TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3940-3p
miRNA Sequence: CAGCCCGGAUCCCAGCCCACUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5----1104 --
NM_000020chr1231733 539 349 12050 22420 168 --
NM_000037chr821955 460 --22152 143 --
NM_000044chrX----1159 --
NM_000068chr1981540 589 582 560 550 478 421 205 ------
NM_000069chr1125 ------
NM_000076chr11168 ------
NM_000088chr171333 --11250 --
NM_000092chr243700 3459 1699 395 ------
NM_000112chr534030 3990 602 --34282 3405 1861 --
NM_000192chr121330 ------
NM_000210chr21573 ------
NM_000238chr72278 55 ------
NM_000248chr342591 2541 1940 862 ------
NM_000252chrX1318 ------
NM_000264chr921011 303 ------
NM_000314chr1032251 2170 850 1499 ----
NM_000326chr15142 ----1361
NM_000332chr632514 2352 1748 --14543 --
NM_000333chr31352 --1143 --
NM_000335chr331952 1555 315 --11600 --
NM_000340chr311024 ------
NM_000346chr1711499 ------
NM_000361chr2051789 585 319 280 217 1340 ----
NM_000430chr17----22978 236 --
NM_000445chr83912 351 283 ------
NM_000449chr11495 1270 1194 --
NM_000459chr91213 ------
NM_000462chr1521721 190 ------
NM_000476chr91556 --21374 427 --
NM_000495chrX----1417 --
NM_000503chr811492 ------
NM_000555chrX1182 --22833 531 --
NM_000598chr7----21532 1249 --
NM_000675chr221263 ------
NM_000678chr203249 148 65 --135 --
NM_000679chr52196 96 ------
NM_000720chr31455 ------
NM_000721chr122280 2216 ------
NM_000722chr71115 ------
NM_000723chr1721116 396 ------
NM_000725chr122291 194 --1855 --
NM_000726chr21113 ------
NM_000801chr201683 ------
NM_000816chr5--1653 ----
NM_000827chr532462 621 39 ------
NM_000831chr176076 5902 5705 1743 503 185 39 11113 35957 958 91 --
NM_000832chr94736 565 220 114 ------
NM_000841chr63180 171 61 ------
NM_000844chr3----1189 --
NM_000870chr51397 --1145 --
NM_000875chr1535190 1551 1528 ----14928
NM_000883chr71106 ----1497
NM_000883chr71106 ----1497
NM_000891chr171781 --23546 1064 --
NM_000899chr1211129 ------
NM_000908chr5158 ------
NM_000918chr174738 662 618 21 ------
NM_000945chr221522 504 ------
NM_000964chr1731371 177 109 --1211 --
NM_000983chr14452 445 367 281 --11488 --
NM_001001323chr121636 ------
NM_001001481chr82840 157 ------
NM_001001521chr21250 136 ----
NM_001001522chr112282 151 ----1263
NM_001001560chr221211 ------
NM_001001661chr71102 ------
NM_001001852chr222772 373 ------
NM_001001890chr2173983 3067 1513 104 97 54 25 ------
NM_001002860chr1441796 1090 915 830 --1610 --
NM_001003676chr11----1354 --
NM_001003681chr2211303 ------
NM_001003694chr31502 ------
NM_001003800chr922848 1406 ------
NM_001004127chr131906 ------
NM_001005271chr17------1118
NM_001005273chr17------1118
NM_001005408chr172396 35 ------
NM_001005417chr12277 188 --1106 --
NM_001005463chr1011883 ------
NM_001005473chr535144 4672 1433 ----15436
NM_001005505chr341669 1213 650 505 --1255 --
NM_001005609chrX43691 2941 1105 922 --21474 642 --
NM_001005611chrX2473 206 ------
NM_001005746chr21113 ------
NM_001005747chr21113 ------
NM_001005920chr162943 406 ------
NM_001006115chr352361 2255 967 867 273 --2587 376 --
NM_001006617chr91136 ------
NM_001006619chr91136 ------
NM_001006620chr91136 ------
NM_001006621chr91136 ------
NM_001006932chr642593 1260 490 48 --1780 --
NM_001007075chr431105 976 110 ------
NM_001007098chr1----1351 --
NM_001007156chr152753 49 ------
NM_001007226chr1711374 ------
NM_001007227chr1711374 ------
NM_001007228chr1711374 ------
NM_001007229chr1711374 ------
NM_001007230chr1711374 ------
NM_001007237chr132690 2399 2121 --11844 --
NM_001007257chr12216 208 ------
NM_001007271chr101292 ------
NM_001007471chr92233 158 ------
NM_001008220chr52751 732 --13209 --
NM_001008222chrX11234 ------
NM_001008541chr1032195 1608 44 ------
NM_001008541chr1032195 1608 44 ------
NM_001008701chr1972929 2567 1003 778 566 370 54 --21014 836 --
NM_001008777chr17----1237 --
NM_001008895chr1311239 ------
NM_001009813chr191325 ------
NM_001009899chr3----25902 1421 --
NM_001009993chr244169 4062 3200 1635 ------
NM_001009996chr32503 127 ------
NM_001010846chr1125 13762 ----
NM_001010861chr112677 1383 ----
NM_001010862chrX22026 1118 ------
NM_001010867chr176133 5962 4621 1044 437 340 265 --66448 5378 5231 4762 2577 249 --
NM_001010911chr103867 842 196 ------
NM_001010926chr11559 --199 --
NM_001010971chr11924 ------
NM_001011645chrX----1159 --
NM_001011658chrX----1675 --
NM_001011708chr222405 2279 ------
NM_001012267chr911654 --1614 --
NM_001012329chr131759 720 64 ------
NM_001012393chr11187 ------
NM_001012426chr642283 1294 820 130 --11344 12702
NM_001012427chr642283 1294 820 130 --11344 12702
NM_001012614chr42148 34 --1118 --
NM_001012644chr201231 ------
NM_001013031chr1022829 2293 12543 ----
NM_001013398chr7----21532 1249 --
NM_001013415chr411041 ------
NM_001013438chr31720 ------
NM_001013439chr31566 ------
NM_001013615chr121089 774 --2453 307 --
NM_001013620chr1215960 15451 ----
NM_001013661chr11345 --121 --
NM_001013693chr182397 2388 1874 1182 1139 1060 831 310 --1386 --
NM_001013693chr182397 2388 1874 1182 1139 1060 831 310 --1386 --
NM_001013739chr71219 ------
NM_001013839chr1731924 1692 732 --21659 80 --
NM_001014797chr1037527 5134 2201 26816 6693 ----
NM_001014839chr11402 ------
NM_001014841chr11402 ------
NM_001015045chr41695 ------
NM_001015053chr1721105 285 --21054 26 --
NM_001015881chrX31171 1003 278 ------
NM_001017368chr1711906 --157 --
NM_001017392chr1911352 ------
NM_001017395chr311237 --1405 --
NM_001017406chr12159 25 ------
NM_001017924chr1021402 35 ------
NM_001017926chr81551 1382 ----
NM_001017992chr5123 --1153 --
NM_001017995chr533952 180 170 ------
NM_001018004chr15----1209 --
NM_001018006chr15----1209 --
NM_001018007chr15----1209 --
NM_001018008chr15125 ------
NM_001018020chr15----1209 --
NM_001018050chr2293204 2721 2651 2415 2310 2093 1337 1253 1017 1539 11080 --
NM_001018052chr2293204 2721 2651 2415 2310 2093 1337 1253 1017 1539 11080 --
NM_001018056chr9--1465 ----
NM_001018057chr11178 ------
NM_001018064chr9149 --11525 --
NM_001018108chr151184 --1818 --
NM_001023567chr1512433 --1759 --
NM_001024660chr321335 325 ------
NM_001024809chr1731371 177 109 --1211 --
NM_001024858chr1482535 2063 1082 558 173 128 120 49 --1634 --
NM_001024937chr17167 --192 --
NM_001024959chr34771 643 232 156 ------
NM_001024960chr34771 643 232 156 ------
NM_001025077chr1037088 4914 1004 1196 ----
NM_001025079chr313247 14002 ----
NM_001025108chr222741 28 --22952 2811 --
NM_001025109chr12722 26 ------
NM_001025202chr71219 ------
NM_001025205chr31142 --1184 --
NM_001025242chrX41304 952 877 477 ------
NM_001025243chrX41304 952 877 477 ------
NM_001025579chr1751134 1067 239 165 65 --139 --
NM_001025580chrX128 11724 ----
NM_001025603chr11495 1270 1194 --
NM_001029859chr1131784 1673 1581 --1319 --
NM_001029989chr152845 711 ------
NM_001030006chr171257 ------
NM_001030007chr162422 298 ------
NM_001031680chr1184 --12238 --
NM_001031690chr743024 268 213 95 --1261 --
NM_001031696chr192235 36 ------
NM_001031702chr33915 301 25 --2661 286 --
NM_001031740chr141721 1668 1415 304 --11355 --
NM_001031803chr171261 ------
NM_001032282chr81103 ------
NM_001032288chr2011299 ------
NM_001032296chr1312476 --12286 --
NM_001032380chr101117 ------
NM_001033026chr192502 40 ------
NM_001033117chr333396 1449 151 --14171 --
NM_001033551chr1773387 2985 2902 1008 682 421 62 --11487 13104
NM_001033561chr17182 ------
NM_001033581chr1184 ------
NM_001033581chr1184 ------
NM_001033582chr1184 ------
NM_001033925chr1021820 1595 ------
NM_001035chr11953 ------
NM_001035254chr932494 2006 1016 ------
NM_001037317chr112677 1383 ----
NM_001037582chr4----1601 --
NM_001038493chr241179 378 104 21 ------
NM_001038640chr15----1826 --
NM_001039141chr2221731 429 ------
NM_001039465chr141138 ------
NM_001039538chr222950 62 ------
NM_001039550chr22591 142 --1846 --
NM_001039574chr12982 721 ------
NM_001039580chr4--14205 ----
NM_001039583chr222536 423 --1155 --
NM_001039584chr222536 423 --1155 --
NM_001039618chr1145588 5106 2266 2070 ------
NM_001039690chr1652149 2025 1686 728 614 ------
NM_001039762chr1011636 ------
NM_001039888chr11712 ------
NM_001039916chr121366 ------
NM_001039917chr121366 ------
NM_001039918chr121366 ------
NM_001039919chr121366 ------
NM_001039920chr121366 ------
NM_001040020chr71995 ------
NM_001040144chr1652149 2025 1686 728 614 ------
NM_001040146chr1652149 2025 1686 728 614 ------
NM_001040152chr744444 251 98 21 1731 ----
NM_001040167chr761082 1054 243 175 160 29 ----1344
NM_001040172chr51397 --1145 --
NM_001040173chr51397 --1145 --
NM_001040284chr1625778 4851 ------
NM_001040424chr2172904 2709 2047 2040 1874 571 259 --1937 --
NM_001040429chr1311132 ------
NM_001040458chr51635 1173 ----
NM_001040653chr31916 ------
NM_001040708chr8--11057 150 --
NM_001042368chr92295 72 --1674 --
NM_001042479chrX31332 776 644 ------
NM_001042480chrX31332 776 644 ------
NM_001042537chrX--11847 ----
NM_001042548chr2126 ------
NM_001042601chr3----1458 --
NM_001042603chr1214077 --43509 3451 3393 3335 --
NM_001042632chr2062515 545 445 356 325 178 --1400 --
NM_001042633chr2062515 545 445 356 325 178 --1400 --
NM_001042663chr151440 1312 376 141 118 --1273 1913
NM_001042664chr151440 1312 376 141 118 --1273 1913
NM_001042665chr151440 1312 376 141 118 --1273 1913
NM_001042681chr1----12051 --
NM_001042682chr1----12051 --
NM_001042682chr1----12051 --
NM_001042749chrX11493 ------
NM_001042750chrX11493 ------
NM_001042751chrX11493 ------
NM_001043318chr145964 489 253 126 38 1259 13173 --
NM_001043351chr132254 1803 1554 --11438 1196
NM_001044385chr21749 --12792 --
NM_001077628chr1125 ------
NM_001078chr1----1503 --
NM_001079874chr1--11516 --1798
NM_001080418chr14533 486 134 30 --1191 --
NM_001092chr1752358 2304 1998 1600 1005 ------
NM_001106chr3108957 3711 3223 3084 2945 2290 2145 1688 1677 689 17985 17997 --
NM_001113490chrX--13327 ----
NM_001116chr1662877 2321 2076 721 670 636 ------
NM_001122631chr11163 --1669 --
NM_001122679chr5----1104 --
NM_001123chr101739 ------
NM_001128chr162422 298 ------
NM_001144chr162501 96 ------
NM_001146chr821667 244 ------
NM_001148chr41621 ------
NM_001174chrX31533 771 701 --1689 --
NM_001191chr2011064 --11176 --
NM_001200chr201386 ------
NM_001201chr413417 ------
NM_001203chr41159 ------
NM_001204chr224827 429 ----15083
NM_001206chr91452 ------
NM_001220chr7160 ------
NM_001221chr4194 ------
NM_001259chr746351 6235 1580 379 --16293 --
NM_001265chr13----2708 256 --
NM_001273chr122420 408 ------
NM_001275chr141294 --1397 --
NM_001277chr112867 856 ------
NM_001282chr171257 ------
NM_001292chr152961 164 ------
NM_001304chr1722457 562 ------
NM_001328chr42148 34 --1118 --
NM_001331chr1122613 1932 --127 1697
NM_001332chr51316 ------
NM_001356chrX--1411 ----
NM_001365chr17148 --2234 193 --
NM_001387chr532975 2966 2638 ------
NM_001389chr211206 --1461 --
NM_001397chr172354 2253 1072 949 544 271 126 --31699 525 250 --
NM_001399chrX43691 2941 1105 922 --21474 642 --
NM_001418chr112532 497 ------
NM_001418chr112532 497 ------
NM_001419chr1943094 3039 616 605 --1532 --
NM_001420chr19136 --1243 --
NM_001423chr1211985 ------
NM_001438chr133464 2955 2786 ------
NM_001453chr611321 ------
NM_001454chr173354 328 104 --1917 --
NM_001460chr14212 144 92 22 ------
NM_001495chr81858 --21195 358 --
NM_001497chr932307 2298 230 --21713 75 --
NM_001523chr19297 62 ------
NM_001542chr132690 2399 2121 --11844 --
NM_001552chr1711030 ------
NM_001567chr111701 --1471 --
NM_001569chrX41304 952 877 477 ------
NM_001614chr171516 ------
NM_001614chr171516 ------
NM_001654chrX1451 ------
NM_001664chr3------1810
NM_001682chr121350 ------
NM_001702chr8128 ------
NM_001703chr11112 --1255 --
NM_001731chr12165 ------
NM_001754chr2173983 3067 1513 104 97 54 25 ------
NM_001777chr313247 14002 ----
NM_001792chr181148 ------
NM_001810chr205740 720 520 161 69 --1240 --
NM_001823chr14154 ------
NM_001826chr11356 ------
NM_001829chr41899 --1135 --
NM_001834chr5245 35 ------
NM_001845chr1311091 ------
NM_001855chr91891 ------
NM_001903chr52737 701 ------
NM_001904chr31383 ------
NM_001935chr21224 ------
NM_001944chr183684 559 425 191 ----
NM_001946chr121879 --173 --
NM_001954chr61144 ------
NM_001977chr4----1527 --
NM_002017chr1111008 ------
NM_002023chr131374 1205 25 --2430 408 --
NM_002025chrX47657 6358 6176 3059 ------
NM_002028chr1411202 11299 1439 --
NM_002031chr61174 ------
NM_002039chr41671 ------
NM_002061chr161955 1851 1707 1480 1362 1230 ------
NM_002069chr7----1232 --
NM_002072chr9--143 ----
NM_002086chr1752013 1675 768 364 117 --1632 --
NM_002092chr415055 ------
NM_002137chr7124 ------
NM_002160chr91103 ------
NM_002189chr103464 152 92 ------
NM_002196chr202426 123 ------
NM_002196chr202426 123 ------
NM_002204chr1721212 480 --1904 --
NM_002212chr20127 ------
NM_002214chr714774 --11255 --
NM_002222chr31520 ------
NM_002232chr11189 ------
NM_002249chr11411 ------
NM_002264chr314437 ------
NM_002267chr1312434 ------
NM_002285chr222741 28 --22952 2811 --
NM_002290chr61983 ------
NM_002309chr2252672 2627 2298 1982 261 --2166 161 --
NM_002310chr522327 74 ------
NM_002359chr17124253 4239 3781 3651 1657 1456 568 539 505 482 415 345 --21312 160 --
NM_002361chr19169 ------
NM_002373chr1531216 1111 136 ----1142
NM_002374chr222950 62 ------
NM_002387chr52521 218 --1391 --
NM_002390chr1731984 1773 615 --12020 --
NM_002399chr151508 ------
NM_002406chr5122 --1261 --
NM_002442chr1231616 1603 150 ------
NM_002446chr19295 27 ------
NM_002465chr12126 ------
NM_002473chr224896 554 529 247 ------
NM_002499chr1521695 245 ------
NM_002506chr1147 ------
NM_002519chr1111324 ------
NM_002537chr151701 ------
NM_002538chr5----1184 --
NM_002545chr11187 ------
NM_002576chr111812 ------
NM_002581chr924377 1462 --13948 --
NM_002586chr611501 --2659 382 --
NM_002599chr1131191 742 145 ------
NM_002609chr521676 1298 --180 --
NM_002630chr6124 ------
NM_002634chr175866 585 296 38 30 ------
NM_002636chr61151 ------
NM_002643chr2149 ------
NM_002646chr13661 310 103 --11484 --
NM_002655chr814715 14460 ----
NM_002698chr1972691 2631 2518 1042 854 845 819 11158 193 --
NM_002699chr11248 --2542 314 11246
NM_002709chr223063 654 ------
NM_002714chr61802 ------
NM_002716chr1132940 1339 1221 --1280 --
NM_002718chr342058 2013 1928 614 12257 1364 --
NM_002730chr1921309 1121 ------
NM_002732chr91477 ------
NM_002737chr1745939 5065 4502 4078 15014 22084 1745 15425
NM_002744chr1184 ------
NM_002747chr1821584 196 ------
NM_002779chr105492 159 80 69 33 ------
NM_002787chr7----1634 --
NM_002840chr121384 188 ------
NM_002850chr1921206 60 --1422 --
NM_002858chr11275 ------
NM_002868chr1232281 2217 686 ------
NM_002874chr9181 ------
NM_002881chr211419 ------
NM_002885chr14847 667 310 124 --2251 168 --
NM_002886chr31577 ------
NM_002918chr193428 409 173 ------
NM_002942chr311055 ------
NM_002956chr12----126 --
NM_002957chr962805 1201 1195 885 842 327 --53296 2952 2786 1391 272 --
NM_002959chr143097 2994 2882 275 --1427 --
NM_002964chr1127 ------
NM_002977chr211327 --12704 --
NM_002994chr411297 ------
NM_003011chr91400 ------
NM_003013chr41119 ------
NM_003030chr31267 ------
NM_003045chr1364266 3595 3277 1688 774 187 ------
NM_003047chr141312 1210 563 130 --1916 --
NM_003069chrX----1597 --
NM_003076chr1231287 1257 551 ------
NM_003091chr20145 ------
NM_003098chr202336 58 --188 --
NM_003108chr274594 2758 2664 2608 2563 2521 1899 ------
NM_003110chr17158 --11080 --
NM_003112chr7170 ------
NM_003128chr21994 --11863 --
NM_003131chr64856 562 549 357 --11761 --
NM_003139chr111656 ------
NM_003150chr1751993 1717 852 597 159 ------
NM_003156chr113370 227 129 ------
NM_003161chr171878 11212 ----
NM_003186chr112282 151 ----1263
NM_003189chr14821 747 610 60 --12412 --
NM_003199chr1811593 ------
NM_003200chr1941916 1820 1524 1479 --41790 958 311 80 --
NM_003204chr171678 --11105 --
NM_003221chr642546 1655 1044 637 ------
NM_003239chr141124 1328 ----
NM_003246chr15170 ------
NM_003250chr172375 101 ------
NM_003255chr1712239 --2945 922 --
NM_003270chrX1211 ------
NM_003281chr11218 11819 53713 1770 1762 890 467 --
NM_003292chr11658 ------
NM_003319chr21819 ------
NM_003325chr221155 ------
NM_003339chr51600 ------
NM_003342chr1713053 --22085 137 --
NM_003345chr16----1440 --
NM_003348chr1221507 398 ------
NM_003349chr2011299 ------
NM_003356chr1131042 1015 743 ------
NM_003383chr9--1465 ----
NM_003385chr21286 ------
NM_003387chr221897 848 --11074 --
NM_003392chr343493 3263 3010 1598 ----14305
NM_003400chr2----1272 --
NM_003430chr192141 23 ------
NM_003468chr213838 --13166 --
NM_003470chr161536 --21827 319 --
NM_003482chr1281853 1033 652 643 475 449 359 179 --12088 --
NM_003483chr1222111 418 ------
NM_003488chr17150 ------
NM_003498chr162216 126 --21737 172 --
NM_003559chr1732531 1047 111 183 1758 --
NM_003563chr1711374 ------
NM_003566chr121186 ------
NM_003575chr771292 1233 1092 1048 291 250 73 ------
NM_003576chr1312476 --12286 --
NM_003580chr81432 ------
NM_003586chr165650 248 138 91 40 ------
NM_003589chr1311239 ------
NM_003597chr232164 2138 751 ------
NM_003607chr143944 1185 835 390 ----11090
NM_003615chr3----1114 --
NM_003624chr1931167 510 120 ------
NM_003629chr143009 2793 2449 2247 ------
NM_003633chr532391 2316 1814 --1495 --
NM_003635chr10--1504 ----
NM_003644chr1756049 992 961 937 100 --149 --
NM_003655chr172186 77 ------
NM_003660chr193690 528 512 --154 --
NM_003666chr12413 175 ------
NM_003684chr11928 --1274 --
NM_003707chr3----181 --
NM_003713chr111138 ------
NM_003714chr542647 1992 377 358 --21984 647 --
NM_003728chr41261 ------
NM_003737chr11178 ------
NM_003779chr11412 --1162 --
NM_003780chr12277 188 --1106 --
NM_003829chr9199 ------
NM_003861chr1412371 ------
NM_003883chr5155 ------
NM_003885chr172862 162 ------
NM_003887chr211525 ------
NM_003888chr1511182 ------
NM_003893chr101453 --1184 --
NM_003916chrX----11158 --
NM_003924chr421456 57 ------
NM_003936chr231050 191 112 ------
NM_003947chr331074 182 174 ----139
NM_003951chrX--1327 ----
NM_003958chr6--13780 1492 --
NM_003972chr1021003 521 ------
NM_003982chr141244 ------
NM_003994chr1211129 ------
NM_004050chr1421847 453 --2795 503 --
NM_004068chr31142 --1184 --
NM_004089chrX31171 1003 278 ------
NM_004093chr1311038 1455 ----
NM_004097chr23878 230 176 ------
NM_004112chr171685 ------
NM_004117chr6154 ------
NM_004130chr31160 ------
NM_004157chr32897 705 ------
NM_004161chr211441 ------
NM_004169chr171113 ------
NM_004171chr1128523 8373 --19265 --
NM_004185chr1----198 --
NM_004187chrX31028 300 271 ------
NM_004193chr101382 ------
NM_004200chr1162826 2574 2419 2335 487 151 --2755 743 --
NM_004225chr8--11084 ----
NM_004228chr19165 ------
NM_004229chrX12184 ------
NM_004240chr19149 ------
NM_004247chr172243 41 ------
NM_004286chr2272665 2288 1897 834 756 531 261 ------
NM_004308chr1121612 1606 --71674 1628 361 252 237 226 44 --
NM_004309chr173930 869 439 ------
NM_004311chr1022602 329 --11186 --
NM_004321chr293358 3304 2561 2413 2347 858 734 593 112 --12986 --
NM_004326chr11394 --1486 --
NM_004341chr2145 ------
NM_004343chr191483 ------
NM_004350chr1184 --12238 --
NM_004393chr321920 348 --22253 1944 --
NM_004395chr51606 --1321 --
NM_004397chr1113178 12950 1768 --
NM_004405chr23384 298 248 --2423 330 --
NM_004418chr2275 64 ------
NM_004420chr1152042 957 872 699 637 --12350 --
NM_004422chr17123 --189 --
NM_004423chr32826 802 ------
NM_004429chrX31136 1098 1037 --2231 160 --
NM_004430chr82773 304 --1600 --
NM_004431chr12537 79 --1189 --
NM_004433chr12589 445 --1674 --
NM_004436chr13179 124 57 ------
NM_004440chr621631 1446 ------
NM_004443chr31758 ------
NM_004450chr14135 ------
NM_004451chr112210 88 ------
NM_004459chr1711934 1661 ----
NM_004463chrX1176 ------
NM_004474chr12817 180 ------
NM_004485chr144411 4369 1137 1098 --11338 --
NM_004494chr121247 425 ------
NM_004501chr123436 115 ------
NM_004515chr1----166 --
NM_004524chr172233 117 ------
NM_004530chr162294 54 ------
NM_004549chr1111537 ------
NM_004560chr91118 ------
NM_004583chr17190 ------
NM_004586chrX43361 1621 1485 1282 ------
NM_004593chr31802 ------
NM_004602chr2021475 311 --1177 --
NM_004603chr7----175 --
NM_004630chr113867 293 209 --21136 145 --
NM_004634chr31502 ------
NM_004637chr311319 ------
NM_004647chr192274 128 ------
NM_004650chrX31286 569 541 ------
NM_004673chr111537 ------
NM_004685chr13--12168 ----
NM_004687chr17----11969 --
NM_004714chr19----163 --
NM_004725chr10----1526 --
NM_004730chr511743 ------
NM_004737chr221478 --11278 --
NM_004739chr11126 ------
NM_004742chr3--11381 ----
NM_004758chr171298 --1195 --
NM_004762chr1761758 1717 1452 631 566 217 ------
NM_004774chr1732226 2088 402 ------
NM_004791chr13141 ------
NM_004807chr242173 2030 756 163 --12185 1423
NM_004808chr1053161 2619 2219 851 718 ------
NM_004815chr1--13779 ----
NM_004821chr5----191 --
NM_004831chr19147 ------
NM_004840chrX1401 ------
NM_004841chr11229 ------
NM_004850chr221764 1646 --1178 11233
NM_004859chr171241 ------
NM_004862chr16129 --11384 --
NM_004866chr524954 4356 1134 14525 --
NM_004911chr72574 500 ------
NM_004922chr101867 --1152 --
NM_004924chr196954 916 905 882 421 53 ------
NM_004948chr1811447 ------
NM_004953chr32393 170 ------
NM_004959chr931348 188 56 ------
NM_004961chrX21368 488 ------
NM_004968chr7----1570 1291
NM_004973chr62626 555 ------
NM_004976chr11144898 4285 3878 3708 3480 3371 3317 1797 1653 1631 792 545 452 130 --34031 3226 3165 --
NM_004978chr121645 1384 ------
NM_004979chrX3911 840 319 --2891 231 --
NM_004992chrX118024 7949 7586 6473 2959 2826 1939 1598 1430 1136 833 --26929 5391 16429
NM_004992chrX118024 7949 7586 6473 2959 2826 1939 1598 1430 1136 833 --26929 5391 16429
NM_004994chr201125 ------
NM_004995chr1441017 978 426 81 ------
NM_004998chr15----1631 --
NM_005027chr194774 412 275 38 --1393 --
NM_005028chr10----12201 --
NM_005044chrX34291 1253 930 --13709 --
NM_005055chr112147 22 ------
NM_005056chr1214321 --43753 3695 3637 3579 --
NM_005063chr1013398 --13094 --
NM_005065chr1415101 14517 ----
NM_005068chr611456 --11289 --
NM_005087chr31566 ------
NM_005099chr12291 29 ------
NM_005102chr2126 ------
NM_005116chr2023818 709 --11304 --
NM_005137chr2242086 885 353 129 --3960 857 682 --
NM_005148chr172451 419 --142 --
NM_005154chr151581 ------
NM_005194chr202436 402 ------
NM_005197chr1414141 11538 ----
NM_005202chr12914 287 --2919 729 --
NM_005219chr541432 1242 1135 360 1453 ----
NM_005220chr1721333 528 ------
NM_005225chr201495 --11060 --
NM_005231chr1121318 481 ------
NM_005241chr31283 ------
NM_005277chr411688 ------
NM_005281chr11679 ------
NM_005312chr952419 2106 987 732 143 ------
NM_005329chr1622101 441 --1282 --
NM_005339chr414194 ------
NM_005359chr1836282 6155 5240 --12172 --
NM_005368chr22133 --2428 41 --
NM_005374chr173763 520 465 ------
NM_005376chr1--1738 ----
NM_005380chr131249 1030 958 1357 1399 1446
NM_005382chr8181 ------
NM_005384chr9124 ------
NM_005386chr202279 23 ------
NM_005399chr133761 3409 417 ------
NM_005406chr181182 ------
NM_005415chr2----2243 205 --
NM_005417chr2041925 1435 736 543 --41776 1390 1277 44 --
NM_005436chr1022793 2516 13672 ----
NM_005458chr92103 51 --11505 --
NM_005461chr2011282 ------
NM_005474chr1721105 285 --21054 26 --
NM_005477chr1542120 2066 1582 301 --11815 --
NM_005477chr1542120 2066 1582 301 --11815 --
NM_005487chr2211303 ------
NM_005497chr1745264 4922 4477 4361 --1158 --
NM_005499chr19149 ------
NM_005505chr123846 668 43 ------
NM_005522chr7144 ----11168
NM_005523chr721609 282 ------
NM_005529chr14747 393 176 31 --1134 --
NM_005539chr1031371 1218 1012 ------
NM_005542chr71108 ------
NM_005550chr163244 228 32 ------
NM_005575chr5156 ------
NM_005576chr15160 --1278 --
NM_005578chr323737 3179 ------
NM_005595chr11202 ------
NM_005596chr916211 --12136 --
NM_005603chr1841635 1280 509 210 --1345 --
NM_005627chr6----1330 --
NM_005634chrX1158 ------
NM_005652chr16----2406 178 1894
NM_005655chr81103 ------
NM_005665chr114124 11372 1705 --
NM_005668chr534591 3516 1728 ------
NM_005676chrX1172 ------
NM_005678chr152802 386 ------
NM_005692chr7177 ------
NM_005708chr132388 171 ------
NM_005715chr632509 217 161 ------
NM_005718chr34771 643 232 156 ------
NM_005719chr12138 ------
NM_005725chr111867 ------
NM_005736chr101159 --21204 376 --
NM_005737chr222197 606 ------
NM_005742chr21627 --1586 --
NM_005748chr1243421 2753 2714 2677 ------
NM_005826chr12205 126 ------
NM_005840chrX12120 ------
NM_005852chr17------1118
NM_005877chr221760 ------
NM_005880chr161471 ------
NM_005881chr163310 65 39 ------
NM_005904chr181516 ------
NM_005909chr5----13965 --
NM_005911chr21177 ------
NM_005920chr133099 2993 472 --22765 78 --
NM_005933chr112818 774 --12237 --
NM_005934chr1992279 2221 2211 2171 2039 1062 855 339 278 --3239 230 202 --
NM_005955chr124642 386 ------
NM_005962chr1032195 1608 44 ------
NM_005962chr1032195 1608 44 ------
NM_005964chr171567 ------
NM_005985chr201571 --1188 --
NM_005994chr173877 173 115 --2855 43 1226
NM_006004chr1140 ------
NM_006007chr911081 --13720 --
NM_006010chr3193 ------
NM_006011chr152515 363 --22944 1448 --
NM_006026chr34328 307 138 34 --1419 --
NM_006030chr341669 1213 650 505 --1255 --
NM_006034chr1132006 156 37 1340 21009 183 --
NM_006037chr254175 3213 1404 564 196 ------
NM_006038chr2041528 682 134 53 ------
NM_006048chr11324 ------
NM_006095chr411002 ------
NM_006113chr1--11516 --1798
NM_006133chr11112320 2286 2082 2071 1724 992 930 720 252 79 26 --2563 540 --
NM_006136chr731358 1198 96 ------
NM_006141chr1612731 --1262 --
NM_006148chr1762880 2355 1147 492 175 58 --32426 2421 2416 --
NM_006161chr51467 ------
NM_006172chr1134 ------
NM_006180chr9149 --11525 --
NM_006224chr1712104 11835 12312 --
NM_006237chr1322282 21 ----11886
NM_006245chr621005 851 ------
NM_006251chr5----2586 423 --
NM_006265chr811492 ------
NM_006266chr92295 72 --1674 --
NM_006268chr111878 ------
NM_006285chr92283 97 ------
NM_006306chrX53689 1345 1259 1208 469 25686 5404 ----
NM_006325chr121149 ------
NM_006336chr921404 487 ------
NM_006338chr12128 70 --1527 --
NM_006352chr11720 ------
NM_006359chrX--11847 ----
NM_006361chr1711728 ------
NM_006369chr1164 --1368 --
NM_006373chr1741215 548 275 208 --2494 472 --
NM_006380chr17----13533 --
NM_006393chr10--11216 1166 --
NM_006416chr61733 ------
NM_006458chr111106 ------
NM_006472chr121271 163 ------
NM_006483chr19----163 --
NM_006484chr19----163 --
NM_006497chr17----2728 723 --
NM_006526chr2021875 1335 ------
NM_006540chr8----138 --
NM_006544chr1415454 --14391 --
NM_006558chr81159 ------
NM_006562chr102287 194 --132 --
NM_006565chr161938 --138 --
NM_006570chr9197 ------
NM_006599chr1617713 12260 --16370
NM_006603chrX11493 ------
NM_006609chr212348 ------
NM_006618chr1----11260 --
NM_006621chr111702 ------
NM_006650chr52751 732 --13209 --
NM_006690chr2041890 1877 1466 231 ------
NM_006693chr72806 233 --1593 --
NM_006696chr52114 64 1194 ----
NM_006708chr61879 ------
NM_006717chr922957 2370 ------
NM_006721chr101739 ------
NM_006722chr342591 2541 1940 862 ------
NM_006726chr41856 --1835 --
NM_006734chr6----11098 --
NM_006736chr241601 1152 691 300 --11856 --
NM_006738chr1553852 3585 598 240 126 14472 ----
NM_006741chr1211003 ------
NM_006756chr8--11061 ----
NM_006759chr21250 136 ----
NM_006766chr822606 2094 ------
NM_006769chr1------1214
NM_006772chr621517 490 ------
NM_006775chr622944 780 ------
NM_006795chr1151287 1224 530 498 162 --21367 1319 --
NM_006805chr521736 1235 ------
NM_006852chr1752621 2488 1859 990 67 ----1391
NM_006854chr711947 ------
NM_006868chr1832851 1962 1130 --13063 --
NM_006884chr31267 ------
NM_006885chr1613244 ------
NM_006888chr1422770 300 ------
NM_006893chr1151 ------
NM_006901chr151157 ------
NM_006906chr11283 29 --1268 --
NM_006917chr1143 ------
NM_006920chr211857 ------
NM_006924chr1712776 1106 ----
NM_006925chr141138 ------
NM_006927chr1672028 774 640 386 178 150 40 ------
NM_006931chr1221952 1834 ------
NM_006936chr2121232 22 ------
NM_006948chr21--12106 ----
NM_006950chrX248 33 ------
NM_006981chr911193 ------
NM_006991chr32397 278 --1145 --
NM_007001chr93192 109 43 ------
NM_007011chr1555637 5385 4862 1645 913 12743 1926 --
NM_007023chr21783 ------
NM_007030chr584720 4699 4245 4190 1287 563 525 286 --14323 --
NM_007032chr2221731 429 ------
NM_007050chr20127728 6590 6019 5495 2776 2588 2325 2018 1825 997 799 628 --37202 5373 81 17557
NM_007064chr321335 325 ------
NM_007078chr1032781 630 488 ------
NM_007097chr5245 35 ------
NM_007144chr1731219 122 61 ------
NM_007146chr1712147 ------
NM_007170chr1----1137 --
NM_007174chr1221979 215 ------
NM_007185chr1192 --1297 --
NM_007189chr731406 1358 974 1307 ----
NM_007200chr1553852 3585 598 240 126 14472 ----
NM_007222chr81551 1382 ----
NM_007223chr151261 --1329 --
NM_007225chr173917 241 78 ------
NM_007245chr161275 ------
NM_007249chr1328746 206 --16341 --
NM_007260chr14585 509 495 160 ------
NM_007280chr151354 ------
NM_007322chr192510 120 ------
NM_007353chr742949 2888 2258 680 ------
NM_007359chr1711210 --11178 --
NM_012074chr143880 740 24 --1763 --
NM_012081chr512937 ------
NM_012082chr8195 ------
NM_012095chr1023253 3000 --12966 --
NM_012099chr193819 224 53 --1488 --
NM_012102chr1----12051 --
NM_012105chr211252 ------
NM_012156chr2032555 2334 1129 --1639 --
NM_012164chr92762 50 ------
NM_012166chr921477 117 ------
NM_012193chr1125172 4962 ------
NM_012197chr941350 1160 1101 1081 ------
NM_012199chr114085 --13155 --
NM_012200chr112311 57 --1340 --
NM_012215chr1031436 268 222 ------
NM_012219chr333075 2086 181 --21298 480 --
NM_012264chr2251402 661 630 500 226 --1437 --
NM_012264chr2251402 661 630 500 226 --1437 --
NM_012268chr192235 36 ------
NM_012281chr71614 ------
NM_012282chrX2185 55 ------
NM_012296chr1163440 3347 1408 1123 1039 921 13700 --1412
NM_012297chr411807 ------
NM_012300chr51870 --21700 875 --
NM_012302chr111005 ------
NM_012307chr18----1806 --
NM_012308chr113936 334 85 --1293 --
NM_012323chr2221475 1223 --11136 --
NM_012326chr22794 97 ------
NM_012329chr1711332 ------
NM_012396chr11532 ------
NM_012399chr2211696 ------
NM_012402chr1131394 382 110 ------
NM_012407chr222536 423 --1155 --
NM_012410chr16154 ------
NM_012425chr1042443 2325 2277 273 ------
NM_012428chr151215 ------
NM_012465chr1022327 825 ------
NM_012473chr222625 289 ------
NM_012482chr1----2576 511 --
NM_013233chr211225 ------
NM_013247chr22409 383 --1139 --
NM_013253chr11178 ------
NM_013261chr433665 3295 616 ----1997
NM_013275chr163314 270 101 --1515 --
NM_013279chr1112287 --11692 12089
NM_013305chr182267 82 ------
NM_013312chr19----277 29 --
NM_013334chr31177 ------
NM_013341chr222405 2279 ------
NM_013365chr221211 ------
NM_013386chr1--1156 ----
NM_013423chrX1495 ------
NM_013427chrX1495 ------
NM_013433chr1951963 1956 1436 1304 456 --1262 --
NM_013449chr123815 622 497 ------
NM_013952chr252595 2046 854 676 438 --11632 --
NM_013953chr252595 2046 854 676 438 --11632 --
NM_013960chr81523 ------
NM_013992chr252595 2046 854 676 438 --11632 --
NM_013993chr61144 ------
NM_013994chr61144 ------
NM_014007chr92886 66 ------
NM_014010chr9185 ------
NM_014023chr102874 226 ------
NM_014028chr612330 ------
NM_014030chr1731177 772 58 ------
NM_014060chrX--126 ----
NM_014079chr32356 210 --1342 --
NM_014112chr824414 2088 ------
NM_014117chr161840 ------
NM_014153chr161156 ------
NM_014155chr1136779 370 163 --11340 --
NM_014157chr1663151 968 504 331 141 73 ------
NM_014181chr212333 12593 ----
NM_014216chr144662 651 404 55 --31449 1344 614 --
NM_014240chr333929 3011 914 --33489 3351 1635 --
NM_014243chr412064 ------
NM_014246chr224405 327 294 231 ------
NM_014250chr2211303 ------
NM_014253chrX--21867 386 ----
NM_014284chr11402 ------
NM_014299chr1941968 1682 1456 134 --21436 881 --
NM_014319chr121520 ------
NM_014360chr141771 --1638 --
NM_014386chr51197 ------
NM_014396chr711613 ------
NM_014397chr921345 1269 --1420 --
NM_014399chr71248 ------
NM_014400chr19----193 --
NM_014409chr13786 134 121 ------
NM_014415chr3----1115 --
NM_014423chr5----12175 --
NM_014445chr312428 ------
NM_014470chr121309 ------
NM_014488chr111117 ------
NM_014494chr161369 ------
NM_014502chr11128 ------
NM_014554chr12----11454 --
NM_014563chrX----1675 --
NM_014591chr1011318 --11042 --
NM_014613chr5----3988 675 637 --
NM_014621chr2169 --190 --
NM_014636chr943831 265 78 53 --34129 1507 816 --
NM_014646chr1842442 1024 378 214 ------
NM_014661chr1093470 3329 3314 3056 1369 1305 656 341 59 12854 ----
NM_014663chr12992 194 ------
NM_014665chr883429 3037 2240 1427 1375 1064 355 136 --2500 495 --
NM_014667chr312178 --11715 --
NM_014671chr711225 ------
NM_014682chr811504 ------
NM_014690chr743024 268 213 95 --1261 --
NM_014701chr151406 1573 ----
NM_014712chr16183 --1567 --
NM_014730chr1255138 3942 2058 1739 1597 --15198 --
NM_014730chr1255138 3942 2058 1739 1597 --15198 --
NM_014731chr2021633 506 --2465 356 --
NM_014736chr152870 736 ------
NM_014737chr2041605 1526 1344 25 ------
NM_014741chr1121344 346 ------
NM_014743chr411008 --12290 --
NM_014747chr175696 5011 4875 4472 1364 855 254 --42019 1222 1148 129 --
NM_014755chr214213 --12607 --
NM_014761chr161819 --1143 --
NM_014762chr12682 281 --1837 --
NM_014766chr753407 3261 1329 1116 1053 --1607 --
NM_014770chr1251172 876 302 58 43 ------
NM_014771chr161851 ------
NM_014772chr1833394 2227 436 ------
NM_014774chr112926 ------
NM_014779chr3--1752 ----
NM_014810chr121195 47 --1704 --
NM_014826chr143944 1185 835 390 ----11090
NM_014828chr141254 --21005 81 1496
NM_014836chr101117 ------
NM_014839chr111892 ------
NM_014840chr124658 377 176 62 --11316 --
NM_014850chr333396 1449 151 --14171 --
NM_014851chr1102532 2346 1911 1852 822 779 634 595 444 93 --12280 --
NM_014869chr31939 --1445 --
NM_014876chr221188 --11596 --
NM_014883chr41695 ------
NM_014888chr71995 ------
NM_014891chr731669 1240 36 ------
NM_014893chrY--1409 ----
NM_014897chr1713268 --22555 2505 --
NM_014900chr21459 ------
NM_014921chr1972929 2567 1003 778 566 370 54 --21014 836 --
NM_014924chr1451242 865 328 320 314 --12228 --
NM_014926chr31727 ------
NM_014934chr1313070 ------
NM_014939chr1811376 ------
NM_014947chr122650 869 --21121 1005 --
NM_014953chr1313932 ------
NM_014982chr1435210 3680 919 ------
NM_014991chr412417 ------
NM_015000chr1212466 ------
NM_015008chr311237 --1405 --
NM_015023chr131739 1607 55 --1185 --
NM_015032chr131550 ------
NM_015033chr952883 2515 2152 313 182 --22562 331 --
NM_015035chr2076207 5522 5404 5269 2176 1201 113 1640 11538 --
NM_015039chr131207 1005 815 --1209 --
NM_015045chr101312 ------
NM_015068chr723296 1084 ------
NM_015075chrX32113 881 313 --2398 104 --
NM_015079chr1583140 3061 3053 2845 2107 443 207 102 --2976 821 --
NM_015080chr113907 837 704 ------
NM_015082chr521997 24 --1939 --
NM_015090chr196130 5414 5322 4575 4221 4074 1766 554 200 --25531 645 --
NM_015091chr141804 ------
NM_015092chr1643532 1770 1652 1516 ------
NM_015100chr1----11710 --
NM_015101chr112600 --1840 --
NM_015107chrX1847 ------
NM_015124chr2232277 2222 584 --22229 574 --
NM_015138chr1531118 242 88 --1232 --
NM_015155chr1033073 2214 598 ------
NM_015176chr111422 ------
NM_015185chrX22856 2289 ------
NM_015186chr9----1380 --
NM_015187chr41254 ------
NM_015200chr412493 --11026 --
NM_015205chr1343929 1031 640 351 --23993 1123 --
NM_015219chr1731924 1692 732 --21659 80 --
NM_015225chr9----1579 --
NM_015245chr662382 2337 2217 2019 998 148 --22715 807 --
NM_015246chr16112012 1955 1546 1463 1410 1368 1341 1282 646 617 275 ------
NM_015254chr882941 2666 2549 2497 2213 2159 187 155 --21140 574 --
NM_015271chr412865 13263 --12767
NM_015272chr1611599 ------
NM_015284chr121511 93 ------
NM_015293chr61299 ------
NM_015299chr1432995 577 478 --23632 3600 --
NM_015305chr1431686 1400 407 --1669 --
NM_015308chr111123 ------
NM_015310chr835125 3349 2475 ------
NM_015315chr532715 493 177 1159 11012 --
NM_015318chr1951701 1239 1212 622 90 ------
NM_015326chr141936 860 637 316 ------
NM_015328chr72425 227 --12534 --
NM_015346chr142154 43 11548 1415 --
NM_015349chr622854 2168 ------
NM_015354chr91332 ------
NM_015355chr1711600 ------
NM_015365chrX128 11724 ----
NM_015374chr2221002 415 ----1391
NM_015375chr174687 4372 3988 1990 1872 947 829 ------
NM_015378chr192855 2722 2342 2140 2091 2079 940 587 102 ------
NM_015401chr122332 215 ------
NM_015435chr811316 --1103 --
NM_015446chr111131 ------
NM_015458chr834853 4160 3908 13814 ----
NM_015472chr3149 ------
NM_015472chr3149 ------
NM_015477chr151108 1170 ----
NM_015481chr121910 --2677 63 --
NM_015503chr161560 ------
NM_015526chr1911343 ------
NM_015528chr17--1181 ----
NM_015542chr101351 ------
NM_015545chr71300 --1314 --
NM_015557chr1102907 2793 2586 2461 2420 2305 2213 845 184 61 12287 23472 1037 --
NM_015564chr513084 ------
NM_015567chr131206 ------
NM_015568chr2031238 272 108 --1408 --
NM_015570chr71621 ------
NM_015576chr31685 12437 ----
NM_015609chr152943 2736 2118 763 65 --22167 960 1783
NM_015630chr21993 ------
NM_015635chr921406 185 ------
NM_015638chr20131 ------
NM_015678chr131634 ------
NM_015686chrX32271 1963 855 ------
NM_015716chr17167 --192 --
NM_015726chr12349 54 11813 ----
NM_015850chr831536 912 68 ------
NM_015866chr12216 208 ------
NM_015872chr141613 1604 557 337 --21368 1180 --
NM_015881chr11178 ------
NM_015898chr192428 340 --1381 --
NM_015902chr81794 ------
NM_015913chr11538 ------
NM_015990chr431105 976 110 ------
NM_015995chr15105178 5108 4927 4225 3917 3663 1716 1708 1405 863 --21387 548 --
NM_015999chr11161 ------
NM_016022chr12417 75 1718 1755 --
NM_016032chrX11234 ------
NM_016037chr1----2872 307 --
NM_016061chr21382 --21466 308 --
NM_016076chr1--13190 ----
NM_016083chr623405 3303 ------
NM_016107chr5--1914 ----
NM_016169chr1052698 2367 1013 738 523 11297 1649 --
NM_016201chr32707 235 ------
NM_016206chr332621 2481 71 37125 1354 439 17479 --
NM_016224chr631984 1483 1401 ------
NM_016237chr12----121 --
NM_016240chr83624 529 146 ------
NM_016250chr141694 --1699 --
NM_016257chr1--13096 ----
NM_016272chr2251845 942 762 583 531 ------
NM_016275chr31708 ------
NM_016281chr121776 ------
NM_016284chr16----1943 --
NM_016287chr1--1607 ----
NM_016289chr21199 ------
NM_016357chr12121 ------
NM_016373chr16172 ----1210
NM_016396chr1521947 1013 ------
NM_016423chr141161 ------
NM_016424chr1711465 11239 ----
NM_016441chr21144 1646 ----
NM_016451chr11149 ------
NM_016463chr5173 ------
NM_016506chr11169 ------
NM_016547chr13645 634 500 --1225 --
NM_016570chr12--1510 ----
NM_016577chr374449 4068 1555 1512 914 651 161 ------
NM_016596chr122332 215 ------
NM_016603chr51898 ------
NM_016605chr512392 ------
NM_016621chr1184144 4050 3797 3245 3047 1197 791 452 --12866 --
NM_016628chr101108 ------
NM_016631chr211712 ------
NM_016830chr12----169 --
NM_016936chr1662101 1781 663 280 217 176 11589 ----
NM_016953chr242334 2079 997 249 11142 24552 135 --
NM_017415chr51255 --13371 11661
NM_017452chr2021475 311 --1177 --
NM_017453chr2021475 311 --1177 --
NM_017454chr2021475 311 --1177 --
NM_017455chr151215 ------
NM_017456chr1761758 1717 1452 631 566 217 ------
NM_017457chr19165 ------
NM_017548chr311717 --11515 --
NM_017550chr197976 274 246 240 159 99 56 ------
NM_017558chr16----1362 --
NM_017559chr17----1257 --
NM_017572chr19121 ------
NM_017575chr173583 265 191 --21494 217 --
NM_017590chr2222516 2057 1567 1221 --
NM_017593chr4--1397 ----
NM_017596chr164207 3803 3432 1769 1520 1076 --13984 --
NM_017602chrX3706 603 274 ------
NM_017610chr1521920 283 ------
NM_017617chr961148 1097 1070 1036 1004 47 ------
NM_017626chr1021706 1352 ------
NM_017637chr918607 --18623 --
NM_017643chr1722818 2597 ------
NM_017650chr725658 1021 --14063 --
NM_017651chr631565 619 481 ------
NM_017660chr1953022 2417 1299 243 29 --11367 --
NM_017676chr521632 717 ------
NM_017694chr21717 ------
NM_017709chr11388 ----13919
NM_017719chr31614 ------
NM_017724chr32324 301 ------
NM_017741chr442323 2205 1933 309 ------
NM_017745chrX1463 ------
NM_017749chr113366 306 239 ------
NM_017752chrX2820 167 --1687 --
NM_017762chr1512024 --1920 --
NM_017787chr1042837 2477 553 494 --12557 --
NM_017805chr192166 45 ------
NM_017848chrX31690 1240 693 ------
NM_017856chrX31332 776 644 ------
NM_017864chr8--143 ----
NM_017893chr1031295 385 57 --21438 512 --
NM_017919chr913911 1926 1203 --
NM_017921chr1741723 1579 872 31 --22311 135 --
NM_017938chrX22089 348 ------
NM_017953chr1167 --1375 --
NM_017994chr722527 71 ------
NM_018000chr23844 794 593 ------
NM_018028chr19394 68 39 ------
NM_018032chr163933 781 197 --198 --
NM_018063chr101341 ------
NM_018064chr6125 ------
NM_018067chr12105 23 ------
NM_018077chr7----160 --
NM_018085chr1118064 7451 6356 6238 6103 2484 1848 1595 1308 1172 35 ------
NM_018086chr211697 --11381 --
NM_018092chr161628 ------
NM_018095chr11169 ------
NM_018114chr32503 127 ------
NM_018131chr101788 ----1900
NM_018133chr311538 11589 ----
NM_018156chr192855 2722 2342 2140 2091 2079 940 587 102 ------
NM_018184chr31336 12166 11584 --
NM_018240chr12715 198 ------
NM_018244chr2011248 ------
NM_018246chr822760 725 12057 ----
NM_018266chr3--1784 ----
NM_018293chr312563 ------
NM_018299chr82840 157 ------
NM_018315chr411041 ------
NM_018371chr81153 ------
NM_018373chr1421282 808 --36104 5509 1016 11541
NM_018374chr713997 ------
NM_018383chr221943 117 --11450 --
NM_018387chr91462 ------
NM_018403chr363406 3063 3004 2886 431 424 ------
NM_018424chr911876 ------
NM_018449chr9243 22 ------
NM_018462chr31149 ------
NM_018482chr8168 ------
NM_018489chr122126 104 ------
NM_018553chr1731863 1831 211 --11363 --
NM_018584chr1----1198 --
NM_018660chr832499 2461 120 --11200 --
NM_018667chr16112335 2056 1982 1799 1078 807 781 513 454 168 57 --21866 307 --
NM_018674chr2----1470 --
NM_018688chr82761 310 ------
NM_018715chr122029 509 --11878 --
NM_018896chr17------168
NM_018947chr754385 4268 4081 3969 3323 ----14965
NM_018951chr72450 132 --1287 --
NM_018976chr1211868 1232 ----
NM_019046chr101784 ------
NM_019050chr421795 919 ------
NM_019058chr10----1335 --
NM_019071chr71567 ------
NM_019074chr152784 258 --2828 656 --
NM_019084chr101341 ------
NM_019106chr2212163 ------
NM_019114chr922382 62 --12414 --
NM_019557chr11781 1573 1592 --
NM_019593chr2022015 95 ------
NM_019596chr2142939 725 562 428 ------
NM_019613chr1731053 93 85 --1335 --
NM_019843chr22385 73 50 ------
NM_019845chr2184 ------
NM_019884chr193370 178 95 ------
NM_019885chr252551 2501 1164 944 666 --1183 --
NM_020064chr94690 473 256 36 ------
NM_020116chr411437 ------
NM_020122chr254951 4704 3749 1266 600 --14835 11197
NM_020137chrX163 ------
NM_020142chr122565 446 --1129 --
NM_020150chr101255 ------
NM_020159chr411734 ------
NM_020160chr191325 ------
NM_020168chr152157 52 --11059 --
NM_020180chr1811313 165 ----
NM_020182chr2032696 1386 776 --23162 21 11087
NM_020199chr521154 1141 ------
NM_020211chr15259 29 ------
NM_020228chr1121633 620 ------
NM_020246chr7----1147 1295
NM_020248chr131759 720 64 ------
NM_020310chr1731994 951 832 --2867 726 --
NM_020336chr201188 1172 ----
NM_020362chr11240 ------
NM_020381chr611870 ------
NM_020416chr421078 826 --1952 1365
NM_020432chr7----1678 --
NM_020440chr122169 1086 --12329 12823
NM_020443chr156950 5626 5493 4333 1630 --36839 2112 315 --
NM_020474chr181771 ----146
NM_020478chr821955 460 --22152 143 --
NM_020526chr1----11687 --
NM_020530chr223244 149 84 --1312 --
NM_020631chr151440 1312 376 141 118 --1273 1913
NM_020640chr32206 189 1434 ----
NM_020673chr2067523 6479 5589 2393 1976 1938 ------
NM_020689chr2021653 680 --2620 571 --
NM_020699chr153845 3727 1527 792 694 --35028 4994 1947 --
NM_020708chr2031989 1932 23 ------
NM_020713chr2083049 2884 2847 2657 2080 939 891 358 --1414 --
NM_020728chr732866 2743 2608 ------
NM_020734chr12--13241 ----
NM_020742chrX1326 ------
NM_020755chr61250 ------
NM_020764chr1691329 886 359 314 249 141 100 81 36 --11301 --
NM_020766chrX33679 3452 1136 ------
NM_020769chrX--1614 ----
NM_020772chr1712456 ----17309
NM_020774chr1822482 131 11878 1871 --
NM_020791chr17----1195 --
NM_020795chr1731848 1544 199 ------
NM_020796chr51171 ------
NM_020801chr511967 ------
NM_020804chr61270 --32052 1882 702 --
NM_020808chr12390 302 ------
NM_020812chr192126 45 ------
NM_020820chr2041103 616 203 24 11079 ----
NM_020824chr101111 ------
NM_020831chr221931 --11005 --
NM_020839chr32575 358 ------
NM_020845chr1272426 1839 1797 967 712 175 77 ------
NM_020856chr19----1128 --
NM_020860chr41357 ------
NM_020871chrX12033 ------
NM_020899chr1712214 ----1850
NM_020940chr1022894 1129 ------
NM_020946chr961566 1524 1504 1471 645 293 --1513 --
NM_020948chr1----1634 --
NM_020952chr92233 158 ------
NM_020956chr19154332 4326 4217 3933 3652 3602 3520 3408 3062 2891 1398 1228 1029 424 292 ------
NM_020972chr44734 284 183 34 ------
NM_020977chr41621 ------
NM_021003chr141803 ------
NM_021019chr121205 ------
NM_021033chr1322319 1109 ------
NM_021035chr2041047 359 241 108 ------
NM_021038chr313312 ------
NM_021061chr813862 13972 ----
NM_021079chr1793272 2529 2307 2099 2063 1347 1336 652 176 ------
NM_021081chr20------124
NM_021090chr2274327 1798 776 744 521 350 66 13168 13977 --
NM_021132chr10134 ------
NM_021133chr12584 73 ------
NM_021135chr642593 1260 490 48 --1780 --
NM_021136chr141606 ------
NM_021140chrX----1316 --
NM_021144chr9125 ------
NM_021145chr71975 ------
NM_021155chr1932744 2574 1874 --22138 662 --
NM_021159chr411372 --11645 --
NM_021188chr141222 --1527 --
NM_021198chr221309 915 ------
NM_021215chr202835 424 --2403 398 --
NM_021224chr9170 ------
NM_021238chr12----1170 --
NM_021242chrX----1267 --
NM_021252chr1021276 160 ------
NM_021255chr1443110 2821 604 377 ------
NM_021614chr5----1104 --
NM_021635chr621970 1853 ------
NM_021638chr464486 4232 3166 1986 1873 418 1817 1448 --
NM_021643chr211243 ------
NM_021648chr62402 192 --1560 --
NM_021728chr14----148 --
NM_021806chrX399 64 23 1430 ----
NM_021814chr6----1204 --
NM_021831chr21283 ------
NM_021905chr62125 21 --2524 132 1145
NM_021914chr141112 ------
NM_021943chr6191 --1529 --
NM_021946chrX21247 338 ------
NM_021961chr1156960 6895 2912 2608 2394 --15905 --
NM_021962chr1752358 2304 1998 1600 1005 ------
NM_021964chr312563 ------
NM_021971chr31177 ------
NM_021984chrX21368 488 ------
NM_021987chrX21368 488 ------
NM_021988chr2011299 ------
NM_021990chrX21368 488 ------
NM_021991chr172319 183 ------
NM_022006chr19161 ------
NM_022039chr102111 27 ------
NM_022041chr16----1103 --
NM_022048chr1534462 2541 1401 --22062 475 --
NM_022060chr1441375 1259 1247 346 ------
NM_022114chr183783 2890 1339 1288 1208 1138 958 342 --1780 --
NM_022117chrX1128 ------
NM_022143chr72351 117 ------
NM_022152chr22220 60 --281 34 --
NM_022153chr1083329 2506 1373 1331 1264 1028 378 22 --22312 121 --
NM_022166chr1665403 4990 4027 2417 806 455 ------
NM_022169chr1131323 1301 450 --2421 168 --
NM_022170chr731656 338 68 --21422 180 --
NM_022307chr7----1570 1291
NM_022343chr911263 --1850 --
NM_022374chr2177 ------
NM_022442chr2011299 ------
NM_022473chr1563977 1730 1412 1280 770 146 --1957 --
NM_022552chr221073 984 ------
NM_022574chr712036 --127 --
NM_022648chr244116 3976 2947 1335 --14195 --
NM_022652chr121879 --173 --
NM_022728chr7173 ------
NM_022748chr772484 1122 712 703 694 591 248 --1722 --
NM_022749chr811080 --2975 112 --
NM_022751chr18163 ------
NM_022758chr622624 2252 ------
NM_022810chrX--1327 ----
NM_022843chr1311426 ------
NM_022893chr21990 ------
NM_022898chr1422964 952 ------
NM_023009chr1----1463 --
NM_023035chr193807 201 152 ------
NM_023067chr32357 110 --1281 --
NM_023075chr182709 381 ------
NM_023076chr1621207 31 ------
NM_023079chr1731540 1476 1245 ------
NM_023105chr831536 912 68 ------
NM_023106chr831536 912 68 ------
NM_023110chr831536 912 68 ------
NM_023111chr831536 912 68 ------
NM_024015chr172867 97 ------
NM_024019chr41196 ------
NM_024085chr22903 743 --2797 159 --
NM_024106chr191352 ------
NM_024107chr172792 74 --1295 --
NM_024117chr91136 ------
NM_024119chr172129 32 ------
NM_024294chr622624 2252 ------
NM_024306chr163782 372 110 ------
NM_024348chr9----1258 --
NM_024490chr151531 --1453 --
NM_024493chr6188 --193 --
NM_024494chr1----198 --
NM_024511chr413299 --1408 --
NM_024522chr141932 1740 247 64 --139 --
NM_024525chr11495 ------
NM_024536chr22305 88 --2320 157 --
NM_024539chrX--2912 392 ----
NM_024541chr102258 55 ------
NM_024615chr5145 ------
NM_024704chr203136 91 54 ------
NM_024742chr1631508 1207 152 --11420 --
NM_024761chr924029 434 ------
NM_024787chr81389 --1140 --
NM_024825chr192304 284 ------
NM_024830chr53668 357 267 --21416 80 --
NM_024859chrX4877 706 277 70 --1852 1783
NM_024871chr32567 80 ------
NM_024877chr1951108 1057 337 282 178 ------
NM_024884chr1454194 800 683 631 418 --11015 --
NM_024900chr432208 447 129 --11993 --
NM_024900chr432208 447 129 --11993 --
NM_024922chr1651476 1398 1366 1304 1293 --21640 311 --
NM_024927chr17144 ------
NM_024953chr12--11913 ----
NM_024969chr21327 --170 --
NM_024971chr92233 158 ------
NM_025048chr61394 --136 --
NM_025054chr8163 ------
NM_025061chr191690 --1160 --
NM_025073chr113552 ------
NM_025090chr173940 610 126 ------
NM_025146chr342253 972 739 670 ------
NM_025179chr134015 3836 1305 --11863 --
NM_025182chr91316 129 1969 --
NM_025222chr352508 2390 2256 2054 649 --1101 --
NM_025248chr1732321 1260 734 ------
NM_025251chr831126 943 367 --1332 --
NM_025264chr2----125 --
NM_030629chr161290 1686 ----
NM_030650chr244263 3431 1529 668 ------
NM_030661chr7----11127 --
NM_030674chr1224873 4100 ------
NM_030751chr101203 ------
NM_030751chr101203 ------
NM_030753chr17284 41 ------
NM_030762chr121706 ------
NM_030766chr121116 --1280 --
NM_030796chr73411 386 96 ------
NM_030802chr171213 ------
NM_030808chr1741048 981 153 79 ------
NM_030906chr111228 ------
NM_030913chr14531 514 487 152 --1522 --
NM_030914chr92657 22 ------
NM_030918chr154020 1616 1103 466 72 --45227 4708 4703 1916 --
NM_030965chr11554 ------
NM_030978chr91424 ------
NM_030981chr111773 --31101 477 126 --
NM_031243chr7124 ------
NM_031283chr21283 ------
NM_031306chr12827 778 ------
NM_031309chr871851 1780 918 846 772 594 76 --21791 683 --
NM_031372chr4------11426
NM_031444chr2252459 1775 897 696 55 ------
NM_031445chr252798 2356 2325 928 422 ------
NM_031492chr11139 ------
NM_031844chr123436 115 ------
NM_031845chr222950 62 ------
NM_031847chr222950 62 ------
NM_031890chr2242385 2205 629 326 --22803 1017 --
NM_031911chr411713 1612 ----
NM_031992chr731656 338 68 --21422 180 --
NM_032017chr161919 1891 1829 1785 101 76 ------
NM_032051chr221261 --1220 --
NM_032052chr221241 --1214 --
NM_032105chr111086 --11325 --
NM_032121chrX----21084 869 --
NM_032160chr1813858 13950 13703 --
NM_032199chr1021108 345 ------
NM_032205chr8135 ------
NM_032208chr223619 1043 12579 21303 24 --
NM_032272chr81318 ------
NM_032281chr19136 --1243 --
NM_032294chr172405 274 ----11555
NM_032316chr372213 2130 942 826 631 350 124 --22419 355 --
NM_032320chr111529 ------
NM_032325chr112361 267 --21469 57 --
NM_032364chr12----1200 --
NM_032373chr1013894 25854 4338 ----
NM_032413chr151135 ------
NM_032420chr51610 --2907 275 --
NM_032434chr211385 ------
NM_032442chr172396 35 ------
NM_032457chr412887 12733 ----
NM_032491chr121267 1113 ----
NM_032505chr312033 ------
NM_032514chr203172 103 35 ------
NM_032538chr631978 838 826 ------
NM_032547chr411274 ------
NM_032552chr941845 1374 1316 628 ------
NM_032569chr1621569 233 ------
NM_032595chr1751456 1437 605 430 194 --11396 --
NM_032596chr9----1116 --
NM_032632chr14------1140
NM_032638chr3127 --1524 --
NM_032645chr112147 22 ------
NM_032701chr191530 ------
NM_032711chr17124253 4239 3781 3651 1657 1456 568 539 505 482 415 345 --21312 160 --
NM_032725chr11----130 --
NM_032737chr1952399 2327 2063 561 295 --52592 1875 1718 617 581 --
NM_032772chr101114 ------
NM_032777chr831544 628 29 ------
NM_032781chr11283 29 --1268 --
NM_032786chr121496 ------
NM_032804chr102162 82 ------
NM_032808chr153887 38 30 --2687 619 --
NM_032827chr221039 959 ------
NM_032837chr17----11978 --
NM_032840chr1261135 779 360 284 203 49 ------
NM_032876chr14----1365 --
NM_032918chr12----1115 --
NM_033056chr10126 ------
NM_033071chr61299 ------
NM_033089chr201368 ------
NM_033102chr1----21026 85 --
NM_033102chr1----21026 85 --
NM_033129chr2021581 51 --11521 --
NM_033132chr133485 191 114 ------
NM_033133chr1773670 2460 2323 1374 1150 973 257 --2599 485 --
NM_033141chr1412219 ------
NM_033143chr4----13805 1143
NM_033181chr623405 3303 ------
NM_033211chr511590 ------
NM_033224chr737814 5212 5091 --16686 --
NM_033225chr8----1357 --
NM_033226chr161186 ------
NM_033259chr34371 247 30 24 ------
NM_033274chr532936 1141 694 --32410 688 440 --
NM_033278chr111106 ------
NM_033290chrX32692 353 186 ------
NM_033326chr11----12503 --
NM_033360chr121581 ------
NM_033375chr1731297 425 201 --1430 --
NM_033380chrX----1417 --
NM_033381chrX----1417 --
NM_033386chr222415 172 --2359 52 --
NM_033401chr161105 ------
NM_033420chr1961038 386 216 182 134 86 ------
NM_033421chr2021859 578 ------
NM_033426chr1432106 525 175 ------
NM_033429chr15130 --21221 827 --
NM_033542chr20154 ------
NM_033551chr532715 493 177 1159 11012 --
NM_033631chr12858 448 --22671 135 --
NM_033632chr411041 ------
NM_033644chr51870 --21700 875 --
NM_033645chr51870 --21700 875 --
NM_052854chr112585 506 ------
NM_052855chr17154 ------
NM_052906chr2244680 1931 1419 488 --64870 4857 3607 3347 3177 1183 --
NM_052933chr73327 110 103 ------
NM_052934chr121440 90 ------
NM_052943chr12174 33 ------
NM_052968chr111562 ------
NM_052996chr1611486 ------
NM_053016chr936846 2958 29 ----27871 6337
NM_053025chr32371 307 ------
NM_053026chr32371 307 ------
NM_053027chr32371 307 ------
NM_053028chr32371 307 ------
NM_053031chr32371 307 ------
NM_053032chr32371 307 ------
NM_053279chr832721 1961 46 ------
NM_054016chr13742 624 491 ------
NM_054016chr13742 624 491 ------
NM_054016chr13742 624 491 ------
NM_054035chr174778 746 608 203 ------
NM_054111chr6------134
NM_057178chr1711906 --157 --
NM_058164chr19121 --1132 --
NM_058167chr141023 1006 929 349 --1164 --
NM_078471chr17153 --11197 --
NM_080391chr11589 ------
NM_080476chr20157 ------
NM_080491chr1163440 3347 1408 1123 1039 921 13700 --1412
NM_080599chr101351 ------
NM_080611chr201231 ------
NM_080616chr201546 ------
NM_080670chr51673 --1642 --
NM_080678chr21216 ------
NM_080682chr1----1503 --
NM_080717chr121330 ------
NM_080738chr121769 1689 ------
NM_080743chr631875 1788 1019 --22318 2052 --
NM_080832chrX155 ------
NM_080881chr51606 --1321 --
NM_100264chr101108 ------
NM_100486chr101108 ------
NM_130439chr1032195 1608 44 ------
NM_130439chr1032195 1608 44 ------
NM_130440chr121384 188 ------
NM_130459chr921525 1056 --134 --
NM_130838chr1521721 190 ------
NM_130839chr1521721 190 ------
NM_133170chr20127728 6590 6019 5495 2776 2588 2325 2018 1825 997 799 628 --37202 5373 81 17557
NM_133264chr1742831 1440 1341 917 ------
NM_133265chrX--13327 ----
NM_133369chr54977 367 361 255 ------
NM_133378chr21819 ------
NM_133432chr21819 ------
NM_133437chr21819 ------
NM_133452chr1951112 1091 1049 857 838 ------
NM_133457chr721358 256 --21215 99 --
NM_133467chr13423 407 80 ------
NM_133476chr121366 ------
NM_133499chrX2118 103 ------
NM_133642chr221478 --11278 --
NM_133650chr61299 ------
NM_134428chr9153 ------
NM_138300chr121460 484 --11161 --
NM_138338chr2293204 2721 2651 2415 2310 2093 1337 1253 1017 1539 11080 --
NM_138415chr2251332 664 585 283 147 ------
NM_138444chr1323026 1423 --1191 --
NM_138457chr642283 1294 820 130 --11344 12702
NM_138479chr111298 --21507 289 --
NM_138492chr511378 ------
NM_138565chr1121318 481 ------
NM_138576chr1422964 952 ------
NM_138578chr2011064 --11176 --
NM_138638chr141112 ------
NM_138713chr1617713 12260 --16370
NM_138714chr1617713 12260 --16370
NM_138732chr113907 837 704 ------
NM_138734chr113907 837 704 ------
NM_138764chr19154 ------
NM_138962chr17162 ------
NM_138991chr211252 ------
NM_138992chr211449 ------
NM_138994chr161105 ------
NM_139015chr1211262 ------
NM_139035chrX----1597 --
NM_139048chr3166 ------
NM_139071chr1231287 1257 551 ------
NM_139239chr191300 ------
NM_139276chr1751993 1717 852 597 159 ------
NM_139280chr1731355 1069 281 --41246 294 286 202 --
NM_144568chr141263 --1626 --
NM_144578chr14----14962 --
NM_144582chr241763 1602 361 54 --12518 1782
NM_144586chr23950 783 506 ------
NM_144589chr10123 ------
NM_144605chr16----129 --
NM_144635chr3176 --2347 182 --
NM_144664chr1112162 ------
NM_144767chr1553852 3585 598 240 126 14472 ----
NM_144979chr4190 ------
NM_145005chr911070 ------
NM_145025chr6----1151 --
NM_145056chr192257 21 ------
NM_145074chr22409 383 --1139 --
NM_145166chr351969 1846 1099 349 101 ------
NM_145185chr1971925 1898 1602 807 490 290 165 --11717 --
NM_145233chr191291 ------
NM_145260chr23687 617 583 ------
NM_145296chr192106 31 --2601 38 --
NM_145313chr1061299 1276 1064 584 484 459 --1507 --
NM_145349chr1761579 655 454 336 241 212 --11843 --
NM_145351chr1762071 946 828 733 704 165 --22335 1678 --
NM_145799chrX32581 87 49 ------
NM_145861chr121769 1689 ------
NM_147156chr101408 ------
NM_147168chr9----1116 --
NM_147202chr942328 921 569 48 ------
NM_148918chr171113 ------
NM_152253chr2264092 3756 3158 3147 3110 290 --11569 13133
NM_152263chr174836 4779 4146 1670 1216 1097 962 --14392 --
NM_152277chr512039 ------
NM_152280chr11744 --1268 --
NM_152296chr19----1273 --
NM_152346chr1751200 1100 998 918 859 ------
NM_152388chr21749 --12792 --
NM_152409chr5----199 --
NM_152414chr811571 ------
NM_152424chrX11320 --14636 --
NM_152441chr121117 ------
NM_152470chr1823047 2655 --22824 2604 --
NM_152542chr42859 740 ------
NM_152546chr521292 1205 --1132 --
NM_152608chr121715 177 --1572 --
NM_152652chr161208 --1182 --
NM_152713chr111155 ------
NM_152722chr1151151 668 596 205 80 ------
NM_152724chr1042443 2325 2277 273 ------
NM_152739chr7--11011 ----
NM_152856chrX1172 ------
NM_152860chr121306 --1146 --
NM_152878chr2221475 1223 --11136 --
NM_152903chr133760 662 530 ------
NM_152924chr1555637 5385 4862 1645 913 12743 1926 --
NM_152995chr41276 ------
NM_153029chr1643852 3237 1187 765 1875 ----
NM_153050chr2274327 1798 776 744 521 350 66 13168 13977 --
NM_153051chr2274327 1798 776 744 521 350 66 13168 13977 --
NM_153209chr17179 ------
NM_153211chr18189 ------
NM_153260chr1531174 1055 591 ------
NM_153270chrX176 ------
NM_153273chr352361 2255 967 867 273 --2587 376 --
NM_153334chr225738 587 495 104 79 ------
NM_153350chr1651145 509 444 195 46 ------
NM_153357chr17149 ------
NM_153360chr202543 209 ------
NM_153499chr1222021 31 ------
NM_153500chr1222021 31 ------
NM_153607chr5----12712 --
NM_153620chr721164 435 ----11559
NM_153631chr7----11127 --
NM_153632chr7----11127 --
NM_153649chr132254 1803 1554 --11438 1196
NM_153697chr25824 703 560 280 175 ------
NM_153715chr72450 132 --1287 --
NM_153759chr221073 984 ------
NM_153812chr162108 816 563 337 260 52 --1585 --
NM_153827chr17167 --192 --
NM_170606chr71391 --11762 --
NM_170663chr17167 --192 --
NM_170674chr151508 ------
NM_170675chr151184 ------
NM_170676chr151184 ------
NM_170677chr151508 ------
NM_170692chr11229 ------
NM_170696chr1511182 ------
NM_170697chr1511182 ------
NM_170706chr131207 1005 815 --1209 --
NM_170774chr2041605 1526 1344 25 ------
NM_170775chr5----1104 --
NM_170782chr11411 ------
NM_171998chrX--1933 ----
NM_172057chr72278 55 ------
NM_172058chr811492 ------
NM_172059chr811492 ------
NM_172060chr811492 ------
NM_172070chr21813 ------
NM_172071chr1150 --12287 --
NM_172078chr7160 ------
NM_172079chr7160 ------
NM_172080chr7160 ------
NM_172081chr7160 ------
NM_172082chr7160 ------
NM_172083chr7160 ------
NM_172084chr7160 ------
NM_172127chr41105 ------
NM_172128chr4161 ------
NM_172200chr103464 152 92 ------
NM_172206chr172405 274 ----11555
NM_172226chr1222021 31 ------
NM_172315chr151508 ------
NM_172316chr151508 ------
NM_172337chr14----148 --
NM_172373chr13--11019 ----
NM_173075chr411733 ------
NM_173084chr3130 --1835 --
NM_173156chr111616 --1760 --
NM_173191chr1011318 --11042 --
NM_173192chr1011318 --11042 --
NM_173193chr1011318 --11042 --
NM_173194chr1011318 --11042 --
NM_173195chr1011318 --11042 --
NM_173198chr911193 ------
NM_173200chr911193 ------
NM_173214chr1617713 12260 --16370
NM_173475chr1611646 ------
NM_173492chr9374 68 40 ------
NM_173500chr1521291 1168 ------
NM_173502chr16------1151
NM_173511chr2--11084 ----
NM_173582chr1155350 5232 1491 1373 1236 --25099 1592 --
NM_173584chr11174 --1103 --
NM_173587chr112178 29 --1204 --
NM_173595chr1234229 1717 641 --23490 1310 15151
NM_173642chr176538 3594 2822 2709 2404 640 118 15789 17916 --
NM_173681chr741519 643 628 412 ------
NM_173825chr312721 ------
NM_173851chr843968 3432 1592 892 ------
NM_173872chr41831 --167 --
NM_174911chr82120 100 1639 1393 12489
NM_174934chr1173063 1129 900 823 453 286 129 12688 22827 2743 --
NM_174937chr10142 ------
NM_175629chr221073 984 ------
NM_175630chr21256 ------
NM_175709chr2242361 946 449 41 ------
NM_175736chr1232598 1097 1041 --15712 1949
NM_175747chr6163 --1888 --
NM_175852chr132670 2369 221 ------
NM_175854chr1321946 395 ------
NM_175920chr5156 ------
NM_176795chr111388 ------
NM_176871chr853206 2767 2605 2518 805 --53257 3048 2911 798 485 --
NM_177414chr111138 ------
NM_177441chr172792 74 --1295 --
NM_177549chr201422 ------
NM_177952chr141803 ------
NM_177991chr201231 ------
NM_177996chr2032555 2334 1129 --1639 --
NM_177999chr943053 2720 2437 1049 --22679 2564 13467
NM_178151chrX1182 --22833 531 --
NM_178152chrX1182 --22833 531 --
NM_178153chrX1182 --22833 531 --
NM_178167chr161310 --162 --
NM_178423chr71127 ------
NM_178425chr71127 ------
NM_178565chr811139 ------
NM_178585chr412417 ------
NM_178835chr41192 ------
NM_178839chr2146 ------
NM_178863chr161445 ------
NM_178864chr111639 ------
NM_180976chr621005 851 ------
NM_180977chr621005 851 ------
NM_181332chrX1326 ------
NM_181356chr63822 193 114 ------
NM_181458chr2----1993 --
NM_181459chr2--1452 ----
NM_181486chr121330 ------
NM_181509chr203172 103 35 ------
NM_181521chr1656934 6366 6330 2004 1817 --11582 --
NM_181528chr20163 ------
NM_181689chr202279 23 ------
NM_181784chr21168 ------
NM_181825chr222290 101 ------
NM_181838chr51600 ------
NM_181876chr421078 826 --1952 1365
NM_181897chr342058 2013 1928 614 12257 1364 --
NM_182498chr19----1258 --
NM_182507chr1241491 702 548 157 --2904 881 --
NM_182509chr1411118 --11663 --
NM_182527chr2251550 613 502 196 96 --21678 1593 --
NM_182540chrX----1168 --
NM_182565chr171171 --126 --
NM_182580chr122405 2034 --2890 842 --
NM_182594chr53439 321 183 ------
NM_182641chr1711934 1661 ----
NM_182700chr75573 501 482 279 210 ------
NM_182744chr131249 1030 958 1357 1399 1446
NM_182830chr14----1699 --
NM_182847chr2----1470 --
NM_182895chr225738 587 495 104 79 ------
NM_182917chr32393 170 ------
NM_182961chr61299 ------
NM_182970chr2044010 3182 2640 1465 --33151 3133 432 --
NM_183078chr6--13686 1398 --
NM_183243chr71106 ----1497
NM_183243chr71106 ----1497
NM_183419chr811316 --1103 --
NM_183425chr202438 372 1193 ----
NM_194248chr21871 --1724 --
NM_194259chr16----1440 --
NM_194260chr16----1440 --
NM_194261chr16----1440 --
NM_194278chr145964 489 253 126 38 1259 13173 --
NM_194313chr911651 --153 --
NM_194314chr125320 715 ------
NM_194315chr141023 1006 929 349 --1164 --
NM_194322chr21871 --1724 --
NM_194457chr141023 1006 929 349 --1164 --
NM_194458chr141023 1006 929 349 --1164 --
NM_194463chrX--2912 392 ----
NM_197939chr171181 ------
NM_197941chr522588 517 ------
NM_197955chr151135 ------
NM_198056chr331952 1555 315 --11600 --
NM_198057chrX31171 1003 278 ------
NM_198086chr14----1365 --
NM_198158chr342591 2541 1940 862 ------
NM_198159chr342591 2541 1940 862 ------
NM_198177chr342591 2541 1940 862 ------
NM_198178chr342591 2541 1940 862 ------
NM_198186chr9185 ------
NM_198187chr9185 ------
NM_198225chr101117 ------
NM_198240chr12----126 --
NM_198241chr32393 170 ------
NM_198242chr32393 170 ------
NM_198244chr32393 170 ------
NM_198270chrX12448 ------
NM_198291chr2041925 1435 736 543 --41776 1390 1277 44 --
NM_198334chr11----1163 --
NM_198335chr11----1163 --
NM_198376chr17------168
NM_198377chr17------168
NM_198378chr17------168
NM_198379chr17------168
NM_198380chr17------168
NM_198382chr17------168
NM_198383chr17------168
NM_198384chr17------168
NM_198385chr17------168
NM_198386chr17------168
NM_198387chr17------168
NM_198388chr17------168
NM_198390chr161290 1686 ----
NM_198396chr17------168
NM_198560chr373077 2997 2782 2641 2394 445 267 --1739 --
NM_198595chr464486 4232 3166 1986 1873 418 1817 1448 --
NM_198597chr101867 --1152 --
NM_198679chr952419 2106 987 732 143 ------
NM_198681chr151440 1312 376 141 118 --1273 1913
NM_198793chr313243 13998 ----
NM_198900chr1232598 1097 1041 --15712 1949
NM_198903chr5--1653 ----
NM_198904chr51388 1653 ----
NM_198956chr75573 501 482 279 210 ------
NM_198968chr1313070 ------
NM_198990chr73753 635 577 ------
NM_199039chr431105 976 110 ------
NM_199054chr1931895 270 91 ------
NM_199129chr202465 315 --1117 --
NM_199141chr19168 --1279 --
NM_199144chr2011299 ------
NM_199168chr104610 557 430 150 ------
NM_199169chr2032696 1386 776 --23162 21 11087
NM_199170chr2032696 1386 776 --23162 21 11087
NM_199171chr2032696 1386 776 --23162 21 11087
NM_199203chr2011299 ------
NM_199320chr4133 --1963 --
NM_199320chr4133 --1963 --
NM_199324chr4----1493 --
NM_199368chr20131 ------
NM_199437chr1121633 620 ------
NM_199438chr1121633 620 ------
NM_199439chr1121633 620 ------
NM_199454chr183783 2890 1339 1288 1208 1138 958 342 --1780 --
NM_199462chr174687 4372 3988 1990 1872 947 829 ------
NM_199487chr2011248 ------
NM_201280chr61623 ------
NM_201378chr83912 351 283 ------
NM_201379chr83912 351 283 ------
NM_201380chr83912 351 283 ------
NM_201381chr83912 351 283 ------
NM_201382chr83912 351 283 ------
NM_201383chr83912 351 283 ------
NM_201384chr83912 351 283 ------
NM_201412chr161167 ------
NM_201432chr1756049 992 961 937 100 --149 --
NM_201433chr1756049 992 961 937 100 --149 --
NM_201434chr17190 ------
NM_201437chr8--11061 ----
NM_201520chr1751780 1621 1601 734 195 ------
NM_201535chr141694 --1699 --
NM_201536chr141694 --1699 --
NM_201537chr141694 --1699 --
NM_201538chr141694 --1699 --
NM_201539chr141694 --1699 --
NM_201540chr141694 --1699 --
NM_201541chr141694 --1699 --
NM_201542chr11107 ------
NM_201568chr111616 --1760 --
NM_201569chr111616 --1760 --
NM_201575chr16154 ------
NM_201591chr411688 ------
NM_201592chr411688 ------
NM_201630chr12128 70 --1527 --
NM_201634chr531492 645 111 ------
NM_201995chr11----1707 --
NM_201998chr11----1772 --
NM_203305chr932494 2006 1016 ------
NM_203318chr17153 --11197 --
NM_203327chr2023818 709 --11304 --
NM_203377chr22133 --2428 41 --
NM_203378chr22133 --2428 41 --
NM_203382chr511370 --11083 --
NM_203422chr112964 24 ------
NM_203434chr931232 337 97 ------
NM_203504chr411807 ------
NM_203505chr411807 ------
NM_203506chr1752013 1675 768 364 117 --1632 --
NM_205768chr11720 ------
NM_205846chr511378 ------
NM_206594chr133464 2955 2786 ------
NM_206595chr133464 2955 2786 ------
NM_206819chr12136 ------
NM_206820chr12136 ------
NM_206821chr12136 ------
NM_206852chr141606 ------
NM_206853chr6----13395 --
NM_206854chr6----14656 --
NM_206855chr6----15621 --
NM_206857chr141606 ------
NM_206876chr223063 654 ------
NM_206907chr5----2586 423 --
NM_206909chr835125 3349 2475 ------
NM_206944chr92233 158 ------
NM_206945chr92233 158 ------
NM_206946chr92233 158 ------
NM_206947chr92233 158 ------
NM_207012chr1023253 3000 --12966 --
NM_207042chr13179 124 57 ------
NM_207045chr13179 124 57 ------
NM_207046chr13179 124 57 ------
NM_207123chr41671 ------
NM_207171chr1----11710 --
NM_207292chr313312 ------
NM_207293chr313312 ------
NM_207294chr313312 ------
NM_207295chr313312 ------
NM_207296chr313312 ------
NM_207297chr313337 ------
NM_207305chr9164 ------
NM_207343chr11157 ------
NM_207362chr21188 ------
NM_207371chr101163 --11164 --
NM_207380chr1583394 3324 2630 2589 1129 1113 571 284 --21104 432 --
NM_207406chr42946 320 11414 ----
NM_207412chr831189 1160 596 ------
NM_207429chr11----1429 --
NM_207442chr142879 344 1111 ----
NM_207445chr152680 214 ------
NM_207518chr1921309 1121 ------
NM_207645chr11----1543 --
NM_212464chr1522039 834 --1637 --
NM_212469chr112867 856 ------
NM_212551chr11217 ------
NM_213594chr121267 1113 ----
NM_213606chr1042671 2027 1775 337 ------
NM_213651chr1--1156 ----