TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3940-5p
miRNA Sequence: GUGGGUUGGGGCGGGCUCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr861598 955 452 435 231 59 --22218 558 --
NM_000074chrX6834 681 601 234 101 73 ------
NM_000092chr254204 3882 1813 1479 744 11600 ----
NM_000093chr982044 1966 1811 646 492 299 164 33 12335 1317 --
NM_000104chr212429 32893 1199 389 ----
NM_000114chr2031247 1164 1070 11300 1822 --
NM_000125chr674238 3868 3199 3128 1697 347 291 11405 14278 --
NM_000168chr793262 2811 2801 2654 2194 2071 2060 1144 1029 --13276 --
NM_000176chr513407 22567 1405 --12802
NM_000192chr1241254 978 972 466 1556 --11005
NM_000202chrX53634 3385 2511 2409 507 3772 289 124 11131 --
NM_000208chr1983090 2967 1797 1738 1658 1465 445 77 11436 14624 12961
NM_000210chr242369 2189 315 273 --1238 --
NM_000217chr12114758 3676 3548 1914 1837 1598 916 790 666 368 73 25282 1362 --14383
NM_000222chr441995 747 122 94 1422 ----
NM_000232chr452366 1049 744 369 91 11265 12617 --
NM_000240chrX42028 1811 1750 1641 11413 1221 --
NM_000244chr117662 286 179 155 68 60 35 1298 1690 187
NM_000245chr761711 795 738 595 392 355 11749 --11862
NM_000248chr392886 2720 2435 2357 2260 2033 449 440 134 --11023 --
NM_000259chr15126164 5701 5379 4875 4406 4140 2517 2404 1943 1579 996 55 25254 4656 ----
NM_000267chr1783421 3331 2857 2620 738 469 154 122 ------
NM_000278chr10112176 2066 1773 923 810 710 429 326 237 153 144 1688 ----
NM_000284chrX41751 1609 809 79 21576 1264 ----
NM_000304chr172307 188 3740 107 93 1728 --
NM_000325chr4150 --1602 --
NM_000332chr666531 4777 4438 1932 1032 535 26540 5570 22558 2173 --
NM_000335chr382006 1728 1616 1424 623 473 414 127 32079 1737 61 21962 1741 --
NM_000337chr586254 5750 5564 5404 4775 1580 1569 712 1998 35466 5233 907 --
NM_000367chr672128 1856 1756 1509 1428 449 413 11545 ----
NM_000368chr944703 4352 3835 214 54559 1798 1302 1296 248 24724 3198 --
NM_000369chr1431366 628 72 2599 176 1603 --
NM_000376chr1292687 2376 2241 2192 2065 829 588 112 86 32970 605 247 42466 1247 1242 145 1167
NM_000408chr263451 2905 2765 2189 1194 518 --13485 --
NM_000430chr1732547 2447 1167 21402 174 21378 684 --
NM_000461chr3104632 4095 3738 3442 2847 1305 830 701 387 265 --13195 --
NM_000462chr1521484 662 1487 1709 --
NM_000489chrX53214 2898 1271 456 280 184 12962 11367
NM_000508chr41296 --1861 196
NM_000533chrX41826 786 648 640 ------
NM_000555chrX127500 6000 5796 5749 4985 2260 1997 1975 1802 1446 1277 403 27267 39 36784 3129 2741 12610
NM_000599chr2134131 3813 3640 3313 3273 2941 1760 1272 1185 1112 871 418 46 22820 1369 21132 461 --
NM_000609chr10123069 2905 2621 2403 1194 1174 1120 823 597 427 373 40 21937 1026 11988 --
NM_000611chr11156936 6697 6518 6164 5936 5829 5737 5455 5288 5004 4776 2595 2365 313 133 11973 14575 --
NM_000612chr11143847 3524 3393 3211 3196 3088 3029 813 785 740 339 314 129 26 13363 1681 13773
NM_000618chr1296485 5841 5371 4516 2436 1438 576 441 387 15692 25992 5177 2790 752
NM_000618chr1296485 5841 5371 4516 2436 1438 576 441 387 15692 25992 5177 2790 752
NM_000633chr1854757 4337 3560 1208 831 --13866 --
NM_000680chr8--1141 2419 145 1307
NM_000719chr12136602 6344 6251 6145 5987 5769 4854 4696 4464 2618 2331 2045 1010 34290 2596 1756 25968 473 --
NM_000721chr182542 2027 2017 1930 884 659 509 171 --31855 1822 1065 --
NM_000729chr3285 37 --146 124
NM_000767chr1931110 323 299 1451 ----
NM_000793chr1474586 4488 4331 1400 467 426 71 24799 4002 ----
NM_000813chr533657 2247 2235 --189 --
NM_000814chr1594111 3952 3535 3203 2878 1445 1332 704 475 --11300 --
NM_000824chr44906 734 642 263 1747 ----
NM_000827chr5132413 2181 2110 2069 2007 1814 1759 1003 835 529 448 265 49 --1687 --
NM_000828chrX--11862 21806 1638 --
NM_000829chr1151751 458 215 101 61 1188 ----
NM_000831chr1185815 5421 5410 5401 4930 4646 4609 4595 3895 1172 984 845 697 579 385 324 292 277 14285 25889 5506 --
NM_000844chr331038 221 61 1268 ----
NM_000849chr173066 3003 2826 1938 1125 1101 866 ------
NM_000868chrX62265 2035 1967 1705 544 136 11656 1847 --
NM_000875chr15116454 6076 4308 2793 2171 1638 1513 1022 963 876 864 15368 183 --
NM_000899chr12114343 3862 3225 3207 3133 2888 1736 1659 1619 1609 495 11425 ----
NM_000912chr843409 552 437 68 --2968 410 12424
NM_000958chr52915 532 1824 1115 --
NM_000962chr933112 2135 1916 --1271 --
NM_000963chr122263 2010 ----11901
NM_000990chr1183980 3391 3334 3104 2692 1411 1217 104 23000 1073 13014 23657 410
NM_001001323chr1283189 2590 2583 2405 2374 1991 519 259 ----12559
NM_001001331chr352731 2580 2159 1854 350 --52208 2037 1895 458 88 --
NM_001001396chr1104497 3886 3703 3610 3078 2993 1698 573 496 63 1989 ----
NM_001001549chr751950 904 594 190 106 12796 1465 --
NM_001001550chr751950 904 594 190 106 12796 1465 --
NM_001001555chr751950 904 594 190 106 12796 1465 --
NM_001001872chr142504 84 --1246 --
NM_001002257chr293510 2897 1195 1138 1011 487 363 312 29 --1897 --
NM_001002860chr1434458 3271 1191 162 1413 --
NM_001003652chr18138663 7886 7671 7159 6646 6457 5803 5726 2661 2512 2232 1855 45 57575 6590 6565 5886 2125 ----
NM_001003712chr1263991 3591 2762 637 270 115 ------
NM_001003800chr983181 2352 968 664 655 596 582 54 23584 325 ----
NM_001003940chr15113677 3087 3032 2991 2835 2819 2413 1215 473 417 371 11505 13128 --
NM_001003942chr15113677 3087 3032 2991 2835 2819 2413 1215 473 417 371 11505 13128 --
NM_001003943chr15113681 3091 3036 2995 2839 2823 2417 1219 477 421 375 11509 13132 --
NM_001004065chr993259 3227 3180 2647 2425 612 235 116 109 13994 1590 --
NM_001004304chr1292702 2522 2508 2128 2082 536 435 316 123 11215 --1957
NM_001004317chr643596 1303 423 389 1921 11743 --
NM_001004342chr1155558 5536 5117 5005 4613 4491 4113 4042 3839 3752 3724 1699 918 118 83 34422 2355 554 12276 1997
NM_001004419chr1274263 4216 4045 3589 3546 2838 1732 12933 ----
NM_001005386chr23938 77 69 ------
NM_001005473chr576549 5771 5079 4682 2589 1504 360 36341 6128 5576 15025 11416
NM_001005502chr1284892 4432 3788 3516 1864 1829 78 71 --21115 23 --
NM_001005609chrX53617 3548 3289 1252 282 13203 13207 21507 1196
NM_001006600chr551838 1820 1600 838 353 21736 103 ----
NM_001007023chr1474586 4488 4331 1400 467 426 71 24799 4002 ----
NM_001007075chr43933 282 105 ------
NM_001007097chr974908 4693 3655 3597 3591 3541 1225 --24489 3102 --
NM_001007156chr1531536 1391 477 ----1347
NM_001008220chr593868 3490 3265 2915 2566 2449 598 400 368 --23403 576 --
NM_001008239chr1843660 3224 2559 126 ------
NM_001008392chr393208 3192 3178 3142 2663 2387 1154 690 614 22600 370 33488 2799 374 --
NM_001008408chr7135760 5528 5266 4727 4609 4118 2404 1715 1688 1028 759 630 473 --24533 2515 --
NM_001008660chr114297 270 253 137 177 ----
NM_001008701chr1992957 2655 2174 2145 1225 1172 1009 717 254 --42397 1126 737 302 12673
NM_001008738chr561919 1882 958 947 732 524 22440 2033 ----
NM_001008801chr1961539 838 562 334 126 43 --1754 --
NM_001008925chr453242 3217 2797 2618 2295 1619 ----
NM_001009555chr451694 1383 567 203 38 ------
NM_001009899chr356313 5472 5448 2494 1676 11850 ----
NM_001009959chr272302 2244 1821 1747 1058 682 153 ------
NM_001010867chr1166407 6383 6152 5644 5474 5223 4939 4568 2646 2060 1534 1525 1456 1075 873 231 26424 5122 ----
NM_001010888chrX74089 1733 1435 1200 491 324 139 24424 273 23567 1402 13594
NM_001010986chrX21627 264 1245 ----
NM_001011513chr463540 2843 2611 1520 1339 728 23630 320 13280 13208
NM_001011666chr785343 2626 1232 1051 804 435 315 84 --25985 4589 --
NM_001012264chr143680 260 22 --1966 --
NM_001012426chr6133387 3350 3191 2620 2400 830 648 562 385 202 81 73 53 --12311 --
NM_001012427chr6133387 3350 3191 2620 2400 830 648 562 385 202 81 73 53 --12311 --
NM_001012643chr194548 230 185 31 --1385 --
NM_001012755chrX124562 3371 3298 3115 1995 1599 1410 1262 1102 264 149 118 33286 3264 171 ----
NM_001013415chr421536 1513 ----11373
NM_001013746chr75939 759 597 512 426 11772 --12021
NM_001013839chr1772450 2216 2019 1964 1590 917 182 --31702 982 395 --
NM_001014434chr12661 104 ------
NM_001014797chr1098146 7800 7594 6726 5675 2393 625 83 41 --36281 5566 2168 --
NM_001015877chrX52689 1973 1085 248 113 ------
NM_001015887chr31421 21639 291 11391 --
NM_001017368chr1742364 2175 501 318 22791 194 1351 --
NM_001017395chr343505 3366 2572 339 1385 12284 1751
NM_001017440chr7187942 7628 7528 7342 7222 6499 6399 5982 5389 2842 2835 2662 2539 1908 1002 694 570 439 46465 5573 1301 141 35484 5125 1879 21119 405
NM_001017535chr1292687 2376 2241 2192 2065 829 588 112 86 32970 605 247 42466 1247 1242 145 1167
NM_001018057chr1121446 410 ------
NM_001018065chr974713 1737 391 236 202 147 60 34328 2306 314 11092 --
NM_001018066chr974713 1737 391 236 202 147 60 34328 2306 314 11092 --
NM_001018067chr184169 3882 3298 1851 1782 1020 669 21 12101 13903 --
NM_001018068chr184169 3882 3298 1851 1782 1020 669 21 12101 13903 --
NM_001018069chr184169 3882 3298 1851 1782 1020 669 21 12101 13903 --
NM_001018074chr513407 22567 1405 --12802
NM_001018075chr513407 22567 1405 --12802
NM_001018076chr513407 22567 1405 --12802
NM_001018077chr513407 22567 1405 --12802
NM_001018111chr7103300 3224 2995 1194 1146 1020 742 202 159 127 --11095 --
NM_001020825chr51882 142 --1277
NM_001024094chr513407 22567 1405 --12802
NM_001024226chr14981 895 889 370 2430 395 1262 --
NM_001024227chr14981 895 889 370 2430 395 1262 --
NM_001024228chr14981 895 889 370 2430 395 1262 --
NM_001024647chr12127746 6430 6286 5337 2928 2289 2165 1831 1672 1533 1436 1071 55808 5440 5434 2791 1039 ----
NM_001024808chr1272290 1887 1090 1011 770 595 146 22537 137 12613 --
NM_001024858chr1472988 2889 2791 2640 2157 1878 503 --155 --
NM_001024912chr1951801 1278 626 429 54 1347 162 --
NM_001024956chr1175610 5350 5285 3956 3939 1461 697 22325 1587 25049 1691 --
NM_001025076chr10115043 4549 4381 4362 2190 1999 1780 1437 1372 950 687 14750 25704 702 --
NM_001025077chr1096401 5907 5739 5720 2795 2730 2308 2045 1194 16108 37062 4673 2060 --
NM_001025079chr353393 3130 1163 1046 714 11658 1437 --
NM_001025108chr284131 4017 3500 2821 1111 857 714 704 23088 2758 11554 --
NM_001025266chr363542 3199 3133 1659 811 33 --3784 673 576 --
NM_001025595chr411303 ----156
NM_001029858chr641271 381 234 187 --134 --
NM_001029863chr651116 1048 566 558 304 13025 ----
NM_001029875chr562731 2509 2086 1999 745 21 32114 463 55 11878 --
NM_001030006chr1772701 2138 1757 1682 942 843 157 --12219 --
NM_001030055chr1484469 4216 1030 620 589 466 348 255 11140 1703 --
NM_001031680chr1102108 1988 1786 1666 720 569 468 426 336 47 --1625 --
NM_001031681chr1792369 2009 1502 791 632 211 182 88 66 --12140 --
NM_001031695chr2284990 4157 3606 3437 911 803 538 33 14335 ----
NM_001031732chr421135 197 33351 2960 181 13542 --
NM_001031804chr16104238 3552 3383 2903 1507 1202 872 799 563 159 --1587 --
NM_001033045chr2104145 3419 3260 3084 1521 1467 1298 1278 688 96 13623 ----
NM_001033059chr61405 11596 --1307
NM_001033117chr374122 3116 1862 1668 1580 1004 242 1930 11962 --
NM_001033551chr17113776 3708 3670 3477 3413 3266 3247 2831 1634 724 285 --21609 616 --
NM_001034954chr1072861 2749 2024 1306 1284 1217 548 2395 151 ----
NM_001034955chr1072861 2749 2024 1306 1284 1217 548 2395 151 ----
NM_001034956chr1072861 2749 2024 1306 1284 1217 548 2395 151 ----
NM_001034957chr1072861 2749 2024 1306 1284 1217 548 2395 151 ----
NM_001035003chr431116 223 146 21415 25 ----
NM_001035004chr431116 223 146 21415 25 ----
NM_001037174chr261885 1876 1622 880 633 330 11459 ----
NM_001037290chr111980 --1674 --
NM_001037334chr18167 ----1159
NM_001037339chr141233 651 395 340 --171 --
NM_001037340chr141233 651 395 340 --171 --
NM_001037341chr141233 651 395 340 --171 --
NM_001037341chr141233 651 395 340 --171 --
NM_001037553chr21114858 4407 4307 3910 3506 3421 3367 3338 3171 925 715 155 11360 --
NM_001037954chr1182870 2729 1102 879 813 521 494 473 ------
NM_001039199chr2073895 3668 1641 1460 688 645 148 11742 --1754
NM_001039538chr253436 2909 2762 2583 1004 22805 349 --1993
NM_001039547chr387578 7317 6514 5682 2850 2692 2137 76 26699 5859 25826 5149 --
NM_001039570chr22114450 3876 3764 3711 3195 3173 2871 1555 1073 963 62 23580 2883 23856 3812 --
NM_001039571chr22114450 3876 3764 3711 3195 3173 2871 1555 1073 963 62 23580 2883 23856 3812 --
NM_001039577chr154067 3910 3759 3580 860 11428 2839 65 --
NM_001039590chrX42958 445 170 59 22737 2578 11384 --
NM_001039591chrX42958 445 170 59 22737 2578 11384 --
NM_001039618chr1165474 4294 1728 286 172 44 14889 ----
NM_001039690chr1692214 2118 1505 905 595 430 245 203 36 1276 --2711 474
NM_001039937chr1374124 3596 3424 3170 2617 981 314 ------
NM_001040001chr631807 1680 239 --11948 --
NM_001040102chr1082720 2586 2475 2389 2351 2215 185 54 22166 1850 --1106
NM_001040103chr1082720 2586 2475 2389 2351 2215 185 54 22166 1850 --1106
NM_001040108chr1442853 2210 2120 677 --1105 1829
NM_001040114chr162127 97 170 2310 80 --
NM_001040144chr1692214 2118 1505 905 595 430 245 203 36 1276 --2711 474
NM_001040146chr1692214 2118 1505 905 595 430 245 203 36 1276 --2711 474
NM_001040151chr1183761 3251 2876 2850 1379 1237 1077 260 --24254 3485 24504 3557
NM_001040152chr754750 4427 1781 1049 271 44043 3280 3263 764 13631 --
NM_001040202chr432456 2013 841 ------
NM_001040272chr972210 1890 580 538 531 333 132 172 12286 --
NM_001040273chr1071907 1535 1515 474 390 366 282 21952 85 21296 826 --
NM_001040284chr1655339 2057 1816 1454 1068 13782 ----
NM_001040402chr463062 2766 2630 2565 2197 1101 ------
NM_001040429chr1343085 3071 2241 78 23195 2373 ----
NM_001040441chr175211 4657 3978 1834 1263 520 266 35319 4309 3857 25328 470 --
NM_001040450chr1582849 2375 1983 1817 685 539 511 307 12105 --12061
NM_001040453chr1582849 2375 1983 1817 685 539 511 307 12105 --12061
NM_001040624chr872376 2181 2162 1810 971 699 333 21962 1777 ----
NM_001040625chr872376 2181 2162 1810 971 699 333 21962 1777 ----
NM_001040626chr872376 2181 2162 1810 971 699 333 21962 1777 ----
NM_001040627chr872376 2181 2162 1810 971 699 333 21962 1777 ----
NM_001040628chr872376 2181 2162 1810 971 699 333 21962 1777 ----
NM_001040629chr872376 2181 2162 1810 971 699 333 21962 1777 ----
NM_001040630chr872376 2181 2162 1810 971 699 333 21962 1777 ----
NM_001040665chr763764 3174 1347 985 780 254 23940 1780 ----
NM_001042404chr131990 736 170 --11712 --
NM_001042413chr953165 1017 499 471 297 ----1101
NM_001042424chr482714 2613 2567 2524 2366 875 208 94 ------
NM_001042453chrX41141 80 55 36 --11580 --
NM_001042476chr1662164 1617 1507 772 288 213 --1351 --
NM_001042486chr2071203 1105 605 524 345 290 82 ------
NM_001042492chr1783421 3331 2857 2620 738 469 154 122 ------
NM_001042494chr1573488 3039 2743 2585 2434 2344 674 1668 ----
NM_001042495chr1573488 3039 2743 2585 2434 2344 674 1668 ----
NM_001042496chr1573488 3039 2743 2585 2434 2344 674 1668 ----
NM_001042497chr1573488 3039 2743 2585 2434 2344 674 1668 ----
NM_001042510chr831897 1773 286 ------
NM_001042511chr831897 1773 286 ------
NM_001042533chr353334 977 596 442 245 12301 ----
NM_001042599chr297597 7430 6106 5813 2634 2170 1932 1017 527 32880 2870 1892 --1578
NM_001042603chr1264676 4392 1285 1115 975 710 21929 1886 ----
NM_001042683chr661808 1599 1234 542 482 84 ------
NM_001042749chrX31897 1576 705 21701 616 11283 --
NM_001042750chrX31897 1576 705 21701 616 11283 --
NM_001042751chrX31897 1576 705 21701 616 11283 --
NM_001043318chr1443408 2684 1412 278 --11448 --
NM_001044385chr253605 3559 3384 2766 32 1573 ----
NM_001046chr563046 2141 1128 672 598 23 ------
NM_001048183chr183659 3038 3014 2670 2566 2444 905 465 3708 428 393 ----
NM_001071775chr1331473 1220 357 ------
NM_001083621chr173844 3473 3313 1854 1490 1104 635 --13362 --
NM_001092chr1762214 2034 328 187 99 41 --163 1381
NM_001099678chr365796 4938 4192 1432 698 481 26044 5137 25734 744 --
NM_001100108chr186726 6249 5639 5614 5336 5172 2173 1030 32815 1370 1120 21124 293 --
NM_001106chr3128555 7966 7738 7309 7284 7133 6672 6465 3498 1918 822 380 1402 ----
NM_001146chr822057 465 11489 ----
NM_001167chrX64976 4422 4221 1931 1677 1256 1986 --15204
NM_001173chr1484469 4216 1030 620 589 466 348 255 11140 1703 --
NM_001186chr2131053 243 213 11083 ----
NM_001204chr2106948 6329 6094 5911 5702 2905 2008 1500 1266 1122 17679 ----
NM_001219chr762017 1946 1722 1514 355 195 --1314 --
NM_001256chr1742801 2689 1889 832 12990 --12238
NM_001259chr742268 2144 596 336 11278 --14544
NM_001282chr1772701 2138 1757 1682 942 843 157 --12219 --
NM_001289chrX2231 113 11051 ----
NM_001290chr43934 777 21 1392 ----
NM_001304chr175913 796 764 672 378 1433 23104 448 11029
NM_001310chr1252561 2200 1127 739 604 ----11928
NM_001331chr1182550 2285 2279 734 690 654 159 131 ------
NM_001346chr352676 1988 1775 347 276 12785 --12137
NM_001387chr562598 2576 2547 2225 2096 2068 2663 93 12610 --
NM_001390chr18113241 3234 2857 2717 2460 2304 741 717 617 585 367 ------
NM_001399chrX53617 3548 3289 1252 282 13203 13207 21507 1196
NM_001401chr93631 359 197 --21163 110 --
NM_001419chr19104491 4477 3880 3725 3600 3486 3227 1313 1076 657 --34402 3292 79 --
NM_001420chr1972927 2825 2792 2484 981 893 107 13067 22797 776 --
NM_001421chrX41519 1410 1278 28 --21390 1185 --
NM_001430chr251900 1513 1371 1363 597 ------
NM_001438chr133391 2609 581 23631 57 12402 --
NM_001453chr661537 1506 1495 1272 248 58 194 ----
NM_001465chr531361 773 196 1376 ----
NM_001498chr641237 994 484 67 --1285 --
NM_001634chr61405 11596 --1307
NM_001650chr18103822 3617 3375 3300 1541 1471 875 649 489 181 33918 1263 324 ----
NM_001655chr1172131 2010 1364 858 590 432 391 11653 --11490
NM_001658chr14981 895 889 370 2430 395 1262 --
NM_001660chr33811 778 274 ------
NM_001682chr1262903 2304 2297 2119 2088 233 ----12273
NM_001683chr352731 2580 2159 1854 350 --52208 2037 1895 458 88 --
NM_001684chr1104214 3603 3420 3327 2795 2710 1674 1415 290 213 1706 ----
NM_001695chr853782 3199 2992 2978 25 12702 13286 --
NM_001709chr1162381 2133 1999 1861 1106 1036 --22008 1160 --
NM_001753chr771539 709 702 606 513 359 211 21334 1240 ----
NM_001759chr1275332 4846 4315 3976 3931 2085 789 1453 14551 --
NM_001777chr353393 3130 1163 1046 714 11658 1437 --
NM_001789chr351766 423 393 166 138 ----130
NM_001830chrX42928 2512 1461 201 13691 --12768
NM_001845chr133987 855 523 ----1265
NM_001859chr973766 3233 2659 1419 714 471 309 22416 479 --11251
NM_001874chr1284892 4432 3788 3516 1864 1829 78 71 --21115 23 --
NM_001884chr53472 104 77 ------
NM_001918chr1158094 7897 7019 6981 6714 6678 6630 3644 3586 3110 3083 2838 2559 1995 1331 11826 16261 --
NM_001939chrX103297 3200 1335 1297 913 774 699 424 249 79 22611 1173 2456 275 --
NM_001945chr521446 1093 1951 --11433
NM_001969chr1463541 2814 2772 2533 1338 1267 23754 160 1487 1867
NM_001982chr1281202 1098 1048 862 442 403 212 100 ------
NM_001999chr521073 455 2519 260 --11257
NM_002006chr465357 4980 3949 2003 1985 586 --14278 1369
NM_002015chr1353039 2896 2890 275 91 12097 ----
NM_002025chrX95681 2865 2851 2179 2142 1874 740 517 300 48859 8523 5858 5807 25641 33 12169
NM_002035chr1893337 3050 2803 2727 1252 1023 629 587 555 168 12561 --
NM_002040chr2112288 1646 11168 1814
NM_002126chr1774018 3420 3399 3293 2691 661 79 33606 3003 1363 ----
NM_002128chr132704 49 12151 165 --
NM_002146chr1741312 253 224 70 1479 1209 --
NM_002158chr22449 343 --11155 --
NM_002210chr242311 648 155 34 22642 92 21124 709 --
NM_002214chr774218 3708 2149 2111 1241 1089 542 14156 24958 4899 14274
NM_002242chr21398 2598 224 --31629 794 681
NM_002254chr292332 1856 1495 838 639 556 525 429 56 11599 ----
NM_002267chr1332366 1812 813 ------
NM_002271chr1382405 2140 2035 1766 1565 682 586 257 22318 464 ----
NM_002285chr284131 4017 3500 2821 1111 857 714 704 23088 2758 11554 --
NM_002310chr586321 4138 2471 2133 1959 1927 1189 804 1215 1205 1671
NM_002336chr1264940 3297 691 629 595 292 34676 3923 557 ----
NM_002351chrX3599 588 551 1688 ----
NM_002374chr253436 2909 2762 2583 1004 22805 349 --1993
NM_002387chr564674 3495 3217 1773 1333 1033 ----1149
NM_002392chr123211 63 45 ------
NM_002395chr63943 347 275 ------
NM_002429chr1271530 1037 293 267 236 183 36 11290 ----
NM_002430chr2262429 2208 2163 988 255 70 ------
NM_002444chrX61236 598 152 108 76 67 --31999 1616 1340 --
NM_002467chr83332 97 89 ------
NM_002474chr162127 97 170 2310 80 --
NM_002481chr1167857 7246 6412 6362 6181 5629 3177 2918 2250 1793 1756 1565 1482 1356 620 394 36990 5068 2153 47366 7033 6199 1318 --
NM_002501chr19114042 3712 3639 3395 3373 3256 2831 1401 949 193 177 --43522 224 132 127 --
NM_002519chr1131498 1343 40 ----1315
NM_002522chr1783191 3021 2692 2543 1230 948 475 169 23634 3034 53038 1269 1080 1075 912 --
NM_002570chr1541298 1260 1234 267 ------
NM_002577chr353437 3077 2708 2565 857 ------
NM_002581chr985312 3612 1813 1776 942 757 695 44 2879 421 --11394
NM_002583chr122527 416 ------
NM_002600chr141233 651 395 340 --171 --
NM_002609chr571817 1684 1668 665 302 259 205 --21577 1341 --
NM_002613chr1694759 4679 4052 3976 1446 1238 1017 805 277 --23586 297 --
NM_002618chr21449 ----186
NM_002645chr1162955 2678 2400 2319 952 451 12703 ----
NM_002655chr8104792 4764 4699 4670 4466 4273 4171 3600 1423 1226 21569 428 ----
NM_002657chr20103516 3074 3048 2749 1496 1482 675 411 394 199 --13063 --
NM_002662chr331917 1907 289 11853 11966 1115
NM_002698chr1992756 1203 920 814 807 745 738 585 41 ----12875
NM_002730chr1991331 932 456 386 313 271 263 255 159 1899 1281 --
NM_002737chr17115761 4757 2670 2397 2272 1170 526 266 71 41 34 55374 4469 591 556 429 15945 --
NM_002745chr2294377 4224 4195 3469 3307 3251 467 207 91 --11083 --
NM_002855chr1193531 3077 2835 2530 1442 1151 154 126 44 1476 23622 753 --
NM_002886chr364845 1994 1785 1081 1058 606 11486 24608 3324 --
NM_002890chr53876 237 176 1143 ----
NM_002941chr331227 412 192 11621 11545 --
NM_002959chr1114291 4111 3673 3235 2941 2844 2831 385 336 105 22 24354 4227 ----
NM_002977chr232714 2698 1076 12949 --13040
NM_002996chr16111953 1590 1496 786 499 479 409 330 319 287 230 --1221 --
NM_003011chr9125 --11622 --
NM_003012chr862578 2312 1192 526 123 73 22789 1173 ----
NM_003016chr1731433 745 38 21497 1324 ----
NM_003017chr631168 1086 950 1503 ----
NM_003028chr9113470 3013 2971 2528 1513 1403 1337 1026 835 567 217 1270 2913 75 --
NM_003042chr371892 1686 1631 677 584 235 22 --195 --
NM_003043chr3153937 3739 3690 3597 3439 3261 3067 3036 2983 1599 1343 655 570 554 228 33548 2710 1432 33508 3364 864 --
NM_003045chr1373778 3737 1776 432 295 151 35 --33499 1073 158 13495
NM_003099chr15116385 5908 5427 4635 2080 1341 1248 839 671 110 23 14512 --15306
NM_003108chr257207 6153 4648 2722 2345 --25543 2901 --
NM_003112chr732445 827 750 ------
NM_003144chr662248 1870 1833 757 361 104 1672 ----
NM_003155chr831891 205 24 22171 1745 21053 1043 --
NM_003161chr173732 502 255 12544 1957 --
NM_003189chr183358 3033 2422 2167 908 828 728 629 21148 1119 23313 2624 --
NM_003199chr18105622 5148 4487 4034 2137 1816 1039 841 96 74 --1284 --
NM_003247chr63211 193 151 1160 11575 --
NM_003262chr354486 2035 859 599 433 --14135 --
NM_003298chr3125846 5080 5071 4529 3988 3892 2395 2304 2037 1378 690 530 1245 14709 15682
NM_003309chr641887 681 447 154 ------
NM_003319chr21745 ----1119
NM_003320chr1173614 2749 1153 863 717 311 71 11010 1854 --
NM_003337chr531224 658 140 ------
NM_003338chr1021638 1478 --1471 --
NM_003339chr551531 640 613 396 97 1407 ----
NM_003369chr1172782 2461 2276 2162 1826 639 70 11884 12154 --
NM_003387chr252545 2077 889 682 616 12609 --12343
NM_003392chr364199 3526 1736 1641 1013 24 --1989 1938
NM_003400chr22788 36 --1769 --
NM_003410chrX2926 808 13112 12755 12221
NM_003412chr372188 1052 287 173 145 117 97 1625 ----
NM_003430chr1971705 1275 437 369 331 247 88 ------
NM_003458chr383572 3301 3288 2599 1126 1095 728 308 --24064 3187 --
NM_003463chr632930 990 159 --32715 2107 184 --
NM_003466chr282452 2419 2326 2250 1787 845 740 409 21730 923 22495 446 --
NM_003468chr264101 4033 3979 1350 950 323 13367 ----
NM_003470chr1641159 608 477 375 ----1485
NM_003471chr34363 194 178 111 1321 11751 12055
NM_003482chr12142322 2110 2036 1022 994 960 828 749 437 369 193 171 99 46 12329 1402 --
NM_003483chr1241858 927 697 302 22300 2179 1479 --
NM_003489chr213941 452 418 ------
NM_003505chr741976 1663 115 83 --1143 --
NM_003574chr1855285 4289 4172 1923 557 ------
NM_003607chr193998 3833 3801 3737 3348 1349 1320 890 470 ------
NM_003617chr164865 4284 1948 1867 1119 54 43995 1986 1396 848 24810 4395 --
NM_003629chr173180 2974 2665 2340 1191 802 622 --13054 --
NM_003644chr17196473 6187 6087 4696 4651 4592 4198 4156 4145 2531 2309 1466 1451 1275 782 606 492 204 198 --21548 729 --
NM_003671chr953638 3064 1342 1079 868 22427 646 ----
NM_003716chr33923 787 74 ------
NM_003718chr72543 375 ----175
NM_003728chr4187 ----1242
NM_003743chr252198 526 487 472 393 22265 656 ----
NM_003758chr1531227 134 44 2239 209 ----
NM_003758chr1531227 134 44 2239 209 ----
NM_003759chr463617 3515 2628 1558 1428 770 11408 23873 3311 --
NM_003762chr131222 1032 76 11173 ----
NM_003819chr1134 ----153
NM_003829chr9------2176 28
NM_003872chr252658 1221 810 741 581 32151 1096 499 --22421 364
NM_003873chr1041623 888 411 283 21765 351 1793 --
NM_003877chr122806 628 ----1740
NM_003888chr1521403 27 31366 1349 628 21564 1353 --
NM_003895chr215735 716 555 354 323 --11888 --
NM_003899chr1352146 2028 1870 1860 186 165 1229 --
NM_003913chr632900 1425 1366 ------
NM_003924chr42206 182 --1519 --
NM_003932chr2231645 1261 412 21881 1838 145 --
NM_003939chr10123816 3394 3086 1603 1378 1363 884 810 682 463 429 37 --44108 3922 3380 521 --
NM_003968chr32274 28 ------
NM_003983chr1693960 3500 2708 1344 1093 1087 863 183 80 33865 1080 109 ----
NM_003987chr10112176 2066 1773 923 810 710 429 326 237 153 144 1688 ----
NM_003989chr10112112 2002 1709 859 746 646 365 262 173 89 80 1624 ----
NM_003990chr10112112 2002 1709 859 746 646 365 262 173 89 80 1624 ----
NM_003994chr12114343 3862 3225 3207 3133 2888 1736 1659 1619 1609 495 11425 ----
NM_004028chr18103822 3617 3375 3300 1541 1471 875 649 489 181 33918 1263 324 ----
NM_004035chr1755052 4384 3283 1669 1435 11735 11602 154
NM_004050chr1462771 2533 2385 1684 602 316 12478 ----
NM_004067chr721282 1019 21238 474 ----
NM_004112chr1741721 1442 533 61 ------
NM_004113chr341356 415 380 82 ------
NM_004117chr63515 288 156 22234 1590 167 11447
NM_004124chr1443492 3003 2927 453 --12854 --
NM_004157chr34902 682 638 602 --2247 185 1883
NM_004171chr11129345 9221 9024 7212 7030 6851 6437 6209 6031 5908 3792 2713 89624 7318 3820 3253 3204 2733 1638 902 27727 6868 13258
NM_004187chrX51399 1310 1063 993 402 ------
NM_004227chr762714 2649 2563 1939 718 21 135 12116 --
NM_004232chr1852582 1130 1105 801 359 13095 ----
NM_004274chr1453091 2998 2814 951 294 --22964 62 12527
NM_004286chr2272837 2803 2076 819 662 381 95 22873 1135 --1785
NM_004293chr931265 406 182 ----13682
NM_004294chr13--1558 1206 1202
NM_004296chr14164053 3912 3821 3721 3608 2785 1597 1372 1335 1217 970 909 877 667 596 231 --34063 3675 939 --
NM_004302chr1292693 2568 2522 2025 1962 444 290 244 100 --22177 403 11017
NM_004316chr1231144 179 63 11040 ----
NM_004321chr293164 2603 2595 2521 2386 1336 357 118 83 --32306 103 38 --
NM_004337chr81773 --21489 608 11875
NM_004342chr741539 477 231 138 31749 684 22 ----
NM_004350chr1102108 1988 1786 1666 720 569 468 426 336 47 --1625 --
NM_004380chr1662494 2401 2296 2110 1837 60 --22448 856 --
NM_004386chr19112325 1875 1698 1681 1480 875 794 694 615 423 74 11718 --1533
NM_004392chr13123 ----1618
NM_004397chr1174329 3771 1624 745 643 623 504 24128 3103 23277 2912 --
NM_004423chr392337 1904 930 902 721 429 311 186 121 --22418 2093 1552
NM_004430chr842420 350 342 161 ----1363
NM_004437chr1133501 2937 2769 2621 2379 2191 1379 1152 537 483 328 291 26 13320 12291 --
NM_004438chr263340 2911 2633 852 807 646 1634 ----
NM_004446chr12183 29 ------
NM_004469chrX4375 135 126 100 ------
NM_004485chr1134199 4134 4103 4002 3500 3126 3020 2982 2880 1766 1693 1374 1163 --1515 --
NM_004491chr19134218 4198 3725 2840 2757 1503 1339 1297 602 487 410 339 219 12813 13033 --
NM_004496chr142222 147 ------
NM_004514chr1792755 2531 2269 978 744 389 182 132 35 21179 126 ----
NM_004586chrX74026 3983 3545 1926 829 739 408 25178 1157 13469 --
NM_004598chr573275 3222 3158 3064 1242 1028 334 11157 ----
NM_004673chr131108 584 150 2972 628 1208 11336
NM_004703chr1742335 2267 2193 46 11938 1192 --
NM_004726chrX45197 1908 928 129 43688 1238 1140 72 32185 727 718 --
NM_004730chr551667 779 457 168 123 178 --153
NM_004734chr1362221 1104 770 664 432 141 140 11190 --
NM_004744chr443417 2776 1484 273 31139 1124 164 13915 --
NM_004745chr8176033 5568 5420 5223 5062 4809 4615 4374 4287 2444 2398 2237 1600 1589 671 458 326 --26241 4839 --
NM_004772chr551239 496 413 235 223 11003 --1289
NM_004788chr1172624 1829 1790 1093 675 490 32 11702 ----
NM_004796chr143871 545 539 42342 2107 698 661 ----
NM_004808chr1023109 2153 --12576 198
NM_004815chr184669 4537 4443 4333 3538 3322 1551 1459 --23390 1633 --
NM_004822chr1793959 3557 3537 2835 2811 2496 1428 1383 946 23441 845 33325 3304 2816 --
NM_004834chr273346 3066 2794 2642 2128 878 690 --11223 --
NM_004836chr23295 178 22 1165 1903 --
NM_004842chr631697 684 566 ------
NM_004904chr785343 2626 1232 1051 804 435 315 84 --25985 4589 --
NM_004932chr551395 1178 671 643 564 21601 1456 --1228
NM_004937chr1782734 2374 1867 997 576 547 453 431 --12505 --
NM_004947chr371960 1792 1649 592 369 157 82 12530 ----
NM_004956chr774626 3657 3574 3200 2826 1739 783 ------
NM_004976chr11164872 4803 4778 4753 4636 3766 3749 3421 3297 2015 1967 1395 1378 1293 1163 1089 13731 44274 3936 3757 629 --
NM_004985chr1243824 1708 1426 725 33550 2940 1240 ----
NM_004992chrX98522 7969 7353 6297 5948 5513 1794 1396 585 16391 18097 22500 593
NM_004992chrX98522 7969 7353 6297 5948 5513 1794 1396 585 16391 18097 22500 593
NM_005028chr1051882 1629 1462 577 81 11968 11442 11652
NM_005056chr1284920 4636 3467 1529 1359 1219 954 172 22173 2130 ----
NM_005063chr1063832 3650 2866 336 165 113 --1474 --
NM_005065chr1494771 3787 3778 3307 1881 1764 1068 1043 419 ----14553
NM_005076chr194236 3948 3512 1678 962 861 770 184 61 13550 53473 3385 1332 735 327 --
NM_005109chr372208 1976 1847 509 456 94 76 31874 1033 859 11951 --
NM_005135chr1573488 3039 2743 2585 2434 2344 674 1668 ----
NM_005151chr18167 ----1159
NM_005156chr953902 3492 1905 1845 359 13724 ----
NM_005187chr16111997 1971 1950 1630 1484 1398 1392 1378 1299 583 44 2824 724 ----
NM_005189chr17112346 1861 1715 937 889 883 731 675 668 448 271 1966 21912 1544 180
NM_005197chr14165497 5450 5441 4939 4722 4388 3897 2487 2409 2371 2076 1995 1702 1696 423 225 36006 4712 531 24589 2139 --
NM_005202chr1101883 1794 1592 1433 808 619 547 405 344 316 11668 1257 --
NM_005233chr352422 2343 2056 1709 998 ------
NM_005235chr297597 7430 6106 5813 2634 2170 1932 1017 527 32880 2870 1892 --1578
NM_005281chr14835 805 103 25 --1233 21001 996
NM_005311chr751950 904 594 190 106 12796 1465 --
NM_005324chr1741424 1409 1378 715 --12002 11873
NM_005336chr262107 1610 1548 1453 861 77 52303 1563 1509 47 41 12198 --
NM_005338chr7104041 3892 3646 2828 2748 1510 1211 1136 678 189 --22833 975 11601
NM_005359chr1876292 5135 4282 2158 2033 364 59 14472 ----
NM_005374chr1792348 2154 1493 927 809 724 90 55 42 --1770 --
NM_005397chr7103300 3224 2995 1194 1146 1020 742 202 159 127 --11095 --
NM_005398chr1031096 902 52 --31124 999 280 --
NM_005399chr184033 3463 3075 1184 1125 935 713 671 33699 3636 3046 11395 --
NM_005430chr1221015 1004 ----2794 789
NM_005497chr1755670 4933 4734 4556 2042 11070 14765 --
NM_005502chr942460 2233 884 302 22435 280 ----
NM_005504chr1255938 5834 2292 1639 988 15066 36048 4395 2353 --
NM_005506chr462719 2570 2057 952 578 471 ------
NM_005562chr111214 --2534 447 --
NM_005596chr9116201 5077 5062 4676 2225 1214 1153 931 690 668 338 26294 5668 ----
NM_005605chr8--140 --186
NM_005607chr84862 661 225 78 1418 ----
NM_005639chr1221328 471 1588 ----
NM_005652chr164849 776 429 331 ------
NM_005665chr144120 3070 1657 574 ------
NM_005668chr543936 3259 3000 1258 13926 23462 373 1460
NM_005677chr371396 1358 457 308 229 152 98 1198 2575 570 --
NM_005722chr23938 77 69 ------
NM_005725chr121516 839 22381 620 21879 301 --
NM_005737chr252246 2108 2034 338 99 22597 2000 22042 1805 --
NM_005746chr732669 2630 1875 11745 ----
NM_005748chr1253154 2739 2524 2421 2099 12475 21210 107 --
NM_005795chr252139 2075 755 697 60 32661 2046 47 1978 --
NM_005808chr393208 3192 3178 3142 2663 2387 1154 690 614 22600 370 33488 2799 374 --
NM_005822chr63777 524 199 ------
NM_005828chr1763903 3624 3280 1310 1175 1128 25005 4341 44409 3860 808 210 --
NM_005840chrX97606 7311 6808 5464 5430 4637 2625 456 439 42282 1846 1653 1012 --15360
NM_005843chr221521 66 11879 --1100
NM_005862chr31135 1350 1200 --
NM_005901chr18138663 7886 7671 7159 6646 6457 5803 5726 2661 2512 2232 1855 45 57575 6590 6565 5886 2125 ----
NM_005909chr544296 4064 4027 1563 23075 2945 --1283
NM_005910chr1793651 3455 3182 2757 2732 2677 2596 1543 492 11185 ----
NM_005920chr183280 3022 2478 2472 2381 894 443 93 12408 ----
NM_005935chr453490 1206 1006 625 360 --34122 1024 717 --
NM_005937chr17124092 3998 3937 2766 2570 1436 835 619 604 556 443 110 13486 --14045
NM_005941chr872670 1354 1012 490 408 369 135 1523 ----
NM_005943chr671692 1283 1190 308 249 167 94 --21473 1108 2235 49
NM_005955chr154906 3798 1925 1422 606 25378 3609 11357 --
NM_005990chr572253 2125 2009 1870 1695 118 77 1228 1941 --
NM_006054chr1141545 470 213 159 ------
NM_006055chr262973 2318 2112 2001 1946 860 32474 356 58 126 --
NM_006139chr232356 2093 38 ----12446
NM_006154chr1542940 2554 1153 610 12735 ----
NM_006191chr124843 680 671 375 --1145 --
NM_006194chr1451351 1151 370 291 102 ------
NM_006203chr5105369 4327 4215 4153 4021 3606 2092 1209 1185 1023 11991 14512 1313
NM_006206chr431141 742 592 --3921 632 434 --
NM_006210chr192768 142 2902 68 177 1867
NM_006224chr1782271 1932 764 650 566 403 314 54 --12041 --
NM_006251chr522561 572 ------
NM_006252chr1107525 7233 7213 6619 6476 2768 2028 1992 1977 640 --16505 --
NM_006282chr2093964 3654 3113 1875 1256 971 541 239 124 ------
NM_006283chr874146 4071 3285 3156 3077 1328 168 24538 1391 13266 13118
NM_006306chrX95662 5031 4771 4131 1602 1030 1015 1001 78 --11716 --
NM_006323chr42634 39 ----1185
NM_006371chr394865 4844 4570 4287 3914 3831 3621 3259 290 --173 13667
NM_006379chr73652 410 230 21907 1421 ----
NM_006380chr1763774 3519 3005 1743 1637 1376 --1236 --
NM_006393chr1074209 4075 3150 3002 2943 1472 420 2656 49 ----
NM_006434chr1072861 2749 2024 1306 1284 1217 548 2395 151 ----
NM_006454chr482640 2409 2206 995 781 576 378 54 --42551 2236 615 610 --
NM_006457chr463540 2843 2611 1520 1339 728 23630 320 13280 13208
NM_006467chr541931 1747 909 501 ------
NM_006534chr2023163 2384 32736 2503 908 11039 --
NM_006538chr2104047 3974 3546 3439 3162 3116 752 429 400 63 11443 23304 1183 --
NM_006540chr811087 11230 --193
NM_006544chr1466010 5349 4616 4022 900 67 ------
NM_006546chr17145508 5277 5266 4934 4732 4343 2278 1986 1971 1864 1689 1534 673 177 22548 1123 24227 1030 --
NM_006558chr82155 82 1456 ----
NM_006561chr10115043 4549 4381 4362 2190 1999 1780 1437 1372 950 687 14750 25704 702 --
NM_006572chr1742918 1330 990 918 13502 ----
NM_006599chr1696811 6072 2718 2678 2585 2477 2324 969 822 13041 26203 2645 --
NM_006603chrX31897 1576 705 21701 616 11283 --
NM_006614chr332751 1205 41 22667 276 --12912
NM_006628chr1584347 4199 4192 4044 3513 1499 1383 744 13146 ----
NM_006629chr1862678 924 689 288 137 35 11892 ----
NM_006646chr1363080 2870 2694 2354 1196 516 12294 --12217
NM_006650chr593868 3490 3265 2915 2566 2449 598 400 368 --23403 576 --
NM_006717chr963420 2982 1356 852 734 112 --21133 965 --
NM_006722chr392886 2720 2435 2357 2260 2033 449 440 134 --11023 --
NM_006729chrX85316 4699 4636 3719 3676 2108 1934 420 --24186 1540 --
NM_006738chr1574647 4479 4093 3800 3694 3060 590 11669 2752 49 --
NM_006750chr16117230 6811 6639 5938 5665 5602 5388 2695 2039 1676 1339 37912 5779 1930 17556 --
NM_006761chr173757 595 546 1893 ----
NM_006766chr832286 1836 233 21019 455 --2830 529
NM_006775chr633049 2870 1988 --33086 2720 182 --
NM_006827chr1432563 933 802 12223 ----
NM_006838chr1241611 1298 406 104 ----1744
NM_006850chr13987 348 238 1806 ----
NM_006852chr1762841 2326 2097 1903 1138 641 ------
NM_006868chr1873070 2504 2260 2038 429 196 43 11190 ----
NM_006885chr1663479 3177 3083 1017 757 239 23712 1553 ----
NM_006888chr1473473 2433 2258 2164 1188 1020 390 11030 32475 983 571 --
NM_006915chrX2451 220 1765 12134 --
NM_006918chr1175610 5350 5285 3956 3939 1461 697 22325 1587 25049 1691 --
NM_006922chr242329 1637 787 170 1245 ----
NM_006924chr1763929 3879 2906 1439 1328 30 34426 3030 825 13897 --
NM_006930chr521499 1386 --1570 --
NM_006943chr2073349 2365 2095 2029 1024 889 261 ----23191 188
NM_006981chr942047 1877 891 80 1361 --22688 169
NM_006996chr121728 1526 11803 ----
NM_006999chr541827 1748 1329 509 ------
NM_007010chr1761891 1815 1748 1549 384 258 --11429 --
NM_007011chr15106019 5680 5584 2248 1801 1661 1414 1057 483 32 25373 1234 14571 11311
NM_007030chr5114311 4282 3609 3439 1862 1784 1097 1006 968 408 99 --1649 1952
NM_007035chr121719 ----1244
NM_007038chr2165895 4607 2276 1969 1924 1480 25685 2089 15319 --
NM_007050chr20227696 7561 7542 7309 7303 7074 6883 6853 6203 6141 5055 4895 3089 2764 2483 2087 1924 1440 1206 1172 818 477 57475 7265 7100 5693 5440 35267 2521 2165 45528 3145 2804 227
NM_007073chr664132 3795 3709 3674 3624 3028 11122 24074 3061 23839 3834
NM_007078chr1042930 2900 2453 481 2276 228 ----
NM_007125chrY51445 1102 538 332 114 ------
NM_007137chrX85278 4696 4569 4050 3455 1900 1075 597 12100 25481 1345 --
NM_007145chr191962 ----11454
NM_007157chrX62077 2023 465 369 204 120 ------
NM_007166chr114297 270 253 137 177 ----
NM_007172chr223871 583 270 12126 23325 336 --
NM_007174chr1251692 875 568 131 23 21733 84 21583 1471 --
NM_007200chr1574647 4479 4093 3800 3694 3060 590 11669 2752 49 --
NM_007203chr993259 3227 3180 2647 2425 612 235 116 109 13994 1590 --
NM_007213chrX7539 458 254 227 186 157 66 1466 2429 53 --
NM_007214chr631299 1080 173 --1994 --
NM_007236chr1542427 1553 129 71 ----11958
NM_007249chr13159017 8218 7494 7062 6964 6484 6026 2196 1518 1471 1433 961 556 415 170 ------
NM_007259chr16518 422 371 192 129 114 --2408 202 --
NM_007292chr1755052 4384 3283 1669 1435 11735 11602 154
NM_007315chr231029 162 131 11483 ----
NM_007325chrX--11862 21806 1638 --
NM_007347chr15103079 2305 2186 2147 2000 888 734 706 188 80 ------
NM_007350chr1274146 3989 3331 1693 1370 1254 1198 2726 405 --14032
NM_007353chr791993 1986 1912 1071 733 531 506 419 38 ----1859
NM_007375chr162551 2099 1962 1038 912 59 ------
NM_012081chr563018 2878 2434 2295 1054 618 ------
NM_012084chrX1147 1473 --1139
NM_012097chr261885 1876 1622 880 633 330 11459 ----
NM_012098chr961063 1028 252 214 81 45 ------
NM_012104chr1163420 2891 2379 1143 935 287 33814 3329 3240 --1327
NM_012104chr1163420 2891 2379 1143 935 287 33814 3329 3240 --1327
NM_012120chr632087 1092 820 32784 2515 989 ----
NM_012137chr132751 784 618 32287 1144 530 1223 --
NM_012141chr1374124 3596 3424 3170 2617 981 314 ------
NM_012156chr2073015 2575 2459 2408 2204 684 649 --22879 2189 139
NM_012164chr9117583 6052 5935 5474 4870 4785 4768 2285 1435 1390 63 55538 5314 1260 1133 562 25048 589 25014 1138
NM_012193chr1194005 3782 3611 3469 3328 1634 1428 397 155 11241 1136 --
NM_012197chr931431 632 168 ------
NM_012199chr1123480 3137 988 970 812 741 691 561 515 356 205 72 1885 13930 --
NM_012218chr1983058 2838 1983 941 807 565 307 172 --13020 --
NM_012219chr352962 2387 2133 95 44 32985 1040 585 23049 270 1590
NM_012232chr17102210 1842 1656 1527 1417 871 777 239 193 177 ------
NM_012242chr10--1775 --177
NM_012244chr1461364 1179 1153 712 683 589 3483 476 449 ----
NM_012252chr723470 234 --13735 14453
NM_012287chr354147 2981 2970 500 186 ------
NM_012288chr6165021 4889 4623 4610 4468 4364 4260 3702 2220 2135 1819 1558 1056 983 838 61 25573 4032 1658 24755 654
NM_012294chr784031 3766 3272 2878 2767 1336 1293 511 21125 117 13345 --
NM_012296chr1193711 2686 2648 2420 1224 876 635 382 23 --32865 727 451 --
NM_012306chr1293457 1394 1316 1308 980 947 819 334 203 1988 62675 1140 767 143 138 105 --
NM_012309chr1194875 4616 4527 4382 3376 1866 1264 1237 100 14004 11567 --
NM_012316chr1165137 4914 4814 4485 4033 3815 2196 1983 1791 1699 1493 1352 638 289 280 60 24318 498 --1875
NM_012328chr731170 1091 1047 2361 27 ----
NM_012333chr131443 1315 242 3224 201 164 ----
NM_012334chr544276 3933 3058 431 2757 617 ----
NM_012384chr2082016 1990 1820 1769 1636 453 371 186 1474 12062 --
NM_012398chr1982849 2610 2311 1872 704 586 485 221 --42690 1113 698 22 12813
NM_012405chr173712 3408 2723 2463 2428 438 37 21044 166 ----
NM_012471chrX51987 1767 1521 1464 1422 132 ----
NM_013230chrY2698 580 151 --156
NM_013231chr1433853 3629 597 1286 23155 1498 --
NM_013233chr221261 64 --1218 11139
NM_013253chr1121446 410 ------
NM_013269chr1274190 4143 3972 3516 3473 2765 1659 12860 ----
NM_013279chr11112282 2249 1898 1794 1775 1531 729 660 448 392 354 ------
NM_013309chr1552279 2044 1973 1057 597 31959 754 74 --21667 270
NM_013357chr83700 629 199 ------
NM_013372chr1563413 2903 932 272 92 42 3906 858 789 1488 --
NM_013396chr2121135 52 --11168 --
NM_013411chr172096 2079 1899 1726 1101 1062 682 ------
NM_013943chr153162 2913 2825 2352 395 22118 972 12335 --
NM_013951chr282452 2419 2326 2250 1787 845 740 409 21730 923 22495 446 --
NM_013952chr282529 2496 2403 2327 1864 922 817 486 21807 1000 22572 523 --
NM_013953chr282529 2496 2403 2327 1864 922 817 486 21807 1000 22572 523 --
NM_013989chr1474586 4488 4331 1400 467 426 71 24799 4002 ----
NM_013992chr282529 2496 2403 2327 1864 922 817 486 21807 1000 22572 523 --
NM_014011chr232055 1744 284 11038 ----
NM_014021chr163114 3036 2184 2123 1281 1241 ------
NM_014028chr653251 3111 2858 2663 2326 ------
NM_014048chr1674723 3811 3620 3428 1132 946 739 23915 152 14018 --
NM_014112chr874551 4199 1864 1102 638 420 284 14725 13396 --
NM_014155chr1166894 5209 4840 2680 2224 79 24659 1551 1121 --
NM_014190chr4111415 1227 532 514 492 389 193 185 174 132 59 ------
NM_014243chr421900 48 ----11457
NM_014253chrX42512 1965 1917 442 52213 880 527 323 242 --12093
NM_014264chr43590 234 124 ------
NM_014289chrX41195 986 494 182 --11058 1157
NM_014309chr2284980 4147 3596 3427 901 793 528 23 14325 ----
NM_014316chr1662164 1617 1507 772 288 213 --1351 --
NM_014381chr1442853 2210 2120 677 --1105 1829
NM_014415chr331591 652 50 --11530 1240
NM_014423chr553962 1677 1146 931 824 34435 3930 151 ----
NM_014445chr32534 53 2669 360 ----
NM_014447chr411302 ----156
NM_014458chr11178 ----1136
NM_014571chr182613 2293 2109 1972 1864 987 821 714 2370 59 1154 --
NM_014585chr24878 798 381 220 1149 ----
NM_014606chr451298 1254 501 350 170 1514 ----
NM_014613chr5102975 2870 2780 982 860 743 647 618 246 198 --1308 --
NM_014614chr22989 316 21491 525 ----
NM_014615chr1663027 1228 405 334 163 28 13366 --1578
NM_014630chr1582885 2807 2658 1476 840 298 274 164 11358 ----
NM_014634chr22113632 3394 3228 3126 3064 2645 1441 1373 430 373 157 173 12734 --
NM_014636chr9114230 3205 2939 1576 1401 1216 975 776 459 110 45 --12704 --
NM_014660chr72854 38 --1912 --
NM_014666chr51903 ----1940
NM_014682chr81848 --12013 --
NM_014683chr1721768 1525 ----1157
NM_014701chr1533260 3014 1362 12232 13169 12281
NM_014702chr643161 2370 2282 613 --1595 --
NM_014711chr1621740 58 --11450 --
NM_014721chr666291 4908 4594 2831 1592 623 21489 976 11906 12658
NM_014723chr2083247 3076 3070 2371 936 825 517 313 2861 215 2449 274 11291
NM_014729chr831993 1882 1820 ------
NM_014730chr12115080 4955 4899 3620 3568 1539 1112 964 579 324 166 ------
NM_014730chr12115080 4955 4899 3620 3568 1539 1112 964 579 324 166 ------
NM_014742chr2051386 1374 1278 1192 357 21585 653 ----
NM_014747chr1115522 5504 5228 5026 4331 4192 4125 3704 2254 2111 1519 1299 13740 11772
NM_014751chr841722 1488 808 107 153 1165 --
NM_014755chr264183 1499 1194 1096 245 55 --12726 --
NM_014762chr182063 1994 1886 1578 887 860 267 233 --22081 166 1131
NM_014767chr10103545 3292 3194 3077 2696 1338 1323 1052 473 377 1709 1412 --
NM_014774chr152864 2112 1017 743 64 13102 ----
NM_014776chr1272844 2355 2007 842 692 179 133 ------
NM_014797chr683173 2772 2335 1135 621 613 546 346 22053 635 ----
NM_014810chr143496 3372 2430 877 12575 ----
NM_014812chr131990 736 170 --11712 --
NM_014819chr542456 2418 921 767 22235 1876 12463 --
NM_014826chr193998 3833 3801 3737 3348 1349 1320 890 470 ------
NM_014828chr1412520 22444 810 1106 --
NM_014830chr1273110 2816 1472 1402 561 511 190 23440 355 23680 1238 --
NM_014839chr132153 1692 366 1201 1116 --
NM_014846chr83321 284 84 ------
NM_014848chr1551815 911 888 172 144 2982 399 12800 --
NM_014850chr374122 3116 1862 1668 1580 1004 242 1930 11962 --
NM_014868chr122655 274 --1346 1300
NM_014870chr173844 3473 3313 1854 1490 1104 635 --13362 --
NM_014873chr154888 4202 3255 1908 1881 --1427 --
NM_014876chr2282171 2089 1947 1852 650 523 454 33 ----11664
NM_014877chr17117568 7065 7039 5982 5282 4750 4698 2785 2076 1603 1492 31988 1433 1257 ----
NM_014897chr1743215 2541 665 399 1225 12340 1768
NM_014899chr563072 2792 2608 2536 620 398 12570 --1572
NM_014902chr2071203 1105 605 524 345 290 82 ------
NM_014904chr1043566 3165 2897 275 23106 1009 ----
NM_014906chr1773859 2710 2509 1075 288 250 106 33439 2809 152 ----
NM_014909chr14123498 3354 3261 2765 1085 804 764 681 547 496 310 141 --11008 --
NM_014912chr1052387 1107 1069 533 175 22928 765 ----
NM_014920chr653796 3613 2578 1493 1096 --13010 --
NM_014921chr1992957 2655 2174 2145 1225 1172 1009 717 254 --42397 1126 737 302 12673
NM_014932chr321988 1246 1730 177 --
NM_014935chr1113256 3229 2936 2827 2686 2554 941 544 525 500 216 13908 ----
NM_014936chr642097 928 594 257 11032 12040 --
NM_014939chr1831516 1188 27 ------
NM_014947chr192951 2832 2532 2495 2095 991 610 519 74 1181 ----
NM_014950chr1441750 1327 165 69 ----1132
NM_014961chr462110 1696 1618 1366 692 429 11952 1346 --
NM_014964chr17102213 1743 1644 571 535 521 379 304 157 151 12202 ----
NM_014990chr1421053 234 --1188 1383
NM_014991chr432703 1272 912 2950 504 ----
NM_015008chr343505 3366 2572 339 21473 385 12284 1751
NM_015020chr1673627 2649 2417 1574 944 601 403 --12392 --
NM_015026chr1243153 1790 1096 992 24126 1828 --13437
NM_015035chr20135868 5856 5469 4948 4776 4525 4265 4072 2676 2501 2364 1286 665 171 1150 12313
NM_015039chr1104119 3392 3032 3006 1313 1164 789 668 123 50 23484 3150 12650 23688 3155
NM_015040chr223430 1232 ----1893
NM_015042chr1593817 3771 3744 3318 3278 1022 865 837 376 --33294 644 318 24218 1111
NM_015045chr1032000 1523 794 32264 2136 590 ----
NM_015049chr231089 715 374 1644 --13136
NM_015051chr953364 3075 1181 1083 69 --147 --
NM_015052chr73479 456 87 11403 ----
NM_015053chr162329 2001 1555 417 345 324 1820 1519 --
NM_015064chr1273279 3243 3086 2248 1014 111 50 --21382 401 --
NM_015068chr753602 3279 1296 962 633 12895 22483 1418 11375
NM_015071chr5126504 6075 5862 5749 5231 5113 4924 3960 2483 1136 1121 324 36317 2559 1325 2726 613 1722
NM_015075chrX82003 1992 1851 900 425 376 349 87 11889 31614 627 578 --
NM_015076chr643419 2815 611 108 23789 3262 233 28 --
NM_015090chr1136013 5739 5007 4626 4385 4363 3821 1923 1885 977 610 508 195 1397 25815 4131 14691
NM_015091chr142667 163 1194 ----
NM_015092chr1683282 2892 2882 1717 1441 1036 209 129 13217 2380 60 --
NM_015100chr11660 ----11828
NM_015101chr141961 1953 896 254 1731 12472 1194
NM_015107chrX82265 1924 1804 1546 910 407 384 59 ------
NM_015115chr463062 2766 2630 2565 2197 1101 ------
NM_015144chr1652859 2673 983 788 587 1106 11263 --
NM_015156chr1473801 3464 3338 3022 1228 883 432 --1568 --
NM_015176chr131281 1257 332 11504 1692 --
NM_015194chr1761380 859 555 488 452 442 --41599 1448 592 78 1499
NM_015199chr322541 940 12380 --194
NM_015206chr1523449 2401 ----22356 729
NM_015215chr153102 2650 2507 2201 2140 21976 250 ----
NM_015219chr1772450 2216 2019 1964 1590 917 182 --31702 982 395 --
NM_015225chr962950 2166 748 589 420 331 22016 784 21995 1978 --
NM_015250chr971483 654 538 340 279 105 49 11886 --198
NM_015271chr452943 614 571 436 422 23868 1428 ----
NM_015272chr1662070 1981 1674 1653 710 372 1815 ----
NM_015278chr621335 639 ----13329
NM_015288chr573787 3691 3225 2782 2409 1095 597 --4819 674 327 57 --
NM_015299chr14103470 3261 3207 3002 2826 2623 1248 1066 832 58 11489 13452 --
NM_015310chr867592 7282 3058 1397 855 368 28427 1956 --17041
NM_015315chr573213 2748 2200 842 510 372 346 --2678 423 1979
NM_015317chr252244 2204 1839 400 207 42106 2078 1999 613 12291 22511 81
NM_015321chr19134768 4707 4522 3291 1474 1261 1068 811 668 476 291 138 54 44940 3017 1012 170 24534 459 --
NM_015326chr162685 2273 2174 1087 697 648 22973 2934 11883 12035
NM_015335chr12285 49 21925 684 1908 --
NM_015347chr1252916 2594 2470 2128 518 31868 744 418 1859 1372
NM_015358chr2131117 481 222 1881 ----
NM_015385chr1072861 2749 2024 1306 1284 1217 548 2395 151 ----
NM_015387chr22314 298 11304 11569 --
NM_015436chr453061 3036 2616 2437 2114 1438 ----
NM_015455chr553885 3525 2709 877 704 1185 ----
NM_015481chr12101025 981 966 906 747 324 309 71 51 30 --11051 --
NM_015526chr1991457 1204 906 594 532 354 250 175 129 21014 991 ----
NM_015535chr252992 2945 1458 956 302 21561 62 14183 11685
NM_015553chr6104113 3627 3467 3279 3225 1749 1252 929 99 46 24827 3573 21590 1537 --
NM_015557chr193444 3425 3253 2850 1162 627 550 193 142 33315 2477 436 2470 76 13172
NM_015564chr583275 3112 3102 2315 1274 914 706 41 1668 12225 --
NM_015568chr20153988 3536 3297 2833 1724 1442 1367 1291 1126 1066 534 139 128 68 51 --21113 1108 162
NM_015569chr153917 3517 1714 1619 251 14273 --14364
NM_015571chr612411 21651 558 --11837
NM_015576chr332255 2045 1920 --12090 --
NM_015640chr184169 3882 3298 1851 1782 1020 669 21 12101 13903 --
NM_015686chrX32519 1802 206 --1144 12132
NM_015852chr793252 1183 1173 766 598 514 346 178 94 22364 2259 22958 420 12506
NM_015878chr852027 670 529 293 217 12130 11655 --
NM_015881chr1121446 410 ------
NM_015898chr19102526 2283 2130 1923 1893 1724 673 613 534 333 128 ----
NM_015906chr183496 3484 1348 1319 1212 590 426 71 1476 ----
NM_015990chr43933 282 105 ------
NM_015995chr15125209 3898 3599 3442 1795 1788 1758 1465 1194 739 655 505 25277 5265 21210 513 --
NM_016025chr1631885 713 220 1196 11740 --
NM_016081chr42209 145 1705 2157 36 --
NM_016083chr663866 3109 2867 2712 2572 298 12638 11560 --
NM_016096chr831897 1773 286 ------
NM_016125chr17------1198
NM_016131chr252014 1943 1752 1489 299 ------
NM_016132chr1533224 572 563 --13306 --
NM_016147chr1161190 1094 1034 863 408 148 --2752 736 --
NM_016206chr3118880 8129 7465 7332 7231 7224 2548 2473 2208 883 239 47978 3521 3257 41 ----
NM_016220chr75939 759 597 512 426 11772 --12021
NM_016260chr296334 6184 5850 5702 1966 1869 1475 1020 71 16562 12125 --
NM_016277chr651409 1399 1133 1033 55 ------
NM_016308chr121725 398 1479 ----
NM_016376chr1764215 3713 2811 1358 1007 839 --13347 --
NM_016377chr631697 684 566 ------
NM_016396chr1542723 2613 2036 233 12088 ----
NM_016399chr121753 1698 --1734
NM_016418chr22113683 3557 3411 2908 2395 1415 1244 927 243 207 71 13193 31081 1069 532 --
NM_016436chr2052075 651 405 81 34 1740 11060 --
NM_016513chr653796 3613 2578 1493 1096 --13010 --
NM_016531chr444045 3943 2836 546 1639 24026 1653 --
NM_016542chrX41141 80 55 36 --11580 --
NM_016599chr431359 248 202 ------
NM_016605chr592757 2679 2344 1833 1816 711 619 306 216 ------
NM_016621chr1164460 4139 2951 1834 685 514 11598 34374 2938 939 --
NM_016631chr213687 259 22 ----1695
NM_016651chr143834 815 735 --1896 --
NM_016834chr1793651 3455 3182 2757 2732 2677 2596 1543 492 11185 ----
NM_016835chr1793651 3455 3182 2757 2732 2677 2596 1543 492 11185 ----
NM_016841chr1793651 3455 3182 2757 2732 2677 2596 1543 492 11185 ----
NM_016946chr153185 3169 2950 2855 1276 ------
NM_016952chr1172822 2677 2602 2594 775 516 230 --12612 --
NM_017415chr563848 3612 1789 1702 1600 1260 11072 ----
NM_017420chr1443160 2553 2521 945 12881 22885 2670 --
NM_017423chr441966 1563 423 26 ------
NM_017447chr2153745 1657 1354 1296 1136 ------
NM_017544chrX3740 362 176 1144 ----
NM_017575chr1761581 1341 1246 1009 659 578 1542 31083 133 102 --
NM_017596chr1134488 3772 3688 1751 1721 1432 1097 1090 611 471 433 403 297 22870 1027 31623 1109 992 --
NM_017628chr464234 3299 1501 1281 1179 970 13515 ----
NM_017633chr653731 3129 1403 1205 91 13265 1637 --
NM_017637chr998909 8266 8236 8180 7765 7104 6727 2804 1321 36968 6351 1253 16027 --
NM_017643chr1722191 2000 --2563 65 22408 2301
NM_017644chr3104754 3744 3555 3442 1355 1053 932 823 777 737 14047 ----
NM_017694chr21133 --21387 769 --
NM_017709chr153591 3287 986 185 107 24030 1604 14034 11120
NM_017719chr331913 927 322 12550 ----
NM_017753chr9--1658 --1747
NM_017754chr694061 3952 3840 3707 3433 2014 1697 1053 954 11524 13727 11007
NM_017761chr121168 1134 11109 --11241
NM_017776chrX7533 451 368 306 284 222 58 ------
NM_017778chr831274 559 474 21073 957 --1352
NM_017811chr982531 2425 2298 2177 538 452 194 95 22582 273 ----
NM_017813chr845545 4051 3923 2019 13845 ----
NM_017824chr1021900 566 22011 176 1790 1394
NM_017849chr2143133 2734 2354 1995 1206 1165 1107 989 886 721 635 603 44 32 --23185 1178 --
NM_017860chr14778 605 60 42 ------
NM_017902chr1064868 3854 3561 1237 424 409 --13966 --
NM_017919chr9105238 5204 4872 4557 3525 1889 1619 1023 354 286 --22106 1370 11280
NM_017933chr241347 1192 1077 552 21403 1093 ----
NM_017935chr43604 542 24 ------
NM_017943chr145953 929 671 279 214 ------
NM_017944chr1132752 539 102 32776 2311 467 ----
NM_017958chr282607 2449 1997 950 575 245 147 39 12837 ----
NM_017994chr732505 233 63 12354 22194 459 1391
NM_018045chr1122728 2641 2612 2541 2414 2326 2307 1961 1012 959 589 41 11946 22349 732 --
NM_018084chr272905 2455 1104 949 814 722 633 1455 13222 --
NM_018085chr1118163 6993 6303 5772 5299 5130 3127 1991 743 621 59 23142 753 --25946 95
NM_018121chr1053088 2888 2177 1082 867 188 1554 --
NM_018126chr411191 11555 --2338 102
NM_018133chr351826 481 418 183 22 ------
NM_018157chr1262775 2465 765 496 461 137 ------
NM_018182chr1792085 1918 1910 785 771 705 509 391 220 1209 ----
NM_018195chr1162137 1999 1993 1958 1914 288 11589 ----
NM_018207chr171671 1660 520 380 277 266 25 --2333 88 --
NM_018263chr252385 1816 1787 1052 1043 --12061 --
NM_018266chr33337 267 29 --1873 --
NM_018287chr1041139 858 531 520 ------
NM_018293chr342252 1965 349 159 12714 ----
NM_018315chr421536 1513 ----11373
NM_018328chr2------1512
NM_018330chr10------2602 124
NM_018364chr153347 3300 2919 933 627 22890 2747 ----
NM_018371chr831466 974 200 --11189 --
NM_018373chr1475940 5784 4971 4392 4321 1250 956 14786 --1276
NM_018374chr733682 1101 850 31664 1641 104 ----
NM_018400chr1183761 3251 2876 2850 1379 1237 1077 260 --24254 3485 24504 3557
NM_018416chr1262491 2237 589 167 75 69 2800 403 128 --
NM_018425chr1062503 1794 1700 1694 931 425 12245 ----
NM_018440chr898321 7783 7281 6055 6006 5910 853 846 84 17026 15738 --
NM_018452chr6_random63669 3246 3221 2894 897 773 11295 22946 2576 --
NM_018482chr862247 2190 2162 508 108 63 1583 ----
NM_018489chr142354 868 846 284 2399 392 ----
NM_018566chr135051 4179 80 13677 --14320
NM_018644chr1172073 1986 1860 1675 1513 636 142 --1492 --
NM_018650chr142032 1656 910 757 --11462 --
NM_018684chrX6391 251 132 94 83 39 ------
NM_018695chr551838 1820 1600 838 353 21736 103 ----
NM_018698chrX21417 280 21627 774 ----
NM_018704chr152121 2008 1760 1429 599 21637 1447 11913 --
NM_018717chr492329 1825 898 798 374 163 101 75 28 --22841 157 12575
NM_018847chr941590 1576 1515 1313 ------
NM_018898chr522178 290 2248 235 12293 1580
NM_018899chr522178 290 2248 235 12293 1580
NM_018900chr522178 290 2248 235 12293 1580
NM_018901chr522178 290 2248 235 12293 1580
NM_018902chr522178 290 2248 235 12293 1580
NM_018903chr522178 290 2248 235 12293 1580
NM_018904chr522178 290 2248 235 12293 1580
NM_018905chr522178 290 2248 235 12293 1580
NM_018906chr522178 290 2248 235 12293 1580
NM_018907chr522178 290 2248 235 12293 1580
NM_018908chr522178 290 2248 235 12293 1580
NM_018909chr522178 290 2248 235 12293 1580
NM_018910chr522178 290 2248 235 12293 1580
NM_018911chr522178 290 2248 235 12293 1580
NM_018947chr795035 4468 4156 3866 1993 1840 1737 1343 962 ------
NM_018958chr1563238 2965 1319 741 701 130 --11088 --
NM_018976chr1262347 2333 2112 1154 981 25 157 ----
NM_018979chr1241872 544 512 338 1322 ----
NM_019008chr2293434 3215 2305 1090 992 670 622 613 182 33366 2935 1080 ----
NM_019009chr11112159 1930 1892 1870 1859 1672 1666 634 463 419 50 ------
NM_019049chr11310 --187 --
NM_019063chr22674 22 12234 11780 --
NM_019072chr521571 1404 43137 409 197 23 13318 24101 3053
NM_019084chr1041947 1940 717 508 --32306 920 27 --
NM_019106chr22133022 2924 2515 2485 2464 2430 2325 2315 2137 1112 485 383 87 --13313 --
NM_019114chr942526 1935 1779 858 1639 12216 --
NM_019891chr131059 1010 1001 ------
NM_020122chr295732 5094 4999 4898 4691 3745 1906 1710 682 31874 1360 466 25476 4287 --
NM_020123chr10------1546
NM_020132chr21114858 4407 4307 3910 3506 3421 3367 3338 3171 925 715 155 11360 --
NM_020144chr741612 787 241 96 2190 76 ----
NM_020177chr572324 2257 881 812 805 757 462 12858 --1601
NM_020182chr2073445 3351 3094 2629 2410 2363 884 --23552 2616 32447 1377 1292
NM_020204chr12661 104 ------
NM_020205chr153436 3264 3202 3080 2717 1943 ----
NM_020310chr17112603 2527 2177 1906 1131 1091 921 861 713 677 104 ------
NM_020338chr1073588 1174 1151 397 291 213 147 --32337 1218 524 --
NM_020346chr112293 143 11289 --11482
NM_020347chr362347 2298 1705 1547 703 176 ------
NM_020374chr1241563 1269 370 185 --21500 117 --
NM_020390chr354282 3133 1216 997 99 14718 ----
NM_020416chr492608 2583 1998 1858 1689 1675 1071 792 762 ------
NM_020429chr763136 2679 2412 1020 811 322 12351 32086 349 299 12735
NM_020443chr1186525 6085 5813 5245 4912 4703 4623 4515 4308 2595 2030 1508 1104 706 509 482 383 103 34480 1732 1317 36742 4963 2236 --
NM_020466chr694370 3085 1818 1275 1081 1062 598 501 82 ------
NM_020478chr861598 955 452 435 231 59 --22218 558 --
NM_020673chr2096893 6042 5117 2876 2511 2269 2051 1471 1218 22247 834 --17397
NM_020699chr165218 5185 4143 3871 3760 3387 1738 14894 1910
NM_020711chr272302 2244 1821 1747 1058 682 153 ------
NM_020717chrX154652 4401 4084 4047 3804 3733 3396 1866 1562 1471 1380 1074 987 951 114 11328 11580 14362
NM_020718chr1695462 4931 4741 4235 4104 2017 1868 1210 1160 12124 12003 --
NM_020727chr2143969 3089 2987 48 --12506 --
NM_020752chr1042856 2161 1144 267 12642 12646 --
NM_020760chr221366 288 ----1215
NM_020766chrX64031 3904 3506 1380 1298 776 22871 1255 13371 --
NM_020768chr552935 2101 1006 628 175 ----32272 1263 1120
NM_020772chr1768246 8127 2436 460 399 382 16283 23024 2356 --
NM_020774chr1855491 5237 4581 2300 227 11175 15893 --
NM_020781chr742560 401 223 201 2577 57 12078 12516
NM_020783chr1842298 1596 845 575 22329 438 ----
NM_020792chr312752 2976 158 1830 --
NM_020796chr592859 2710 2400 1191 810 779 531 451 261 12807 12691 --
NM_020802chr11133230 3023 2461 2193 1278 1255 944 875 857 759 251 127 104 12870 ----
NM_020813chr1952019 697 636 540 42 --32341 422 260 --
NM_020841chr1263991 3591 2762 637 270 115 ------
NM_020845chr12132385 1684 994 874 829 678 553 538 517 492 455 221 55 ------
NM_020856chr1941562 1365 1215 1059 ------
NM_020888chr152000 1849 1694 479 32 --2673 497 1100
NM_020899chr1782531 2477 2024 998 768 364 318 270 ------
NM_020921chr1452823 2688 1457 1392 900 3554 274 91 ----
NM_020940chr1042431 922 238 143 ------
NM_020948chr113268 1403 11454 11279
NM_020956chr19164674 4400 4260 4199 4000 3798 3453 1583 1350 1077 1022 965 899 821 487 122 156 1132 --
NM_020964chr1864653 3917 3449 958 387 27 13347 ----
NM_020981chr23603 324 265 ------
NM_020988chr1661243 1056 360 273 139 133 --124 --
NM_020993chr1272290 1887 1090 1011 770 595 146 22537 137 12613 --
NM_021020chr8153055 2903 2886 2689 2630 2379 2256 991 688 674 551 454 376 188 122 22223 640 32878 590 197 --
NM_021032chr341356 415 380 82 ------
NM_021033chr1392673 2459 2381 1345 753 640 622 611 119 13487 ----
NM_021038chr353204 2115 1217 877 183 12338 13098 --
NM_021061chr854244 4214 3707 3489 23 ----21015 69
NM_021072chr532016 879 294 11658 --2731 389
NM_021079chr1762811 2362 2138 1052 826 414 --22755 1074 12918
NM_021090chr2294768 4570 3539 1932 1623 938 865 730 62 --13079 --
NM_021097chr262564 2485 1008 888 838 115 --1808 --
NM_021110chr83763 621 508 ------
NM_021116chr7288840 8639 8175 8105 8093 7995 6966 6631 6446 6266 5627 3607 3324 3061 2939 2612 2569 2333 2276 2026 1618 1513 1466 1344 1131 1018 484 437 18633 28779 6877 13010
NM_021140chrX3290 122 53 ------
NM_021163chr753468 3093 2701 2408 921 32395 137 56 ----
NM_021167chr762589 2040 1889 1068 827 522 ------
NM_021183chrX62544 2397 365 232 87 44 ------
NM_021202chr2092708 2412 2294 1975 1885 853 494 386 180 22140 976 ----
NM_021238chr1231728 1444 684 11480 ----
NM_021255chr1463588 2838 2770 1520 1045 796 23880 3309 ----
NM_021648chr632326 740 495 22697 887 --1509
NM_021813chr685465 5400 3901 1883 1866 1446 1233 881 1918 11735 --
NM_021911chr533657 2247 2235 --189 --
NM_021912chr1594111 3952 3535 3203 2878 1445 1332 704 475 --11300 --
NM_021943chr6112098 1961 1932 1811 1774 1692 1653 1543 1503 1382 625 --11720 --
NM_021945chr673209 2696 2656 2384 1217 928 197 1906 ----
NM_021956chr6186 11524 --1958
NM_021961chr1187055 6042 5657 5642 5290 4783 2338 693 22315 1159 22365 268 26012 303
NM_021962chr1762214 2034 328 187 99 41 --163 1381
NM_021964chr336274 5297 4379 1145 ----
NM_021977chr653305 1363 329 294 252 23353 2973 --12399
NM_021999chr133720 605 49 ------
NM_022003chr1161246 1132 1053 858 445 103 11179 21183 890 --
NM_022048chr15106071 5433 5241 4897 4168 4054 2272 1071 389 371 1311 14419 15439
NM_022062chr1171923 1896 1221 1206 708 577 198 ------
NM_022066chr176927 900 869 450 436 112 11103 ----
NM_022166chr16135667 5362 4111 3989 3919 3913 956 934 694 566 448 291 178 31258 502 396 24207 1822 --
NM_022351chr8103709 2925 1537 1496 1223 624 568 555 499 243 22666 866 1493 1489
NM_022456chr12127746 6430 6286 5337 2928 2289 2165 1831 1672 1533 1436 1071 55808 5440 5434 2791 1039 ----
NM_022459chr1385884 5548 5054 4624 4393 3933 1620 1100 16098 25127 768 --
NM_022462chr19133766 3303 3101 2910 2748 2697 2322 1501 1186 803 746 739 151 ------
NM_022465chr1262556 1104 899 545 384 337 --1817 --
NM_022469chr1113131 3003 2687 2587 2193 2167 665 542 204 86 26 23059 2263 ----
NM_022497chr363017 2594 1311 1030 505 344 1496 1655 --
NM_022648chr2114362 4071 3816 3760 3484 3327 1221 1172 356 84 59 3531 398 259 ----
NM_022650chr53876 237 176 1143 ----
NM_022658chr1241319 1148 125 35 11093 ----
NM_022745chr161013 946 770 373 57 39 32184 1097 77 ----
NM_022753chr142418 1711 470 330 12128 1530 --
NM_022758chr6113006 2890 2693 2570 2159 2071 1220 1127 673 232 172 --32453 1276 979 --
NM_022781chr962777 2770 2700 2560 2127 92 ----11163
NM_022896chr2051122 1066 617 353 100 ------
NM_022898chr1484439 4414 4206 3454 1855 1823 1814 350 31923 1793 172 --1141
NM_022918chr1131424 1347 687 11452 1678 --
NM_023076chr1662882 1203 1057 862 264 255 ------
NM_023923chr183659 3038 3014 2670 2566 2444 905 465 3708 428 393 ----
NM_024007chr551923 1075 729 264 93 13086 ----
NM_024090chr43423 261 161 31707 1411 128 1725 --
NM_024103chr1971312 1255 1238 587 373 335 27 11590 --1288
NM_024294chr6113006 2890 2693 2570 2159 2071 1220 1127 673 232 172 --32453 1276 979 --
NM_024312chr1241198 499 154 56 --1181 --
NM_024332chrX41330 1286 206 194 2636 364 11397 --
NM_024345chr974914 1743 1510 1457 1024 442 417 24254 3811 --12261
NM_024522chr191779 1758 1746 1605 1216 737 383 201 123 1582 --11188
NM_024524chr31378 --2596 201 1232
NM_024607chr874217 1783 1743 1496 729 380 165 ------
NM_024639chr67955 691 673 651 433 328 56 21032 597 --12818
NM_024721chr831994 735 552 32027 1749 96 --11012
NM_024770chr286259 5299 5292 2530 2373 2117 1307 1052 22617 462 36392 4727 594 --
NM_024811chr1171711 1632 1503 1221 656 534 186 1219 ----
NM_024817chr15115718 5240 4587 4363 4306 4027 3903 1713 1206 848 305 --32264 484 431 --
NM_024884chr14114505 3701 3687 2846 1438 1219 1039 1001 623 518 396 11581 --24106 2965
NM_024887chr142043 1597 792 229 --2673 274 1650
NM_024920chr431202 1000 989 ------
NM_024942chr1031429 1367 167 164 ----
NM_024949chr484891 4832 4582 4429 4196 3779 3600 118 33241 1412 1350 34226 3987 1242 14076
NM_024953chr1232297 355 96 1522 ----
NM_024989chr287689 7247 5996 2738 2256 1248 1017 200 27527 5983 17736 --
NM_024991chr1072861 2749 2024 1306 1284 1217 548 2395 151 ----
NM_025054chr853535 2732 1477 947 736 --23025 1182 --
NM_025073chr184501 4426 3940 3931 1648 1600 1557 578 --11115 --
NM_025074chr473019 2757 1974 1011 925 874 400 1686 22125 142 --
NM_025106chr181835 1757 1326 1260 1244 1232 516 245 11930 21858 47 --
NM_025134chr1631603 881 401 ------
NM_025146chr3--22020 850 --11744
NM_025160chr143804 3784 1621 282 13177 ----
NM_025164chr1162078 1930 1915 780 232 57 11745 ----
NM_025179chr174716 4680 4197 997 981 323 236 --13618 --
NM_025191chr153081 2351 1363 834 214 13321 ----
NM_025221chr431116 223 146 21415 25 ----
NM_030621chr1453594 3565 3406 3330 2665 --1781 --
NM_030625chr1042241 1642 993 956 11704 ----
NM_030627chr53876 839 76 12979 ----
NM_030634chr182294 1835 1783 1771 1731 937 684 234 11935 ----
NM_030647chr785955 5146 4412 4338 4135 3912 2431 741 15380 11886 --
NM_030648chr465316 4884 3747 3411 567 539 --13469 --
NM_030650chr283939 3650 3621 3172 2727 1573 315 227 23513 1466 13059 --
NM_030674chr1285637 4006 3766 1926 1472 894 831 822 ------
NM_030761chr1112635 2615 2494 2482 2411 2164 1690 715 662 565 164 12127 ----
NM_030786chr161344 1185 529 290 200 25 1374 ----
NM_030806chr1169040 7331 7179 7173 6639 6624 6551 6495 6455 3378 3348 3340 3222 3104 2781 365 37850 3699 2603 37043 6725 334 16846
NM_030809chr1232364 558 189 22428 305 22224 2066 --
NM_030816chr143660 3482 3066 982 21435 864 ----
NM_030817chr1283741 2435 1322 1053 1006 520 487 473 23023 237 1630 --
NM_030918chr174626 3896 1735 1429 1319 965 207 11065 ----
NM_030938chr1731056 758 97 --1205 --
NM_030964chr5103577 3229 3058 2717 2574 2451 1407 1389 1040 350 ------
NM_031216chr1821732 533 11958 --1147
NM_031267chr72543 375 ----175
NM_031268chr1694759 4679 4052 3976 1446 1238 1017 805 277 --23586 297 --
NM_031411chr522178 290 2248 235 12293 1580
NM_031427chr14115824 5428 5236 4336 3797 3703 2356 2094 1726 1503 191 ------
NM_031439chr871479 1357 565 437 251 200 28 --21900 210 1470
NM_031445chr24958 589 510 365 12286 13077 12845
NM_031453chr1051784 839 619 488 363 11042 --12268
NM_031468chr7187942 7628 7528 7342 7222 6499 6399 5982 5389 2842 2835 2662 2539 1908 1002 694 570 439 46465 5573 1301 141 35484 5125 1879 21119 405
NM_031469chr674020 3261 1555 1469 1166 866 367 ------
NM_031483chr2063332 3160 1284 807 733 535 11006 ----
NM_031845chr253436 2909 2762 2583 1004 22805 349 --1993
NM_031847chr253436 2909 2762 2583 1004 22805 349 --1993
NM_031849chr522178 290 2248 235 12293 1580
NM_031857chr522178 290 2248 235 12293 1580
NM_031860chr522178 290 2248 235 12293 1580
NM_031938chr111980 --1674 --
NM_032012chr994960 4684 4390 3497 3335 2013 1488 599 106 23953 3201 15241 11136
NM_032041chr872376 2181 2162 1810 971 699 333 21962 1777 ----
NM_032102chr1172632 2463 2446 2350 1983 1895 429 2497 328 ----
NM_032105chr1167990 7379 6545 6495 6314 5762 4902 3051 2383 1926 1889 1698 1615 1489 753 527 37123 5201 2286 57499 7166 6332 1451 24 14931
NM_032145chr61579 --1357 1614
NM_032160chr1833689 3275 3072 11448 147 --
NM_032199chr1043435 2998 183 176 --1503 13027
NM_032208chr283641 3224 2702 2619 1092 837 752 94 1531 13287 13277
NM_032281chr1972927 2825 2792 2484 981 893 107 13067 22797 776 --
NM_032321chr232692 2197 692 ----1748
NM_032373chr1084734 4356 4326 4184 4093 3884 1566 834 11973 ----
NM_032424chr111295 11106 --21341 456
NM_032444chr168951 875 798 766 365 240 42 28 --2855 163 1159
NM_032445chr1522178 213 21771 987 --11907
NM_032449chr172681 1024 780 600 592 509 86 12089 42272 2120 2093 67 12831
NM_032457chr452824 1215 930 506 218 11567 ----
NM_032581chr73629 468 29 ------
NM_032632chr143581 560 257 ----141
NM_032646chr1771600 1575 1381 1370 704 429 421 --1409 1536
NM_032777chr871329 1072 1023 495 218 185 126 --1433 11160
NM_032778chr353334 977 596 442 245 12301 ----
NM_032859chr1343338 2816 1214 989 23871 1045 ----
NM_032873chr1183591 3517 2825 1541 1473 1400 650 76 --13713 --
NM_032900chr1063513 3411 1566 1398 1104 157 13503 ----
NM_032975chr18113241 3234 2857 2717 2460 2304 741 717 617 585 367 ------
NM_032980chr18113241 3234 2857 2717 2460 2304 741 717 617 585 367 ------
NM_033020chr183496 3484 1348 1319 1212 590 426 71 1476 ----
NM_033083chr333200 601 21 --12304 --
NM_033121chr1231800 1135 312 ------
NM_033129chr2071499 733 517 434 167 158 86 --31991 276 209 --
NM_033138chr741539 477 231 138 31749 684 22 ----
NM_033139chr741539 477 231 138 31749 684 22 ----
NM_033140chr741539 477 231 138 31749 684 22 ----
NM_033143chr474588 4529 4303 4151 3932 2876 135 --21501 298 24018 1622
NM_033157chr741539 477 231 138 31749 684 22 ----
NM_033181chr663866 3109 2867 2712 2572 298 12638 11560 --
NM_033201chr1661179 1006 861 784 319 231 11077 1974 --
NM_033207chr1082720 2586 2475 2389 2351 2215 185 54 22166 1850 --1106
NM_033215chrX2349 340 ------
NM_033221chr992514 1914 1864 1844 1769 1050 1030 409 72 ------
NM_033224chr7167980 7558 6672 5965 5828 5569 5553 5277 4919 2568 2294 1670 1438 1334 298 217 --16551 --
NM_033225chr863075 2852 2836 2001 1218 120 ------
NM_033240chr1591668 1623 1129 686 528 489 337 218 62 --51367 1265 592 577 562 --
NM_033272chr2----1421 1400
NM_033274chr562552 1175 1091 237 184 57 23385 2745 11264 12842
NM_033285chr853627 3015 1673 1587 768 ----11518
NM_033290chrX63713 3356 2730 2587 475 329 ----13602
NM_033315chr1781973 1942 1543 1486 1428 678 257 184 --32050 1502 697 --
NM_033331chr953638 3064 1342 1079 868 22427 646 ----
NM_033360chr1243945 1829 1547 846 33671 3061 1361 12821 --
NM_033389chr1774469 4132 4070 3769 3078 928 509 23429 685 --23983 1922
NM_033425chr1182870 2729 1102 879 813 521 494 473 ------
NM_033503chr15113677 3087 3032 2991 2835 2819 2413 1215 473 417 371 11505 13128 --
NM_033516chr951590 1198 286 218 64 2461 337 ----
NM_033551chr573213 2748 2200 842 510 372 346 --2678 423 1979
NM_033626chrX31696 1669 1463 21808 1229 11676 1666
NM_033632chr421536 1513 ----11373
NM_033637chr10123816 3394 3086 1603 1378 1363 884 810 682 463 429 37 --44108 3922 3380 521 --
NM_052832chr832999 1841 1013 1712 --12897
NM_052845chr1293247 3092 2912 2822 2739 2718 2428 2177 978 1989 23192 3024 --
NM_052869chr1771600 1575 1381 1370 704 429 421 --1409 1536
NM_052875chr1191833 1627 870 786 723 709 581 464 115 1164 ----
NM_052898chr831485 559 23 21893 600 1723 11162
NM_052917chr243076 2474 2413 404 32487 1042 717 ----
NM_052927chr532050 1419 269 ------
NM_052936chrX3765 338 190 2829 119 ----
NM_052937chr852529 2519 2509 706 585 ----12542
NM_053016chr9117575 7369 7331 7266 6793 6650 6402 2115 627 335 315 14915 27338 968 --
NM_053025chr321384 1093 281 62 1385 --
NM_053026chr321384 1093 281 62 1385 --
NM_053027chr321384 1093 281 62 1385 --
NM_053028chr321384 1093 281 62 1385 --
NM_053031chr321384 1093 281 62 1385 --
NM_053032chr321384 1093 281 62 1385 --
NM_053043chr7135760 5528 5266 4727 4609 4118 2404 1715 1688 1028 759 630 473 --24533 2515 --
NM_054025chr1172073 1986 1860 1675 1513 636 142 --1492 --
NM_057159chr93631 359 197 --21163 110 --
NM_057169chr1272844 2355 2007 842 692 179 133 ------
NM_057170chr1272844 2355 2007 842 692 179 133 ------
NM_057175chr442484 1890 590 525 ----12175
NM_057178chr1742364 2175 501 318 22791 194 1351 --
NM_078487chr942923 2534 931 764 33298 2560 104 ----
NM_080491chr1193711 2686 2648 2420 1224 876 635 382 23 --32865 727 451 --
NM_080538chr371396 1358 457 308 229 152 98 1198 2575 570 --
NM_080539chr371396 1358 457 308 229 152 98 1198 2575 570 --
NM_080541chr371396 1358 457 308 229 152 98 1198 2575 570 --
NM_080591chr933112 2135 1916 --1271 --
NM_080717chr1241254 978 972 466 1556 --11005
NM_080743chr621853 1614 --12229 1730
NM_080759chr13123 ----1618
NM_080760chr13123 ----1618
NM_080867chr1463868 3641 3472 1386 751 142 44846 4323 3923 1280 13601 --
NM_080872chr853216 2675 1487 1315 227 --2999 488 --
NM_080874chr421252 495 --21735 1342 --
NM_130385chr1151090 969 913 867 715 --1776 --
NM_130438chr2172710 2190 1232 777 408 50 30 12981 ----
NM_130799chr117662 286 179 155 68 60 35 1298 1690 187
NM_130800chr117662 286 179 155 68 60 35 1298 1690 187
NM_130801chr117662 286 179 155 68 60 35 1298 1690 187
NM_130802chr117662 286 179 155 68 60 35 1298 1690 187
NM_130803chr117662 286 179 155 68 60 35 1298 1690 187
NM_130804chr117662 286 179 155 68 60 35 1298 1690 187
NM_130838chr1521484 662 1487 1709 --
NM_130839chr1521484 662 1487 1709 --
NM_133170chr20227696 7561 7542 7309 7303 7074 6883 6853 6203 6141 5055 4895 3089 2764 2483 2087 1924 1440 1206 1172 818 477 57475 7265 7100 5693 5440 35267 2521 2165 45528 3145 2804 227
NM_133264chr1773951 3819 3419 3333 3277 997 326 13664 23480 1114 --
NM_133330chr482714 2613 2567 2524 2366 875 208 94 ------
NM_133331chr482714 2613 2567 2524 2366 875 208 94 ------
NM_133335chr482714 2613 2567 2524 2366 875 208 94 ------
NM_133370chr421135 197 33351 2960 181 13542 --
NM_133372chr561919 1882 958 947 732 524 22440 2033 ----
NM_133378chr21745 ----1119
NM_133432chr21745 ----1119
NM_133437chr21745 ----1119
NM_133445chr9113531 3429 2828 2316 1387 1307 1086 1010 536 445 270 13123 13400 --
NM_133457chr791248 1192 997 540 509 473 426 361 42 --11129 --
NM_133473chr1931534 1510 1328 ----11828
NM_133496chr164525 3677 3386 2980 754 108 24069 3458 ----
NM_133625chr331391 1209 366 --21057 153 130
NM_133631chr331227 412 192 11621 11545 --
NM_133646chr274403 4136 3989 3947 1756 1235 1088 25525 716 24095 491 --
NM_133647chr1573488 3039 2743 2585 2434 2344 674 1668 ----
NM_134325chr151676 1477 1439 1421 50 11175 21275 248 --
NM_138270chrX53214 2898 1271 456 280 184 12962 11367
NM_138319chr1541298 1260 1234 267 ------
NM_138457chr6133387 3350 3191 2620 2400 830 648 562 385 202 81 73 53 --12311 --
NM_138468chr2115540 5124 3922 2388 1560 1004 795 749 702 542 85 45044 4861 4463 1156 ----
NM_138473chr1284316 4238 4085 3895 1557 1433 845 47 24825 714 13128 14927
NM_138554chr962181 1871 1780 987 265 241 --1228 --
NM_138576chr1484439 4414 4206 3454 1855 1823 1814 350 31923 1793 172 --1141
NM_138621chr2104047 3974 3546 3439 3162 3116 752 429 400 63 11443 23304 1183 --
NM_138633chr631697 684 566 ------
NM_138713chr1696811 6072 2718 2678 2585 2477 2324 969 822 13041 26203 2645 --
NM_138714chr1696811 6072 2718 2678 2585 2477 2324 969 822 13041 26203 2645 --
NM_138731chr1443508 2927 819 404 34231 3772 3455 ----
NM_138970chr143871 545 539 42342 2107 698 661 ----
NM_138971chr1163420 2891 2379 1143 935 287 33814 3329 3240 --1327
NM_138971chr1163420 2891 2379 1143 935 287 33814 3329 3240 --1327
NM_138972chr1163420 2891 2379 1143 935 287 33814 3329 3240 --1327
NM_138972chr1163420 2891 2379 1143 935 287 33814 3329 3240 --1327
NM_138973chr1163420 2891 2379 1143 935 287 33814 3329 3240 --1327
NM_138973chr1163420 2891 2379 1143 935 287 33814 3329 3240 --1327
NM_139279chr252945 1415 887 703 83 13245 ----
NM_144571chr475354 4883 2648 2337 1959 844 604 12618 14682 --
NM_144578chr1453476 2192 685 424 117 1436 ----
NM_144579chr252822 2230 1982 159 101 --51873 1047 659 495 138 --
NM_144590chr1092843 2562 2552 2217 2064 1855 545 416 331 ------
NM_144633chr321322 38 11016 1934 1258
NM_144657chrX3512 477 265 1605 ----
NM_144721chr442565 2414 2264 1764 12447 --1470
NM_144767chr1574647 4479 4093 3800 3694 3060 590 11669 2752 49 --
NM_144778chr1382157 2120 1969 1728 1085 938 891 148 ----1216
NM_144949chr232055 1744 284 11038 ----
NM_144963chr832104 1796 917 11884 ----
NM_144973chr1284019 3965 1926 1822 1624 1158 427 127 14996 33353 2112 386 --
NM_145055chr1843660 3224 2559 126 ------
NM_145117chr1152494 2049 966 349 93 12941 ----
NM_145165chr1482762 2687 2486 2438 2043 1940 1808 862 42553 870 559 531 ----
NM_145176chr631171 897 328 12819 --23141 1261
NM_145206chr1062873 2247 2149 2118 513 475 1619 13002 --
NM_145259chr266887 6193 5372 4933 4457 604 25734 5125 25978 235 --
NM_145284chrX32424 2267 1658 ------
NM_145303chr62369 104 155 ----
NM_145307chr1094306 4120 3407 3197 3035 2944 1094 518 445 23863 1029 ----
NM_145686chr273346 3066 2794 2642 2128 878 690 --11223 --
NM_145687chr273346 3066 2794 2642 2128 878 690 --11223 --
NM_145799chrX72706 2604 2295 2212 1121 586 33 12597 22740 142 1138
NM_145805chr154637 429 175 23 ----1157
NM_145891chr1651625 1612 1588 649 98 --1521 --
NM_145892chr1651625 1612 1588 649 98 --1521 --
NM_145893chr1641747 1734 1710 220 --1643 --
NM_147147chr664132 3795 3709 3674 3624 3028 11122 24074 3061 23839 3834
NM_147150chr993259 3227 3180 2647 2425 612 235 116 109 13994 1590 --
NM_147181chr431116 223 146 21415 25 ----
NM_147182chr431116 223 146 21415 25 ----
NM_147183chr431116 223 146 21415 25 ----
NM_147202chr9102204 2169 2136 2105 1862 914 892 799 122 69 12041 32012 1844 748 1860
NM_147223chr272381 1543 709 670 655 576 118 32448 839 111 ----
NM_147233chr252198 526 487 472 393 22265 656 ----
NM_148174chr852027 670 529 293 217 12130 11655 --
NM_148921chr17102213 1743 1644 571 535 521 379 304 157 151 12202 ----
NM_148955chr15116385 5908 5427 4635 2080 1341 1248 839 671 110 23 14512 --15306
NM_152237chr2291555 1268 1188 1106 1089 1081 360 258 52 --1599 1155
NM_152280chr142656 2404 677 304 13512 22334 295 --
NM_152300chr1761891 1815 1748 1549 384 258 --11429 --
NM_152305chr31152 1253 1410 --
NM_152375chr192508 2018 1977 1906 1899 1707 651 381 284 --198 --
NM_152388chr253605 3559 3384 2766 32 1573 ----
NM_152390chr24659 157 114 99 ------
NM_152424chrX74326 4299 3343 3137 1534 1399 265 ----21045 191
NM_152437chr1252381 1945 1514 100 35 21529 82 ----
NM_152470chr1893271 1658 1437 1026 1011 559 337 292 183 ----33352 3212 2680
NM_152519chr232227 2028 505 41638 1462 1439 839 ----
NM_152529chr2104145 3419 3260 3084 1521 1467 1298 1278 688 96 13623 ----
NM_152538chr31421 21639 291 11391 --
NM_152556chr732111 970 79 1961 ----
NM_152594chr1542215 633 136 114 11856 ----
NM_152624chr597223 6815 5323 2829 2563 1093 787 744 597 22820 2694 14567 --
NM_152629chr953165 1017 499 471 297 ----1101
NM_152636chr1152827 2730 2416 728 430 32273 795 282 ----
NM_152641chr122909 347 12868 12872 --
NM_152695chrX41813 313 225 144 146 ----
NM_152699chr373744 2761 1350 1292 1253 666 473 22511 380 ----
NM_152723chr112791 287 ----1119
NM_152744chr793407 3163 3130 2949 1354 1300 791 309 75 --13321 13020
NM_152754chr752558 1448 1354 885 477 ------
NM_152756chr541730 1514 1333 653 --23365 594 --
NM_152758chr843029 2607 1923 540 --12419 --
NM_152772chr123400 336 36 2376 118 ----
NM_152826chr15116385 5908 5427 4635 2080 1341 1248 839 671 110 23 14512 --15306
NM_152914chr1784358 3942 3590 3121 3078 2984 2895 2766 --43947 3177 1495 1041 --
NM_152924chr15106019 5680 5584 2248 1801 1661 1414 1057 483 32 25373 1234 14571 11311
NM_152999chr763764 3174 1347 985 780 254 23940 1780 ----
NM_153013chr532232 1981 1734 ------
NM_153018chr1763195 2790 2497 818 664 239 196 12744 --
NM_153050chr2294768 4570 3539 1932 1623 938 865 730 62 --13079 --
NM_153051chr2294768 4570 3539 1932 1623 938 865 730 62 --13079 --
NM_153182chr353334 977 596 442 245 12301 ----
NM_153207chr1242674 818 128 97 12683 ----
NM_153262chr143161 2719 468 114 --23144 2885 --
NM_153321chr172307 188 3740 107 93 1728 --
NM_153322chr172307 188 3740 107 93 1728 --
NM_153332chr863075 2995 2031 1221 1056 603 --1557 --
NM_153343chr482144 2010 1609 1500 908 630 523 451 12219 ----
NM_153350chr16101631 1511 1495 1449 1249 703 643 604 185 32 ----11420
NM_153367chr10193912 3856 3760 3670 3585 3402 3295 2844 1376 1189 1183 822 743 713 701 629 566 279 41 13634 ----
NM_153426chr4150 --1602 --
NM_153427chr4150 --1602 --
NM_153456chr13226256 6221 5878 5730 5621 5593 4633 4605 4569 4513 3836 2510 2093 2063 2018 1842 1449 713 615 489 465 337 --22446 1606 14563
NM_153487chr6124711 4552 3547 3467 3128 1885 1544 1444 1281 818 714 29 --44626 4515 861 327 14436
NM_153607chr533166 844 721 12066 ----
NM_153619chr1583529 2879 965 822 694 311 285 187 42782 2411 840 684 12671 --
NM_153634chr1211074 1327 --11653
NM_153645chr223871 583 270 12126 23325 336 --
NM_153712chr263396 2628 2604 365 333 112 23157 3029 21289 88 --
NM_153810chr1084465 4342 4332 3673 3184 808 677 484 34978 3990 1222 13900 --
NM_153825chr471799 1555 1434 1400 1267 645 189 --11467 1671
NM_153831chr84862 661 225 78 1418 ----
NM_153836chr231781 1341 110 --2247 200 --
NM_170686chr742560 401 223 201 2577 57 12078 12516
NM_170696chr1521403 27 31366 1349 628 21564 1353 --
NM_170697chr1521403 27 31366 1349 628 21564 1353 --
NM_170706chr1104119 3392 3032 3006 1313 1164 789 668 123 50 23484 3150 12650 23688 3155
NM_170731chr1162381 2133 1999 1861 1106 1036 --22008 1160 --
NM_170732chr1162381 2133 1999 1861 1106 1036 --22008 1160 --
NM_170733chr1162381 2133 1999 1861 1106 1036 --22008 1160 --
NM_170734chr1162381 2133 1999 1861 1106 1036 --22008 1160 --
NM_170735chr1162381 2133 1999 1861 1106 1036 --22008 1160 --
NM_172071chr1106628 4732 2569 2373 2273 2179 1480 1452 432 112 ------
NM_172127chr431598 324 304 ------
NM_172128chr431554 280 260 ------
NM_172159chr34363 194 178 111 1321 11751 12055
NM_172160chr34363 194 178 111 1321 11751 12055
NM_172375chr143927 429 169 2327 321 --1368
NM_173083chr11433 31040 851 88 ----
NM_173198chr942047 1877 891 80 1361 --22688 169
NM_173200chr942047 1877 891 80 1361 --22688 169
NM_173214chr1696811 6072 2718 2678 2585 2477 2324 969 822 13041 26203 2645 --
NM_173463chr453780 2787 1523 668 297 13579 14500 --
NM_173468chr424816 1465 26066 5846 ----
NM_173473chr1042261 1960 1863 1672 --22397 456 --
NM_173511chr253729 2835 2734 1108 185 ------
NM_173576chr1032226 177 55 1788 --1455
NM_173582chr1145297 4795 4714 1438 34036 2018 2012 ----
NM_173595chr12164887 4601 3873 3828 3781 3686 3219 2075 2062 1876 1423 1150 1013 929 649 230 13313 11436 13939
NM_173602chr1293772 3234 3086 2855 2658 2460 1472 906 486 --1467 --
NM_173642chr1117833 6981 6868 6485 5856 5831 2367 1956 1439 1011 316 18294 12374 --
NM_173667chr552189 1780 358 287 70 ----11649
NM_173694chrX21693 330 1311 ----
NM_173808chr133696 3469 813 14090 1421 --
NM_173825chr362765 2116 1060 845 549 442 12706 ----
NM_173826chr341154 577 245 66 ----11269
NM_173829chr585742 5371 4575 4404 3784 1636 1597 1400 34074 1649 1068 24810 4632 --
NM_173851chr852703 2540 1543 729 347 13512 --1957
NM_174911chr873498 3198 3159 2834 2502 676 559 ------
NM_174938chr9------1381
NM_175061chr72332 92 22220 1439 1408 --
NM_175607chr331656 1433 424 21382 508 --1638
NM_175612chr331656 1433 424 21382 508 --1638
NM_175623chr12127746 6430 6286 5337 2928 2289 2165 1831 1672 1533 1436 1071 55808 5440 5434 2791 1039 ----
NM_175624chr12127841 6525 6381 5432 3023 2384 2260 1926 1767 1628 1531 1166 55903 5535 5529 2886 1134 ----
NM_175625chr12127841 6525 6381 5432 3023 2384 2260 1926 1767 1628 1531 1166 55903 5535 5529 2886 1134 ----
NM_175736chr12177688 7467 7444 6432 6288 6255 6249 5132 5094 4868 2681 2315 2023 1974 1471 661 320 36695 5740 5312 36964 2763 2325 --
NM_175861chr12115555 5179 5079 3815 3673 3653 2026 1870 1187 155 21 23792 1792 11629 --
NM_175876chr132614 1775 675 42378 1707 826 173 ----
NM_175931chr16111997 1971 1950 1630 1484 1398 1392 1378 1299 583 44 2824 724 ----
NM_176801chr4111415 1227 532 514 492 389 193 185 174 132 59 ------
NM_176823chr143092 2847 1504 1460 23902 3244 22924 2430 --
NM_176871chr873232 3145 2566 2470 2392 2155 2039 --13223 12174
NM_177438chr1453594 3565 3406 3330 2665 --1781 --
NM_177968chr252099 1844 1619 670 220 ------
NM_177972chr1173614 2749 1153 863 717 311 71 11010 1854 --
NM_177985chr261885 1876 1622 880 633 330 11459 ----
NM_177996chr2073015 2575 2459 2408 2204 684 649 --22879 2189 139
NM_178011chr1062984 2775 2731 2304 1024 270 1135 ----
NM_178013chr1492659 2438 2168 2129 1230 878 735 397 85 12391 22077 742 --
NM_178037chr1273279 3243 3086 2248 1014 111 50 --21382 401 --
NM_178038chr1273279 3243 3086 2248 1014 111 50 --21382 401 --
NM_178140chr552751 2733 2067 1691 368 ----21033 669
NM_178151chrX127500 6000 5796 5749 4985 2260 1997 1975 1802 1446 1277 403 27267 39 36784 3129 2741 12610
NM_178152chrX127500 6000 5796 5749 4985 2260 1997 1975 1802 1446 1277 403 27267 39 36784 3129 2741 12610
NM_178153chrX127500 6000 5796 5749 4985 2260 1997 1975 1802 1446 1277 403 27267 39 36784 3129 2741 12610
NM_178270chrX3765 338 190 2829 119 ----
NM_178505chr1073058 2650 2568 2533 2290 1019 81 11289 ----
NM_178539chr1231699 1500 1351 166 ----
NM_178566chr941655 1349 1311 100 31181 468 265 ----
NM_178585chr432703 1272 912 2950 504 ----
NM_181339chr13987 348 238 1806 ----
NM_181349chr763136 2679 2412 1020 811 322 12351 32086 349 299 12735
NM_181358chr143481 3146 742 492 11313 ----
NM_181486chr1241254 978 972 466 1556 --11005
NM_181659chr2023163 2384 32736 2503 908 11039 --
NM_181659chr2023163 2384 32736 2503 908 11039 --
NM_181712chr131698 1590 478 21688 1376 21803 1324 1759
NM_181828chr22113683 3557 3411 2908 2395 1415 1244 927 243 207 71 13193 31081 1069 532 --
NM_181829chr22113683 3557 3411 2908 2395 1415 1244 927 243 207 71 13193 31081 1069 532 --
NM_181830chr22113683 3557 3411 2908 2395 1415 1244 927 243 207 71 13193 31081 1069 532 --
NM_181832chr22113698 3572 3426 2923 2410 1430 1259 942 258 222 86 13208 31096 1084 547 --
NM_181838chr551531 640 613 396 97 1407 ----
NM_181876chr492608 2583 1998 1858 1689 1675 1071 792 762 ------
NM_182485chr463550 3098 2766 1395 1228 1217 ------
NM_182487chr9124125 3913 3791 2701 1335 1085 983 977 615 357 266 75 11425 73395 1344 1263 630 625 441 105 --
NM_182526chr14122908 2518 2477 2436 2018 1252 832 815 658 635 117 43 --22387 2110 --
NM_182527chr2261786 1662 1497 744 326 223 21977 641 61855 1833 1747 620 583 408 --
NM_182551chr293510 2897 1195 1138 1011 487 363 312 29 --1897 --
NM_182646chr463550 3098 2766 1395 1228 1217 ------
NM_182664chr141868 1764 360 23 42225 1725 814 52 11656 --
NM_182700chr791998 1726 1509 639 631 388 266 250 79 11271 ----
NM_182701chr63832 393 307 ------
NM_182728chr1461364 1179 1153 712 683 589 3483 476 449 ----
NM_182758chr1533834 978 616 32401 583 49 ----
NM_182762chr744524 2181 1255 589 26226 4280 ----
NM_182797chr2051312 628 331 223 33 ------
NM_182898chr785343 2626 1232 1051 804 435 315 84 --25985 4589 --
NM_182899chr785343 2626 1232 1051 804 435 315 84 --25985 4589 --
NM_182964chr1152494 2049 966 349 93 12941 ----
NM_182970chr20104064 4029 3142 2959 2763 1501 1046 813 375 50 --23661 1172 --
NM_182972chr132711 2131 837 125 --11130
NM_183004chr1463541 2814 2772 2533 1338 1267 23754 160 1487 1867
NM_183006chr2071203 1105 605 524 345 290 82 ------
NM_183227chr651409 1399 1133 1033 55 ------
NM_183376chr1532572 1706 889 ------
NM_183393chr33923 787 74 ------
NM_183394chr33923 787 74 ------
NM_194071chr7104204 3608 3468 2022 1846 1618 1097 673 494 339 14071 32177 1970 1282 11271
NM_194278chr1443408 2684 1412 278 --11448 --
NM_194285chr1133292 2490 1135 13008 ----
NM_194286chr12186022 6011 5916 5678 5083 4249 2403 2036 1912 1891 1687 1231 1146 989 865 841 792 714 14081 32487 1739 1646 16004
NM_194301chr142881 62 ----1211
NM_194313chr971605 1361 528 322 287 141 104 1247 1662 --
NM_194314chr154294 3656 1475 956 652 23419 884 34412 3423 1078 --
NM_194328chr962777 2770 2700 2560 2127 92 ----11163
NM_194329chr962777 2770 2700 2560 2127 92 ----11163
NM_194330chr962777 2770 2700 2560 2127 92 ----11163
NM_194332chr962777 2770 2700 2560 2127 92 ----11163
NM_194434chr1855285 4289 4172 1923 557 ------
NM_197941chr541898 727 366 135 1298 32153 2019 914 11981
NM_198056chr382006 1728 1616 1424 623 473 414 127 32079 1737 61 21962 1741 --
NM_198158chr392886 2720 2435 2357 2260 2033 449 440 134 --11023 --
NM_198159chr392886 2720 2435 2357 2260 2033 449 440 134 --11023 --
NM_198177chr392886 2720 2435 2357 2260 2033 449 440 134 --11023 --
NM_198178chr392886 2720 2435 2357 2260 2033 449 440 134 --11023 --
NM_198195chr32274 28 ------
NM_198268chr143481 3146 742 492 11313 ----
NM_198269chr143481 3146 742 492 11313 ----
NM_198270chrX32912 2621 2210 22709 1101 1783 13364
NM_198281chr43730 615 240 22751 1223 ----
NM_198320chr1284892 4432 3788 3516 1864 1829 78 71 --21115 23 --
NM_198392chr63601 415 51 --31922 1552 427 --
NM_198400chr1542940 2554 1153 610 12735 ----
NM_198440chr2262448 2068 1919 1584 973 272 --12095 1419
NM_198465chrX62986 2378 2236 1980 507 487 1115 --1917
NM_198468chr641403 1030 1013 917 11499 ----
NM_198485chr362474 2314 2095 1684 365 67 11925 1279 --
NM_198490chr3113041 2650 2609 1246 1203 1165 499 457 261 83 65 --22760 1186 --
NM_198581chr2127427 7190 6961 6490 5799 5545 5090 4918 2370 1272 1172 869 31965 1416 271 14599 14631
NM_198793chr353389 3126 1159 1042 710 11654 1433 --
NM_198834chr1792109 1670 1648 1515 687 498 395 342 99 1608 1190 --
NM_198836chr1792109 1670 1648 1515 687 498 395 342 99 1608 1190 --
NM_198837chr1792109 1670 1648 1515 687 498 395 342 99 1608 1190 --
NM_198838chr1792109 1670 1648 1515 687 498 395 342 99 1608 1190 --
NM_198839chr1792109 1670 1648 1515 687 498 395 342 99 1608 1190 --
NM_198900chr12177688 7467 7444 6432 6288 6255 6249 5132 5094 4868 2681 2315 2023 1974 1471 661 320 36695 5740 5312 36964 2763 2325 --
NM_198947chr112269 225 11081 1164 1686
NM_198956chr791998 1726 1509 639 631 388 266 250 79 11271 ----
NM_199005chr96950 691 673 651 328 56 11027 ----
NM_199039chr43933 282 105 ------
NM_199072chr74797 672 446 117 21022 624 ----
NM_199132chr1961539 838 562 334 126 43 --1754 --
NM_199169chr2073445 3351 3094 2629 2410 2363 884 --23552 2616 32447 1377 1292
NM_199170chr2073445 3351 3094 2629 2410 2363 884 --23552 2616 32447 1377 1292
NM_199171chr2073445 3351 3094 2629 2410 2363 884 --23552 2616 32447 1377 1292
NM_199262chr1782321 1846 1732 918 823 796 632 621 11916 ----
NM_199320chr442292 2258 352 87 32824 1869 249 1419 12427
NM_199320chr442292 2258 352 87 32824 1869 249 1419 12427
NM_199324chr452760 2691 2636 1320 116 1724 --1546
NM_199355chr1631591 464 50 11358 1727 --
NM_199421chr1463868 3641 3472 1386 751 142 44846 4323 3923 1280 13601 --
NM_199478chrX41826 786 648 640 ------
NM_199482chr22314 298 11304 11569 --
NM_201266chr252658 1221 810 741 581 32151 1096 499 --22421 364
NM_201279chr252658 1221 810 741 581 32151 1096 499 --22421 364
NM_201428chr1141545 470 213 159 ------
NM_201429chr1141545 470 213 159 ------
NM_201430chr1141471 396 139 85 ------
NM_201432chr17196473 6187 6087 4696 4651 4592 4198 4156 4145 2531 2309 1466 1451 1275 782 606 492 204 198 --21548 729 --
NM_201433chr17196473 6187 6087 4696 4651 4592 4198 4156 4145 2531 2309 1466 1451 1275 782 606 492 204 198 --21548 729 --
NM_201567chr351766 423 393 166 138 ----130
NM_201634chr571697 1419 1396 1345 376 237 73 31870 1473 1234 ----
NM_203329chr11156936 6697 6518 6164 5936 5829 5737 5455 5288 5004 4776 2595 2365 313 133 11973 14575 --
NM_203330chr11156936 6697 6518 6164 5936 5829 5737 5455 5288 5004 4776 2595 2365 313 133 11973 14575 --
NM_203331chr11156936 6697 6518 6164 5936 5829 5737 5455 5288 5004 4776 2595 2365 313 133 11973 14575 --
NM_203342chr1133501 2937 2769 2621 2379 2191 1379 1152 537 483 328 291 26 13320 12291 --
NM_203343chr1133501 2937 2769 2621 2379 2191 1379 1152 537 483 328 291 26 13320 12291 --
NM_203346chr262107 1610 1548 1453 861 77 52303 1563 1509 47 41 12198 --
NM_203446chr2181164 1133 743 635 336 273 243 60 1145 12698 1523
NM_203459chr142243 949 613 554 --1778 --
NM_205848chr182493 2377 2304 2150 1031 580 511 419 42099 1906 1766 1072 ----
NM_205855chr73742 138 50 --1296 --
NM_205861chr142043 1597 792 229 --2673 274 1650
NM_206594chr133391 2609 581 23631 57 12402 --
NM_206595chr133391 2609 581 23631 57 12402 --
NM_206853chr632819 2728 668 ----13623
NM_206854chr664080 3989 3274 1929 1025 80 ----14884
NM_206855chr655045 4954 4239 1990 1045 --1961 15849
NM_206866chr2131053 243 213 11083 ----
NM_206907chr522561 572 ------
NM_206909chr867592 7282 3058 1397 855 368 28427 1956 --17041
NM_206933chr142387 2099 443 27 12682 1862 --
NM_207032chr2031560 1477 1383 11613 11135 --
NM_207033chr2031468 1385 1291 11521 11043 --
NM_207034chr2031468 1385 1291 11521 11043 --
NM_207171chr11660 ----11828
NM_207292chr353204 2115 1217 877 183 12338 13098 --
NM_207293chr353204 2115 1217 877 183 12338 13098 --
NM_207294chr353204 2115 1217 877 183 12338 13098 --
NM_207295chr353204 2115 1217 877 183 12338 13098 --
NM_207296chr353204 2115 1217 877 183 12338 13098 --
NM_207297chr353229 2140 1242 902 208 12363 13123 --
NM_207299chr9--1658 --1747
NM_207304chr1382044 2007 1856 1615 972 825 778 35 ----1103
NM_207372chr1052113 1701 1688 219 54 1322 11740 --
NM_207396chr191618 1397 1303 1254 734 623 511 473 169 11856 ----
NM_207406chr496188 6054 5699 5398 4732 3957 1627 1434 146 24155 4149 ----
NM_207445chr1541836 452 49 36 1306 --1610
NM_207518chr1991331 932 456 386 313 271 263 255 159 1899 1281 --
NM_207577chr1162620 2411 2283 1804 520 213 1890 ----
NM_207645chr11------1275
NM_213589chr2124889 4464 4435 3962 3774 3749 3676 3519 3404 2098 1745 708 14811 ----