TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3938
miRNA Sequence: AAUUCCCUUGUAGAUAACCCGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000337chr576560 5151 1727 1487 1394 848 445 --45111 4456 1366 433 --
NM_000719chr12216078 5843 5815 4683 4380 4368 4307 4284 2584 2431 2231 2066 1789 1783 1490 1360 802 644 521 487 441 --26586 4518 15574
NM_000926chr1197590 6811 6627 6384 3577 2199 1234 947 932 16318 18919 12347
NM_001001669chr5132436 2308 2264 2172 1783 884 873 765 677 615 556 101 68 12757 2841 685 12363
NM_001004304chr12153131 2810 2763 2653 2517 2450 1171 1091 829 694 356 234 207 149 27 13134 1362 --
NM_001005473chr5136424 6010 1887 1443 1058 1038 1014 973 961 949 706 410 137 --11782 26031 110
NM_001008220chr5183850 3776 3729 3585 3381 3137 3098 3024 2981 2747 1441 1137 1118 1108 833 466 220 94 --1459 --
NM_001014797chr10147957 7588 7173 6939 6919 6901 6773 6645 6066 5293 5204 811 644 564 16680 ----
NM_001037165chr7178913 8056 7964 7772 7481 6795 6760 6698 5986 3540 3419 2665 2332 1650 1614 230 23 15597 ----
NM_001039937chr1343527 3518 762 386 --21483 906 23784 2691
NM_001040284chr1694992 4921 4765 2274 2028 658 437 393 217 11464 --1333
NM_001040712chr9113141 2995 2976 2637 2561 1312 1083 861 469 463 280 --1475 --
NM_001044385chr273459 1438 1352 1158 719 667 389 23893 722 1541 1219
NM_001100108chr1138110 7426 6898 6877 6396 1922 1345 1140 1009 449 259 50 43 27735 1273 ----
NM_001106chr3168903 8498 8401 8220 6366 3747 3588 3439 3342 3278 3033 2726 2082 1032 751 640 --21608 1047 --
NM_001113490chrX63412 2685 2539 2408 1415 1405 --4783 601 532 108 31100 493 196
NM_002270chr594323 4216 716 429 335 164 105 81 64 ----1125
NM_002839chr9113141 2995 2976 2637 2561 1312 1083 861 469 463 280 --1475 --
NM_002886chr3125129 4650 4613 4069 3870 3798 3579 3177 1773 797 375 354 13515 --15078
NM_003099chr15165525 5497 5322 4975 4961 4900 4763 4741 4388 4288 4281 3993 1400 1102 618 443 56125 5196 4537 2330 324 16297 --
NM_003108chr2186999 6521 5917 5232 4689 2683 2380 2372 2364 2298 2222 1789 1687 992 707 659 420 138 --1526 --
NM_003559chr17113870 3794 3581 3470 2552 1507 710 181 65 58 51 1713 ----
NM_004098chr1061082 369 294 137 121 55 --1128 --
NM_004397chr11114150 3987 3923 3830 3398 3376 3097 304 274 268 64 13019 11085 --
NM_004898chr492571 2241 1922 1787 1098 942 809 84 32 --2316 41 --
NM_005477chr1571672 1664 760 313 243 236 222 --32129 1755 1677 --
NM_005477chr1571672 1664 760 313 243 236 222 --32129 1755 1677 --
NM_005840chrX117367 6752 6343 5905 5317 4946 2986 2024 2017 772 138 15943 16999 1450
NM_005938chrX111401 1241 1209 1152 1141 1006 988 973 209 202 191 --1480 --
NM_006237chr1372198 272 264 257 232 213 122 ----11466
NM_006371chr3154700 4479 4255 4031 3438 2064 1839 1627 1418 1324 1297 1240 1157 1119 123 ----11247
NM_006546chr17196335 6044 5742 5635 5487 5435 5299 5041 4710 4686 4540 4476 4062 1949 1505 946 635 558 91 --12559 12601
NM_006650chr5183850 3776 3729 3585 3381 3137 3098 3024 2981 2747 1441 1137 1118 1108 833 466 220 94 --1459 --
NM_006729chrX55506 5466 4803 1236 707 ----35061 1274 951
NM_007050chr20177703 7242 6990 6258 5855 5511 3222 3041 2917 2034 1939 1764 1556 1293 963 738 359 ----15217
NM_007249chr13109153 7428 6239 3524 2582 2496 1783 1260 1246 883 28561 3043 28810 3146 --
NM_012141chr1343527 3518 762 386 --21483 906 23784 2691
NM_012296chr11133459 3216 3183 3079 1202 1179 1063 1014 901 710 631 612 333 1967 2978 457 12955
NM_012316chr1145282 3893 3831 3783 3446 2181 1415 791 783 740 484 224 163 21 11809 127 --
NM_012334chr5124559 4297 3985 3861 1441 659 492 476 453 348 262 135 11611 1464 --
NM_013411chr1102691 1880 1026 590 569 562 436 213 111 81 --1575 --
NM_014586chr21134497 4401 4308 4104 3959 3825 3711 3627 3491 3251 964 406 296 13385 24440 1692 --
NM_014935chr1153723 3450 3265 3121 3047 1401 1322 1214 987 831 791 653 308 142 131 ----1845
NM_015035chr20176645 6578 6444 6223 6091 5904 5718 5316 4994 4832 4788 4767 2602 1641 757 498 453 34563 2109 1872 ----
NM_015039chr1114189 3761 3663 3455 2983 2719 2709 1457 1438 246 238 --1227 --
NM_015879chr18138145 7418 7330 7314 6398 6315 5957 5291 3368 3026 2933 2281 1853 --1222 --
NM_016260chr277063 5439 3007 2487 1590 249 21 1210 37544 2041 1294 --
NM_017637chr9119389 8797 8780 7896 7602 6885 6582 3214 2182 1863 423 13692 38981 7084 843 --
NM_020205chr1133306 3185 2193 2164 1397 1391 766 636 621 452 319 251 91 ----13065
NM_020774chr1845130 3841 1916 1345 14195 --2598 503
NM_021116chr7239104 8171 8161 8141 6886 6717 5799 3349 2835 2785 2740 2490 1975 1808 1631 1329 1301 1276 1087 283 207 107 42 ----12504
NM_021202chr2072823 2386 2052 1030 751 695 673 --2768 687 --
NM_022648chr2214431 4016 3956 3947 3583 3215 3194 3164 3154 3077 1217 1147 732 414 371 353 168 161 144 55 36 11744 12996 --
NM_024947chr389048 8720 3632 2918 2786 1615 752 696 12236 16948 16977
NM_025160chr174145 3416 2923 2880 1705 1694 1681 34148 3112 1515 ----
NM_031417chr19142612 2405 2320 2288 2139 2129 2111 999 679 636 570 350 337 193 --1355 --
NM_033224chr767416 6502 6435 119 106 98 17616 --25773 322
NM_052906chr22224641 4485 4347 4138 4109 4022 3704 3524 3240 3110 2039 1904 1766 1466 1152 1048 825 709 520 453 429 58 23794 3722 24211 542 --
NM_080491chr11133459 3216 3183 3079 1202 1179 1063 1014 901 710 631 612 333 1967 2978 457 12955
NM_130391chr9113141 2995 2976 2637 2561 1312 1083 861 469 463 280 --1475 --
NM_130392chr9113141 2995 2976 2637 2561 1312 1083 861 469 463 280 --1475 --
NM_130393chr9113141 2995 2976 2637 2561 1312 1083 861 469 463 280 --1475 --
NM_130446chr3153898 3762 3675 3526 3285 3141 3049 2774 2738 2687 1045 896 344 212 141 --22779 118 13544
NM_133170chr20177703 7242 6990 6258 5855 5511 3222 3041 2917 2034 1939 1764 1556 1293 963 738 359 ----15217
NM_133265chrX63412 2685 2539 2408 1415 1405 --4783 601 532 108 31100 493 196
NM_138473chr12114689 4400 4171 3871 3865 3773 3282 1553 1424 1406 1400 11747 1876 --
NM_148955chr15165525 5497 5322 4975 4961 4900 4763 4741 4388 4288 4281 3993 1400 1102 618 443 56125 5196 4537 2330 324 16297 --
NM_152263chr1135950 5047 4354 3927 3831 3798 2056 2034 2021 1740 1541 271 52 ------
NM_152388chr273459 1438 1352 1158 719 667 389 23893 722 1541 1219
NM_152424chrX184751 4568 4498 4247 4177 4146 3978 3386 3366 3242 2912 1481 1185 1091 1031 548 209 52 14442 21799 1139 --
NM_152826chr15165525 5497 5322 4975 4961 4900 4763 4741 4388 4288 4281 3993 1400 1102 618 443 56125 5196 4537 2330 324 16297 --
NM_153188chr594323 4216 716 429 335 164 105 81 64 ----1125
NM_153335chr174149 143 137 45 --1887 --
NM_153456chr13116233 4911 4618 4501 3998 2277 1718 1642 702 685 677 --24592 3875 11355
NM_170706chr1114189 3761 3663 3455 2983 2719 2709 1457 1438 246 238 --1227 --
NM_173642chr1139002 8305 7184 7016 6598 6437 6418 6399 3504 3497 3071 1076 542 --28191 8002 --
NM_175736chr12135760 5748 3063 2731 2717 2660 2445 1852 1841 1059 1019 719 420 26505 957 24909 785 11443
NM_175907chr1881750 843 735 537 285 222 176 29 12072 --12224
NM_181491chr9142953 2914 2793 2307 2279 2064 2057 1261 1253 766 745 502 493 259 --21028 520 --
NM_198900chr12135760 5748 3063 2731 2717 2660 2445 1852 1841 1059 1019 719 420 26505 957 24909 785 11443