TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3937
miRNA Sequence: ACAGGCGGCUGUAGCAAUGGGGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr1232428 224 124 --2128 29 1587
NM_000024chr51135 ------
NM_000037chr862266 2173 2164 2015 669 236 ------
NM_000044chrX----161 --
NM_000053chr132475 426 --2574 201 --
NM_000074chrX190 ------
NM_000081chr121868 1234 ------
NM_000082chr51700 ------
NM_000084chrX76541 5375 5360 4811 4434 4215 1317 26352 5532 ----
NM_000088chr1711136 ------
NM_000093chr93960 621 238 --11663 --
NM_000094chr3--1259 ----
NM_000125chr633746 1470 687 23936 3829 ----
NM_000134chr42575 426 ------
NM_000141chr1021144 303 ------
NM_000166chrX2578 240 --191 1606
NM_000188chr102702 27 ----1451
NM_000214chr20----11310 11633
NM_000217chr1223283 1269 ------
NM_000228chr12282 41 ------
NM_000244chr11----125 --
NM_000245chr712172 ----160
NM_000248chr352659 2376 602 489 346 ------
NM_000259chr1584945 4902 4869 2398 2019 1314 1198 1063 14127 ----
NM_000267chr1732273 371 185 ----12235
NM_000271chr181144 ------
NM_000278chr1071666 1634 882 815 761 588 442 --3264 260 243 164
NM_000280chr111115 ------
NM_000291chrX1268 ------
NM_000314chr10----11042 --
NM_000319chr122133 49 ------
NM_000325chr41459 ------
NM_000330chrX123 11631 ----
NM_000332chr641654 448 438 282 15405 ----
NM_000335chr312029 --11914 --
NM_000346chr1721503 734 --1365 --
NM_000362chr2283417 3024 2904 1288 1245 828 772 96 --11369 1751
NM_000367chr652001 1808 1761 481 455 --22185 1515 --
NM_000368chr924697 4053 14133 24170 3760 13054
NM_000376chr12113055 2649 2500 2266 1999 1265 1187 1000 442 309 25 --2409 101 --
NM_000378chr112191 167 ------
NM_000387chr32584 293 ------
NM_000390chrX12946 --11262 12316
NM_000391chr1141661 1492 1466 205 ------
NM_000403chr11133 --143 --
NM_000408chr222597 107 ------
NM_000411chr2122160 582 12659 130 --
NM_000424chr12123 ------
NM_000425chrX3643 583 109 ------
NM_000430chr1763070 3036 2905 2854 2560 2440 1372 ----
NM_000434chr6245 31 187 ----
NM_000435chr19153 ----1850
NM_000439chr542223 716 646 63 ------
NM_000442chr172960 834 11003 ----
NM_000445chr83874 766 207 --2759 322 --
NM_000449chr11165 ------
NM_000459chr91229 ------
NM_000461chr344028 3133 1476 1309 23175 1617 ----
NM_000476chr94978 493 347 122 --11412 --
NM_000480chr1131444 1201 418 1289 11394 --
NM_000484chr2121039 123 1159 ----
NM_000503chr82611 145 --1109 --
NM_000533chrX21242 544 ------
NM_000552chr12126 --136 --
NM_000555chrX57636 5024 4857 4820 299 15302 ----
NM_000578chr241628 1492 1218 674 ------
NM_000597chr2121 ------
NM_000615chr113921 841 784 --11037 --
NM_000618chr1265854 5537 5403 5202 2033 293 11404 12568 --
NM_000618chr1265854 5537 5403 5202 2033 293 11404 12568 --
NM_000619chr122476 380 ------
NM_000633chr183955 356 325 --1989 --
NM_000660chr192227 64 --1238 --
NM_000719chr1256378 5938 1951 243 190 16552 ----
NM_000721chr132479 1984 222 1799 ----
NM_000723chr1751401 1192 1169 517 87 11496 2483 207 --
NM_000725chr1211004 --2890 146 --
NM_000726chr211327 ------
NM_000767chr1991438 1419 1361 1187 1116 377 331 93 54 ------
NM_000806chr511882 ------
NM_000813chr534339 2171 1403 ------
NM_000814chr1521062 692 --161 --
NM_000817chr211013 ------
NM_000829chr1142313 2225 2213 1918 --12138 --
NM_000831chr196026 5780 5524 5263 5109 4624 4026 1258 500 15806 35899 5029 117 --
NM_000833chr1621490 1363 ------
NM_000836chr191694 --1124 --
NM_000838chr622752 155 ------
NM_000841chr62877 96 --6843 835 822 815 802 769 --
NM_000861chr342233 1770 1699 634 ------
NM_000864chr12971 344 ------
NM_000868chrX32499 1802 1796 ------
NM_000875chr1541253 948 855 581 ----1453
NM_000883chr71263 --2577 573 --
NM_000883chr71263 --2577 573 --
NM_000891chr1731205 785 372 ------
NM_000901chr442366 1975 536 350 ------
NM_000908chr51177 ----133
NM_000912chr822318 2272 22386 1373 ----
NM_000924chr1221083 922 ------
NM_000935chr311079 ------
NM_000937chr172379 278 ------
NM_000939chr2182 ------
NM_000944chr422078 926 ------
NM_000945chr2----11481 --
NM_000960chr192768 495 ------
NM_000961chr20103454 3324 3028 2895 2869 1402 1357 1267 1032 32 --23844 3458 --
NM_000964chr174970 886 418 55 --1194 --
NM_000965chr311055 1968 ----
NM_001001132chr2121192 132 ------
NM_001001331chr351839 950 750 552 55 ------
NM_001001344chrX----22492 548 --
NM_001001395chr1212687 ------
NM_001001396chr153797 3633 1791 1703 1491 ------
NM_001001436chr162746 125 ------
NM_001001438chr211124 --129 --
NM_001001481chr81924 ------
NM_001001520chr191139 ------
NM_001001522chr11272 63 ------
NM_001001549chr752185 965 827 292 202 --12380 --
NM_001001550chr752185 965 827 292 202 --12380 --
NM_001001555chr752185 965 827 292 202 --12380 --
NM_001001557chr85873 763 617 225 53 ------
NM_001001890chr2164164 3206 3109 939 48 42 --1207 --
NM_001001974chr102896 114 --125 --
NM_001001994chrX--1350 ----
NM_001001996chrX--1350 ----
NM_001001998chr1123 ------
NM_001002000chr141374 ------
NM_001002002chr141374 ------
NM_001002031chr12138 ------
NM_001002032chr17----1544 --
NM_001002033chr171533 --2644 514 --
NM_001002252chr12----157 --
NM_001002295chr1021112 1074 ------
NM_001002762chr1062571 2336 1027 973 720 49 --21010 465 21158 470
NM_001002814chr853439 3176 2858 1166 1031 22456 80 ----
NM_001002838chrX3743 697 354 ------
NM_001002840chr74539 512 237 191 ------
NM_001002841chr17122 ------
NM_001002860chr1454566 2964 1227 989 21 21032 28 ----
NM_001002909chr1722107 1837 ------
NM_001003407chr1035029 767 489 ------
NM_001003408chr1035029 767 489 ------
NM_001003674chr1836922 2689 2523 --15605 --
NM_001003675chr1836922 2689 2523 --15605 --
NM_001003676chr111330 ------
NM_001003681chr221279 ------
NM_001003805chr14162 ------
NM_001003809chr182249 73 ------
NM_001003891chr222811 130 ------
NM_001003895chrY--1143 ----
NM_001003940chr1523739 2780 --53155 2944 2517 1234 44 --
NM_001003942chr1523739 2780 --53155 2944 2517 1234 44 --
NM_001003943chr1523743 2784 --53159 2948 2521 1238 48 --
NM_001003954chr8139 ------
NM_001004105chr5----137 --
NM_001004354chr93420 251 240 ------
NM_001004419chr1221595 548 ------
NM_001004439chr1531210 1008 146 ------
NM_001005290chr1132 ------
NM_001005353chr121162 181 ------
NM_001005353chr121162 181 ------
NM_001005360chr192806 165 ------
NM_001005361chr192806 165 ------
NM_001005362chr192806 165 ------
NM_001005366chr121246 ------
NM_001005386chr211679 --1703 --
NM_001005404chr1734068 2796 1699 ----1333
NM_001005463chr1032423 1838 307 ------
NM_001005476chr21677 ------
NM_001005502chr1264958 4898 3600 1440 1302 309 43783 1483 1044 601 25065 5055 --
NM_001005505chr35359 338 248 82 51 ------
NM_001005739chr22854 72 ------
NM_001005743chr142394 201 ------
NM_001005744chr142394 201 ------
NM_001005745chr142394 201 ------
NM_001005746chr211327 ------
NM_001005747chr211327 ------
NM_001005861chr3139 ------
NM_001006115chr331720 618 244 --12784 --
NM_001006600chr51975 ------
NM_001006617chr92903 289 --146 --
NM_001006619chr92903 289 --146 --
NM_001006620chr92903 289 --146 --
NM_001006621chr92903 289 --146 --
NM_001006623chr222038 729 ------
NM_001006636chr2--1389 ----
NM_001006932chr633202 3042 533 1591 2788 76 --
NM_001006944chr113673 509 254 --177 --
NM_001006946chr211291 --21827 192 --
NM_001007072chr15------196
NM_001007098chr12824 240 ------
NM_001007102chr611317 ------
NM_001007224chr73918 473 116 ------
NM_001007226chr1721134 349 --1987 --
NM_001007227chr1721134 349 --1987 --
NM_001007228chr1721134 349 --1987 --
NM_001007229chr1721134 349 --1987 --
NM_001007230chr1721134 349 --1987 --
NM_001007233chr51700 ------
NM_001007237chr121931 165 12009 ----
NM_001007257chr11371 ------
NM_001007271chr101410 ------
NM_001007277chr113399 130 92 --1199 --
NM_001007527chr51228 ------
NM_001007553chr12410 305 1875 1910 --
NM_001007559chr1841910 1864 1729 1703 ------
NM_001008216chr11133 --143 --
NM_001008220chr553839 3158 2891 2580 1045 --12695 --
NM_001008225chr71690 ------
NM_001008239chr1861479 1384 913 796 562 296 ----12425
NM_001008495chr81220 ------
NM_001008564chr1331577 783 530 ------
NM_001008660chr11----1352 --
NM_001008777chr171228 ------
NM_001008801chr1931751 1571 1348 ------
NM_001008860chr151719 --1665 --
NM_001008892chr151719 --1665 --
NM_001008894chr151719 --1665 --
NM_001009552chr82233 22 ------
NM_001009554chr4----21253 150 --
NM_001009554chr4----21253 150 --
NM_001009993chr224041 3652 --1220 --
NM_001009997chr102333 80 ------
NM_001010853chr642658 754 619 593 ------
NM_001010867chr1156481 6257 6035 5870 5249 4385 4347 2655 2629 2600 2092 2066 1738 1622 395 --45649 714 360 155 21872 1729
NM_001010917chr1041653 898 513 86 --1196 12133
NM_001010924chr10--1372 1823 --
NM_001010934chr7------1227
NM_001010938chr32564 296 ----132
NM_001010986chrX1358 ------
NM_001011515chr41952 ------
NM_001011516chr41952 ------
NM_001011645chrX----161 --
NM_001011658chrX51397 1371 494 362 336 ------
NM_001011666chr756028 4442 1486 1446 1034 2849 324 ----
NM_001011708chr222802 2758 12347 ----
NM_001011713chr141579 ------
NM_001011885chr1511654 ------
NM_001012264chr141665 ------
NM_001012329chr132175 769 606 --1908 --
NM_001012338chr152127 52 ------
NM_001012393chr1131951 1851 32 13322 --11465
NM_001012398chr16------183
NM_001012426chr6103209 3143 2652 2526 2489 1056 957 742 463 275 --12161 --
NM_001012427chr6103209 3143 2652 2526 2489 1056 957 742 463 275 --12161 --
NM_001012614chr43643 161 31 --1679 --
NM_001012643chr192514 220 1146 2213 25 --
NM_001012644chr201124 --1334 --
NM_001012756chr1932627 2447 2421 ------
NM_001012977chrX3519 279 164 ------
NM_001013415chr431085 991 210 ------
NM_001013437chr182380 170 ------
NM_001013620chr1256415 5979 3071 2935 998 16738 ----
NM_001013642chr13996 911 217 --11130 --
NM_001013690chr1252164 1803 1775 576 51 ----11573
NM_001013693chr172111 1827 1002 902 688 615 231 --2597 393 --
NM_001013693chr172111 1827 1002 902 688 615 231 --2597 393 --
NM_001013839chr1712206 --41013 726 722 21 --
NM_001014445chr173993 742 55 --1182 --
NM_001014794chr11197 --1235 --
NM_001014795chr11197 --1235 --
NM_001014797chr1097863 7581 7506 6288 2845 2690 1438 668 285 ----12857
NM_001014831chr191788 ----1736
NM_001014832chr191788 ----1736
NM_001014834chr191788 ----1736
NM_001014835chr191788 ----1736
NM_001014839chr13874 728 368 ------
NM_001014841chr13874 728 368 ------
NM_001015045chr43685 158 120 ------
NM_001015877chrX1136 --1775 11211
NM_001015880chr1021547 1159 ------
NM_001017368chr171156 ------
NM_001017395chr353278 2451 1406 1020 395 ----12329
NM_001017402chr12282 41 ------
NM_001017405chr41680 ------
NM_001017406chr12176 42 ------
NM_001017523chr121119 ----11683
NM_001017535chr12113055 2649 2500 2266 1999 1265 1187 1000 442 309 25 --2409 101 --
NM_001017916chr17102029 1845 1740 1707 1615 1546 1291 344 162 45 ------
NM_001017917chr17102029 1845 1740 1707 1615 1546 1291 344 162 45 ------
NM_001017981chr22----3551 505 45 --
NM_001018050chr2253416 3369 2775 2146 2139 1945 22493 893 --
NM_001018052chr2253416 3369 2775 2146 2139 1945 22493 893 --
NM_001018064chr921944 440 ------
NM_001018065chr9--167 ----
NM_001018066chr9--167 ----
NM_001018067chr134931 4074 3919 ------
NM_001018068chr134931 4074 3919 ------
NM_001018069chr134931 4074 3919 ------
NM_001018072chr121119 ----11683
NM_001018108chr1561926 731 612 285 47 38 ------
NM_001018111chr7--1214 --12845
NM_001018676chr8191 ------
NM_001018677chr8191 ------
NM_001020658chr121619 412 ------
NM_001020658chr121619 412 ------
NM_001024218chr141303 ------
NM_001024226chr12469 92 ------
NM_001024227chr12469 92 ------
NM_001024228chr12469 92 ------
NM_001024372chr8123 --1774 1264
NM_001024460chr611117 11090 176 --
NM_001024463chr151444 --140 --
NM_001024647chr1255289 5155 2880 2108 1225 25650 24 --15413
NM_001024666chrX1475 ------
NM_001024668chr122789 745 ------
NM_001024680chr221711 1576 ------
NM_001024808chr122998 408 12217 ----
NM_001024809chr174970 886 418 55 --1194 --
NM_001024845chr1----186 --
NM_001024847chr332518 601 285 ------
NM_001024937chr171214 ------
NM_001024948chr162921 2636 2167 943 274 241 ------
NM_001024959chr34726 704 556 198 --1785 --
NM_001024960chr34726 704 556 198 --1785 --
NM_001025068chr311590 ------
NM_001025069chr311590 ------
NM_001025076chr1055671 5253 5137 4840 4207 11263 ----
NM_001025077chr1067029 6611 6495 6198 5565 884 22621 1120 1425 --
NM_001025105chr5----1580 --
NM_001025108chr254178 3431 3003 2829 802 13759 1186 13146
NM_001025205chr31109 ------
NM_001025252chr833206 2873 2731 ------
NM_001025253chr833206 2873 2731 ------
NM_001025266chr384917 3824 3798 1691 1665 535 259 163 ------
NM_001025389chr1131444 1201 418 1289 11394 --
NM_001025390chr1131444 1201 418 1289 11394 --
NM_001025579chr172162 74 11044 1188 --
NM_001025580chrX33476 737 388 ------
NM_001025595chr411496 ------
NM_001025603chr11165 ------
NM_001025780chr941200 1070 1024 998 ------
NM_001029858chr653379 2978 1303 1277 559 ------
NM_001029875chr552545 2394 2024 1158 134 12145 ----
NM_001029882chr11118 ------
NM_001029882chr11118 ------
NM_001029989chr155990 862 816 796 728 ------
NM_001030007chr162933 528 ------
NM_001031690chr741995 1175 572 23 ----1537
NM_001031695chr2245414 1894 1731 203 11921 ----
NM_001031702chr33282 123 117 ------
NM_001031740chr131688 1567 263 --1245 11194
NM_001031803chr171290 ------
NM_001031804chr1623467 2730 ------
NM_001031812chr51673 12292 ----
NM_001032280chr621318 217 ------
NM_001032283chr1231093 1005 109 ------
NM_001032284chr1231093 1005 109 ------
NM_001032288chr203509 396 375 11605 ----
NM_001032289chrX5834 761 376 209 98 --1698 --
NM_001032293chr17------1626
NM_001032296chr1332720 2425 2263 1860 ----
NM_001033057chr311312 2850 185 ----
NM_001033081chr121422 279 11893 ----
NM_001033082chr121422 279 11893 ----
NM_001033112chr51640 ------
NM_001033117chr344875 4757 3807 1197 --1117 --
NM_001033504chr172599 518 --1502 --
NM_001033551chr1753685 2883 1391 943 867 --53128 2982 2962 2627 384 --
NM_001033602chr1352480 2414 2036 1709 634 ------
NM_001033677chr121380 --1122 --
NM_001033723chr8----12543 --
NM_001033925chr1022072 174 ------
NM_001034025chr122173 165 --1177 --
NM_001034837chr51763 ------
NM_001034838chr51763 ------
NM_001034841chr1684645 4529 4128 3528 2138 1690 1115 986 11495 ----
NM_001034915chr821566 1161 ------
NM_001035256chr2182 ------
NM_001035260chr101321 ------
NM_001035511chr111728 --1314 --
NM_001035512chr111835 --1421 --
NM_001035513chr111835 --1421 --
NM_001037164chr731901 326 88 ------
NM_001037324chr32293 193 --1245 --
NM_001037332chr522451 843 ------
NM_001037333chr522451 843 ------
NM_001037339chr12686 439 --11506 11212
NM_001037340chr12686 439 --11506 11212
NM_001037341chr12686 439 --11506 11212
NM_001037341chr12686 439 --11506 11212
NM_001037582chr451161 619 593 451 314 ------
NM_001037639chr3------145
NM_001037954chr1162771 2681 2469 644 307 165 --11262 --
NM_001039140chr203385 147 48 ------
NM_001039350chr711774 ------
NM_001039467chr20296 31 ------
NM_001039468chr111273 ------
NM_001039469chr111313 ------
NM_001039479chr141568 ----11522
NM_001039538chr2--1309 ----
NM_001039547chr387530 7002 5634 5499 2903 2724 2077 612 15400 17628 --
NM_001039550chr21745 --2762 262 1554
NM_001039577chr164433 4173 3920 848 687 635 14299 ----
NM_001039590chrX23509 373 --1175 --
NM_001039591chrX23509 373 --1175 --
NM_001039618chr1135023 4331 278 ------
NM_001039671chr19----175 --
NM_001039672chr19----175 --
NM_001039673chr19----175 --
NM_001039693chr243949 2951 2574 345 ------
NM_001039711chr12185 106 ------
NM_001039712chr12185 106 ------
NM_001039762chr10132 ------
NM_001039771chr141878 --1246 --
NM_001039840chrX75997 5623 4329 1763 1742 1385 319 ------
NM_001039877chr191176 ------
NM_001039937chr1321650 749 13076 12761 --
NM_001039960chr1231665 1065 596 ------
NM_001040057chr721401 177 ------
NM_001040092chr8--1137 ----
NM_001040108chr1433173 1316 419 ------
NM_001040110chr721866 572 ------
NM_001040142chr21709 ------
NM_001040143chr21709 ------
NM_001040152chr751733 1127 1103 981 856 --1605 --
NM_001040153chr13--1183 ----
NM_001040284chr1645414 4868 2070 1087 ------
NM_001040429chr1312893 ------
NM_001040439chr1651357 935 522 457 437 --1393 --
NM_001040446chr571956 1097 884 869 732 626 539 1804 1692 --
NM_001040450chr1532922 2666 1053 22844 95 188 --
NM_001040453chr1532922 2666 1053 22844 95 188 --
NM_001040661chr721006 90 1710 31131 1070 423 --
NM_001040665chr744954 4807 2016 1854 --11483 --
NM_001040666chr72656 509 ------
NM_001040708chr821022 776 ------
NM_001042368chr93528 199 154 --1286 --
NM_001042404chr12690 236 ------
NM_001042413chr933812 2851 412 --1749 --
NM_001042424chr41186 --21206 57 1203
NM_001042425chr621318 217 ------
NM_001042453chrX11159 ------
NM_001042473chr1011372 11633 11457 --
NM_001042479chrX42136 1537 793 661 --1308 --
NM_001042480chrX42136 1537 793 661 --1308 --
NM_001042486chr2011402 --11482 --
NM_001042492chr1732273 371 185 ----12235
NM_001042494chr1583347 3280 3261 2856 2761 2617 2591 1513 1249 ----
NM_001042495chr1583347 3280 3261 2856 2761 2617 2591 1513 1249 ----
NM_001042496chr1583347 3280 3261 2856 2761 2617 2591 1513 1249 ----
NM_001042497chr1583347 3280 3261 2856 2761 2617 2591 1513 1249 ----
NM_001042506chrX3519 279 164 ------
NM_001042510chr81543 ------
NM_001042511chr81543 ------
NM_001042537chrX21963 466 --1589 --
NM_001042539chr161142 ------
NM_001042548chr21785 ------
NM_001042599chr267821 7157 6710 5255 4872 289 15641 ----
NM_001042632chr202542 334 1217 ----
NM_001042633chr202542 334 1217 ----
NM_001042663chr181327 1256 1044 1004 998 131 91 55 ------
NM_001042664chr181327 1256 1044 1004 998 131 91 55 ------
NM_001042665chr181327 1256 1044 1004 998 131 91 55 ------
NM_001042681chr121888 533 --1803 --
NM_001042682chr121888 533 --1803 --
NM_001042682chr121888 533 --1803 --
NM_001042749chrX--1168 ----
NM_001042750chrX--1168 ----
NM_001042751chrX--1168 ----
NM_001043318chr14103916 3513 3329 2905 2859 2716 2690 1326 748 102 --13935 --
NM_001043351chr171642 1505 1480 1434 781 452 171 ----155
NM_001044385chr213871 ------
NM_001044722chr51673 12292 ----
NM_001044723chr51673 12292 ----
NM_001045556chr8158 ------
NM_001045557chr8158 ------
NM_001065chr122113 48 --2430 159 --
NM_001070chr17130 ----156
NM_001071775chr1321533 1482 ------
NM_001077628chr11260 ------
NM_001079874chr112076 --11458 --
NM_001080418chr12530 431 ------
NM_001092chr1741881 633 540 332 --52346 1904 1810 665 504 1370
NM_001094chr173631 321 143 ------
NM_001095chr1241201 273 169 70 ------
NM_001099678chr366083 5971 4890 3928 1795 500 14933 13905 --
NM_001100108chr166204 6162 6072 5685 5566 5432 --28245 754 --
NM_001106chr372521 2142 1923 1834 1104 504 336 --23836 3176 --
NM_001113490chrX23547 1283 ------
NM_001116chr1642909 1234 764 214 ------
NM_001117chr1822075 1579 11979 ----
NM_001128chr162933 528 ------
NM_001131chr62335 211 ------
NM_001144chr1641012 329 299 26 --1304 --
NM_001146chr8----11581 --
NM_001148chr41603 ------
NM_001149chr1031066 552 414 ------
NM_001153chr21124 ------
NM_001167chrX106166 6033 5593 5331 4173 4129 2100 1937 1223 946 25374 4216 15847 --
NM_001172chr141101 ------
NM_001174chrX3939 759 569 ------
NM_001189chr431049 1042 725 --3923 317 247 --
NM_001198chr622253 60 ------
NM_001206chr932135 2081 240 ------
NM_001220chr7----174 --
NM_001249chr141153 ------
NM_001253chr6----1293 --
NM_001259chr786305 6244 6084 5975 2199 1652 1095 157 16328 ----
NM_001265chr131285 ------
NM_001280chr191155 ------
NM_001283chr73668 273 116 --1436 --
NM_001284chr5--1514 ----
NM_001298chr211301 ----1136
NM_001310chr122981 618 ------
NM_001326chr111409 ------
NM_001328chr43643 161 31 --1679 --
NM_001329chr102491 173 ------
NM_001331chr112144 115 ------
NM_001343chr52317 283 ------
NM_001346chr322014 399 --1723 --
NM_001350chr6122 ------
NM_001351chr311813 ------
NM_001352chr19141 ------
NM_001356chrX32550 888 246 ------
NM_001364chr1143888 3513 1671 1438 24733 3582 11872 13596
NM_001365chr173758 554 35 ------
NM_001382chr11182 ------
NM_001383chr171250 --1109 --
NM_001386chr84935 395 319 171 ------
NM_001387chr52808 158 ------
NM_001389chr211618 --1203 --
NM_001395chrX2914 190 ------
NM_001396chr2111750 ------
NM_001397chr172304 2281 2101 1973 1965 721 577 --22007 90 --
NM_001404chr11----128 --
NM_001406chr173420 370 359 ------
NM_001407chr31639 ------
NM_001418chr111473 ------
NM_001418chr111473 ------
NM_001419chr1943207 3184 1100 441 1739 ----
NM_001426chr21289 ------
NM_001429chr221309 ------
NM_001430chr2----166 --
NM_001432chr43680 279 42 ------
NM_001438chr113315 --31393 330 326 --
NM_001447chr531257 1049 539 1425 ----
NM_001448chrX21426 352 ------
NM_001453chr61364 1586 ----
NM_001454chr173626 375 212 --1866 --
NM_001520chr16----257 39 --
NM_001523chr19123 ------
NM_001525chr1----1108 --
NM_001530chr141841 ------
NM_001542chr121931 165 12009 ----
NM_001543chr564119 3779 2937 1823 658 263 24774 3943 --14207
NM_001552chr171971 --1106 --
NM_001567chr113286 200 110 ------
NM_001604chr111115 ------
NM_001614chr171557 ------
NM_001614chr171557 ------
NM_001619chr1131012 915 725 11106 2954 150 --
NM_001620chr112127 101 --1161 --
NM_001635chr71884 ------
NM_001642chr11--1106 ----
NM_001650chr18--1314 ----
NM_001654chrX197 1324 ----
NM_001656chr51427 11729 ----
NM_001658chr12469 92 ------
NM_001659chr1252214 1066 822 472 151 ------
NM_001660chr31253 ------
NM_001661chr171570 ------
NM_001662chr7----1142 --
NM_001664chr31354 1838 1180 --
NM_001665chr11170 ------
NM_001668chr122201 745 --1487 --
NM_001677chr11316 ------
NM_001678chr1741796 1557 1202 187 --1310 165
NM_001679chr31635 --1182 --
NM_001683chr351839 950 750 552 55 ------
NM_001684chr153514 3350 1508 1420 1208 ------
NM_001694chr163374 322 146 ------
NM_001707chr73700 34 21 ------
NM_001722chr8129 --148 --
NM_001730chr1311125 ------
NM_001730chr1311125 ------
NM_001742chr711392 ------
NM_001753chr731430 560 368 1625 21381 1186 --
NM_001754chr2164164 3206 3109 939 48 42 --1207 --
NM_001759chr1275202 4781 4704 3869 3784 1596 319 --13280 --
NM_001760chr62106 67 ------
NM_001773chr121383 1299 ------
NM_001783chr192298 248 --132 --
NM_001802chr16145 ------
NM_001806chr1912863 ------
NM_001823chr142205 51 --1199 --
NM_001825chr51111 ------
NM_001827chr91222 ------
NM_001851chr6141 ------
NM_001865chr6125 ------
NM_001874chr1264958 4898 3600 1440 1302 309 43783 1483 1044 601 25065 5055 --
NM_001892chr5----1580 --
NM_001895chr20173 127 ----
NM_001896chr16----1329 --
NM_001901chr61335 --1389 --
NM_001903chr51731 ------
NM_001904chr3161 1404 ----
NM_001914chr182113 100 ------
NM_001915chr17102029 1845 1740 1707 1615 1546 1291 344 162 45 ------
NM_001918chr1118590 7193 7147 7058 6987 6409 2512 2379 1777 1634 315 1493 ----
NM_001933chr1421316 276 ------
NM_001936chr711774 ------
NM_001939chrX33401 1472 321 ------
NM_001945chr521039 127 ------
NM_001949chr612124 1341 ----
NM_001951chr81611 ------
NM_001955chr621082 380 ------
NM_001956chr1----186 --
NM_001964chr5--1320 --1224
NM_001965chr21124 ------
NM_001967chr31383 ------
NM_001968chr41153 ------
NM_001970chr171462 --1467 --
NM_001981chr142023 862 314 268 --1272 --
NM_001995chr41173 ------
NM_002010chr131204 ------
NM_002015chr13--13206 ----
NM_002024chrX11377 ------
NM_002025chrX38674 2118 912 --39095 8731 7881 --
NM_002027chr8191 ------
NM_002028chr1431267 829 506 ------
NM_002031chr6----1220 --
NM_002035chr1833281 3235 1428 13332 ----
NM_002036chr1143 ------
NM_002040chr2122848 467 ------
NM_002045chr31110 ------
NM_002048chr931250 265 59 ------
NM_002051chr1021112 1074 ------
NM_002055chr1741676 546 73 33 11251 ----
NM_002061chr121721 1378 21897 1422 181 --
NM_002069chr71633 ------
NM_002077chr941781 1528 1514 424 ------
NM_002085chr19----179 --
NM_002086chr1792030 1873 1822 1396 902 741 653 527 75 1825 ----
NM_002092chr464635 4393 4047 2006 1523 392 14308 ----
NM_002094chr16169 ------
NM_002103chr1931014 259 34 --31072 790 26 --
NM_002105chr114765 362 155 98 --1209 --
NM_002126chr1743147 2795 1005 339 ----1760
NM_002145chr17149 ------
NM_002146chr17----1201 --
NM_002147chr171114 --1646 --
NM_002158chr22884 780 1181 ----
NM_002166chr21654 ------
NM_002167chr1----154 --
NM_002193chr21331 --21197 543 11233
NM_002196chr204384 226 142 42 ------
NM_002196chr204384 226 142 42 ------
NM_002199chr41283 ------
NM_002205chr12----1896 --
NM_002214chr731273 1247 951 ------
NM_002223chr1223567 1350 13698 --148
NM_002226chr141650 --3678 671 56 --
NM_002229chr19136 --1311 --
NM_002230chr171163 1374 ----
NM_002232chr12174 62 11359 ----
NM_002234chr121192 ------
NM_002246chr231144 151 80 ------
NM_002254chr262391 1796 894 707 331 167 2358 233 51909 866 241 154 79 --
NM_002264chr354751 3917 3087 1293 1255 ----11886
NM_002265chr171362 ------
NM_002267chr131642 ------
NM_002268chr3--1320 ----
NM_002270chr524061 1396 22239 1769 ----
NM_002283chr121515 --245 41 --
NM_002285chr254178 3431 3003 2829 802 13759 1186 13146
NM_002305chr22139 ------
NM_002309chr2262901 2806 2239 965 273 138 11047 ----
NM_002310chr556353 3987 2595 1933 1877 1442 ----
NM_002313chr1035029 767 489 ------
NM_002315chr11----358 46 30 --
NM_002332chr121221 --1197 --
NM_002333chr193943 73 36 --1211 --
NM_002334chr1141810 636 334 87 --229 25 --
NM_002336chr1233547 742 27 ----11556
NM_002356chr632566 2409 261 ------
NM_002359chr1793993 3613 3605 3318 2910 1610 1332 1171 1140 --13985 11679
NM_002373chr151974 1258 --1885
NM_002374chr2--1309 ----
NM_002375chr372009 1997 742 619 288 255 29 --21806 718 12327
NM_002376chr143474 140 93 ------
NM_002387chr531953 1779 252 1657 13382 --
NM_002390chr1751974 1717 635 312 39 --21981 689 --
NM_002395chr61232 1989 ----
NM_002397chr512234 ------
NM_002401chr172641 593 --22292 624 1978
NM_002406chr5--11020 2821 85 --
NM_002419chr11292 35 ------
NM_002430chr2221825 1794 --1631 --
NM_002436chrX161 ------
NM_002442chr122605 184 --1133 --
NM_002467chr81144 ------
NM_002473chr2221039 425 ------
NM_002476chr17122 ------
NM_002479chr11206 ------
NM_002481chr177958 7219 7198 5458 2202 2068 973 --47263 5435 1526 851 --
NM_002499chr1542392 1762 223 171 --12355 --
NM_002500chr21152 ------
NM_002501chr1963946 3717 3644 3407 1220 349 14112 14047 --
NM_002507chr1731235 668 234 21507 699 1102 --
NM_002509chr201165 --1613 --
NM_002515chr141762 ------
NM_002520chr5139 ------
NM_002521chr1171 ------
NM_002524chr11744 ------
NM_002530chr152127 52 ------
NM_002537chr152915 698 ------
NM_002545chr1131951 1851 32 13322 --11465
NM_002547chrX32972 1602 1577 --1582 --
NM_002553chr71424 ------
NM_002581chr92929 131 14395 ----
NM_002587chr5122 ------
NM_002595chr12--1366 ----
NM_002599chr1131199 1115 162 ------
NM_002600chr12686 439 --11506 11212
NM_002603chr8128 ------
NM_002608chr2221521 476 1118 1105 1419
NM_002609chr52709 212 ----129
NM_002616chr171166 ------
NM_002622chr54627 607 332 192 ----1289
NM_002632chr142536 236 --1691 --
NM_002633chr11507 ------
NM_002634chr173875 803 361 ------
NM_002641chrX11738 ------
NM_002646chr122084 1476 --21632 633 --
NM_002648chr621023 168 --1525 --
NM_002651chr11904 --1843 --
NM_002656chr61351 ------
NM_002657chr2042594 1489 1386 475 --2874 65 --
NM_002660chr201329 1915 1740 --
NM_002673chr34534 425 392 88 ------
NM_002687chr14191 ------
NM_002699chr11525 --1265 11062
NM_002707chr2----1339 --
NM_002710chr121734 ------
NM_002714chr62829 718 ------
NM_002719chr1431840 1663 142 ------
NM_002721chr91113 ------
NM_002730chr1911107 --31081 479 291 --
NM_002733chr12----152 --
NM_002734chr172758 697 --2620 506 --
NM_002736chr711814 ------
NM_002739chr191661 --1608 --
NM_002742chr141542 --1546 --
NM_002745chr222568 95 1984 11601 --
NM_002746chr163603 389 41 --149 --
NM_002747chr182163 99 ------
NM_002750chr10136 ------
NM_002752chr51155 ------
NM_002753chr4133 --2146 142 --
NM_002761chr16----1130 137
NM_002776chr191777 --1199 --
NM_002779chr102524 27 ----161
NM_002808chr31103 ------
NM_002816chr17--1215 ----
NM_002821chr61581 ------
NM_002823chr2172 ------
NM_002824chr121156 ----1367
NM_002833chr15----21332 1208 --
NM_002835chr71149 ------
NM_002837chr1244359 3188 3154 3131 ------
NM_002841chr31247 ------
NM_002846chr23430 159 50 ------
NM_002850chr1941265 1118 970 214 ------
NM_002858chr11260 ------
NM_002867chr14757 669 511 147 ------
NM_002868chr1252260 2230 1842 828 126 ------
NM_002871chr141976 410 321 91 ------
NM_002874chr931724 1679 938 ------
NM_002885chr12752 135 ------
NM_002903chr17160 ------
NM_002904chr61177 ------
NM_002906chr11--1301 ----
NM_002911chr1931563 1261 461 --31283 1110 498 --
NM_002924chr12487 165 ------
NM_002931chr62283 208 ------
NM_002950chr3137 ------
NM_002958chr3139 ------
NM_002959chr174169 4100 3364 3043 2910 1010 364 ------
NM_002977chr232768 2722 304 ------
NM_002985chr174813 315 179 41 ------
NM_002994chr421290 190 ------
NM_002996chr1641969 1815 1505 1418 --145 --
NM_002997chr211291 --21827 192 --
NM_002998chr821657 1396 ------
NM_003001chr111835 --1421 --
NM_003009chr191301 ------
NM_003010chr1722438 1883 ------
NM_003012chr832483 743 100 --12254 --
NM_003013chr41134 ------
NM_003016chr171267 11757 ----
NM_003028chr933717 2955 1006 --23078 864 --
NM_003030chr331928 118 29 ------
NM_003037chr11109 ------
NM_003047chr151014 314 202 170 25 --41440 1116 909 590 --
NM_003051chr111818 ------
NM_003070chr91323 ------
NM_003074chr311456 --1673 --
NM_003076chr1251486 1411 1048 230 78 --161 --
NM_003081chr201427 ------
NM_003091chr20----1205 --
NM_003099chr15106156 5578 5209 4600 4463 2417 948 559 94 40 15648 ----
NM_003107chr632410 1945 890 --12583 --
NM_003108chr2116181 6048 5751 5400 2574 2462 2081 2044 1869 1518 485 ------
NM_003110chr173705 188 88 11119 ----
NM_003112chr71510 ------
NM_003113chr21209 --151 --
NM_003128chr21307 ------
NM_003131chr621585 589 12153 2581 173 --
NM_003139chr113827 265 32 ----1354
NM_003146chr11128 ------
NM_003155chr842028 1924 221 83 ------
NM_003156chr1121320 209 --1201 --
NM_003161chr1723513 1409 ------
NM_003164chr11----1482 --
NM_003165chr951599 1486 613 187 170 ------
NM_003170chr172570 63 --2578 537 --
NM_003173chrX31190 1153 101 --21089 359 --
NM_003174chr101283 ------
NM_003175chr1124 ------
NM_003178chr331394 894 651 ------
NM_003179chrX21316 427 ----1432
NM_003184chr81105 ------
NM_003186chr11272 63 ------
NM_003188chr61122 ------
NM_003189chr142573 2262 1223 385 12224 ----
NM_003199chr1833898 1590 1378 11392 ----
NM_003200chr1952013 1961 584 307 33 ----11883
NM_003202chr541415 512 242 58 --21181 465 1366
NM_003204chr1711355 --21612 1495 --
NM_003214chr611039 1969 159 --
NM_003216chr2232492 2304 1318 --32062 52 33 --
NM_003220chr621318 217 ------
NM_003221chr633260 3184 490 --21571 656 13731
NM_003223chr162606 277 ------
NM_003236chr2187 --32904 1364 173 --
NM_003239chr14------148
NM_003242chr332518 601 285 ------
NM_003246chr153755 303 157 --11832 --
NM_003253chr2111541 1674 11505 --
NM_003255chr1732095 870 295 ------
NM_003262chr374701 4655 4519 4492 3633 2023 1568 1618 ----
NM_003269chr61296 --1222 --
NM_003292chr112191 ------
NM_003298chr322182 463 13783 24268 1151 --
NM_003305chr41376 ------
NM_003317chr143561 45 37 ------
NM_003319chr2--1660 ----
NM_003320chr1173266 2942 2829 923 622 76 51 13084 32805 59 55 --
NM_003325chr22173 ------
NM_003334chrX1151 ------
NM_003342chr1763063 3047 2149 2103 989 866 --13081 --
NM_003344chr721453 1379 ------
NM_003347chr222435 117 --42243 1925 1921 106 --
NM_003349chr203509 396 375 11605 ----
NM_003359chr43391 345 257 ------
NM_003370chr19268 25 ------
NM_003371chr92450 318 --1788 --
NM_003373chr1021945 751 21639 1483 ----
NM_003387chr211122 --1230 --
NM_003389chr92485 394 ------
NM_003392chr321716 42 11401 ----
NM_003400chr21644 ------
NM_003403chr141758 ------
NM_003404chr2021884 1482 11797 ----
NM_003406chr841721 1429 340 25 ------
NM_003407chr191556 ------
NM_003410chrX12016 ------
NM_003412chr311059 ------
NM_003413chrX21284 384 ------
NM_003430chr192161 40 ------
NM_003457chr17------1626
NM_003458chr353700 2666 1130 837 379 --33443 1585 205 --
NM_003462chr11566 --21760 1240 --
NM_003463chr61491 ------
NM_003468chr233484 1311 220 1849 ----
NM_003470chr1631666 713 351 1410 1555 --
NM_003478chr111124 ------
NM_003482chr121626 --22378 469 --
NM_003483chr1212857 ------
NM_003485chr143381 133 71 ------
NM_003487chr17165 ------
NM_003489chr2123088 340 ------
NM_003505chr71566 21915 1491 ----
NM_003549chr32123 23 ------
NM_003557chr121314 1197 --11385 --
NM_003558chr91504 ------
NM_003562chr17125 ------
NM_003563chr1721134 349 --1987 --
NM_003564chr12624 156 ------
NM_003566chr121495 ------
NM_003575chr731459 627 440 --191 --
NM_003576chr1332720 2425 2263 1860 ----
NM_003583chr1223221 825 --11475 --
NM_003586chr161490 ----1197
NM_003590chr212949 ------
NM_003597chr222161 83 ------
NM_003599chr6122 ------
NM_003603chr431944 542 454 21357 62 132 --
NM_003607chr153787 3625 1715 83 49 ------
NM_003612chr152544 95 ------
NM_003615chr323953 821 ------
NM_003624chr1931088 404 45 ----1176
NM_003628chr21677 ------
NM_003629chr1----22809 821 --
NM_003630chr6--1102 ----
NM_003632chr174714 351 195 55 ------
NM_003637chr1199 1330 1423 --
NM_003654chr111543 1211 ----
NM_003663chr322949 2495 ------
NM_003664chr5267 48 ------
NM_003670chr331048 290 192 11142 ----
NM_003672chr11107 ------
NM_003681chr21146104 6041 5486 5125 4902 4475 4364 4203 1615 1482 1238 1224 933 76 --35450 4050 2422 --
NM_003685chr192390 182 --1772 --
NM_003693chr173648 602 222 ------
NM_003704chr4----1624 1128
NM_003726chr172264 35 ------
NM_003741chr31121 ------
NM_003743chr241525 427 382 373 ------
NM_003744chr142394 201 ------
NM_003745chr16166 ------
NM_003749chr131182 12153 ----
NM_003760chr1----1546 --
NM_003768chr111495 ------
NM_003773chr3121 ------
NM_003779chr11423 ------
NM_003822chr143034 2893 2811 2543 ------
NM_003827chr19128 ------
NM_003835chr171259 ------
NM_003873chr1011689 ------
NM_003877chr12----1952 --
NM_003888chr1521225 40 ------
NM_003893chr102121 33 ------
NM_003897chr62694 626 --1553 --
NM_003902chr11328 ------
NM_003908chr2021054 528 ------
NM_003913chr622670 2639 1732 1478 --
NM_003916chrX2968 127 ------
NM_003924chr4----2279 248 --
NM_003927chr182729 87 ------
NM_003936chr241229 957 769 432 1490 21194 251 --
NM_003938chr192405 72 ------
NM_003941chr712332 --1622 --
NM_003942chr113673 509 254 --177 --
NM_003947chr3----1171 --
NM_003949chr172641 289 --1264 --
NM_003958chr642710 1144 385 249 --13178 --
NM_003971chr17136 ------
NM_003972chr1021128 969 ------
NM_003987chr1071666 1634 882 815 761 588 442 --3264 260 243 164
NM_003988chr1081743 1711 959 892 838 665 519 63 --3341 337 320 1141
NM_004028chr18--1314 ----
NM_004035chr17114947 4460 4448 4415 4390 4039 1989 1868 1817 1727 42 11911 1543 --
NM_004036chr22685 186 ------
NM_004050chr141787 --2858 508 --
NM_004061chr51488 ------
NM_004068chr31109 ------
NM_004077chr1211061 --21248 203 --
NM_004080chr7--11459 ----
NM_004090chr1743016 2833 2493 463 --12680 --
NM_004093chr1332600 773 382 13116 1402 --
NM_004096chr1021606 134 --1377 --
NM_004099chr941976 704 550 524 ------
NM_004100chr6------1338
NM_004103chr8162 --3256 43 24 --
NM_004107chr191147 ------
NM_004114chrX--1483 ----
NM_004116chr22306 118 ------
NM_004123chr17154 ------
NM_004124chr1413182 11141 ----
NM_004132chr102300 198 --11133 --
NM_004156chr82233 22 ------
NM_004161chr21116 173 ----
NM_004169chr17----150 --
NM_004171chr1169521 6339 2098 649 429 208 --16343 12482
NM_004185chr12670 108 --1691 --
NM_004186chr33918 223 157 --2631 590 --
NM_004200chr1172833 2795 2087 1142 1046 777 759 --22116 1070 --
NM_004202chrY2182 167 ------
NM_004205chr111212 --1395 --
NM_004227chr722368 2311 22533 1921 11975 --
NM_004228chr19----146 --
NM_004229chrX21547 446 ------
NM_004238chr2----128 --
NM_004272chr511376 ------
NM_004274chr1432925 2819 51 ------
NM_004276chr121380 --1122 --
NM_004279chr722371 722 ------
NM_004283chr19138 ------
NM_004286chr2262673 2516 2240 2107 897 831 --22083 410 --
NM_004295chr172305 105 ------
NM_004301chr31340 ------
NM_004302chr1272376 2169 1923 1823 586 534 332 ------
NM_004306chr8139 ------
NM_004311chr1053127 2746 1902 1195 688 ------
NM_004316chr1211095 1207 ----
NM_004321chr273495 2854 2699 2438 2428 589 60 1666 22474 2199 12631
NM_004329chr101324 ------
NM_004338chr1836922 2689 2523 --15605 --
NM_004342chr72336 200 1888 ----
NM_004356chr112469 438 --181 --
NM_004360chr1621537 462 ------
NM_004364chr192496 374 ------
NM_004370chr612162 --1485 --
NM_004379chr231666 1531 188 ----1122
NM_004380chr1632437 1697 1037 ------
NM_004383chr153615 569 156 1529 ----
NM_004384chr51673 12292 ----
NM_004391chr351414 607 581 292 159 --22022 139 --
NM_004393chr311747 ------
NM_004395chr53596 144 79 --1100 --
NM_004397chr1123459 1591 ------
NM_004405chr22271 136 ------
NM_004408chr9----146 --
NM_004409chr193588 520 469 --2485 83 --
NM_004411chr72262 58 ------
NM_004414chr211425 ------
NM_004416chr122970 314 --1141 --
NM_004418chr22555 392 --123 --
NM_004419chr101291 --1851 --
NM_004420chr1142127 2017 1807 931 --22238 866 --
NM_004421chr1------129
NM_004423chr382198 2060 1721 688 566 536 198 72 21899 636 31856 595 530 --
NM_004426chr1231447 775 400 ------
NM_004427chr111095 --1903 --
NM_004428chr12653 267 ------
NM_004429chrX11273 --11127 --
NM_004430chr85871 767 481 284 265 ------
NM_004431chr11328 ------
NM_004432chr91326 1914 ----
NM_004437chr111385 ----11066
NM_004438chr242238 1277 911 291 12496 1561 --
NM_004444chr7134 --1721 --
NM_004447chr121385 ------
NM_004451chr113726 582 42 ------
NM_004454chr3----11481 --
NM_004456chr7140 ------
NM_004457chr21594 ------
NM_004458chrX12278 ------
NM_004459chr171338 ------
NM_004474chr141026 386 331 292 1987 ----
NM_004499chr51103 ------
NM_004500chr1421446 54 ------
NM_004501chr123366 109 ------
NM_004506chr61470 ------
NM_004515chr1----156 --
NM_004517chr11197 --1235 --
NM_004524chr171262 ------
NM_004529chr91387 ------
NM_004543chr2198 ------
NM_004554chr1421472 190 ------
NM_004569chr141484 ------
NM_004573chr152585 120 --2714 551 1719
NM_004575chr42617 66 ------
NM_004578chr1----1902 --
NM_004583chr17130 ----141
NM_004586chrX52152 1592 1502 1394 679 11681 ----
NM_004588chr1172968 2490 1270 1149 857 831 36 11313 171 --
NM_004593chr31864 ------
NM_004602chr20----1247 --
NM_004612chr954538 4469 4100 4034 3058 ------
NM_004630chr1141052 919 873 171 ------
NM_004640chr6----132 --
NM_004654chrY1372 ------
NM_004655chr17----1265 --
NM_004656chr311193 1833 1290 --
NM_004660chrY1861 ------
NM_004667chr15----2179 80 --
NM_004670chr1021547 1159 ------
NM_004680chrY--1143 ----
NM_004687chr171313 --11846 --
NM_004700chr1------1142
NM_004703chr171287 ------
NM_004711chr2273301 2991 1111 935 690 531 108 --43391 3186 3034 2425 --
NM_004716chr113354 300 196 ----1766
NM_004717chr711267 ------
NM_004723chr11818 ------
NM_004726chrX55675 4591 2075 1690 775 1782 ----
NM_004730chr521541 92 11456 ----
NM_004742chr3198 ------
NM_004745chr875512 5275 1671 1560 1157 51 38 --24272 2502 --
NM_004746chr182249 73 ------
NM_004747chr102440 95 --1586 140
NM_004748chr151732 ------
NM_004755chr141113 158 ----
NM_004762chr1741704 1372 788 589 --1617 --
NM_004770chr8179 ------
NM_004772chr51327 ------
NM_004774chr171765 ----12298
NM_004775chr1812170 ------
NM_004781chr131501 1134 409 ------
NM_004781chr131501 1134 409 ------
NM_004783chr163511 473 216 --1204 --
NM_004788chr1132721 1840 1677 ------
NM_004789chr91121 ------
NM_004798chr2063206 3020 1375 924 596 494 --23416 1104 12754
NM_004800chr13176 ------
NM_004801chr2----1497 --
NM_004808chr1072327 2238 1133 990 868 735 268 23104 911 ----
NM_004818chr12152 ----146
NM_004824chr631329 436 117 ------
NM_004831chr19190 ------
NM_004834chr232738 2108 847 ------
NM_004836chr2166 ------
NM_004839chr151554 ------
NM_004840chrX3832 792 186 ------
NM_004845chrX93827 3809 3723 3374 3209 3108 3074 2799 68 ------
NM_004850chr231784 1619 1529 11706 ----
NM_004859chr1722738 2424 1564 ----
NM_004860chr17139 ------
NM_004861chr222263 26 --130 --
NM_004862chr1641080 463 249 72 ------
NM_004874chr8186 ------
NM_004879chr112341 277 --177 --
NM_004883chr5164 ------
NM_004886chr19136 ------
NM_004896chr101236 ------
NM_004899chr21148 --2163 117 --
NM_004902chr201222 ------
NM_004904chr756028 4442 1486 1446 1034 2849 324 ----
NM_004905chr11182 ------
NM_004906chr61200 ------
NM_004926chr142712 27 ------
NM_004945chr192806 165 ------
NM_004948chr1821468 1087 11391 ----
NM_004953chr34419 390 285 106 --2167 62 --
NM_004954chr111273 ------
NM_004955chr62537 45 --126 --
NM_004956chr723152 763 ------
NM_004959chr971372 1365 1358 1295 1280 926 228 ------
NM_004962chr10144 ------
NM_004973chr621625 1128 --1701 --
NM_004977chr192399 205 --1557 140
NM_004985chr1224020 224 13031 ----
NM_004991chr31125 ------
NM_004992chrX65868 3194 3122 1237 1122 419 --11365 --
NM_004992chrX65868 3194 3122 1237 1122 419 --11365 --
NM_004996chr162686 387 --1175 --
NM_005011chr721866 572 ------
NM_005026chr151732 1658 1568 367 124 --31607 1603 353 --
NM_005028chr1021675 837 ------
NM_005032chrX--1222 ----
NM_005044chrX34152 1545 397 --148 --
NM_005056chr1214899 --53749 3691 3633 3575 3487 --
NM_005063chr1032638 629 170 --11506 --
NM_005065chr1424784 1863 13523 14788 --
NM_005070chr22250 179 ------
NM_005078chr1541366 1158 697 531 --11595 --
NM_005079chr833206 2873 2731 ------
NM_005094chr92720 212 ----1599
NM_005095chr1--12078 11588 --
NM_005096chrX51180 1002 810 412 139 ------
NM_005099chr151163 1064 1018 883 80 ------
NM_005102chr21785 ------
NM_005103chr111254 ------
NM_005112chr41652 --1399 --
NM_005116chr2054027 2809 1616 425 181 1166 33899 2913 1297 --
NM_005121chr172527 428 ------
NM_005124chr62166 102 ------
NM_005135chr1583347 3280 3261 2856 2761 2617 2591 1513 1249 ----
NM_005161chr111427 --32168 2125 1525 --
NM_005168chr211354 ------
NM_005169chr111108 --3554 512 91 --
NM_005174chr10148 ------
NM_005176chr12138 ------
NM_005184chr1961269 1230 1152 1117 1093 227 --11173 --
NM_005187chr1661663 1566 1491 211 92 78 ----1119
NM_005194chr201526 ------
NM_005197chr1434913 1679 1412 15834 --14118
NM_005201chr32901 171 ------
NM_005206chr1741339 1205 898 375 --194 --
NM_005207chr2293404 2738 2719 865 818 684 658 641 165 --141 --
NM_005219chr531603 1538 272 --1176 --
NM_005225chr202947 439 ------
NM_005229chrX1937 ------
NM_005235chr267821 7157 6710 5255 4872 289 15641 ----
NM_005238chr1133198 3063 3006 --12556 --
NM_005241chr3--1867 ----
NM_005245chr4--126 ----
NM_005278chrX--1350 ----
NM_005284chr6170 ------
NM_005311chr752185 965 827 292 202 --12380 --
NM_005324chr1711697 ------
NM_005328chr8------1266
NM_005329chr1612043 1506 1240 --
NM_005336chr262090 1732 1581 1479 798 148 11978 ----
NM_005339chr43626 433 185 13108 13304 --
NM_005354chr191246 ------
NM_005359chr18106486 4827 4396 2276 2236 2190 2164 1717 1637 137 ------
NM_005370chr192324 49 ------
NM_005374chr1711825 ----12136
NM_005375chr621157 1092 ------
NM_005378chr2----1589 --
NM_005384chr9----1187 --
NM_005392chr95757 262 142 89 66 11236 ----
NM_005393chrX1253 ------
NM_005397chr7--1214 --12845
NM_005402chr72702 395 ------
NM_005406chr182302 277 ------
NM_005417chr2031817 1697 561 --4456 452 86 82 --
NM_005424chr1199 ------
NM_005430chr123664 375 181 --1347 --
NM_005436chr10152 ------
NM_005437chr1021160 123 ------
NM_005439chr122513 219 ------
NM_005443chr41150 ------
NM_005455chr1--1457 ----
NM_005458chr922125 418 ------
NM_005461chr202598 223 ------
NM_005469chr20121 ------
NM_005471chr531172 1153 1130 ------
NM_005475chr1222878 2825 13008 ----
NM_005476chr93516 418 351 ------
NM_005477chr1532199 1954 701 ------
NM_005477chr1532199 1954 701 ------
NM_005479chr1011505 ------
NM_005487chr221279 ------
NM_005493chr61305 ------
NM_005499chr19----1542 --
NM_005504chr1235870 2026 1980 ------
NM_005505chr123839 143 75 ------
NM_005506chr452842 2089 2063 1032 95 ------
NM_005507chr11----122 --
NM_005529chr11997 ------
NM_005561chr132975 365 ------
NM_005565chr5137 ------
NM_005569chr2211002 1232 1393 --
NM_005574chr11150 ------
NM_005575chr5165 ------
NM_005578chr333257 1275 432 23152 1028 ----
NM_005581chr192334 87 --1169 --
NM_005584chr131321 1732 ----
NM_005593chr121484 ------
NM_005596chr955686 4910 3959 2156 1723 ------
NM_005599chr11115 --128 --
NM_005604chr632349 1953 852 ------
NM_005613chr132146 2103 1620 --1126 --
NM_005614chr71825 ------
NM_005618chr62204 164 --1193 --
NM_005627chr62832 257 ------
NM_005634chrX3543 446 98 ------
NM_005637chr1841910 1864 1729 1703 ------
NM_005639chr121448 ------
NM_005648chr8191 ------
NM_005650chr221152 ------
NM_005652chr1651007 864 376 196 170 ------
NM_005664chr15257 47 ------
NM_005665chr194778 4217 1528 1241 742 652 606 580 164 11863 ----
NM_005668chr56948 902 814 802 768 742 ------
NM_005688chr321292 852 --154 --
NM_005707chr1521167 907 ------
NM_005708chr131141 ------
NM_005715chr631974 1789 694 --12139 --
NM_005717chr12869 26 ------
NM_005718chr34726 704 556 198 --1785 --
NM_005719chr12124 ------
NM_005722chr211679 --1703 --
NM_005725chr11182 ----11833
NM_005736chr1021588 433 --189 --
NM_005737chr221928 420 --1646 --
NM_005738chr731901 326 88 ------
NM_005748chr1222425 369 ------
NM_005752chr162998 978 ------
NM_005756chrX1979 ------
NM_005765chrX1144 ------
NM_005766chr1321112 996 1173 11116 --
NM_005768chr121279 --1657 --
NM_005776chr14--1546 ----
NM_005779chr521197 396 12555 ----
NM_005781chr32564 296 ----132
NM_005786chr181108 ------
NM_005795chr212013 1231 ----
NM_005796chr161328 ------
NM_005801chr172228 124 ------
NM_005803chr6--147 ----
NM_005814chr1154 ------
NM_005817chr19132 ------
NM_005822chr622246 31 ------
NM_005824chr72626 45 1256 ----
NM_005828chr1753877 3231 1047 593 49 --1650 --
NM_005840chrX16456 --1626 22460 1645
NM_005841chr41843 ------
NM_005851chr113353 58 27 ------
NM_005860chr1961655 1432 1421 1310 1221 1215 1230 ----
NM_005873chr20296 31 ------
NM_005875chr3165 ------
NM_005879chr32386 37 ------
NM_005880chr16--149 ----
NM_005882chr41680 ------
NM_005884chr191788 ----1736
NM_005885chr5------1616
NM_005898chr112999 733 ------
NM_005899chr17----129 --
NM_005909chr5----12931 --
NM_005911chr21252 ------
NM_005920chr153503 3072 2844 2634 1497 ------
NM_005933chr1152075 1928 832 474 286 --1795 --
NM_005934chr1962069 1740 767 101 80 63 --32360 2050 460 --
NM_005935chr435103 1981 1532 ------
NM_005937chr1793366 2964 2712 1619 1040 746 257 219 82 --33409 1335 815 --
NM_005938chrX21360 357 ------
NM_005941chr813575 ------
NM_005943chr611258 11222 ----
NM_005955chr1124798 2134 2088 2000 1954 1706 1472 1314 882 610 362 64 14012 ----
NM_005964chr1721520 1175 ------
NM_005967chr122250 120 ------
NM_005969chr112316 91 --11056 --
NM_005990chr532108 1864 102 1152 --22472 767
NM_006007chr963937 3712 3156 1247 382 334 12914 ----
NM_006011chr1584181 3982 3688 3408 2958 1310 596 338 ------
NM_006015chr11268 ------
NM_006022chr132412 77 ------
NM_006030chr35359 338 248 82 51 ------
NM_006032chr14144 ------
NM_006034chr1172419 2011 1845 1802 1603 813 34 ----1673
NM_006037chr284628 3226 3049 3040 1464 521 193 81 --14040 --
NM_006038chr2021853 1452 ------
NM_006041chr173425 345 132 --1397 1327
NM_006047chr2013491 ------
NM_006048chr11183 ------
NM_006067chr162795 710 ----1205
NM_006076chr773067 2346 2280 1015 895 77 32 --11101 --
NM_006080chr7--1297 ----
NM_006085chr14899 523 172 40 ------
NM_006089chrX21367 1341 ------
NM_006091chr1531790 517 129 --1407 --
NM_006094chr821908 23 ------
NM_006095chr423780 1038 1629 ----
NM_006099chr11593 ----1152
NM_006100chr3----1120 --
NM_006113chr112076 --11458 --
NM_006133chr1161752 698 679 467 344 66 --2740 358 --
NM_006135chr11185 --11055 --
NM_006136chr711195 ------
NM_006141chr1622640 1026 1658 ----
NM_006147chr1--1368 1433 --
NM_006148chr1742645 2585 2360 815 ----11937
NM_006157chr111427 ------
NM_006158chr811400 ------
NM_006161chr5172 --1142 --
NM_006162chr181616 ----11441
NM_006166chr1222146 664 ------
NM_006167chr8140 --1753 --
NM_006176chr112661 323 --1580 --
NM_006178chr17--1534 ----
NM_006180chr921944 440 ------
NM_006185chr112137 65 ------
NM_006191chr12136 ------
NM_006201chrX2456 96 --3444 432 142 1106
NM_006202chr1941341 593 345 77 --1418 1624
NM_006203chr525509 4592 ------
NM_006206chr412706 11123 ----
NM_006209chr8--1137 ----
NM_006216chr21630 ------
NM_006224chr173514 355 270 --1187 --
NM_006226chr22444 234 ------
NM_006228chr82302 140 --1100 --
NM_006237chr1331617 867 168 --21938 110 --
NM_006243chr1----1863 --
NM_006245chr61259 ------
NM_006251chr523023 604 ------
NM_006252chr146897 6265 558 506 11926 --16299
NM_006256chr11349 ------
NM_006258chr102162 26 ------
NM_006265chr811369 1378 ----
NM_006266chr93528 199 154 --1286 --
NM_006268chr113815 365 136 ------
NM_006270chr19149 ------
NM_006279chr12840 149 --1718 --
NM_006283chr834426 898 148 14982 1140 --
NM_006285chr9----1270 --
NM_006301chr12--1621 ----
NM_006306chrX55803 3939 1851 1039 520 24076 1214 15894 --
NM_006313chr1211272 ------
NM_006317chr5--1310 ----
NM_006320chr411009 ------
NM_006321chr341830 621 450 83 ------
NM_006323chr4--1779 ----
NM_006324chr16162 ------
NM_006328chr113252 245 190 ------
NM_006329chr142538 29 ------
NM_006335chr1----1335 --
NM_006352chr121596 1373 ------
NM_006359chrX21963 466 --1589 --
NM_006361chr1741698 1629 721 353 ------
NM_006362chr11170 --159 1135
NM_006364chr141284 ------
NM_006367chr13815 796 137 ------
NM_006369chr11306 ------
NM_006372chr6----1134 --
NM_006374chr22159 104 ------
NM_006375chrX--1521 ----
NM_006378chr921247 434 --11059 --
NM_006380chr1753597 3551 3525 3503 2852 ------
NM_006386chr2242088 779 626 82 ------
NM_006387chr192792 107 ------
NM_006389chr1131165 850 295 --11141 --
NM_006400chr121280 ------
NM_006401chr91159 ------
NM_006403chr611811 21671 1418 ----
NM_006411chr61927 ------
NM_006439chr4--1399 ----
NM_006454chr452855 1881 1156 795 636 12162 82895 1992 845 448 180 154 140 30 11997
NM_006459chr1011927 --1276 --
NM_006465chr1532017 1481 388 --1140 --
NM_006482chr1223221 825 --11475 --
NM_006489chr141762 ------
NM_006494chr194765 627 109 56 ------
NM_006497chr172805 276 ------
NM_006500chr116926 895 538 440 184 115 --132 --
NM_006532chr193313 236 143 --1469 --
NM_006538chr243757 3414 1366 469 --1839 --
NM_006540chr81183 ------
NM_006544chr1425305 4554 ------
NM_006547chr711581 ------
NM_006548chr32457 225 ------
NM_006549chr1222615 41 --1984 --
NM_006555chr731985 1953 1821 --11804 --
NM_006557chr91642 ------
NM_006559chr111179 ------
NM_006561chr1055671 5253 5137 4840 4207 11263 ----
NM_006572chr1733492 3072 414 ------
NM_006577chr21973 ------
NM_006578chr1541465 1221 1130 409 ------
NM_006589chr11482 ------
NM_006593chr2176 --1132 --
NM_006595chr112635 156 ----11385
NM_006599chr1648048 7592 6501 1386 12133 ----
NM_006603chrX--1168 ----
NM_006618chr121306 1168 ------
NM_006621chr11365 ------
NM_006625chr11972 ------
NM_006625chr11972 ------
NM_006625chr11972 ------
NM_006628chr1544528 3680 3545 3519 13237 ----
NM_006633chr51605 ------
NM_006646chr1342558 673 604 431 --1354 --
NM_006650chr553839 3158 2891 2580 1045 --12695 --
NM_006651chr461466 1051 538 348 233 144 --11455 --
NM_006653chr6152 ------
NM_006670chr6----1456 --
NM_006675chr1263317 2404 2383 1307 728 141 --33275 2347 77 --
NM_006677chr3158 --142 --
NM_006690chr2012056 --12204 --
NM_006698chr2031415 1287 274 11325 11268 --
NM_006709chr6285 52 ------
NM_006717chr921333 1146 13022 ----
NM_006718chr61351 ------
NM_006720chr1035029 767 489 ------
NM_006722chr352659 2376 602 489 346 ------
NM_006726chr42778 772 ------
NM_006734chr6194 ------
NM_006736chr231755 571 497 --31772 1272 587 11564
NM_006738chr1574278 3762 3339 1805 518 491 30 --34291 3922 1268 --
NM_006742chr1642006 1506 1275 1246 ------
NM_006748chr8158 ------
NM_006749chr81127 ------
NM_006761chr171677 ------
NM_006762chr121173 46 ------
NM_006763chr141887 1707 486 258 ------
NM_006772chr63530 310 261 ------
NM_006775chr652637 586 95 84 55 --159 --
NM_006802chr111092 ------
NM_006805chr52170 100 1463 ----
NM_006815chr121219 ------
NM_006826chr211178 ------
NM_006827chr1432641 2595 65 --12727 --
NM_006838chr1221509 161 ------
NM_006846chr5----1267 --
NM_006851chr1222575 865 1775 ----
NM_006852chr1722470 1986 --1699 --
NM_006854chr721926 672 ------
NM_006861chr1251946 1748 691 447 236 ------
NM_006874chr42837 207 ------
NM_006876chr111545 ------
NM_006884chr331928 118 29 ------
NM_006896chr72237 221 ------
NM_006897chr12121 ------
NM_006899chr201295 ------
NM_006901chr151111 ------
NM_006906chr11296 71 ------
NM_006910chr161307 ------
NM_006912chr112312 ------
NM_006922chr21649 ------
NM_006924chr1714084 ------
NM_006931chr1241972 1851 1727 1342 1765 1261 --
NM_006939chr141889 ------
NM_006943chr2052698 2618 816 693 392 ------
NM_006946chr113579 385 378 --195 --
NM_006950chrX3886 726 646 --1820 --
NM_006990chr1102030 1843 1787 1776 1755 559 535 500 256 49 --12300 12425
NM_006991chr33631 161 33 1338 ----
NM_006996chr11454 --154 --
NM_006999chr531324 297 227 ------
NM_007006chr16----136 --
NM_007007chr1221226 64 ------
NM_007030chr5105102 4223 3407 1689 1470 1149 857 764 568 238 --14337 --
NM_007039chr1421753 64 ------
NM_007050chr2035827 5316 2339 --12861 1110
NM_007051chr11121 ------
NM_007054chr592931 2885 2751 2725 2526 2464 1187 789 50 ------
NM_007067chr171211 ------
NM_007068chr221939 ------
NM_007084chr131561 ------
NM_007106chr1322523 629 --22381 103 --
NM_007107chr331978 1649 1604 --11742 11692
NM_007111chr13--1760 ----
NM_007118chr52635 609 ------
NM_007124chr61344 --11811 --
NM_007126chr9167 --137 --
NM_007129chr131713 ------
NM_007144chr172506 309 ------
NM_007150chrX21973 1393 ------
NM_007158chr12410 305 1875 1910 --
NM_007159chr31631 ------
NM_007162chr63417 155 116 ------
NM_007166chr11----1352 --
NM_007170chr11244 ------
NM_007172chr2242790 907 388 203 ------
NM_007174chr1241573 1516 825 207 ------
NM_007178chr121448 ------
NM_007184chr3----2588 549 --
NM_007185chr12286 170 ------
NM_007189chr741423 1115 1104 148 11158 ----
NM_007191chr121180 ------
NM_007200chr1574278 3762 3339 1805 518 491 30 --34291 3922 1268 --
NM_007217chr3151 ------
NM_007219chr203810 620 40 ------
NM_007235chr121193 ------
NM_007236chr1541720 1559 370 159 --11875 --
NM_007245chr161177 ------
NM_007246chr41132 ------
NM_007249chr1347609 6594 2213 196 --26618 3380 --
NM_007275chr32340 315 ------
NM_007286chr552129 2069 2059 1996 1344 ------
NM_007292chr17114947 4460 4448 4415 4390 4039 1989 1868 1817 1727 42 11911 1543 --
NM_007322chr192404 45 ----1176
NM_007331chr422538 2097 --1624 --
NM_007353chr711140 1514 ----
NM_007363chrX2955 430 --1119 --
NM_007375chr1--21956 247 ----
NM_012062chr122309 55 ------
NM_012074chr1431041 755 720 ------
NM_012081chr523341 3197 ------
NM_012090chr11130 ------
NM_012098chr91586 ------
NM_012102chr121888 533 --1803 --
NM_012120chr61554 ------
NM_012127chr9----131 --
NM_012141chr1321650 749 13076 12761 --
NM_012166chr911045 11076 --21269 70
NM_012168chr1----133 --
NM_012193chr1144169 4011 297 142 ------
NM_012197chr921390 1132 ------
NM_012199chr123030 2944 11314 73023 3019 3015 3011 3007 3003 2999 --
NM_012207chr101270 ------
NM_012214chr241712 1534 1413 1279 15832 12281 16148
NM_012234chr333103 2877 1324 ------
NM_012238chr1011215 ------
NM_012242chr101277 ------
NM_012249chr232749 2588 1389 ------
NM_012250chr112555 371 ------
NM_012252chr711214 ----14077
NM_012259chr6--1408 ----
NM_012281chr732147 1946 255 ------
NM_012287chr311345 --1411 --
NM_012288chr685254 4302 4168 3947 3730 1378 105 77 11553 192 1947
NM_012290chr221324 447 --1247 --
NM_012297chr4----1358 --
NM_012301chr73613 405 61 ------
NM_012302chr111101 ------
NM_012308chr1162483 1994 953 376 277 262 --1185 1859
NM_012316chr1114946 4766 4633 4418 4410 3554 1755 1563 1073 655 543 --1646 --
NM_012317chrX1624 --1130 --
NM_012326chr2----1739 --
NM_012329chr1741573 1315 1040 170 ------
NM_012330chr1021633 299 ------
NM_012333chr11588 ------
NM_012334chr5104095 3775 1704 1633 1587 1561 592 354 166 160 24138 3720 ----
NM_012384chr2042381 2312 1808 609 --22451 1748 --
NM_012388chr1541257 1136 1091 1003 13135 ----
NM_012402chr1111284 ------
NM_012423chr192156 37 ------
NM_012425chr1032342 2297 2207 12250 ----
NM_012431chr743679 3551 3505 3417 --23159 2295 --
NM_012434chr62472 24 --1234 --
NM_012446chr5--1582 ----
NM_012448chr1752477 1864 1836 1680 871 --11796 --
NM_012461chr143656 273 43 ------
NM_012463chr123740 578 109 ------
NM_012479chr741836 917 231 146 ------
NM_013230chrY21481 66 ------
NM_013233chr21453 ------
NM_013236chr221475 ------
NM_013261chr422527 1465 ------
NM_013266chr10144 ------
NM_013269chr1221522 475 ------
NM_013279chr113869 710 556 --3851 666 234 --
NM_013281chr20--1212 ----
NM_013286chr363225 3007 2664 2551 1348 628 ------
NM_013309chr1542104 1680 957 27 ------
NM_013313chr2252423 797 514 379 275 ------
NM_013316chr71915 ------
NM_013341chr222802 2758 12347 ----
NM_013354chr81132 ------
NM_013364chrX31277 538 283 ----11578
NM_013372chr1531127 174 118 12934 ----
NM_013373chr221977 --1173 --
NM_013381chr12----1370 --
NM_013390chr92549 453 ------
NM_013392chr21409 ------
NM_013399chr1611272 --31387 639 30 --
NM_013403chr191176 ------
NM_013410chr121162 181 ------
NM_013446chr7176 ------
NM_013450chr21883 1803 ----
NM_013958chr8197 --1104 --
NM_013959chr8197 --1104 --
NM_013960chr82606 566 --1574 --
NM_013961chr8197 --1104 --
NM_013962chr8197 --1104 --
NM_013981chr5164 ------
NM_013982chr5164 ------
NM_013983chr5164 ------
NM_013995chrX22594 1022 22277 171 ----
NM_014000chr1021945 751 21639 1483 ----
NM_014010chr91550 ------
NM_014011chr22477 38 ------
NM_014016chr33601 169 73 ------
NM_014021chr122641 1341 --13070 --
NM_014023chr102956 396 22423 1799 2820 423 --
NM_014028chr622586 2229 ------
NM_014030chr1731133 799 295 ------
NM_014042chr11--1108 ----
NM_014043chr31602 ------
NM_014060chrX189 ------
NM_014079chr31162 ------
NM_014089chr1331577 783 530 ------
NM_014106chr1541828 726 714 680 ------
NM_014109chr82462 67 ------
NM_014112chr821612 110 23794 1530 1644 --
NM_014153chr16----1700 --
NM_014155chr1146137 1358 314 96 11045 ----
NM_014171chr2148 ------
NM_014191chr121133 ------
NM_014226chr142179 105 ------
NM_014231chr121863 --2455 242 --
NM_014232chr1721118 24 ----11165
NM_014232chr1721118 24 ----11165
NM_014240chr3143828 3694 3666 3513 3419 3217 3157 2997 2792 2637 1594 883 841 176 13871 12698 --
NM_014250chr221279 ------
NM_014251chr71750 --1798 --
NM_014253chrX32484 1771 129 --139 --
NM_014271chrX161 ------
NM_014284chr13874 728 368 ------
NM_014286chr9103219 2988 2730 1403 1225 1170 949 445 287 24 --2708 517 22420 184
NM_014293chr2272772 1574 1440 1323 797 621 34 --23839 3028 --
NM_014294chr81212 ------
NM_014299chr194857 733 699 187 11524 41549 244 207 203 11554
NM_014309chr2245404 1884 1721 193 11911 ----
NM_014319chr1211750 ------
NM_014332chrX--1111 ----
NM_014333chr1132363 1052 412 ------
NM_014338chr224885 715 226 101 ------
NM_014342chr1121468 141 ------
NM_014376chr522451 843 ------
NM_014381chr1433173 1316 419 ------
NM_014393chr83627 332 83 --1210 --
NM_014396chr731634 1512 793 ----1362
NM_014400chr191409 ------
NM_014417chr191295 --1126 --
NM_014423chr524718 364 24901 1112 1948 --
NM_014431chr1021587 494 ------
NM_014445chr31105 ------
NM_014447chr411495 ------
NM_014449chr12181 ------
NM_014454chr61871 --1878 --
NM_014460chr2251380 1162 1137 258 126 11195 1138 --
NM_014482chr21106 ------
NM_014494chr1632381 418 257 --291 74 --
NM_014506chr9299 85 ------
NM_014507chr2241172 978 477 57 ------
NM_014515chr121167 ------
NM_014517chr3--1401 1261 --
NM_014520chr172330 32 --1139 144
NM_014548chr15--11220 ----
NM_014562chr24685 534 142 85 ------
NM_014563chrX51397 1371 494 362 336 ------
NM_014572chr1331649 637 33 ------
NM_014573chr171262 1589 11439 --
NM_014574chr141375 --1105 --
NM_014575chr31405 ------
NM_014577chr221216 --1170 --
NM_014584chr14124 ------
NM_014587chr1631516 135 109 --1519 --
NM_014592chr51763 ------
NM_014613chr532289 2074 440 13015 21076 237 --
NM_014614chr2196 ------
NM_014615chr1613386 --11151 --
NM_014630chr154747 489 426 366 21611 1466 1360 --
NM_014636chr973849 3792 3356 2850 1024 442 226 ------
NM_014647chr1611711 ------
NM_014653chr1222068 1994 ----11724
NM_014659chr151444 --140 --
NM_014660chr71234 ------
NM_014661chr1063349 3335 2769 2637 1283 290 --63381 3279 2828 2399 2395 155 --
NM_014663chr12989 305 ------
NM_014665chr842367 1370 1248 537 22548 2458 21329 283 --
NM_014666chr51396 ------
NM_014667chr31255 2510 47 12330 --
NM_014670chr211198 ------
NM_014671chr72622 504 196 ----
NM_014676chr121619 412 ------
NM_014678chr223634 573 43 ----1178
NM_014682chr811432 ------
NM_014683chr1731562 873 185 ------
NM_014686chr1962401 2365 1715 1594 508 233 11637 51901 35 31 27 23 --
NM_014690chr741995 1175 572 23 ----1537
NM_014693chr32293 193 --1245 --
NM_014699chr161300 ------
NM_014702chr613508 ----13234
NM_014712chr163467 456 175 ------
NM_014720chr101105 --11326 --
NM_014723chr2072716 2626 2226 2069 1129 422 27 --12475 1799
NM_014726chr173909 450 293 ------
NM_014729chr81288 ----11638
NM_014730chr12104506 4335 4265 3434 3335 3246 2104 1634 738 696 --11977 --
NM_014730chr12104506 4335 4265 3434 3335 3246 2104 1634 738 696 --11977 --
NM_014731chr201542 1724 ----
NM_014735chrX1599 ------
NM_014736chr1551015 887 841 821 753 ------
NM_014739chr614089 ------
NM_014742chr2011765 ------
NM_014743chr421157 949 ------
NM_014747chr1105080 4499 4112 3963 3828 1288 1177 426 115 46 24269 1389 1382 11949
NM_014748chr23408 306 64 --1270 --
NM_014752chr11----1542 --
NM_014761chr161830 ------
NM_014762chr132149 679 504 ------
NM_014764chr121455 ------
NM_014767chr1073628 3608 3589 3550 2509 2486 1058 11103 33417 3082 1032 --
NM_014770chr1221146 314 --1328 --
NM_014774chr1133 12750 --12273
NM_014776chr1253143 2903 2747 517 329 --11138 --
NM_014781chr81326 ------
NM_014795chr2--197 ----
NM_014797chr633104 2844 2591 22455 72 ----
NM_014802chr122183 132 ------
NM_014806chr92452 417 ------
NM_014807chr113595 521 84 ------
NM_014810chr142558 1380 1266 57 ------
NM_014812chr12690 236 ------
NM_014820chr332000 450 354 ------
NM_014826chr153787 3625 1715 83 49 ------
NM_014830chr1212658 ------
NM_014835chr202748 194 ------
NM_014841chr61346 ------
NM_014850chr344875 4757 3807 1197 --1117 --
NM_014853chr1741431 1008 552 236 ------
NM_014858chr131166 990 362 ------
NM_014862chr1544193 1417 1016 520 --11320 --
NM_014869chr3134 177 11286 --
NM_014871chr121585 ------
NM_014872chr942038 1970 1615 437 --11878 --
NM_014874chr131226 505 180 ------
NM_014876chr224815 715 370 27 ------
NM_014877chr1787050 6520 6194 6148 6014 5988 4999 934 --15683 --
NM_014883chr43685 158 120 ------
NM_014897chr1762759 2573 2501 2095 1087 104 ------
NM_014898chr1922042 1882 1599 ----
NM_014900chr221139 407 ------
NM_014901chr511914 --3216 212 114 2240 37
NM_014902chr2011402 --11482 --
NM_014903chr121825 ------
NM_014904chr1023189 991 ------
NM_014906chr1722770 1469 ------
NM_014912chr10167 ------
NM_014934chr1333751 2706 93 13099 ----
NM_014935chr141058 1048 513 442 --11019 --
NM_014942chr611877 ----1385
NM_014945chr511249 2727 314 1104 --
NM_014946chr232912 1185 1133 ------
NM_014947chr151204 1117 1069 1023 997 --11155 --
NM_014952chr151444 ------
NM_014956chr113997 891 313 159 170 --
NM_014962chr2022178 182 160 ----
NM_014974chr1021755 229 --11497 --
NM_014978chr1031312 494 375 ------
NM_014989chr61117 --11810 --
NM_014991chr4--1627 22756 470 12621
NM_014992chr14176 ------
NM_014994chr1552328 2266 2022 1735 212 21930 1778 ----
NM_014997chr732609 2586 2572 --11135 --
NM_015000chr121278 --1306 --
NM_015001chr11351 ------
NM_015002chr1221536 198 ------
NM_015008chr353278 2451 1406 1020 395 ----12329
NM_015009chr3162 ------
NM_015015chr1952046 720 703 661 68 --1805 --
NM_015017chr13937 513 333 ------
NM_015020chr1641446 635 359 73 --1639 --
NM_015024chr81319 ------
NM_015025chr222158 444 ------
NM_015026chr1224580 1028 ------
NM_015033chr983245 3078 1202 1067 841 793 762 749 --32712 2429 52 --
NM_015035chr2085542 5421 4634 4576 4536 1708 843 522 --22413 48 --
NM_015039chr12279 68 13477 ----
NM_015040chr233378 2279 597 ------
NM_015042chr1564240 3974 3763 3631 2847 784 --34002 3302 696 --
NM_015044chr1632927 1128 329 13155 --12372
NM_015045chr1011421 ------
NM_015052chr71166 ------
NM_015063chr192481 261 --11423 11065
NM_015068chr731177 1068 585 --11591 11470
NM_015071chr595174 5054 4206 4033 2226 1846 1111 1037 703 15127 14633 --
NM_015074chr1124557 4117 3996 3951 3861 3824 3574 1347 1226 1182 1094 29 ------
NM_015075chrX72088 1983 1493 419 412 176 80 11952 --1261
NM_015076chr654235 3601 2893 2847 627 1254 12979 --
NM_015080chr112238 107 ------
NM_015090chr176145 5774 5130 2393 2159 1548 618 12012 12003 --
NM_015091chr14185 ------
NM_015092chr1641669 1621 1533 754 ----1247
NM_015093chr61239 ------
NM_015097chr31904 --1727 --
NM_015100chr1--21734 201 11992 --
NM_015107chrX52271 1507 937 789 293 --1201 11763
NM_015133chr1651357 935 522 457 437 --1393 --
NM_015144chr1623338 212 12485 ----
NM_015150chr31319 ------
NM_015153chr6178 ------
NM_015155chr1023098 2505 ------
NM_015156chr1453871 1074 722 280 155 ------
NM_015158chr91198 196 ----
NM_015163chr1431292 205 196 --245 29 --
NM_015170chr811533 12177 ----
NM_015185chrX31006 400 281 ------
NM_015191chr1122073 633 --11696 --
NM_015192chr2012793 ------
NM_015194chr1751770 1391 1355 157 69 --11574 --
NM_015197chr1473106 2915 2574 2295 2248 669 463 --22132 515 --
NM_015200chr42309 127 --1550 --
NM_015208chr1884081 3960 3911 3823 3521 3135 810 70 ------
NM_015213chr111240 ------
NM_015215chr122720 918 ------
NM_015219chr1712206 --41013 726 722 21 --
NM_015221chr10282 33 11239 ----
NM_015229chr1731053 1030 968 --21034 160 --
NM_015230chr421748 509 ------
NM_015233chr1352480 2414 2036 1709 634 ------
NM_015236chr411075 ------
NM_015239chr91180 ------
NM_015246chr1641539 1365 564 467 --1326 11996
NM_015250chr91444 ------
NM_015251chr1632014 1750 890 --1521 --
NM_015263chr1521087 389 ------
NM_015265chr242501 310 266 229 ------
NM_015268chr3188 ------
NM_015271chr424150 24 ------
NM_015284chr162062 2055 1930 787 478 62 ----1344
NM_015291chr12820 194 ------
NM_015292chr124305 252 63 41 1155 ----
NM_015296chr131491 ------
NM_015299chr1441589 589 547 46 13900 23690 692 --
NM_015305chr1461760 1695 1281 665 494 392 --1180 --
NM_015310chr857992 5649 5469 2026 1842 15295 ----
NM_015313chr1114706 --21367 113 --
NM_015315chr532126 1008 955 ------
NM_015316chr1431394 907 205 1890 1996 --
NM_015326chr152157 1926 810 174 138 12836 ----
NM_015327chr121249 262 ------
NM_015328chr762598 2552 2069 731 502 166 1900 1108 --
NM_015332chr743200 1259 1086 574 1483 12240 13437
NM_015336chr12--142 ----
NM_015338chr2041800 1577 1510 1501 ----1299
NM_015339chr202282 91 ------
NM_015345chr622717 245 ------
NM_015347chr1252792 2223 2210 781 523 ------
NM_015355chr171626 ------
NM_015358chr21--11228 ----
NM_015365chrX33476 737 388 ------
NM_015374chr225403 335 229 75 61 ------
NM_015375chr164901 4225 1773 846 800 712 1889 ----
NM_015387chr21238 ------
NM_015407chr3----1174 --
NM_015416chr122789 745 ------
NM_015435chr8----11163 --
NM_015446chr121615 1300 ------
NM_015447chr91240 ------
NM_015453chr341901 1777 835 329 ------
NM_015455chr544105 1437 943 290 --1973 --
NM_015460chr33207 170 35 ------
NM_015461chr18--1222 ----
NM_015470chr241248 845 134 96 --3479 240 50 --
NM_015472chr32154 104 ------
NM_015472chr32154 104 ------
NM_015481chr123756 252 220 ------
NM_015483chr7--128 ----
NM_015488chr231521 626 223 --11531 --
NM_015493chr1941986 864 729 57 --11379 --
NM_015497chr15----1399 --
NM_015515chr17----122 --
NM_015520chr322010 1865 1883 ----
NM_015530chr21210 ------
NM_015531chr111162 ------
NM_015534chr12851 807 ------
NM_015544chr172599 518 --1502 --
NM_015553chr674270 4145 4119 3621 3334 1562 1374 --14261 --
NM_015554chr1532925 1987 1813 --12159 --
NM_015556chr141173 ------
NM_015557chr163101 3048 2775 2617 1211 55 22641 1107 32228 1145 577 --
NM_015564chr512679 --1566 --
NM_015565chr21------167
NM_015570chr71640 ------
NM_015576chr332967 1981 741 ------
NM_015577chr531312 559 171 11698 ----
NM_015578chr192362 148 ------
NM_015609chr172501 2426 2136 1055 1032 771 43 ------
NM_015626chr1721007 928 ------
NM_015640chr134931 4074 3919 ------
NM_015651chr93628 222 121 --41917 146 142 138 --
NM_015658chr12367 90 --1335 --
NM_015670chr17----1337 --
NM_015680chr2185 --1231 --
NM_015686chrX32432 1987 1820 ------
NM_015691chrX72967 2385 2367 2304 2244 2117 814 --12376 --
NM_015695chr641978 473 466 35 --2338 27 --
NM_015704chr22126 ------
NM_015711chr191700 --1157 --
NM_015716chr171214 ------
NM_015723chr71478 ------
NM_015726chr1----151 --
NM_015845chr181151 ------
NM_015850chr842293 542 148 120 --1290 --
NM_015866chr11371 ------
NM_015872chr131374 1112 656 ------
NM_015879chr1878578 8366 6300 3186 1724 1443 297 --11709 15872
NM_015885chr11----1176 --
NM_015889chr222811 130 ------
NM_015902chr81326 ------
NM_015904chr21219 ------
NM_015906chr123346 105 --14737 --
NM_015955chr21353 ------
NM_015975chrX21739 274 ------
NM_015981chr552672 2561 2385 2255 523 ----1305
NM_015995chr15154964 4945 4832 4562 4499 4407 4139 3978 3777 3587 1908 811 685 398 300 14381 34415 1288 670 --
NM_016018chr811933 ------
NM_016022chr1----138 --
NM_016037chr141029 936 890 864 ------
NM_016048chr51268 ------
NM_016072chr121327 --12080 --
NM_016073chr151330 ------
NM_016075chr13------11020
NM_016076chr111290 12626 ----
NM_016083chr633102 2939 993 ------
NM_016096chr81543 ------
NM_016098chr61172 ------
NM_016100chr20--1325 ----
NM_016131chr22915 477 ------
NM_016132chr1512147 ------
NM_016141chr32648 59 ------
NM_016152chr311055 1968 ----
NM_016156chr1122246 2122 ------
NM_016166chr15----1210 --
NM_016185chr171533 --2644 514 --
NM_016194chr1541465 1221 1130 409 ------
NM_016201chr332272 829 508 ------
NM_016206chr357606 7497 3053 2498 1785 --17627 --
NM_016216chr33322 141 115 ------
NM_016217chr623418 440 ------
NM_016231chr171469 ------
NM_016235chr1641472 1013 493 105 11491 ----
NM_016242chr41140 ------
NM_016250chr141782 ------
NM_016255chr623201 2774 ------
NM_016260chr225634 167 ------
NM_016261chr173287 166 119 ------
NM_016263chr1973490 3120 898 386 326 91 79 22879 163 3958 333 286 --
NM_016272chr2221931 473 ------
NM_016279chr51374 ------
NM_016281chr122227 152 ------
NM_016284chr16------1651
NM_016287chr12271 186 --1452 --
NM_016319chr12----250 46 --
NM_016320chr112762 61 ------
NM_016322chr922549 71 ------
NM_016338chr52389 23 ------
NM_016352chr721444 1339 ------
NM_016374chr1----1280 --
NM_016374chr1----1280 --
NM_016376chr1733581 3479 702 --1375 24318 683
NM_016396chr1532213 946 109 --1619 --
NM_016399chr121574 ----1332
NM_016424chr171759 ------
NM_016441chr21252 ------
NM_016470chr201447 ------
NM_016480chr51640 ------
NM_016486chr1----280 56 189
NM_016507chr172837 309 ------
NM_016516chr22854 72 ------
NM_016522chr1121326 1187 ----1537
NM_016532chr173828 193 55 ------
NM_016542chrX11159 ------
NM_016544chr231248 1177 689 --1831 --
NM_016570chr12--136 ----
NM_016575chr1265375 3812 3370 1496 1362 1336 --35034 5007 4107 --
NM_016588chr62718 248 ------
NM_016592chr201391 1322 ----
NM_016603chr51723 ------
NM_016604chr52426 155 1269 ----
NM_016605chr532713 2044 832 ------
NM_016607chrX1226 ------
NM_016621chr1183743 3725 3617 3596 2855 2817 1734 305 --13400 --
NM_016623chr81405 ------
NM_016626chr1821420 427 ------
NM_016641chr1621487 1344 --11467 --
NM_016643chr164945 865 746 243 ------
NM_016733chr2211002 1232 1393 --
NM_016823chr1731209 1075 245 ------
NM_016831chr131504 947 672 ------
NM_016848chr9----192 --
NM_016929chr643663 2966 1666 89 13470 --11134
NM_016938chr111402 ------
NM_016946chr152249 2203 1297 989 842 --12333 --
NM_016952chr1183833 1481 1452 719 679 673 548 522 ------
NM_017409chr12165 ------
NM_017410chr1221052 42 ------
NM_017413chrX42224 1963 1838 867 --2314 150 --
NM_017415chr543889 3122 1089 913 --23310 48 --
NM_017420chr1413781 ------
NM_017423chr4------168
NM_017452chr20----1247 --
NM_017453chr20----1247 --
NM_017454chr20----1247 --
NM_017456chr1741704 1372 788 589 --1617 --
NM_017457chr19----146 --
NM_017490chr111273 ------
NM_017491chr41652 --1399 --
NM_017545chr20--1440 ----
NM_017549chr721162 259 ------
NM_017550chr1921069 62 --1255 --
NM_017553chr151198 --1992 11003
NM_017563chr3105969 5847 5713 3948 3902 1586 1523 655 369 42 25890 4552 24034 766 --
NM_017582chr12128 83 --21433 1285 --
NM_017593chr4--1381 ----
NM_017596chr174021 4015 3121 1360 1017 981 759 23873 3329 33781 164 142 11474
NM_017617chr92187 52 --21401 513 --
NM_017626chr1041409 1174 360 262 ------
NM_017629chr1172 --11681 --
NM_017633chr663748 3372 3136 2961 899 825 --23708 2432 --
NM_017637chr989348 8763 8728 6359 6133 3683 1079 407 23304 1703 17959 --
NM_017638chr14851 729 366 161 1772 ----
NM_017641chr122981 313 ------
NM_017650chr725230 965 15862 ----
NM_017662chr91628 --140 --
NM_017668chr16143 --1330 --
NM_017670chr113870 754 709 --2703 192 --
NM_017672chr15132 ------
NM_017686chr121022 890 ------
NM_017709chr133914 3044 850 12913 ----
NM_017715chr71477 1167 ----
NM_017724chr31289 --1811 --
NM_017728chr171454 --4753 706 502 226 --
NM_017730chr3--1635 ----
NM_017737chr121630 876 --1419 --
NM_017741chr462341 2222 2086 937 551 326 ------
NM_017749chr112731 185 ------
NM_017753chr91379 ------
NM_017758chr1741091 1014 572 154 ------
NM_017772chr6131 ------
NM_017778chr831328 1168 990 11020 1138 --
NM_017779chr122453 2183 12709 ----
NM_017786chr8--1254 ----
NM_017791chr141343 ----11384
NM_017798chr2021049 786 11035 --11206
NM_017799chr1421674 1577 ------
NM_017805chr19------168
NM_017811chr921132 283 ------
NM_017824chr1012659 11965 --12078
NM_017831chr1834129 649 554 14186 ----
NM_017847chr11164 ------
NM_017848chrX34480 1280 708 --1158 --
NM_017849chr242569 2386 2360 145 --12183 --
NM_017851chr152911 884 ------
NM_017856chrX42136 1537 793 661 --1308 --
NM_017857chr11174 --1218 --
NM_017902chr1075744 4635 4494 4177 523 242 55 25240 1738 24464 4391 11061
NM_017905chr132267 38 ------
NM_017919chr921068 621 --23916 3539 --
NM_017933chr21362 ------
NM_017988chr121673 ------
NM_017994chr752606 2308 1083 140 54 ------
NM_018003chr1521688 1553 11731 ----
NM_018008chr31256 ------
NM_018017chr1011017 ------
NM_018027chr1032824 161 131 ------
NM_018028chr192337 312 --1261 --
NM_018045chr122635 2503 2537 135 12062 1334
NM_018064chr6129 ------
NM_018078chr4--148 ----
NM_018083chr19172 ------
NM_018086chr21355 ------
NM_018087chr11193 ------
NM_018092chr1631687 614 306 ------
NM_018096chr173993 742 55 --1182 --
NM_018103chr11319 ------
NM_018107chr14123 ------
NM_018110chr16----142 --
NM_018111chr19128 ------
NM_018115chr42745 693 ------
NM_018128chr1731493 1405 1111 ------
NM_018133chr321408 427 ------
NM_018144chr101233 ------
NM_018157chr1211228 ------
NM_018164chr121100 ------
NM_018172chr1131304 1179 1112 ------
NM_018182chr1722020 759 --21618 245 --
NM_018192chr31700 --1981 --
NM_018211chr12729 64 --1741 --
NM_018221chr21124 ------
NM_018243chr462727 2682 2592 641 362 254 1341 12879 --
NM_018244chr2021145 64 1523 ----
NM_018254chr11342 ------
NM_018263chr212508 ------
NM_018299chr81924 ------
NM_018312chr1121781 849 ----11724
NM_018313chr3--1514 ----
NM_018315chr431085 991 210 ------
NM_018362chr1123414 3279 ------
NM_018364chr113900 11093 ----
NM_018369chr5----1648 --
NM_018371chr831046 188 182 ------
NM_018387chr9----1393 --
NM_018403chr31396 ------
NM_018416chr1222412 181 --193 --
NM_018424chr9----11745 --
NM_018440chr837414 6295 6157 --26224 209 16647
NM_018452chr6_random43071 2925 1359 787 ----11502
NM_018469chr1721495 199 11201 21344 135 --
NM_018471chr21420 ------
NM_018482chr83827 171 52 ------
NM_018489chr1159 ------
NM_018490chr11----1105 --
NM_018509chr17124 ------
NM_018534chr2184 ------
NM_018553chr1721847 695 --11359 --
NM_018569chr421475 197 ------
NM_018584chr1----11058 --
NM_018622chr3------145
NM_018639chr1231378 1071 404 ------
NM_018640chr1212687 ------
NM_018644chr1131792 867 831 ----1788
NM_018650chr11845 --191 --
NM_018657chr31266 ------
NM_018667chr1662321 2211 2205 535 388 218 --42029 2018 1792 1068 --
NM_018670chr153227 83 22 ------
NM_018683chr2041371 1342 632 277 ------
NM_018695chr51975 ------
NM_018697chr732108 1768 1459 165 ----
NM_018700chr52579 179 ------
NM_018703chr161307 ------
NM_018704chr111722 1392 ----
NM_018712chr1131535 596 41 --11107 --
NM_018713chr121080 972 ------
NM_018715chr152241 1989 913 525 468 --1581 --
NM_018718chr72593 392 11701 1505 --
NM_018841chr121023 26 ------
NM_018945chr683048 2928 2883 2795 2630 1035 313 150 12971 --11135
NM_018951chr71915 --1461 --
NM_018952chr171245 ------
NM_018959chr192156 21 ------
NM_018970chr732906 2852 540 ----12374
NM_018977chrX1361 ------
NM_018991chr74539 512 237 191 ------
NM_018994chr11550 ------
NM_018999chr1034890 3371 382 24022 1492 ----
NM_019009chr1131950 1766 744 --22182 1010 1684
NM_019022chr1813189 ------
NM_019027chr412140 155 ----
NM_019035chr411946 ------
NM_019046chr104804 683 635 354 ------
NM_019053chr10--11050 ----
NM_019063chr21625 ------
NM_019064chr171779 --170 --
NM_019084chr1022042 816 ------
NM_019091chr211006 ------
NM_019094chr1263786 1392 1380 1346 1320 88 --11475 --
NM_019106chr2232352 898 269 --1718 --
NM_019114chr932433 1861 49 ------
NM_019116chr1683667 3447 3185 3102 2702 1352 1125 887 --1667 --
NM_019557chr1282 58 ------
NM_019593chr2033103 3044 2225 --12115 --
NM_019605chr12626 136 ------
NM_019606chr71153 ------
NM_019610chr121557 388 ------
NM_019613chr173958 867 40 ------
NM_019845chr23614 181 38 ----1619
NM_019854chr122298 122 ------
NM_019857chrX----136 --
NM_019858chr12181 ------
NM_019862chr162686 387 --1175 --
NM_019898chr162686 387 --1175 --
NM_019899chr162686 387 --1175 --
NM_019900chr162686 387 --1175 --
NM_020039chr1241201 273 169 70 ------
NM_020119chr73500 363 337 13922 ----
NM_020121chr13----153 --
NM_020126chr191118 2243 216 ----
NM_020131chr151624 1304 593 98 24 ------
NM_020152chr212715 708 ------
NM_020155chr11199 ------
NM_020156chr71380 ------
NM_020159chr4----11171 --
NM_020168chr1541364 1116 469 79 1485 ----
NM_020180chr1821345 1256 1409 ----
NM_020182chr201819 1717 23366 2984 13371
NM_020198chr1711286 ------
NM_020205chr133423 3010 572 ------
NM_020211chr1511070 --2590 129 --
NM_020235chr31304 ------
NM_020248chr132175 769 606 --1908 --
NM_020309chr193345 248 101 ------
NM_020310chr1732786 2442 352 --12243 --
NM_020318chr1131 ------
NM_020337chr432358 169 75 --12559 --
NM_020338chr1033189 1404 402 --21325 1006 --
NM_020342chr2--12003 ----
NM_020357chr3196 ------
NM_020371chr15--122 ----
NM_020378chr193449 419 62 --1573 --
NM_020381chr63688 642 616 --1773 --
NM_020390chr331166 1029 1003 24131 3332 ----
NM_020403chr1311299 ------
NM_020418chr32141 53 ------
NM_020426chr17182 ------
NM_020432chr712172 ----163
NM_020438chr91504 11344 1211 --
NM_020440chr11397 --12979 1406
NM_020443chr176547 5819 2792 2588 2305 1908 1445 26381 1307 ----
NM_020473chrX11738 ------
NM_020475chr862203 2110 2101 1952 606 173 ------
NM_020476chr862203 2110 2101 1952 606 173 ------
NM_020477chr862203 2110 2101 1952 606 173 ------
NM_020478chr862266 2173 2164 2015 669 236 ------
NM_020480chr862203 2110 2101 1952 606 173 ------
NM_020526chr141846 1789 294 176 --1647 --
NM_020546chr523086 674 1602 22535 1125 --
NM_020631chr181327 1256 1044 1004 998 131 91 55 ------
NM_020647chr81414 ------
NM_020655chr1651374 1360 1169 969 343 11270 ----
NM_020659chr192545 140 --189 --
NM_020673chr20137556 7372 6532 6422 6210 6074 6048 5431 5147 1344 1117 1097 1001 --13003 --
NM_020693chr112146 27 ------
NM_020695chr193691 568 24 ------
NM_020699chr143859 1560 831 87 ------
NM_020704chr722327 62 ------
NM_020708chr2082383 2342 1893 842 745 464 458 152 --12509 1133
NM_020713chr2063060 2873 2159 1241 340 110 --12747 --
NM_020717chrX33322 452 391 14704 14593 --
NM_020718chr1665878 4976 4139 1977 1148 185 ------
NM_020728chr772886 2765 2625 2257 2230 2180 1152 ------
NM_020734chr122841 565 ------
NM_020739chr151732 ------
NM_020742chrX12284 --11886 --
NM_020747chr52937 860 ------
NM_020748chr1711483 ------
NM_020752chr1012755 ------
NM_020753chr172518 44 ----1664
NM_020760chr24527 500 221 51 ------
NM_020764chr162911 78 --1166 --
NM_020766chrX21574 818 11766 ----
NM_020768chr51142 ------
NM_020771chr611401 ------
NM_020772chr1755991 2347 2325 2269 1961 16498 11997 --
NM_020778chr15114849 4533 4005 3339 3206 1662 1101 659 445 430 262 --1728 --
NM_020781chr721191 505 --1586 --
NM_020791chr17155 ------
NM_020792chr321824 316 ------
NM_020794chr11363 ------
NM_020795chr1721243 555 --21797 714 --
NM_020796chr532631 969 80 ------
NM_020801chr51820 ------
NM_020806chr141303 ------
NM_020807chr16188 --2630 552 --
NM_020824chr101752 ------
NM_020825chr16113683 3553 3140 2623 2497 1336 1311 940 519 299 248 1986 ----
NM_020834chr1451930 767 741 619 449 ------
NM_020845chr1242282 1748 730 162 --72415 2395 1894 1890 1755 671 662 --
NM_020850chr1643099 1070 975 961 12282 62909 2584 2580 2361 871 123 --
NM_020851chr1551781 635 625 599 50 ------
NM_020858chr15193 1197 ----
NM_020860chr41258 ------
NM_020861chr6--11150 ----
NM_020872chr31274 ------
NM_020886chr1121058 464 --142 --
NM_020888chr151530 1295 691 232 115 ------
NM_020896chr111857 ----1968
NM_020897chr111188 --11231 --
NM_020899chr172826 398 ------
NM_020918chr1023510 857 --13397 --
NM_020922chrX3743 697 354 ------
NM_020927chr1622249 1941 ------
NM_020940chr1012939 ------
NM_020946chr921703 649 ------
NM_020948chr122490 154 ------
NM_020949chr31207 ------
NM_020951chr1941919 1873 1744 1571 ------
NM_020956chr1994750 4440 4026 1284 1140 778 632 569 562 --84339 3791 3167 1100 1049 703 503 413 --
NM_020962chr1592127 1546 923 908 622 605 496 426 89 --1809 --
NM_020964chr1883478 3455 3113 3088 1519 1440 1211 754 11907 24149 657 --
NM_020972chr42267 251 ------
NM_020975chr10----11368 --
NM_020977chr41603 ------
NM_020987chr1031066 552 414 ------
NM_020993chr122998 408 12217 ----
NM_021005chr151861 ------
NM_021007chr21709 ------
NM_021020chr873341 3136 2926 2866 2765 2413 1040 12427 --12187
NM_021033chr132987 63 ----12361
NM_021035chr204258 213 125 21 --11213 --
NM_021069chr431944 542 454 21357 62 132 --
NM_021072chr5----11823 --
NM_021090chr2263793 3761 3532 1563 1367 214 --1310 --
NM_021095chr23208 154 21 ------
NM_021135chr633202 3042 533 1591 2788 76 --
NM_021149chr1641037 488 360 162 --2287 44 --
NM_021155chr1953020 863 816 680 654 ------
NM_021177chr61242 ------
NM_021189chr11879 --1107 --
NM_021200chr1131025 860 34 1206 11122 --
NM_021202chr2043024 2697 590 171 --22716 963 --
NM_021213chr1741005 992 256 217 1198 ----
NM_021215chr20----11637 --
NM_021218chr92901 765 1944 ----
NM_021224chr91448 ------
NM_021238chr1251983 1570 1501 188 162 ------
NM_021249chr1421629 35 ------
NM_021259chr162282 71 --2483 191 --
NM_021260chr1421354 499 --1510 1542
NM_021622chr102896 114 --125 --
NM_021625chr121166 1395 ----
NM_021627chr31209 ------
NM_021643chr241605 346 283 85 --11474 --
NM_021644chr101270 ------
NM_021647chr4----21253 150 --
NM_021648chr63796 551 295 --31686 995 173 --
NM_021738chr101283 ------
NM_021813chr622219 1460 --14072 14474
NM_021911chr534339 2171 1403 ------
NM_021912chr1521062 692 --161 --
NM_021943chr63751 702 204 --11901 --
NM_021945chr653187 2559 1242 1069 99 12785 32775 429 425 --
NM_021946chrX31195 929 126 ------
NM_021949chrX----22787 843 --
NM_021959chr61707 --1280 195
NM_021960chr112194 --12115 --
NM_021961chr1157128 6973 6441 4552 2762 16716 15163 --
NM_021962chr1741881 633 540 332 --52346 1904 1810 665 504 1370
NM_021973chr41190 ------
NM_021980chr1031037 290 156 ------
NM_021988chr203509 396 375 11605 ----
NM_022039chr10263 21 ------
NM_022042chr42215 59 ------
NM_022048chr1562513 2423 1410 1300 540 510 --2258 195 --
NM_022060chr1411369 --11289 --
NM_022062chr1111908 ------
NM_022066chr17----153 --
NM_022067chr142100 28 --149 --
NM_022068chr181603 ------
NM_022080chr2012356 --12730 12073
NM_022085chr611420 1627 ----
NM_022123chr141221 --137 --
NM_022130chr521494 375 ------
NM_022133chr811715 ------
NM_022166chr1676363 4966 4960 4588 2349 1671 182 --25539 4387 --
NM_022167chr17--1805 ----
NM_022170chr731237 203 99 ------
NM_022171chr361447 1406 1339 397 203 153 ------
NM_022343chr9184 11102 1846 --
NM_022373chr71346 ------
NM_022374chr2----174 --
NM_022442chr203509 396 375 11605 ----
NM_022456chr1255289 5155 2880 2108 1225 25650 24 --15413
NM_022459chr1336061 1057 418 22396 819 14261 14144
NM_022465chr1222159 1120 ----11082
NM_022469chr13962 689 64 --1101 --
NM_022470chr341277 1156 1022 856 --138 --
NM_022476chr16------183
NM_022477chr2031340 1205 618 --2578 157 --
NM_022495chr14--1115 ----
NM_022497chr342933 1117 983 552 --12672 --
NM_022572chr231521 626 223 --11531 --
NM_022644chr172176 86 ------
NM_022658chr1211108 ------
NM_022719chr2233379 2889 2828 --11389 --
NM_022733chr131177 1018 829 ------
NM_022735chr1----1347 --
NM_022737chr1931039 469 140 ------
NM_022744chr1631047 1005 424 --31153 821 408 --
NM_022745chr132756 1124 651 ------
NM_022749chr861322 1199 1133 485 295 55 --163 --
NM_022750chr7139 ------
NM_022753chr152437 2227 1781 629 280 ------
NM_022755chr932282 2180 1875 ------
NM_022756chr131165 1087 126 ------
NM_022757chr32998 796 ------
NM_022758chr653072 2641 2540 2059 1225 ------
NM_022763chr322843 1121 --1637 --
NM_022776chr31575 1498 ----
NM_022802chr102491 173 ------
NM_022818chr1621410 407 ------
NM_022825chrX2274 212 ------
NM_022836chr121343 570 ------
NM_022843chr1311448 ------
NM_022893chr212836 ------
NM_022894chr21276 ------
NM_022896chr2051664 1630 431 385 359 ------
NM_022898chr1414797 ------
NM_022912chr21110 13065 ----
NM_022970chr1021144 303 ------
NM_022977chrX12278 ------
NM_023008chr192235 119 ------
NM_023009chr12484 89 --168 --
NM_023018chr131304 1044 144 --21250 89 1576
NM_023067chr32258 116 --21081 1077 --
NM_023075chr183884 729 100 ------
NM_023076chr1662710 2703 1062 978 808 163 11149 3272 268 157 --
NM_023105chr842293 542 148 120 --1290 --
NM_023106chr842293 542 148 120 --1290 --
NM_023110chr842293 542 148 120 --1290 --
NM_023111chr842293 542 148 120 --1290 --
NM_023927chr521155 360 1233 ----
NM_023929chr822581 2546 ------
NM_023931chr1651413 1151 1009 141 70 --1516 --
NM_024003chrX3643 583 109 ------
NM_024007chr511061 ------
NM_024045chr10146 ------
NM_024046chr321247 478 ------
NM_024052chr1721054 554 ------
NM_024063chr15154 1146 ----
NM_024117chr92903 289 --146 --
NM_024293chr22287 276 --4156 152 148 144 --
NM_024294chr653072 2641 2540 2059 1225 ------
NM_024308chr17154 --1425 --
NM_024336chr161274 ------
NM_024345chr956106 5089 5020 4751 1562 ------
NM_024421chr1821260 879 11183 ----
NM_024424chr112191 167 ------
NM_024425chr112191 167 ------
NM_024426chr112191 167 ------
NM_024490chr152589 553 ------
NM_024494chr12670 108 --1691 --
NM_024501chr2--1544 ----
NM_024511chr483449 3316 2335 2245 2202 2176 426 400 --1824 --
NM_024522chr121751 131 --11372 --
NM_024524chr322167 679 --1641 --
NM_024527chr192198 26 --1148 --
NM_024541chr1051500 1300 1187 666 640 --1483 11253
NM_024551chr12--22310 1878 ----
NM_024551chr12--22310 1878 ----
NM_024554chr11369 --1112 --
NM_024567chr83700 693 268 1638 ----
NM_024598chr1621161 1020 --11169 --
NM_024599chr171250 --151 --
NM_024612chr1711000 ------
NM_024613chr81168 1112 ----
NM_024624chr2--1626 ----
NM_024626chr121578 1183 21354 1268 21405 325 --
NM_024639chr6------1235
NM_024645chr811423 11044 ----
NM_024659chr2--1389 ----
NM_024667chr1211442 --31196 702 698 1542
NM_024689chrX31745 1250 1230 ------
NM_024692chr221445 635 ------
NM_024698chr1141063 941 501 480 --1183 --
NM_024704chr20197 1165 1190 --
NM_024711chr73918 473 116 ------
NM_024713chr1511547 21274 83 ----
NM_024721chr822393 207 ------
NM_024740chr1133173 2763 80 --11434 --
NM_024742chr1661917 1686 1271 1191 413 397 --21505 1416 --
NM_024770chr265602 4873 4484 1803 1668 1380 1841 14923 --
NM_024786chr5----175 --
NM_024787chr84866 364 275 189 ------
NM_024798chr15102317 909 854 705 571 545 409 362 272 25 ----11161
NM_024884chr1464406 1169 1079 1007 700 195 1742 ----
NM_024920chr411254 11533 ----
NM_024927chr17----134 --
NM_024939chr16----1170 --
NM_024943chr43738 605 545 ------
NM_024954chr103486 139 65 --2247 35 --
NM_024989chr246455 2427 2421 2288 1847 21514 1487 --
NM_025048chr6254 28 --1189 --
NM_025054chr824041 2744 --11381 --
NM_025090chr1721497 177 ------
NM_025099chr171165 ------
NM_025109chr17146 ------
NM_025133chr21366 ------
NM_025146chr322029 1941 ------
NM_025160chr133377 3254 484 ------
NM_025179chr1104687 3966 3906 3625 3210 1375 1363 1253 986 294 ------
NM_025181chr21258 ------
NM_025182chr92420 201 ------
NM_025191chr12469 395 11416 ----
NM_025202chr241052 660 222 202 ------
NM_025219chr2062062 723 450 311 131 40 --41641 1637 430 102 --
NM_025222chr322598 2529 --1431 --
NM_025224chr2052125 2065 875 561 31 --1478 --
NM_025230chr1441779 1612 1339 51 31655 1382 340 ----
NM_025237chr1751151 1119 267 255 110 ------
NM_025238chr1511451 ------
NM_025248chr1742108 830 602 374 --31246 1216 27 --
NM_025251chr84467 336 317 247 --1161 --
NM_025256chr6285 52 ------
NM_030621chr1434266 3289 3021 ------
NM_030627chr512764 ------
NM_030629chr1621193 585 ------
NM_030636chr74815 790 521 91 ------
NM_030647chr726055 4068 --184 --
NM_030650chr244162 4028 3870 3033 ------
NM_030651chr66795 575 331 222 154 136 --1676 --
NM_030661chr711039 ------
NM_030751chr101462 1211 ----
NM_030751chr101462 1211 ----
NM_030762chr12----1504 --
NM_030763chrX1895 ------
NM_030780chr841725 650 604 354 ----1211
NM_030791chr141410 --1548 --
NM_030802chr171194 ------
NM_030805chr241176 1108 508 459 ------
NM_030806chr168672 6356 6274 6243 5944 2788 19295 28618 1512 --
NM_030808chr17176 1958 1102 --
NM_030809chr1231667 547 21 ------
NM_030810chr611420 1627 ----
NM_030820chr61284 ------
NM_030881chr2242088 779 626 82 ------
NM_030884chr372009 1997 742 619 288 255 29 --21806 718 12327
NM_030885chr3--1169 ----
NM_030912chr102821 97 ------
NM_030913chr14504 284 213 146 ------
NM_030915chr232277 1876 1823 --21719 635 --
NM_030918chr154553 3345 2129 1934 238 --15170 --
NM_030922chr151719 --1665 --
NM_030935chr7----157 --
NM_030937chr121397 1137 11263 ----
NM_030954chr83807 761 673 ------
NM_030958chr81196 ------
NM_030962chr11--1474 ----
NM_030964chr532669 776 644 --2430 32 --
NM_030978chr92440 167 ------
NM_030981chr1121055 852 --1154 --
NM_031205chr121380 --1122 --
NM_031216chr1832185 2083 1975 ------
NM_031266chr51103 ------
NM_031283chr21638 --1352 --
NM_031314chr1421446 54 ------
NM_031371chr1----1280 --
NM_031371chr1----1280 --
NM_031372chr411391 ------
NM_031407chrX1478 --1192 --
NM_031417chr1922306 318 --1110 --
NM_031418chr1122592 285 ----12001
NM_031426chr922202 160 ------
NM_031439chr82741 174 ------
NM_031442chrX2337 57 --1418 --
NM_031445chr242685 2577 1038 142 22700 1130 1838 --
NM_031453chr101166 ------
NM_031454chr221166 ------
NM_031469chr643571 3095 1372 224 1731 1386 --
NM_031483chr20--1667 22998 64 --
NM_031844chr123366 109 ------
NM_031845chr2--1309 ----
NM_031847chr2--1309 ----
NM_031858chr17----129 --
NM_031862chr17----129 --
NM_031922chr61501 ------
NM_031992chr731237 203 99 ------
NM_032013chr2031340 1205 618 --2578 157 --
NM_032017chr131621 1555 787 --11324 --
NM_032042chr512793 --1273 --
NM_032102chr1152126 2036 833 737 99 12213 ----
NM_032109chr54419 225 137 121 ----1199
NM_032121chrX51840 1055 887 725 412 ------
NM_032153chr33953 628 66 ----1388
NM_032160chr1833695 2849 2656 23258 2645 --11012
NM_032181chr2154 --138 --
NM_032182chr1021579 1211 11103 ----
NM_032192chr173624 562 99 ----1204
NM_032193chr1141981 1283 576 437 --2819 355 1678
NM_032195chr21------1389
NM_032199chr10--1159 13506 --
NM_032233chr142320 252 ------
NM_032246chr15179 ------
NM_032268chr1643109 2629 2517 2309 22271 719 12184 --
NM_032271chr1621517 225 --21043 94 --
NM_032287chr2282989 1617 1184 1113 1093 764 237 27 2840 707 ----
NM_032298chr191443 ------
NM_032301chr192208 89 --130 --
NM_032307chr92297 164 1340 1807 --
NM_032320chr111663 ------
NM_032321chr232905 2716 2010 --12819 --
NM_032373chr1034045 3911 305 ------
NM_032375chr194621 312 233 137 ------
NM_032382chr161469 --1121 --
NM_032389chr11----1193 --
NM_032410chr81368 ------
NM_032420chr5----1580 1680
NM_032429chr101411 ------
NM_032430chr19----1437 --
NM_032431chr111734 --1966 --
NM_032438chr611317 ------
NM_032440chr102405 288 ------
NM_032452chr14161 --11337 --
NM_032457chr433178 135 123 ----13259
NM_032458chrX1466 --11105 --
NM_032505chr311953 ------
NM_032510chr184998 641 508 199 1685 ----
NM_032514chr20188 --3445 330 284 --
NM_032521chr2062226 1108 1029 1017 983 729 12037 ----
NM_032552chr9125 1740 21382 1250 --
NM_032558chr91969 ------
NM_032560chr141437 ------
NM_032569chr1621562 744 --1345 --
NM_032578chr1021146 355 ------
NM_032590chr121418 ------
NM_032595chr1731451 1092 490 --1516 --
NM_032622chr411516 ------
NM_032631chr191139 ------
NM_032632chr141241 ------
NM_032638chr32573 188 ------
NM_032682chr323483 472 ------
NM_032711chr1793993 3613 3605 3318 2910 1610 1332 1171 1140 --13985 11679
NM_032731chr1721513 164 ------
NM_032737chr1932310 2197 1054 --32527 906 577 --
NM_032741chr61927 ------
NM_032765chr51376 ------
NM_032781chr11296 71 ------
NM_032784chr61786 ------
NM_032800chr152030 2014 1903 1764 390 --11778 22574 2215
NM_032827chr221124 156 1394 1221 --
NM_032833chr141841 1705 1679 266 ------
NM_032846chr142410 282 --11326 --
NM_032898chr32380 335 1423 ----
NM_032905chr1011046 ------
NM_032924chr72904 813 11022 ----
NM_032961chr41253 ------
NM_032968chrX13288 ------
NM_032969chrX13288 ------
NM_032973chrY13283 ------
NM_032982chr742516 1675 203 153 ------
NM_032998chr12185 106 ------
NM_033008chr32141 53 ------
NM_033009chr32141 53 ------
NM_033010chr32141 53 ------
NM_033016chr2221521 476 1118 1105 1419
NM_033017chr71647 ------
NM_033018chrX2456 96 --3444 432 142 1106
NM_033020chr123346 105 --14737 --
NM_033025chr191300 1821 ----
NM_033044chr11130 ------
NM_033058chr8----1146 --
NM_033089chr201372 ------
NM_033102chr1135 ----21230 216
NM_033102chr1135 ----21230 216
NM_033117chr9158 --162 --
NM_033129chr2041962 1632 458 188 ------
NM_033132chr131911 ------
NM_033133chr1753274 3164 2612 2594 2348 ------
NM_033138chr72336 200 1888 ----
NM_033139chr72336 200 1888 ----
NM_033140chr72336 200 1888 ----
NM_033141chr1452118 1981 1654 659 597 12161 11584 --
NM_033157chr72336 200 1888 ----
NM_033158chr3121 ------
NM_033161chr911331 1204 2277 24 --
NM_033181chr633102 2939 993 ------
NM_033185chr17--127 ----
NM_033224chr7116840 6704 5350 5229 5184 5108 2835 1730 1711 1675 1481 --17831 --
NM_033225chr832493 353 228 ------
NM_033259chr32620 165 ------
NM_033260chr61712 ------
NM_033274chr533186 357 94 --12962 --
NM_033284chrY150 ------
NM_033285chr8--13901 ----
NM_033309chr161101 ------
NM_033310chr11160 ------
NM_033326chr1121732 772 ----1864
NM_033360chr1224141 345 13152 ----
NM_033375chr1741456 974 598 581 --1518 --
NM_033389chr1754064 1669 1026 541 413 --24360 3810 --
NM_033396chr112363 137 --1382 --
NM_033420chr191189 --2946 30 --
NM_033425chr1162771 2681 2469 644 307 165 --11262 --
NM_033448chr122384 24 ------
NM_033449chr511444 21798 260 ----
NM_033496chr102702 27 ----1451
NM_033497chr102702 27 ----1451
NM_033498chr102702 27 ----1451
NM_033500chr102702 27 ----1451
NM_033503chr1523739 2780 --53155 2944 2517 1234 44 --
NM_033505chr255628 5167 5030 2461 754 --15121 15866
NM_033551chr532126 1008 955 ------
NM_033557chr19----175 --
NM_033624chr1221536 198 ------
NM_033626chrX51619 1486 1469 1333 319 ----11219
NM_033632chr431085 991 210 ------
NM_033642chrX--1483 ----
NM_033656chr21--11289 15138 --
NM_044472chr1--1233 ----
NM_052820chr92485 394 ------
NM_052840chr153470 190 137 176 11344 --
NM_052841chr1163 ------
NM_052879chr121519 ------
NM_052880chr222292 115 ------
NM_052896chr12126 43 1983 ----
NM_052897chr122789 782 ------
NM_052898chr821637 1382 ------
NM_052906chr22104990 4412 4248 3843 3353 3319 1659 1643 1389 1033 --24231 1075 --
NM_052907chr1233188 2943 1703 --1249 --
NM_052910chr1311577 ------
NM_052925chr194979 778 273 51 --1413 --
NM_052934chr14727 509 38 26 ------
NM_052936chrX--195 ----
NM_052937chr81639 12453 ----
NM_052954chr21145 ----1779
NM_052958chr81223 1306 ----
NM_052978chr1431439 497 104 ------
NM_053016chr998037 6602 5770 5712 5434 3145 2800 543 109 37545 7398 3188 ----
NM_053023chr1113141 ------
NM_053056chr1132901 2394 711 --12264 --
NM_053064chr14----1218 --
NM_054016chr141618 762 641 596 1684 ----
NM_054016chr141618 762 641 596 1684 ----
NM_054016chr141618 762 641 596 1684 ----
NM_054025chr1131792 867 831 ----1788
NM_054027chr542028 859 280 252 ------
NM_054033chr21435 ------
NM_057089chr72466 71 ------
NM_057169chr1253143 2903 2747 517 329 --11138 --
NM_057170chr1253143 2903 2747 517 329 --11138 --
NM_057175chr41610 ------
NM_057178chr171156 ------
NM_058164chr194290 284 146 120 --269 29 --
NM_058172chr421430 146 ------
NM_058237chr141837 ------
NM_058238chr224769 673 170 77 ------
NM_058243chr191178 ------
NM_078469chr101558 ------
NM_078471chr1731138 853 461 --150 --
NM_078483chr583987 3814 3546 2983 1459 1275 293 28 --1129 --
NM_078485chr6141 ------
NM_080415chr172931 640 ------
NM_080546chr9--1784 ----
NM_080552chr203557 190 94 ------
NM_080600chr19127 --1460 --
NM_080611chr201124 --1334 --
NM_080616chr202599 70 ------
NM_080645chr612162 --1485 --
NM_080647chr221458 --1380 --
NM_080654chr111142 ------
NM_080671chr252055 1923 1664 1630 197 --1352 --
NM_080679chr61170 --2687 633 --
NM_080680chr61170 --2687 633 --
NM_080681chr61170 --2687 633 --
NM_080738chr121727 1534 ------
NM_080743chr6129 ------
NM_080764chr2263234 3055 2610 1138 544 403 ------
NM_080792chr202788 340 --1277 --
NM_080872chr833931 2804 72 ------
NM_080881chr53596 144 79 --1100 --
NM_080927chr31199 ------
NM_130436chr2111750 ------
NM_130438chr2122327 398 ------
NM_130446chr381353 1266 1220 677 632 539 465 50 11334 ----
NM_130459chr921171 204 ------
NM_130766chr173828 193 55 ------
NM_130797chr711774 ------
NM_130799chr11----125 --
NM_130800chr11----125 --
NM_130801chr11----125 --
NM_130802chr11----125 --
NM_130803chr11----125 --
NM_130804chr11----125 --
NM_130811chr201427 ------
NM_130830chr373847 3836 3130 1409 880 417 68 1153 11382 --
NM_133170chr2035827 5316 2339 --12861 1110
NM_133171chr20----1398 --
NM_133264chr1743824 2692 942 285 --11095 --
NM_133265chrX23547 1283 ------
NM_133330chr41186 --21206 57 1203
NM_133331chr41186 --21206 57 1203
NM_133335chr41186 --21206 57 1203
NM_133369chr52245 187 ----1391
NM_133378chr2--1660 ----
NM_133432chr2--1660 ----
NM_133437chr2--1660 ----
NM_133444chr1951525 1394 1219 1173 1085 --1439 1190
NM_133445chr943148 2813 2479 146 ------
NM_133468chr731946 495 376 --1380 --
NM_133478chr241758 837 747 279 2925 790 1313 --
NM_133499chrX3956 796 716 --1890 --
NM_133507chr121363 ------
NM_133638chr521230 132 ------
NM_133646chr235110 3806 1786 1237 ----
NM_133647chr1583347 3280 3261 2856 2761 2617 2591 1513 1249 ----
NM_134265chr1721007 928 ------
NM_134268chr172915 849 --1190 --
NM_134325chr13548 262 44 ------
NM_134442chr231666 1531 188 ----1122
NM_138286chr1921399 1219 12665 14006 --
NM_138288chr1421470 1382 --1410 --
NM_138316chr1021329 1315 ------
NM_138328chr1753253 2183 961 596 59 --12190 11215
NM_138335chr4----1274 --
NM_138338chr2253416 3369 2775 2146 2139 1945 22493 893 --
NM_138350chr121396 462 --11155 --
NM_138357chr10--11233 ----
NM_138370chr23670 245 55 ------
NM_138376chr14----1132 --
NM_138396chr121284 ------
NM_138415chr224738 717 567 402 --1280 --
NM_138423chr1542237 1998 520 494 ------
NM_138426chr71329 ------
NM_138444chr1331526 835 286 --2735 731 --
NM_138457chr6103209 3143 2652 2526 2489 1056 957 742 463 275 --12161 --
NM_138473chr1254364 4068 3699 3136 726 --1774 --
NM_138477chr153645 54 21 --1149 --
NM_138479chr112051 --21522 285 --
NM_138576chr1414797 ------
NM_138621chr243757 3414 1366 469 --1839 --
NM_138713chr1648048 7592 6501 1386 12133 ----
NM_138714chr1648048 7592 6501 1386 12133 ----
NM_138729chr1----131 --
NM_138732chr112238 107 ------
NM_138734chr112238 107 ------
NM_138735chr2----1497 --
NM_138736chr16134244 4220 4068 3907 3255 1616 1600 1387 1332 979 971 543 442 --136 --
NM_138775chr111721 --1543 --
NM_138782chr512240 ------
NM_138795chr151600 1591 561 253 229 ------
NM_138799chr222105 1939 ------
NM_138959chr174997 4746 1418 1118 502 322 304 ------
NM_138966chr181109 ------
NM_138967chr1572134 2079 1531 984 970 927 568 11748 --12450
NM_138969chr82510 359 ------
NM_138981chr4133 --2146 142 --
NM_138992chr213975 306 76 ------
NM_139015chr1211571 11503 11441 --
NM_139045chr91323 ------
NM_139046chr10136 ------
NM_139058chrX1127 1315 ----
NM_139070chr51155 ------
NM_139071chr1251486 1411 1048 230 78 --161 --
NM_139125chr33580 462 27 --11019 --
NM_139132chr112762 61 ------
NM_139135chr11268 ------
NM_139155chr101121 --1367 --
NM_139161chr191177 --1341 --
NM_139167chr8----151 --
NM_139182chr421748 509 ------
NM_139207chr12----1394 --
NM_139211chr4162 ------
NM_139212chr4162 ------
NM_139215chr17165 ------
NM_139245chr3124 --1621 --
NM_139316chr71884 ------
NM_139323chr2021884 1482 11797 ----
NM_144498chr202748 194 ------
NM_144499chr3155 --11178 --
NM_144568chr142117 26 ------
NM_144571chr416831 ------
NM_144578chr1434678 3795 145 --14514 --
NM_144583chr211728 ------
NM_144586chr21315 2498 435 ----
NM_144593chr12125 ------
NM_144595chr13--1183 ----
NM_144600chr1631069 330 304 ------
NM_144633chr3--1367 ----
NM_144653chr9--1112 ----
NM_144667chr123982 457 277 --1179 --
NM_144767chr1574278 3762 3339 1805 518 491 30 --34291 3922 1268 --
NM_144778chr132906 641 ------
NM_144949chr22477 38 ------
NM_144963chr822277 36 ------
NM_144967chrX1718 ------
NM_145055chr1861479 1384 913 796 562 296 ----12425
NM_145113chr141189 ------
NM_145159chr141650 --3678 671 56 --
NM_145166chr321910 70 ----1142
NM_145173chr192769 51 --12473 --
NM_145185chr1921827 462 12022 21722 81 --
NM_145204chr15--183 ----
NM_145206chr1043277 2666 2096 381 --23146 2925 1519
NM_145239chr164409 234 194 49 ------
NM_145245chr1921112 267 --11220 --
NM_145253chr165651 640 556 242 155 --2668 655 --
NM_145263chr4182 --12118 --
NM_145265chr5------1149
NM_145276chr192969 326 --1384 --
NM_145296chr193633 165 138 ------
NM_145305chrX11030 ------
NM_145313chr1021130 489 --1368 --
NM_145330chr2141 ------
NM_145331chr61122 ------
NM_145349chr1792042 1996 1907 1861 1835 1616 513 229 220 ------
NM_145350chr1751394 1348 1259 1213 1187 ------
NM_145638chr111857 ----1968
NM_145686chr232738 2108 847 ------
NM_145687chr232738 2108 847 ------
NM_145690chr841721 1429 340 25 ------
NM_145698chr1011372 11633 11457 --
NM_145798chr178865 815 770 628 579 260 92 47 ------
NM_145802chrX1704 ------
NM_145805chr15196 ------
NM_145808chr732154 514 464 --161 --
NM_145859chr3151 ------
NM_145860chr3151 ------
NM_145861chr121727 1534 ------
NM_145888chr191777 --1199 --
NM_145912chr2243758 2920 1146 329 --23781 1650 13838
NM_146388chr192941 140 ------
NM_147192chr131596 565 136 --2405 196 --
NM_147202chr972581 2299 1090 628 598 286 85 --189 --
NM_147204chr121166 1395 ----
NM_147223chr241708 610 565 556 ------
NM_147233chr241525 427 382 373 ------
NM_148894chr41336 ------
NM_148918chr17----150 --
NM_148955chr15106156 5578 5209 4600 4463 2417 948 559 94 40 15648 ----
NM_148960chr121737 1316 21914 1467 1784 --
NM_148977chr1021329 1315 ------
NM_148978chr1021329 1315 ------
NM_152233chr1421629 35 ------
NM_152237chr2231582 1126 75 --31222 651 401 --
NM_152240chr341277 1156 1022 856 --138 --
NM_152253chr2243614 2889 2865 26 --33573 3155 2702 13397
NM_152263chr1155911 5799 5670 5644 4986 4853 4117 4029 2280 2220 1411 1157 1115 1069 760 --21420 481 --
NM_152271chr8170 ------
NM_152272chr821071 213 --11198 11227
NM_152280chr162991 2895 2757 2659 2620 471 ------
NM_152335chr151407 --1127 --
NM_152344chr1711505 ------
NM_152346chr175445 333 272 141 103 --31042 369 34 1412
NM_152348chr172846 617 ------
NM_152380chr121218 225 ------
NM_152384chr23506 488 295 --41711 826 802 746 1477
NM_152388chr213871 ------
NM_152390chr21107 ------
NM_152399chr4136 ------
NM_152410chr61353 ------
NM_152414chr811436 ------
NM_152420chr92670 618 ------
NM_152422chr931745 1591 1181 ------
NM_152424chrX43625 3114 2939 1674 --24692 543 --
NM_152440chr1231083 1031 774 1964 ----
NM_152441chr121525 --1104 --
NM_152470chr1843659 1080 1052 573 1541 23615 217 --
NM_152475chr1952565 1861 1676 1042 42 ------
NM_152487chr13497 308 171 1351 ----
NM_152493chr11559 11305 1155 --
NM_152519chr211882 11479 ----
NM_152534chr31112 ------
NM_152545chr4----121 --
NM_152550chr5161 ------
NM_152563chr1131304 1179 1112 ------
NM_152594chr15199 ------
NM_152605chr1911320 ------
NM_152622chr521360 680 ------
NM_152624chr531928 1798 780 ------
NM_152629chr933812 2851 412 --1749 --
NM_152636chr1122978 2328 12371 ----
NM_152660chr1----1879 --
NM_152663chr11256 ------
NM_152667chr2031313 1216 1010 ------
NM_152682chr411138 ------
NM_152688chr61764 ------
NM_152695chrX2818 525 ------
NM_152699chr383507 2975 2935 2929 2793 2767 2389 1109 --12344 --
NM_152704chr131371 ------
NM_152721chr18173 --152 --
NM_152724chr1032342 2297 2207 12250 ----
NM_152733chr686339 6089 5349 4311 2390 1400 1181 1119 --25506 1152 --
NM_152739chr72193 74 ------
NM_152740chr71152 ------
NM_152745chr72809 92 ------
NM_152754chr732747 2692 1162 ------
NM_152789chr721401 177 ------
NM_152793chr775191 4688 3485 3285 1355 858 206 --33191 1733 821 --
NM_152826chr15106156 5578 5209 4600 4463 2417 948 559 94 40 15648 ----
NM_152835chr142029 1022 852 479 ------
NM_152836chr811715 ------
NM_152837chr811715 ------
NM_152838chr2013491 ------
NM_152888chr8------1982
NM_152988chr1981612 1216 682 672 508 316 204 89 --31686 1539 57 11569
NM_152998chr7140 ------
NM_152999chr744954 4807 2016 1854 --11483 --
NM_153020chr621389 342 ------
NM_153026chr122432 414 ----151
NM_153050chr2263793 3761 3532 1563 1367 214 --1310 --
NM_153051chr2263793 3761 3532 1563 1367 214 --1310 --
NM_153181chr181109 ------
NM_153184chr32214 91 ------
NM_153186chr91198 196 ----
NM_153188chr524061 1396 22239 1769 ----
NM_153223chr511485 ------
NM_153235chr6134 ------
NM_153247chr721006 90 1710 31131 1070 423 --
NM_153257chr1931266 1178 1052 ------
NM_153260chr151939 --1325 --
NM_153262chr11676 1684 ----
NM_153273chr331720 618 244 --12784 --
NM_153280chrX1151 ------
NM_153330chr3123 ------
NM_153331chr32651 203 ------
NM_153332chr863182 2812 2509 1131 728 539 --12531 --
NM_153350chr162396 84 --1336 --
NM_153354chr51391 ------
NM_153365chr432688 2408 1016 --1246 11846
NM_153367chr1053969 2424 768 727 315 --1411 --
NM_153371chr132711 551 ------
NM_153377chr121345 ------
NM_153426chr41459 ------
NM_153427chr41459 ------
NM_153450chr112674 652 ------
NM_153456chr1355454 2364 2077 1151 172 --25626 2398 --
NM_153498chr102589 325 ------
NM_153499chr1222713 139 --21082 105 --
NM_153500chr1222713 139 --21082 105 --
NM_153607chr522877 472 ------
NM_153616chr15193 1197 ----
NM_153617chr15193 1197 ----
NM_153618chr15193 1197 ----
NM_153619chr1521331 449 11435 ----
NM_153631chr711039 ------
NM_153632chr711039 ------
NM_153645chr2242790 907 388 203 ------
NM_153649chr171642 1505 1480 1434 781 452 171 ----155
NM_153698chr9159 ------
NM_153712chr263581 2439 1152 1023 415 22 23742 2624 --11054
NM_153715chr71915 --1461 --
NM_153819chr11137 ------
NM_153827chr171214 ------
NM_153832chr11656 --168 --
NM_170607chr1731405 1010 274 --1533 --
NM_170609chr62459 335 ------
NM_170663chr171214 ------
NM_170665chr12133841 3557 3519 3252 3243 2930 2844 1544 1477 1468 1414 668 658 12866 1594 --
NM_170686chr721191 505 --1586 --
NM_170696chr1521225 40 ------
NM_170697chr1521225 40 ------
NM_170706chr12279 68 13477 ----
NM_170707chr13726 643 288 ------
NM_170708chr13726 643 288 ------
NM_170710chr412666 ------
NM_170711chr192332 197 ------
NM_170743chr182460 2323 991 925 701 674 151 43 ------
NM_170751chr631329 436 117 ------
NM_170752chr631329 436 117 ------
NM_171825chr552672 2561 2385 2255 523 ----1305
NM_171998chrX2847 758 1170 ----
NM_172058chr82611 145 --1109 --
NM_172059chr82611 145 --1109 --
NM_172060chr82611 145 --1109 --
NM_172071chr146784 4859 2305 858 11321 ----
NM_172078chr7----174 --
NM_172079chr7----174 --
NM_172080chr7----174 --
NM_172081chr7----174 --
NM_172082chr7----174 --
NM_172083chr7----174 --
NM_172084chr7----174 --
NM_172103chr6------1338
NM_172105chr6------1338
NM_172163chr1------1142
NM_172216chr1222615 41 --1984 --
NM_172225chr131596 565 136 --2405 196 --
NM_172226chr1222713 139 --21082 105 --
NM_172230chr111734 --1966 --
NM_172236chr202621 167 ------
NM_172387chr181569 ----11394
NM_172388chr181616 ----11441
NM_172389chr181616 ----11441
NM_173064chr182460 2323 991 925 701 674 151 43 ------
NM_173074chr2155 ------
NM_173075chr411692 ------
NM_173156chr122073 278 ------
NM_173172chr211508 ------
NM_173174chr8162 --3256 43 24 --
NM_173175chr8162 --3256 43 24 --
NM_173176chr8162 --3256 43 24 --
NM_173199chr91494 --1458 --
NM_173214chr1648048 7592 6501 1386 12133 ----
NM_173468chr432155 1697 1185 ------
NM_173470chrX12861 ------
NM_173475chr1631432 1401 122 ------
NM_173492chr9183 ------
NM_173510chr2242394 1921 929 764 ------
NM_173511chr223944 1512 ------
NM_173515chr6----128 --
NM_173527chr142770 105 ------
NM_173552chr31427 ------
NM_173567chr11223 ------
NM_173576chr101551 ------
NM_173595chr12115073 4977 4589 4321 4199 3914 3732 1225 1040 417 268 --14728 --
NM_173602chr1243187 3105 3009 776 13818 ----
NM_173633chr19----148 --
NM_173642chr1117430 6669 6231 6011 5952 2960 2839 2726 2309 2127 728 29146 8075 19081 27814 2512
NM_173681chr741956 1821 477 315 1271 ----
NM_173683chr81465 --11551 --
NM_173694chrX2424 24 ------
NM_173797chr511132 ------
NM_173808chr124097 126 ------
NM_173829chr51661 14654 16009 --
NM_173851chr823951 3261 --13836 --
NM_174856chr201295 ------
NM_174911chr842514 1558 819 285 ------
NM_174921chr421076 802 ------
NM_174938chr9168 ------
NM_174963chr12840 149 --1718 --
NM_174964chr12840 149 --1718 --
NM_174965chr12859 168 --1737 --
NM_174966chr12840 149 --1718 --
NM_174967chr12859 168 --1737 --
NM_174968chr12840 149 --1718 --
NM_174969chr12840 149 --1718 --
NM_174970chr12859 168 --1737 --
NM_174971chr12840 149 --1718 --
NM_175056chr3--11451 --176
NM_175061chr722211 746 ------
NM_175623chr1255289 5155 2880 2108 1225 25650 24 --15413
NM_175630chr21309 ------
NM_175733chr1142180 1645 1498 623 ------
NM_175736chr1287116 5320 3136 2998 2820 2655 2532 1667 --45682 5620 2542 1861 --
NM_175748chr141803 ------
NM_175854chr1322376 750 ------
NM_175859chrX----136 --
NM_175876chr121096 679 ------
NM_175898chr1551282 1256 511 340 92 --11078 --
NM_175920chr5165 ------
NM_175931chr1661663 1566 1491 211 92 78 ----1119
NM_176792chr1011427 ------
NM_176812chr201222 ------
NM_176814chr71193 ------
NM_176823chr143847 1514 252 227 ------
NM_176871chr842283 632 499 219 --13169 1645
NM_177438chr1434266 3289 3021 ------
NM_177539chr13872 653 241 --3591 339 35 1171
NM_177559chr20173 127 ----
NM_177560chr20173 127 ----
NM_177947chrX1226 ------
NM_177948chrX1226 ------
NM_177951chr141889 ------
NM_177968chr252171 2051 2006 1891 196 1304 ----
NM_177972chr1173266 2942 2829 923 622 76 51 13084 32805 59 55 --
NM_177974chr1542237 1998 520 494 ------
NM_177977chr172641 289 --1264 --
NM_177983chr2----1339 --
NM_177989chr31340 ------
NM_177991chr201124 --1334 --
NM_177995chr931745 1591 1181 ------
NM_177999chr983597 3505 2945 2820 2686 2278 497 156 --11120 23405 99
NM_178013chr1463000 2913 2632 2096 844 569 --2620 440 --
NM_178014chr63143 93 46 ------
NM_178034chr15--2351 278 ----
NM_178042chr31340 ------
NM_178126chr1761742 683 543 514 385 365 --1847 --
NM_178151chrX57636 5024 4857 4820 299 15302 ----
NM_178152chrX57636 5024 4857 4820 299 15302 ----
NM_178153chrX57636 5024 4857 4820 299 15302 ----
NM_178191chr111465 ------
NM_178270chrX--195 ----
NM_178313chr221513 376 ------
NM_178314chr123223 189 28 ------
NM_178423chr7----192 --
NM_178425chr7----192 --
NM_178426chr122301 845 --1587 --
NM_178427chr122201 745 --1487 --
NM_178441chr1421354 499 --1510 1542
NM_178493chr17192 ------
NM_178502chr12137 ------
NM_178509chr17--24121 1426 ----
NM_178539chr1211738 ------
NM_178554chr363477 2808 1139 1112 554 126 --33394 3145 1040 --
NM_178562chr72620 314 ------
NM_178580chr20128 ------
NM_178585chr4--1627 22756 470 12621
NM_178586chr1431840 1663 142 ------
NM_178815chr1031992 511 272 11875 2671 423 --
NM_178835chr41574 --1189 --
NM_178839chr2143 ------
NM_178841chr162295 29 --3968 199 23 --
NM_178860chr17----1161 --
NM_178863chr16121 ------
NM_178864chr111512 --1636 --
NM_180976chr61259 ------
NM_180977chr61259 ------
NM_181054chr141987 ------
NM_181265chr412666 ------
NM_181310chr621257 1201 ------
NM_181332chrX12284 --11886 --
NM_181351chr113921 841 784 --11037 --
NM_181356chr62420 22 ------
NM_181357chr1441779 1612 1339 51 31655 1382 340 ----
NM_181358chr111521 ------
NM_181442chr202282 91 ------
NM_181443chr2022178 182 160 ----
NM_181457chr2137 ------
NM_181481chr1836922 2689 2523 --15605 --
NM_181482chr1836922 2689 2523 --15605 --
NM_181483chr1836922 2689 2523 --15605 --
NM_181492chr22190 ------
NM_181504chr5--11107 ----
NM_181505chr173624 562 99 ----1204
NM_181509chr20188 --3445 330 284 --
NM_181521chr1665361 2902 1679 953 719 40 15163 25538 1777 15085
NM_181523chr5--11107 ----
NM_181524chr5--11107 ----
NM_181527chr20--1325 ----
NM_181528chr20--1380 ----
NM_181552chr71292 ------
NM_181670chr121388 ------
NM_181671chr171107 ------
NM_181672chrX1320 11497 ----
NM_181673chrX1320 11497 ----
NM_181782chr6195 ------
NM_181784chr231872 450 341 12442 ----
NM_181825chr224857 222 135 86 ------
NM_181843chr11142 --2254 50 --
NM_181844chr1731963 1807 180 ------
NM_182314chrX--1521 ----
NM_182481chr2131336 1173 50 ------
NM_182482chr2131336 1173 50 ------
NM_182488chr13133 ------
NM_182492chr221252 ------
NM_182509chr1441522 1087 394 170 --1203 --
NM_182546chr72156 62 ------
NM_182553chr113546 168 46 ------
NM_182557chr1141903 1559 1461 1415 --12222 --
NM_182580chr152119 1964 846 537 35 1301 --11954
NM_182606chr4--1886 ----
NM_182641chr171338 ------
NM_182643chr821908 23 ------
NM_182685chr12653 267 ------
NM_182687chr16----1198 --
NM_182688chr2162170 1856 1724 1642 819 685 1862 ----
NM_182697chr721453 1379 ------
NM_182700chr72678 395 ----1245
NM_182757chr621083 136 22871 2436 ----
NM_182779chr1------129
NM_182811chr201329 1915 1740 --
NM_182854chr161336 ------
NM_182898chr756028 4442 1486 1446 1034 2849 324 ----
NM_182899chr756028 4442 1486 1446 1034 2849 324 ----
NM_182907chr622253 60 ------
NM_182917chr34419 390 285 106 --2167 62 --
NM_182935chr31806 --1181 --
NM_182943chr311079 ------
NM_182976chr11789 ------
NM_183006chr2011402 --11482 --
NM_183057chr8169 182 1196 --
NM_183058chr10167 ------
NM_183078chr642616 1050 291 155 --13084 --
NM_183243chr71263 --2577 573 --
NM_183243chr71263 --2577 573 --
NM_183373chr6126 ------
NM_183377chr173631 321 143 ------
NM_183397chr2074943 4483 3999 3548 1729 1571 294 23658 1907 14755 14075
NM_183416chr12500 362 ------
NM_183419chr8----11163 --
NM_183422chr132412 77 ------
NM_183425chr202599 162 1708 31487 1209 448 --
NM_184085chr8----134 --
NM_184086chr8----134 --
NM_184087chr8----134 --
NM_184234chr201222 ------
NM_194071chr751701 960 701 413 346 24002 605 11120 --
NM_194248chr23759 331 41 --4960 769 407 352 --
NM_194278chr14103916 3513 3329 2905 2859 2716 2690 1326 748 102 --13935 --
NM_194282chr442631 1187 1053 1027 ------
NM_194285chr1122815 58 ------
NM_194286chr1252055 2021 1839 982 74 --16051 --
NM_194313chr941534 687 295 120 ------
NM_194314chr124023 1974 ------
NM_194322chr23759 331 41 --4960 769 407 352 --
NM_194356chr1252352 2014 1841 882 595 11697 ----
NM_197939chr172444 423 1868 1824 --
NM_197941chr511990 ------
NM_198040chr111095 --1903 --
NM_198056chr312029 --11914 --
NM_198066chr1432651 2527 2205 ------
NM_198074chr12448 421 ----11306
NM_198081chr63487 408 60 ------
NM_198147chr1711064 --1205 --
NM_198158chr352659 2376 602 489 346 ------
NM_198159chr352659 2376 602 489 346 ------
NM_198177chr352659 2376 602 489 346 ------
NM_198178chr352659 2376 602 489 346 ------
NM_198186chr91550 ------
NM_198187chr91550 ------
NM_198196chr342432 2076 1907 1819 2354 177 1869 --
NM_198204chr1731405 1010 274 --1533 --
NM_198205chr1731405 1010 274 --1533 --
NM_198216chr20----132 --
NM_198241chr34419 390 285 106 --2167 62 --
NM_198242chr34419 390 285 106 --2167 62 --
NM_198243chr152873 771 ------
NM_198244chr34419 390 285 106 --2167 62 --
NM_198264chr11482 ------
NM_198268chr111521 ------
NM_198269chr111521 ------
NM_198270chrX22868 326 --122 --
NM_198281chr453360 2252 1374 702 344 13320 ----
NM_198291chr2031817 1697 561 --4456 452 86 82 --
NM_198320chr1264958 4898 3600 1440 1302 309 43783 1483 1044 601 25065 5055 --
NM_198324chr1211061 --21248 203 --
NM_198334chr11171 ------
NM_198335chr11171 ------
NM_198390chr1621193 585 ------
NM_198391chr20--1212 ----
NM_198396chr172411 126 ------
NM_198399chr311590 ------
NM_198427chr12497 333 --1310 --
NM_198467chr71143 ------
NM_198468chr674312 4119 2948 2821 2795 352 344 ------
NM_198485chr3--1268 ----
NM_198503chr11566 ------
NM_198513chr821285 139 ------
NM_198516chr11263 26 ------
NM_198521chr12153 ------
NM_198525chr15122 --163 --
NM_198527chr151495 ------
NM_198560chr363171 3047 2433 1146 405 51 --23565 374 13183
NM_198563chr31140 ------
NM_198581chr2147290 6553 6519 6496 5758 5712 5576 5551 5430 5221 5084 4950 4924 1535 ----1283
NM_198681chr181327 1256 1044 1004 998 131 91 55 ------
NM_198834chr173742 735 56 ------
NM_198836chr173742 735 56 ------
NM_198837chr173742 735 56 ------
NM_198838chr173742 735 56 ------
NM_198839chr173742 735 56 ------
NM_198880chr3--1635 ----
NM_198900chr1287116 5320 3136 2998 2820 2655 2532 1667 --45682 5620 2542 1861 --
NM_198935chr203626 190 120 ------
NM_198956chr72678 395 ----1245
NM_198968chr1333751 2706 93 13099 ----
NM_198993chr172383 42 ------
NM_199000chr7--199 ----
NM_199003chr811130 ------
NM_199005chr9------1235
NM_199040chr1263786 1392 1380 1346 1320 88 --11475 --
NM_199054chr1941663 1623 1522 622 --61456 1452 798 672 540 107 --
NM_199131chr1081423 954 877 769 605 240 83 34 1693 ----
NM_199132chr1931751 1571 1348 ------
NM_199138chr131371 ------
NM_199144chr203509 396 375 11605 ----
NM_199160chr921829 1281 ------
NM_199169chr201819 1717 23366 2984 13371
NM_199170chr201819 1717 23366 2984 13371
NM_199171chr201819 1717 23366 2984 13371
NM_199183chr3127 ------
NM_199185chr5139 ------
NM_199188chr121519 ------
NM_199190chr121519 ------
NM_199191chr2170 --285 39 --
NM_199194chr2170 --285 39 --
NM_199203chr203509 396 375 11605 ----
NM_199229chr211712 ------
NM_199245chr1211629 --7861 648 365 65 61 57 53 --
NM_199262chr1741986 1975 412 243 --12253 --
NM_199320chr412580 ------
NM_199320chr412580 ------
NM_199324chr422919 2802 ------
NM_199327chr41843 ------
NM_199330chr151554 ------
NM_199331chr151554 ------
NM_199332chr151554 ------
NM_199334chr171463 ------
NM_199355chr16169 ------
NM_199414chr15--1761 1973 --
NM_199436chr232912 1185 1133 ------
NM_199461chr1053637 2393 2348 2265 1020 11107 1618 --
NM_199462chr164901 4225 1773 846 800 712 1889 ----
NM_199478chrX21242 544 ------
NM_199482chr21238 ------
NM_199487chr2021145 64 1523 ----
NM_201267chr2184 ------
NM_201278chr1122246 2122 ------
NM_201280chr641583 1235 1190 576 --11587 --
NM_201281chr1122246 2122 ------
NM_201378chr83874 766 207 --2759 322 --
NM_201379chr83874 766 207 --2759 322 --
NM_201380chr83874 766 207 --2759 322 --
NM_201381chr83874 766 207 --2759 322 --
NM_201382chr83874 766 207 --2759 322 --
NM_201383chr83874 766 207 --2759 322 --
NM_201384chr83874 766 207 --2759 322 --
NM_201412chr161203 ------
NM_201413chr2121039 123 1159 ----
NM_201414chr2121039 123 1159 ----
NM_201434chr17130 ----141
NM_201516chr71931 ------
NM_201520chr1751460 1415 1273 556 403 11509 ----
NM_201535chr141782 ------
NM_201536chr141782 ------
NM_201537chr141782 ------
NM_201538chr141782 ------
NM_201539chr141782 ------
NM_201540chr141782 ------
NM_201541chr141782 ------
NM_201568chr122073 278 ------
NM_201569chr122073 278 ------
NM_201574chr22250 179 ------
NM_201599chrX51180 1002 810 412 139 ------
NM_201624chr13937 513 333 ------
NM_201632chr541415 512 242 58 --21181 465 1366
NM_201634chr541514 611 341 157 --21280 564 1465
NM_201998chr112688 555 ------
NM_201999chr42837 207 ------
NM_203301chr141301 ------
NM_203304chr191170 --1273 --
NM_203316chr11182 ------
NM_203318chr1731138 853 461 --150 --
NM_203327chr2054027 2809 1616 425 181 1166 33899 2913 1297 --
NM_203342chr111385 ----11066
NM_203343chr111385 ----11066
NM_203346chr262090 1732 1581 1479 798 148 11978 ----
NM_203350chr1--1352 ----
NM_203351chr172641 593 --22292 624 1978
NM_203364chr1111237 11225 ----
NM_203372chr21594 ------
NM_203417chr211425 ------
NM_203418chr211425 ------
NM_203434chr921105 974 ------
NM_203459chr1161 ------
NM_203463chr214733 13563 ----
NM_203464chr121162 181 ------
NM_203473chrX2274 212 ------
NM_203474chrX2274 212 ------
NM_203475chrX2274 212 ------
NM_203476chrX2274 212 ------
NM_203487chr1311299 ------
NM_203504chr4----1358 --
NM_203505chr4----1358 --
NM_203506chr1792030 1873 1822 1396 902 741 653 527 75 1825 ----
NM_205767chr19----121 --
NM_205768chr121596 1373 ------
NM_205860chr143034 2893 2811 2543 ------
NM_206594chr113315 --31393 330 326 --
NM_206595chr113315 --31393 330 326 --
NM_206833chr192753 576 --1516 --
NM_206853chr613463 ------
NM_206854chr614724 ------
NM_206855chr625689 859 1949 ----
NM_206907chr523023 604 ------
NM_206909chr857992 5649 5469 2026 1842 15295 ----
NM_207009chr10----1206 1386
NM_207171chr1--21734 201 11992 --
NM_207299chr91379 ------
NM_207303chr1023872 578 1361 ----
NM_207304chr132793 528 ------
NM_207306chr144045 2857 2831 241 11789 24355 84 --
NM_207321chr1021072 80 ------
NM_207325chr1911629 ------
NM_207366chr73427 260 170 ------
NM_207371chr101979 --11111 --
NM_207396chr15479 383 337 201 175 1236 ----
NM_207397chr11814 1702 ----
NM_207429chr112497 471 --1627 --
NM_207435chr122298 188 ------
NM_207481chr2------1344
NM_207518chr1911107 --31081 479 291 --
NM_207577chr112599 115 --12608 --
NM_212460chr731901 326 88 ------
NM_212461chr12----152 --
NM_212464chr1531838 1819 124 11564 2763 315 --
NM_212471chr172758 697 --2620 506 --
NM_212472chr172758 697 --2620 506 --
NM_212551chr121017 101 ------
NM_213606chr1041926 1880 1792 882 11969 ----
NM_213613chr42215 59 ------
NM_213648chr541415 512 242 58 --21181 465 1366
NM_213662chr1782274 1815 1769 1751 838 792 708 473 1881 31980 1744 490 --