TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3939
miRNA Sequence: UACGCGCAGACCACAGGAUGUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000074chrX1346 ------
NM_000088chr1711085 ------
NM_000092chr233036 912 901 ------
NM_000094chr31111 --1113 --
NM_000141chr101296 1258 ----
NM_000161chr14----122 --
NM_000188chr102576 172 ------
NM_000192chr12--1372 ----
NM_000259chr15----24785 4717 --
NM_000264chr932110 593 516 --2617 615 --
NM_000278chr1022241 273 ------
NM_000334chr17----11524 --
NM_000391chr111707 ------
NM_000461chr312993 --43021 3015 3001 2999 --
NM_000462chr151258 ------
NM_000679chr52388 324 --3355 334 332 --
NM_000767chr191600 ------
NM_000817chr2----11206 --
NM_000818chr10189 ------
NM_000841chr6156 ------
NM_000870chr5173 ------
NM_000875chr1532405 1385 39 ------
NM_001001502chr51543 ------
NM_001001549chr7--12693 167 --
NM_001001550chr7--12693 167 --
NM_001001555chr7--12693 167 --
NM_001001795chr81116 --2748 288 --
NM_001001890chr2123978 1426 ------
NM_001002032chr171622 ------
NM_001002860chr141984 --12982 --
NM_001002876chr221383 --130 --
NM_001003652chr181390 ------
NM_001003792chr3----1876 --
NM_001003793chr3----1876 --
NM_001003800chr9----21395 1321 --
NM_001004317chr611781 ------
NM_001004342chr1----11596 --
NM_001004354chr931001 132 79 ------
NM_001005404chr1733767 3065 1729 --43553 3551 1543 1541 --
NM_001005611chrX1455 ------
NM_001006115chr312718 ------
NM_001006634chr161129 ------
NM_001007237chr11201 ------
NM_001007559chr1811282 ------
NM_001008225chr71144 ------
NM_001008407chr7--1426 ----
NM_001008541chr101831 ------
NM_001008541chr101831 ------
NM_001008701chr19--11239 ----
NM_001009899chr3----156 --
NM_001010854chr14----1176 --
NM_001010924chr10--167 ----
NM_001010983chr3159 ------
NM_001010986chrX----12362 --
NM_001012977chrX----21035 1029 --
NM_001013437chr18----1167 --
NM_001013699chr121220 ------
NM_001014809chr41805 ------
NM_001017368chr171756 ------
NM_001018050chr2212168 ------
NM_001018052chr2212168 ------
NM_001018056chr91128 ------
NM_001018111chr743450 970 789 760 ------
NM_001024680chr211560 ------
NM_001025076chr1014985 --13968 --
NM_001025077chr1016343 --15326 --
NM_001025105chr5----11369 --
NM_001025108chr2--12539 24030 3803 --
NM_001025579chr171265 ------
NM_001029858chr6--13132 ----
NM_001031690chr712171 ------
NM_001032288chr20----11634 --
NM_001032999chr2044964 4561 4314 3416 ------
NM_001033581chr1--1350 ----
NM_001033581chr1--1350 ----
NM_001033582chr1--1350 ----
NM_001033925chr101506 ------
NM_001034841chr1615233 ------
NM_001034852chr14----1154 --
NM_001034954chr1013283 ------
NM_001034955chr1013283 ------
NM_001034956chr1013283 ------
NM_001034957chr1013283 ------
NM_001037331chr18----1271 --
NM_001038493chr21586 ------
NM_001039140chr20170 ------
NM_001039574chr11842 ------
NM_001039709chr2044964 4561 4314 3416 ------
NM_001039937chr13----1278 --
NM_001040167chr71768 --6129 127 123 121 117 115 --
NM_001040172chr5173 ------
NM_001040173chr5173 ------
NM_001040708chr81866 ------
NM_001042533chr311334 ------
NM_001042599chr216763 ------
NM_001043351chr111936 ------
NM_001046chr51282 ------
NM_001065chr122186 163 ------
NM_001094chr171197 ------
NM_001126chr1----1346 --
NM_001147chr81110 ------
NM_001149chr101239 ------
NM_001175chr12155 ------
NM_001204chr217770 ------
NM_001219chr71254 ------
NM_001300chr10----175 --
NM_001313chr41805 ------
NM_001332chr51537 ------
NM_001356chrX11923 --21618 1616 --
NM_001364chr1113014 ------
NM_001396chr21----11017 --
NM_001408chr111698 ------
NM_001419chr1923072 1776 13773 1427 --
NM_001426chr21554 ------
NM_001542chr11201 ------
NM_001546chr6121 ------
NM_001655chr111136 ------
NM_001681chr12148 --157 --
NM_001743chr21370 ------
NM_001754chr2123978 1426 ------
NM_001892chr5----11369 --
NM_001949chr612555 ------
NM_001988chr17131 --133 --
NM_002010chr131468 ------
NM_002017chr11------11190
NM_002025chrX49246 8287 8272 7894 --28289 2615 --
NM_002045chr31321 --1323 --
NM_002074chr11700 ------
NM_002080chr161929 ------
NM_002088chr191106 ------
NM_002094chr161381 ------
NM_002137chr71458 --1460 --
NM_002193chr2----21267 510 --
NM_002196chr20----1886 --
NM_002196chr20----1886 --
NM_002226chr141241 ------
NM_002233chr11----2303 301 --
NM_002234chr121679 ------
NM_002254chr2185 --121954 1952 1942 1940 115 113 109 107 97 93 91 87 --
NM_002285chr2--12539 24030 3803 --
NM_002309chr2222556 2090 --11043 --
NM_002341chr6129 ------
NM_002359chr1753921 3587 2688 631 354 ------
NM_002360chr732613 622 591 --11763 --
NM_002401chr17----11944 --
NM_002442chr1211443 ------
NM_002469chr121471 ------
NM_002522chr1731440 451 49 --4338 310 308 70 --
NM_002607chr72116 70 ------
NM_002667chr6----11229 --
NM_002713chr1197 ------
NM_002731chr11150 ------
NM_002737chr1724822 746 --21764 1762 --
NM_002744chr1--1350 ----
NM_002745chr2211706 ----13541
NM_002806chr141246 ------
NM_002896chr11----1105 --
NM_002972chr221267 ------
NM_003016chr1711650 1380 ----
NM_003031chr162352 334 --2365 363 --
NM_003043chr313845 --2156 150 --
NM_003072chr19----1341 --
NM_003085chr51543 ------
NM_003128chr221876 846 --11144 --
NM_003131chr612148 --12053 --
NM_003144chr6----2232 230 --
NM_003185chr2011144 ------
NM_003188chr61104 ------
NM_003211chr1211417 11621 ----
NM_003216chr221430 --33270 3264 3262 --
NM_003222chr201858 ------
NM_003223chr161208 ------
NM_003247chr6----11686 --
NM_003257chr151959 ------
NM_003275chr9----11134 --
NM_003286chr201370 ------
NM_003339chr5----1149 --
NM_003341chr31507 ------
NM_003342chr1712462 ------
NM_003345chr161152 ------
NM_003349chr20----11634 --
NM_003350chr81283 ------
NM_003360chr4----2305 303 --
NM_003383chr91128 ------
NM_003392chr322815 957 --11684 --
NM_003404chr2021563 64 ------
NM_003410chrX1730 ------
NM_003412chr3----1759 --
NM_003458chr321239 413 --23676 3662 --
NM_003483chr12----12320 --
NM_003498chr1621977 313 ----1522
NM_003583chr1212709 ------
NM_003590chr213867 ------
NM_003615chr3------155
NM_003654chr111269 ------
NM_003656chr3133 ------
NM_003671chr9--13506 ----
NM_003704chr41111 --2193 180 1183
NM_003716chr31276 ------
NM_003768chr11132 --3147 145 135 --
NM_003791chr161254 ------
NM_003800chr612344 12420 ----
NM_003828chrX----1523 --
NM_003924chr411426 --1345 --
NM_003941chr71992 --12288 --
NM_003980chr611025 ------
NM_003987chr1022241 273 ------
NM_003988chr1022318 350 ------
NM_003989chr1022177 209 ------
NM_003990chr1022177 209 ------
NM_004075chr12------1463
NM_004093chr1322239 2215 --22597 2217 --
NM_004171chr111398 ------
NM_004217chr17127 --129 --
NM_004302chr122613 571 --1615 --
NM_004311chr1012387 ------
NM_004331chr8----2810 30 --
NM_004352chr161145 ------
NM_004364chr1931006 183 150 --11009 --
NM_004397chr112955 452 ------
NM_004407chr41893 ------
NM_004418chr2----1471 --
NM_004430chr85570 555 520 497 485 --1510 --
NM_004432chr911976 ------
NM_004443chr32671 658 1719 ----
NM_004449chr21----11130 --
NM_004455chr111086 ------
NM_004499chr51191 ------
NM_004535chr2041737 1576 472 438 --11598 --
NM_004540chr21153 ------
NM_004571chr212439 132 --4205 203 197 195 --
NM_004630chr11----11098 --
NM_004655chr171491 ------
NM_004667chr151183 --1186 --
NM_004745chr811626 --24986 285 --
NM_004759chr1----1518 --
NM_004762chr1711721 ------
NM_004783chr16----1274 --
NM_004796chr14----1570 1573
NM_004840chrX1182 --1171 --
NM_004891chr2--180 ----
NM_004899chr2----1130 --
NM_004921chr1--1132 ----
NM_004929chr8--11499 ----
NM_004978chr121505 567 ------
NM_004981chr221388 ------
NM_004992chrX66630 6617 6500 5358 2855 544 --26632 6113 --
NM_004992chrX66630 6617 6500 5358 2855 544 --26632 6113 --
NM_005028chr101255 ------
NM_005093chr2044964 4561 4314 3416 ------
NM_005095chr1----12074 --
NM_005121chr1711246 ------
NM_005124chr61342 ------
NM_005137chr2231939 1667 136 ------
NM_005153chr16123 ------
NM_005157chr911830 ------
NM_005235chr216763 ------
NM_005252chr14----1127 --
NM_005276chr1211782 ------
NM_005276chr1211782 ------
NM_005311chr7--12693 167 --
NM_005324chr1721803 1461 ------
NM_005336chr222140 160 --12142 --
NM_005397chr743450 970 789 760 ------
NM_005402chr711621 1252 ----
NM_005417chr20----31540 1528 1526 --
NM_005425chr16----133 --
NM_005461chr2031446 790 171 --1368 --
NM_005465chr11516 ------
NM_005477chr152641 629 ------
NM_005477chr152641 629 ------
NM_005563chr11747 ------
NM_005637chr1811282 ------
NM_005692chr7147 ------
NM_005736chr101102 --1104 --
NM_005737chr2135 ------
NM_005746chr7--11979 ----
NM_005768chr12124 ------
NM_005782chr17184 ------
NM_005840chrX------12880
NM_005901chr181390 ------
NM_005904chr182376 357 ------
NM_005909chr511062 --11121 --
NM_005933chr1121214 99 ------
NM_005962chr101831 ------
NM_005962chr101831 ------
NM_005966chr212342 ------
NM_005968chr191187 ------
NM_006015chr1----241 39 --
NM_006022chr13----135 --
NM_006036chr211609 ------
NM_006037chr234350 4278 543 ------
NM_006047chr2013182 ------
NM_006054chr11----11590 --
NM_006080chr712853 ------
NM_006095chr413141 ------
NM_006136chr71982 ------
NM_006160chr17----21625 1060 --
NM_006203chr511298 ------
NM_006237chr1312263 --1685 --
NM_006251chr51637 ------
NM_006312chr122787 284 ------
NM_006322chr131146 1727 ----
NM_006324chr16----159 --
NM_006325chr12175 ------
NM_006434chr1013283 ------
NM_006454chr4148 --12537 --
NM_006460chr171165 ------
NM_006482chr1212709 ------
NM_006521chrX11407 ------
NM_006546chr1721624 1540 ------
NM_006561chr1014985 --13968 --
NM_006599chr1611634 ------
NM_006717chr9----22577 2571 --
NM_006734chr611074 ------
NM_006749chr82930 53 ------
NM_006766chr812423 ------
NM_006769chr1126 ------
NM_006896chr721179 294 ------
NM_006897chr121413 ------
NM_006997chr10136 ------
NM_007005chr91366 --11496 --
NM_007054chr5------1795
NM_007084chr131267 ------
NM_007150chrX12173 ------
NM_007159chr321204 552 ------
NM_007174chr121941 ------
NM_007182chr32672 50 ------
NM_007218chr81304 ------
NM_007313chr911830 ------
NM_007371chr9----2609 178 --
NM_007375chr11851 ------
NM_009588chr62484 471 ------
NM_012083chr101128 ------
NM_012090chr11312 ----1995
NM_012104chr111388 ------
NM_012104chr111388 ------
NM_012141chr13----1278 --
NM_012156chr20----13400 --
NM_012193chr1124567 4070 11255 ----
NM_012234chr322925 1320 12766 12927 --
NM_012294chr721519 148 ------
NM_012297chr41611 ------
NM_012304chr512549 ------
NM_012402chr111426 ------
NM_012420chr101175 ------
NM_012428chr15--1944 ----
NM_012448chr17----2218 216 --
NM_012476chr2----1178 --
NM_013261chr4157 --2297 295 --
NM_013354chr81241 ------
NM_013372chr15------1143
NM_013382chr1421653 948 --1292 --
NM_013433chr191431 ------
NM_013449chr121434 --11058 --
NM_014007chr9180 ------
NM_014021chr112710 13362 ----
NM_014110chr1197 ------
NM_014191chr12------1933
NM_014212chr122912 905 --1914 --
NM_014240chr32981 255 13403 --1186
NM_014253chrX1602 ------
NM_014283chr111345 ------
NM_014333chr1111059 ------
NM_014350chr51953 ------
NM_014351chr221108 --11018 --
NM_014488chr11--1469 ----
NM_014498chr31317 ------
NM_014552chr2----11500 --
NM_014577chr221213 ------
NM_014634chr2212871 ------
NM_014665chr853116 1423 1171 945 915 ------
NM_014667chr31421 --2447 445 11816
NM_014686chr1922009 752 ------
NM_014690chr712171 ------
NM_014718chr121720 ------
NM_014729chr822329 2233 ------
NM_014742chr202145 57 ------
NM_014810chr1----13510 13513
NM_014839chr1----1648 --
NM_014840chr121448 ------
NM_014876chr22----11415 --
NM_014901chr5--1443 ----
NM_014903chr121481 ------
NM_014912chr1012641 ------
NM_014921chr19--11239 ----
NM_014924chr14----2269 267 --
NM_014947chr111932 ------
NM_014974chr1011137 ------
NM_014975chr19281 69 ------
NM_014978chr10----1621 --
NM_015017chr1185 ------
NM_015024chr811410 --11010 --
NM_015032chr131222 ------
NM_015079chr1532121 251 36 --12201 --
NM_015097chr31886 --1888 --
NM_015101chr122848 846 ------
NM_015113chr1721776 924 1167 ----
NM_015155chr1023139 2441 ------
NM_015184chr3----1172 --
NM_015250chr91217 1506 ----
NM_015254chr812831 ------
NM_015284chr121469 752 ------
NM_015288chr513685 ------
NM_015299chr14--13523 ----
NM_015385chr1013283 ------
NM_015426chr31590 ------
NM_015441chr1164 ------
NM_015483chr72716 706 --2933 931 --
NM_015530chr2152 ------
NM_015567chr131276 --1230 --
NM_015568chr2011627 ------
NM_015570chr711616 ------
NM_015575chr211346 --1996 --
NM_015576chr322569 776 ------
NM_015657chr2129 --11005 11008
NM_016083chr611504 ----12422
NM_016227chr111345 ------
NM_016260chr212318 ------
NM_016275chr3----2604 602 --
NM_016277chr611349 ------
NM_016315chr211828 ------
NM_016322chr9----12461 --
NM_016403chr111531 ------
NM_016422chr1113077 ------
NM_016529chr131363 ------
NM_016530chr1513139 --13706 --
NM_016544chr2----13383 --
NM_016545chr12352 109 ------
NM_016547chr11654 ------
NM_016592chr201386 ------
NM_016605chr51409 --1422 --
NM_016612chr81177 --2500 498 --
NM_016623chr8------1596
NM_016626chr1811519 ----11522
NM_016930chr4155 --1945 --
NM_016953chr2----15754 --
NM_017415chr524441 368 ------
NM_017450chr171474 ------
NM_017455chr15--1944 ----
NM_017456chr1711721 ------
NM_017583chr11--160 ----
NM_017594chr91366 ------
NM_017617chr9158 ------
NM_017633chr622876 654 ------
NM_017637chr9174 ------
NM_017643chr1712640 ------
NM_017670chr11----2171 169 --
NM_017714chr202219 209 ----1213
NM_017740chr1611580 --51706 610 608 600 598 --
NM_017772chr6171 ------
NM_017793chr151241 ------
NM_017798chr2011179 ------
NM_017813chr815336 ------
NM_017848chrX----13740 --
NM_017873chr92688 413 ------
NM_017902chr1024902 1744 --51718 932 926 334 332 1880
NM_017933chr2----11471 11474
NM_018054chr161129 ------
NM_018105chr811000 ------
NM_018144chr10----228 26 --
NM_018164chr12150 ------
NM_018287chr10------1207
NM_018361chr81930 ------
NM_018362chr1113312 ------
NM_018419chr20--198 ----
NM_018437chr9159 ------
NM_018446chr3159 ------
NM_018593chr61701 ------
NM_018652chr15133 ------
NM_018660chr821205 167 --2329 327 --
NM_018667chr1632245 1741 1041 ------
NM_018945chr643423 2923 1295 395 ------
NM_018959chr191760 ------
NM_018970chr712842 ------
NM_018993chr201368 ------
NM_019072chr513624 ------
NM_019089chr12632 320 ------
NM_019102chr7----1388 --
NM_019102chr7----1388 --
NM_019854chr121502 --2569 563 --
NM_019885chr21297 --42389 2387 2383 2381 --
NM_020148chr18150 --13015 12435
NM_020180chr1821370 433 ------
NM_020194chr21650 ------
NM_020205chr112413 ------
NM_020225chr4----1352 --
NM_020337chr4--12683 ----
NM_020403chr13----156 --
NM_020708chr20--1540 ----
NM_020718chr16--1376 24218 145 --
NM_020737chr6131 ------
NM_020801chr51349 ------
NM_020815chr41257 1390 ----
NM_020834chr14------1482
NM_020858chr1512072 --2576 574 --
NM_020927chr161104 --1106 --
NM_020944chr91217 ------
NM_020948chr1--1739 ----
NM_020987chr101239 ------
NM_021012chr1743096 3018 2879 2552 --12883 --
NM_021079chr1722104 181 ------
NM_021224chr91397 ------
NM_021249chr1421475 1196 ------
NM_021643chr2------11929
NM_021777chr81341 ------
NM_021813chr613664 ------
NM_021907chr21209 ------
NM_021914chr14------12200
NM_021956chr611273 --11275 --
NM_021973chr4----1301 --
NM_021988chr20----11634 --
NM_021999chr13----1659 --
NM_022048chr1525395 5382 --25397 5356 --
NM_022129chr10------192
NM_022137chr14----1154 --
NM_022170chr7----21242 212 --
NM_022442chr20----11634 --
NM_022497chr3--1245 ----
NM_022566chr151534 ------
NM_022658chr1211127 ------
NM_022719chr2212459 ------
NM_022737chr192936 368 --2378 376 --
NM_022743chr1131 ------
NM_022751chr18----146 --
NM_022763chr311223 ------
NM_022780chr211624 --1621 --
NM_022898chr141106 ------
NM_022970chr101296 1258 ----
NM_023018chr1----174 --
NM_024007chr512546 ------
NM_024016chr171670 ------
NM_024050chr191599 ------
NM_024085chr2----1822 --
NM_024090chr41404 ------
NM_024337chr51309 ------
NM_024541chr101701 ------
NM_024551chr121146 ------
NM_024551chr121146 ------
NM_024557chr1111323 ------
NM_024563chr511811 ------
NM_024595chr11333 --1335 --
NM_024612chr17--1350 ----
NM_024674chr11678 ------
NM_024676chr121269 286 ------
NM_024770chr2----16190 --
NM_024830chr521691 197 --1410 --
NM_024852chr11225 ------
NM_024933chr22639 605 ------
NM_024991chr1013283 ------
NM_025090chr172174 106 --2254 225 --
NM_025179chr1--11993 14626 --
NM_025187chr161436 ------
NM_025195chr8----11647 --
NM_025219chr20--1173 ----
NM_025237chr17----176 --
NM_030621chr1412720 ------
NM_030629chr16--1655 ----
NM_030808chr171179 ------
NM_031203chr191187 ------
NM_031216chr18----11972 --
NM_031243chr71458 --1460 --
NM_031266chr51191 ------
NM_031426chr9----32774 2758 2756 --
NM_031442chrX------1788
NM_031477chr161342 ------
NM_031866chr101233 ------
NM_031892chrX1955 ------
NM_031946chr7----1490 --
NM_031992chr7----21242 212 --
NM_032017chr121853 820 ------
NM_032153chr31441 ------
NM_032189chr1333103 394 199 --11760 --
NM_032268chr1611021 ------
NM_032283chr11136 ------
NM_032354chr171486 1385 ----
NM_032413chr15188 ------
NM_032452chr14137 ------
NM_032494chr2----158 --
NM_032569chr161212 ------
NM_032594chr141347 ------
NM_032682chr313416 --13427 --
NM_032711chr1753921 3587 2688 631 354 ------
NM_032778chr311334 ------
NM_032918chr121160 ------
NM_033023chr7292 46 ------
NM_033030chr2158 ------
NM_033044chr11312 ----1995
NM_033147chr21209 ------
NM_033148chr21209 ------
NM_033181chr611504 ----12422
NM_033285chr8----14044 --
NM_033326chr112792 485 ------
NM_033331chr9--13506 ----
NM_033389chr1714842 ------
NM_033467chr1259 23 ------
NM_033496chr102576 172 ------
NM_033497chr102576 172 ------
NM_033498chr102576 172 ------
NM_033500chr102576 172 ------
NM_033518chrX130 ------
NM_044472chr11488 ------
NM_052845chr121302 --13066 --
NM_052864chr4----1486 --
NM_052874chr161277 --3285 283 279 --
NM_052876chr19----2766 764 --
NM_053025chr3----11631 11634
NM_053026chr3----11631 11634
NM_053027chr3----11631 11634
NM_053028chr3----11631 11634
NM_053031chr3----11631 11634
NM_053032chr3----11631 11634
NM_053281chrX--1158 ----
NM_057178chr171756 ------
NM_078471chr171782 ------
NM_080391chr1----1559 --
NM_080392chr1----1608 --
NM_080552chr20----2627 625 --
NM_080600chr191200 ------
NM_080717chr12--1372 ----
NM_080723chr61394 ------
NM_080744chr71188 ------
NM_080927chr311164 --1657 --
NM_130436chr21----11017 --
NM_130439chr101831 ------
NM_130439chr101831 ------
NM_130838chr151258 ------
NM_130839chr151258 ------
NM_133369chr5----2291 289 --
NM_133445chr91243 ------
NM_133486chrX1134 ------
NM_133499chrX1902 ------
NM_134269chr22----1245 --
NM_138338chr2212168 ------
NM_138479chr11118 ------
NM_138558chr1197 ------
NM_138559chr21110 ------
NM_138576chr141106 ------
NM_138638chr14------12200
NM_138713chr1611634 ------
NM_138714chr1611634 ------
NM_138795chr121397 1235 ------
NM_138966chr181453 ------
NM_138970chr14----1570 1573
NM_138971chr111388 ------
NM_138971chr111388 ------
NM_138972chr111388 ------
NM_138972chr111388 ------
NM_138973chr111388 ------
NM_138973chr111388 ------
NM_139014chr6----5853 224 218 214 208 --
NM_139135chr1----241 39 --
NM_139323chr2021563 64 ------
NM_144601chr16----11061 --
NM_144642chr311307 ------
NM_144723chr5----153 --
NM_145068chr172495 25 --128 --
NM_145159chr141241 ------
NM_145206chr1012843 ------
NM_145316chr61738 ------
NM_145331chr61104 ------
NM_152233chr1421475 1196 ------
NM_152410chr61465 ------
NM_152470chr1833641 2766 1499 13694 ----
NM_152493chr1----11049 --
NM_152622chr5----128 --
NM_152636chr1112447 ------
NM_152678chr312546 ------
NM_152721chr18----2584 582 --
NM_152774chr712350 ------
NM_152835chr11443 ------
NM_152838chr2013182 ------
NM_152868chr221388 ------
NM_152932chr3159 ------
NM_153181chr181453 ------
NM_153182chr311334 ------
NM_153184chr311461 ------
NM_153273chr312718 ------
NM_153367chr1023879 828 --184 --
NM_153616chr1512072 --2576 574 --
NM_153617chr1512072 --2576 574 --
NM_153618chr1512072 --2576 574 --
NM_153619chr1513310 ------
NM_153649chr111936 ------
NM_153810chr1024692 3401 ------
NM_170665chr1213883 --13892 --
NM_170711chr191936 ------
NM_170712chr32672 50 ------
NM_170713chr32672 50 ------
NM_170714chr32672 50 ------
NM_171998chrX1151 ------
NM_172020chr7----21709 1325 --
NM_173075chr41351 ------
NM_173076chr2129 --11005 11008
NM_173214chr1611634 ------
NM_173510chr2212627 ------
NM_173694chrX----12428 --
NM_173827chr4--12845 ----
NM_175610chr151959 ------
NM_175866chr121380 246 ------
NM_175907chr181794 ------
NM_177422chr11225 ------
NM_177438chr1412720 ------
NM_177536chr16136 ------
NM_177996chr20----13400 --
NM_177999chr931251 976 180 ------
NM_178011chr101527 ------
NM_178120chr21408 ------
NM_178426chr11664 ------
NM_178562chr71948 ------
NM_178812chr8--1998 ----
NM_178815chr101298 ------
NM_178818chr161129 ------
NM_178864chr111597 ----1600
NM_181358chr133993 3952 752 ------
NM_181457chr2----2224 214 --
NM_181458chr2----2357 347 --
NM_181459chr2----2123 113 --
NM_181460chr2----2170 160 --
NM_181486chr12--1372 ----
NM_181504chr51306 ------
NM_181523chr51306 ------
NM_181524chr51306 ------
NM_181553chr16----11061 --
NM_181554chr16----11061 --
NM_181838chr5----1149 --
NM_181842chr6146 ------
NM_182498chr191309 ------
NM_182526chr1433063 2795 514 ------
NM_182528chr21162 ------
NM_182565chr17----2669 268 --
NM_182580chr122030 912 ------
NM_182644chr31320 ------
NM_182666chr31507 ------
NM_182918chr21----11130 --
NM_182948chr11150 ------
NM_182972chr111736 ------
NM_183065chr171486 1385 ----
NM_183227chr611349 ------
NM_183360chr21209 ------
NM_183361chr21209 ------
NM_183377chr171197 ------
NM_183393chr31276 ------
NM_183394chr31276 ------
NM_183416chr1----11404 --
NM_183422chr13----135 --
NM_194259chr161152 ------
NM_194260chr161152 ------
NM_194261chr161152 ------
NM_197955chr15188 ------
NM_197970chr2158 ------
NM_197978chr9159 ------
NM_198041chr41177 ------
NM_198182chr2----11500 --
NM_198268chr133993 3952 752 ------
NM_198269chr133993 3952 752 ------
NM_198291chr20----31540 1528 1526 --
NM_198390chr16--1655 ----
NM_198447chr1----2294 292 --
NM_198686chr1431736 562 54 ------
NM_199131chr101543 ------
NM_199144chr20----11634 --
NM_199191chr2----152 --
NM_199194chr2----152 --
NM_199203chr20----11634 --
NM_199262chr17--1104 ----
NM_199282chr171297 --2285 283 --
NM_199324chr412881 ------
NM_199334chr17126 ------
NM_199355chr161442 --2569 567 --
NM_201428chr11----11590 --
NM_201429chr11----11590 --
NM_201430chr11----11516 --
NM_201624chr1185 ------
NM_201995chr11----1669 --
NM_201998chr11----1734 --
NM_203318chr171782 ------
NM_203346chr222140 160 --12142 --
NM_203351chr17----11944 --
NM_203399chr11747 ------
NM_203401chr11747 ------
NM_203487chr13----156 --
NM_203504chr41611 ------
NM_203505chr41611 ------
NM_206853chr6----1789 --
NM_206854chr6----12050 --
NM_206860chr10136 ------
NM_206861chr10136 ------
NM_206862chr10136 ------
NM_206907chr51637 ------
NM_206914chr12176 ------
NM_207305chr9268 51 ------
NM_207311chr1211144 ------
NM_207371chr1011012 ------
NM_207645chr111167 11012 ----
NM_213609chr31137 ------