 --
NM_006636chr261053 1007 708 689 318 152 1993 2915 796 --
NM_006644chr134569 462 237 93 ------
NM_006646chr1362728 2587 2364 1869 525 368 1470 12034 12800
NM_006650chr542691 1087 54 44 ------
NM_006651chr451506 1017 566 541 250 ------
NM_006654chr12184757 4451 4433 4342 4159 3971 3949 3865 3577 3524 2954 1894 1837 1565 1198 856 778 642 23343 1316 2859 810 1119
NM_006658chr751114 295 224 168 81 1186 ----
NM_006660chr153362 288 42 ------
NM_006662chr164388 343 325 245 ------
NM_006663chr19--122 1135 --
NM_006667chrX41126 435 409 243 11002 ----
NM_006670chr61219 ----1581
NM_006675chr1273339 2882 2388 2272 1000 977 607 1577 33102 2722 2266 --
NM_006680chr113169 120 107 ------
NM_006681chr4169 ------
NM_006690chr2031662 1528 899 ------
NM_006695chr171122 --1291 --
NM_006696chr5--123 ----
NM_006698chr202560 445 --11217 --
NM_006699chr182741 2524 2496 2080 1668 694 653 453 12073 1656 --
NM_006700chr123121 87 79 ------
NM_006703chr62356 180 ----1360
NM_006704chr133453 124 115 ------
NM_006705chr91423 ------
NM_006706chr52744 174 1142 1177 --
NM_006711chr163741 700 65 --1215 --
NM_006713chr52540 76 ----1547
NM_006716chr71147 ------
NM_006717chr9133146 2919 2875 2719 2303 2274 1069 998 839 527 497 201 121 12968 33306 2420 2124 --
NM_006720chr10184714 4674 4071 3995 3702 3676 3576 3482 3284 3240 1227 1075 1061 1029 975 732 617 289 44794 4486 1776 1740 14295 14803
NM_006721chr101335 --1684 --
NM_006722chr3102986 2748 2477 2412 2138 2027 952 936 710 82 1270 11046 --
NM_006724chr62483 33 ------
NM_006726chr461136 1082 981 463 152 64 --11052 --
NM_006727chr52156 115 ------
NM_006729chrX165423 4541 3928 3801 3544 3526 2041 1888 1852 1626 1256 987 921 905 741 108 13576 34267 3538 1344 11857
NM_006731chr9245844 5322 5007 4985 4820 4806 4624 4513 4487 4294 4278 3783 3756 2212 2144 1773 1711 1460 1398 647 585 243 153 30 --11988 1897
NM_006732chr1962060 1795 1400 713 640 203 41956 1841 762 290 --11742
NM_006734chr671606 1537 540 518 344 250 60 ------
NM_006735chr73299 94 67 --1138 --
NM_006736chr251732 542 510 500 473 11259 11706 --
NM_006738chr1574605 4557 3207 3010 2903 1813 1313 --13447 --
NM_006744chr102184 91 ------
NM_006745chr43874 303 162 2920 880 ----
NM_006746chrX81474 1364 1168 538 525 445 227 169 --177 --
NM_006749chr831261 1170 124 --11038 11111
NM_006750chr16247854 7823 7722 7223 6600 6154 5730 5463 5416 5238 5191 4900 3232 3184 3175 3161 2957 2725 2304 1958 1471 360 304 85 36051 5342 1482 24905 2441 13240
NM_006751chr22890 94 --1932 1982
NM_006754chr731076 816 422 ------
NM_006755chr11--1122 ----
NM_006756chr83355 311 279 --31133 1021 228 --
NM_006758chr21--1122 ----
NM_006761chr173688 232 199 131 ----
NM_006763chr151936 591 526 515 425 --11811 1678
NM_006766chr8162523 2402 2360 2156 2120 2075 2038 1645 1055 732 697 671 306 201 164 126 --21845 129 --
NM_006769chr12527 133 ------
NM_006772chr661781 1698 1638 1451 1292 26 1229 41728 1459 1120 1106 --
NM_006775chr672837 2788 2678 2540 2180 1112 407 22510 436 33033 3025 1064 12591
NM_006777chrX102802 2441 2421 2270 1813 1793 1183 722 692 394 11845 22318 777 1306
NM_006778chr641951 1926 423 387 1672 ----
NM_006783chr13--4609 286 267 197 ----
NM_006785chr1831642 879 836 ------
NM_006788chr1851699 437 301 257 113 --2326 260 1514
NM_006790chr51378 ------
NM_006791chr152654 172 --2602 121 --
NM_006800chrX2624 527 ------
NM_006805chr561575 1517 1084 615 553 435 11725 11192 --
NM_006807chr1741303 1282 843 129 --1236 --
NM_006808chr91161 ------
NM_006810chr3--162 ----
NM_006811chr204989 867 296 276 --1875 --
NM_006813chr62782 658 ------
NM_006814chr2052556 1909 1714 464 408 --12499 11957
NM_006815chr1281403 1143 1019 971 958 543 471 295 1497 1382 31029 125 95
NM_006818chr13644 177 94 ------
NM_006823chr81400 ----1536
NM_006825chr124979 783 719 385 --1189 --
NM_006826chr2126 ------
NM_006827chr1493393 3022 2842 975 833 469 385 337 191 12855 11223 --
NM_006832chr142805 671 --1122 --
NM_006838chr123682 612 412 --31468 652 556 138
NM_006851chr1242801 2242 2198 844 22411 2044 2919 462 --
NM_006852chr1762445 2358 1956 1038 421 126 ----1944
NM_006854chr751754 1632 1422 362 170 --11604 1346
NM_006856chr1231035 1010 889 1240 11022 --
NM_006861chr1232083 493 112 ------
NM_006873chr273507 3370 3271 3037 1281 665 333 --22873 638 --
NM_006874chr431140 968 954 --1957 11102
NM_006877chr64305 285 277 271 --1298 --
NM_006884chr341859 1618 1601 1349 --1712 --
NM_006885chr16184034 3439 2844 2697 1508 1450 1402 1394 1359 1344 1330 1094 1067 1039 822 665 313 200 11623 21347 690 12761
NM_006887chr22462 239 --1266 --
NM_006888chr1483534 3415 3354 3294 2901 1196 722 713 13459 13238 12805
NM_006901chr151118 2520 367 ----
NM_006906chr112860 368 --2750 26 --
NM_006908chr751111 966 607 586 574 21022 390 ----
NM_006915chrX52509 2472 2112 1620 322 12378 1251 --
NM_006918chr11195720 5656 5564 5431 5032 4956 4887 4518 4319 3777 3716 1930 1796 1744 1723 1684 1622 1568 58 25509 5437 21162 615 --
NM_006920chr281782 1728 1602 1528 1519 798 642 467 --11816 11790
NM_006922chr292337 1891 1797 1648 1595 840 581 158 23 --12395 --
NM_006924chr1764198 4137 3813 2848 2708 361 24156 173 34452 3936 2747 --
NM_006925chr141149 --1102 --
NM_006930chr551915 1867 1845 1258 249 ------
NM_006931chr1232133 1527 795 --22153 1530 --
NM_006937chr173126 117 39 ------
NM_006939chr141916 1426 ----
NM_006940chr127757 669 553 543 500 475 459 1710 1503 --
NM_006941chr222391 140 ------
NM_006943chr2033312 2307 2240 22772 2197 32959 881 398 --
NM_006947chr421315 380 --1568 --
NM_006951chr10----1269 --
NM_006955chr1052893 2868 1332 1241 842 --23439 3417 --
NM_006958chr8156 ------
NM_006963chr1041229 1063 398 202 ------
NM_006965chr1861042 917 362 339 315 43 ------
NM_006981chr942170 351 266 140 --22914 148 --
NM_006982chr122242 24 ------
NM_006987chr1741228 1054 174 162 ----1897
NM_006988chr212788 271 1481 ----
NM_006990chr171899 1792 1562 984 636 312 28 ----156
NM_006996chr151739 1552 1440 652 479 ----1238
NM_006997chr102472 451 --1475 --
NM_006999chr562067 1653 1287 701 610 470 21540 1449 1224 12076
NM_007002chr20189 ------
NM_007005chr941187 1071 1057 547 ------
NM_007006chr1663536 3019 2695 946 675 42 --13442 --
NM_007007chr1294735 4566 4107 3770 3670 3084 2945 1929 689 11409 53353 3175 3076 3021 1780 11933
NM_007010chr1731918 1179 371 --1725 --
NM_007011chr15146739 6672 6247 5493 5189 5089 2046 1933 1908 1856 1825 1437 782 205 35789 5738 2697 --36597 4657 1763
NM_007013chr82413 168 --1983 --
NM_007017chr51832 --2893 354 --
NM_007019chr20175 ------
NM_007023chr21351 --2842 266 --
NM_007033chr1112278 2075 1991 1985 1956 1740 1567 1478 196 109 70 ----1659
NM_007034chr11107 --1751 --
NM_007039chr1471929 1566 1473 611 421 303 291 12339 12098 --
NM_007040chr1921079 836 --2226 191 11083
NM_007042chr352526 2504 2491 2063 442 11655 --12603
NM_007046chr21380 ------
NM_007050chr20147906 7767 7381 6618 6564 3154 2877 2492 1528 1517 1102 910 762 286 --66697 2951 847 831 746 696 --
NM_007054chr5123631 3463 3437 3267 3189 3045 975 837 785 704 589 86 --11108 21003 841
NM_007064chr361523 1429 1351 1262 510 360 ----21219 110
NM_007067chr1761494 1371 1360 1219 1056 304 --31589 1162 76 --
NM_007068chr221285 1999 ----
NM_007074chr16----1109 --
NM_007076chr121108 ------
NM_007078chr1052214 1973 1071 841 148 ------
NM_007084chr1361472 1337 1197 602 596 531 ------
NM_007096chr92273 93 ------
NM_007100chr4123 ------
NM_007106chr1392783 2652 2603 2116 1714 1067 979 149 36 11795 12141 --
NM_007107chr3102212 2192 2083 1800 1571 577 566 558 515 399 --1370 1850
NM_007112chr11251 ------
NM_007114chr372993 2826 2346 2071 1012 212 82 ----12204
NM_007115chr21102 ----1363
NM_007118chr52254 28 ------
NM_007124chr651945 1441 736 450 212 --21807 681 1454
NM_007125chrY51470 297 290 53 35 ------
NM_007126chr91160 ------
NM_007129chr131315 1220 1729 --
NM_007136chr33971 46 32 --11085 2476 50
NM_007137chrX95541 4682 4435 3971 1482 907 777 716 314 24883 4360 33491 1543 818 --
NM_007139chr771118 1061 1002 969 897 831 40 ------
NM_007144chr173481 465 183 --158 --
NM_007145chr1911150 --11240 --
NM_007146chr1762448 2397 2140 1776 1163 139 ----11167
NM_007147chr1931070 295 250 ------
NM_007150chrX12126 21648 1583 ----
NM_007157chrX202853 2688 2520 2491 2376 2305 2235 2148 1861 1170 1097 1020 906 786 646 566 382 301 271 95 1578 --12442
NM_007158chr151164 1141 828 441 431 --11200 --
NM_007159chr341708 1085 703 82 --11533 1371
NM_007166chr1171413 1280 1048 983 489 441 264 --11051 --
NM_007170chr12369 338 ------
NM_007172chr2263238 2700 2141 700 425 76 --12796 21159 88
NM_007174chr1282322 2031 1513 523 416 404 393 238 ------
NM_007175chr873551 3313 3246 3180 1276 1194 734 1646 --22304 94
NM_007178chr121370 ----1347
NM_007184chr33557 159 73 ------
NM_007185chr15973 887 792 757 671 1176 11027 --
NM_007187chr133929 895 693 ------
NM_007189chr721380 573 --1366 --
NM_007191chr122203 169 --1722 --
NM_007192chr1441111 955 464 275 --11016 --
NM_007197chr1261040 970 942 86 71 56 ------
NM_007200chr1574605 4557 3207 3010 2903 1813 1313 --13447 --
NM_007202chr171681 1105 ----
NM_007203chr9123981 3823 3813 3307 3030 2849 2508 1425 516 485 339 28 33616 3136 2738 23816 3033 12512
NM_007204chr11204 1103 ----
NM_007207chr12945 78 --1606 1828
NM_007212chr1122293 2043 645 621 572 539 525 445 315 208 113 50 1119 11624 --
NM_007214chr651244 1061 1001 550 360 --1363 --
NM_007217chr3--1313 ----
NM_007218chr85880 856 711 365 190 ------
NM_007222chr831513 1238 267 2307 79 --31766 1204 403
NM_007224chr121653 ------
NM_007231chrX92212 2122 1930 1592 619 592 382 343 200 1809 --11934
NM_007235chr122446 369 1360 1138 --
NM_007236chr1562250 1781 797 658 478 208 32106 1979 551 22001 423 --
NM_007245chr162835 798 ------
NM_007246chr43969 825 777 1416 2925 194 11008
NM_007247chr1731073 819 779 --137 1243
NM_007249chr13279174 8607 8580 8515 8222 7886 7622 7458 7371 7280 7135 6968 6879 6424 6209 5880 3649 2807 2557 2420 1651 1593 1415 1205 1148 735 153 48799 7378 7299 6602 59276 8911 3115 2763 2426 23005 304
NM_007250chrX2379 369 2518 82 ----
NM_007257chr8122512 2336 2125 1096 652 526 385 220 203 152 144 60 1802 12975 12706
NM_007260chr11761 ------
NM_007269chr11453 ------
NM_007270chr711076 --11257 11558
NM_007271chr691805 1706 1683 1447 1231 1217 736 397 152 --140 1675
NM_007276chr73975 283 206 ------
NM_007278chr173355 291 141 1303 ----
NM_007281chr41186 --1189 --
NM_007282chr32232 86 1646 ----
NM_007285chr162502 197 1465 ----
NM_007287chr353080 2822 674 268 65 21179 1028 22482 2344 --
NM_007288chr353080 2822 674 268 65 21179 1028 22482 2344 --
NM_007289chr353080 2822 674 268 65 21179 1028 22482 2344 --
NM_007292chr1795183 4207 4197 3905 3826 1625 1163 539 523 --14412 11078
NM_007294chr172401 314 --1182 11137
NM_007295chr172401 314 --1182 11137
NM_007296chr172401 314 --1182 11137
NM_007297chr172401 314 --1182 11137
NM_007298chr172401 314 --1182 11137
NM_007299chr172401 314 --1182 11137
NM_007300chr172401 314 --1182 11137
NM_007302chr172401 314 --1182 11137
NM_007303chr172401 314 --1182 11137
NM_007304chr172401 314 --1182 11137
NM_007305chr172401 314 --1182 11137
NM_007308chr41218 ------
NM_007313chr951911 1819 1624 368 219 --11925 11567
NM_007322chr191593 1562 ----
NM_007324chr11429 --125 --
NM_007325chrX42038 1975 877 369 --1685 1335
NM_007345chr1892214 2082 1573 936 894 587 493 392 201 136 2496 330 --
NM_007346chr202301 253 ----1331
NM_007347chr1532653 2553 133 11996 2371 136 11131
NM_007350chr1284235 3887 3644 3615 3439 3237 1475 264 1359 33736 3240 170 1999
NM_007351chr461006 822 405 344 93 63 11153 ----
NM_007357chr12154 87 --1176 1426
NM_007358chr181948 1871 1489 1297 1242 686 497 301 --142 --
NM_007361chr141647 ----1561
NM_007362chr321509 1198 ----1249
NM_007363chrX4881 819 751 427 ----11037
NM_007365chr192197 1905 1831 1818 1663 1581 801 555 238 21947 1938 22088 822 --
NM_007372chr174887 867 223 173 ------
NM_007373chr1091768 1330 720 668 508 435 326 197 128 --31333 224 200 1684
NM_007375chr192594 2197 1829 1128 535 465 371 154 52 1673 32401 2151 330 --
NM_009585chr32169 145 ------
NM_009585chr32169 145 ------
NM_009588chr61209 160 1435 --
NM_012064chr1241076 1046 384 107 1429 11107 --
NM_012069chrX102716 2553 2521 2338 945 901 369 76 58 37 1589 ----
NM_012081chr583441 3154 2811 2746 895 455 184 138 23347 2567 13299 23128 432
NM_012082chr82666 645 ------
NM_012083chr1041111 977 833 424 --31018 844 433 --
NM_012084chrX3529 510 94 ------
NM_012089chr141409 1154 294 247 ----21529 1352
NM_012090chr141214 369 308 142 ------
NM_012092chr281880 1747 1441 1372 692 616 431 70 1503 ----
NM_012093chr141256 1220 1188 1065 ------
NM_012094chr11194 ------
NM_012095chr1053406 3270 2877 2438 2136 12325 ----
NM_012096chr393423 2401 2305 1475 1456 1235 605 586 381 --21274 847 11460
NM_012102chr1132616 2247 2147 2100 1885 1870 1859 1788 999 917 566 298 116 12364 1799 --
NM_012104chr1163695 2989 2469 858 736 340 12325 1742 --
NM_012104chr1163695 2989 2469 858 736 340 12325 1742 --
NM_012110chr4----1235 --
NM_012111chr141182 --1154 --
NM_012120chr652877 2230 2134 2050 1939 12341 1889 12316
NM_012129chr772178 1988 1840 1815 835 537 367 12191 ----
NM_012137chr192717 2166 2150 2141 2092 2055 1027 950 445 --22253 2095 12317
NM_012141chr13143874 3334 3139 3053 2888 2858 2754 2708 2676 2652 1568 746 303 166 --13979 189
NM_012153chr1192512 2484 2360 2054 1737 773 583 284 93 12025 2910 227 22380 97
NM_012156chr20143408 3348 3160 3145 3115 2916 2892 2837 2581 2552 2517 2450 622 28 --33163 2331 708 --
NM_012157chr32628 386 ------
NM_012158chr1331490 713 349 ----1334
NM_012160chr62527 197 --1491 --
NM_012164chr9187374 7196 7067 6837 5981 5742 5730 5515 5199 4919 4637 1211 1192 971 926 852 792 399 25556 4557 27208 7132 16097
NM_012175chr113821 250 219 --186 --
NM_012176chr5----1255 --
NM_012177chr61561 1521 ----
NM_012188chr531090 1082 1021 ------
NM_012189chr181475 ------
NM_012191chr3130 ------
NM_012193chr11145091 4900 4692 4671 4539 3834 3684 3336 1875 1723 1556 1532 727 670 65020 4678 3566 3484 1910 824 24703 676 --
NM_012197chr951602 1465 1369 465 353 1615 31287 469 59 --
NM_012198chr27688 653 629 174 127 91 42 ------
NM_012199chr1144482 4228 3296 3282 3269 3228 3050 2962 2935 1763 1462 1147 1073 640 21875 196 54039 3689 3638 828 653 33460 3326 1377
NM_012207chr102423 75 --2828 166 --
NM_012210chr951148 1052 1012 1002 423 --11534 --
NM_012214chr2206188 6121 6003 5345 5008 4926 4073 2525 2419 2265 2128 1989 1874 987 945 901 886 558 546 300 --36368 5066 561 15912
NM_012215chr1031673 1410 798 --31336 666 315 --
NM_012218chr192464 383 11972 1828 --
NM_012219chr343229 2866 521 385 11008 1917 --
NM_012223chr211064 --21310 117 --
NM_012233chr25784 762 435 321 221 ------
NM_012234chr3103627 3531 3483 2545 1429 1382 1172 1096 433 134 ------
NM_012238chr1051405 489 430 267 173 --21789 433 --
NM_012242chr102259 164 ------
NM_012243chr13771 384 302 ------
NM_012247chr102902 868 --1423 --
NM_012248chr163573 467 254 ------
NM_012249chr2103437 3401 2558 2505 2496 2294 1111 928 346 39 1829 11289 --
NM_012250chr1151075 881 147 57 51 ----1533
NM_012252chr7245364 5332 5284 4988 4740 4707 4677 4475 3923 3646 3610 3557 3543 3449 3389 1141 1002 861 820 812 697 398 209 101 35126 4039 1523 25367 4724 1216
NM_012255chr202118 70 1448 1407 --
NM_012257chr731097 969 227 ------
NM_012259chr691418 1295 1065 1003 950 424 343 173 164 ------
NM_012262chr1115016 4514 4294 4287 3474 3341 2000 1703 1679 1273 527 54865 4423 4160 3922 1772 --13300
NM_012266chr921077 105 ------
NM_012281chr732319 1736 572 ----1495
NM_012286chrX4487 176 86 67 --1595 --
NM_012287chr3124302 4140 4131 4091 1681 1584 1072 1033 955 432 310 234 23574 1195 24094 4019 --
NM_012288chr6175685 5529 5104 4981 4922 4537 4176 3970 3817 3771 3591 3492 1253 1230 1207 307 219 11747 42042 1132 384 274 15764
NM_012290chr261467 1385 1316 630 555 84 21498 31 11036 --
NM_012294chr7143907 3885 3423 3016 2956 2790 2634 2558 1287 772 762 664 499 443 ------
NM_012295chr222414 268 ------
NM_012297chr492108 2098 1691 826 756 548 417 354 131 21978 1609 21953 872 22586 114
NM_012300chr572179 1792 668 607 594 550 33 --2684 553 --
NM_012301chr752247 1377 806 697 678 11364 1894 1527
NM_012302chr121048 798 1905 1120 --
NM_012307chr1831066 868 825 ------
NM_012308chr1162373 2304 2167 2000 1678 113 --32307 2003 1925 --
NM_012309chr11204647 4358 4305 3882 3321 3131 1916 1909 1827 1678 1615 1396 1364 1110 925 707 700 633 594 242 --24023 909 24862 1230
NM_012311chr103646 623 97 ------
NM_012316chr1175614 5448 5420 4272 4138 4071 3872 3486 1713 1319 941 715 584 569 360 352 240 13653 35423 4275 4051 12088
NM_012318chr421384 1229 ------
NM_012322chr7----1299 --
NM_012323chr2211613 --197 --
NM_012324chr225760 300 290 273 230 --1235 --
NM_012325chr2071635 1545 1376 1188 1147 1010 104 ------
NM_012327chr1861554 645 583 531 180 172 ------
NM_012328chr751321 1233 933 251 218 155 172 --
NM_012329chr1751195 1037 533 469 311 11442 2675 167 --
NM_012330chr10101813 1758 1579 1159 731 467 264 221 198 183 --2710 244 11382
NM_012333chr141539 1321 1295 653 --31197 504 178 2377 79
NM_012334chr593624 3566 3463 3158 1486 779 559 114 27 --34057 562 405 --
NM_012339chr10--1592 ----
NM_012343chr551102 1049 881 851 216 --11105 --
NM_012345chr1341857 1749 1452 246 11792 1249 --
NM_012347chr672993 2899 2417 2406 535 349 181 12041 22280 2206 --
NM_012382chr5144270 4200 3851 3395 3117 3044 2875 1454 1283 921 834 603 582 430 2523 233 34263 3543 1668 1573
NM_012383chr9165 ------
NM_012384chr2041866 1549 800 230 --42375 1893 1552 524 12329
NM_012388chr1572019 1994 953 780 602 384 23 23193 1935 42934 2894 2022 606 12728
NM_012394chr1126 ------
NM_012395chr7143414 3164 3055 2901 2590 2366 2282 2271 846 457 330 276 174 113 --2503 177 2527 461
NM_012399chr2261899 1693 791 748 637 496 --11344 --
NM_012405chr1123850 3827 3786 3663 3637 3116 3081 2988 2651 809 484 91 --1958 --
NM_012408chr202813 656 ------
NM_012413chr22453 137 ----1443
NM_012417chr171635 ------
NM_012419chr63577 550 139 ------
NM_012420chr1061945 1504 714 294 194 182 1302 ----
NM_012426chr162377 345 ------
NM_012428chr154797 698 85 78 --164 --
NM_012430chr35751 665 520 225 112 ------
NM_012431chr7113201 3042 2875 2857 2744 2403 1130 803 464 400 105 1392 2282 83 12655
NM_012434chr621665 441 1412 ----
NM_012443chr101132 ------
NM_012444chr201175 --1178 --
NM_012445chr43529 506 142 ------
NM_012448chr17132360 2294 2160 2145 1882 1677 1653 1019 674 498 491 144 86 ----1915
NM_012453chr771553 1444 1335 1294 519 220 114 --11347 --
NM_012454chr62566 364 --1569 --
NM_012455chr241581 1246 1096 1077 ----11163
NM_012461chr146638 539 492 479 276 68 --139 --
NM_012464chr482014 1838 1785 1024 745 702 341 140 11081 ----
NM_012465chr10103265 3164 2983 2964 2869 2163 845 471 201 109 ------
NM_012470chr71458 ------
NM_012479chr732664 2141 788 3555 152 140 --12577
NM_012482chr1--1693 ----
NM_012486chr12158 99 ------
NM_013230chrY41346 1329 1153 565 ------
NM_013231chr14104273 3997 3621 3605 3381 1750 1633 1197 220 183 24292 667 --13866
NM_013233chr24416 376 209 76 1957 ----
NM_013236chr2231054 377 180 --1190 2794 405
NM_013242chr16147 ------
NM_013243chr1521046 467 --11156 --
NM_013244chr12--129 ----
NM_013248chr204238 230 99 23 ------
NM_013249chr111206 ------
NM_013254chr121680 ------
NM_013255chr7228878 8725 8676 8357 8314 8185 7983 7332 7022 6920 6852 6442 6328 5801 3524 3443 3269 2574 928 526 336 261 12159 ----
NM_013257chr842128 2084 394 144 ------
NM_013261chr4143209 2818 2728 2284 1516 1472 1456 1196 1175 1138 863 779 678 116 32608 1030 979 --21476 1066
NM_013262chr641103 1088 505 428 21255 289 31313 1164 988 --
NM_013269chr1284509 4161 3809 3379 1408 1335 1254 774 13957 44362 4182 3351 449 14021
NM_013272chr153356 157 53 ------
NM_013275chr164637 609 322 197 1643 ----
NM_013277chr1261011 970 902 727 349 283 1676 1905 --
NM_013279chr1122054 545 1907 ----
NM_013281chr2031520 1007 342 --11245 --
NM_013282chr1971292 1122 1097 1009 990 393 328 ----1233
NM_013283chr56857 816 801 614 198 21 ------
NM_013292chr16184 ------
NM_013300chr121239 ------
NM_013302chr16124732 4710 3333 3006 1854 1725 1326 1244 1158 827 617 162 --54742 4582 1728 1304 979 --
NM_013309chr1532634 448 161 ------
NM_013313chr2252196 1365 931 224 150 2834 202 12744 --
NM_013316chr73943 131 52 1903 ----
NM_013322chr751599 1406 1388 1143 1092 --11409 --
NM_013323chr175911 869 816 801 276 ------
NM_013330chr1179 ------
NM_013336chr33694 517 123 ------
NM_013341chr241952 1126 1078 934 2115 72 --11956
NM_013346chrX278 72 ------
NM_013348chr1921295 1154 ------
NM_013351chr171639 1734 1114 --
NM_013352chr64809 669 310 68 ------
NM_013354chr851486 1367 1144 483 65 1447 ----
NM_013357chr81707 ------
NM_013363chr34429 297 183 61 ------
NM_013364chrX41993 1967 1945 771 ----11425
NM_013365chr221531 ------
NM_013371chr1------1334
NM_013372chr1573419 2798 2216 2141 1348 981 211 ----12825
NM_013374chr373049 2987 2671 2065 1118 381 132 11252 23053 536 --
NM_013377chr123574 202 183 ------
NM_013381chr1252442 2309 830 622 199 ----1626
NM_013386chr1101774 1345 1292 1194 523 422 258 237 64 50 1563 --11375
NM_013390chr931701 488 467 --21749 1560 --
NM_013396chr2151489 1278 1193 970 302 1589 ----
NM_013400chr71846 --11029 --
NM_013401chr111726 --1928 --
NM_013411chr152790 1843 1093 700 178 --11972 --
NM_013423chrX31047 499 99 ------
NM_013427chrX31047 499 99 ------
NM_013433chr1931578 280 27 --21634 1363 11652
NM_013436chr22298 115 1313 --1135
NM_013437chr821218 554 1248 ----
NM_013438chr981693 1684 1436 1418 1292 1195 512 176 2629 538 2182 167 --
NM_013441chr11433 ------
NM_013444chrX71139 928 722 344 242 105 86 1769 ----
NM_013445chr21126 ------
NM_013446chr741406 1366 457 84 11016 ----
NM_013448chr141699 ------
NM_013449chr1292532 2430 2297 2256 1162 637 587 553 266 --21187 272 1775
NM_013450chr231223 926 109 --1468 --
NM_013937chr64916 903 795 717 1107 1415 --
NM_013943chr193265 3255 3200 2899 2239 2018 1103 828 703 12795 12242 --
NM_013958chr82473 336 ------
NM_013959chr82473 336 ------
NM_013961chr82473 336 ------
NM_013962chr82473 336 ------
NM_013993chr63730 636 619 ------
NM_013994chr63730 636 619 ------
NM_013995chrX52543 920 871 583 23 --22409 1948 --
NM_014000chr1051952 1807 1284 364 196 --11942 --
NM_014007chr911183 1131 1838 --
NM_014011chr272638 2125 1991 606 568 399 387 --21756 505 12557
NM_014016chr351736 590 580 456 447 ------
NM_014021chr183446 3345 3304 2531 1253 1120 698 644 11132 ----
NM_014023chr1072597 2050 1846 929 606 523 129 --32687 625 66 --
NM_014028chr6103340 2993 2718 2708 2479 2187 859 595 173 155 ----23101 2910
NM_014033chr122802 778 11734 32243 2163 2156 12286
NM_014034chr661143 1106 456 345 255 195 11054 --11114
NM_014041chr33237 124 34 --1364 --
NM_014043chr351672 1488 537 252 71 ------
NM_014048chr16124923 4880 4861 4780 1985 1946 1811 1540 1390 1284 904 363 34122 1577 991 ----
NM_014055chr125460 344 200 120 72 --1509 --
NM_014059chr131254 ------
NM_014071chr20189 ------
NM_014089chr1392288 2229 2128 1963 1747 857 204 174 63 11935 11428 --
NM_014106chr1572076 2037 1895 1196 1031 935 32 ------
NM_014109chr83437 431 26 ------
NM_014112chr8215009 4795 4590 4127 4074 3810 3677 3626 3512 3334 3322 2073 1551 1489 1009 848 812 530 146 135 41 22174 670 14365 --
NM_014117chr1642537 2081 1827 900 --22248 2084 12531
NM_014141chr7155178 4760 4199 3606 3493 3475 3448 1641 998 911 586 428 385 345 193 12075 25299 1537 --
NM_014149chr72586 348 --1558 --
NM_014154chr321596 423 --11438 1355
NM_014155chr11257554 6773 6308 6145 6094 5970 5784 5760 5360 5239 5095 4869 2975 2951 2363 1999 1933 1803 1779 1249 1239 1221 1096 821 802 35160 2446 417 46523 6202 2183 869 14558
NM_014157chr1663763 3171 2669 2536 1315 1238 23704 1568 21350 689 --
NM_014159chr3176 ------
NM_014171chr22576 45 1740 ----
NM_014176chr1----139 --
NM_014181chr262947 1094 876 824 668 366 12424 22801 2197 --
NM_014182chr12173 --1275 1202
NM_014183chr201308 ------
NM_014189chr431533 446 377 ------
NM_014190chr431885 1156 729 1323 ----
NM_014191chr121214 ----1817
NM_014208chr41289 ------
NM_014211chr54469 455 407 133 11219 ----
NM_014212chr123837 87 73 ------
NM_014213chr22133 123 1168 ----
NM_014216chr14------1140
NM_014217chr141604 1410 321 48 21323 183 21441 469 1214
NM_014223chr13636 296 211 --1574 --
NM_014231chr1272097 1939 1904 1837 750 736 611 --21878 251 --
NM_014232chr1751173 670 654 634 574 --21513 515 --
NM_014232chr1751173 670 654 634 574 --21513 515 --
NM_014233chr1782042 1889 1657 1470 1429 679 667 118 ------
NM_014238chr1731494 1375 152 11511 ----
NM_014240chr3124098 3607 3251 3079 2658 2625 1436 1050 803 484 411 204 --42877 806 659 207 --
NM_014243chr442070 1954 1322 553 1273 ----
NM_014248chr221128 ------
NM_014250chr2221528 252 --11450 --
NM_014253chrX52503 2131 1660 331 77 ----21996 1722
NM_014258chr201288 --144 --
NM_014263chr1011154 ------
NM_014267chr114869 335 293 21 ----1678
NM_014268chr1871297 1283 1262 562 287 277 166 11476 1169 --
NM_014271chrX----1162 --
NM_014278chr41445 ------
NM_014280chr15917 666 263 160 70 ------
NM_014283chr151367 1164 1059 554 431 --1416 149
NM_014284chr12909 127 ----1137
NM_014286chr953484 3251 2747 2439 1285 11136 --12231
NM_014289chrX41206 1150 1076 260 1327 ----
NM_014292chr221248 ------
NM_014294chr861383 1339 1207 1134 463 273 1107 178 --
NM_014296chr321617 1154 --11264 --
NM_014299chr1951630 1453 381 229 80 --42149 723 407 274 --
NM_014305chr133159 125 99 1208 ----
NM_014309chr22185066 4884 4733 4612 4448 4201 1502 1471 1234 1042 852 777 618 487 453 230 203 190 34863 4514 495 54624 4548 4072 3842 1801 1164
NM_014313chr131223 1162 90 1104 ----
NM_014317chr10121 ------
NM_014319chr1221773 464 1120 11439 --
NM_014323chr224788 701 393 283 ------
NM_014325chr1251903 850 750 740 403 ------
NM_014331chr4167362 6457 6345 5310 5169 5141 5109 4924 2743 2464 2424 2284 2209 2047 1041 299 47036 5830 2074 242 1354 26613 73
NM_014333chr11102635 2473 2262 2165 1877 1851 977 623 493 331 --3581 448 170 --
NM_014334chr91153 ------
NM_014342chr1141478 425 153 30 21373 952 11266 --
NM_014344chr113251 225 154 --1841 --
NM_014345chr61272 2878 360 ----
NM_014352chr1171368 1047 965 947 577 555 507 --21380 510 1528
NM_014353chr16----1717 --
NM_014363chr1371256 1067 1049 893 470 423 319 ------
NM_014365chr123348 243 234 --1351 153
NM_014372chr1101962 1895 1887 1839 1735 1504 698 501 399 375 ----21810 404
NM_014374chr71846 --11029 --
NM_014382chr351150 692 641 582 492 --31657 1288 1084 11466
NM_014388chr1215917 5716 5362 5268 4948 4702 4613 4029 3682 2245 2230 1713 1662 1634 1483 1219 1089 1050 349 295 147 35774 5728 5496 36046 4605 2320 --
NM_014390chr72403 182 ----1432
NM_014392chr431341 1198 1059 ----1349
NM_014393chr862213 2044 399 236 201 172 12190 52301 2218 2015 1869 745 --
NM_014394chr1031123 970 300 --3935 170 25 11170
NM_014395chr431832 574 104 --21922 1854 --
NM_014397chr931435 222 63 ------
NM_014399chr73168 154 51 1207 2995 61 --
NM_014411chr782051 1994 1349 1326 477 466 172 41 1438 21562 1329 --
NM_014415chr321218 393 ----11182
NM_014417chr19----2904 91 --
NM_014419chr19177 ------
NM_014421chr462137 2030 1958 1946 1663 1388 --21794 1443 11533
NM_014423chr5145218 5204 4691 4671 4645 4386 1955 1577 1552 1534 510 361 113 32 31823 1203 973 15657 22118 2109
NM_014426chr202709 533 ------
NM_014429chr35646 252 220 69 56 ------
NM_014431chr1041584 1377 1240 349 --21462 570 --
NM_014432chr61134 --1351 --
NM_014445chr352295 1957 1922 1570 174 --11659 22200 703
NM_014447chr441107 1099 635 266 --11040 11148
NM_014452chr64296 184 174 64 175 ----
NM_014454chr641098 868 682 135 --1146 --
NM_014455chr11141 ------
NM_014456chr104661 585 324 173 1122 1467 --
NM_014458chr141397 1120 1104 1048 11233 ----
NM_014469chr113624 308 210 --1627 --
NM_014470chr123753 640 543 --1705 --
NM_014488chr112509 460 197 ----
NM_014491chr74273 247 206 189 ----1946
NM_014494chr1682047 1869 908 899 867 412 344 291 11860 1110 --
NM_014498chr32327 42 --1352 --
NM_014500chrX1228 ------
NM_014505chr121372 ------
NM_014515chr1241050 659 214 37 ----11029
NM_014517chr341359 1224 755 376 11621 11659 11983
NM_014521chr231439 738 676 2579 433 11858 --
NM_014547chr152198 22 ------
NM_014547chr152198 22 ------
NM_014548chr1541326 512 389 141 11530 11329 --
NM_014552chr241431 969 342 291 ------
NM_014554chr12122346 2248 1933 1785 1731 1704 1682 1672 1660 1503 1428 49 12149 21972 1717 --
NM_014569chr751516 1160 607 562 468 ----11483
NM_014570chr224259 236 195 150 1134 ----
NM_014572chr1391740 1439 1307 1185 1166 1126 422 342 292 ------
NM_014573chr1731481 1285 1276 11868 ----
NM_014574chr1431352 334 318 11047 --11375
NM_014577chr224762 273 151 112 ----1258
NM_014585chr221250 1176 --1372 --
NM_014586chr2144341 3747 1578 1023 44001 3816 3330 1620 64554 4488 4344 4119 3795 3272 --
NM_014587chr1621361 214 11530 21417 1351 --
NM_014588chr206771 592 528 502 252 105 ------
NM_014591chr103901 157 76 ------
NM_014592chr51624 1183 1137 --
NM_014600chr231477 560 414 --21687 419 --
NM_014603chr1731687 1402 387 ------
NM_014604chr174709 640 194 40 ------
NM_014606chr471524 1420 1147 987 385 361 146 --11005 --
NM_014607chr251549 643 445 188 39 1604 --1696
NM_014608chr153158 94 45 1397 ----
NM_014612chr941563 529 495 441 1143 11091 --
NM_014613chr582692 2654 1997 1225 731 693 611 529 11187 ----
NM_014614chr251505 1102 1038 128 78 ------
NM_014615chr1653290 1296 539 372 237 13629 ----
NM_014616chr392736 2408 2398 2320 2270 1037 873 241 108 --23430 2413 --
NM_014620chr122530 115 ------
NM_014630chr15163984 3767 3662 3336 3148 2936 2721 2469 2459 1299 1199 1096 1042 731 604 551 11001 --1545
NM_014633chr114631 117 103 30 --2582 211 1442
NM_014634chr22102662 2262 1384 1080 1059 888 811 736 453 50 --12272 --
NM_014635chr271711 1700 1628 1379 1278 1243 78 31578 1284 1235 1280 --
NM_014636chr9164364 4245 4179 4139 3753 3699 3192 2979 1702 1611 1503 1434 1353 766 676 262 --33301 1416 718 --
NM_014637chr851371 1075 571 559 117 11083 ----
NM_014644chr121027 656 1207 ----
NM_014646chr1862497 2459 2318 2037 2018 618 --1489 --
NM_014647chr1672207 2082 2075 849 201 185 147 1460 21810 86 --
NM_014655chr162088 2005 1555 584 556 212 32333 2262 1593 ----
NM_014659chr153985 257 153 --1203 1403
NM_014660chr741073 848 824 260 --1379 11132
NM_014661chr1063733 1546 1138 503 476 320 --2826 287 --
NM_014665chr863687 2892 2777 599 352 162 --1568 --
NM_014666chr52359 93 --21123 382 --
NM_014667chr352351 2125 1778 896 683 1584 22385 1750 1751
NM_014669chr161112 ----1150
NM_014670chr251217 1077 626 331 268 ------
NM_014671chr721540 118 --1498 --
NM_014673chr8----1111 --
NM_014674chr3174034 3955 3673 3302 3295 3260 3046 3001 2768 1314 1236 1005 616 553 286 175 124 23329 1336 43845 1088 1012 527 --
NM_014676chr131247 1166 1144 ------
NM_014677chr851195 1051 1017 913 347 ------
NM_014682chr842160 1855 1703 239 --11514 --
NM_014683chr1751907 1839 806 785 216 --1219 --
NM_014685chr161465 --1561 --
NM_014686chr1962284 2263 2095 2053 968 641 ------
NM_014689chr21182 142 --1186
NM_014690chr772911 2666 1117 994 981 661 448 --22890 451 --
NM_014699chr163340 143 73 ------
NM_014700chr1631469 1322 360 ------
NM_014701chr1582750 2643 2534 1213 1204 1183 871 411 12455 13136 --
NM_014702chr6123450 3101 2947 2523 2458 2331 2179 1353 998 908 657 89 --33116 414 260 23338 1079
NM_014703chr361159 932 919 853 396 222 ----1880
NM_014705chr751838 1428 1374 678 568 12059 134 --
NM_014707chr751877 1593 1436 1423 61 12092 ----
NM_014711chr1691936 1588 1500 825 784 748 668 372 214 --11511 1483
NM_014712chr162391 215 --1218 --
NM_014713chr21519 ------
NM_014717chr19--1751 ----
NM_014719chr73459 411 97 11083 ----
NM_014720chr1071346 735 666 613 508 428 266 ------
NM_014721chr6257273 7164 6826 6653 6594 6477 5957 5797 5646 5537 5360 5335 5298 5073 4858 2714 2343 2309 2023 1870 1563 1543 1531 665 42 16729 36612 5316 1848 --
NM_014726chr172298 227 11390 ----
NM_014727chr191246 ------
NM_014729chr842219 209 173 21 ------
NM_014730chr12205084 5062 4822 4199 4183 4157 4062 3902 3417 3329 3232 1638 1491 1329 1071 974 569 237 215 71 1938 34288 3592 878 --
NM_014730chr12205084 5062 4822 4199 4183 4157 4062 3902 3417 3329 3232 1638 1491 1329 1071 974 569 237 215 71 1938 34288 3592 878 --
NM_014731chr2031225 394 120 11558 ----
NM_014733chr552096 1595 583 249 204 22220 1793 21873 1771 21934 485
NM_014735chrX51697 1687 1566 784 541 --32051 1709 731 21701 1515
NM_014739chr6124036 3749 3234 3225 2882 2834 2665 2571 1134 720 693 328 --13241 --
NM_014741chr1141873 745 564 538 --12179 --
NM_014742