TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3936
miRNA Sequence: UAAGGGGUGUAUGGCAGAUGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511342 ------
NM_000024chr52381 214 1449 ----
NM_000034chr16----1165 --
NM_000037chr882517 2276 1667 239 185 171 158 61 12230 ----
NM_000044chrX282 43 ------
NM_000053chr134756 560 304 207 --11299 --
NM_000074chrX3851 686 642 1115 1604 1969
NM_000075chr123226 219 47 ------
NM_000081chr151871 1520 1230 430 323 ------
NM_000084chrX106916 6163 5851 4540 4443 4423 2506 1998 1862 724 --12491 25222 1483
NM_000088chr1751168 382 366 357 318 --1403 --
NM_000089chr71552 --1190 --
NM_000090chr23815 620 57 ------
NM_000092chr264477 3549 3471 3181 3072 104 --44465 2979 1403 747 --
NM_000104chr22536 84 --1759 --
NM_000109chrX31807 446 102 ------
NM_000110chr111048 ------
NM_000125chr6104135 3130 1478 1443 1201 1181 488 436 241 36 --34216 3950 3330 --
NM_000138chr1512317 --1923 --
NM_000141chr101241 1969 ----
NM_000163chr52711 619 --1731 11475
NM_000165chr621098 313 ------
NM_000166chrX5574 254 247 137 57 ------
NM_000168chr7103053 2834 2813 2803 2737 2489 2110 444 284 245 --12063 --
NM_000176chr563696 3145 3084 2675 1371 1281 --13365 --
NM_000183chr2--1103 ----
NM_000189chr272224 1582 539 284 74 39 30 1272 194 --
NM_000192chr1251341 595 572 547 531 1474 ----
NM_000194chrX2557 212 ------
NM_000202chrX133935 2715 2685 2675 2631 2591 2485 2479 2453 2411 764 236 40 13242 ----
NM_000208chr19104545 3952 3303 3218 3029 1660 1150 839 758 238 --23481 1382 --
NM_000214chr2041758 1541 236 104 ------
NM_000217chr1295224 4655 3681 3656 3356 1880 1605 1001 792 21697 829 --11337
NM_000233chr22734 134 ------
NM_000237chr85716 705 510 318 143 11563 11440 --
NM_000240chrX31600 671 325 1430 11765 --
NM_000243chr164988 681 349 262 ------
NM_000245chr73722 508 234 ------
NM_000248chr332391 2359 507 22398 2038 1452 --
NM_000259chr1585036 5019 4885 4877 4814 4258 4235 2520 ------
NM_000264chr983135 2116 2074 1083 1056 897 601 250 13363 160 --
NM_000266chrX2256 203 ------
NM_000267chr1773486 3460 2442 2424 893 387 77 --21152 60 --
NM_000276chrX22131 149 --51504 510 448 433 271 --
NM_000278chr1092019 1619 1603 1540 889 822 543 251 155 ------
NM_000284chrX41868 1755 1612 330 --1672 --
NM_000298chr14185 171 82 34 --2467 48 --
NM_000314chr1023104 2692 12427 21184 412 13250
NM_000319chr1251092 987 821 266 211 1831 ----
NM_000321chr133429 258 37 ------
NM_000325chr41162 ------
NM_000332chr687048 6488 6212 5913 5481 4948 2838 788 26172 37 14629 14412
NM_000334chr17142206 2178 2101 1996 1957 1940 1805 1579 661 514 434 333 289 233 --21893 671 --
NM_000337chr596378 5178 4657 4460 2148 1299 948 933 539 11052 24295 4280 --
NM_000345chr42869 184 ------
NM_000346chr1731967 304 82 --11374 --
NM_000354chrX1260 1105 ----
NM_000362chr22153140 3123 2991 2886 2677 1420 1391 1249 1237 397 358 276 193 52 35 13426 ----
NM_000365chr124326 109 73 24 ------
NM_000368chr9114363 4354 4030 4010 3011 1570 949 931 912 454 187 --1691 24376 729
NM_000378chr113783 319 78 ------
NM_000386chr17126 --1144 --
NM_000393chr241392 745 464 454 1155 ----
NM_000399chr104261 146 105 50 1334 2420 87 --
NM_000411chr2142773 2451 668 355 13071 13323 --
NM_000412chr31264 ------
NM_000421chr171128 ------
NM_000428chr1472633 1991 1744 1015 1008 896 844 --3883 601 358 --
NM_000430chr1743486 3073 2507 30 --11261 --
NM_000435chr197950 748 735 286 245 101 57 ------
NM_000439chr532274 764 737 ------
NM_000442chr174226 80 64 25 ------
NM_000449chr131014 980 33 ------
NM_000451chrX42033 1489 457 94 ------
NM_000459chr93819 53 32 ------
NM_000461chr3113627 3391 3336 3206 2967 2872 1708 1148 1117 1063 157 14282 1850 --
NM_000462chr1531289 1153 168 ------
NM_000474chr71260 ------
NM_000476chr961398 1282 381 295 281 252 11381 ----
NM_000478chr13619 468 227 1295 ----
NM_000484chr2121050 698 1319 ----
NM_000489chrX13320 23048 109 11220 --
NM_000500chr65479 429 168 64 42 1382 ----
NM_000503chr821543 141 ------
NM_000522chr721264 431 ------
NM_000523chr221174 822 1145 ----
NM_000525chr1131500 1144 232 --11205 --
NM_000530chr15815 407 372 306 272 2776 247 ----
NM_000533chrX61828 763 757 412 108 21 1181 1191 --
NM_000544chr6_cox_hap193263 3135 3083 2447 2399 1372 1249 1002 25 12430 11360 --
NM_000554chr1943312 3283 974 739 12882 2159 44 --
NM_000555chrX187646 7547 6986 6942 5810 5690 4993 3023 2890 2706 2580 2012 1961 1830 1742 999 515 439 27292 5632 47620 6790 5501 5240 16621
NM_000557chr204361 173 59 47 ------
NM_000572chr14851 137 114 92 ------
NM_000578chr231767 1514 213 ------
NM_000595chr62202 96 --1621 --
NM_000598chr731510 1355 528 ------
NM_000599chr284318 3653 3495 3462 3447 3292 598 549 33199 616 225 24589 2991 --
NM_000609chr10112781 2662 2348 2301 2160 929 920 531 499 287 26 --22746 2367 --
NM_000611chr11166334 6325 6102 6014 5578 5055 4742 4562 2826 2610 2181 2172 1238 967 339 258 --1871 --
NM_000612chr11113667 3526 2925 2633 2361 701 630 523 510 318 245 22420 344 23779 2974 --
NM_000615chr1172869 2010 1178 1078 898 215 188 --1564 11096
NM_000618chr12125516 5287 5112 4783 4224 4179 2612 2151 2051 1261 807 499 15602 15959 16020
NM_000618chr12125516 5287 5112 4783 4224 4179 2612 2151 2051 1261 807 499 15602 15959 16020
NM_000627chr2----1674 --
NM_000633chr1853396 2080 1460 1210 286 ------
NM_000635chr1921641 1585 2326 96 11030 --
NM_000678chr204799 614 276 136 ----1622
NM_000684chr1011250 --21116 431 --
NM_000686chrX41204 605 522 363 ------
NM_000687chr202200 55 ------
NM_000689chr91483 2349 50 ----
NM_000693chr1551751 1431 1396 1140 459 1256 ----
NM_000706chr121636 ------
NM_000719chr12176604 6438 6318 5885 5670 5658 5619 5202 5011 4827 4560 4444 2655 2343 2138 1954 1277 --24547 2355 --
NM_000721chr1122657 2099 1886 1839 1833 1814 1734 661 308 302 225 192 21690 1678 12535 --
NM_000723chr1781622 1284 1096 1074 488 363 251 111 --11059 --
NM_000724chr1021227 458 ------
NM_000725chr1241000 781 248 204 1317 ----
NM_000726chr211347 --11474 --
NM_000738chr11122 --1289 --
NM_000761chr1551363 1287 1256 1115 587 ------
NM_000780chr8172 ------
NM_000795chr1151127 1051 934 110 67 --2757 709 --
NM_000800chr571329 1170 513 412 266 177 78 ------
NM_000801chr2061062 1005 697 194 188 178 --11016 --
NM_000806chr531629 325 151 ------
NM_000809chr4139271 9031 8551 7657 6858 6831 6726 6152 6063 5764 3331 581 390 29017 2650 13108 --
NM_000811chr52675 174 ------
NM_000813chr562176 2040 1790 806 592 361 --14197 --
NM_000814chr1542885 2817 1239 959 --23841 2927 --
NM_000816chr51171 ------
NM_000817chr22237 66 ------
NM_000826chr422014 961 1119 ----
NM_000827chr572009 741 589 461 420 177 63 21685 431 3576 205 22 12114
NM_000829chr1152251 2161 2045 2031 1901 ------
NM_000831chr1156095 5894 5650 5239 4932 4723 4424 4019 3897 1632 1312 581 571 523 286 15863 14612 --
NM_000833chr1621268 1170 ------
NM_000842chr11------1123
NM_000844chr331058 1040 919 ------
NM_000845chr7179 ------
NM_000855chr112274 25 ------
NM_000859chr54424 375 288 181 11491 --11375
NM_000861chr362618 2383 1733 1052 584 505 --1556 --
NM_000864chr11950 --11014 --
NM_000865chr61197 ------
NM_000868chrX52527 2355 1619 962 262 ------
NM_000872chr1021083 148 ------
NM_000875chr15216668 6005 5868 5171 5064 4779 4746 4631 4376 4327 2798 2109 1728 1495 1479 1400 1340 721 390 327 223 22413 1498 26679 1989 14967
NM_000883chr75622 502 481 162 118 ------
NM_000883chr75622 502 481 162 118 ------
NM_000891chr1753285 3136 2995 1185 1123 23338 2862 ----
NM_000899chr1233089 1679 815 --24346 1309 13147
NM_000901chr41396 --11030 --
NM_000903chr1641403 1289 364 291 11357 ----
NM_000914chr62406 301 --1132 --
NM_000918chr175727 627 146 125 36 ------
NM_000919chr51240 162 ----
NM_000922chr111169 ------
NM_000924chr1281361 1339 1196 1146 1124 460 254 164 ------
NM_000933chr201316 ------
NM_000935chr31966 1979 ----
NM_000945chr22686 543 11391 21607 1314 --
NM_000949chr53734 147 117 --1716 --
NM_000950chrX33345 2293 1462 --23029 845 --
NM_000960chr192801 501 ------
NM_000965chr341059 308 258 160 ------
NM_000966chr127926 917 737 437 335 171 127 --2880 113 1763
NM_000984chr172294 136 --1446 --
NM_001001323chr12--1107 32936 2368 242 11945
NM_001001342chr1051489 1193 1122 1059 194 ------
NM_001001344chrX52410 1904 1682 1650 980 22624 733 22000 1002 --
NM_001001394chr21450 ------
NM_001001395chr1232659 2561 2538 11800 --1827
NM_001001396chr1183910 3848 3823 3547 3501 1780 1688 1629 1326 969 950 863 834 821 577 417 309 108 11244 23661 534 --
NM_001001433chr2063048 2737 2708 2426 473 146 12559 --11960
NM_001001438chr212120 79 ------
NM_001001481chr832229 685 393 --12429 --
NM_001001484chr1022359 960 1847 ----
NM_001001522chr112322 44 ------
NM_001001549chr741910 972 853 734 --21933 406 --
NM_001001550chr741910 972 853 734 --21933 406 --
NM_001001555chr741910 972 853 734 --21933 406 --
NM_001001557chr841570 743 707 657 12229 1842 --
NM_001001661chr7----1600 --
NM_001001664chr272856 2649 2557 1171 1115 1051 44 1504 --13758
NM_001001890chr2172947 2863 2814 2636 974 627 378 11114 --11726
NM_001001924chr811315 ----11304
NM_001001925chr811315 ----11304
NM_001001931chr811315 ----11304
NM_001001995chrX------2352 331
NM_001002009chr75191 177 165 112 25 ------
NM_001002010chr75191 177 165 112 25 ------
NM_001002243chr22878 358 --149 --
NM_001002255chr61141 1293 ----
NM_001002269chr9--1436 ----
NM_001002762chr10112308 2154 2033 967 829 529 518 376 248 144 65 ------
NM_001002814chr873793 3623 3387 3086 1359 1003 771 1778 1953 --
NM_001002838chrX31446 240 81 --11898 --
NM_001002840chr74629 608 583 187 ------
NM_001002843chr151806 ------
NM_001002860chr1454289 2923 1705 1501 742 13214 24126 803 --
NM_001002909chr1792110 1717 1637 1629 638 346 271 226 56 ------
NM_001003674chr18196925 6306 6274 6211 5945 5804 5134 4806 4307 2818 1959 1944 1754 1427 1279 1143 1115 552 64 --16414 --
NM_001003675chr18196925 6306 6274 6211 5945 5804 5134 4806 4307 2818 1959 1944 1754 1427 1279 1143 1115 552 64 --16414 --
NM_001003676chr114374 345 263 28 --1995 1743
NM_001003682chr141099 559 513 364 --1529 --
NM_001003688chr41114 ------
NM_001003698chr691740 1701 1651 1627 1599 1430 439 242 80 --21956 328 11992
NM_001003699chr691740 1701 1651 1627 1599 1430 439 242 80 --21956 328 11992
NM_001003712chr122639 302 ------
NM_001003760chr643282 2840 670 67 13235 2810 180 --
NM_001003792chr31449 ------
NM_001003793chr31449 ------
NM_001003800chr953386 1486 1330 605 187 ----13194
NM_001003810chr41253 --1693 --
NM_001003940chr15113648 3608 3464 3150 2907 2567 2503 2392 2374 1249 659 11036 21028 1001 --
NM_001003942chr15113648 3608 3464 3150 2907 2567 2503 2392 2374 1249 659 11036 21028 1001 --
NM_001003943chr15123652 3612 3468 3154 2911 2571 2507 2396 2378 1253 663 21 11040 21032 1005 --
NM_001004127chr131370 --1294 --
NM_001004196chr32331 202 --11012 --
NM_001004317chr663890 3744 1221 910 628 589 1958 14100 --
NM_001004419chr1254047 3691 1817 1016 440 13535 11626 --
NM_001004720chr22670 296 ------
NM_001004722chr22839 465 ------
NM_001005271chr1771124 1103 1075 1056 1046 168 135 --2128 101 --
NM_001005273chr1771124 1103 1075 1056 1046 168 135 --2128 101 --
NM_001005291chr172210 28 ------
NM_001005340chr72855 799 ------
NM_001005353chr111077 ------
NM_001005353chr111077 ------
NM_001005375chrY31786 1190 1156 ------
NM_001005377chr191112 --146 --
NM_001005386chr231971 1881 109 ----1445
NM_001005404chr1784262 3751 2899 1380 1230 1079 980 342 --11333 13082
NM_001005463chr1032090 2013 1844 12031 ----
NM_001005473chr586376 5642 5473 2303 2166 1478 1338 337 1852 15786 15685
NM_001005474chr311033 --21510 1133 --
NM_001005502chr1285204 4894 3862 3451 1706 1686 1038 946 21857 1240 21961 1932 --
NM_001005505chr371706 1658 1169 1124 514 240 46 ------
NM_001005527chr341200 543 387 79 ------
NM_001005609chrX123553 3389 3030 2656 2579 2375 2354 1031 852 824 68 32 ----12440
NM_001005743chr1461225 1208 1189 1174 369 252 2266 258 ----
NM_001005744chr1461225 1208 1189 1174 369 252 2266 258 ----
NM_001005745chr1461225 1208 1189 1174 369 252 2266 258 ----
NM_001005746chr211347 --11474 --
NM_001005747chr211347 --11474 --
NM_001005782chr23367 219 202 ------
NM_001005845chr82366 165 154 ----
NM_001005849chr172563 138 ------
NM_001005861chr31851 ------
NM_001005920chr162726 358 ------
NM_001006115chr3112753 2443 2349 2274 2034 1114 944 698 409 390 265 12021 128 --
NM_001006600chr5--12004 --11813
NM_001006605chr12948 200 --1108 --
NM_001006605chr12948 200 --1108 --
NM_001006612chrX1383 ------
NM_001006613chrX1383 ------
NM_001006614chrX1383 ------
NM_001006623chr242052 1718 1691 237 11694 22326 1978 --
NM_001006634chr161470 --168 --
NM_001006636chr22851 185 ------
NM_001006665chr13507 169 140 ------
NM_001006684chrX1588 ------
NM_001007024chr17114239 3738 3517 3118 3021 1307 1286 1272 1072 843 463 33755 3588 1651 --13864
NM_001007025chr17114239 3738 3517 3118 3021 1307 1286 1272 1072 843 463 33755 3588 1651 --13864
NM_001007026chr125436 429 397 386 380 ------
NM_001007027chr11----136 --
NM_001007097chr944701 3829 877 74 --13721 --
NM_001007156chr154675 221 195 21 1454 1720 1144
NM_001007226chr1761421 1348 1342 1157 1023 225 ----1535
NM_001007227chr1761421 1348 1342 1157 1023 225 ----1535
NM_001007228chr1761421 1348 1342 1157 1023 225 ----1535
NM_001007229chr1761421 1348 1342 1157 1023 225 ----1535
NM_001007230chr1761421 1348 1342 1157 1023 225 ----1535
NM_001007237chr142681 2145 1031 52 --2373 360 --
NM_001007246chr2131196 746 380 1754 ----
NM_001007257chr12975 516 ------
NM_001007267chr24723 715 234 83 --2167 155 --
NM_001007273chr10230 23 ----1151
NM_001007277chr114781 444 248 75 ------
NM_001007466chr694792 4462 4039 3666 3391 1626 1187 1062 840 25156 3868 11177 --
NM_001007553chr151118 1009 947 88 81 ------
NM_001007559chr1821841 835 --1628 --
NM_001007565chr32367 278 ------
NM_001007792chr1----1207 --
NM_001007793chr102306 200 ------
NM_001008220chr5163909 3782 3659 3571 3530 3314 2626 879 698 637 621 589 560 256 168 118 ------
NM_001008222chrX61336 1138 425 283 213 100 ------
NM_001008223chr123623 117 32 --190 --
NM_001008239chr18103226 2364 1379 700 662 620 153 145 54 36 23719 3513 ----
NM_001008272chr32292 96 ------
NM_001008273chr32292 96 ------
NM_001008392chr382999 2708 2389 1348 906 801 342 44 --11157 --
NM_001008407chr751794 1654 1332 554 497 --1136 --
NM_001008410chr281945 1932 1464 806 751 500 421 394 11884 1854 1903
NM_001008495chr811692 22223 755 1209 --
NM_001008529chr1741294 1029 448 223 ------
NM_001008539chr884912 4780 4054 3395 2131 1512 1022 730 35093 4860 3977 --1832
NM_001008541chr1092253 1497 1454 1439 821 706 386 321 96 --11681 --
NM_001008541chr1092253 1497 1454 1439 821 706 386 321 96 --11681 --
NM_001008563chr95979 838 489 304 260 ------
NM_001008564chr1321561 853 ------
NM_001008566chr222380 72 ------
NM_001008567chr92355 312 190 ----
NM_001008660chr112272 255 1597 ----
NM_001008701chr19172976 2967 2959 2898 2842 2831 2751 2017 1244 1194 886 702 690 619 612 330 122 1863 21998 869 --
NM_001008726chr1431653 1606 1597 11600 ----
NM_001008738chr532025 1055 91 12163 ----
NM_001008744chr141107 188 11317 --
NM_001008801chr19------1717
NM_001008925chr453274 3013 2764 2718 2346 1605 12800 22677 1264
NM_001009183chr142522 423 ------
NM_001009552chr81503 ------
NM_001009554chr463430 3422 1755 1506 1379 50 21586 1285 23996 1827 1109
NM_001009554chr463430 3422 1755 1506 1379 50 21586 1285 23996 1827 1109
NM_001009566chr141414 1113 316 117 --1960 --
NM_001009899chr3116437 5853 5462 5292 4701 4408 2379 2279 2263 2198 1977 --35819 4499 2344 1654
NM_001009955chr11435 ------
NM_001009955chr11435 ------
NM_001009993chr254387 4380 3748 1663 1567 --1661 --
NM_001010000chr1833164 2381 538 --22704 389 --
NM_001010853chr641309 1146 731 589 --22623 1070 13082
NM_001010861chr132486 2246 1878 --21940 43 --
NM_001010862chrX93339 3118 3109 2877 2600 2420 2153 305 97 ------
NM_001010867chr1186116 5947 5859 5764 4090 2273 2229 2062 1760 1674 1518 1458 1426 963 875 811 634 139 26001 4098 ----
NM_001010888chrX74510 3973 3324 2954 635 286 168 11411 23578 1592 --
NM_001010891chr595626 5550 5504 5304 5035 2723 2579 2279 347 ------
NM_001010895chr921360 166 ------
NM_001010903chr641169 1094 96 28 ------
NM_001010908chr10------1233
NM_001010934chr71236 --11167 --
NM_001010984chr12836 546 --31042 506 391 --
NM_001011538chr43781 300 64 ------
NM_001011546chr202812 50 ------
NM_001011553chr73905 766 628 ------
NM_001011645chrX282 43 ------
NM_001011658chrX41367 805 690 473 ------
NM_001011666chr7136001 5953 5867 5687 5233 4780 4761 4511 1719 1004 580 571 100 24495 684 44962 4730 4699 318 11846
NM_001011708chr282805 2762 2744 2025 1181 1157 1121 346 12658 11061 --
NM_001012264chr145815 766 211 68 24 1609 1683 --
NM_001012329chr1112215 2127 1930 1737 1689 1552 937 830 680 105 89 ------
NM_001012393chr11104588 3789 3214 3208 2065 1493 1357 732 606 273 13549 24024 945 --
NM_001012426chr6203342 3073 2993 2878 2498 2479 2461 2383 1370 1244 1184 945 918 457 377 337 244 204 83 38 ----12424
NM_001012427chr6203342 3073 2993 2878 2498 2479 2461 2383 1370 1244 1184 945 918 457 377 337 244 204 83 38 ----12424
NM_001012643chr192555 33 1226 1188 --
NM_001012661chr114157 52 35 29 ------
NM_001012751chr1011750 11262 ----
NM_001012754chr1361892 1799 1584 1569 1519 165 ------
NM_001012756chr1942456 2417 2198 2115 ------
NM_001012968chrX11133 21939 580 2971 324 --
NM_001012977chrX91314 1159 919 525 499 282 195 186 150 ------
NM_001013031chr1093357 1095 967 935 704 686 482 401 238 --2664 583 --
NM_001013251chr114157 52 35 29 ------
NM_001013398chr731510 1355 528 ------
NM_001013415chr411428 --1100 --
NM_001013439chr31320 ------
NM_001013615chr1101208 1099 1081 1073 956 886 837 507 448 173 --1790 --
NM_001013620chr1278219 7974 7201 5911 3048 1104 269 ----16606
NM_001013624chr1751037 1021 836 380 183 --21127 44 --
NM_001013635chr1261156 1052 1010 452 293 274 ------
NM_001013690chr12162366 2123 1936 1638 1621 1598 887 652 607 520 492 470 433 411 358 305 ------
NM_001013693chr14675 440 88 29 21904 432 ----
NM_001013693chr14675 440 88 29 21904 432 ----
NM_001013839chr1762320 1592 994 832 672 643 1997 ----
NM_001014434chr12189 39 1295 ----
NM_001014435chr166614 569 179 162 130 113 --1427 --
NM_001014443chr13211 174 43 134 ----
NM_001014797chr10107736 7197 5847 3027 2672 2497 2211 1796 1218 964 15834 27419 790 1486
NM_001014809chr44800 292 249 137 --156 --
NM_001014831chr197784 673 627 590 538 126 87 ------
NM_001014832chr197784 673 627 590 538 126 87 ------
NM_001014834chr197784 673 627 590 538 126 87 ------
NM_001014835chr197784 673 627 590 538 126 87 ------
NM_001014839chr15904 892 739 190 162 --11029 --
NM_001014841chr15904 892 739 190 162 --11029 --
NM_001015053chr17101268 1115 1059 570 564 552 522 420 274 118 11481 21530 516 --
NM_001015508chr81705 ------
NM_001015877chrX11976 ------
NM_001015882chr911073 1158 ----
NM_001017368chr1792500 2492 2321 2205 1793 928 767 333 145 32341 934 856 32006 1860 178 11723
NM_001017371chr2--11090 ----
NM_001017392chr193987 272 63 ------
NM_001017395chr331320 964 415 43027 2818 2555 591 1704 --
NM_001017424chr15738 555 543 527 503 --11499 --
NM_001017425chr15738 555 543 527 503 --11499 --
NM_001017440chr7187392 7344 6699 6187 5943 5760 5470 3210 3016 2370 1958 1690 1520 1426 1259 899 593 182 57226 5117 1997 1922 1065 ----
NM_001017926chr831817 1684 1572 ------
NM_001017969chr91505 ------
NM_001017973chr52152 23 ------
NM_001017974chr52152 23 ------
NM_001017977chr11119 ------
NM_001017979chr42167 46 ------
NM_001017981chr222568 37 1277 ----
NM_001017995chr5194677 4495 4117 3777 3430 3140 3059 3047 1808 1669 1485 1274 1165 553 474 272 255 189 176 2940 71 44297 3248 1621 863 --
NM_001017999chr182130 1960 1746 493 390 372 200 179 12099 11486 --
NM_001017999chr182130 1960 1746 493 390 372 200 179 12099 11486 --
NM_001018000chr182130 1960 1746 493 390 372 200 179 12099 11486 --
NM_001018000chr182130 1960 1746 493 390 372 200 179 12099 11486 --
NM_001018001chr182130 1960 1746 493 390 372 200 179 12099 11486 --
NM_001018004chr15------171
NM_001018005chr15156 ------
NM_001018006chr15------171
NM_001018007chr15------171
NM_001018008chr153512 266 248 ------
NM_001018020chr15------171
NM_001018025chrX3275 90 34 --1253 --
NM_001018050chr22153305 3017 2870 2813 2786 2735 2715 2699 2613 2562 2350 1257 1225 249 179 13255 --13427
NM_001018052chr22153305 3017 2870 2813 2786 2735 2715 2699 2613 2562 2350 1257 1225 249 179 13255 --13427
NM_001018054chr1--11239 1991 --
NM_001018056chr91231 ------
NM_001018057chr1141388 960 557 244 ------
NM_001018064chr951515 1445 229 102 39 --1306 --
NM_001018065chr9125434 5215 5081 5041 4611 3874 3856 3738 1729 1260 732 204 ----1133
NM_001018066chr9125434 5215 5081 5041 4611 3874 3856 3738 1729 1260 732 204 ----1133
NM_001018074chr563696 3145 3084 2675 1371 1281 --13365 --
NM_001018075chr563696 3145 3084 2675 1371 1281 --13365 --
NM_001018076chr563696 3145 3084 2675 1371 1281 --13365 --
NM_001018077chr563696 3145 3084 2675 1371 1281 --13365 --
NM_001018108chr1591406 782 736 582 516 334 143 117 27 --31817 1764 213 1852
NM_001020825chr531171 559 150 ------
NM_001023560chr61144 1845 ----
NM_001023587chr3----1808 --
NM_001024094chr563696 3145 3084 2675 1371 1281 --13365 --
NM_001024226chr15983 915 897 214 26 ----11084
NM_001024227chr15983 915 897 214 26 ----11084
NM_001024228chr15983 915 897 214 26 ----11084
NM_001024401chr16112792 2560 2435 1970 1896 948 784 696 588 531 184 12299 12291 --
NM_001024455chrX122445 2435 2307 1681 974 762 467 349 313 231 56 36 --12618 --
NM_001024460chr671218 1204 1110 1053 443 425 303 ------
NM_001024647chr12106350 5586 5084 4999 4966 2751 1086 1060 435 113 11971 1570 --
NM_001024649chr552478 2222 1883 1837 457 ------
NM_001024660chr311421 ----21045 130
NM_001024666chrX2662 537 ------
NM_001024808chr1282751 2413 1030 738 700 493 444 87 31837 917 590 ----
NM_001024845chr17995 958 903 883 859 772 313 ------
NM_001024847chr342112 1978 79 43 --11529 --
NM_001024912chr1981544 1493 1183 1173 419 413 297 90 --11784 --
NM_001024934chr61555 --1121 --
NM_001024935chr61555 --1121 --
NM_001024936chr61555 --1121 --
NM_001024937chr1712691 651 590 513 284 276 249 198 181 150 143 74 ------
NM_001024948chr1--1337 11226 --
NM_001024957chr113121 57 32 ------
NM_001025076chr10115045 4919 4268 4156 2253 2215 2008 1967 1908 1408 1186 --11440 --
NM_001025077chr10126403 6277 5626 5514 4994 4881 2766 2544 1335 439 271 248 --12798 --
NM_001025079chr3123094 2954 2658 2557 2544 2529 1595 1133 902 783 634 142 --1717 13207
NM_001025081chr1871180 361 328 320 221 103 76 ------
NM_001025090chr1871180 361 328 320 221 103 76 ------
NM_001025092chr1871180 361 328 320 221 103 76 ------
NM_001025101chr1871180 361 328 320 221 103 76 ------
NM_001025105chr541341 1288 1023 461 ------
NM_001025107chr1162680 2331 2315 2266 2151 2049 2041 1669 853 498 463 457 443 342 206 103 1304 1365 --
NM_001025107chr1162680 2331 2315 2266 2151 2049 2041 1669 853 498 463 457 443 342 206 103 1304 1365 --
NM_001025109chr1101020 1003 951 882 814 726 310 176 108 47 ------
NM_001025252chr872850 2681 2369 2272 2105 383 172 ----1193
NM_001025253chr872850 2681 2369 2272 2105 383 172 ----1193
NM_001025266chr394321 3746 3285 1661 1611 1538 497 491 396 11052 14083 --
NM_001025366chr621708 247 --11246 --
NM_001025366chr621708 247 --11246 --
NM_001025367chr621708 247 --11246 --
NM_001025367chr621708 247 --11246 --
NM_001025368chr621708 247 --11246 --
NM_001025368chr621708 247 --11246 --
NM_001025369chr621724 263 --11262 --
NM_001025369chr621724 263 --11262 --
NM_001025370chr621708 247 --11246 --
NM_001025370chr621708 247 --11246 --
NM_001025580chrX104116 4028 3848 3266 3153 3029 2964 706 393 321 13352 34094 2702 45 1598
NM_001025595chr421368 140 ------
NM_001025596chr112536 110 ------
NM_001025603chr131014 980 33 ------
NM_001025616chr441735 1635 695 425 1759 1351 --
NM_001025780chr931275 1136 994 ------
NM_001029863chr632143 995 975 ----12645
NM_001029864chr20122411 1675 1644 1593 1571 678 659 513 306 265 179 162 ------
NM_001029871chr20101430 1327 330 242 227 212 160 129 63 42 180 ----
NM_001029875chr522458 147 ----12573
NM_001029882chr13209 112 71 --1546 --
NM_001029882chr13209 112 71 --1546 --
NM_001029976chr82149 51 ------
NM_001030006chr17122350 2307 2263 1981 1884 1871 1736 946 644 560 299 21 --42236 771 613 220 --
NM_001030007chr16113754 2984 2718 1235 1062 770 390 302 263 242 236 1833 13014 --
NM_001030055chr1424218 837 ------
NM_001030272chr111500 ------
NM_001030273chr111500 ------
NM_001030287chr12382 99 ------
NM_001031679chr1262803 2723 2627 2239 1024 304 --23532 255 --
NM_001031690chr792737 2248 1122 954 840 821 723 473 410 1945 12098 --
NM_001031695chr22195265 5198 4992 4963 4927 4921 4713 4483 4381 4001 3912 3903 3608 3472 3298 1876 1727 829 605 ------
NM_001031711chr5111767 1599 1482 1239 1226 1165 729 540 287 221 69 --4632 586 490 167 --
NM_001031723chr42316 158 ------
NM_001031732chr463037 2441 1139 505 483 140 ------
NM_001031740chr141431 1108 689 181 11185 1630 --
NM_001031803chr17----2329 248 --
NM_001031804chr1684419 4399 4084 3985 3180 1772 449 134 14171 23143 578 12910
NM_001031812chr522318 2092 1947 --12025
NM_001032221chr951652 1466 1392 505 160 --21843 584 --
NM_001032280chr671492 1478 1059 605 245 91 23 21114 457 1326 --
NM_001032288chr2051055 615 546 517 31 1385 ----
NM_001032289chrX4716 191 68 48 1343 1117 1792
NM_001032296chr1382850 2744 2170 725 677 659 213 58 --21029 464 --
NM_001032394chr642474 942 930 25 --1668 --
NM_001033025chr151253 1245 1227 410 292 21513 1236 1236 --
NM_001033044chr191781 1774 1661 1546 1451 1202 591 205 30 ------
NM_001033045chr244367 3013 292 98 1328 11411 --
NM_001033047chr491864 475 431 321 191 79 72 45 27 21938 632 ----
NM_001033056chr191781 1774 1661 1546 1451 1202 591 205 30 ------
NM_001033057chr31508 ------
NM_001033059chr612005 ------
NM_001033081chr161592 1391 1358 608 466 195 171 ----
NM_001033082chr161592 1391 1358 608 466 195 171 ----
NM_001033085chr21240 ------
NM_001033087chr2053172 2841 2244 811 332 12085 ----
NM_001033117chr3174787 4482 4467 4163 3900 3490 3480 1481 1459 1426 1331 1320 877 767 706 490 196 13499 ----
NM_001033507chr151503 1479 1408 1235 302 11776 --11974
NM_001033561chr176815 803 773 312 109 48 ------
NM_001033566chr172758 694 ------
NM_001033568chr172758 694 ------
NM_001033581chr1------144
NM_001033581chr1------144
NM_001033582chr1------144
NM_001033723chr822482 121 --11767 12707
NM_001033756chr621642 181 --11180 --
NM_001033756chr621642 181 --11180 --
NM_001033925chr1031893 1750 443 ------
NM_001033953chr112452 336 --144 --
NM_001034025chr123883 264 241 --161 --
NM_001034845chr42494 228 ------
NM_001034954chr1021188 538 --12297 12653
NM_001034955chr1021188 538 --12297 12653
NM_001034956chr1021188 538 --12297 12653
NM_001034957chr1021188 538 --12297 12653
NM_001035chr12365 41 ------
NM_001035003chr42911 55 ------
NM_001035004chr42911 55 ------
NM_001035254chr9182458 2124 2116 1944 1724 1635 826 758 745 732 721 637 587 553 470 165 93 81 ------
NM_001035260chr103547 131 122 ----1481
NM_001035267chr12----1280 --
NM_001035511chr182009 1407 718 662 214 119 83 26 1581 1616 --
NM_001035512chr182116 1514 825 769 321 226 190 133 2688 98 1723 --
NM_001035513chr182116 1514 825 769 321 226 190 133 2688 98 1723 --
NM_001035521chr22639 54 ----1143
NM_001035534chr961431 1380 1047 459 289 45 --11219 --
NM_001037131chr281164 846 501 299 272 218 174 105 ------
NM_001037132chr722035 398 ------
NM_001037133chr722035 398 ------
NM_001037165chr7187592 7552 7532 7362 7204 6706 6384 5408 3406 3285 3251 3209 2273 1783 1768 1064 345 148 28931 7299 11807 --
NM_001037174chr252146 1983 1938 1823 1787 ------
NM_001037317chr132486 2246 1878 --21940 43 --
NM_001037339chr141622 1202 1156 382 11647 11236 --
NM_001037340chr141622 1202 1156 382 11647 11236 --
NM_001037341chr141622 1202 1156 382 11647 11236 --
NM_001037341chr141622 1202 1156 382 11647 11236 --
NM_001037553chr21154921 4827 4762 3669 3639 3565 3423 1820 1308 1236 1217 1131 752 706 374 1315 25152 382 --
NM_001037738chr51229 1293 ----
NM_001038493chr251215 1101 570 198 137 ------
NM_001038640chr15--1804 1868 --
NM_001038707chr1102144 1902 728 560 516 456 187 110 83 72 ----21534 375
NM_001038707chr1102144 1902 728 560 516 456 187 110 83 72 ----21534 375
NM_001039348chr221034 785 ------
NM_001039349chr221034 785 ------
NM_001039350chr761096 686 339 272 170 77 ------
NM_001039459chr77460 404 330 163 140 127 25 21158 771 ----
NM_001039538chr222810 745 --1874 --
NM_001039547chr397623 7144 6082 5960 5108 2836 1241 1004 292 11071 15288 --
NM_001039577chr174222 3982 3869 3121 3100 1338 135 34177 3516 240 31353 1213 943 11816
NM_001039590chrX52609 1366 1162 1088 399 12476 ----
NM_001039591chrX52609 1366 1162 1088 399 12476 ----
NM_001039618chr11105934 5151 5077 4816 4668 1778 1218 893 480 174 35819 512 49 137 --
NM_001039690chr1672220 2199 2162 766 575 352 210 11570 2148 39 --
NM_001039711chr191050 909 830 823 206 166 102 84 47 1198 ----
NM_001039712chr191050 909 830 823 206 166 102 84 47 1198 ----
NM_001039762chr1032159 1774 643 22314 1955 1193 --
NM_001039770chr3102182 1972 1502 930 771 750 563 349 120 24 11723 21928 1551 --
NM_001039771chr143882 805 36 1982 1117 --
NM_001039802chr141424 894 432 173 11141 ----
NM_001039840chrX95926 5685 1692 1038 771 570 546 83 47 --2886 683 1391
NM_001039877chr197843 813 611 548 208 161 147 --1887 --
NM_001039888chr11789 1505 ----
NM_001039905chr1571145 560 453 443 349 245 202 11119 ----
NM_001039916chr1231032 435 115 1349 ----
NM_001039917chr1231032 435 115 1349 ----
NM_001039918chr1231032 435 115 1349 ----
NM_001039919chr1231032 435 115 1349 ----
NM_001039920chr1231032 435 115 1349 ----
NM_001039937chr1343702 1365 1002 331 ------
NM_001039960chr122396 255 11058 --1649
NM_001040002chr1741060 600 202 80 2517 192 ----
NM_001040057chr731514 983 416 126 ----
NM_001040100chr341126 925 359 322 ------
NM_001040108chr1453298 3113 882 466 459 22586 2112 --12269
NM_001040113chr161299 --128 --
NM_001040142chr21158 ------
NM_001040143chr21158 ------
NM_001040144chr1672220 2199 2162 766 575 352 210 11570 2148 39 --
NM_001040146chr1672220 2199 2162 766 575 352 210 11570 2148 39 --
NM_001040152chr795051 5045 5005 4993 4910 2047 1813 1717 1625 --14339 14754
NM_001040153chr131101 ------
NM_001040158chr5277 70 --197 --
NM_001040181chr33735 395 71 --1976 --
NM_001040182chr33735 395 71 --1976 --
NM_001040183chr33735 395 71 --1976 --
NM_001040195chr11629 --145 --
NM_001040199chr33735 395 71 --1976 --
NM_001040200chr33735 395 71 --1976 --
NM_001040284chr1665630 4494 4163 1312 719 71 15061 ----
NM_001040402chr442899 2372 363 112 --32568 2342 717 --
NM_001040429chr1333073 2908 64 13512 ----
NM_001040439chr1661176 409 356 140 108 96 ------
NM_001040441chr154058 4028 3968 1626 1267 2271 251 15116 --
NM_001040446chr582175 931 846 657 600 534 357 57 --1771 --
NM_001040458chr591687 701 677 619 536 472 451 135 112 --1733 --
NM_001040619chr13549 223 171 --1413 --
NM_001040624chr852448 2347 2341 2081 45 ------
NM_001040625chr852448 2347 2341 2081 45 ------
NM_001040626chr852448 2347 2341 2081 45 ------
NM_001040627chr852448 2347 2341 2081 45 ------
NM_001040628chr852448 2347 2341 2081 45 ------
NM_001040629chr852448 2347 2341 2081 45 ------
NM_001040630chr852448 2347 2341 2081 45 ------
NM_001040697chr111509 ------
NM_001040708chr831132 1026 380 ------
NM_001040712chr933465 3225 426 12676 11302 --
NM_001040715chr16101028 1000 794 456 425 402 391 375 170 55 2956 381 ----
NM_001042353chr204555 409 373 65 ------
NM_001042355chr1694825 4584 4513 4072 2057 1560 1033 903 332 1592 35303 4304 3630 14451
NM_001042403chr12--11020 1237 --
NM_001042404chr151756 1590 1326 364 117 11937 1283 --
NM_001042412chr1694825 4584 4513 4072 2057 1560 1033 903 332 1592 35303 4304 3630 14451
NM_001042413chr9133824 3132 2683 2593 1330 1134 1112 1002 760 523 430 299 192 33906 2759 1127 ----
NM_001042424chr452778 2569 2294 407 241 11981 12092 --
NM_001042425chr671492 1478 1059 605 245 91 23 21114 457 1326 --
NM_001042453chrX31369 686 268 --1635 --
NM_001042459chr3169 ------
NM_001042473chr1011988 ------
NM_001042475chr61290 ------
NM_001042476chr1682095 1765 1611 774 668 467 361 215 1708 121 --
NM_001042486chr2081557 1509 1390 1150 1108 470 411 250 ------
NM_001042492chr1773486 3460 2442 2424 893 387 77 --21152 60 --
NM_001042498chrX4853 328 205 185 --1254 1929
NM_001042506chrX81154 919 525 499 282 195 186 150 ------
NM_001042510chr841935 1345 576 148 --21776 427 --
NM_001042511chr841935 1345 576 148 --21776 427 --
NM_001042533chr323202 2968 11090 ----
NM_001042537chrX31714 1677 491 --31603 1569 578 --
NM_001042539chr167981 942 366 265 250 225 99 --11065 --
NM_001042543chr421530 1040 ------
NM_001042555chr1253545 3532 1847 553 358 24777 537 34152 4142 92 1174
NM_001042599chr2167710 7613 7432 7137 6734 5514 5475 5251 2638 2601 2162 1957 1742 1582 446 353 16446 16540 --
NM_001042601chr332923 664 506 ------
NM_001042603chr12104771 4394 3912 1786 1543 1087 617 419 237 147 24195 131 45333 5024 4727 3897 --
NM_001042632chr20152545 2258 1930 1900 1747 1713 1660 1614 1574 995 969 937 768 661 118 11984 2509 496 12181
NM_001042633chr20152545 2258 1930 1900 1747 1713 1660 1614 1574 995 969 937 768 661 118 11984 2509 496 12181
NM_001042663chr191436 1198 1050 975 506 366 328 220 127 ------
NM_001042664chr191436 1198 1050 975 506 366 328 220 127 ------
NM_001042665chr191436 1198 1050 975 506 366 328 220 127 ------
NM_001042669chr441735 1635 695 425 1759 1351 --
NM_001042681chr152402 2158 2062 2040 343 --2874 686 --
NM_001042682chr152402 2158 2062 2040 343 --2874 686 --
NM_001042682chr152402 2158 2062 2040 343 --2874 686 --
NM_001042683chr621187 220 ----1546
NM_001042724chr198755 723 563 298 267 251 155 81 ----145
NM_001042728chr127926 917 737 437 335 171 127 --2880 113 1763
NM_001042749chrX1387 ------
NM_001042750chrX1387 ------
NM_001042751chrX1387 ------
NM_001043318chr1493457 3215 3002 2836 2693 1377 1359 1097 1066 22511 798 44000 3530 3438 2557 --
NM_001043351chr172153 1618 785 681 174 138 122 21898 748 2857 372 --
NM_001044305chr631574 1280 348 ------
NM_001044385chr253772 3339 1487 884 787 1417 1775 --
NM_001044722chr522318 2092 1947 --12025
NM_001044723chr522318 2092 1947 --12025
NM_001046chr52674 371 ------
NM_001048183chr1103736 3627 3440 3417 3231 3016 2575 1067 571 546 21125 253 1316 --
NM_001049chr1492258 1850 1590 769 540 509 397 299 287 12328 12353 --
NM_001050chr1721151 89 1204 ----
NM_001065chr122416 130 ------
NM_001069chr61136 ------
NM_001070chr17--1156 ----
NM_001077628chr12479 21 1464 ----
NM_001079874chr141942 1816 624 137 31870 310 131 ----
NM_001083620chr422012 960 1119 ----
NM_001087chr25325 153 129 58 52 ------
NM_001092chr1782410 1725 1707 842 618 521 229 43 ------
NM_001094chr171340 1205 ----
NM_001095chr1271706 1515 1496 1430 1204 255 122 1590 11684 --
NM_001100108chr1136815 6751 6517 6001 5522 5176 3194 2789 2428 2339 1099 298 134 11105 11782 13227
NM_001106chr3149228 8438 7572 7400 7286 7004 3483 2643 1840 1638 1133 1016 980 521 23040 2400 17076 11206
NM_001111chr1162680 2331 2315 2266 2151 2049 2041 1669 853 498 463 457 443 342 206 103 1304 1365 --
NM_001113490chrX63480 3468 2863 2699 201 59 --22272 1173 --
NM_001117chr182653 389 ------
NM_001121chr1021851 1367 1655 ----
NM_001122679chr511342 ------
NM_001126chr13936 777 363 --130 --
NM_001127chr228453 400 357 349 324 218 153 54 ------
NM_001128chr16113754 2984 2718 1235 1062 770 390 302 263 242 236 1833 13014 --
NM_001135chr154652 236 167 83 ------
NM_001140chr174242 211 192 96 --158 --
NM_001144chr162512 325 1203 ----
NM_001146chr821938 105 --11856 --
NM_001148chr441499 1413 330 127 --1502 --
NM_001149chr10--1556 ----
NM_001152chrX2219 80 ------
NM_001157chr104276 226 215 140 --1532 --
NM_001163chr98972 889 876 809 329 217 71 42 --1148 --
NM_001167chrX35827 4518 2077 --11521 --
NM_001173chr1424218 837 ------
NM_001174chrX31968 1574 426 1119 ----
NM_001177chr1292209 1988 1773 1748 1620 1517 300 51 44 1389 ----
NM_001178chr111500 ------
NM_001189chr451003 992 882 348 256 11054 ----
NM_001190chr191295 --1230 --
NM_001191chr2091395 1137 579 487 474 315 206 147 38 --1377 1323
NM_001198chr652178 1699 549 266 131 22257 1905 11638 --
NM_001199chr82256 183 --126 --
NM_001200chr20----1817 --
NM_001204chr2107394 6337 5222 2465 1994 1502 1462 1184 1078 116 32775 2012 689 16347 --
NM_001206chr941976 1189 308 214 1458 ----
NM_001219chr731564 1392 899 --52107 1583 1503 596 358 --
NM_001222chr1061954 1803 1655 1640 1257 151 --11694 --
NM_001225chr11--133 ----
NM_001232chr14477 139 112 106 --1864 --
NM_001237chr411140 --1745 --
NM_001237chr411140 --1745 --
NM_001241chr242059 1815 872 191 --11592 --
NM_001241chr242059 1815 872 191 --11592 --
NM_001256chr1742505 743 601 275 --1965 1836
NM_001257chr161195 --11054 --
NM_001265chr133358 85 71 ------
NM_001270chr52847 808 ------
NM_001271chr1572780 2121 1111 893 733 550 196 ------
NM_001275chr143340 273 60 ------
NM_001282chr17122350 2307 2263 1981 1884 1871 1736 946 644 560 299 21 --42236 771 613 220 --
NM_001290chr41717 --1203 --
NM_001293chr112386 61 ----1423
NM_001294chr19286 47 1396 ----
NM_001304chr1763592 2621 1203 641 172 57 12504 ----
NM_001313chr44800 292 249 137 --156 --
NM_001315chr651937 1896 1432 822 89 ------
NM_001326chr11129 ------
NM_001329chr101303 1412 1437 --
NM_001331chr11121870 1735 1068 1055 1028 1021 968 942 870 740 574 309 31036 713 504 11727 --
NM_001343chr531342 286 148 1543 1356 --
NM_001351chr311126 ------
NM_001356chrX22495 756 ------
NM_001358chr41179 ------
NM_001364chr11154574 4375 3985 3961 3351 3299 3261 3242 3190 3175 3129 3077 934 857 255 --34530 3704 499 1972
NM_001365chr173550 238 161 1259 1108 --
NM_001378chr2--2421 156 ----
NM_001382chr113116 86 61 ------
NM_001385chr8152 ------
NM_001387chr5143003 2869 2857 2770 2560 2442 2313 2098 2070 1238 915 811 795 711 --12530 --
NM_001390chr18103261 3191 2602 1342 1319 1128 733 332 187 26 ------
NM_001391chr1831100 388 302 --2481 452 --
NM_001396chr2152592 1912 1100 429 230 ------
NM_001399chrX123553 3389 3030 2656 2579 2375 2354 1031 852 824 68 32 ----12440
NM_001401chr91387 1503 1218 --
NM_001406chr17121669 1646 1621 1380 1160 563 554 476 466 124 116 83 1538 21474 1358 --
NM_001408chr1101294 1267 1096 652 519 460 445 353 230 35 --11050 --
NM_001412chrX83615 3226 3154 2396 1087 967 417 369 ------
NM_001416chr172377 368 --1172 --
NM_001417chr1251743 1727 1304 518 71 1525 ----
NM_001418chr111486 ------
NM_001418chr111486 ------
NM_001419chr19103851 3666 3490 3277 3192 1860 1745 1714 1453 314 13654 24051 930 --
NM_001420chr1982937 2929 2827 2742 2551 2459 1228 396 ------
NM_001421chrX111446 1412 1370 1363 1334 1253 1235 555 394 179 86 --11287 --
NM_001423chr1262081 1374 732 527 219 176 11904 ----
NM_001426chr23639 611 65 --1588 1265
NM_001427chr78818 801 770 754 747 740 728 722 --11768 --
NM_001430chr271852 1538 1422 311 305 184 29 ------
NM_001431chr62811 45 --1930 --
NM_001438chr1122611 1325 495 478 466 449 438 431 385 309 251 213 1271 23141 2582 --
NM_001439chr151253 1245 1227 410 292 21513 1236 1236 --
NM_001444chr8----1179 --
NM_001448chrX1381 11175 11438 --
NM_001449chrX41054 442 119 103 --1996 --
NM_001453chr651524 1164 653 145 109 ------
NM_001454chr175873 861 665 637 24 ------
NM_001461chr13591 228 190 ------
NM_001463chr21302 --1184 --
NM_001478chr125967 790 218 176 45 --2956 930 --
NM_001482chr153376 310 203 1118 ----
NM_001483chr71212 11098 1134 --
NM_001493chrX7733 707 501 238 213 170 21 ------
NM_001497chr952467 1009 496 116 46 ------
NM_001508chr23773 676 224 ------
NM_001518chr721084 908 ------
NM_001521chr22639 54 ----1143
NM_001530chr141139 --1306 --
NM_001542chr142681 2145 1031 52 --2373 360 --
NM_001543chr574724 4620 4526 3335 1870 1806 366 1906 33556 1919 699 --
NM_001554chr1----1434 --
NM_001587chrX22131 149 --51504 510 448 433 271 --
NM_001616chr233318 2983 827 --1135 --
NM_001634chr612005 ------
NM_001635chr71433 --1970 --
NM_001642chr1121239 461 ----11299
NM_001650chr1812986 --22560 878 2493 36
NM_001654chrX3414 384 307 ------
NM_001655chr1171884 838 680 667 654 575 323 --1105 1758
NM_001658chr15983 915 897 214 26 ----11084
NM_001659chr12132401 2282 2205 2138 2079 1086 754 588 343 269 189 160 38 --21682 76 --
NM_001660chr34527 338 221 202 ------
NM_001662chr73253 89 74 ------
NM_001663chr143869 548 180 --177 --
NM_001665chr113428 382 29 1155 1105 --
NM_001668chr151666 1522 129 114 98 ------
NM_001674chr12382 99 ------
NM_001678chr17111732 1696 1645 1324 1189 724 640 573 477 448 70 --61618 1601 1478 1401 599 415 --
NM_001679chr32277 200 1639 ----
NM_001682chr1211169 --22650 2082 --
NM_001690chr352295 1697 651 292 210 22545 2226 2311 87 --
NM_001699chr1971786 1724 1691 1642 1636 635 157 ------
NM_001701chr911545 --1556 --
NM_001707chr76795 703 696 675 606 576 --1769 --
NM_001709chr1131907 883 338 --12222 --
NM_001717chr152975 503 ------
NM_001719chr20----124 --
NM_001720chr1101805 1561 871 798 638 508 170 145 53 33 1333 1139 --
NM_001730chr13--11519 ----
NM_001730chr13--11519 ----
NM_001731chr122619 71 ------
NM_001735chr9145 ------
NM_001737chr52184 64 ------
NM_001742chr731526 521 320 ------
NM_001743chr2--1154 ----
NM_001746chr552478 2222 1883 1837 457 ------
NM_001753chr731508 1209 1159 --11249 --
NM_001754chr2172947 2863 2814 2636 974 627 378 11114 --11726
NM_001755chr1642099 1882 749 341 ------
NM_001759chr12134904 4289 4015 3740 3579 3377 1339 1264 1060 1041 1033 606 385 34366 3873 3327 34699 1155 226 --
NM_001760chr65875 733 389 328 115 ------
NM_001773chr1131386 1369 1317 1248 1180 1092 542 474 413 193 116 91 80 ------
NM_001777chr3123094 2954 2658 2557 2544 2529 1595 1133 902 783 634 142 --1717 13207
NM_001788chr73905 766 628 ------
NM_001789chr341383 481 191 58 41471 1406 1279 51 ----
NM_001791chr141424 894 432 173 11141 ----
NM_001792chr1811147 ------
NM_001810chr205805 768 562 217 202 ------
NM_001821chr163633 3018 1322 1099 623 37 11161 11621 --
NM_001823chr142129 74 ------
NM_001825chr5--1135 ----
NM_001830chrX63158 2797 1382 1362 1342 1042 --1337 --
NM_001842chr93536 486 194 ------
NM_001843chr12148 --1176 --
NM_001844chr122387 322 ------
NM_001845chr132438 167 ------
NM_001852chr12569 508 --1597 --
NM_001854chr12548 255 ------
NM_001859chr963538 3419 3261 3074 143 98 13055 186 --
NM_001862chr2178 ------
NM_001873chr4--1156 ----
NM_001874chr1285204 4894 3862 3451 1706 1686 1038 946 21857 1240 21961 1932 --
NM_001891chr4--2145 30 ----
NM_001892chr541341 1288 1023 461 ------
NM_001894chr2231096 1086 208 ------
NM_001895chr2021016 56 --11172 --
NM_001920chr122769 653 ------
NM_001923chr112588 21 ------
NM_001927chr26458 207 175 143 126 40 ------
NM_001932chr172729 656 --1191 --
NM_001936chr761096 686 339 272 170 77 ------
NM_001938chr11368 ------
NM_001939chrX93832 3365 2916 1059 969 953 506 438 351 2253 226 21452 818 --
NM_001940chr125436 429 397 386 380 ------
NM_001945chr541448 1127 1102 43 --1109 --
NM_001946chr121939 ------
NM_001949chr661230 1153 929 313 209 82 125 ----
NM_001951chr8134 ------
NM_001964chr57836 399 377 334 252 207 188 198 1326 --
NM_001965chr22210 88 ------
NM_001967chr31193 ------
NM_001968chr4175 ------
NM_001969chr1443523 2774 1475 968 1353 43633 1402 1388 1322 --
NM_001970chr175576 238 190 170 104 1418 1487 --
NM_001973chr11273 --2383 364 --
NM_001978chr85878 731 284 138 107 132 1991 --
NM_001980chr1231942 1507 590 11624 ----
NM_001981chr142222 1519 705 234 11740 --11747
NM_001987chr12154166 3986 3920 3684 3495 3108 2954 1688 1584 879 701 632 503 288 47 ------
NM_001991chr1762120 2055 1992 1732 1553 421 11644 --12239
NM_001995chr43544 520 507 1442 ----
NM_002006chr433605 553 200 21847 1488 ----
NM_002009chr1521065 305 12399 ----
NM_002010chr13------1547
NM_002013chr141184 ------
NM_002015chr1353062 2349 1189 141 95 ------
NM_002025chrX178841 8441 8352 7853 7705 7581 7562 7443 6817 6785 6682 6643 1861 1152 916 908 46 21988 1403 58782 7376 2527 1199 641 --
NM_002026chr231051 1016 111 ------
NM_002028chr1431313 1278 1132 ------
NM_002033chr1163304 3022 2745 903 217 74 --23695 777 --
NM_002035chr1841505 1407 1292 1285 22468 800 ----
NM_002037chr62412 49 ------
NM_002045chr33143 91 67 ------
NM_002060chr1----1484 --
NM_002061chr11191 --11636 --
NM_002063chrX1233 1790 ----
NM_002065chr191781 1774 1661 1546 1451 1202 591 205 30 ------
NM_002071chr182450 145 2578 418 1513 --
NM_002072chr92791 362 ------
NM_002073chr2261273 1223 1049 409 307 139 --1124 --
NM_002074chr111652 --31659 1607 1493 11122
NM_002076chr1282819 2374 1100 782 307 245 43 32 ------
NM_002077chr952064 1836 1563 663 390 22036 1491 21580 506 --
NM_002080chr162838 776 --1723 --
NM_002089chr4----1575 --
NM_002092chr474801 4787 4728 4373 3755 3115 1875 ----14001
NM_002094chr161100 1335 ----
NM_002114chr62458 66 ------
NM_002126chr1773298 2932 1182 1042 989 335 328 1552 13317 --
NM_002128chr1312080 11634 171 11586
NM_002130chr52667 549 --2522 265 --
NM_002131chr641174 967 386 329 --188 --
NM_002138chr41253 --1693 --
NM_002141chr72584 80 ----134
NM_002145chr173298 146 41 ------
NM_002146chr1731369 501 141 --1187 --
NM_002148chr22611 199 ------
NM_002149chr22496 208 ------
NM_002158chr233617 2851 2663 --13169 --
NM_002160chr91137 --1427 --
NM_002166chr21239 --1610 --
NM_002167chr12353 71 --1141 --
NM_002187chr51956 --11136 --
NM_002202chr51713 ------
NM_002204chr1761346 1307 1271 1261 555 229 ------
NM_002205chr125939 919 223 205 178 ------
NM_002214chr7124674 3691 3539 1928 1470 1385 1243 1091 1046 649 394 324 24634 874 11614 --
NM_002221chr192927 2883 2790 2633 2436 2299 2250 939 39 12045 22356 1158 --
NM_002228chr12941 199 ----1405
NM_002230chr1710989 956 900 859 288 281 213 105 61 29 ------
NM_002232chr13969 209 53 1219 1847 --
NM_002240chr21122 ------
NM_002246chr29477 458 419 392 278 191 111 73 48 ------
NM_002247chr102182 106 21575 802 11473 --
NM_002248chr194567 524 83 25 ------
NM_002249chr12448 442 ------
NM_002251chr2092514 2347 2240 1890 904 878 817 730 33 12286 1562 --
NM_002253chr42227 27 --1986 --
NM_002254chr2112253 2056 1441 937 578 569 431 372 270 171 37 --11738 --
NM_002264chr3144574 4491 4472 3606 1643 1592 1548 684 498 341 311 246 195 58 2714 355 23059 1567 --
NM_002267chr1322005 109 1228 22045 347 --
NM_002268chr341625 771 759 554 ------
NM_002270chr555058 3731 1984 1574 1410 --24844 690 21657 95
NM_002271chr1321937 638 --21568 54 --
NM_002289chr124243 195 41 24 --153 --
NM_002290chr621381 483 ------
NM_002293chr1112172 2138 1936 1774 1119 1077 932 492 250 101 29 ----12802
NM_002294chrX160 ------
NM_002296chr12257 31 11673 ----
NM_002298chr1381110 1068 494 477 461 368 281 40 ------
NM_002306chr141103 ------
NM_002309chr22103052 3007 2755 2597 2246 2217 1127 294 286 226 1427 1476 --
NM_002310chr596119 2457 2432 2125 1929 1837 1828 1793 1277 22337 1843 1454 14400
NM_002319chr77973 742 324 305 258 216 119 --129 --
NM_002334chr112312 41 --11510 --
NM_002336chr1244966 4302 1541 698 14823 25023 1307 --
NM_002355chr1271368 1165 1031 576 168 101 26 ------
NM_002359chr17174186 3790 3712 3679 3155 3072 3047 2829 2820 2729 1684 1528 1492 1119 1080 168 114 1719 44156 956 931 249 --
NM_002361chr192220 74 ------
NM_002373chr1521088 45 --2477 374 --
NM_002374chr222810 745 --1874 --
NM_002382chr1481037 494 416 309 216 179 120 57 11314 ----
NM_002383chr169804 765 372 364 347 189 88 73 48 --1888 --
NM_002385chr1871180 361 328 320 221 103 76 ------
NM_002387chr594727 4619 3428 1887 1775 419 373 302 154 --23164 1263 --
NM_002390chr17101816 1796 1635 1443 1286 1258 399 361 125 117 ------
NM_002397chr551798 1787 1637 783 275 ----11866
NM_002398chr21432 ------
NM_002399chr151117 ------
NM_002404chr175866 388 237 151 74 ----1113
NM_002406chr56827 741 701 410 393 26 198 1351 --
NM_002409chr22123187 2908 2563 2534 2508 2074 760 670 403 193 84 52 --22341 905 --
NM_002430chr22112174 1990 1745 1735 991 828 746 707 455 257 82 22061 618 1348 --
NM_002442chr12141589 1277 1183 1166 1156 715 659 597 442 416 305 238 209 159 --1450 --
NM_002445chr84269 238 109 61 --1209 --
NM_002448chr42593 167 2195 103 2688 132 --
NM_002449chr52220 90 --11206 --
NM_002451chr993433 3299 3244 3058 2835 2620 2605 1200 166 --23366 591 --
NM_002465chr12244 32 ------
NM_002473chr2281280 997 501 495 452 445 196 56 ------
NM_002479chr13648 230 143 1211 ----
NM_002480chr12--21419 132 ----
NM_002481chr1297670 7567 7483 7378 6884 6671 6664 6462 6219 6147 5888 4968 4890 3162 3121 2816 2797 1940 1538 1402 920 714 622 559 295 194 142 131 56 37084 6609 1925 47396 4884 2684 1839 --
NM_002486chr922126 2081 1273 ----
NM_002487chr151709 ------
NM_002499chr152217 58 ------
NM_002500chr22862 81 --1930 --
NM_002501chr19213925 3905 3725 3217 3204 3056 3003 2983 2555 1572 1544 1516 1334 998 992 898 865 796 712 675 540 13876 22900 452 --
NM_002505chr621226 421 1103 1392 --
NM_002507chr17121912 1827 1814 1693 1281 488 312 283 250 227 184 62 --31847 791 86 --
NM_002508chr181574 662 537 416 357 259 226 200 ------
NM_002509chr202219 174 --1626 --
NM_002515chr1481743 1641 1540 1430 1320 1271 1261 35 --21737 707 --
NM_002516chr195263 225 108 77 51 --127 --
NM_002518chr23914 131 95 ------
NM_002519chr111353 11036 1569 149
NM_002520chr5----1197 --
NM_002522chr17173048 2735 2614 2590 2532 2498 1235 1165 1125 978 972 885 871 737 171 116 84 ----12714
NM_002524chr11282 --1227 --
NM_002542chr3--1215 ----
NM_002544chr17136 ------
NM_002545chr11104588 3789 3214 3208 2065 1493 1357 732 606 273 13549 24024 945 --
NM_002546chr8--1240 ----
NM_002547chrX103981 3932 2901 1434 1422 1040 1003 744 194 113 --21374 40 --
NM_002556chr1161982 1724 1592 1347 660 341 2832 435 21781 1336 --
NM_002569chr1561345 1303 1281 583 434 39 --1219 --
NM_002576chr1171140 863 315 126 91 85 74 ------
NM_002577chr3142883 2710 1623 1542 1533 1506 1489 909 901 811 795 444 413 336 23128 505 22821 193 --
NM_002578chrX3387 371 328 ----1399
NM_002581chr963770 2266 1589 1444 788 759 --152 14582
NM_002586chr661483 1112 1097 529 397 217 --1297 11010
NM_002588chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_002594chr2032338 2065 902 ------
NM_002595chr122646 120 ------
NM_002599chr115914 366 360 326 262 1929 1384 --
NM_002600chr141622 1202 1156 382 11647 11236 --
NM_002601chr24365 330 319 103 ------
NM_002607chr7143 1893 ----
NM_002608chr22141514 1490 1387 1339 1327 1151 620 528 432 424 402 336 170 150 1266 11132 --
NM_002609chr561670 1503 1480 417 350 117 --11262 --
NM_002610chr242892 2822 850 523 ------
NM_002612chr74676 365 239 81 1216 --1120
NM_002628chr32463 173 ------
NM_002631chr15361 338 245 126 80 ------
NM_002636chr65489 416 399 386 63 ------
NM_002641chrX3568 264 123 ------
NM_002645chr1112427 ------
NM_002646chr152175 846 790 224 77 11354 22165 840 --
NM_002648chr661091 977 930 495 218 157 --1426 --
NM_002651chr12322 219 --2864 647 --
NM_002655chr844767 4184 3602 1060 11156 24419 1617 --
NM_002657chr20163630 3607 3466 3213 2861 2647 2482 2467 1289 1159 1132 617 371 337 311 285 13256 23771 2427 --
NM_002670chr321463 1332 ------
NM_002687chr1431209 433 333 --1254 --
NM_002698chr19192809 2712 2601 2460 2454 2332 2311 2292 2273 2259 2224 1905 1144 1136 1010 346 253 200 99 ------
NM_002699chr181369 1251 1089 947 532 494 441 301 11510 ----
NM_002705chr164292 263 84 66 ------
NM_002709chr233205 3140 509 --23100 2712 1100
NM_002714chr68985 970 916 359 353 310 93 33 --1295 --
NM_002715chr53813 441 161 --1826 --
NM_002716chr1173505 3498 3451 3275 2802 2547 1115 ------
NM_002717chr85651 507 493 469 100 ------
NM_002718chr352695 2459 1880 738 348 11867 12320 1202
NM_002719chr1442140 1761 1493 614 ------
NM_002721chr93355 116 40 ------
NM_002725chr1184403 4394 4342 4319 4069 3311 3248 1755 1109 1007 818 657 414 323 296 253 233 90 23163 116 22906 479 --
NM_002726chr62347 172 ------
NM_002730chr1981360 1161 1127 999 265 243 237 205 ----1936
NM_002734chr1731980 1534 23 --11522 --
NM_002742chr141665 ------
NM_002744chr1------144
NM_002745chr2243378 1460 1314 74 1471 24227 118 --
NM_002752chr51519 1439 ----
NM_002753chr43831 547 115 ------
NM_002761chr16131 ------
NM_002773chr161480 --1100 --
NM_002791chr141110 ------
NM_002821chr67631 562 554 312 161 104 80 --1247 --
NM_002824chr126467 395 372 356 323 127 ------
NM_002829chr95295 119 68 47 28 ------
NM_002830chr21291 147 ----
NM_002833chr1541416 1139 319 155 --2626 363 --
NM_002834chr1263678 3424 1140 1051 1001 374 ------
NM_002838chr11486 ------
NM_002839chr933465 3225 426 12676 11302 --
NM_002840chr141375 368 325 184 ------
NM_002841chr31183 ----2637 593
NM_002843chr1183271 2766 2701 2420 1109 740 682 259 --1491 --
NM_002844chr621363 370 ------
NM_002846chr24522 516 77 44 --1100 --
NM_002849chr121169 1933 ----
NM_002850chr1961145 798 351 239 156 53 --11054 --
NM_002855chr11183669 3597 3463 3430 3374 3199 2760 2702 2658 2561 1434 1359 1342 1295 703 325 135 46 42263 1037 903 259 ----
NM_002859chr1291638 1612 1356 601 577 548 177 114 28 --11334 --
NM_002866chr197409 228 209 125 100 76 27 ------
NM_002868chr12132109 1985 1928 1825 1493 956 407 373 367 360 85 70 64 1760 12254 --
NM_002869chr1151766 1524 398 383 100 21487 53 ----
NM_002874chr932054 888 650 --1822 --
NM_002886chr374596 3635 3364 3278 1301 1255 1031 --11997 --
NM_002888chr3--145 ----
NM_002890chr52239 74 --1858 --
NM_002892chr1421432 236 ------
NM_002895chr202854 637 --1834 --
NM_002896chr11165 ------
NM_002897chr21189 ------
NM_002906chr113382 375 237 ------
NM_002911chr1941455 1251 415 319 ------
NM_002912chr6------1332
NM_002924chr11207 --1586 --
NM_002931chr62312 45 ------
NM_002938chr451993 1412 1287 501 462 --1146 --
NM_002941chr31187 21587 132 1518 --
NM_002942chr31475 ------
NM_002945chr171858 ------
NM_002953chr13507 169 140 ------
NM_002955chr691740 1701 1651 1627 1599 1430 439 242 80 --21956 328 11992
NM_002956chr1221020 301 1159 ----
NM_002957chr9103739 3520 3280 2992 1452 1430 1114 825 803 618 1167 ----
NM_002958chr31851 ------
NM_002959chr1114127 4030 3418 3411 3329 1264 964 651 637 616 422 24243 4061 11122 152
NM_002962chr11110 --135 --
NM_002967chr19----1186 --
NM_002973chr122403 43 ------
NM_002996chr16121854 1819 1498 1475 1448 1388 1241 788 632 321 270 53 11522 11559 --
NM_002998chr832067 419 399 ------
NM_003001chr182116 1514 825 769 321 226 190 133 2688 98 1723 --
NM_003010chr1741753 937 705 149 ------
NM_003011chr95588 383 345 311 101 --2239 212 --
NM_003012chr822993 156 ------
NM_003013chr4195 ------
NM_003016chr1731853 748 100 3775 426 282 ----
NM_003017chr61293 21379 236 ----
NM_003022chrX3857 308 300 ----11173
NM_003026chr931111 423 30 1187 ----
NM_003028chr9163798 3780 3758 3734 3594 3349 3234 2922 2713 2630 2623 2537 1467 1028 387 236 22608 2458 ----
NM_003029chr191430 1381 1109 488 397 372 343 273 238 ------
NM_003030chr341345 761 132 111 --186 --
NM_003034chr12198110 7055 7024 6777 6676 6660 6578 6261 6009 5586 5444 5226 5089 4990 2602 2087 1034 636 481 27373 6942 36251 940 516 --
NM_003035chr13708 386 21 1790 ----
NM_003037chr11116 ------
NM_003042chr33538 379 162 ------
NM_003043chr3163999 3939 3747 3585 3441 3356 3282 3263 3244 3093 3053 1601 1489 1390 1218 657 ------
NM_003045chr13114946 4189 4141 3692 3655 3429 3340 3202 1220 1152 600 1342 11372 --
NM_003046chr884912 4780 4054 3395 2131 1512 1022 730 35093 4860 3977 --1832
NM_003047chr1111295 1247 1095 1081 1003 964 504 413 254 106 75 --11241 --
NM_003051chr161935 1808 1707 1700 778 648 --11293 1160
NM_003060chr541230 878 363 114 --1396 --
NM_003062chr5127 ------
NM_003070chr91741 ------
NM_003074chr341967 1396 730 156 1148 ----
NM_003076chr12121438 1418 1370 1315 1130 1096 1074 507 396 259 204 168 11605 --1619
NM_003077chr172768 574 ------
NM_003081chr20151 --1236 --
NM_003088chr77939 876 259 251 159 107 25 --2289 67 --
NM_003091chr201242 ------
NM_003099chr15156496 6058 5925 5529 5331 5078 4178 2463 1818 1469 1250 1196 461 342 77 11141 46051 4347 1706 113 --
NM_003100chr51357 ------
NM_003106chr3--1945 ----
NM_003107chr691853 1619 676 668 533 524 450 370 345 ----11910
NM_003108chr2157216 6679 6506 6371 5995 5576 5500 2206 1963 1872 1817 1765 1040 865 277 1856 46852 5316 4498 498 --
NM_003110chr179863 851 770 339 285 177 166 113 62 ------
NM_003111chr2--11090 ----
NM_003112chr7125 12762 ----
NM_003113chr2----168 --
NM_003118chr53636 515 46 11988 11371 --
NM_003128chr242875 2511 1909 1050 ----1762
NM_003131chr6182109 2097 1966 1873 1700 1575 1436 860 818 658 649 602 529 471 407 395 251 203 ------
NM_003137chr641678 259 71 55 ------
NM_003139chr114717 255 236 136 --1863 --
NM_003140chrY146 ------
NM_003144chr631645 684 106 1846 ----
NM_003145chr12354 193 ------
NM_003150chr1761597 967 917 441 320 64 ------
NM_003155chr852320 2037 1136 908 245 22452 125 22299 354 --
NM_003156chr1151154 1021 298 69 60 11182 ----
NM_003161chr1712443 12886 ----
NM_003164chr113492 440 142 --2430 157 --
NM_003165chr961751 1565 1491 604 259 116 --21942 683 --
NM_003168chr174778 766 731 356 ------
NM_003173chrX61391 1381 1266 1198 1112 184 ------
NM_003178chr372234 2171 1662 1594 1488 1480 403 ----1745
NM_003179chrX141392 1374 1353 1274 1204 1194 1120 905 392 264 243 95 74 65 --21381 257 11464
NM_003185chr2041224 988 522 470 --21347 94 --
NM_003186chr112322 44 ------
NM_003189chr162840 1187 830 399 326 253 ------
NM_003194chr63486 451 35 ------
NM_003199chr1845626 1766 1385 805 192 ----
NM_003200chr1982345 2105 2082 2020 1841 1785 1758 1573 ------
NM_003204chr1731589 622 606 11167 1240 --
NM_003211chr1211152 --2531 367 11569
NM_003216chr22163164 2972 2911 2864 2693 2166 2078 2044 1023 976 767 717 308 293 71 47 2899 660 21332 652 --
NM_003220chr671492 1478 1059 605 245 91 23 21114 457 1326 --
NM_003221chr6144066 3398 3377 3120 3086 3032 2887 2864 2778 2658 1646 576 522 307 --44092 2843 1090 504 --
NM_003223chr163602 549 26 --1132 --
NM_003234chr342147 1544 689 273 --12319 --
NM_003236chr283238 3010 2289 1411 1384 747 595 263 12403 1676 13325
NM_003242chr342112 1978 79 43 --11529 --
NM_003246chr1551279 679 429 139 99 --11419 --
NM_003247chr631530 640 110 ------
NM_003250chr172177 145 ------
NM_003253chr214766 547 472 465 191 21651 414 --
NM_003255chr17111944 1859 1816 1791 1689 1650 835 495 431 151 145 --178 --
NM_003257chr1531244 1093 157 --11072 --
NM_003269chr621114 85 1300 ----
NM_003270chrX4796 480 349 294 ------
NM_003272chr12490 171 ------
NM_003274chr2132767 2081 517 1810 1558 --
NM_003275chr91471 11486 1105 --
NM_003281chr1164870 4338 4268 2101 1780 1638 1576 1420 963 954 793 724 656 556 104 71 --55358 5118 2113 328 95 --
NM_003285chr12539 344 1467 ----
NM_003286chr2021141 434 ----1821
NM_003289chr93201 190 46 ------
NM_003291chr132632 186 ------
NM_003292chr12530 177 ------
NM_003298chr3115849 5092 3998 3894 2462 2306 1762 1667 1073 798 777 34951 1368 130 14826 --
NM_003300chr14140 ------
NM_003302chr71136 ------
NM_003304chr331410 1296 373 ------
NM_003319chr21979 --1696 --
NM_003323chr19140 ------
NM_003336chrX3930 767 72 1164 1150 --
NM_003337chr52605 53 ------
NM_003338chr102544 173 ------
NM_003339chr541502 1407 1199 25 --1634 --
NM_003342chr1782875 2537 2187 961 856 777 561 494 2968 487 1714 --
NM_003344chr721093 507 ----1155
NM_003348chr1271424 1317 596 410 402 247 59 --11273 --
NM_003349chr2051055 615 546 517 31 1385 ----
NM_003352chr23367 219 202 ------
NM_003369chr1151948 702 527 362 304 22585 503 32495 891 73 --
NM_003370chr198778 592 586 572 245 219 211 31 --1691 --
NM_003371chr971587 1319 761 671 634 433 324 ------
NM_003372chrX2823 327 --157 --
NM_003373chr1061948 1867 1241 706 141 35 ------
NM_003374chr53802 232 157 ------
NM_003376chr621708 247 --11246 --
NM_003376chr621708 247 --11246 --
NM_003383chr91231 ------
NM_003385chr22350 267 ------
NM_003387chr232056 945 87 32805 951 934 22322 818 12510
NM_003392chr352978 2932 1105 1023 513 --11724 --
NM_003394chr126658 594 471 297 217 64 1230 ----
NM_003400chr21120 ------
NM_003403chr14177 ------
NM_003404chr2031752 1623 699 --159 --
NM_003405chr224547 534 212 134 ------
NM_003406chr811738 21682 1653 ----
NM_003407chr192564 122 1494 ----
NM_003409chr183284 251 244 ------
NM_003410chrX32154 1940 249 12418 ----
NM_003412chr342924 1117 1107 1062 ----12192
NM_003413chrX51900 287 257 251 177 --1789 --
NM_003439chr7103105 2195 1068 890 756 737 725 673 197 33 ------
NM_003442chr113556 274 174 ------
NM_003453chr13--1657 193 --
NM_003458chr3223851 3834 3815 3731 3533 3205 3004 2966 2741 2621 2565 2443 1620 1500 1485 1317 1305 1029 967 941 550 127 13454 12540 --
NM_003462chr131401 378 89 1702 21507 544 11576
NM_003463chr652747 2647 2458 992 161 ------
NM_003466chr272454 2360 854 781 713 588 547 22177 1718 32487 2433 652 1208
NM_003468chr2102895 2804 1399 1382 1166 996 887 705 499 239 11090 ----
NM_003470chr1641728 610 504 177 21875 50 ----
NM_003471chr31113 11438 ----
NM_003472chr611206 ------
NM_003477chr111252 ------
NM_003478chr1132528 1323 184 ------
NM_003482chr12132666 2627 2514 1727 1062 1024 902 773 533 511 389 197 131 12478 149 --
NM_003483chr1222234 881 --1208 12530
NM_003487chr172209 86 1184 ----
NM_003489chr2122194 745 ------
NM_003498chr1682488 2129 1775 1028 1021 636 370 347 ------
NM_003502chr163534 218 124 ------
NM_003538chr6147 ------
NM_003542chr6165 ------
NM_003545chr6152 ------
NM_003548chr1143 ------
NM_003549chr33137 128 26 ------
NM_003559chr17173698 3651 3602 3179 3036 2983 2869 2842 2828 2751 2506 929 823 610 443 280 234 --12731 --
NM_003562chr173292 96 81 ------
NM_003563chr1761421 1348 1342 1157 1023 225 ----1535
NM_003564chr16576 231 195 146 107 22 ------
NM_003566chr123909 667 222 11263 --12618
NM_003574chr1885171 5016 4124 4112 1925 1698 711 477 25139 456 41571 517 375 347 --
NM_003575chr741316 1201 513 502 --11473 --
NM_003576chr1382850 2744 2170 725 677 659 213 58 --21029 464 --
NM_003581chr22670 296 ------
NM_003583chr1242864 808 778 397 1386 ----
NM_003586chr162573 459 --1410 --
NM_003587chr6136 ------
NM_003590chr251367 960 901 203 149 ------
NM_003592chr71109 ------
NM_003595chr222380 72 ------
NM_003603chr411652 11629 ----
NM_003607chr174329 3465 2821 1001 587 273 23 1736 11009 14192
NM_003609chr16127 1163 159 --
NM_003612chr152427 90 ------
NM_003615chr3--11519 ----
NM_003616chr142491 392 ------
NM_003620chr172771 718 ----1987
NM_003624chr1961260 1179 433 379 355 249 --1930 --
NM_003629chr162651 2524 2184 1108 1093 624 --1805 --
NM_003632chr174755 676 356 218 191 ----
NM_003633chr552379 638 406 331 299 ------
NM_003634chr2271048 869 326 187 66 30 24 ------
NM_003642chr21240 ------
NM_003644chr17266503 6336 6023 5944 5418 5335 4902 4686 4350 4185 4172 4008 2157 2143 2055 2035 1613 1352 1277 1252 1231 1199 1087 763 497 369 --36190 6151 4080 --
NM_003648chr2132552 2449 2390 2313 2162 1857 1631 1597 995 811 649 484 126 --1944 --
NM_003656chr32124 62 ------
NM_003659chr22366 318 ------
NM_003663chr332281 497 447 12129 ----
NM_003670chr341052 1001 321 221 --2925 478 --
NM_003671chr932795 2730 854 33236 2421 951 ----
NM_003680chr14571 255 207 23 ------
NM_003709chr21126 ------
NM_003713chr11425 --11240 --
NM_003714chr552765 2494 933 678 173 11005 ----
NM_003716chr3--1722 ----
NM_003722chr382291 2256 766 316 105 99 61 29 42128 866 485 270 1479 1148
NM_003728chr43674 662 643 1253 ----
NM_003735chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_003736chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_003737chr114394 388 382 362 ------
NM_003743chr282302 2213 1785 1761 1631 1521 1473 582 1874 1576 --
NM_003744chr1461225 1208 1189 1174 369 252 2266 258 ----
NM_003749chr134951 521 191 185 12423 ----
NM_003750chr101289 ------
NM_003758chr151374 11129 2137 47 --
NM_003758chr151374 11129 2137 47 --
NM_003759chr493960 3217 3142 2845 1164 1105 744 579 347 ----2955 774
NM_003762chr121226 172 ------
NM_003763chr2063048 2737 2708 2426 473 146 12559 --11960
NM_003768chr1121812 1556 1511 1469 1443 1165 731 546 510 311 197 51 21578 125 --11791
NM_003779chr14444 404 348 308 ------
NM_003783chr11765 ------
NM_003787chr1841144 670 623 184 --1609 --
NM_003795chr62506 186 ------
NM_003800chr642208 2109 1874 497 ------
NM_003806chr121219 ------
NM_003819chr1------138
NM_003822chr162520 2113 734 515 492 485 ------
NM_003825chr1541401 582 148 50 ------
NM_003829chr921126 33 ------
NM_003831chr182197 130 ------
NM_003858chr142141 26 --1702 --
NM_003860chr113312 266 64 ------
NM_003861chr1452873 2167 2105 2033 144 12641 1240 --
NM_003872chr2112710 2678 2665 2432 2403 2225 2216 1196 1101 948 836 --11148 --
NM_003873chr107890 660 454 386 317 294 285 --1978 --
NM_003877chr123894 362 208 --1785 --
NM_003884chr31148 ------
NM_003885chr1782651 2022 1762 923 651 391 266 146 12657 ----
NM_003887chr231942 1617 908 ------
NM_003888chr1571738 1251 1230 1174 411 384 277 --11321 --
NM_003895chr212592 181 --1719 --
NM_003899chr1352525 1891 1581 1044 58 --12266 12458
NM_003901chr1072717 2698 2288 1951 1854 1738 711 1162 12162 --
NM_003908chr2011191 11416 ----
NM_003913chr654174 3873 3496 3209 494 24361 3745 12903 --
NM_003924chr43617 197 189 ------
NM_003927chr182807 778 ------
NM_003930chr742295 2003 1949 91 --11940 --
NM_003931chr61555 --1121 --
NM_003932chr2261936 1802 1350 139 133 89 --11648 --
NM_003934chr9--11169 ----
NM_003939chr10143824 3818 3644 3462 3330 3147 3048 2923 1008 675 652 296 288 151 --24017 2744 13198
NM_003948chr432675 974 611 --22342 742 --
NM_003949chr17181995 1981 1914 1898 1887 1852 1803 1765 1613 1380 1364 1353 1343 1260 644 285 114 105 --11621 --
NM_003957chr116985 927 836 433 269 224 ------
NM_003958chr653074 2937 2484 882 517 --2740 425 --
NM_003968chr31152 --1277 --
NM_003980chr61251 --2589 415 --
NM_003983chr16124398 4140 4043 3616 3183 2763 1601 1236 1217 1146 613 253 1497 23991 3512 --
NM_003987chr1092019 1619 1603 1540 889 822 543 251 155 ------
NM_003988chr1092096 1696 1680 1617 899 620 328 232 44 ------
NM_003989chr1091955 1555 1539 1476 825 758 479 187 91 ------
NM_003990chr1091955 1555 1539 1476 825 758 479 187 91 ------
NM_003994chr1233089 1679 815 --24346 1309 13147
NM_003996chr63161 57 45 ------
NM_004006chrX31807 446 102 ------
NM_004007chrX31807 446 102 ------
NM_004009chrX31807 446 102 ------
NM_004010chrX31807 446 102 ------
NM_004011chrX31807 446 102 ------
NM_004012chrX31807 446 102 ------
NM_004013chrX31807 446 102 ------
NM_004014chrX31807 446 102 ------
NM_004015chrX31807 446 102 ------
NM_004016chrX21721 360 ------
NM_004017chrX31807 446 102 ------
NM_004018chrX21721 360 ------
NM_004020chrX31807 446 102 ------
NM_004021chrX21721 360 ------
NM_004022chrX21721 360 ------
NM_004023chrX21721 360 ------
NM_004024chr11458 --1322 --
NM_004028chr1812986 --22560 878 2493 36
NM_004050chr1462057 1877 920 758 604 556 --1394 --
NM_004059chr93432 345 54 --1122 --
NM_004063chr82356 115 1751 1659 --
NM_004064chr1231215 853 450 ------
NM_004067chr751428 1070 614 574 205 --11412 --
NM_004074chr112196 161 --1138 --
NM_004077chr1281309 1243 1213 1104 463 415 193 173 11079 1956 --
NM_004078chr181011 990 976 963 915 262 146 34 1944 ----
NM_004080chr71442 ------
NM_004081chrY31786 1190 1156 ------
NM_004082chr23299 229 26 --1319 --
NM_004086chr14--1643 1149 --
NM_004090chr1782913 2902 2738 2552 2438 1119 740 366 13310 ----
NM_004093chr1372985 2644 2374 1313 947 128 61 1674 ----
NM_004094chr1421135 612 12945 1309 --
NM_004096chr1062132 1674 825 790 550 206 11343 11652 --
NM_004098chr104977 933 903 225 1808 ----
NM_004100chr632569 2542 1723 --32619 2322 1001 --
NM_004103chr811797 763 757 746 733 705 329 156 150 118 38 ------
NM_004105chr221034 785 ------
NM_004113chr321983 42 --136 --
NM_004116chr21452 ------
NM_004117chr661685 1581 712 642 412 42 ------
NM_004124chr1432729 2311 353 1633 --13496
NM_004130chr31459 ------
NM_004133chr831781 706 249 21935 925 ----
NM_004156chr81503 ------
NM_004157chr33904 803 332 ------
NM_004161chr221160 170 11446 ----
NM_004169chr171118 ------
NM_004171chr11158656 8505 8245 6574 6093 5942 3855 3767 3193 2883 2808 2028 1694 1039 293 26516 479 39224 9027 6300 17274
NM_004176chr172210 28 ------
NM_004178chr121110 --133 --
NM_004186chr34614 606 116 47 2810 664 ----
NM_004187chrX131401 1355 1051 460 447 426 404 358 202 142 133 116 60 ------
NM_004193chr101405 ------
NM_004199chr52152 23 ------
NM_004200chr11143232 2818 2744 2072 1236 1204 1102 1087 918 794 786 544 309 236 --1965 --
NM_004205chr112477 27 ------
NM_004210chr1062128 2098 1713 1347 728 83 --12001 --
NM_004225chr811142 ------
NM_004227chr772202 2027 932 835 623 323 66 ------
NM_004228chr192113 61 ------
NM_004229chrX42122 1840 1710 591 ------
NM_004235chr91347 ------
NM_004236chr15----1412 --
NM_004247chr17150 ------
NM_004248chr103655 481 140 1627 ----
NM_004253chr9--1277 1926 --
NM_004261chr11835 ------
NM_004263chr271673 1612 1579 1564 720 275 259 --11482 --
NM_004272chr53590 345 119 ------
NM_004274chr1462984 2793 2487 2212 333 286 ------
NM_004277chr62177 21 --192 --
NM_004283chr193802 129 29 --1101 --
NM_004286chr22132840 2611 2530 2446 1974 1886 1078 808 772 646 629 494 383 1656 ----
NM_004296chr14123343 3302 2743 2684 1409 1125 1026 1008 829 822 633 503 13954 13160 --
NM_004302chr12112719 2623 2578 2456 2384 2117 1881 792 722 446 84 --22862 1965 --
NM_004308chr1191743 1699 1459 652 610 517 388 132 26 --31446 670 295 --
NM_004311chr10132941 2762 2725 2565 2554 2267 2253 2246 2148 2138 2049 684 416 12855 33053 2548 2316 --
NM_004316chr124830 441 425 389 ------
NM_004321chr252951 2555 1261 1026 85 13289 ----
NM_004326chr151145 1037 1008 925 848 ------
NM_004331chr812120 --1194 --
NM_004338chr18196925 6306 6274 6211 5945 5804 5134 4806 4307 2818 1959 1944 1754 1427 1279 1143 1115 552 64 --16414 --
NM_004364chr1951207 1183 1120 378 160 ------
NM_004369chr2192 --129 1562
NM_004370chr621958 1831 --11486 --
NM_004376chr1031449 422 319 --11557 11308
NM_004377chr22127 ------
NM_004379chr22392 358 ------
NM_004380chr1662410 2210 2101 1847 1702 27 11726 ----
NM_004381chr61159 --1172 --
NM_004384chr522318 2092 1947 --12025
NM_004389chr21590 1634 ----
NM_004391chr3131753 1705 1511 1432 1417 1410 1369 1295 807 577 129 99 68 --11884 --
NM_004392chr131349 ------
NM_004395chr55699 681 580 267 27 --2693 537 --
NM_004397chr1184017 3754 3473 3113 2977 1358 935 602 ------
NM_004411chr71303 ------
NM_004414chr211160 11593 ----
NM_004417chr52420 52 ------
NM_004418chr2196 ------
NM_004420chr11202414 2380 2371 2272 2219 2109 1897 1890 1884 1877 1870 1823 1635 1586 843 836 768 454 421 283 ------
NM_004422chr173369 318 165 ------
NM_004423chr3112699 1074 1013 904 716 676 590 510 419 391 234 1383 2459 258 1295
NM_004425chr1----185 --
NM_004426chr1241588 1575 1409 520 ------
NM_004427chr13792 464 294 ------
NM_004429chrX101331 1029 455 327 313 247 184 141 81 54 1945 ----
NM_004430chr892607 2193 1107 1068 957 791 781 139 128 22769 815 1951 12173
NM_004432chr92633 398 11843 ----
NM_004433chr16626 604 547 255 199 87 ------
NM_004437chr172413 2407 1076 740 566 486 451 --2753 294 --
NM_004438chr273205 2110 1015 793 648 543 344 --22825 2443 --
NM_004440chr631783 281 155 --11794 --
NM_004441chr371291 1275 481 467 447 427 417 ------
NM_004443chr33587 239 227 --1188 --
NM_004446chr1231 23 ------
NM_004450chr141320 ------
NM_004454chr342029 656 153 108 21648 275 1534 --
NM_004458chrX42282 889 372 57 1222 12036 11774
NM_004459chr171536 ------
NM_004464chr494059 4010 3644 3553 3350 1189 1151 907 442 --1212 --
NM_004468chr14605 111 72 57 ------
NM_004474chr13696 379 37 ------
NM_004484chrX1320 ------
NM_004485chr1173917 3804 3551 3386 3210 2984 2890 2859 2757 2682 1165 1066 919 777 442 101 27 11711 33753 2825 1050 1375
NM_004486chr951195 838 751 118 65 1863 175 2779 91
NM_004487chr32898 56 --1906 --
NM_004494chr1121242 1235 1181 1014 968 937 490 369 339 212 196 120 --2945 95 --
NM_004496chr142314 286 1416 ----
NM_004497chr192738 293 --2605 581 --
NM_004500chr1441907 1641 1267 752 11984 1251 --
NM_004502chr172556 374 ------
NM_004503chr125811 252 218 32 23 --2780 338 --
NM_004504chr242696 2014 1921 1900 --163 --
NM_004505chr171421 --31381 548 51 --
NM_004514chr1772848 2539 2024 1196 969 514 109 ----1152
NM_004519chr82159 22 ------
NM_004521chr10296 88 ------
NM_004524chr17----2301 220 --
NM_004525chr21572 11262 ----
NM_004527chr1741060 600 202 80 2517 192 ----
NM_004529chr921313 505 ------
NM_004535chr2051722 1439 1310 627 593 11149 ----
NM_004540chr212167 148 ------
NM_004556chr63929 724 38 ------
NM_004571chr2183279 2960 2734 2370 2214 1182 567 290 ----12175
NM_004575chr461078 1048 573 244 69 30 ------
NM_004583chr174630 606 288 264 ------
NM_004586chrX44731 4018 1474 1210 34617 950 347 1432 24441 833
NM_004588chr1163659 3466 3097 1628 1099 651 12936 --22631 679
NM_004598chr572926 2120 1177 1013 706 590 263 1339 1356 --
NM_004599chr224436 147 30 22 2574 162 ----
NM_004603chr741063 976 300 135 --11125 --
NM_004612chr964709 3869 2962 1416 399 27 --13773 --
NM_004630chr1191035 1021 943 902 754 397 369 306 273 ------
NM_004631chr1--11239 1991 --
NM_004637chr3101287 1253 1237 1157 1114 889 453 439 242 81 --21203 467 --
NM_004640chr61137 ------
NM_004642chr12183 ------
NM_004643chr143742 634 308 ------
NM_004645chr171828 ------
NM_004655chr1711209 ------
NM_004656chr361227 1218 1140 1017 861 78 11143 ----
NM_004658chr123416 87 52 --196 --
NM_004660chrY126 ------
NM_004686chr81436 1449 2492 347 --
NM_004687chr1741344 469 270 132 --22001 514 --
NM_004694chr17191 --1552 --
NM_004698chr1131 2186 177 ----
NM_004703chr1711682 22351 1567 --12182
NM_004717chr731523 1502 1386 ------
NM_004718chr21646 --144 --
NM_004723chr11985 --1855 --
NM_004725chr1031527 1421 479 --1337 --
NM_004726chrX55678 4699 4493 1667 659 1277 15300 --
NM_004730chr541927 1518 739 88 ------
NM_004734chr1321311 104 1268 2144 118 --
NM_004736chr182086 1991 1894 1772 1727 1420 663 72 11717 1748 --
NM_004738chr2072447 1605 1026 500 354 337 133 ------
NM_004742chr321245 182 1434 1301 --
NM_004745chr8115425 5015 4376 4291 2425 2325 1911 1884 1591 607 574 46603 6140 5279 5175 14510 --
NM_004747chr104546 534 390 145 11149 ----
NM_004748chr1524098 2868 23774 1147 22934 1330 --
NM_004755chr142871 403 ------
NM_004760chr73760 666 66 11555 ----
NM_004765chr16----165 --
NM_004768chr111189 ------
NM_004772chr551410 1400 585 323 237 ------
NM_004774chr1752743 2489 2210 862 343 ----1608
NM_004775chr185827 497 198 162 101 ------
NM_004781chr121657 319 11509 2629 41 --
NM_004781chr121657 319 11509 2629 41 --
NM_004784chr4----197 --
NM_004789chr91368 ------
NM_004792chr2171 ------
NM_004796chr141547 ------
NM_004798chr20123506 2932 2869 2549 681 375 344 328 313 296 187 127 ------
NM_004807chr271646 1052 908 487 481 294 29 --11899 --
NM_004808chr1093265 2933 2648 2592 2542 2304 2162 1209 296 ------
NM_004811chr11123 ------
NM_004814chr1197 ------
NM_004815chr184539 4357 4131 3223 1462 859 312 91 14066 24446 745 --
NM_004821chr52784 42 --2742 328 --
NM_004822chr17213828 3683 3655 3529 3112 2875 2645 1430 1388 1044 949 834 782 776 770 748 584 537 523 281 166 ------
NM_004824chr6----21145 1015 --
NM_004827chr441852 1519 293 96 31858 1831 1348 ----
NM_004831chr193780 766 721 ------
NM_004834chr253349 2871 2753 1348 149 1162 33411 3069 2679 --
NM_004836chr22297 180 ------
NM_004841chr14804 324 126 73 11156 1974 --
NM_004845chrX73445 3274 2888 1635 1083 1062 549 21388 848 11559 --
NM_004849chr621684 186 --165 --
NM_004859chr1742824 1906 764 259 ------
NM_004860chr174367 230 191 25 ------
NM_004863chr1495233 4968 4200 3738 3510 3266 1840 857 747 11091 25060 909 1531
NM_004865chr61145 ------
NM_004866chr544966 3531 1077 198 13594 --13969
NM_004869chr1821149 180 ------
NM_004871chr17114239 3738 3517 3118 3021 1307 1286 1272 1072 843 463 33755 3588 1651 --13864
NM_004872chr12298 51 ------
NM_004874chr8173 ------
NM_004879chr114659 353 322 126 ------
NM_004884chr1591672 1568 1440 1170 571 550 535 243 131 1510 ----
NM_004887chr531019 1000 971 ------
NM_004890chr17396 28 21 ------
NM_004893chr5277 70 --197 --
NM_004896chr104610 462 46 37 ----1396
NM_004898chr472726 2535 2279 2079 874 478 471 1366 ----
NM_004902chr201616 ------
NM_004904chr7136001 5953 5867 5687 5233 4780 4761 4511 1719 1004 580 571 100 24495 684 44962 4730 4699 318 11846
NM_004915chr212195 117 1338 ----
NM_004926chr1491749 1463 694 612 606 571 556 67 39 --31614 412 126 --
NM_004930chr1289 77 ------
NM_004947chr382585 1962 1718 995 868 720 547 209 --32187 2130 424 --
NM_004952chr19845 765 703 673 666 327 312 292 99 --2719 159 --
NM_004956chr723254 877 23466 3156 ----
NM_004959chr961426 1354 1156 939 367 145 --1386 --
NM_004960chr161135 ------
NM_004961chrX91348 1309 988 522 516 242 165 58 31 11060 2602 567 --
NM_004964chr12557 58 ------
NM_004965chr21141 1632 ----
NM_004966chr10--1738 1141 --
NM_004968chr74683 643 633 454 ------
NM_004969chr10--1211 ----
NM_004972chr91745 ------
NM_004973chr621673 1604 --11113 --
NM_004975chr202242 220 ------
NM_004976chr11225060 4882 4766 4641 4433 4421 4289 4205 4175 3884 3779 3716 3299 3170 1990 1976 1500 1399 1101 465 411 181 14486 ----
NM_004977chr192536 73 1195 --1370
NM_004978chr151551 1353 505 218 58 --11531 1443
NM_004979chrX91061 793 786 445 314 298 253 244 32 --2101 50 --
NM_004985chr1264514 3223 697 552 509 355 ------
NM_004991chr32399 171 ------
NM_004992chrX368514 7971 7794 7313 7050 6980 6974 6804 6782 6684 6415 6164 5922 5877 5824 5434 5275 3332 3190 3073 3007 3001 2664 2512 2505 1995 1811 1565 1506 1371 1287 1270 1225 955 675 265 57912 7090 6996 3049 66 37884 2520 1302 --
NM_004992chrX368514 7971 7794 7313 7050 6980 6974 6804 6782 6684 6415 6164 5922 5877 5824 5434 5275 3332 3190 3073 3007 3001 2664 2512 2505 1995 1811 1565 1506 1371 1287 1270 1225 955 675 265 57912 7090 6996 3049 66 37884 2520 1302 --
NM_004993chr1431368 1352 507 ------
NM_004995chr1491345 1279 399 371 251 236 149 119 26 ------
NM_004998chr151210 179 ----
NM_005010chr722035 398 ------
NM_005016chr12----128 --
NM_005020chr74176 152 82 73 ------
NM_005022chr172177 21 --149 --
NM_005027chr19111118 1106 1027 958 909 388 353 216 194 147 34 ------
NM_005028chr103858 741 116 --21562 333 11633
NM_005055chr113169 78 39 ------
NM_005056chr12115015 4638 4156 2030 1787 1331 861 663 481 391 191 24439 375 45577 5268 4971 4141 --
NM_005063chr10103764 3246 3087 1439 1392 1132 957 603 263 237 1270 23002 2591 --
NM_005065chr14104870 4806 4196 4037 3513 3309 1853 1459 640 634 13312 1733 --
NM_005068chr611460 ------
NM_005070chr2----1235 --
NM_005074chr6--143 ----
NM_005076chr1124021 3501 3199 2952 2886 1265 995 918 851 618 138 63 23577 2941 ----
NM_005078chr1561474 1151 498 465 330 175 11180 11772 --
NM_005079chr872850 2681 2369 2272 2105 383 172 ----1193
NM_005080chr225745 275 108 100 31 ------
NM_005087chr31320 ------
NM_005095chr161837 875 802 640 591 97 32241 2216 1428 ----
NM_005096chrX71212 1191 1113 436 375 280 117 1817 ----
NM_005099chr171140 995 518 385 378 128 23 11337 ----
NM_005105chr141529 805 767 746 ------
NM_005109chr362530 2281 2137 2039 616 158 12479 32258 2227 1000 --
NM_005110chr54734 660 626 575 ------
NM_005116chr20154230 4188 3964 3860 3538 3026 1761 1485 976 963 732 392 318 270 216 1190 1209 --
NM_005117chr11123 --1875 --
NM_005119chr161305 1186 1165 930 431 153 31287 1211 1068 ----
NM_005121chr1773475 3327 2995 2390 1526 1503 1339 13261 1493 --
NM_005124chr61135 --2322 178 --
NM_005126chr312039 --1603 --
NM_005137chr22102338 2285 2110 1687 881 587 513 433 244 84 1975 --1989
NM_005146chr112245 215 159 ----
NM_005155chr66694 665 472 254 171 30 ------
NM_005156chr984959 4740 4704 3494 1305 468 200 93 24563 3351 31926 1688 621 13714
NM_005160chr22136495 6368 6271 6036 6011 5641 5002 4638 2633 2061 260 131 102 26100 1629 36646 5864 4906 --
NM_005168chr221119 402 11421 ----
NM_005169chr116481 416 252 131 70 51 ------
NM_005178chr192161 66 ------
NM_005180chr103365 166 37 ------
NM_005181chr8268 22 181 ----
NM_005182chr166614 569 179 162 130 113 --1427 --
NM_005184chr1991283 1155 1144 453 351 290 230 203 176 ------
NM_005187chr16111652 1551 1433 1400 1370 1340 1315 806 594 334 161 ------
NM_005191chr32963 944 3937 367 113 21043 67 --
NM_005197chr14145508 5499 5274 4941 4726 4533 3827 2494 2148 1139 508 425 184 167 14383 14981 --
NM_005201chr3--1276 ----
NM_005202chr17898 889 810 778 715 624 263 141 21797 1441 --
NM_005203chr101406 --1161 --
NM_005206chr1731057 928 409 ------
NM_005207chr2253440 2311 1107 795 54 --11250 13327
NM_005215chr181654 ------
NM_005219chr551751 1565 1384 1376 460 --21659 1118 --
NM_005220chr1791137 1093 959 487 223 128 122 110 23 ------
NM_005222chr72360 170 ----1371
NM_005229chrX11128 --21036 27 --
NM_005230chr12----1576 --
NM_005233chr352345 2194 2187 1762 1005 12554 ----
NM_005235chr2167710 7613 7432 7137 6734 5514 5475 5251 2638 2601 2162 1957 1742 1582 446 353 16446 16540 --
NM_005238chr1182866 2798 2660 2573 2496 2479 1102 957 --1865 --
NM_005240chr14740 684 552 193 2806 712 ----
NM_005241chr31560 11241 2879 484 --
NM_005243chr22--1290 1245 --
NM_005250chr1641935 1468 1411 1205 ------
NM_005252chr14----1196 --
NM_005254chr1541320 1282 432 416 --11222 --
NM_005256chr111892 1636 ----
NM_005257chr1811177 1930 ----
NM_005259chr22992 300 ------
NM_005261chr82867 27 ------
NM_005271chr1051185 1005 978 262 33 --189 --
NM_005274chr11156 ----139
NM_005276chr123629 616 504 --31537 576 493 --
NM_005276chr123629 616 504 --31537 576 493 --
NM_005311chr741910 972 853 734 --21933 406 --
NM_005312chr9111860 1831 1698 1067 1048 973 736 663 543 303 179 1709 ----
NM_005313chr1541100 1007 877 96 1867 1318 --
NM_005316chr111952 --1918 --
NM_005324chr1712054 ------
NM_005327chr42249 201 ------
NM_005329chr1622263 473 ------
NM_005334chrX101717 1518 1131 585 484 458 388 134 126 73 --21652 569 --
NM_005336chr2102155 1999 1915 1724 873 863 651 434 402 118 --22204 1795 --
NM_005338chr794035 3859 3405 1617 1270 1168 1100 697 583 11294 31513 1139 176 --
NM_005339chr453637 2620 606 155 38 14313 21719 707 --
NM_005342chrX3446 436 23 ------
NM_005347chr9--11653 ----
NM_005359chr18115973 5827 4842 4814 4350 3980 2386 2301 2160 1167 186 34619 1684 301 --1669
NM_005370chr192965 65 11170 2823 521 --
NM_005374chr17101978 1783 1582 1517 613 440 433 424 368 223 11791 ----
NM_005376chr14412 372 237 91 ------
NM_005381chr22125 23 ------
NM_005386chr205854 715 709 585 268 --2206 195 --
NM_005387chr112606 73 --1229 --
NM_005392chr951186 486 179 148 112 ------
NM_005398chr101260 --11130 --
NM_005399chr1114243 3209 2963 2924 2795 1324 704 613 592 553 46 23583 3456 23268 1630 --
NM_005400chr282664 2456 657 444 404 290 145 58 --12868 --
NM_005407chr1471298 1287 1264 1249 407 312 286 ------
NM_005412chr124491 142 109 45 ------
NM_005413chr24364 87 78 29 --149 --
NM_005415chr21231 ----1768
NM_005429chr4186 ------
NM_005430chr1281043 846 817 799 389 369 200 166 --2652 258 --
NM_005433chr1832536 1944 863 12196 ----
NM_005436chr1053824 2996 2688 1449 866 --54086 3094 2887 2787 1634 --
NM_005437chr101223 31164 1043 307 ----
NM_005439chr123505 357 129 --2386 168 --
NM_005440chr17133231 3088 2931 2569 2557 2525 2483 2332 1287 883 508 432 187 22490 1340 12789 --
NM_005458chr952425 2143 1797 903 447 --12134 --
NM_005461chr2051523 1337 1267 739 347 ------
NM_005465chr131912 1636 136 --11667 --
NM_005474chr17101268 1115 1059 570 564 552 522 420 274 118 11481 21530 516 --
NM_005475chr1272690 2606 1203 1075 983 974 147 23046 208 32751 1131 811 --
NM_005477chr1582425 2395 1950 895 863 835 43 22 12289 22282 1004 --
NM_005477chr1582425 2395 1950 895 863 835 43 22 12289 22282 1004 --
NM_005493chr6------1207
NM_005497chr1784918 4784 2447 1731 1643 1455 1012 880 --21552 1426 --
NM_005499chr191125 130 1208 --
NM_005502chr922896 1099 12973 23018 2341 12237
NM_005505chr123682 330 64 --1880 --
NM_005506chr452931 2721 2059 252 79 ------
NM_005507chr114446 419 330 73 --2185 126 --
NM_005517chr15419 358 351 252 229 1389 ----
NM_005520chr51770 ------
NM_005522chr761435 1282 386 314 246 39 ----1476
NM_005523chr751492 601 384 313 246 ------
NM_005534chr213492 387 98 ------
NM_005542chr72197 128 11562 11335 --
NM_005544chr2155 ------
NM_005552chr142146 84 ------
NM_005558chr110871 785 405 356 321 314 194 178 109 64 --186 11008
NM_005562chr1----21217 184 --
NM_005563chr13717 618 35 ------
NM_005565chr52405 104 ------
NM_005569chr2251234 991 502 258 50 1565 ----
NM_005578chr374810 4797 4783 4082 4036 3874 291 ------
NM_005581chr195419 407 127 102 95 ------
NM_005584chr132253 36 ------
NM_005587chr151833 --2205 120 --
NM_005595chr12365 271 --1977 --
NM_005596chr935026 1105 340 1275 ----
NM_005598chr1161593 1586 1557 1526 1406 1384 1373 1187 1055 682 559 416 348 340 160 42 ------
NM_005603chr1811534 --1141 --
NM_005604chr64702 73 61 45 3777 747 132 ----
NM_005607chr83864 785 33 1977 ----
NM_005610chr12101 36 ------
NM_005611chr16----2918 156 --
NM_005614chr761020 885 689 673 140 68 ------
NM_005619chr191406 ------
NM_005629chrX121004 836 828 513 501 362 324 298 289 71 49 30 ------
NM_005634chrX3553 238 26 ------
NM_005637chr1821841 835 --1628 --
NM_005638chrX21656 118 11540 ----
NM_005639chr1221552 171 ----11332
NM_005643chr61550 --1208 --
NM_005644chr12361 355 ------
NM_005649chr51471 ------
NM_005650chr22----21084 402 --
NM_005652chr1671210 1170 1164 1024 1010 433 56 1818 ----
NM_005653chr12360 45 34 ------
NM_005656chr2151477 1189 1151 458 344 --1203 --
NM_005665chr154007 3844 3072 1888 719 --24785 3658 --
NM_005667chr21348 --1374 --
NM_005669chr532320 2287 1966 12234 ----
NM_005687chr22332 42 ------
NM_005708chr131146 ------
NM_005717chr11305 1479 ----
NM_005721chr21820 ------
NM_005722chr231971 1881 109 ----1445
NM_005730chr12133462 3406 3289 3252 3206 3097 2999 2952 2722 2607 2301 1267 1043 22891 1155 ----
NM_005731chr24380 281 266 88 ------
NM_005735chr21118 --165 --
NM_005736chr1061536 1449 1299 1074 990 24 ------
NM_005737chr262698 2080 711 577 522 390 11798 ----
NM_005742chr2----2527 342 --
NM_005746chr762526 2401 2316 605 224 126 --12516 --
NM_005748chr1223439 2229 1475 ----
NM_005749chr17168 1224 ----
NM_005756chrX2560 263 --11350 --
NM_005759chr284137 3774 3637 3480 3396 875 441 346 13053 24483 611 11886
NM_005768chr12154 --169 --
NM_005776chr143557 539 244 ----1132
NM_005777chr3138 ------
NM_005778chr33481 370 314 1168 ----
NM_005779chr553325 3292 851 772 30 13261 13421 11389
NM_005786chr181921 --1395 --
NM_005789chr1792098 1570 1514 1507 813 718 679 595 114 --31658 1492 173 --
NM_005795chr243014 816 564 389 --1758 --
NM_005796chr16267 46 ------
NM_005801chr174792 756 69 60 1507 1149 --
NM_005802chr91837 1114 ----
NM_005808chr382999 2708 2389 1348 906 801 342 44 --11157 --
NM_005814chr181241 950 937 591 524 218 73 67 ------
NM_005819chr132322 387 212 --23063 2630 --
NM_005822chr62429 37 --22198 1644 --
NM_005826chr11175 1220 ----
NM_005828chr17154804 4635 4569 4124 3905 3758 3737 1787 1602 1312 612 564 251 245 238 13971 25017 1796 --
NM_005832chr331439 1066 975 ------
NM_005834chrX2236 174 ------
NM_005835chr6------1207
NM_005839chr12833 251 ------
NM_005840chrX236823 6526 6469 6285 5494 4839 2597 2579 2156 2038 1751 1322 1302 918 674 597 586 579 533 502 341 200 35 15202 22890 459 26235 2303
NM_005842chr133691 535 262 ------
NM_005850chr1181 --1220 --
NM_005851chr113411 314 118 ------
NM_005852chr1771124 1103 1075 1056 1046 168 135 --2128 101 --
NM_005862chr311035 --1138 --
NM_005868chr772186 2130 2085 549 475 466 204 ------
NM_005876chr25786 759 746 680 564 ------
NM_005880chr1621383 244 ------
NM_005884chr197784 673 627 590 538 126 87 ------
NM_005885chr511246 134 ----
NM_005898chr1183119 2971 2763 2505 2087 1975 258 95 --11014 --
NM_005899chr1711361 ------
NM_005900chr41114 ------
NM_005902chr15134599 4557 4286 3705 3695 3273 2888 1862 1425 1077 542 477 363 --33463 683 214 --
NM_005906chr61303 ------
NM_005909chr574256 4087 4029 3972 3335 3251 691 --11597 --
NM_005910chr17153717 3706 3633 3281 3202 3074 3002 1527 1505 1202 1146 1032 863 633 398 1823 23458 1247 --
NM_005911chr23943 101 80 1487 11071 --
NM_005920chr1203695 3592 3264 2803 2718 2519 2417 2371 1486 1271 1233 1212 1197 1175 1148 1141 878 827 598 227 --13484 13517
NM_005927chr531033 1014 925 11006 ----
NM_005932chr13------122
NM_005933chr11122836 2703 2424 2417 2242 2008 1084 1044 721 712 377 234 --12128 --
NM_005934chr1992520 1971 1785 1768 1703 1050 940 742 300 ------
NM_005935chr484387 3563 2124 1642 1550 886 821 805 12108 23264 1466 --
NM_005937chr17144008 3958 3924 3905 3846 3650 3404 2729 2582 2574 1110 691 515 198 11078 2622 494 --
NM_005938chrX81324 1301 1258 1085 1057 534 353 71 1443 ----
NM_005941chr843592 3321 2986 838 --31676 1015 821 --
NM_005943chr691509 1455 1410 1390 1320 645 513 191 156 ------
NM_005944chr32331 202 --11012 --
NM_005955chr1165202 5087 4974 4784 4661 4619 4565 3989 3951 3405 2175 1486 1197 471 418 23 11338 ----
NM_005957chr1184890 4458 3561 3401 3209 3143 3118 1520 1503 1489 1369 1036 1027 700 670 461 89 36 23185 645 --14478
NM_005962chr1092253 1497 1454 1439 821 706 386 321 96 --11681 --
NM_005962chr1092253 1497 1454 1439 821 706 386 321 96 --11681 --
NM_005964chr1751228 1049 629 431 181 11397 21031 293 --
NM_005968chr19136 ------
NM_005977chr131239 ------
NM_006015chr161248 1007 889 247 164 130 174 1927 --
NM_006030chr371706 1658 1169 1124 514 240 46 ------
NM_006032chr142176 160 --186 --
NM_006034chr11122404 2371 1746 1587 1568 974 688 571 493 360 261 67 ------
NM_006036chr261917 1578 851 486 339 293 2431 233 ----
NM_006037chr264823 4677 4195 4106 3332 3218 --13184 --
NM_006038chr2071863 1390 1361 709 568 514 364 1735 1502 --
NM_006039chr1771046 949 757 447 358 305 220 ------
NM_006040chr1671242 887 558 491 439 119 48 ------
NM_006047chr2043369 3206 2750 2511 --11200 --
NM_006048chr12921 432 --2495 334 --
NM_006054chr1141321 1289 513 330 1155 1523 --
NM_006070chr32367 278 ------
NM_006071chr22--1251 ----
NM_006077chr106644 153 146 105 75 25 ------
NM_006079chr6--2231 73 1286 --
NM_006091chr15111606 1399 1290 715 577 566 551 491 471 221 158 169 2667 626 157
NM_006094chr831938 622 590 --1683 --
NM_006095chr433302 3007 35 33977 1676 917 11613 --
NM_006096chr841276 412 237 65 1671 1500 --
NM_006099chr14813 359 342 84 --1189 --
NM_006106chr1132634 2513 1247 --1190 --
NM_006113chr141942 1816 624 137 31870 310 131 ----
NM_006133chr1182103 1962 1698 957 869 670 492 156 --1895 --
NM_006141chr162933 213 --1197 --
NM_006145chr192405 333 --1857 --
NM_006148chr17102434 2385 2209 2072 810 775 500 305 200 124 12127 11947 --
NM_006153chr31246 ------
NM_006154chr1522498 1902 12558 1334 --
NM_006156chr14----122 --
NM_006157chr111378 1276 ----
NM_006158chr81173 --11523 --
NM_006159chr121557 ------
NM_006160chr1771578 1385 1304 628 462 293 266 ------
NM_006162chr185679 609 381 45 24 11427 ----
NM_006166chr123786 389 263 12200 12228 --
NM_006176chr115705 597 540 192 55 --1297 --
NM_006177chr142989 744 1212 ----
NM_006178chr1741493 337 317 157 ------
NM_006180chr951515 1445 229 102 39 --1306 --
NM_006186chr22147 140 1458 ----
NM_006187chr12103211 2998 2805 1297 872 846 830 804 415 342 --21999 395 --
NM_006191chr125919 845 284 152 45 --1688 --
NM_006194chr143298 104 87 11316 ----
NM_006195chr941262 992 920 484 ------
NM_006201chrX41094 881 849 51 --1221 --
NM_006203chr554155 3608 1583 1274 550 --23628 863 --
NM_006206chr452900 2240 452 199 43 ------
NM_006216chr22592 517 --2652 60 --
NM_006223chrX1126 --1529 --
NM_006224chr1772230 2135 1912 1583 908 868 797 ------
NM_006237chr1332116 728 127 12153 ----
NM_006239chr4--172 ----
NM_006241chr312423 1789 1829 --
NM_006243chr12733 364 ------
NM_006244chr115588 490 457 200 95 --156 --
NM_006245chr62345 173 1871 ----
NM_006246chr141246 ------
NM_006251chr54800 717 499 492 23175 428 ----
NM_006252chr156323 6311 6242 978 346 36256 6180 881 11888 16480
NM_006253chr1241143 939 933 873 --21222 360 --
NM_006256chr12464 62 --1847 147
NM_006265chr83987 967 520 1485 181 --
NM_006267chr22610 234 ------
NM_006268chr1191109 983 856 470 293 218 176 94 79 --2974 735 --
NM_006275chr2062378 2275 918 675 193 82 1678 ----
NM_006281chr81751 1393 ----
NM_006281chr81751 1393 ----
NM_006282chr20114716 3422 3412 3258 1650 1258 1132 710 548 455 269 14287 34656 3577 1534 --
NM_006283chr8144893 4795 3859 3570 3557 3013 1865 1555 1369 780 757 492 346 90 34163 783 260 13259 --
NM_006293chr155885 835 751 657 369 ------
NM_006306chrX184974 4946 4934 4577 4478 4055 3699 2283 1530 1466 1046 1017 460 305 295 262 100 35 --34697 1518 990 --
NM_006307chrX131 ------
NM_006309chr3133 ------
NM_006313chr1221225 595 --1259 --
NM_006320chr43767 412 54 ------
NM_006321chr351844 1620 380 215 119 ----1143
NM_006322chr131201 ------
NM_006328chr111629 ------
NM_006330chr81588 ------
NM_006334chr91208 ------
NM_006336chr961421 1234 458 322 255 83 ------
NM_006340chr172381 333 --127 --
NM_006348chr71237 --1147 --
NM_006352chr121559 406 21283 1269 ----
NM_006357chr2----1478 --
NM_006359chrX31714 1677 491 --31603 1569 578 --
NM_006361chr1791929 1692 1643 675 578 440 427 120 105 1770 21842 398 --
NM_006367chr13819 684 32 ------
NM_006369chr12294 136 --1399 --
NM_006372chr6--1109 ----
NM_006375chrX21274 225 ------
NM_006377chr951018 513 324 312 304 --1111 --
NM_006378chr941025 319 289 141 --1342 --
NM_006379chr73331 307 119 11891 ----
NM_006380chr1743007 2941 320 144 13150 13406 --
NM_006382chr172271 81 ------
NM_006386chr2241981 614 354 77 ------
NM_006389chr1171271 559 536 405 186 121 38 --11290 --
NM_006390chr1251501 1390 740 664 159 ------
NM_006393chr1053394 3152 863 274 161 1324 13978 --
NM_006400chr12241 35 180 ----
NM_006401chr91180 ------
NM_006405chr14136 ------
NM_006407chr321396 1116 ------
NM_006411chr65355 181 171 125 91 ------
NM_006420chr2022701 346 13247 --12301
NM_006421chr83796 164 36 ------
NM_006424chr471859 1685 1491 481 431 194 151 --180 --
NM_006427chr14----1159 --
NM_006430chr22484 396 ------
NM_006434chr1021188 538 --12297 12653
NM_006439chr41525 ------
NM_006449chr231525 1465 543 --11480 --
NM_006459chr1031740 453 117 11650 11303 --
NM_006460chr1721549 1176 1302 11532 --
NM_006461chr17----132 --
NM_006464chr284401 4200 4044 3771 1663 1613 1476 1470 31761 504 264 ----
NM_006465chr1562343 1999 867 812 596 363 --12350 --
NM_006478chr22391 63 41 --135 --
NM_006482chr1242864 808 778 397 1386 ----
NM_006489chr1481743 1641 1540 1430 1320 1271 1261 35 --21737 707 --
NM_006496chr12491 335 --11458 --
NM_006497chr176758 649 560 279 269 133 ------
NM_006500chr1141009 541 127 23 ------
NM_006510chr641036 853 802 410 ----1759
NM_006516chr1101513 1484 1477 1332 1052 1029 1014 641 519 122 ------
NM_006517chrX91956 1480 727 578 266 250 136 43 27 12260 22019 1539 --
NM_006526chr2021943 1483 ------
NM_006529chr421682 1521 ------
NM_006532chr1971774 1688 1465 1445 590 290 132 --1571 --
NM_006534chr2073080 2603 2590 2430 2282 2124 205 12562 31127 855 476 123
NM_006538chr2103736 3631 3613 3295 2955 2917 2622 981 532 431 11373 23442 1205 --
NM_006540chr821158 186 ------
NM_006544chr1486123 5570 5296 5254 4386 1671 903 509 --15125 --
NM_006546chr17196219 5988 5954 5889 5510 5361 5213 4559 4381 4358 4154 4124 2659 2497 2154 1554 960 466 215 11924 35318 5139 4346 35577 2268 1868
NM_006547chr731726 277 152 --11417 11563
NM_006548chr3--11351 2367 311 --
NM_006549chr1232512 2464 2450 --22845 1825 --
NM_006558chr81496 --185 --
NM_006560chr112536 110 ------
NM_006561chr10115045 4919 4268 4156 2253 2215 2008 1967 1908 1408 1186 --11440 --
NM_006565chr164520 448 296 74 ------
NM_006574chr3168 ------
NM_006584chr17124 ------
NM_006589chr15564 440 144 130 78 ------
NM_006595chr1151908 1902 1642 1467 436 42042 1890 444 141 21493 1302 --
NM_006599chr16107748 7560 7404 7393 7143 5906 5154 3159 2587 844 15651 37494 1774 876 --
NM_006601chr121316 ------
NM_006602chr20--1204 ----
NM_006603chrX1387 ------
NM_006609chr221059 542 1202 11948 11003
NM_006618chr141595 1052 432 332 ------
NM_006620chr63873 166 51 --11868 --
NM_006621chr141825 1599 1443 96 1483 31640 1630 89 --
NM_006622chr5132 ------
NM_006624chr1031721 1604 852 ------
NM_006625chr12221 150 ------
NM_006625chr12221 150 ------
NM_006625chr12221 150 ------
NM_006626chr972679 2602 1793 1049 957 942 236 ------
NM_006628chr1594026 3657 3515 3224 3096 1604 1390 1178 746 23196 49 14647 13263
NM_006650chr5163909 3782 3659 3571 3530 3314 2626 879 698 637 621 589 560 256 168 118 ------
NM_006651chr4111493 1324 1223 1199 1067 951 526 319 244 68 39 ------
NM_006653chr6161 ------
NM_006654chr1253545 3532 1847 553 358 24777 537 34152 4142 92 1174
NM_006662chr163301 258 128 ------
NM_006667chrX2869 449 --1400 --
NM_006668chr147404 370 158 109 79 56 28 ------
NM_006675chr12163262 3017 2909 2818 2604 2479 1311 1142 1112 1022 986 851 464 311 214 98 ------
NM_006681chr41112 ------
NM_006690chr20102011 1982 1923 1570 1482 561 503 434 351 302 --11969 --
NM_006694chr13288 274 111 ------
NM_006698chr2071263 424 413 388 370 361 267 1438 1455 --
NM_006699chr142618 2164 556 97 ----12301
NM_006704chr13----1122 --
NM_006706chr51769 --1859 --
NM_006709chr6----1119 --
NM_006711chr164334 137 99 25 ------
NM_006717chr933422 1274 1152 --31210 1139 196 13410
NM_006722chr332391 2359 507 22398 2038 1452 --
NM_006729chrX135453 5405 5344 4919 4437 4170 3774 3550 1039 937 928 422 168 14989 25336 3740 --
NM_006732chr1972127 1836 1756 1487 1338 557 196 1587 31737 1541 475 --
NM_006734chr611320 11112 11293 --
NM_006735chr72361 118 --2110 43 1232
NM_006736chr241512 1381 740 601 ------
NM_006738chr15124650 4628 4398 3194 3158 1865 1836 1453 1243 863 564 54 ------
NM_006750chr16158002 7160 7025 6673 6067 5633 5456 3179 1746 1724 1152 816 516 427 93 --37236 5931 2713 26643 5000
NM_006751chr22918 265 ------
NM_006754chr71814 ------
NM_006756chr831400 1301 1292 --1144 --
NM_006761chr174743 734 722 702 --2760 59 --
NM_006763chr151973 1711 1623 1432 453 11561 ----
NM_006766chr8102655 2630 2621 2118 2103 1649 949 653 626 606 21047 537 42521 892 644 442 --
NM_006772chr6161694 1568 1530 1426 1404 1395 1311 1284 1239 1203 1186 671 563 467 244 196 --3557 511 279 --
NM_006775chr611998 ----11042
NM_006777chrX1357 --11084 --
NM_006788chr1871872 1840 1812 1805 567 487 288 --1149 --
NM_006791chr151166 ------
NM_006800chrX1620 ------
NM_006802chr12942 383 185 3369 285 95 --
NM_006803chr821751 120 ------
NM_006805chr551445 1277 178 147 72 --11072 --
NM_006809chr203727 609 27 --1128 --
NM_006813chr62636 48 ------
NM_006814chr2072441 2254 2137 972 922 570 245 1837 --1150
NM_006823chr851340 1074 530 329 188 ------
NM_006825chr122956 226 1108 1382 --
NM_006826chr211106 1414 ----
NM_006827chr14113293 3032 2872 2707 2241 925 758 477 459 434 310 13039 32251 780 746 --
NM_006838chr1241709 1547 539 221 ------
NM_006841chr37776 610 598 509 284 272 62 ------
NM_006843chr124436 429 345 47 ------
NM_006851chr1232807 2408 2084 --12605 --
NM_006852chr1782779 2562 2538 2530 933 873 598 554 ------
NM_006854chr721562 420 --21713 387 --
NM_006856chr1251067 885 736 329 288 ------
NM_006857chr21108 --2743 361 --
NM_006870chr202812 50 ------
NM_006874chr411218 1211 ----
NM_006884chr341345 761 132 111 --186 --
NM_006885chr1643101 1367 1045 342 21080 1053 44213 1566 1355 328 --
NM_006887chr25651 458 199 180 61 ------
NM_006888chr1483455 3174 3131 3009 2577 2191 1022 549 --33253 2697 66 1262
NM_006898chr2296 39 1579 ----
NM_006899chr202240 49 ------
NM_006908chr741395 1250 1002 34 --1979 --
NM_006913chr65435 94 87 77 67 ------
NM_006920chr231958 706 491 1125 2158 80 --
NM_006922chr242490 2422 2308 155 ------
NM_006924chr1783761 2966 2908 1731 1381 695 162 139 23782 994 13724 --
NM_006930chr541871 1860 1698 1233 11282 11955 --
NM_006931chr1261622 1576 1550 294 205 46 ----21611 785
NM_006937chr172563 138 ------
NM_006939chr14----1423 --
NM_006940chr1221600 1450 --11919 --
NM_006941chr2291133 1036 891 829 805 791 384 375 37 2984 811 1990 --
NM_006943chr20203308 3299 3041 2837 2819 2034 964 840 798 757 529 509 450 356 326 312 304 219 158 72 --2480 200 --
NM_006946chr113422 402 78 ------
NM_006950chrX9902 774 609 591 288 167 125 40 29 --3881 357 88 --
NM_006958chr82149 51 ------
NM_006965chr1841153 1147 451 299 1381 ----
NM_006981chr972793 2695 981 807 716 656 442 --1752 12051
NM_006987chr1721122 491 1430 1170 --
NM_006988chr212341 219 ------
NM_006990chr182157 1880 1873 796 772 748 711 241 31593 571 333 2672 446 1876
NM_006997chr101298 ------
NM_007006chr1642773 495 380 116 --12443 --
NM_007008chr21367 ------
NM_007011chr15206471 5401 4627 4482 4409 4392 4363 4229 4173 2719 2480 2314 2148 2000 1979 1571 1562 1085 988 435 11164 25489 1433 12174
NM_007013chr82188 113 1419 ----
NM_007014chr1651753 1707 1532 1523 1380 ------
NM_007017chr51720 --1192 --
NM_007026chr171517 ------
NM_007027chr32228 136 --1438 --
NM_007030chr583245 1735 1610 1438 1246 994 852 157 14644 --14757
NM_007036chr51845 ------
NM_007039chr14--11988 11551 11668
NM_007040chr196992 885 381 306 67 32 ----1977
NM_007042chr322037 468 1471 ----
NM_007043chr1251797 1603 1527 411 35 --1333 --
NM_007047chr692390 2031 1975 1606 854 646 493 160 26 11609 32080 2042 1771 --
NM_007050chr20156863 5732 5628 5590 5368 5343 5245 2342 1093 979 820 755 481 381 56 33129 2377 388 32319 1158 615 15153
NM_007051chr11124 ------
NM_007054chr552760 2721 2440 1485 1162 23609 3199 ----
NM_007064chr311421 ----21045 130
NM_007067chr1761570 1530 1334 1277 1117 1038 --1554 1428
NM_007078chr1042250 750 543 123 ------
NM_007106chr1312430 12358 --1920
NM_007108chr164362 112 78 66 1545 ----
NM_007111chr132289 138 1570 ----
NM_007112chr12161 91 --143 --
NM_007114chr3--12249 ----
NM_007115chr21176 --161 --
NM_007123chr12827 110 --159 --
NM_007124chr64766 221 101 49 ------
NM_007125chrY----11253 --
NM_007129chr133851 653 364 --1207 --
NM_007144chr1741273 959 398 66 11087 31062 78 46 --
NM_007146chr1752639 2240 1099 1059 929 12672 ----
NM_007150chrX41886 408 366 90 1598 ----
NM_007158chr151118 1009 947 88 81 ------
NM_007159chr3189 --11591 198
NM_007166chr112272 255 1597 ----
NM_007172chr2262982 2974 2271 1113 802 189 158 12244 --
NM_007174chr1251781 1712 883 150 25 --11677 --
NM_007185chr15811 430 233 155 50 ------
NM_007192chr1431005 371 47 21116 911 ----
NM_007195chr1873268 2663 2367 1388 1016 920 894 33200 2952 401 12594 --
NM_007197chr122731 242 ------
NM_007200chr15124650 4628 4398 3194 3158 1865 1836 1453 1243 863 564 54 ------
NM_007202chr174774 738 607 58 ------
NM_007218chr8----1169 --
NM_007221chr14370 317 285 83 ------
NM_007222chr831817 1684 1572 ------
NM_007232chr204840 406 302 186 ------
NM_007236chr1572398 1697 1555 836 628 95 61 --1725 11923
NM_007238chr20144873 4755 4464 4146 4093 4081 3991 3984 3880 3835 1392 1118 550 366 13416 ----
NM_007249chr13137882 5753 3256 2916 2795 2675 2198 1291 1201 993 856 559 76 --57707 7675 3199 1869 418 1411
NM_007270chr721439 1192 ------
NM_007275chr371151 969 823 462 453 402 255 1918 1936 --
NM_007276chr72815 263 ------
NM_007278chr173298 79 60 1103 1337 --
NM_007282chr3174 132 --1767
NM_007285chr161460 --186 --
NM_007286chr5112079 2072 2034 1868 1837 1818 1731 436 289 210 84 1819 21313 615 --
NM_007294chr1731071 439 197 21056 171 ----
NM_007295chr1731071 439 197 21056 171 ----
NM_007296chr1731071 439 197 21056 171 ----
NM_007297chr1731071 439 197 21056 171 ----
NM_007298chr1731071 439 197 21056 171 ----
NM_007299chr1731071 439 197 21056 171 ----
NM_007300chr1731071 439 197 21056 171 ----
NM_007302chr1731071 439 197 21056 171 ----
NM_007303chr1731071 439 197 21056 171 ----
NM_007304chr1731071 439 197 21056 171 ----
NM_007305chr1731071 439 197 21056 171 ----
NM_007349chr7132 ------
NM_007350chr1243398 1618 1426 937 23659 3033 23728 1005 --
NM_007359chr1771552 1173 633 525 513 363 156 1652 ----
NM_007361chr141500 ------
NM_007363chrX132 --3848 727 48 --
NM_007365chr181595 1464 845 778 674 545 534 30 ------
NM_007371chr9162 --1487 --
NM_007375chr12430 307 --32590 1090 378 --
NM_012062chr122733 85 1813 ----
NM_012064chr1261029 457 335 230 209 66 ------
NM_012069chrX42563 2551 2044 681 ------
NM_012072chr2064270 3587 3131 631 262 147 1138 14150 1603
NM_012074chr1461112 968 962 169 157 131 ------
NM_012081chr533730 2449 819 --23281 2595 --
NM_012092chr24549 454 274 218 --1427 --
NM_012095chr1063304 2938 2284 1066 481 316 12675 22794 2192 12777
NM_012096chr322336 29 33253 444 190 22449 2347 13310
NM_012097chr252146 1983 1938 1823 1787 ------
NM_012098chr961386 570 334 216 83 23 --11266 --
NM_012101chr1141105 928 142 34 1738 1199 --
NM_012102chr152402 2158 2062 2040 343 --2874 686 --
NM_012115chr61405 ------
NM_012120chr631862 951 822 22486 530 ----
NM_012137chr152204 994 631 440 68 12871 ----
NM_012141chr1343702 1365 1002 331 ------
NM_012153chr1151782 854 695 270 63 --11724 --
NM_012158chr1311607 ------
NM_012161chr411181 --195 --
NM_012164chr996895 6693 6231 2429 1934 1668 1148 910 65 1768 15477 --
NM_012175chr111801 ------
NM_012192chr1142410 2100 701 130 22226 1683 ----
NM_012193chr11155080 4797 4635 4629 4371 4148 4007 3452 3332 3319 1999 1867 1818 1626 1286 --25419 3282 34453 4234 401
NM_012199chr1154522 4449 4303 3101 2958 2931 2900 1872 1796 1155 1069 1046 693 629 221 34117 2880 1078 23254 1549 --
NM_012200chr115373 348 126 118 99 --129 --
NM_012207chr103941 354 255 --11008 --
NM_012214chr256159 5005 3914 2520 384 --55470 5215 4054 2373 97 16134
NM_012218chr1952900 2664 2413 2080 273 11929 12822 --
NM_012229chr10----11310 --
NM_012232chr17142182 2114 2075 2035 1889 1844 1798 1452 1429 459 400 241 52 38 11907 ----
NM_012234chr372688 1126 1067 1057 962 597 80 22608 1507 --1110
NM_012242chr101289 1532 129 --
NM_012244chr14131665 1635 1601 1378 1197 694 517 507 360 315 96 40 30 --11566 --
NM_012247chr10--153 ----
NM_012248chr162247 123 ------
NM_012249chr233324 3098 386 --11107 --
NM_012259chr63942 180 66 --1984 --
NM_012262chr153734 3713 1268 420 386 14883 24396 1935 --
NM_012278chrX--2153 47 ----
NM_012281chr752153 1666 1526 979 222 --1631 --
NM_012282chrX5221 207 200 86 51 ------
NM_012286chrX1172 ------
NM_012287chr354577 3628 1456 1322 1127 --33500 3431 200 --
NM_012288chr6154524 4262 3706 3573 3524 2026 1970 1911 1824 1236 1070 537 254 84 30 24988 176 44904 4725 4666 3587 25046 2114
NM_012290chr221680 1370 ------
NM_012295chr222390 322 --1398 --
NM_012296chr1193925 3404 3371 2914 2713 845 417 290 155 13093 ----
NM_012297chr462350 1840 1830 813 804 766 ------
NM_012300chr54919 480 189 173 11551 11657 --
NM_012301chr741554 675 574 216 ------
NM_012302chr11968 --11186 --
NM_012304chr592365 2235 1851 1836 1789 1742 1693 944 325 --1788 --
NM_012307chr18181 ------
NM_012308chr11102599 2479 1676 1637 835 796 592 581 345 127 --12086 --
NM_012309chr1164618 3974 3796 1390 489 177 13802 ----
NM_012311chr101643 ----1562
NM_012316chr1135488 5385 4575 3869 3638 1964 1709 1678 1103 1069 923 151 110 1384 23650 727 --
NM_012325chr2031350 1020 72 --2159 126 --
NM_012329chr1711542 --1608 1686
NM_012330chr1031661 1254 378 --1685 --
NM_012333chr121525 1478 ------
NM_012342chr101121 ------
NM_012343chr52176 39 --11047 --
NM_012347chr652972 2675 2148 1107 321 ----32686 878 761
NM_012382chr594246 4210 4051 3460 3451 3188 2792 642 47 ------
NM_012384chr2081898 1785 876 818 810 487 224 22 11906 ----
NM_012395chr762796 2383 2330 2304 764 518 33005 2958 1167 ----
NM_012396chr14627 601 547 220 ------
NM_012398chr19122886 2386 2131 2084 1009 979 732 683 668 344 211 161 ------
NM_012399chr2231803 1546 1464 ------
NM_012402chr1121148 114 --1408 --
NM_012412chr73828 624 24 ------
NM_012414chr11628 --1179 --
NM_012416chr921270 439 ------
NM_012420chr1032300 1710 38 --185 --
NM_012426chr162431 326 ------
NM_012428chr15191 --176 --
NM_012446chr51150 ------
NM_012448chr1752169 1726 1716 1023 555 ------
NM_012461chr144556 475 66 52 ------
NM_012463chr12----21753 147 --
NM_012473chr222238 27 1682 1505 --
NM_012475chr13211 174 43 134 ----
NM_012479chr732206 829 149 1795 ----
NM_012482chr11113 ------
NM_013227chr154652 236 167 83 ------
NM_013231chr1431690 1126 1024 1792 ----
NM_013233chr25456 398 72 58 50 1971 --1314
NM_013236chr224469 388 351 308 ------
NM_013238chr1321804 1434 21516 192 2738 475 1367
NM_013245chr166725 683 486 462 266 251 ------
NM_013246chr115712 700 332 118 30 ------
NM_013247chr22134 44 ------
NM_013251chr12121 --287 44 --
NM_013253chr1141388 960 557 244 ------
NM_013255chr7148465 7952 7603 7328 6000 5836 3520 3510 2837 2517 2150 1564 433 151 16337 2495 318 12721
NM_013259chr32292 96 ------
NM_013261chr412775 ----11368
NM_013269chr1253974 3618 1744 943 367 13462 11553 --
NM_013275chr161319 --1152 --
NM_013279chr1192160 2060 2042 1446 927 816 373 363 182 1505 2395 273 --
NM_013281chr2011299 ----11377
NM_013293chr73633 516 40 1613 --1101
NM_013302chr1694222 4078 3635 3294 1078 1071 898 512 168 14601 14373 14633
NM_013309chr1542144 1765 93 23 1908 ----
NM_013313chr2282768 2521 2251 980 966 883 181 23 13010 ----
NM_013316chr72910 82 --11037 --
NM_013341chr282805 2762 2744 2025 1181 1157 1121 346 12658 11061 --
NM_013354chr851356 377 320 107 76 ------
NM_013357chr83713 119 89 --1703 --
NM_013368chr193407 116 57 ------
NM_013372chr1562808 1343 934 892 466 361 ------
NM_013385chr2281823 1715 1452 1369 1249 699 462 238 11703 ----
NM_013388chr24568 418 404 73 ------
NM_013396chr21154 ------
NM_013399chr1661718 1637 1237 734 711 135 --11810 --
NM_013400chr751057 760 748 676 366 1291 ----
NM_013403chr197843 813 611 548 208 161 147 --1887 --
NM_013410chr111077 ------
NM_013411chr1122768 2592 2586 2242 1853 1735 1728 997 881 654 602 56 --11065 --
NM_013423chrX2930 261 ------
NM_013427chrX2930 261 ------
NM_013433chr1981943 1926 1717 1429 1373 1334 511 257 11320 ----
NM_013437chr821150 454 ------
NM_013446chr751425 1218 1097 509 154 ------
NM_013448chr141682 ------
NM_013449chr12142944 2719 2603 2366 2279 864 854 841 829 659 633 529 188 178 1156 1170 --
NM_013450chr21351 1867 ----
NM_013943chr153164 2632 2498 2180 171 --171 --
NM_013951chr272454 2360 854 781 713 588 547 22177 1718 32487 2433 652 1208
NM_013952chr272531 2437 931 858 790 665 624 22254 1795 32564 2510 729 1285
NM_013953chr272531 2437 931 858 790 665 624 22254 1795 32564 2510 729 1285
NM_013986chr22--1290 1245 --
NM_013992chr272531 2437 931 858 790 665 624 22254 1795 32564 2510 729 1285
NM_013999chr1731097 239 117 2554 229 ----
NM_014000chr1061948 1867 1241 706 141 35 ------
NM_014005chr542928 877 743 637 22433 1214 ----
NM_014010chr93553 419 380 --1442 --
NM_014011chr211952 --12159 --
NM_014015chr162626 24 ------
NM_014016chr31347 ------
NM_014030chr178999 826 810 467 420 290 168 157 1483 ----
NM_014034chr61262 1548 ----
NM_014038chr72290 128 ------
NM_014048chr1665127 4514 4198 3334 1424 1115 13544 ----
NM_014066chr82410 308 ------
NM_014071chr202183 121 ------
NM_014089chr1321561 853 ------
NM_014112chr833348 1901 131 --11105 --
NM_014117chr1682266 2243 1969 1897 1784 1052 174 96 22556 1947 --12042
NM_014141chr774347 4194 4055 1866 1824 1015 211 24605 1458 --11275
NM_014154chr341585 1085 604 506 ------
NM_014155chr11126143 5677 2545 2284 1495 1473 1367 1335 405 145 81 38 15662 16874 --
NM_014166chr133879 823 811 ------
NM_014175chr8--169 ----
NM_014178chr141570 ------
NM_014181chr221118 698 1829 ----
NM_014182chr122685 478 ------
NM_014184chr11113 ------
NM_014186chr1192338 2165 2114 2108 2062 623 599 576 537 11724 ----
NM_014212chr123944 898 389 --1716 --
NM_014217chr15738 555 543 527 503 --11499 --
NM_014223chr12726 687 --1518 --
NM_014231chr1261950 1926 1795 1714 1614 135 11473 22095 544 --
NM_014232chr17101631 1341 1184 407 346 312 280 259 252 68 11457 2623 238 --
NM_014232chr17101631 1341 1184 407 346 312 280 259 252 68 11457 2623 238 --
NM_014233chr1752176 1824 1726 442 91 ------
NM_014234chr61169 ------
NM_014238chr1721373 117 ------
NM_014240chr394196 3579 3484 2672 1660 1475 1142 370 72 1639 53077 2904 1498 667 407 --
NM_014243chr461902 1828 1750 1540 171 50 ------
NM_014245chr32927 232 ------
NM_014246chr2242277 2046 1707 1658 11645 22311 428 --
NM_014251chr73689 315 59 --188 --
NM_014252chr132163 128 ------
NM_014253chrX52514 2121 713 556 445 ------
NM_014267chr111112 ------
NM_014268chr1861289 1163 1144 933 455 331 --11334 --
NM_014271chrX2834 614 --1294 --
NM_014279chr94764 642 165 52 ------
NM_014284chr15904 892 739 190 162 --11029 --
NM_014286chr9103578 3522 3506 2974 2550 2238 1234 1174 214 42 --33228 2514 936 --
NM_014289chrX51211 1065 957 937 496 --142 --
NM_014293chr22203993 3977 3880 3763 3744 3523 3231 2793 2677 1365 1318 1293 857 574 565 492 423 389 112 24 --33824 3159 722 --
NM_014299chr1962076 2040 1511 655 502 398 ------
NM_014305chr13----1216 --
NM_014309chr22195255 5188 4982 4953 4917 4911 4703 4473 4371 3991 3902 3893 3598 3462 3288 1866 1717 819 595 ------
NM_014316chr1682095 1765 1611 774 668 467 361 215 1708 121 --
NM_014319chr1211877 ------
NM_014323chr221411 --1143 --
NM_014329chr161288 ------
NM_014333chr1151995 1984 848 443 339 12665 22036 200 --
NM_014345chr64949 392 174 162 1182 ----
NM_014363chr131454 ------
NM_014372chr11382 --2762 694 --
NM_014374chr751057 760 748 676 366 1291 ----
NM_014381chr1453298 3113 882 466 459 22586 2112 --12269
NM_014393chr822296 373 --1786 --
NM_014405chr1762294 1683 826 704 521 340 --22025 815 --
NM_014411chr792001 1715 1550 1464 1261 681 621 597 428 ------
NM_014418chr1431326 1299 412 --21917 1886 --
NM_014423chr574525 4221 2213 1403 1184 1136 933 1176 11163 14622
NM_014426chr202542 224 ------
NM_014431chr1061581 1364 462 436 388 356 --1196 --
NM_014445chr342208 2160 1821 1584 1460 ----
NM_014447chr421367 140 ------
NM_014450chr9--1207 ----
NM_014452chr641138 1045 892 180 ------
NM_014456chr10----2319 223 --
NM_014462chr8----1219 --
NM_014469chr111297 --131 --
NM_014488chr111110 --2622 197 --
NM_014491chr73954 771 153 ------
NM_014494chr1662055 2006 1846 1667 392 336 ------
NM_014501chr19138 ------
NM_014515chr12133 ------
NM_014517chr321632 1587 ------
NM_014550chr224681 589 529 97 1287 ----
NM_014554chr1282297 2144 1825 1677 1609 548 230 111 ------
NM_014563chrX41367 805 690 473 ------
NM_014570chr222225 41 ------
NM_014571chr192887 2740 2484 2295 2063 1974 534 289 163 --2931 587 --
NM_014573chr1721565 714 --11752 --
NM_014574chr1421262 484 ------
NM_014583chr31443 ------
NM_014584chr1411503 ------
NM_014591chr1071279 845 355 301 264 232 72 11124 --11202
NM_014604chr175815 638 164 153 24 ------
NM_014612chr941387 1180 994 137 --11148 --
NM_014614chr211439 ------
NM_014616chr3132947 2748 2586 2518 2445 2385 1064 1033 273 256 184 172 39 ------
NM_014620chr122700 141 --1218 --
NM_014622chr113859 664 232 1915 1957 --
NM_014630chr15113907 3294 2473 2428 1471 848 842 640 627 527 419 13205 23068 705 11250
NM_014632chr11180 133 ----
NM_014634chr2292791 2780 2689 2560 2449 1443 1232 1078 28 --12412 --
NM_014636chr9134152 3536 3385 3274 2709 1403 1361 1218 977 874 840 764 229 23439 1369 11018 --
NM_014637chr821338 27 --196 --
NM_014646chr18122801 2574 2495 2488 2361 2221 860 616 562 287 239 139 ----12865
NM_014660chr71370 --150 --
NM_014661chr10103838 3550 3536 3005 1428 1187 1008 904 605 293 --12449 --
NM_014666chr51822 --189 --
NM_014667chr352109 1897 1740 1680 275 ------
NM_014674chr383665 3503 3258 3179 3172 1509 1454 584 23208 244 23525 2834 --
NM_014677chr831039 1013 310 --11030 --
NM_014678chr221514 148 ----
NM_014683chr1731891 1481 417 --2694 206 --
NM_014689chr22150 27 ------
NM_014690chr792737 2248 1122 954 840 821 723 473 410 1945 12098 --
NM_014701chr1523121 2267 --23253 2216 --
NM_014705chr71106 --1257 1643
NM_014707chr732262 2210 471 ------
NM_014709chr21474 ------
NM_014715chr114881 179 157 102 ------
NM_014721chr676943 5340 5124 4709 2630 2082 1447 26315 1450 37271 1754 773 16453
NM_014723chr20123204 3140 2960 2703 2232 2043 1123 715 377 290 280 70 --22614 708 --
NM_014726chr1751379 1247 905 391 272 --1976 --
NM_014729chr8----11692 --
NM_014730chr12154960 4911 4826 4760 4607 3950 3845 3750 3740 3325 1487 1304 984 896 245 11712 35221 4539 3536 --
NM_014730chr12154960 4911 4826 4760 4607 3950 3845 3750 3740 3325 1487 1304 984 896 245 11712 35221 4539 3536 --
NM_014732chr16195152 5043 5033 4684 4523 4342 4085 3845 2072 1976 1923 1846 1763 1639 1091 1043 784 216 120 35516 5254 2314 24261 893 --
NM_014733chr52869 802 --1320 --
NM_014735chrX42124 1809 1509 574 --1457 12041
NM_014740chr17150 ------
NM_014741chr11122104 2029 1989 1779 1364 773 752 620 531 366 84 31 2506 484 ----
NM_014742chr2081376 1280 1264 1121 571 560 113 91 ------
NM_014743chr442873 1116 1063 102 ----1731
NM_014747chr1175758 5415 5385 5146 5028 4608 4319 3988 3772 3686 3649 2184 1783 1591 1215 722 238 1777 35541 5507 98 --
NM_014751chr832089 1681 245 11384 ----
NM_014752chr1141586 620 209 23 11521 --11800
NM_014754chr84948 937 827 710 ------
NM_014755chr273491 3449 3402 2681 1005 495 86 12879 ----
NM_014759chr8101494 1103 1063 615 589 571 358 263 168 136 --1522 --
NM_014761chr162433 72 --11030 --
NM_014762chr15671 663 269 105 54 1263 ----
NM_014764chr121401 --1472 --
NM_014765chr152507 769 673 615 545 11062 ----
NM_014766chr7113781 3400 2839 1382 1274 592 574 193 174 114 22 13527 22970 2748 --
NM_014767chr10223196 3066 2862 2843 2729 2698 2658 2334 1360 1184 1175 1069 1054 1042 1027 948 669 494 475 447 300 289 --1425 --
NM_014770chr1271298 1097 1038 989 961 947 90 --1496 --
NM_014772chr1872672 2462 2231 2213 349 269 169 ------
NM_014774chr1103027 2881 2823 2798 2175 2082 1314 592 267 66 --42867 2522 2317 1033 --
NM_014776chr12103049 2725 2716 2639 2151 2145 2129 1216 925 776 13110 12619 1316
NM_014783chr15----11102 --
NM_014784chr15809 440 394 93 37 1209 ----
NM_014787chr142418 2049 731 262 1742 ----
NM_014798chr1781640 1398 1286 726 664 615 203 110 ------
NM_014800chr77460 404 330 163 140 127 25 21158 771 ----
NM_014802chr1231024 833 215 ------
NM_014806chr92379 121 1167 ----
NM_014807chr114782 616 337 54 1629 165 --
NM_014810chr1113457 2818 2626 2587 1417 751 689 638 451 301 262 12562 1740 --
NM_014812chr151756 1590 1326 364 117 11937 1283 --
NM_014819chr53947 777 454 --1479 1759
NM_014820chr371907 1834 1660 595 588 49 28 11370 --21579 516
NM_014822chr4150 ------
NM_014824chr1141901 1884 1395 152 ------
NM_014826chr174329 3465 2821 1001 587 273 23 1736 11009 14192
NM_014827chr141560 1428 250 129 --1317 --
NM_014830chr12113665 3426 3416 3262 2874 2673 2594 2403 1415 658 300 12931 13751 --
NM_014832chr131350 136 ----
NM_014838chr2252469 2236 1941 854 169 --2716 163 --
NM_014839chr132160 1937 1694 1884 11770 --
NM_014840chr1292617 2290 2117 1311 1036 834 817 420 411 12743 2870 81 --
NM_014841chr61195 ------
NM_014847chr13551 375 208 ------
NM_014848chr1562430 1837 1805 390 206 131 1959 ----
NM_014849chr141184 1143 885 193 --155 --
NM_014850chr3174787 4482 4467 4163 3900 3490 3480 1481 1459 1426 1331 1320 877 767 706 490 196 13499 ----
NM_014859chr1741470 466 297 255 ------
NM_014868chr124869 680 615 319 ------
NM_014869chr331293 224 52 11188 ----
NM_014871chr12--136 ----
NM_014872chr951976 1928 1747 385 206 ----22081 1797
NM_014873chr173553 3050 1605 1424 1128 1075 141 1373 1593 --
NM_014874chr151892 1681 1320 574 408 --11753 --
NM_014876chr2261934 525 299 237 118 35 ------
NM_014877chr1795597 5581 5563 2787 1687 1277 1129 905 97 17007 36916 2174 1606 11167
NM_014887chr131640 ------
NM_014890chr3169 ------
NM_014897chr1743152 2685 2312 2082 11103 ----
NM_014901chr551581 498 287 171 101 ----11619
NM_014902chr2081557 1509 1390 1150 1108 470 411 250 ------
NM_014903chr1242074 431 362 327 1708 ----
NM_014904chr1023455 117 --11616 11186
NM_014906chr1743138 1415 292 254 --32876 2732 305 --
NM_014909chr14103897 3225 3219 3162 2974 2967 2767 2672 694 365 ------
NM_014912chr1052851 2729 2441 535 424 12607 ----
NM_014914chr281164 846 501 299 272 218 174 105 ------
NM_014917chr121005 833 ------
NM_014918chr15--11306 2284 130 --
NM_014920chr643734 2690 2538 1495 ----1694
NM_014921chr19172976 2967 2959 2898 2842 2831 2751 2017 1244 1194 886 702 690 619 612 330 122 1863 21998 869 --
NM_014923chr1322275 1590 --1693 --
NM_014925chr122247 222 --1173 --
NM_014926chr32898 765 181 171 --
NM_014938chr1252309 2013 1850 719 44 --21944 208 --
NM_014944chr141414 1113 316 117 --1960 --
NM_014945chr581485 1278 1238 719 693 641 620 347 2608 170 --11899
NM_014946chr212250 --22020 1024 --
NM_014948chr2092457 2347 1621 1529 985 907 542 291 76 12233 ----
NM_014952chr1592036 1329 833 633 588 552 450 388 147 31624 1505 1376 ----
NM_014961chr42823 754 --21369 496 --
NM_014964chr1781769 1745 1711 1685 1545 1535 293 187 1779 ----
NM_014966chr3----169 --
NM_014969chr11736 2823 122 11205 --
NM_014978chr1051391 730 340 300 117 11324 ----
NM_014982chr1494075 2142 1785 1376 1140 1106 660 172 148 --21927 1447 --
NM_014988chr432066 1065 964 1982 ----
NM_014989chr631361 1295 564 ------
NM_014990chr14----1237 1429
NM_014991chr452250 2147 2083 816 534 --143 --
NM_014994chr15132211 2150 2117 1961 1526 885 773 761 453 223 208 66 58 12284 --1672
NM_014996chr341005 270 212 128 --1911 --
NM_014997chr722589 248 11111 2598 53 --
NM_015000chr1253090 2379 1911 338 92 12322 1262 --
NM_015001chr12901 272 ------
NM_015008chr331320 964 415 43027 2818 2555 591 1704 --
NM_015009chr31189 --1263 --
NM_015017chr11444 ------
NM_015020chr1623094 1449 --21160 604 --
NM_015024chr82297 39 ----11132
NM_015025chr252047 1009 915 775 46 ------
NM_015026chr1254583 4567 4475 3638 122 --1395 --
NM_015027chr1631364 778 298 ------
NM_015032chr134899 556 546 519 ------
NM_015033chr9102690 2422 2091 1325 1179 896 306 295 117 101 --1581 --
NM_015039chr143102 1386 393 34 1451 23309 1498 --
NM_015040chr253261 2461 2378 1011 680 ------
NM_015042chr15204298 4281 4124 4047 3893 3634 3444 3280 3257 3110 2838 2829 2671 1480 1024 910 853 847 451 146 11345 43774 868 840 194 --
NM_015044chr1682860 2754 2735 2235 802 682 135 21 --12282 --
NM_015045chr1021525 290 ------
NM_015050chr641119 437 91 23 1942 1951 --
NM_015051chr91857 1184 12981 --
NM_015052chr771379 1215 924 92 72 65 48 179 11051 --
NM_015053chr1102235 2003 1863 1674 709 315 309 79 63 29 21764 1725 22148 1937 --
NM_015056chr2132396 674 158 12160 12125 --
NM_015059chr15113774 3000 2609 2601 1188 1144 1132 597 560 511 211 2826 738 1361 --
NM_015063chr1981341 1233 385 348 269 190 125 81 --11225 --
NM_015064chr1273274 3119 3019 2702 2250 1406 363 23145 56 --12320
NM_015068chr7133903 3897 3857 3845 3762 1523 1491 1429 1170 899 665 569 477 --13191 13606
NM_015069chr162411 24 ------
NM_015071chr5156506 5546 4628 4100 3997 2316 2288 1552 1140 1106 902 794 767 674 470 14827 21955 958 --
NM_015072chr143484 397 39 --1590 --
NM_015074chr1113827 3798 3420 3147 1924 1912 1406 590 389 126 56 ------
NM_015075chrX102248 2049 1995 1594 804 791 594 384 182 89 11762 21622 841 --
NM_015076chr664060 3205 3083 1381 1245 911 14322 21813 211 --
NM_015077chr17174592 3697 3689 3546 3340 3114 3059 3047 2893 1753 1670 1613 1364 827 794 498 326 34007 3731 2878 14379 --
NM_015079chr1573180 2732 2609 2471 2265 1081 725 --1615 --
NM_015082chr592393 2144 2105 1991 1920 1659 874 329 135 1361 11799 --
NM_015087chr1332672 2007 435 --12248 --
NM_015090chr1176015 5754 5663 5652 5134 4719 4599 2083 1238 1127 768 704 654 612 550 260 189 --65927 5742 5186 5093 4257 743 11646
NM_015092chr1674433 4323 3284 2907 994 945 655 24363 682 12895 --
NM_015094chr22214552 4504 4095 3255 3168 2997 2883 1869 1639 1632 1511 1373 1314 1122 778 730 550 488 480 307 122 --11166 --
NM_015097chr342213 1938 1477 687 ----1700
NM_015100chr151643 827 799 616 365 ------
NM_015107chrX102445 2158 1807 576 531 259 173 149 72 21 --31825 162 29 --
NM_015113chr1771830 1684 911 626 495 108 83 --31599 584 458 --
NM_015115chr442899 2372 363 112 --32568 2342 717 --
NM_015116chr132661 96 11245 11685 --
NM_015120chr21258 ------
NM_015124chr22112180 2051 1956 1893 1538 651 527 343 301 202 150 1534 ----
NM_015133chr1661176 409 356 140 108 96 ------
NM_015134chr172577 470 ------
NM_015138chr1592783 2595 2109 1008 472 356 167 82 63 ------
NM_015143chr431068 586 249 ------
NM_015144chr1663226 2642 869 551 416 407 --12544 --
NM_015150chr32287 125 --1108 --
NM_015155chr1052766 981 913 800 162 ------
NM_015156chr1483353 3302 3050 2698 860 638 631 354 ------
NM_015157chr1131110 777 444 1451 1338 1181
NM_015161chr1621344 585 1312 11126 --
NM_015163chr1451877 1460 178 169 163 1501 ----
NM_015171chr16----1101 --
NM_015172chr131292 1087 593 1427 ----
NM_015176chr121469 1211 194 ----
NM_015178chr871867 977 948 726 691 409 56 --12665 --
NM_015185chrX102895 2626 2329 2177 2096 564 552 519 313 118 22214 963 12190 --
NM_015192chr2032713 1894 454 ----1108
NM_015194chr1792075 1676 1472 643 557 420 238 129 109 21849 753 11545 --
NM_015199chr342907 2069 1828 942 ----12050
NM_015200chr462434 2133 1996 1781 797 239 --12372 22295 1793
NM_015202chr1621709 1414 --11530 --
NM_015206chr1543254 3089 549 382 ------
NM_015209chr182130 1960 1746 493 390 372 200 179 12099 11486 --
NM_015215chr142931 782 310 138 ----122
NM_015219chr1762320 1592 994 832 672 643 1997 ----
NM_015225chr962894 2716 2539 2027 1937 554 32987 967 297 ----
NM_015227chr21103089 2941 2737 1313 1072 881 798 706 171 62 165 23104 131 --
NM_015235chr1021934 1878 ------
NM_015236chr42232 93 ------
NM_015245chr682577 2114 2061 1841 1006 587 328 131 1776 12256 --
NM_015247chr1694825 4584 4513 4072 2057 1560 1033 903 332 1592 35303 4304 3630 14451
NM_015250chr951688 307 247 58 51 ----11496
NM_015251chr1631733 749 513 --32273 626 547 --
NM_015254chr872769 2470 931 723 632 94 43 ------
NM_015265chr232479 1938 1852 --1156 --
NM_015267chr1231430 238 225 --1328 --
NM_015270chr12142241 2048 1928 1878 1866 1684 1641 1587 1480 935 658 398 347 307 --11668 --
NM_015271chr422948 958 11012 1664 --
NM_015272chr1681983 1793 1724 518 401 208 190 32 ------
NM_015278chr622958 686 --141 --
NM_015282chr262352 2040 653 452 139 73 1414 23050 1962 12699
NM_015288chr5153868 3860 3693 3664 2832 2802 2475 1281 1164 1097 990 705 658 644 252 ------
NM_015296chr13144 ------
NM_015299chr14113959 3783 3715 3289 3209 2828 1520 969 650 415 61 --1821 11389
NM_015305chr1491408 607 465 418 292 265 206 133 115 ----11332
NM_015310chr897881 7152 6872 6297 3345 1759 1447 1330 1196 36259 3236 1521 32728 2488 271 --
NM_015313chr1144094 3632 3124 2977 13348 21440 707 --
NM_015314chr721613 434 --2677 621 --
NM_015315chr5213172 2942 2877 2849 2780 2711 2663 2361 2347 2171 2165 1244 1232 1119 870 651 512 489 386 197 173 --12681 1666
NM_015317chr232884 2707 2462 ------
NM_015328chr782750 2529 2484 2294 2186 813 598 319 --21220 616 12333
NM_015332chr7123354 3095 2964 2917 2775 2387 2332 1037 1001 785 510 107 1557 2519 504 --
NM_015335chr1231970 722 386 22161 402 1185 --
NM_015336chr1232155 1748 1632 12653 ----
NM_015338chr2061846 1561 1545 1449 477 168 ------
NM_015344chr82128 105 ------
NM_015349chr672463 2248 2149 2073 1955 1137 996 ------
NM_015355chr1721878 405 --11836 --
NM_015356chr8160 ------
NM_015359chr8122747 2615 2583 2467 2241 2172 894 822 742 311 231 212 12843 12064 --
NM_015361chr22752 99 1639 ----
NM_015365chrX104116 4028 3848 3266 3153 3029 2964 706 393 321 13352 34094 2702 45 1598
NM_015381chr2231560 1361 810 --22079 781 --
NM_015382chr14156 ------
NM_015385chr1021188 538 --12297 12653
NM_015388chr64270 245 234 30 --1260 --
NM_015393chr473534 3428 2885 2377 1228 663 169 --13254 --
NM_015396chr351400 1130 971 927 40 ----11389
NM_015397chr991863 1563 1511 1282 781 362 334 264 197 ------
NM_015401chr126752 743 714 340 170 60 ------
NM_015404chr94538 81 54 40 1496 ----
NM_015426chr32585 393 ------
NM_015429chr31897 --1743 --
NM_015436chr453093 2832 2583 2537 2165 1424 12619 22496 1083
NM_015443chr1751257 1026 1019 969 479 --11310 --
NM_015444chr32256 108 ------
NM_015447chr91175 --1619 --
NM_015455chr542591 1003 644 405 --13335 --
NM_015457chr11111090 1052 999 986 973 838 801 354 241 230 208 ------
NM_015460chr352084 1509 1439 581 568 --21585 1543 --
NM_015464chr7--1830 1379 --
NM_015466chr31190 ------
NM_015472chr32126 54 ------
NM_015472chr32126 54 ------
NM_015475chr22747 216 2987 932 ----
NM_015481chr1281077 1014 968 927 815 269 108 77 ------
NM_015488chr2141686 1614 1596 1588 1371 1332 1310 1270 1152 551 522 438 308 298 --11203 --
NM_015493chr1942067 1583 483 47 11693 12045 --
NM_015496chr81207 ------
NM_015503chr163573 464 26 ------
NM_015508chr321487 978 ----11154
NM_015509chr1261412 615 559 386 375 308 ------
NM_015514chr142616 430 2390 123 ----
NM_015520chr321713 442 ------
NM_015526chr19121476 1468 1435 1135 933 908 580 568 534 402 252 117 1393 ----
NM_015527chr169739 704 696 595 524 309 152 102 37 ------
NM_015530chr24985 822 728 342 ------
NM_015534chr12889 32 ------
NM_015548chr61333 1761 ----
NM_015550chr763563 3549 3079 2255 2246 375 21350 773 22439 1135 11011
NM_015553chr6105019 4719 4712 4652 4241 4115 3148 1985 816 726 21492 26 ----
NM_015557chr1113323 3294 3070 3033 2858 1302 1181 1043 702 661 552 --13428 --
NM_015564chr562868 2667 2402 2184 550 216 --11036 1614
NM_015565chr2132237 295 26 --11497 --
NM_015567chr1381214 534 512 506 418 406 395 369 ------
NM_015568chr20104200 3725 2905 2761 1728 1535 1294 1190 887 786 21657 1132 32836 1617 1586 --
NM_015569chr164600 3583 1919 1445 972 484 ----1544
NM_015570chr741338 597 122 76 --1116 --
NM_015571chr622341 1786 11031 11825 1417
NM_015575chr273364 2498 1373 1281 624 148 27 --12324 --
NM_015576chr31681 12225 12309 --
NM_015577chr561634 501 367 302 126 29 11324 1225 --
NM_015578chr1922086 464 11374 --11845
NM_015607chr1----1192 --
NM_015609chr1132879 2835 2786 2647 2444 2416 955 880 869 829 194 185 136 12419 --11886
NM_015626chr171961 --1283 --
NM_015634chr101449 --1401 --
NM_015635chr92372 337 --11829 --
NM_015642chr31308 ------
NM_015645chr112355 35 ------
NM_015649chr196382 373 292 118 98 36 ------
NM_015657chr21665 ------
NM_015670chr173109 93 56 ------
NM_015678chr132545 387 ------
NM_015686chrX112242 2230 2115 2066 1997 1919 1874 1809 458 309 242 22424 2387 12378 --
NM_015687chr62519 452 ------
NM_015695chr65804 620 322 72 64 1742 1488 --
NM_015702chr21273 ------
NM_015713chr833134 1367 299 23119 592 13205 --
NM_015716chr1712691 651 590 513 284 276 249 198 181 150 143 74 ------
NM_015719chr192525 151 1742 1281 --
NM_015723chr72646 237 ------
NM_015726chr151697 1363 548 337 260 11140 31423 744 62 --
NM_015840chr1162680 2331 2315 2266 2151 2049 2041 1669 853 498 463 457 443 342 206 103 1304 1365 --
NM_015841chr1162680 2331 2315 2266 2151 2049 2041 1669 853 498 463 457 443 342 206 103 1304 1365 --
NM_015845chr181680 ------
NM_015850chr871959 474 390 268 170 95 61 ------
NM_015855chr111822 ------
NM_015866chr12975 516 ------
NM_015872chr1131771 1704 1502 1458 1390 1331 1256 1157 662 444 428 388 380 11419 11354 --
NM_015878chr81531 ----1237
NM_015881chr1141388 960 557 244 ------
NM_015886chr855698 5255 4060 1239 209 1120 ----
NM_015891chr642046 1622 517 308 --31394 376 120 --
NM_015892chr1051990 833 613 430 190 12360 22110 1888 --
NM_015895chr61245 ------
NM_015897chr191154 --1127 --
NM_015898chr19142481 2440 2251 2144 1925 1862 1841 1654 1596 1585 804 545 249 198 22270 946 ----
NM_015902chr81698 ------
NM_015906chr194805 4323 4271 4201 4163 3664 3351 434 122 13501 ----
NM_015911chr15655 606 497 195 188 ------
NM_015912chr821942 303 --12188 --
NM_015933chr3158 ----136
NM_015949chr72366 211 --21005 288 --
NM_015974chr13127 --1370 --
NM_015981chr5132970 2504 2364 2315 2086 1278 691 619 581 461 425 419 208 --12986 --
NM_015986chr172521 286 ------
NM_015995chr15125021 4764 3837 3594 3445 1494 1439 1278 1260 1252 579 245 --35212 493 290 14391
NM_016019chr72982 770 ----1403
NM_016021chr682385 2286 2258 2167 1863 450 312 106 ----12326
NM_016022chr18871 776 769 712 413 316 251 101 1856 ----
NM_016025chr162746 94 ------
NM_016032chrX61336 1138 425 283 213 100 ------
NM_016037chr13334 302 169 ------
NM_016038chr7123 ------
NM_016040chr141984 1862 972 765 ----12024
NM_016041chr172314 257 ------
NM_016045chr2011793 1293 1263 --
NM_016057chr1271106 377 317 285 250 167 32 ------
NM_016061chr2138 ------
NM_016072chr1232427 2111 1638 12329 11879 --
NM_016076chr172538 2517 1231 832 598 587 318 12851 ----
NM_016083chr622954 78 23674 1280 ----
NM_016096chr841935 1345 576 148 --21776 427 --
NM_016097chr182720 407 ------
NM_016098chr61347 ------
NM_016120chrX1323 ------
NM_016129chr4----1106 --
NM_016131chr242254 2018 1880 745 11979 11704 --
NM_016132chr1563351 3246 3075 1272 876 516 1576 ----
NM_016147chr1171103 855 848 455 316 237 231 ------
NM_016151chr164361 346 322 147 ------
NM_016152chr341059 308 258 160 ------
NM_016162chr123318 229 215 --1125 --
NM_016169chr10203260 3093 3015 2958 2789 2647 2640 2597 2556 2502 2391 2328 2210 1212 1177 1171 1164 780 339 320 --12470 11069
NM_016201chr372280 2005 1509 884 720 654 101 --12169 --
NM_016206chr377712 7270 5453 3376 2592 1129 246 38562 7284 6468 ----
NM_016221chr542303 846 622 196 11602 42325 2293 830 491 --
NM_016224chr632079 676 583 --1477 --
NM_016231chr1711221 ------
NM_016252chr22882 796 ------
NM_016255chr633063 2909 66 1562 ----
NM_016257chr133003 2803 65 --22244 446 1803
NM_016258chr12244 215 ------
NM_016260chr2106593 6257 5667 5639 5621 5555 4670 1369 524 26 22028 1496 11034 11479
NM_016269chr42960 203 --165 --
NM_016271chr1842122 1726 1468 254 ------
NM_016272chr2292451 2429 1942 885 784 572 374 365 358 --32034 1853 678 1195
NM_016277chr61173 --31525 1412 204 --
NM_016279chr51404 ------
NM_016281chr124986 980 908 181 ------
NM_016282chr911474 ------
NM_016284chr163872 708 107 ------
NM_016287chr131859 1611 192 1667 31926 1716 600 --
NM_016289chr232235 1773 400 --1135 --
NM_016293chr122100 21 ------
NM_016303chrX1383 ------
NM_016308chr12370 324 --2271 69 --
NM_016319chr124706 253 118 86 157 ----
NM_016322chr9112936 2799 2552 2358 2291 1228 794 324 245 41 22 --22314 855 --
NM_016337chr141176 ------
NM_016339chr17131719 1605 1548 1520 1271 1246 605 590 338 310 254 192 142 --31633 1445 1265 --
NM_016353chr852487 2005 1909 1838 108 ------
NM_016356chr621946 1812 2812 530 12397 --
NM_016357chr123932 901 59 1920 ----
NM_016364chr10230 23 ----1151
NM_016374chr11356 ------
NM_016374chr11356 ------
NM_016376chr17114403 4204 3963 3715 3635 3263 3011 866 501 326 276 --34218 4197 558 --
NM_016396chr1542886 2615 2059 1025 --150 --
NM_016399chr121131 --1338 --
NM_016418chr22103685 3622 2672 2400 1323 1178 1170 1125 873 343 1217 11297 --
NM_016422chr1141214 530 510 147 ------
NM_016423chr142414 355 ------
NM_016424chr1731309 251 151 --1723 --
NM_016433chr1241394 1041 231 93 ------
NM_016436chr2031941 930 235 1539 ----
NM_016448chr151849 1698 1301 1264 438 ------
NM_016451chr11----1243 --
NM_016453chr35673 491 268 251 227 ------
NM_016454chr151330 ------
NM_016456chr15834 784 766 133 84 1108 ----
NM_016485chr62781 285 ------
NM_016486chr12409 35 ------
NM_016489chr75191 177 165 112 25 ------
NM_016492chr171123 ------
NM_016506chr11----135 --
NM_016507chr1712347 ----12289
NM_016513chr643734 2690 2538 1495 ----1694
NM_016519chr43441 165 91 ------
NM_016522chr1121674 1456 --1302 --
NM_016525chr96783 774 708 673 221 42 ------
NM_016526chr1192385 2274 1924 1795 1784 1568 777 697 400 --1265 --
NM_016530chr1563899 978 668 187 128 43 --13487 1934
NM_016531chr474094 3849 1590 587 463 414 257 32603 1079 190 1517 --
NM_016532chr1751058 1038 838 299 128 ------
NM_016536chr191336 ------
NM_016542chrX31369 686 268 --1635 --
NM_016544chr2163786 3424 2865 2854 2835 2777 1445 1258 1170 1164 1120 1102 720 604 533 429 13804 1353 21494 1035
NM_016548chr951564 1540 1339 632 280 11276 ----
NM_016559chr361444 1209 1125 538 329 31 ------
NM_016571chr6----123 --
NM_016574chr1151127 1051 934 110 67 --2757 709 --
NM_016577chr3104229 3303 3287 3164 3008 2771 2763 696 428 398 --54394 4214 4147 1773 36 --
NM_016587chr72815 263 ------
NM_016588chr61739 ------
NM_016592chr2041244 1237 1209 26 ------
NM_016596chr126752 743 714 340 170 60 ------
NM_016603chr511643 ------
NM_016604chr53461 341 235 1987 ----
NM_016605chr572495 1882 845 835 332 260 230 1489 1928 --
NM_016607chrX41601 657 388 296 ------
NM_016620chr1--11456 ----
NM_016621chr11164481 4347 4159 4056 4035 3792 3757 3496 3384 3134 3003 1530 1501 715 695 598 --34319 1685 889 --
NM_016623chr82135 128 ------
NM_016628chr103637 628 184 ------
NM_016639chr161137 ------
NM_016641chr1641559 1330 1324 245 --171 --
NM_016651chr1421037 817 ------
NM_016654chr1541320 1282 432 416 --11222 --
NM_016733chr2251234 991 502 258 50 1565 ----
NM_016818chr212195 117 1338 ----
NM_016819chr3181 1522 ----
NM_016823chr172927 279 ------
NM_016824chr1021851 1367 1655 ----
NM_016827chr31495 126 1532 1572
NM_016830chr122157 76 --1457 --
NM_016834chr17153717 3706 3633 3281 3202 3074 3002 1527 1505 1202 1146 1032 863 633 398 1823 23458 1247 --
NM_016835chr17153717 3706 3633 3281 3202 3074 3002 1527 1505 1202 1146 1032 863 633 398 1823 23458 1247 --
NM_016836chr21189 ------
NM_016839chr21189 ------
NM_016841chr17153717 3706 3633 3281 3202 3074 3002 1527 1505 1202 1146 1032 863 633 398 1823 23458 1247 --
NM_016929chr683995 3729 3274 1652 1567 1516 178 75 11366 21451 370 --
NM_016931chr111349 ------
NM_016936chr1681888 1805 1795 1550 1525 1514 408 86 --11608 --
NM_016946chr1122724 2315 1440 1369 1308 1232 945 551 291 191 174 66 --43470 3329 2323 976 --
NM_016952chr11124005 3907 3636 3603 3504 3069 2907 2793 1566 1397 650 165 --11585 14090
NM_017409chr126595 141 57 49 34 24 ------
NM_017412chr811049 ------
NM_017413chrX122292 2044 1818 1679 972 965 834 676 439 393 279 236 11682 1416 --
NM_017420chr1442840 2764 2711 2463 22792 2473 2498 23 --
NM_017423chr41547 1769 ----
NM_017439chr7----162 --
NM_017447chr2121115 793 135 1641 2380 324
NM_017455chr15191 --176 --
NM_017457chr192113 61 ------
NM_017488chr291480 1447 1273 601 488 383 349 295 194 --11069 --
NM_017514chrX4892 693 298 160 --1750 --
NM_017519chr621279 448 ------
NM_017522chr1--11239 1991 --
NM_017540chr5112910 2580 2382 2052 1289 486 300 245 173 79 59 13174 ----
NM_017548chr32547 22 --11534 --
NM_017549chr751143 1106 958 935 523 1459 1555 --
NM_017551chr1042500 965 462 360 ------
NM_017553chr152362 273 1304 ----
NM_017558chr162393 68 ------
NM_017575chr17101590 1525 1190 1180 642 627 443 426 177 125 11193 1594 --
NM_017580chr103919 691 547 ------
NM_017582chr13675 630 241 31327 326 283 11518 --
NM_017590chr2252243 1641 975 602 280 12683 12348 --
NM_017593chr41369 ------
NM_017594chr943317 2790 2772 236 --12314 --
NM_017596chr1234589 4453 4421 4350 4250 4155 4118 3690 3478 1857 1742 1456 1396 1151 1092 958 889 750 717 495 129 44 28 --2830 113 --
NM_017599chr12----21354 376 --
NM_017602chrX7379 252 157 119 95 87 45 ------
NM_017610chr1521980 1666 ------
NM_017626chr1031146 395 44 ------
NM_017633chr643733 3147 1483 205 --13312 --
NM_017634chr831713 1401 504 ------
NM_017635chr112480 106 ------
NM_017637chr988867 6718 6608 6284 6144 3018 2270 1323 48272 7512 6292 214 59429 8244 1990 1507 270 --
NM_017643chr1743123 2333 2310 491 ------
NM_017644chr384899 4886 4840 4586 3875 793 665 86 11864 11099 --
NM_017645chr922112 190 --32320 1099 977 --
NM_017657chr22878 358 --149 --
NM_017658chr1444511 3949 3870 358 11572 ----
NM_017661chr151806 ------
NM_017668chr165808 721 210 103 80 --192 --
NM_017670chr116829 338 307 297 255 102 --1774 --
NM_017679chr177711 604 551 541 466 165 79 1607 ----
NM_017684chr152633 236 ------
NM_017686chr131139 854 119 ------
NM_017694chr21378 ------
NM_017700chr41510 1136 1622 --
NM_017709chr164209 3463 3277 1629 1583 71 12937 13389 23291 1482
NM_017712chr19206254 6134 5711 5509 5398 5187 5161 5152 5114 3963 2467 2378 2152 2008 1987 1089 626 466 152 145 11347 ----
NM_017714chr202932 280 ------
NM_017719chr322416 2041 --12081 22221 280
NM_017724chr32664 33 --2835 82 --
NM_017730chr33530 196 163 ------
NM_017737chr12503 196 ------
NM_017741chr421985 334 --2612 134 --
NM_017742chr18--11869 ----
NM_017744chr182387 2028 1678 1535 761 310 175 77 --1572 --
NM_017753chr9----1950 --
NM_017758chr1751377 954 600 426 53 --21397 538 --
NM_017768chr1123 ------
NM_017772chr6121637 1614 1602 1411 1135 1084 463 439 429 422 263 101 1266 --11366
NM_017778chr841493 994 529 503 --1550 --
NM_017779chr122729 2464 --11856 --
NM_017780chr82599 205 ------
NM_017784chr33916 407 319 ------
NM_017786chr81109 ------
NM_017787chr1072304 1102 969 905 643 264 187 --12774 --
NM_017790chr9----144 --
NM_017791chr1471583 1101 1070 1023 595 315 233 11164 ----
NM_017801chr311026 11039 ----
NM_017811chr9122897 2717 2711 2503 2465 2301 2147 1168 630 231 162 82 33084 2781 142 ----
NM_017824chr1032309 880 349 --12512 --
NM_017845chr4----1537 --
NM_017848chrX104015 3806 3183 3033 1817 1770 1531 541 520 149 --33074 503 492 1959
NM_017849chr2122500 2356 2225 2032 1263 943 932 877 237 167 76 34 --1465 --
NM_017851chr1551133 1025 838 370 242 ------
NM_017873chr9143176 2870 2672 2076 1967 1161 932 830 790 706 552 441 435 207 ------
NM_017893chr1061319 1145 561 448 111 88 --21476 345 --
NM_017902chr10235625 5388 5245 5112 5065 4771 4688 4640 4616 4600 4358 4213 4198 3781 3552 1675 1550 1422 1412 783 208 201 178 24516 4476 14528 --
NM_017907chr113355 322 60 ------
NM_017919chr964420 4115 3680 2048 863 745 24933 3934 31819 1116 851 15149
NM_017921chr1762057 801 734 487 436 293 11841 ----
NM_017922chr14----1548 --
NM_017933chr231485 1325 1153 1625 ----
NM_017938chrX2419 285 --1550 --
NM_017953chr13797 766 213 --1164 --
NM_017955chr1441113 843 315 255 --11044 11174
NM_017964chr221002 676 --139 --
NM_017982chr121020 35 ------
NM_017983chr172305 156 ------
NM_017984chr7233 23 ------
NM_017987chr104547 504 496 478 2837 87 ----
NM_017988chr121217 1208 ----
NM_017994chr762871 2220 1992 995 829 803 11975 12921 --
NM_018011chr131155 ------
NM_018026chr11101233 1133 1088 940 570 411 221 206 199 188 11029 21264 96 --
NM_018027chr1052789 2731 2247 383 251 1853 ----
NM_018028chr1971202 997 908 888 525 308 272 1140 ----
NM_018030chr182948 74 1951 ----
NM_018032chr162385 299 ----1829
NM_018045chr1102771 2333 2291 2162 2022 1198 1157 859 642 442 11018 ----
NM_018046chr521546 26 1436 21731 114 --
NM_018047chr52854 88 1254 ----
NM_018048chr1252055 1448 810 745 506 1426 1792 --
NM_018054chr161470 --168 --
NM_018061chr131375 131 94 ------
NM_018062chr21408 ------
NM_018070chr11435 ------
NM_018071chr144761 665 342 257 --1784 --
NM_018077chr7155 ------
NM_018079chr21501 1194 ----
NM_018084chr253279 3004 2457 2026 992 ------
NM_018086chr251816 1584 1325 1310 78 ------
NM_018092chr161309 --186 11435
NM_018095chr11----135 --
NM_018099chr12246 35 ------
NM_018105chr81236 ------
NM_018107chr1410980 907 763 421 412 371 365 292 144 27 ----1865
NM_018111chr19156 ------
NM_018116chr11467 ------
NM_018117chr10----1647 --
NM_018121chr1062426 2215 2006 1143 452 300 1654 ----
NM_018133chr331461 676 27 ------
NM_018137chr151412 1273 1015 361 117 ------
NM_018150chr12906 76 1655 ----
NM_018155chr333009 1029 236 --23219 808 --
NM_018172chr1181281 1242 584 532 480 428 376 199 ------
NM_018178chr121606 23 1644 12034 --
NM_018179chr122600 27 ------
NM_018181chr1831285 633 28 ------
NM_018182chr1781968 1838 1722 787 695 417 398 385 1322 21781 744 --
NM_018184chr321906 157 ------
NM_018195chr1131778 555 173 11963 156 21583 1435
NM_018199chr142787 269 --3910 825 64 --
NM_018201chr9152311 2208 2037 1836 1808 1723 1003 824 664 654 640 620 299 208 162 --12050 --
NM_018202chr11307 1749 --1347
NM_018206chr16170 --126 --
NM_018214chr63370 329 86 ------
NM_018222chr115528 514 447 245 193 ------
NM_018227chr431242 558 447 --13115 --
NM_018234chr281945 1932 1464 806 751 500 421 394 11884 1854 1903
NM_018237chr10----1205 --
NM_018240chr14337 323 213 94 ------
NM_018241chr42835 742 ------
NM_018244chr2051030 955 893 204 105 2231 155 ----
NM_018246chr832750 1772 346 --12155 --
NM_018247chr672884 2147 2036 1911 744 672 288 --13087 --
NM_018254chr12345 214 --22305 549 3964 676 401
NM_018263chr282476 2373 2281 1930 1789 1031 707 387 1544 --12116
NM_018293chr31471 --12673 --
NM_018299chr832229 685 393 --12429 --
NM_018302chr452136 2061 1995 680 356 --11724 12271
NM_018307chr172758 694 ------
NM_018313chr322466 1986 11890 ----
NM_018314chr111661 --1513 --
NM_018315chr411428 --1100 --
NM_018319chr141107 188 11317 --
NM_018322chr651336 1199 927 546 32 ------
NM_018327chr2041153 646 89 54 --1315 --
NM_018330chr101653 ------
NM_018334chr7----1473 --
NM_018338chr31164 ------
NM_018340chr16105006 4958 4730 4588 3983 3276 1076 819 501 468 --33769 975 80 --
NM_018351chr1294525 4238 4174 4130 2979 2870 1841 1214 120 24437 1096 34334 3277 600 --
NM_018353chr141872 ------
NM_018362chr1143321 2971 750 123 13505 22758 2481 --
NM_018364chr123067 2822 23074 332 1936 --
NM_018367chr111214 11020 ----
NM_018374chr754515 1853 1420 1409 641 21624 1529 13232 --
NM_018383chr232076 1445 722 1821 ----
NM_018385chr321165 222 --11266 --
NM_018398chr32283 244 ------
NM_018401chr451614 639 490 95 63 ------
NM_018409chr432928 2908 711 --33175 2181 2077 1226
NM_018412chr7163 ------
NM_018416chr1272298 2274 2225 2103 992 114 82 1577 32046 1660 958 --
NM_018424chr931922 1865 431 --1615 --
NM_018440chr8107915 7633 5594 2091 1912 1832 1783 1168 446 204 15274 --17288
NM_018442chr11119 ------
NM_018444chr812238 --21514 115 --
NM_018445chr152581 44 ------
NM_018448chr1211248 ------
NM_018449chr94550 512 259 87 1693 ----
NM_018462chr33614 319 81 193 ----
NM_018464chr10175 ------
NM_018469chr1721248 358 ------
NM_018471chr21574 ------
NM_018477chr14----11078 --
NM_018488chr172721 53 --1520 --
NM_018489chr181799 1558 1502 873 700 611 534 420 ------
NM_018490chr1111743 ------
NM_018553chr1721808 486 21573 622 31166 407 251 --
NM_018557chr2----21440 102 --
NM_018566chr154428 4325 3112 1095 221 --24281 1392 --
NM_018569chr441328 1282 1179 633 ------
NM_018571chr22476 46 --1443 --
NM_018584chr141167 1148 1088 837 ------
NM_018590chr1061515 1300 587 455 441 85 --11273 1565
NM_018602chr1541637 1282 428 216 1505 ----
NM_018638chr1224740 646 ----15273
NM_018640chr1232659 2561 2538 11800 --1827
NM_018644chr1191951 1644 1518 862 717 569 530 113 90 --1732 11679
NM_018649chr102497 476 ------
NM_018650chr121646 1386 ----12270
NM_018667chr1692001 1885 1814 1063 1015 995 960 734 53 1332 1446 --
NM_018684chrX91105 1029 540 490 406 253 134 85 41 --2970 228 --
NM_018688chr83226 126 26 --1754 --
NM_018689chr15112489 1930 1776 1015 627 475 280 252 203 178 92 ------
NM_018695chr5--12004 --11813
NM_018699chr41294 ------
NM_018704chr11515 --11763 --
NM_018710chr81877 1885 1289 --
NM_018712chr1111113 ------
NM_018713chr1--1447 1188 --
NM_018715chr192089 2005 1931 1805 1792 1491 892 572 33 31480 430 211 2517 349 --
NM_018717chr472394 937 915 852 743 376 287 1948 ----
NM_018718chr751967 759 130 52 40 1654 ----
NM_018719chr711268 ------
NM_018841chr173505 1186 979 886 819 59 29 12456 11258 2701 181
NM_018847chr941342 1323 400 54 11566 ----
NM_018890chr741395 1250 1002 34 --1979 --
NM_018898chr5181 1106 11819 --
NM_018899chr5181 1106 11819 --
NM_018900chr5181 1106 11819 --
NM_018901chr5181 1106 11819 --
NM_018902chr5181 1106 11819 --
NM_018903chr5181 1106 11819 --
NM_018904chr5181 1106 11819 --
NM_018905chr5181 1106 11819 --
NM_018906chr5181 1106 11819 --
NM_018907chr5181 1106 11819 --
NM_018908chr5181 1106 11819 --
NM_018909chr5181 1106 11819 --
NM_018910chr5181 1106 11819 --
NM_018911chr5181 1106 11819 --
NM_018912chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018913chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018914chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018915chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018916chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018917chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018918chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018919chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018920chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018921chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018922chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018923chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018924chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018925chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018926chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018927chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018928chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018929chr5131716 1489 1412 1404 1375 1250 643 539 529 485 386 313 133 161 2474 172 --
NM_018948chr1------189
NM_018964chr2151040 717 157 104 42 ------
NM_018970chr732772 2484 2092 --11023 --
NM_018976chr1221903 984 ------
NM_018977chrX2350 316 ----1227
NM_018991chr74629 608 583 187 ------
NM_018999chr1064741 3022 1882 1582 997 879 14606 11107 --
NM_019004chr731831 216 142 11737 ----
NM_019005chr7126 ------
NM_019008chr2283802 3731 3437 3409 3352 2742 1507 1294 --11185 12563
NM_019027chr432064 698 546 22304 640 ----
NM_019050chr421981 292 --1606 --
NM_019053chr1021010 983 ------
NM_019062chr13101 34 24 1289 ----
NM_019063chr232336 1471 331 1656 ----
NM_019064chr175775 582 242 56 45 ------
NM_019071chr73608 275 201 ------
NM_019072chr532746 1573 85 1377 2215 138 --
NM_019080chr13----11518 --
NM_019083chr131478 1258 199 ------
NM_019087chr521676 1486 --1336 --
NM_019091chr2--190 ----
NM_019096chr63987 981 905 --2417 403 --
NM_019102chr72327 82 ------
NM_019102chr72327 82 ------
NM_019106chr22183198 3185 3026 3011 2959 2683 2498 2393 2355 2317 2279 1302 1252 760 751 620 287 245 ------
NM_019113chr19133 ------
NM_019114chr992548 2232 2226 2108 1937 1652 990 955 878 11659 1593 11783
NM_019116chr16113377 3335 2722 1447 1268 843 789 769 543 203 74 33162 3058 2870 22923 935 --
NM_019117chrX43266 3040 2926 2540 --11184 --
NM_019555chr32539 349 --11163 --
NM_019557chr13837 775 295 186 ----
NM_019592chr95842 819 150 79 64 --2693 71 --
NM_019593chr2052827 2744 2729 2686 2182 23135 1992 ----
NM_019600chr151634 ------
NM_019624chr125761 729 714 317 157 ----2912 188
NM_019625chr125761 729 714 317 157 ----2912 188
NM_019854chr122712 648 1306 --1661
NM_019857chrX41700 1630 1155 110 ----1621
NM_019859chr1021114 179 ------
NM_019860chr1021162 227 ------
NM_019885chr2142441 2347 2325 1909 1822 1106 1009 977 826 396 334 241 189 123 --1358 --
NM_019891chr121064 458 ------
NM_019895chr33735 395 71 --1976 --
NM_019903chr1021851 1367 1655 ----
NM_020039chr1271706 1515 1496 1430 1204 255 122 1590 11684 --
NM_020062chr201992 1255 1876 --
NM_020063chr13204 99 43 --131 --
NM_020066chr11868 --1114 --
NM_020122chr2105982 5610 5524 5489 4603 4264 3909 2008 1494 1398 25393 5303 ----
NM_020123chr1011161 1459 11472 --
NM_020132chr21154921 4827 4762 3669 3639 3565 3423 1820 1308 1236 1217 1131 752 706 374 1315 25152 382 --
NM_020141chr142360 294 269 134 ------
NM_020142chr126589 503 203 172 159 65 ------
NM_020144chr732082 1614 171 ----1791
NM_020147chr153785 371 194 ------
NM_020150chr1041932 1446 515 374 ------
NM_020155chr11189 ------
NM_020168chr1531136 882 520 --31215 234 216 --
NM_020177chr553267 2699 2373 2259 2174 11278 ----
NM_020178chr174843 133 93 76 ------
NM_020179chr111355 ------
NM_020180chr18184 1981 11182 --
NM_020182chr20103437 2842 2478 2350 1450 1425 1414 1251 1057 1009 --12777 --
NM_020184chr2122067 2052 2032 1955 1914 1670 1632 863 806 790 459 167 --21978 1542 --
NM_020188chr162271 232 1198 ----
NM_020193chr114969 559 444 62 ------
NM_020204chr12189 39 1295 ----
NM_020205chr163333 2885 1367 1355 1102 525 23431 651 --23198 2319
NM_020210chr154885 787 634 275 1258 ----
NM_020211chr15101478 1374 1259 1237 1008 989 342 255 162 156 11022 ----
NM_020214chr152219 27 ------
NM_020226chr41717 ------
NM_020228chr1131929 1803 759 --11915 --
NM_020239chr1102144 1902 728 560 516 456 187 110 83 72 ----21534 375
NM_020245chr694698 4368 3945 3572 3297 1532 1093 968 746 25062 3774 11083 --
NM_020248chr1112215 2127 1930 1737 1689 1552 937 830 680 105 89 ------
NM_020309chr195944 404 270 150 125 ----1306
NM_020310chr1792330 2029 1963 1942 937 923 836 785 715 --12473 --
NM_020336chr2073745 3277 2699 2688 2549 1110 209 --11045 --
NM_020337chr442991 2896 905 786 --22966 934 12455
NM_020338chr10103590 2446 1360 1332 1176 1042 608 560 233 25 ------
NM_020341chr20----2770 569 --
NM_020342chr212630 11693 ----
NM_020346chr11----21636 1436 --
NM_020348chr1072652 2242 1892 1693 317 137 121 11024 22640 2357 --
NM_020354chr101317 --2641 272 --
NM_020357chr321570 1283 1376 ----
NM_020381chr61753 11908 ----
NM_020382chr1251297 1115 610 354 38 ------
NM_020383chr104153 108 81 66 ------
NM_020390chr371726 1714 1694 1218 1143 999 614 14265 1901 --
NM_020416chr472282 2050 1940 979 811 308 22 ------
NM_020420chrY31786 1190 1156 ------
NM_020423chr1140 ------
NM_020429chr7112681 2477 2437 2291 1114 847 724 608 436 192 135 ------
NM_020431chr14112603 2427 2085 2076 2063 1827 1082 1067 1059 619 301 ------
NM_020432chr742037 1444 523 30 ------
NM_020443chr1216749 6734 6527 5518 5464 5458 4310 2405 2226 2118 1685 1510 1480 1122 1112 886 484 453 310 283 80 35569 5033 4472 12570 --
NM_020444chr52950 54 --11279 --
NM_020449chrX1581 1117 ----
NM_020452chr181697 1467 1440 1323 477 455 363 311 1350 11866 --
NM_020455chr642474 942 930 25 --1668 --
NM_020456chr1342234 1853 1711 889 ------
NM_020457chr164428 230 84 74 ------
NM_020463chr221262 444 ------
NM_020465chr1641392 808 657 232 21515 73 1430 --
NM_020473chrX3568 264 123 ------
NM_020475chr872454 2213 1604 176 122 108 95 12167 ----
NM_020476chr872454 2213 1604 176 122 108 95 12167 ----
NM_020477chr872454 2213 1604 176 122 108 95 12167 ----
NM_020478chr882517 2276 1667 239 185 171 158 61 12230 ----
NM_020480chr872454 2213 1604 176 122 108 95 12167 ----
NM_020524chr17777 748 689 673 368 341 66 ------
NM_020525chr122143 37 ------
NM_020526chr151746 1555 1277 1187 566 11214 1392 --
NM_020532chr21367 ------
NM_020630chr10--1590 1720 --
NM_020631chr191436 1198 1050 975 506 366 328 220 127 ------
NM_020638chr1281909 1762 324 263 137 71 35 23 --11846 --
NM_020644chr112991 937 ------
NM_020647chr831868 1503 522 21889 80 ----
NM_020651chr221249 484 --21663 1259 --
NM_020654chr3--155 1528 --
NM_020663chr142614 107 ------
NM_020673chr20116514 6189 5774 5555 5259 2398 2272 1802 1677 1464 1103 36487 6459 1020 35598 4775 2054 --
NM_020676chr32838 808 1133 ----
NM_020689chr2081515 1456 1203 515 343 336 184 32 --2524 206 --
NM_020698chr1273021 2308 2215 2186 1975 756 281 11940 22931 889 12132
NM_020699chr1145004 4964 4908 4825 4641 3802 3389 3371 3357 2038 1295 384 271 53 53772 3277 1894 1515 188 25175 46 --
NM_020702chr961767 1328 1208 643 222 101 11144 21875 259 --
NM_020706chr211145 ------
NM_020708chr2082545 2270 756 748 475 363 239 221 1120 21666 893 --
NM_020713chr20192594 2578 2377 2315 2262 1174 802 658 642 632 605 586 520 393 363 254 148 113 78 ------
NM_020714chr1963366 1144 1005 749 587 127 14307 13260 --
NM_020717chrX124147 3512 3504 3492 3299 1733 1276 1067 672 607 244 29 33742 1112 574 2704 143 --
NM_020718chr1696637 5681 4899 2611 2130 1770 1552 1523 56 1279 25105 2371 --
NM_020728chr743146 1120 46 26 ------
NM_020732chr621279 448 ------
NM_020734chr1252123 940 322 157 30 --1252 --
NM_020739chr1524098 2868 23774 1147 22934 1330 --
NM_020742chrX51968 1924 802 176 27 1448 ----
NM_020748chr1721841 1402 11819 ----
NM_020749chr811315 ----11304
NM_020750chr631283 459 54 ------
NM_020752chr1032120 1001 215 ------
NM_020760chr231843 347 174 ------
NM_020766chrX64183 3464 2931 2837 550 162 14568 21410 566 --
NM_020768chr542465 2348 2237 363 --1943 --
NM_020769chrX5790 751 332 145 109 --1691 --
NM_020771chr641195 1055 321 163 ------
NM_020772chr17108453 8203 8057 6720 3448 3082 2530 2299 1568 489 12858 27520 5388 18309
NM_020773chr462583 2236 2028 1655 909 55 12284 1284 --
NM_020774chr18106179 5884 5730 4321 2031 1452 1431 1296 1286 912 22334 1532 25147 2385 12320
NM_020775chr11170 ------
NM_020776chr1882613 2498 949 784 752 525 391 96 --22999 412 --
NM_020778chr15194296 4180 3534 3155 3042 1840 1743 1259 1213 1116 1020 756 697 676 646 509 280 202 130 --14329 24591 1502
NM_020783chr1831823 780 233 --11599 --
NM_020791chr1711136 ------
NM_020792chr33743 737 32 12009 --1403
NM_020795chr17121740 1729 1700 1356 1279 1261 805 602 566 560 551 487 --21990 418 11972
NM_020796chr542830 2536 2307 2002 --1718 --
NM_020800chr331257 377 288 ----11129
NM_020801chr51988 12328 22133 583 --
NM_020802chr1152661 2619 2415 405 330 --23390 393 --
NM_020805chr181114 ------
NM_020807chr1631392 1378 183 21311 293 1246 --
NM_020808chr14900 219 49 41 ------
NM_020809chr1122006 1796 21997 1803 31591 763 75 --
NM_020810chr1463207 3101 3078 2777 2571 103 13238 1355 --
NM_020821chr152633 236 ------
NM_020826chr1172599 1000 894 398 70 59 23 12393 13357 --
NM_020832chr16488 223 175 70 36 29 ------
NM_020834chr1441550 1193 351 313 --1459 --
NM_020839chr321538 301 ------
NM_020841chr122639 302 ------
NM_020843chr15133 ------
NM_020845chr1282387 2328 2064 2036 1686 971 876 733 ------
NM_020850chr16113115 2769 914 893 884 736 728 618 201 142 115 12604 22792 517 22935 2139
NM_020851chr1581767 1459 1412 1154 474 463 224 111 1119 ----
NM_020854chr181232 11059 ----
NM_020856chr1921240 982 --31565 1218 373 1477
NM_020858chr1531506 758 414 ------
NM_020861chr64152 129 123 57 ------
NM_020866chr13----1840 --
NM_020870chr422023 771 --22196 1588 --
NM_020871chrX1994 1769 ----
NM_020872chr31606 --11298 --
NM_020886chr1131035 299 48 --1513 --
NM_020897chr161288 1184 922 913 319 68 ------
NM_020899chr17112362 2032 2011 1614 697 689 566 127 95 84 22 --31691 819 261 --
NM_020918chr1052942 2922 1177 841 810 ------
NM_020919chr21491 --1296 --
NM_020921chr1433330 2693 153 ------
NM_020922chrX31446 240 81 --11898 --
NM_020925chr1199 1361 11442 --
NM_020935chr234332 3223 214 --14311 --
NM_020946chr951706 1500 505 260 122 ------
NM_020948chr143583 2979 2709 509 12941 ----
NM_020956chr19134598 4363 3731 2990 1480 1407 1024 901 754 684 664 379 78 13004 14617 --
NM_020962chr1561728 929 778 653 643 111 22440 528 12279 --
NM_020964chr18114496 4291 3895 3595 3326 3258 3101 3062 1478 824 408 --1849 13335
NM_020967chr2021251 445 ------
NM_020971chr195736 207 187 94 41 1248 1882 --
NM_020975chr1041263 800 523 73 ------
NM_020977chr441499 1413 330 127 --1502 --
NM_020983chr12142241 2048 1928 1878 1866 1684 1641 1587 1480 935 658 398 347 307 --11668 --
NM_020987chr10--1556 ----
NM_020988chr165885 875 860 362 123 --11100 --
NM_020993chr1282751 2413 1030 738 700 493 444 87 31837 917 590 ----
NM_021003chr141590 --1709 --
NM_021005chr153943 410 219 --1916 --
NM_021007chr21158 ------
NM_021012chr1793073 2527 2466 2399 2298 1131 1096 946 365 ------
NM_021020chr883284 3057 3037 2978 1267 690 676 220 11074 33313 379 90 --
NM_021032chr321983 42 --136 --
NM_021033chr1322912 213 13205 ----
NM_021035chr2051287 1231 1125 1043 471 --2967 531 --
NM_021069chr411652 11629 ----
NM_021072chr5190 --22447 2060 --
NM_021079chr1772813 1098 1054 906 755 548 100 --22365 1039 --
NM_021083chrX83665 3224 2489 1433 796 392 281 185 --22995 116 11106
NM_021090chr22144723 4147 3820 1502 1496 1378 1125 1115 1075 1033 748 656 631 236 34807 998 621 21935 473 --
NM_021097chr253044 2394 2173 1920 1039 ------
NM_021104chr12----1280 --
NM_021106chr91479 ------
NM_021110chr82223 131 2717 193 1486 --
NM_021116chr7178517 8503 8416 8312 8187 7363 7309 7288 7045 3632 3380 2598 2411 2335 1838 1569 785 17449 36634 2819 1469 16904
NM_021120chrX73039 2759 2273 850 113 65 51 12201 13141 --
NM_021132chr102322 141 11237 ----
NM_021136chr141290 ------
NM_021137chr1781995 1803 904 861 624 548 232 183 21882 334 ----
NM_021140chrX2764 349 --1293 --
NM_021144chr92416 120 ------
NM_021145chr751023 995 864 239 162 --160 --
NM_021148chr732521 1991 914 ----11814
NM_021149chr161244 1168 3323 211 26 1901
NM_021155chr19103000 2605 2513 2449 2377 1975 1960 1167 650 96 --32317 488 370 --
NM_021156chr202731 54 ------
NM_021159chr441560 1433 1210 565 ------
NM_021168chr1661180 1129 1065 1002 427 57 ------
NM_021174chr84690 497 286 239 --1611 --
NM_021177chr6271 29 ------
NM_021188chr142558 138 1493 ----
NM_021189chr181003 981 948 904 828 785 223 99 ------
NM_021191chr1282546 2221 2129 1871 1798 1716 856 94 --2598 155 --
NM_021200chr11101117 1081 1064 1054 994 807 157 122 49 27 1368 ----
NM_021202chr20212916 2851 2281 1990 1977 858 841 580 436 332 321 300 292 281 252 245 202 189 90 65 45 1445 129 --
NM_021205chr141135 522 299 264 --21149 76 --
NM_021215chr2082329 2196 1757 789 544 390 151 83 22050 293 2905 96 --
NM_021216chr1961155 889 482 395 289 196 21092 172 ----
NM_021218chr91298 1668 ----
NM_021229chr125987 482 392 310 203 ------
NM_021238chr1261974 1966 1504 703 517 81 1305 ----
NM_021239chr141168 1958 150 --
NM_021249chr1421625 129 --11271 --
NM_021253chr651153 1133 445 368 58 11387 11141 --
NM_021259chr1610977 958 881 745 457 444 243 209 175 158 1128 138 --
NM_021619chr971278 860 813 501 492 444 369 ------
NM_021637chrX11357 1446 ----
NM_021638chr4175023 4322 4224 3998 3961 3737 3429 3379 3192 3148 1393 1340 1130 1040 1034 811 44 14116 23550 1512 --
NM_021643chr211654 --1261 --
NM_021644chr103941 354 255 --11008 --
NM_021647chr463430 3422 1755 1506 1379 50 21586 1285 23996 1827 1109
NM_021648chr682112 1926 1789 984 934 911 745 50 12301 11919 --
NM_021705chr621226 421 1103 1392 --
NM_021728chr141664 ------
NM_021783chrX102257 2243 2203 844 795 600 406 398 206 25 ------
NM_021804chrX122 ------
NM_021813chr6135476 5402 5326 5165 4005 1753 1656 1538 1510 563 291 162 34 15088 23800 206 --
NM_021814chr62215 149 --11193 --
NM_021817chr11309 --172 --
NM_021905chr672242 2192 2082 1978 1720 1557 1435 11875 ----
NM_021908chr76829 667 585 301 277 223 1243 1211 --
NM_021911chr562176 2040 1790 806 592 361 --14197 --
NM_021912chr1542885 2817 1239 959 --23841 2927 --
NM_021913chr1971786 1724 1691 1642 1636 635 157 ------
NM_021914chr142265 102 ----11678
NM_021940chr631574 1280 348 ------
NM_021943chr621451 1373 --22101 438 --
NM_021946chrX111221 1083 1073 1016 1010 548 312 298 60 33 23 --11038 --
NM_021947chr1731062 339 278 ------
NM_021949chrX42705 2199 1977 1945 22919 1028 22295 239 --
NM_021954chr1353325 3104 2863 2766 1242 23485 355 13171 --
NM_021956chr631402 964 237 --11473 --
NM_021960chr111773 --1771 --
NM_021961chr11136994 6627 6473 6467 6418 5370 4570 2709 2425 2037 1871 1749 1335 22083 1551 27094 2489 1740
NM_021962chr1782410 1725 1707 842 618 521 229 43 ------
NM_021964chr331765 1594 543 ------
NM_021965chr941064 521 405 273 190 ----
NM_021973chr42541 169 --1109 --
NM_021977chr683091 2953 2859 2746 1537 788 758 51 12992 22768 2478 11394
NM_021984chrX91348 1309 988 522 516 242 165 58 31 11060 2602 567 --
NM_021987chrX91348 1309 988 522 516 242 165 58 31 11060 2602 567 --
NM_021988chr2051055 615 546 517 31 1385 ----
NM_021990chrX91348 1309 988 522 516 242 165 58 31 11060 2602 567 --
NM_021998chrX1172 --11091 --
NM_021999chr13------158
NM_022003chr1131195 957 106 11032 1851 --
NM_022042chr431165 211 80 ------
NM_022048chr15156306 5828 5180 5039 4518 3878 2357 2007 1925 1782 528 348 328 271 88 1338 66161 6122 4777 4196 2211 1585 --
NM_022060chr1481379 1340 1318 1295 1198 1160 1072 505 --1261 --
NM_022062chr1191927 1898 1684 1445 1309 732 597 470 293 --11494 --
NM_022066chr177806 429 300 291 122 92 78 ------
NM_022073chr1451386 1164 533 133 87 --21272 592 --
NM_022075chr15687 680 673 660 134 ------
NM_022085chr651184 1175 520 253 23 ------
NM_022095chr20181 ------
NM_022114chr184399 4349 3876 3692 3304 3252 896 105 34131 1787 1464 23080 442 --
NM_022123chr141144 ------
NM_022124chr102473 195 ------
NM_022130chr53536 186 27 ------
NM_022131chr361467 1427 1052 608 85 36 11034 --1141
NM_022138chr62348 218 1938 ----
NM_022140chr532368 1546 366 --11972 --
NM_022143chr71624 ------
NM_022166chr16326127 5814 5630 5364 5113 5066 5035 4922 4867 4534 4523 4252 4113 2523 2410 2399 2329 2275 2160 1690 1393 1374 1333 1297 983 812 699 646 574 464 296 280 34826 4361 719 45600 4233 492 238 --
NM_022169chr11101441 1423 1297 1189 1115 547 535 296 122 59 --11227 --
NM_022170chr731477 270 92 ------
NM_022307chr74683 643 633 454 ------
NM_022340chr373496 3392 2682 2567 2337 1122 498 --43244 627 362 274 --
NM_022368chrX272 21 ------
NM_022442chr2051055 615 546 517 31 1385 ----
NM_022456chr12106350 5586 5084 4999 4966 2751 1086 1060 435 113 11971 1570 --
NM_022458chr742666 2444 917 100 12723 ----
NM_022459chr1354656 1914 1002 616 533 24278 1838 15274 --
NM_022462chr19203665 3568 3469 3205 2864 2549 1415 1202 1106 879 873 858 852 773 627 528 242 213 159 106 13502 43369 2700 1398 294 --
NM_022465chr12182944 2923 2817 2499 2253 2216 2071 1953 1876 1106 1042 995 849 810 791 780 140 61 1406 42884 2169 562 340 1451
NM_022469chr1122884 2714 2612 2589 2315 2169 1154 692 470 449 440 395 ------
NM_022473chr1574297 4108 3949 3525 1682 131 81 --1872 --
NM_022474chr1432762 2212 782 1163 1303 --
NM_022475chr42206 93 ------
NM_022477chr2061422 1317 1175 637 168 122 ------
NM_022491chr1243493 2658 2608 799 174 130 --
NM_022497chr373019 1302 547 507 459 199 85 ----1348
NM_022552chr241218 993 267 252 --11123 --
NM_022553chr64498 178 102 68 --188 --
NM_022566chr15164 --121 1396
NM_022572chr2141686 1614 1596 1588 1371 1332 1310 1270 1152 551 522 438 308 298 --11203 --
NM_022574chr7102182 1972 1943 1795 1765 1743 1736 755 642 22 --1286 --
NM_022644chr173434 186 33 ------
NM_022648chr2144601 4354 4173 4140 4131 3680 3661 3414 3103 1828 1089 1061 820 347 24558 3820 24391 1393 --
NM_022650chr52239 74 --1858 --
NM_022652chr121939 ------
NM_022658chr122288 39 128 1255 --
NM_022659chr82200 120 ------
NM_022664chr1----185 --
NM_022716chr153007 2082 739 537 451 ------
NM_022719chr22113909 3746 3699 2769 2739 1477 1351 1103 702 529 228 ------
NM_022725chr111763 1589 1333 --
NM_022726chr61520 --11197 --
NM_022728chr71583 ------
NM_022730chr28920 876 835 422 403 397 200 184 ------
NM_022733chr19981 973 748 310 175 95 84 69 51 ------
NM_022737chr19131249 1120 1062 1034 950 925 256 249 211 135 106 100 94 --1910 --
NM_022739chr1731229 116 58 ------
NM_022748chr731878 1091 920 12877 ----
NM_022749chr871195 1105 897 540 301 40 28 ------
NM_022750chr74744 721 584 116 ------
NM_022753chr172784 2766 1124 894 768 610 335 22286 476 1879 --
NM_022755chr931832 365 135 --1115 --
NM_022756chr161177 1035 337 279 104 49 ------
NM_022758chr6142620 2564 2524 2387 2335 2280 2202 2180 2161 804 699 620 401 105 12591 1610 --
NM_022763chr372780 2740 2671 2288 1247 84 71 12162 ----
NM_022768chr1----2310 259 --
NM_022771chr1211077 --147 --
NM_022776chr321557 606 ------
NM_022781chr963293 2779 2662 2333 676 609 22931 100 ----
NM_022784chr151122 --1374 --
NM_022802chr101303 1412 1437 --
NM_022821chr11391 ------
NM_022822chr114697 226 144 107 1641 --1200
NM_022826chr221063 275 --1310 --
NM_022831chr141555 526 288 83 --1195 11701
NM_022832chr442405 2301 146 80 1904 11954 --
NM_022833chr961431 1380 1047 459 289 45 --11219 --
NM_022841chr152992 964 --31914 1827 1030 --
NM_022844chr161299 --128 --
NM_022845chr1642053 1836 703 295 ------
NM_022893chr232649 60 44 13182 ----
NM_022894chr221755 1631 31646 1574 1323 1347 --
NM_022898chr14104736 4431 3860 3526 3413 3205 3181 3101 3002 1857 --1330 --
NM_022910chr1641392 808 657 232 21515 73 1430 --
NM_022912chr252710 978 382 233 202 --1674 --
NM_022970chr101241 1969 ----
NM_022977chrX42282 889 372 57 1222 12036 11774
NM_023000chr1421432 236 ------
NM_023001chr1421432 236 ------
NM_023009chr14756 291 275 141 2217 193 ----
NM_023012chr12----1588 --
NM_023019chr23299 229 26 --1319 --
NM_023034chr82551 220 --1515 --
NM_023037chr131113 1994 ----
NM_023039chr52369 29 ------
NM_023067chr33532 225 180 --1377 --
NM_023074chr1961221 979 858 533 403 155 ------
NM_023079chr17101741 1632 1571 1448 1270 666 495 305 186 21 1324 2678 52 --
NM_023105chr871959 474 390 268 170 95 61 ------
NM_023106chr871959 474 390 268 170 95 61 ------
NM_023110chr871959 474 390 268 170 95 61 ------
NM_023111chr871959 474 390 268 170 95 61 ------
NM_023923chr1103736 3627 3440 3417 3231 3016 2575 1067 571 546 21125 253 1316 --
NM_023927chr521165 44 2379 368 1888 --
NM_023929chr841947 1050 884 672 ------
NM_023930chr112839 243 --1689 1718
NM_023932chr6246 27 --138 --
NM_024007chr552811 1966 1077 863 786 12607 --1608
NM_024015chr1751144 1119 1109 1077 954 ------
NM_024017chr1761477 1145 584 542 327 157 ------
NM_024019chr45996 341 85 74 45 ------
NM_024034chr206876 861 707 413 406 395 ------
NM_024040chr10170 --1112 --
NM_024045chr101201 ------
NM_024046chr361153 1029 865 329 323 221 1975 ----
NM_024052chr1772646 2355 2058 2031 1058 694 456 22346 817 12676 --
NM_024072chr1251639 1337 1033 573 28 ------
NM_024076chr1992347 2147 1501 971 948 698 482 188 130 ------
NM_024082chrX2106 37 ----1445
NM_024085chr251044 948 407 309 239 ------
NM_024090chr421295 248 ------
NM_024095chr1241310 1013 192 159 1276 2387 65 --
NM_024103chr19101827 1578 1452 1289 430 225 189 131 81 29 ----1274
NM_024107chr173569 159 39 ----1546
NM_024122chrX1235 --1201 --
NM_024165chr62265 61 ------
NM_024294chr6142620 2564 2524 2387 2335 2280 2202 2180 2161 804 699 620 401 105 12591 1610 --
NM_024295chr862044 1554 525 361 346 274 21874 1775 1805 --
NM_024306chr168966 858 804 774 462 352 179 46 ------
NM_024315chr71145 ------
NM_024323chr193378 276 102 ------
NM_024328chr145683 214 103 88 55 ------
NM_024345chr966062 4283 3830 2153 1060 687 24469 1304 ----
NM_024408chr162687 2329 1186 576 488 443 12869 2774 603 --
NM_024411chr2071185 1090 609 322 204 89 38 31118 405 78 ----
NM_024424chr113783 319 78 ------
NM_024425chr113783 319 78 ------
NM_024426chr113783 319 78 ------
NM_024490chr151571 ------
NM_024491chr33477 460 120 --1221 --
NM_024501chr22532 60 ------
NM_024511chr462943 2312 2172 396 291 38 23067 2999 1547 --
NM_024512chr322478 1062 ------
NM_024524chr333138 382 109 --1358 --
NM_024532chr2--137 ----
NM_024551chr1292450 2396 2183 2132 1720 875 746 365 283 12458 11905 --
NM_024551chr1292450 2396 2183 2132 1720 875 746 365 283 12458 11905 --
NM_024554chr131581 1359 1071 11594 ----
NM_024557chr113593 540 48 11257 --1427
NM_024561chr13123 11270 1518 --
NM_024594chr521419 185 31630 1328 249 ----
NM_024595chr11813 ------
NM_024612chr1711052 ------
NM_024616chr321449 575 --1138 --
NM_024624chr2----1118 --
NM_024627chr22104965 4386 1359 736 681 650 361 237 208 31 --14512 --
NM_024631chr113507 74 38 --1114 --
NM_024645chr821375 401 ------
NM_024646chr173222 2614 944 654 639 338 307 ------
NM_024659chr22851 185 ------
NM_024665chr364668 3841 3228 398 357 238 13375 34618 3894 3366 --
NM_024666chr1531347 673 56 1132 ----
NM_024674chr183217 3206 3090 2307 2175 1283 955 620 12766 22042 139 --
NM_024675chr16