TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3942-3p
miRNA Sequence: UUUCAGAUAACAGUAUUACAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr52484 178 --1357 --
NM_000038chr541945 1341 760 150 22009 139 --22047 709
NM_000052chrX103335 3073 2947 2859 1319 394 367 316 178 127 1884 52794 2786 2773 2508 360 --
NM_000067chr81560 ------
NM_000070chr15--1507 ----
NM_000080chr17--153 ----
NM_000081chr11152 21792 1175 --1206
NM_000084chrX96332 6135 6025 5722 5532 5472 5299 5066 691 45508 4975 954 164 66497 6267 5048 4886 4501 2676 11911
NM_000089chr73594 538 329 --1214 139
NM_000090chr22305 140 1368 ----
NM_000092chr273810 3718 3526 2827 1818 1809 401 23891 752 11215 --
NM_000096chr32927 866 ------
NM_000108chr741661 589 385 363 131 --11722
NM_000109chrX22323 632 --12346 --
NM_000110chr13835 349 218 1383 ----
NM_000112chr563961 3558 3545 3418 462 134 32231 1652 787 24110 3779 14275
NM_000115chr1332471 1888 823 32039 798 602 ----
NM_000126chr152209 117 ------
NM_000134chr42610 438 11530 ----
NM_000138chr1532247 2216 1626 ------
NM_000151chr1741705 631 480 333 21851 427 168 11770
NM_000163chr511913 1338 1791 --
NM_000165chr621688 507 11152 11455 --
NM_000167chrX41253 653 513 374 21807 580 ----
NM_000168chr753016 1349 1185 360 215 22791 167 ----
NM_000176chr552788 2525 1575 1440 1009 23474 2756 ----
NM_000177chr91234 ------
NM_000189chr242189 1791 1610 433 ----21617 800
NM_000208chr19114422 4375 3990 3667 3251 1678 1606 1588 1551 1329 367 271 61 --14798
NM_000214chr2051546 1195 632 80 37 11488 11686 1425
NM_000216chrX42766 2563 738 475 21453 1225 1165 1846
NM_000217chr1253536 1922 1578 1126 872 --13564 --
NM_000222chr462126 1981 857 800 708 134 21927 1748 --11640
NM_000232chr421139 311 --13012 1583
NM_000248chr342664 920 332 271 32840 758 661 ----
NM_000251chr2--1180 ----
NM_000252chrX--1253 11132 --
NM_000259chr1565727 5118 2186 1710 971 343 56237 6073 6022 4524 1604 --15570
NM_000267chr1773180 3071 2499 1351 1105 913 226 22324 2279 11377 --
NM_000280chr112923 740 ------
NM_000281chr10121 ------
NM_000291chrX----1211 --
NM_000297chr431279 611 345 --21750 668 --
NM_000314chr1092615 2562 2460 2313 2293 2132 1138 1107 551 12571 1615 --
NM_000330chrX42059 1888 644 416 ----1355
NM_000332chr6136190 5474 5435 5405 5102 5076 4476 4365 2805 2163 2001 1090 994 76658 5189 4790 4623 1764 1693 1409 47128 6448 6230 2267 16112
NM_000337chr5105925 5322 5139 5013 4965 4148 2571 1759 671 495 34366 4216 469 36119 6041 2274 --
NM_000358chr5177 ------
NM_000362chr2263267 1232 1192 1129 688 338 --13169 11185
NM_000379chr251074 991 576 526 355 ----1272
NM_000393chr221974 76 ----11342
NM_000396chr12387 96 1537 ----
NM_000408chr252912 965 624 505 437 33310 658 85 11311 --
NM_000411chr2141131 779 443 174 22988 902 --22934 51
NM_000430chr1773501 2485 1293 996 513 118 40 31282 1195 424 --1952
NM_000437chr172222 1915 1807 1338 690 490 169 ----11488
NM_000439chr552571 1653 552 256 70 22423 743 21774 608 21012 361
NM_000441chr752358 2024 1537 866 843 41480 1448 639 487 --12290
NM_000448chr1173296 3169 2271 2182 1242 1213 448 ----23305 232
NM_000461chr394305 1755 1729 1166 1056 1032 994 865 220 13509 13613 --
NM_000462chr1521860 307 21504 526 ----
NM_000480chr1181407 1358 603 467 405 221 188 113 11577 11157 --
NM_000493chr65821 776 737 361 127 1116 --11071
NM_000508chr42882 384 1169 1390 --
NM_000522chr71876 --1899 1366
NM_000544chr6_cox_hap173397 2828 2791 2418 778 536 520 23190 1068 --12924
NM_000555chrX117900 7222 7036 6330 5941 5071 4891 2372 2298 908 449 57508 6946 5268 1559 132 16544 27362 1381
NM_000572chr131008 283 65 ------
NM_000573chr121771 102 --184 12179
NM_000587chr521160 1090 21047 959 1172 --
NM_000597chr21288 ------
NM_000598chr72231 177 2511 158 ----
NM_000599chr244236 1704 1216 130 1680 11422 --
NM_000609chr1073097 2927 2809 2767 2681 322 153 149 ----
NM_000610chr1132759 2573 234 32375 580 201 1395 12770
NM_000615chr1162838 2593 1872 1086 973 487 22125 957 ----
NM_000618chr12106026 5146 4814 4726 2394 1608 1601 1589 466 354 46556 6360 6086 1807 12482 36446 5083 1864
NM_000618chr12106026 5146 4814 4726 2394 1608 1601 1589 466 354 46556 6360 6086 1807 12482 36446 5083 1864
NM_000633chr1824179 851 44714 1939 1089 874 24583 403 23175 1518
NM_000639chr12708 91 ------
NM_000651chr121771 102 --184 12179
NM_000681chr10--11103 ----
NM_000685chr33847 269 156 ----1713
NM_000685chr33847 269 156 ----1713
NM_000719chr1296112 5522 5290 4623 4352 4144 2367 2020 1751 35015 1353 1321 11304 12323
NM_000724chr103810 414 38 ------
NM_000773chr10------1106
NM_000780chr811252 11263 ----
NM_000793chr1475147 4354 4180 1804 1146 978 308 23464 619 33684 1434 646 14192
NM_000806chr531637 1621 166 1570 1720 1109
NM_000807chr4171 ----2689 523
NM_000809chr4138832 8374 7642 7126 5722 3466 3297 2930 1225 1121 1097 883 635 89243 8938 8462 8390 6820 6267 3069 1555 38682 6661 2389 37298 1773 314
NM_000813chr595146 5058 2066 2043 1951 1710 828 660 538 24398 1755 15089 --
NM_000814chr1574154 3589 2874 2841 1315 1209 682 3699 654 470 ----
NM_000817chr221183 1143 1796 11264 --
NM_000824chr43154 122 86 ------
NM_000826chr411590 11646 11017 1834
NM_000831chr1156222 5673 5662 5417 5327 4878 4306 4243 3817 2344 2058 1701 1593 1564 556 35989 4904 1030 55698 4169 2090 2006 840 34350 4322 4139
NM_000860chr441580 1393 642 103 --21321 71 --
NM_000864chr131099 1086 991 2167 85 --11137
NM_000866chr321884 1586 11289 11231 21189 714
NM_000868chrX52107 2099 1721 1696 576 1107 22063 1605 --
NM_000875chr1596994 6955 6751 6104 5629 5287 5007 888 680 15383 --16517
NM_000880chr81139 ------
NM_000882chr3--147 1358 1415
NM_000891chr1753306 2919 1294 811 302 42576 2382 384 22 --33022 2692 2322
NM_000899chr1274362 4021 3559 3229 1341 594 103 23683 3667 --1478
NM_000901chr442119 1774 541 198 1828 ----
NM_000921chr12197 --1533 --
NM_000925chr3------139
NM_000926chr11149120 9096 9080 8471 8238 8163 7994 7358 7311 6001 2746 2246 2230 1190 49396 2736 847 98 --26069 3333
NM_000933chr2051388 661 341 138 48 --11665 1115
NM_000935chr341049 487 189 66 1264 --1142
NM_000945chr251748 1710 497 208 52 ----22102 1464
NM_000950chrX23045 2803 33317 2444 968 ----
NM_000956chr141841 2325 54 --21115 41
NM_000959chr173411 3275 2801 2642 608 443 121 33976 713 150 13537 --
NM_000962chr951025 628 486 465 24 --13100 1157
NM_000963chr141947 1882 967 305 22486 408 --1547
NM_000983chr121586 1281 11018 --11540
NM_000984chr172333 26 1157 ----
NM_001001132chr2131467 989 138 ----1477
NM_001001323chr1232990 2921 1081 23056 1111 ----
NM_001001330chr101392 1531 11050 --
NM_001001331chr332115 1786 185 3532 479 442 11993 --
NM_001001389chr1132759 2573 234 32375 580 201 1395 12770
NM_001001390chr1132759 2573 234 32375 580 201 1395 12770
NM_001001391chr1132759 2573 234 32375 580 201 1395 12770
NM_001001392chr1142805 2619 1880 280 32421 626 247 1441 12816
NM_001001395chr1252643 2601 1896 1079 1025 --21788 313 --
NM_001001396chr163831 3506 2944 1020 628 284 43450 1603 1567 776 13585 34367 2935 1448
NM_001001419chr564409 3629 3364 3268 1777 1242 45181 4920 4479 1907 24616 522 1318
NM_001001420chr564409 3629 3364 3268 1777 1242 45181 4920 4479 1907 24616 522 1318
NM_001001436chr161623 --1823 1879
NM_001001481chr842954 1011 733 75 --12490 --
NM_001001484chr1022453 1956 31532 555 152 22338 909 --
NM_001001521chr21298 ------
NM_001001556chr1511168 --2581 269 11541
NM_001001660chr121249 ------
NM_001001664chr231616 1508 1457 43938 3816 3022 2677 ----
NM_001001665chr233097 2953 391 --23077 451 --
NM_001001668chr1963951 3643 3249 2830 1206 1126 --191 1224
NM_001001701chr431465 815 250 31895 1526 52 12028 --
NM_001001740chr11281 ------
NM_001001740chr11281 ------
NM_001001890chr2143808 1704 1225 1187 --13351 12775
NM_001001938chr974117 4048 4002 3230 2835 2706 1363 52630 1244 1077 971 539 21390 572 13423
NM_001001974chr1052250 2032 1596 745 236 41907 1656 668 516 12230 11833
NM_001002032chr17146 ------
NM_001002233chr871663 1435 751 614 594 472 279 --12051 --
NM_001002243chr21229 2914 316 ----
NM_001002257chr273538 2992 2653 2607 1223 687 184 32939 880 675 --1346
NM_001002838chrX41683 1211 153 109 ----11458
NM_001002860chr1484214 4058 3761 1819 1598 1570 1182 216 24178 3666 --13168
NM_001003407chr10114795 4487 4133 4053 3955 3554 3162 1777 1692 786 569 24917 3757 11655 --
NM_001003408chr10114795 4487 4133 4053 3955 3554 3162 1777 1692 786 569 24917 3757 11655 --
NM_001003652chr18118716 7882 7742 7193 6548 6394 3279 2167 1572 1469 1353 78310 7098 3221 2668 2517 1599 602 1168 27941 6821
NM_001003665chr183512 3067 3001 1077 870 823 449 104 2207 151 1648 21342 1139
NM_001003674chr1896094 5934 5414 4864 4649 1927 316 282 198 46322 6185 2740 2159 16788 --
NM_001003675chr1896094 5934 5414 4864 4649 1927 316 282 198 46322 6185 2740 2159 16788 --
NM_001003679chr15593 553 409 203 85 1128 41999 1679 1499 1412 --
NM_001003683chr2145 ------
NM_001003712chr1263366 3102 3002 1093 187 40 21342 342 43787 3721 3306 865 --
NM_001003800chr963482 3438 1150 1062 917 533 43622 2315 898 688 ----
NM_001003803chr14------139
NM_001003810chr42172 159 --3671 70 58 --
NM_001004051chrX1309 ------
NM_001004065chr973887 3617 3137 2621 2525 1542 190 13310 ----
NM_001004308chrX51495 1271 1081 349 286 ----11152
NM_001004330chr1231655 653 195 --31414 1310 188 1133
NM_001004342chr185994 5445 5160 4895 1641 1521 1276 1035 45113 2152 1299 985 --16094
NM_001004346chr4150 --11285 --
NM_001004360chr231982 1637 1266 21954 1750 21911 153 11873
NM_001004419chr1264095 3995 3814 1498 1377 524 33466 861 821 --33442 2821 1002
NM_001004720chr21689 --1968 --
NM_001004722chr21858 --11137 --
NM_001005158chr3132 ------
NM_001005159chr3132 ------
NM_001005242chr1221401 1318 --11430 --
NM_001005266chr15--1656 ----
NM_001005267chr15--1656 ----
NM_001005268chr15--1656 ----
NM_001005269chr15--1656 ----
NM_001005375chrY51338 734 457 172 132 ----1435
NM_001005386chr252404 2293 2202 892 65 --21663 185 12422
NM_001005404chr1764514 4150 3687 3348 2944 1192 --13335 --
NM_001005463chr1011034 ------
NM_001005473chr5136510 6414 6039 5955 5564 5153 4136 1598 1498 1348 1307 203 103 66283 2652 2202 1273 1241 828 14688 15347
NM_001005474chr331405 502 219 --1235 1584
NM_001005476chr2179 --1526 --
NM_001005505chr31444 ------
NM_001005527chr351315 1256 392 235 222 --1989 --
NM_001005611chrX1497 ------
NM_001005743chr1411271 1165 1301 --
NM_001005744chr1411271 1165 1301 --
NM_001005745chr1411271 1165 1301 --
NM_001005782chr23939 909 121 1114 1130 --
NM_001005845chr841889 1863 750 672 --11301 --
NM_001006118chrY1266 ----1218
NM_001006120chrY1266 ----1218
NM_001006600chr512433 22395 1501 22469 467 1582
NM_001006612chrX2162 21 ------
NM_001006613chrX2162 21 ------
NM_001006614chrX2162 21 ------
NM_001006618chr9152 --1212 --
NM_001006623chr262552 2296 1644 818 477 205 ----1294
NM_001006945chr13624 277 96 185 ----
NM_001007023chr1475147 4354 4180 1804 1146 978 308 23464 619 33684 1434 646 14192
NM_001007024chr1773846 3679 3508 3279 2946 1331 1096 61561 1058 1019 905 786 54 13222 --
NM_001007025chr1773846 3679 3508 3279 2946 1331 1096 61561 1058 1019 905 786 54 13222 --
NM_001007097chr974087 3423 3171 1894 1576 1221 116 41404 985 655 330 11845 --
NM_001007099chr1--126 ----
NM_001007100chr1--126 ----
NM_001007102chr641658 1403 603 501 ----11107
NM_001007157chr7--125 ----
NM_001007189chr5------1117
NM_001007237chr122596 921 32569 2258 1752 --22335 487
NM_001007246chr2131663 1339 357 41557 511 373 234 --11874
NM_001007466chr624761 579 --15177 21168 1081
NM_001007471chr92679 180 ------
NM_001007526chrY1266 ----1218
NM_001007559chr1811967 --21477 787 11341
NM_001008225chr71608 ----1748
NM_001008239chr1833342 874 349 23808 3158 22655 755 --
NM_001008388chr431035 288 128 --2731 384 --
NM_001008392chr372739 2354 2326 2304 1370 1352 409 42892 2595 2336 39 23472 3084 --
NM_001008405chr711461 31556 680 170 11167 11479
NM_001008408chr796388 6023 5400 4807 4564 1230 931 396 309 22083 2035 ----
NM_001008495chr851933 1805 1743 1704 1463 ------
NM_001008541chr1052334 2048 1835 874 283 2610 557 ----
NM_001008541chr1052334 2048 1835 874 283 2610 557 ----
NM_001008564chr1362029 1936 1882 1515 418 215 1131 22104 137 --
NM_001008566chr223483 388 192 ------
NM_001008707chr1411937 --11241 11420
NM_001008723chr10--1341 ----
NM_001008738chr51241 12699 1108 1251
NM_001008779chr2--1266 ----
NM_001008895chr1331437 1194 401 41309 1244 1229 1171 ----
NM_001008925chr442447 2387 1079 658 12991 11426 13381
NM_001009552chr81184 ------
NM_001009554chr494625 4569 3497 3282 2953 1318 1271 779 328 23414 2999 11731 --
NM_001009554chr494625 4569 3497 3282 2953 1318 1271 779 328 23414 2999 11731 --
NM_001009881chr1----1616 --
NM_001009882chr1----1616 --
NM_001009899chr356427 5396 995 970 134 15034 26095 610 21691 1260
NM_001009958chr71140 ------
NM_001009960chr742867 2147 588 165 11031 12185 156
NM_001009993chr284487 3780 3505 3487 3236 1419 999 273 23678 1172 23949 1433 1480
NM_001010853chr653300 2940 2856 898 880 12824 22756 495 12785
NM_001010861chr142589 1926 750 641 1451 1438 --
NM_001010870chr65478 461 434 375 82 --1507 --
NM_001010891chr5156692 6583 6571 6425 6161 6150 5299 2287 1330 1193 906 632 459 358 336 36615 5422 1631 --34823 1807 1608
NM_001010895chr911690 1283 11915 164
NM_001010922chr174252 3996 3864 3840 3612 1255 702 13735 12635 --
NM_001010923chr661544 1298 1150 580 467 339 2683 355 ----
NM_001010927chr61551 ------
NM_001010984chr142588 1679 846 266 11757 --12575
NM_001010986chrX31559 822 640 --12146 1898
NM_001011513chr463918 3181 2607 2562 1560 151 1100 135 1327
NM_001011515chr411007 ------
NM_001011516chr411007 ------
NM_001011537chr382346 1777 1686 1597 1583 680 509 132 139 ----
NM_001011663chr1031000 785 298 2959 758 ----
NM_001011666chr776285 5143 5115 4796 4297 2347 1635 26127 2416 44601 4101 4030 1832 14570
NM_001011708chr262125 958 411 352 319 48 51958 918 897 801 74 ----
NM_001011713chr143618 417 179 11598 11421 --
NM_001011720chr84922 587 551 180 ----2544 110
NM_001012393chr1153894 1151 849 720 23 34552 3203 1525 1646 --
NM_001012398chr162980 271 --1442 --
NM_001012419chr921101 895 21248 1173 11198 --
NM_001012420chr1542537 2109 2044 829 12708 22457 95 32653 2602 2182
NM_001012423chr1552537 2109 2044 829 95 12708 12457 32653 2602 2182
NM_001012425chr1------1101
NM_001012512chr181108 ------
NM_001012513chr181119 ------
NM_001012751chr10--21937 1469 11777 --
NM_001012754chr1392148 1996 1896 1803 1641 1587 641 600 436 21830 1573 ----
NM_001012990chrX151 ------
NM_001013031chr1072564 1273 1241 961 887 807 185 2436 174 ----
NM_001013398chr72231 177 2511 158 ----
NM_001013659chr1965373 4960 4299 4222 3841 1334 24187 3315 1389 15420
NM_001013674chr13504 315 26 2748 323 ----
NM_001014283chr1342155 1637 728 537 11604 --1602
NM_001014380chr13125363 5041 4980 4768 3673 1998 1590 1567 1506 1388 1221 1023 34906 3765 1617 35760 4005 630 15086
NM_001014434chr11273 ----1703
NM_001014797chr1087323 7158 6364 6178 6083 4966 2609 1544 48131 7283 5368 1332 --12371
NM_001015045chr422447 812 21848 75 32301 2127 1854 --
NM_001015508chr8------1295
NM_001015877chrX42536 2438 2359 303 11072 ----
NM_001015881chrX3937 865 196 ----11021
NM_001015882chr931008 288 121 ------
NM_001017368chr1752483 2464 1952 1945 1775 12578 --11752
NM_001017371chr21513 ------
NM_001017395chr373389 3332 3108 3092 580 466 81 23256 903 22771 287 --
NM_001017415chr1194 --2773 148 --
NM_001017416chr1194 --2773 148 --
NM_001017923chr1441422 469 421 308 21114 564 2486 333 --
NM_001017926chr881797 1668 1598 1205 737 308 292 52 ----11639
NM_001017979chr44687 676 617 207 ----1177
NM_001017992chr541459 1435 1319 1220 31267 1107 1090 1564 --
NM_001018008chr152430 273 3524 487 444 ----
NM_001018025chrX2696 307 ----1640
NM_001018038chr94544 473 146 91 ----1528
NM_001018056chr9--1396 ----
NM_001018064chr941907 797 323 314 11986 11742 --
NM_001018065chr995378 2104 1939 1715 1210 1164 474 337 297 12046 ----
NM_001018066chr995378 2104 1939 1715 1210 1164 474 337 297 12046 ----
NM_001018067chr133256 2043 1983 34425 4238 3985 24951 3369 --
NM_001018068chr133256 2043 1983 34425 4238 3985 24951 3369 --
NM_001018069chr133256 2043 1983 34425 4238 3985 24951 3369 --
NM_001018074chr552788 2525 1575 1440 1009 23474 2756 ----
NM_001018075chr552788 2525 1575 1440 1009 23474 2756 ----
NM_001018076chr552788 2525 1575 1440 1009 23474 2756 ----
NM_001018077chr552788 2525 1575 1440 1009 23474 2756 ----
NM_001018091chr1542491 895 357 111 --1301 --
NM_001018111chr783919 3602 3071 2925 2439 1566 698 522 13028 13367 --
NM_001020658chr131494 1150 497 21684 97 ----
NM_001020658chr131494 1150 497 21684 97 ----
NM_001023560chr63818 757 314 3885 868 697 2743 719 --
NM_001023567chr15--12095 195 --
NM_001023587chr341131 393 357 323 1964 2310 270 --
NM_001024094chr552788 2525 1575 1440 1009 23474 2756 ----
NM_001024647chr12127653 7291 6934 6770 6195 6016 5650 2853 1529 1352 1195 400 55415 1694 1551 1003 524 1494 --
NM_001024649chr552946 2828 2074 2047 783 22692 2612 ----
NM_001024847chr341844 800 725 475 --11695 --
NM_001024947chr52827 113 --11099 --
NM_001024948chr173381 3131 2508 1305 917 440 290 1390 32867 841 371 --
NM_001024956chr11104967 4856 4696 3607 3571 1305 873 803 704 617 --21185 780 --
NM_001025076chr1094856 4090 2454 1987 1970 1492 1427 1147 490 25242 199 --11460
NM_001025077chr10116214 5448 4748 4696 2850 2785 2505 1848 1120 1071 970 46600 4650 1557 398 1264 12818
NM_001025079chr363886 3405 1426 1413 957 787 24044 3509 33798 987 915 --
NM_001025105chr531199 1061 349 21513 1260 ----
NM_001025108chr231337 1261 652 53883 3467 3340 1522 773 23537 3236 --
NM_001025266chr363676 1803 983 869 523 236 11531 34046 3534 281 --
NM_001025366chr61482 11523 ----
NM_001025366chr61482 11523 ----
NM_001025367chr61482 11523 ----
NM_001025367chr61482 11523 ----
NM_001025368chr61482 11523 ----
NM_001025368chr61482 11523 ----
NM_001025369chr61498 11539 ----
NM_001025369chr61498 11539 ----
NM_001025370chr61482 11523 ----
NM_001025370chr61482 11523 ----
NM_001025389chr1181407 1358 603 467 405 221 188 113 11577 11157 --
NM_001025390chr1181407 1358 603 467 405 221 188 113 11577 11157 --
NM_001025580chrX64147 3946 3585 2939 2756 1470 33885 3083 554 --23396 3383
NM_001025595chr411062 1276 1206 --
NM_001025596chr111500 ------
NM_001025777chr22138 131 ----136
NM_001029851chr52203 127 --1825 --
NM_001029852chr52203 127 --1825 --
NM_001029853chr52203 127 --1825 --
NM_001029854chr52203 127 --1825 --
NM_001029858chr642881 2232 2157 265 22781 1067 12452 --
NM_001029860chr83364 69 46 ------
NM_001029875chr521991 1889 22285 1984 1830 22884 37
NM_001029991chr141144 ------
NM_001029998chr451360 1016 979 157 66 1338 ----
NM_001030007chr1683709 3204 2516 1105 939 483 326 213 31414 1294 557 ----
NM_001030055chr1463940 3609 3386 601 405 130 34159 3505 522 14508 --
NM_001031623chr62266 145 ----1112
NM_001031679chr12--23502 2404 33248 2343 2316 13351
NM_001031684chr241087 518 288 279 2416 193 1122 --
NM_001031689chr9158 ------
NM_001031695chr2294874 4525 1469 1034 765 491 418 380 175 ----11834
NM_001031700chr45995 927 680 260 252 2300 188 --21605 783
NM_001031710chr721096 855 ------
NM_001031716chr241132 962 868 789 1724 ----
NM_001031732chr443234 2761 2389 1248 13443 11319 --
NM_001031804chr1674029 3780 3733 3690 3456 2937 410 13310 --31555 846 287
NM_001032221chr91276 31758 1457 171 ----
NM_001032280chr621363 1128 ------
NM_001032282chr83296 256 245 ------
NM_001032283chr122963 180 3718 290 238 ----
NM_001032284chr122963 180 3718 290 238 ----
NM_001032288chr2031453 1169 1060 21475 631 --1185
NM_001032380chr1031848 1239 47 ----11551
NM_001032394chr642749 2205 890 566 --1511 12297
NM_001032395chr642616 2072 757 433 --1378 12164
NM_001032999chr20105231 4904 4698 4565 4319 1787 1681 1179 804 717 24041 3328 --31064 940 764
NM_001033045chr263520 1747 1683 1650 553 103 --33909 1698 311 --
NM_001033049chr2152362 2174 1990 937 258 --22188 73 --
NM_001033057chr371970 1770 1654 850 761 403 98 ----1145
NM_001033059chr631945 1524 152 11614 11650 --
NM_001033087chr2053138 2517 1122 666 527 12925 --32882 2484 977
NM_001033112chr53710 596 361 --1580 --
NM_001033503chr5154 1370 1148 --
NM_001033506chr11--1377 ----
NM_001033564chr661884 436 192 69 61 28 --11483 11919
NM_001033578chr81957 2921 487 ----
NM_001033756chr61416 11457 ----
NM_001033756chr61416 11457 ----
NM_001033925chr10162 11807 41676 1537 861 466 --
NM_001034841chr1655493 5158 5150 1637 1085 35205 5176 893 23618 476 1737
NM_001034850chr571655 1601 1460 1394 1353 1093 580 11592 11411 11253
NM_001034915chr821550 194 21486 44 ----
NM_001034954chr1073214 2289 2120 751 720 477 291 13080 22790 1079 --
NM_001034955chr1073214 2289 2120 751 720 477 291 13080 22790 1079 --
NM_001034956chr1073214 2289 2120 751 720 477 291 13080 22790 1079 --
NM_001034957chr1073214 2289 2120 751 720 477 291 13080 22790 1079 --
NM_001035003chr45569 445 380 262 159 11043 ----
NM_001035004chr45569 445 380 262 159 11043 ----
NM_001035260chr1031200 1045 661 21610 297 143 11671
NM_001037131chr24997 833 495 445 11298 11111 --
NM_001037164chr751646 1639 482 291 48 21380 550 ----
NM_001037165chr787636 7416 6565 5621 1609 745 674 156 37400 2735 2438 38786 8353 2754 --
NM_001037174chr221483 301 11580 21917 1448 1148
NM_001037277chr131416 360 222 11558 1228 --
NM_001037278chr131416 360 222 11558 1228 --
NM_001037317chr142589 1926 750 641 1451 1438 --
NM_001037637chr52367 98 ------
NM_001037738chr5----1314 --
NM_001037872chr21557 ------
NM_001037954chr1173280 2378 1169 541 469 260 175 21388 780 23059 218 1337
NM_001038640chr152899 301 --1171 --
NM_001039111chr3185 ------
NM_001039199chr2084281 4012 3880 3817 3091 1981 1256 303 65056 5038 3187 1920 1582 1117 21926 255 --
NM_001039366chr22----165 --
NM_001039547chr3106674 6211 6001 5282 5180 5028 3046 2385 2256 2120 38012 6160 484 52957 1479 906 642 433 14928
NM_001039569chr253231 2803 540 376 346 12737 1907 --
NM_001039580chr493958 3916 3490 1782 1275 990 939 673 174 43284 1297 659 460 11234 14651
NM_001039585chr183668 3532 3058 2899 865 700 378 224 34233 970 407 13794 --
NM_001039590chrX73581 2818 2652 2594 1457 1265 628 12948 --12446
NM_001039591chrX73581 2818 2652 2594 1457 1265 628 12948 --12446
NM_001039618chr11115593 5319 4698 4584 4553 4534 4110 3927 3752 2296 1632 53804 2386 2312 2170 1933 24992 4803 22257 1881
NM_001039619chr141293 --1236 --
NM_001039709chr20105231 4904 4698 4565 4319 1787 1681 1179 804 717 24041 3328 --31064 940 764
NM_001039771chr1431172 847 840 ------
NM_001039840chrX115770 5714 5228 4683 3879 2033 1103 913 906 687 309 45653 5633 1812 966 24632 1866 32163 1578 1330
NM_001039937chr1344057 3739 3387 473 1938 13834 21489 112
NM_001040001chr641579 672 644 73 21998 690 --11529
NM_001040092chr81123 ----177
NM_001040100chr321231 94 2311 156 11248 --
NM_001040135chr74726 717 653 279 1302 ----
NM_001040142chr2--12256 --12304
NM_001040143chr2--12256 --12304
NM_001040151chr11114318 4091 3667 3436 3390 3286 3156 2816 731 602 166 64513 4182 3275 1544 1479 1312 24064 3845 11508
NM_001040152chr7114507 4350 4236 3922 3779 3572 3388 3378 1305 425 319 34312 1352 1276 13438 13251
NM_001040158chr5------1498
NM_001040159chr42584 253 1353 --1132
NM_001040202chr442199 1954 989 847 11579 32247 1903 251 --
NM_001040214chr622336 2184 ----11668
NM_001040284chr1685728 5651 5467 4750 4299 4278 412 237 65327 1940 1576 1499 1450 618 --14097
NM_001040402chr482828 2753 2733 2719 2674 2536 2043 371 2490 322 1589 --
NM_001040409chr2--1822 ----
NM_001040429chr1332662 2486 822 --23008 136 22411 1436
NM_001040441chr185376 3717 1250 505 463 168 145 123 31221 856 580 11521 2596 514
NM_001040450chr151372 32351 972 414 22161 1097 11027
NM_001040453chr151372 32351 972 414 22161 1097 11027
NM_001040633chr71219 3974 738 684 --1720
NM_001040665chr764697 4622 3498 3382 624 390 35007 4731 3720 23204 529 --
NM_001040666chr7--1709 ----
NM_001040708chr811048 ------
NM_001040709chr141734 953 940 505 31779 343 291 22557 932 11969
NM_001040712chr932193 64 21 --1237 1706
NM_001040876chr431409 669 452 1106 ----
NM_001042355chr1684811 4645 4042 3280 1874 1427 1164 664 --14351 15131
NM_001042406chr63500 439 232 --11200 21131 62
NM_001042412chr1684811 4645 4042 3280 1874 1427 1164 664 --14351 15131
NM_001042413chr963604 3257 1468 1256 1244 1177 ----13177
NM_001042425chr621363 1128 ------
NM_001042440chr5121729 1254 805 637 497 487 288 229 191 141 68 24 11364 --11646
NM_001042441chr5121729 1254 805 637 497 487 288 229 191 141 68 24 11364 --11646
NM_001042442chr5121729 1254 805 637 497 487 288 229 191 141 68 24 11364 --11646
NM_001042443chr5121729 1254 805 637 497 487 288 229 191 141 68 24 11364 --11646
NM_001042444chr5121729 1254 805 637 497 487 288 229 191 141 68 24 11364 --11646
NM_001042445chr5121729 1254 805 637 497 487 288 229 191 141 68 24 11364 --11646
NM_001042446chr5121729 1254 805 637 497 487 288 229 191 141 68 24 11364 --11646
NM_001042453chrX51563 1484 1172 597 582 21761 178 11290 11647
NM_001042473chr101716 22038 825 ----
NM_001042481chr1432369 694 310 ------
NM_001042492chr1773180 3071 2499 1351 1105 913 226 22324 2279 11377 --
NM_001042510chr8--1827 11950 1852
NM_001042511chr8--1827 11950 1852
NM_001042533chr363362 3310 3150 2499 2106 1225 12088 --11046
NM_001042537chrX82420 2330 2199 2127 1760 1004 535 93 1661 --12016
NM_001042552chr12987 936 --183 154
NM_001042555chr1264745 2924 992 812 295 120 2935 398 43397 1599 754 670 1747
NM_001042599chr2117641 6704 6478 6390 5779 4824 2917 1920 1137 1118 932 87199 7165 6625 5587 5370 1749 1637 516 15034 17809
NM_001042601chr383311 2992 2510 2218 895 840 393 360 23179 3021 2538 489 22718 2379
NM_001042603chr1285015 4573 4011 3582 3559 1952 698 681 44899 3903 1523 744 12066 13768
NM_001042604chr341940 1290 690 545 11874 14244 --
NM_001042632chr2042502 2281 874 514 22478 1702 42614 2187 2113 1915 12247
NM_001042633chr2042502 2281 874 514 22478 1702 42614 2187 2113 1915 12247
NM_001042749chrX31883 263 198 --1318 --
NM_001042750chrX31883 263 198 --1318 --
NM_001042751chrX31883 263 198 --1318 --
NM_001044305chr63250 163 130 ------
NM_001044385chr2103496 3307 3031 2978 2789 2702 1296 1243 796 642 34064 558 455 --13257
NM_001046chr552682 2058 1111 1097 894 32916 1183 342 1860 1131
NM_001048183chr193515 3468 3303 607 453 273 213 140 123 13198 --1665
NM_001071775chr1341620 1332 419 52 1541 1729 --
NM_001083620chr411589 11645 11016 1833
NM_001083621chr174699 4609 3375 2903 1081 1036 674 34292 1629 310 1185 --
NM_001099678chr366262 6109 5530 5399 5200 292 11200 --16286
NM_001100108chr188253 7886 6873 6006 5910 2810 1937 39 87644 6980 6803 5324 2838 2441 1799 881 42935 2510 1167 584 --
NM_001106chr3139366 7608 7576 7392 7320 6745 6449 6304 3878 3808 3149 3005 434 69626 9080 6438 3454 1407 809 78678 8289 7915 7550 6025 1300 41 29373 8377
NM_001113490chrX62781 2694 2441 1006 689 245 22884 1027 ----
NM_001116chr1641085 1050 525 327 --22917 2024 12991
NM_001117chr1831860 1631 379 11763 ----
NM_001121chr1041885 1171 279 199 1622 ----
NM_001126chr11112 1781 ----
NM_001128chr1683709 3204 2516 1105 939 483 326 213 31414 1294 557 ----
NM_001135chr15--1826 ----
NM_001148chr431687 1586 861 --11481 11400
NM_001160chr122408 43 22754 1818 ----
NM_001167chrX106719 6466 6359 4823 4431 4393 2695 1076 684 162 21489 576 36365 5235 325 --
NM_001173chr1463940 3609 3386 601 405 130 34159 3505 522 14508 --
NM_001174chrX62219 2138 1709 381 318 146 1394 ----
NM_001177chr1262402 2330 1662 961 327 177 11562 22240 2132 12360
NM_001186chr2142955 993 737 401 53009 2694 2543 2078 427 1859 11113
NM_001198chr631951 442 278 31645 570 135 1637 --
NM_001200chr2021102 834 1161 --1965
NM_001201chr473548 3318 3249 2980 1369 407 192 2830 325 122 --
NM_001204chr2177507 7336 7295 6844 6449 6107 5167 5142 2675 2599 2238 2180 1928 1118 1047 619 506 25816 719 22828 2213 46196 5942 5503 1172
NM_001206chr942397 781 694 233 42749 2676 1993 724 11121 11150
NM_001207chr52367 98 ------
NM_001227chr1031268 296 166 --1449 21145 918
NM_001233chr752231 2091 1871 1730 22 --12112 --
NM_001237chr4197 --1467 11171
NM_001237chr4197 --1467 11171
NM_001241chr231570 883 461 1248 21792 427 12386
NM_001241chr231570 883 461 1248 21792 427 12386
NM_001256chr1722731 1177 --22656 2143 --
NM_001259chr7126183 5756 5705 5327 5221 5067 4104 4049 4000 2389 293 128 55592 4304 1140 909 174 34930 2287 103 --
NM_001286chr141018 967 685 175 --12844 --
NM_001289chrX21586 550 ----11217
NM_001300chr101392 ------
NM_001304chr1783538 3388 2884 1390 1133 781 208 164 --32425 996 932 13412
NM_001310chr12132978 2960 2797 2783 2454 2290 2183 2090 1965 1888 1119 1090 939 ----1993
NM_001331chr1162771 2463 2337 525 412 24 1913 ----
NM_001332chr51505 1613 ----
NM_001338chr211293 11218 --2365 215
NM_001343chr531268 605 375 11643 ----
NM_001349chr2----1405 1460
NM_001351chr361464 1312 638 358 84 44 1336 11470 --
NM_001356chrX32291 833 206 11851 ----
NM_001358chr4------1110
NM_001386chr841811 1714 946 535 161 11940 --
NM_001387chr583122 2627 2594 2498 2078 2028 638 50 33099 3008 1075 ----
NM_001390chr1863589 3421 3335 1395 1138 490 32512 1458 907 12405 13433
NM_001396chr2142788 2180 2005 806 12822 1651 --
NM_001406chr17----11751 --
NM_001412chrX82641 2391 1457 1026 437 352 320 36 --11471 13481
NM_001415chrX11973 2662 599 11851 --
NM_001418chr11162 --1653 --
NM_001418chr11162 --1653 --
NM_001419chr1994747 4320 4268 1469 1339 1194 907 282 117 34524 3196 177 13794 --
NM_001426chr2--2744 180 1481 --
NM_001429chr2221079 80 ------
NM_001432chr4113748 3665 3595 3451 3385 3340 2495 2424 1511 1282 925 13433 13735 1542
NM_001438chr131261 966 825 ----1401
NM_001446chr6----2287 202 --
NM_001451chr1621261 231 1476 --31228 1221 1088
NM_001453chr621739 1610 11389 ----
NM_001455chr653959 3790 1145 744 413 13931 34702 3605 3274 --
NM_001460chr112623 23105 2584 11265 13607
NM_001463chr22722 517 ------
NM_001465chr561912 1577 1428 618 160 54 11522 22089 761 --
NM_001491chr682697 2041 1789 906 790 525 390 201 22568 799 ----
NM_001499chr91157 --1143 --
NM_001527chr664891 4865 4561 676 291 72 24072 3869 24452 3729 --
NM_001542chr122596 921 32569 2258 1752 --22335 487
NM_001546chr621015 390 --1900 --
NM_001584chr11--1407 --1186
NM_001604chr112923 740 ------
NM_001608chr22250 175 ----1679
NM_001609chr1053834 3791 3263 1367 493 32886 1668 1259 1632 --
NM_001616chr232789 1196 41 53155 2887 806 312 241 22709 644 1928
NM_001619chr1111049 ------
NM_001621chr732337 1932 1181 22632 2408 1339 11926
NM_001621chr732337 1932 1181 22632 2408 1339 11926
NM_001622chr3--1307 ----
NM_001634chr631945 1524 152 11614 11650 --
NM_001650chr1843139 2917 1244 1130 23630 3613 23009 387 1660
NM_001656chr521541 24 --1726 --
NM_001663chr1452642 249 242 117 104 41708 884 727 705 1110 22403 2361
NM_001668chr152287 2143 418 382 230 2505 224 12258 1879
NM_001682chr1232704 2635 795 42770 1137 1091 825 ----
NM_001683chr332115 1786 185 3532 479 442 11993 --
NM_001684chr153548 3223 2661 737 345 43167 1320 1284 493 13302 34084 2652 1165
NM_001688chr12226 66 1707 ----
NM_001690chr322201 403 22491 1639 1222 12208
NM_001695chr853773 3432 798 660 466 23369 917 43999 2697 748 710 11586
NM_001696chr22----165 --
NM_001706chr31887 ------
NM_001709chr1111764 32273 2227 925 22214 384 --
NM_001717chr1521023 116 1460 ----
NM_001723chr6--1233 ----
NM_001729chr4--1384 --160
NM_001730chr131140 1630 --1199
NM_001730chr131140 1630 --1199
NM_001742chr74607 430 397 390 21233 350 1146 --
NM_001746chr552946 2828 2074 2047 783 22692 2612 ----
NM_001750chr5121729 1254 805 637 497 487 288 229 191 141 68 24 11364 --11646
NM_001754chr2143808 1704 1225 1187 --13351 12775
NM_001755chr1632156 1526 1436 22124 1445 21658 268 --
NM_001759chr1265297 4537 4251 3778 1101 44 24304 978 33386 1569 204 15286
NM_001762chr72708 674 2161 97 124 --
NM_001769chr121406 ------
NM_001777chr363886 3405 1426 1413 957 787 24044 3509 33798 987 915 --
NM_001796chr161248 ------
NM_001797chr16--1802 ----
NM_001806chr1952267 1006 987 265 188 11848 12463 --
NM_001812chr41240 ------
NM_001829chr41607 ------
NM_001830chrX104025 3815 3474 3209 3198 3090 3082 2613 622 602 13782 21224 521 --
NM_001845chr131479 ------
NM_001854chr151133 1038 608 454 83 21479 180 1267 --
NM_001858chr664249 4124 3284 1540 380 148 24587 1206 11592 --
NM_001859chr973875 1410 1276 1129 1031 354 175 23412 2736 11382 --
NM_001866chrX------1118
NM_001870chr3--1257 ----
NM_001881chr10--1140 --2473 338
NM_001884chr5--1392 --1430
NM_001891chr42109 38 1302 ----
NM_001892chr531199 1061 349 21513 1260 ----
NM_001901chr63757 727 195 --1344 --
NM_001903chr5----1891 --
NM_001920chr122670 209 1503 ----
NM_001924chr1--2521 50 --1410
NM_001935chr21209 ------
NM_001938chr141870 1850 223 183 --1476 --
NM_001942chr1811377 ------
NM_001946chr1231075 1057 857 ----1368
NM_001957chr452155 1837 1779 1537 687 1561 1539 1483
NM_001963chr4----1593 --
NM_001966chr321050 187 21526 99 ----
NM_001967chr31599 --2446 92 --
NM_001968chr41107 ------
NM_001969chr1483925 2796 2680 1564 1226 700 538 324 22469 235 13372 23720 647
NM_001980chr1232044 765 667 22243 1555 12112 --
NM_001993chr11932 2359 190 ----
NM_001995chr441428 1236 277 82 1363 --11139
NM_001999chr53484 190 136 ----163
NM_002006chr445090 4532 3853 722 25103 1036 13834 13985
NM_002009chr1552659 1845 933 332 324 12787 --1194
NM_002017chr1131391 524 222 1292 ----
NM_002024chrX11408 --12222 31568 844 209
NM_002025chrX199043 8872 7655 7243 7028 6703 6690 6397 6362 5802 3491 3006 2636 2441 2426 2024 1981 800 226 67779 6633 6034 3032 1334 881 47603 2826 1070 751 28422 6113
NM_002026chr22713 119 1331 --1779
NM_002035chr1894010 3842 3783 2451 1514 1154 813 571 218 22548 1171 23447 43 --
NM_002039chr4263 24 1691 1179 --
NM_002040chr212633 114 1379 22181 83 1324
NM_002044chr1511168 --2581 269 11541
NM_002048chr9----1387 --
NM_002056chr22290 207 --1741 1310
NM_002061chr121677 123 21196 683 --1663
NM_002072chr9--1763 ----
NM_002076chr1243218 2575 2256 890 2804 134 --1811
NM_002091chr181108 ------
NM_002092chr4104692 4509 3710 3405 3213 2018 1639 535 491 249 34738 4368 1729 24757 1866 --
NM_002101chr2------1516
NM_002106chr41124 ------
NM_002114chr6--2441 57 ----
NM_002126chr17114174 3219 2870 2785 2564 1611 1263 1230 1205 844 56 23728 1295 13689 --
NM_002128chr1331868 539 431 2775 491 12092 12556
NM_002129chr4----1439 --
NM_002130chr551116 1089 670 396 83 41713 1580 614 526 --1621
NM_002137chr7--1392 --11983
NM_002138chr42172 159 --3671 70 58 --
NM_002139chrX1189 ------
NM_002158chr252969 2744 1284 1112 683 23269 1364 11234 1247
NM_002182chr322759 2111 1798 11752 --
NM_002199chr4----1744 --
NM_002202chr52994 937 168 1388 --
NM_002203chr544007 3727 1372 1342 24147 899 --13645
NM_002210chr283526 3061 2526 2390 2340 2190 1278 613 33378 3368 2319 --42968 2533 2273 2176
NM_002211chr1021053 918 2158 114 ----
NM_002214chr7105474 4772 4211 3764 3679 2166 1943 974 426 287 25287 4077 25407 4743 --
NM_002222chr321358 429 21219 1040 1925 --
NM_002223chr12103863 3667 2801 2768 2567 2514 2507 1598 928 758 12662 ----
NM_002239chr23931 854 124 21063 305 --2890 89
NM_002242chr221497 1463 41705 1574 1302 170 1609 11905
NM_002247chr10------31609 554 479
NM_002249chr11433 ------
NM_002264chr374739 4170 3990 3324 3151 1886 1528 23093 1053 23672 3213 34056 1143 164
NM_002267chr1342260 2065 770 733 11931 1432 --
NM_002268chr311352 21735 522 ----
NM_002270chr545396 4466 3896 801 14812 23658 216 --
NM_002271chr1342417 2231 515 125 32085 2031 1898 --11865
NM_002285chr231337 1261 652 53883 3467 3340 1522 773 23537 3236 --
NM_002293chr142637 1072 913 130 --22786 741 --
NM_002303chr1------1106
NM_002312chr132967 36 ----1999
NM_002313chr10114795 4487 4133 4053 3955 3554 3162 1777 1692 786 569 24917 3757 11655 --
NM_002317chr53362 266 49 2307 95 ----
NM_002336chr12105071 4784 4666 4212 3579 1909 1160 887 470 355 14095 168 --
NM_002350chr821170 879 --2937 259 --
NM_002351chrX61717 1413 1321 1222 654 479 51754 1701 1643 544 187 --1671
NM_002356chr632847 2631 1113 22310 1860 ----
NM_002358chr43533 269 175 139 ----
NM_002395chr631225 1136 220 --11209 --
NM_002401chr1782450 2388 2208 1740 1551 924 793 423 12011 12022 --
NM_002408chr142602 162 1845 --1303
NM_002431chr142237 218 ------
NM_002445chr831264 612 64 ------
NM_002449chr521264 1230 21211 859 ----
NM_002465chr12----1314 --
NM_002481chr1117015 6487 6075 5595 5526 5095 3098 2610 1214 958 803 67920 7408 7351 3045 1996 501 21140 254 --
NM_002486chr932394 996 74 1647 --1511
NM_002508chr14775 686 502 346 ------
NM_002519chr1111528 3603 363 152 --2378 88
NM_002524chr13783 209 169 2736 325 --1307
NM_002539chr2--189 ----
NM_002543chr1231193 298 269 151 ----
NM_002545chr1153894 1151 849 720 23 34552 3203 1525 1646 --
NM_002547chrX33436 2926 2669 2380 53 33004 2867 1497 --
NM_002568chr81134 ------
NM_002572chr111133 ------
NM_002577chr343290 1477 1317 139 11456 12466 12863
NM_002581chr994841 4782 4570 3707 2261 1593 1284 526 390 55160 3491 2091 1661 224 --1718
NM_002586chr641431 1051 602 484 1423 --11209
NM_002592chr201298 ------
NM_002595chr1231930 1914 1617 31657 1477 1217 ----
NM_002603chr8----1161 --
NM_002607chr7--1928 ----
NM_002610chr262259 2215 2045 903 554 117 12831 --13159
NM_002613chr1674511 4261 3535 3492 3406 2122 1175 34372 3878 994 15158 --
NM_002635chr12180 ------
NM_002641chrX41832 1701 563 476 ------
NM_002645chr112672 200 23158 2908 22653 2239 --
NM_002655chr874770 4279 1965 1702 1137 558 369 --11261 --
NM_002670chr311596 166 --11430
NM_002687chr1421189 487 ------
NM_002699chr121402 1348 11440 ----
NM_002703chr471791 1785 1588 1298 585 500 385 2664 151 11491 11204
NM_002706chr2--1612 192 --
NM_002709chr222999 91 --33457 2811 2577 --
NM_002718chr362378 2355 1906 1898 715 155 22649 423 ----
NM_002719chr1411831 2716 434 ----
NM_002731chr152687 2670 2661 2074 506 --42762 2528 368 23 12441
NM_002734chr1752227 1924 1805 1622 839 2710 666 --11583
NM_002740chr322823 2293 21869 406 ----
NM_002745chr2242884 1710 1697 1463 43564 3366 3294 303 33845 3688 3301 --
NM_002748chr1511230 11046 ----
NM_002750chr10--1201 ----
NM_002760chrY105472 4783 4406 2185 2133 1739 859 493 479 186 45674 1638 1275 406 45646 3723 1775 663 35175 4822 205
NM_002763chr12492 23 1445 ----
NM_002786chr11183 1194 ----
NM_002809chr171335 ------
NM_002828chr183971 768 187 --1344 --
NM_002830chr2--1126 ----
NM_002834chr1222867 2668 32975 1109 281 2879 747 1158
NM_002835chr72755 481 1194 1702 --
NM_002837chr1254637 4430 4305 2888 588 44390 3731 3063 1744 33717 1617 126 21596 1307
NM_002839chr932193 64 21 --1237 1706
NM_002843chr1163110 2690 1274 666 530 24 13138 1513 --
NM_002844chr621125 126 ------
NM_002847chr741592 1177 1162 65 --11544 11515
NM_002849chr124847 794 213 109 1970 ----
NM_002851chr71203 1725 132 --
NM_002859chr1271773 1750 1650 1272 1215 1164 731 11390 --11767
NM_002865chr81213 ----195
NM_002874chr922302 664 --12113 --
NM_002881chr251430 1377 1338 876 366 21087 971 1553 1531
NM_002886chr394947 4076 4047 1933 1810 1730 1705 1157 628 14251 31969 691 675 14627
NM_002890chr53906 722 242 ------
NM_002892chr1411495 --31084 412 292 --
NM_002894chr18--1240 ----
NM_002902chr152628 173 ------
NM_002906chr1152053 1821 1775 649 301 21725 929 ----
NM_002907chr121141 2340 168 ----
NM_002911chr191643 ------
NM_002912chr62285 171 1599 1117 --
NM_002931chr6--1317 ----
NM_002938chr431548 1417 114 --12033 --
NM_002940chr431409 669 452 1106 ----
NM_002941chr311410 --21364 1104 11503
NM_002942chr341366 1198 922 33 ------
NM_002951chr20--2257 28 ----
NM_002956chr1241316 1151 1084 243 --21171 501 --
NM_002957chr943085 598 450 427 23840 2413 --23473 1170
NM_002959chr174133 3051 2863 2755 2689 1257 508 33531 798 208 24385 1536 --
NM_002970chrX------1254
NM_002979chr1--126 ----
NM_002994chr461968 1343 1329 160 70 60 ------
NM_002998chr81715 --21440 822 --
NM_002999chr204336 237 133 59 ------
NM_003010chr1752370 2038 1965 470 406 21859 599 --1908
NM_003016chr1721876 1256 21542 1303 11492 1679
NM_003017chr651269 1046 907 259 47 2496 182 ----
NM_003022chrX----1166 --
NM_003030chr331846 741 281 1698 11388 --
NM_003034chr12117782 7710 7410 7182 6478 5147 4962 3220 2629 1021 702 57501 5908 5545 3118 2526 12285 25812 3178
NM_003043chr344108 3880 1539 712 --34128 1628 993 --
NM_003048chr272634 2413 2167 1078 978 119 32 21981 63 22419 25 11884
NM_003051chr121654 178 1784 21757 1691 22020 53
NM_003054chr10----1299 --
NM_003068chr8--1732 ----
NM_003070chr91576 --1561 --
NM_003071chr341292 748 695 228 --1754 --
NM_003100chr51384 ------
NM_003106chr3--21108 879 31024 991 328 --
NM_003107chr622204 2162 ------
NM_003108chr296867 6632 5479 5122 4886 4812 469 452 317 35430 1358 477 12116 15518
NM_003111chr21513 ------
NM_003112chr732675 2624 2173 31210 361 55 --2573 63
NM_003133chr15916 793 675 250 53 ----1305
NM_003135chr5------1366
NM_003154chr42250 109 ------
NM_003155chr832647 2122 1752 --31010 493 340 --
NM_003156chr1131379 948 517 --1989 --
NM_003161chr1763583 3104 2847 2753 1238 320 23206 1325 23628 2905 13414
NM_003171chr10158 ------
NM_003178chr351898 1772 1615 1512 874 --21948 578 11527
NM_003184chr84986 205 148 124 1345 ----
NM_003188chr62657 110 126 ----
NM_003193chr11198 ------
NM_003199chr1885646 4898 4076 1531 1210 1013 441 124 42087 1926 1394 380 14888 --
NM_003206chr6--1429 ----
NM_003211chr1231743 1428 315 --21551 212 11737
NM_003220chr621363 1128 ------
NM_003221chr694189 3957 3731 3677 2921 1687 1573 1338 1193 --14117 --
NM_003234chr331895 400 329 1548 --11650
NM_003236chr242861 1347 1337 302 23188 2170 13454 12685
NM_003242chr341844 800 725 475 --11695 --
NM_003253chr211138 41623 1578 651 484 --21766 387
NM_003257chr152336 130 ----1922
NM_003262chr3145062 4218 4099 3544 3218 1645 1488 1364 1144 923 618 499 217 124 24200 3247 ----
NM_003274chr2111894 33001 1850 696 --22443 2276
NM_003275chr93391 219 29 1483 ----
NM_003292chr112268 1566 1424 --
NM_003300chr14----154 --
NM_003304chr331639 1597 1585 --21503 553 --
NM_003319chr22920 75 1282 ----
NM_003320chr1154469 4423 3025 2976 674 23339 1002 --11705
NM_003334chrX--1167 ----
NM_003337chr541646 596 558 333 ------
NM_003338chr102141 112 11979 21818 743 21280 591
NM_003339chr521397 79 152 ----
NM_003342chr1783013 2612 2582 2359 2307 1063 844 213 13137 12858 --
NM_003348chr1221589 1173 1636 21558 215 11128
NM_003349chr2031453 1169 1060 21475 631 --1185
NM_003352chr23939 909 121 1114 1130 --
NM_003368chr1194 --2773 148 --
NM_003369chr1132557 2479 1790 --12231 --
NM_003376chr61482 11523 ----
NM_003376chr61482 11523 ----
NM_003380chr101243 ------
NM_003383chr9--1396 ----
NM_003385chr21730 1155 1887 --
NM_003390chr1141146 1010 700 693 2943 370 ----
NM_003392chr364195 4086 3712 1651 994 803 33974 2982 239 33110 2941 748 --
NM_003400chr2----1299 --
NM_003405chr221218 ----1595
NM_003409chr1821352 276 1511 ----
NM_003410chrX53050 2157 1910 547 179 21200 372 ----
NM_003411chrY31731 1369 500 21715 1125 ----
NM_003412chr322738 2140 22585 2148 23094 2609 --
NM_003413chrX11994 21528 750 1210 --
NM_003423chr191345 1526 --1764
NM_003432chr52504 46 ------
NM_003439chr753510 3078 2857 1312 1077 --12842 --
NM_003442chr111889 1796 ----
NM_003453chr131237 ------
NM_003454chr164292 243 67 25 --1304 1415
NM_003463chr642986 2837 2418 728 42587 2182 962 648 ----
NM_003466chr252261 1945 1846 1801 1535 11663 --22338 2272
NM_003468chr284261 4074 3553 3394 1712 961 761 371 43574 2965 1405 1317 14029 --
NM_003471chr361875 1809 1683 1521 953 85 12038 11458 21613 173
NM_003472chr641133 422 160 48 --21266 41 --
NM_003473chr1031029 749 365 ------
NM_003477chr113506 314 138 ------
NM_003478chr1163215 3148 2731 2531 1034 273 22339 725 1906 12573
NM_003489chr2143312 3077 2927 1302 1123 33458 2422 967 185
NM_003503chr1----11281 --
NM_003505chr751940 1768 1403 374 136 --1669 --
NM_003506chr811300 1438 1427 1406
NM_003558chr9--1619 ----
NM_003566chr1272898 2546 2298 2116 1190 964 700 ------
NM_003574chr18105741 5121 4952 4658 4376 4097 2024 1510 1472 905 1930 11950 --
NM_003581chr21689 --1968 --
NM_003586chr161561 ------
NM_003589chr1331437 1194 401 41309 1244 1229 1171 ----
NM_003590chr273883 3210 2492 691 647 535 462 23558 907 ----
NM_003595chr223483 388 192 ------
NM_003597chr262304 2211 1630 1515 533 249 22057 2045 2308 258 --
NM_003603chr432037 1986 302 11857 --1856
NM_003615chr3103782 3580 2657 1408 1293 774 705 671 186 133 13104 --12640
NM_003617chr174969 4315 4206 3930 3556 1314 463 21687 1438 34773 4723 636 --
NM_003622chr1262074 1658 629 594 321 165 --11974 --
NM_003628chr2179 --1526 --
NM_003629chr193293 2914 2829 2352 1259 873 633 483 345 3938 832 243 12563 11318
NM_003630chr61742 ------
NM_003633chr572240 2175 2160 1038 566 413 354 12032 --1392
NM_003644chr1796565 5444 5158 4213 1809 1294 1204 538 220 34750 718 264 22236 2009 --
NM_003645chr15180 ------
NM_003651chr12--1551 --1388
NM_003658chr114754 565 550 170 ------
NM_003659chr211080 11149 --1951
NM_003663chr333121 1149 1071 33471 2869 1285 ----
NM_003668chr12------137
NM_003671chr962718 2253 1013 468 365 156 12341 --23552 74
NM_003672chr131635 710 262 1788 21384 57 --
NM_003690chr2--1633 1483 --
NM_003701chr1321052 396 --1378 --
NM_003704chr4--1680 ----
NM_003713chr11292 11467 ----
NM_003714chr562990 2799 2008 992 914 628 --22758 2404 --
NM_003719chr52203 127 --1825 --
NM_003725chr123433 298 127 ----146
NM_003728chr4----1437 --
NM_003743chr222107 897 175 1313 1763
NM_003744chr1411271 1165 1301 --
NM_003750chr102835 357 2350 209 1401 --
NM_003757chr11361 ------
NM_003758chr1531436 583 264 11648 ----
NM_003758chr1531436 583 264 11648 ----
NM_003760chr1--1799 ----
NM_003762chr131486 929 35 ----1258
NM_003772chr113980 889 82 1340 1128 1963
NM_003774chr1243295 3230 2319 884 22487 1242 12106 --
NM_003794chr331047 275 198 ------
NM_003796chr193510 211 174 193 --1153
NM_003800chr621796 225 22239 492 2255 119 1360
NM_003816chr841503 1477 364 286 1593 ----
NM_003819chr12271 61 ------
NM_003821chr81181 ------
NM_003822chr163005 2391 683 500 407 93 ------
NM_003825chr1521464 1099 --11503 11347
NM_003831chr1841504 1293 1284 247 21643 650 ----
NM_003850chr13----1552 --
NM_003872chr222472 25 22311 1152 ----
NM_003877chr122989 86 1789 ----
NM_003878chr8----2221 33 --
NM_003884chr341642 741 489 423 2562 131 ----
NM_003885chr1732609 787 171 ----12449
NM_003887chr252321 2069 1612 439 361 1493 ----
NM_003895chr212306 132 1432 ----
NM_003902chr11737 1144 ----
NM_003909chr842649 2298 1045 523 --22971 2643 --
NM_003913chr654203 3877 3414 1649 107 44249 3815 959 895 24290 127 33388 3068 2834
NM_003916chrX3347 270 233 --11370 --
NM_003922chr15158 --1410 --
NM_003929chr151441 1381 471 356 339 2555 479 21113 95 --
NM_003932chr22101941 1867 1855 1764 1193 1180 417 374 328 123 11615 11548 --
NM_003934chr911268 11133 ----
NM_003938chr191174 ----11058
NM_003941chr732565 1757 458 42501 2297 770 747 ----
NM_003958chr6153500 3327 2903 2831 2759 2653 2618 2428 1301 926 784 390 275 95 61 33420 1437 916 1760 126
NM_003966chr5157649 7348 7084 6176 5822 5419 4896 4836 3121 2859 2357 1515 1505 1108 77 77369 6682 5967 5466 2931 2263 394 37191 5959 506 15722
NM_003989chr1011963 ------
NM_003990chr1011963 ------
NM_003994chr1274362 4021 3559 3229 1341 594 103 23683 3667 --1478
NM_004006chrX22323 632 --12346 --
NM_004007chrX22323 632 --12346 --
NM_004009chrX22323 632 --12346 --
NM_004010chrX22323 632 --12346 --
NM_004011chrX22323 632 --12346 --
NM_004012chrX22323 632 --12346 --
NM_004013chrX22323 632 --12346 --
NM_004014chrX22323 632 --12346 --
NM_004015chrX22323 632 --12346 --
NM_004016chrX22237 546 --12260 --
NM_004017chrX22323 632 --12346 --
NM_004018chrX22237 546 --12260 --
NM_004020chrX22323 632 --12346 --
NM_004021chrX22237 546 --12260 --
NM_004022chrX22237 546 --12260 --
NM_004023chrX22237 546 --12260 --
NM_004028chr1843139 2917 1244 1130 23630 3613 23009 387 1660
NM_004035chr1774823 2018 2011 1702 1562 1079 386 23323 1484 21574 674 --
NM_004056chr81713 ------
NM_004060chr531245 1112 34 --1186 --
NM_004081chrY51338 734 457 172 132 ----1435
NM_004087chr362063 1970 1769 602 541 72 11724 ----
NM_004089chrX3937 865 196 ----11021
NM_004093chr1352652 2474 2079 1196 586 1779 12934 --
NM_004094chr142915 677 11219 11014 --
NM_004096chr1031902 1416 175 ----21350 1324
NM_004100chr62395 338 12680 1430 12585
NM_004124chr1483241 3131 2784 2502 2494 1257 1129 714 23156 2343 22273 149 1917
NM_004156chr81184 ------
NM_004161chr241132 495 444 351 11252 146 --
NM_004162chr31153 ------
NM_004170chr92233 107 11827 --11581
NM_004171chr11129442 9357 8914 8640 8547 7196 6640 6417 6195 2993 1538 719 69287 8319 7836 2613 1729 1649 27913 236 12671
NM_004172chr5--1370 --21314 1250
NM_004180chr22464 138 --1126 --
NM_004202chrY--1112 1512 --
NM_004215chr81550 --1510 --
NM_004229chrX31928 450 391 21857 648 32085 2014 57 --
NM_004232chr1811098 23571 2368 22701 1021 12944
NM_004236chr151416 ------
NM_004238chr21251 ------
NM_004242chr6----1303 --
NM_004244chr121389 ------
NM_004253chr92688 58 ----1830
NM_004255chr151171 ------
NM_004272chr551889 1858 1842 1641 801 21678 141 1462 --
NM_004273chr1041567 1122 494 419 2970 434 21950 1028 11672
NM_004274chr1421058 235 32463 1066 809 43167 509 443 198 --
NM_004277chr641228 1133 621 200 1155 21446 373 --
NM_004293chr933127 2976 2337 32498 982 484 --1324
NM_004305chr2199 1438 ----
NM_004311chr1053021 2794 2152 181 117 43059 2207 883 439 22381 2295 1752
NM_004329chr1031333 1317 915 --1568 --
NM_004330chr15----11001 --
NM_004331chr841849 1708 1001 985 21869 1678 21823 70 --
NM_004337chr841821 833 530 88 22235 627 ----
NM_004338chr1896094 5934 5414 4864 4649 1927 316 282 198 46322 6185 2740 2159 16788 --
NM_004342chr721946 1902 32094 804 470 2304 281 1492
NM_004349chr81280 ------
NM_004359chr19--1511 ----
NM_004370chr651448 850 836 548 38 32182 294 62 ----
NM_004379chr21708 --11185 --
NM_004381chr61140 ------
NM_004388chr11142 1403 1358 1149
NM_004389chr21659 --1742 --
NM_004392chr1342596 1002 966 300 32685 1976 355 22092 369 22126 644
NM_004396chr17164 --1296 1248
NM_004407chr41921 1679 --1984
NM_004412chr1095439 5321 4652 4487 3738 3693 1540 729 76 25977 64 35672 4914 638 --
NM_004414chr21--11308 ----
NM_004429chrX21440 424 ------
NM_004432chr951557 914 480 260 201 1966 22307 169 --
NM_004434chr1411937 --11241 11420
NM_004437chr162646 1194 970 718 701 192 23392 1255 ----
NM_004438chr263150 2890 2589 2533 2333 296 32819 337 102 22229 200 23312 767
NM_004440chr641830 1636 1295 1255 1526 ----
NM_004454chr331972 1599 142 --1122 22230 523
NM_004456chr71242 298 31 ----
NM_004457chr241622 1130 533 258 --11300 --
NM_004458chrX21704 928 2754 691 1725 --
NM_004460chr2----1263 137
NM_004464chr463647 3634 3274 3058 1628 72 13709 --13780
NM_004492chr15153 ------
NM_004498chr15----1106 --
NM_004501chr1103654 3646 3535 3184 2852 2748 2678 2564 1603 1151 22898 746 23865 3575 --
NM_004504chr232989 1908 1000 23054 2771 22143 2038 --
NM_004516chr192440 193 21132 137 1484 --
NM_004520chr53580 509 282 ----2703 80
NM_004529chr9--11322 --21131 1076
NM_004535chr2011272 1256 1266 --
NM_004537chr1221300 82 11095 11533 --
NM_004538chrX3785 577 522 1682 ----
NM_004540chr211261 ----1647
NM_004571chr2142965 2419 1000 712 23373 3357 --1407
NM_004575chr43586 495 248 --11292 --
NM_004576chr52397 83 ------
NM_004580chr1521331 729 --21737 424 --
NM_004586chrX65330 4548 1344 1205 920 565 13902 13482 179
NM_004598chr553234 2684 1152 625 549 32725 1109 792 --13261
NM_004600chr131566 1484 509 21092 420 ----
NM_004612chr9103079 1825 1662 1635 1454 904 745 723 458 427 23256 817 24778 1203 11815
NM_004627chr212671 64 ------
NM_004654chrY51284 1064 1040 509 263 ----11094
NM_004655chr172272 89 11220 --1314
NM_004660chrY22045 199 21781 714 --1877
NM_004663chr1541552 1027 607 501 155 --11155
NM_004685chr1371982 1967 1077 801 743 353 228 32529 2400 914 12336 --
NM_004687chr173556 446 39 21438 238 ----
NM_004705chr116557 348 333 172 157 33 1252 ----
NM_004719chr1222320 2152 32568 2387 1794 1532 --
NM_004723chr11782 ----199
NM_004726chrX135508 5025 4614 4219 4210 3852 3817 3581 1622 1403 924 67 58 21796 1634 24777 4554 13510
NM_004733chr33467 437 164 ------
NM_004736chr121900 547 11934 ----
NM_004742chr341844 1823 1289 680 21709 106 1498 --
NM_004744chr483721 3536 3353 2787 1580 661 182 116 32766 1017 745 21417 349 --
NM_004748chr1593884 1652 1487 1085 870 831 635 365 34 23680 618 24029 3820 --
NM_004760chr732374 831 249 21799 670 ----
NM_004768chr15969 845 358 214 110 11157 ----
NM_004775chr1832187 1776 699 62245 1979 1567 1480 189 110 ----
NM_004779chr531122 282 197 1313 1874 11249
NM_004788chr1142764 2487 2451 556 32685 2166 980 ----
NM_004789chr91443 ------
NM_004795chr132588 108 3374 151 33 1315 --
NM_004798chr20113327 3115 2896 2754 2746 976 839 694 643 175 151 23167 48 33262 2884 2605 --
NM_004800chr131206 ------
NM_004801chr21555 ----2534 54
NM_004805chr211416 31194 453 367 --11159
NM_004808chr1022200 1173 2702 63 --11324
NM_004822chr1733027 2984 2568 13061 1593 --
NM_004835chr33847 269 156 ----1713
NM_004835chr33847 269 156 ----1713
NM_004837chr131416 360 222 11558 1228 --
NM_004840chrX42425 2189 1576 67 21683 1661 --12270
NM_004842chr61366 11562 31536 1325 380 --
NM_004857chr14104360 4316 4075 4057 3681 3311 3132 2991 1863 194 54548 4234 3999 3758 1893 14530 --
NM_004858chr121263 2543 33 ----
NM_004859chr1712224 12060 12248 1877
NM_004863chr1484344 3888 3420 1230 1177 1170 1124 689 45209 1831 1221 954 1816 22009 1348
NM_004867chrX1237 2261 204 ----
NM_004871chr1773846 3679 3508 3279 2946 1331 1096 61561 1058 1019 905 786 54 13222 --
NM_004872chr1----1471 1403
NM_004888chr91346 ------
NM_004893chr5------1498
NM_004896chr1031115 960 576 21525 212 --11586
NM_004904chr776285 5143 5115 4796 4297 2347 1635 26127 2416 44601 4101 4030 1832 14570
NM_004906chr61229 ------
NM_004921chr182191 2144 1911 1760 1725 755 263 51 1436 --1160
NM_004927chr1111379 ----11494
NM_004929chr811371 ----11093
NM_004932chr511342 11595 --11112
NM_004936chr942889 2476 298 194 32195 604 130 --13055
NM_004939chr22187 27 ------
NM_004947chr372274 2154 1911 1861 1853 998 293 42191 2124 1952 65 12248 --
NM_004956chr784329 3020 2953 1598 778 727 635 182 23488 1469 --23421 846
NM_004958chr12156 37 1114 ----
NM_004965chr21----1542 --
NM_004985chr1294013 3479 3288 3083 3009 1384 912 347 211 --23760 1772 --
NM_004993chr1431384 1373 1147 21320 608 --11095
NM_004999chr654275 3657 1496 605 555 21272 458 ----
NM_005000chr72895 416 ----2666 249
NM_005028chr1012021 11556 ----
NM_005040chr112505 109 ------
NM_005044chrX43302 2925 1116 317 24230 223 2789 533 33694 3344 22
NM_005053chr191571 ------
NM_005054chr241616 1317 1273 362 21639 319 ----
NM_005056chr1285259 4817 4255 3826 3803 2196 942 925 45143 4147 1767 988 --14012
NM_005057chr131170 710 53 --11206 2420 75
NM_005058chrY1266 ----1218
NM_005063chr10103893 3836 3688 3176 3145 2873 2707 1163 513 406 13105 13167 23857 1287
NM_005065chr1475262 4448 1810 1520 786 152 68 54150 3366 1374 452 261 34173 3536 1391 --
NM_005066chr1--1735 1836 --
NM_005068chr641221 1120 591 125 21003 40 ----
NM_005093chr20105231 4904 4698 4565 4319 1787 1681 1179 804 717 24041 3328 --31064 940 764
NM_005103chr11--1323 ----
NM_005105chr132147 127 44 ------
NM_005109chr332397 790 677 --12437 1258
NM_005116chr2084260 3672 2782 1501 1076 665 578 415 --1254 --
NM_005124chr61260 --3724 388 89 --
NM_005126chr321978 425 --12197 12271
NM_005128chr21197 1119 1491 --
NM_005141chr4--1128 ----
NM_005156chr944109 589 463 112 14747 33274 1989 299 13892
NM_005160chr22146712 6251 6147 5913 5509 5498 4545 4366 4310 2235 2153 712 287 80 66678 6295 6203 5255 4289 2097 36823 6359 4887 --
NM_005164chr1252501 2329 1962 306 152 42108 953 860 338 12385 --
NM_005168chr241398 1333 708 312 1573 ----
NM_005171chr1231338 871 312 ------
NM_005181chr81212 --1645 --
NM_005188chr11107509 7355 7255 6268 6113 5209 2664 2336 2263 896 27946 6310 37696 1183 217 --
NM_005197chr14115834 5747 4863 4749 1774 1558 1265 1006 628 553 25 15216 25588 268 13878
NM_005203chr10--178 ----
NM_005204chr103662 241 180 ------
NM_005207chr2262793 2357 1485 946 482 58 33511 3259 1467 --1985
NM_005229chrX1283 ------
NM_005230chr121581 1451 ----
NM_005231chr111119 1180 11343 --
NM_005233chr372391 2038 786 651 476 83 25 1625 11978 12132
NM_005235chr2117641 6704 6478 6390 5779 4824 2917 1920 1137 1118 932 87199 7165 6625 5587 5370 1749 1637 516 15034 17809
NM_005238chr1182878 2778 2641 1402 936 518 76 69 ----1490
NM_005244chr203514 432 214 1179 ----
NM_005249chr141797 ------
NM_005257chr1831412 1089 458 1129 11326 --
NM_005259chr231399 591 63 11554 --21342 1236
NM_005264chr10--1889 ----
NM_005269chr121162 ------
NM_005277chr421398 510 31905 367 234 131 --
NM_005296chrX3424 270 127 1292 174 --
NM_005302chr71367 1167 ----
NM_005339chr4104129 3113 2859 2761 2731 1512 1485 893 597 506 11227 ----
NM_005349chr4------1162
NM_005358chr1331439 1404 333 ----1383
NM_005359chr18105622 5202 4892 4818 4734 4522 4258 2424 2043 1045 35301 4635 4242 174 14027
NM_005375chr621105 986 1350 --1822
NM_005378chr22695 627 1869 ----
NM_005389chr6--1120 ----
NM_005392chr911322 ----1189
NM_005397chr783919 3602 3071 2925 2439 1566 698 522 13028 13367 --
NM_005398chr1061189 500 418 390 202 113 --11386 --
NM_005399chr1104218 4119 3796 3770 3232 1189 918 155 130 57 33350 3147 650 ----
NM_005400chr272977 2143 2125 1920 756 683 521 22605 574 --21156 701
NM_005402chr731840 624 591 --11440 --
NM_005418chr11--1510 ----
NM_005433chr1832740 1706 695 --11818 1618
NM_005436chr1083810 3739 2917 2798 1109 904 812 484 23539 478 --1951
NM_005437chr1031237 132 96 21138 453 ----
NM_005445chr10--1248 ----
NM_005493chr6------177
NM_005497chr1756173 3879 2345 627 144 65205 4079 3953 1473 1355 666 1251 --
NM_005499chr192211 47 1130 ----
NM_005502chr982346 2302 1233 1081 983 954 524 298 ----13130
NM_005504chr12116499 6440 5900 5246 4353 4041 1494 1483 897 506 393 25037 383 56190 5948 5506 4974 74 11929
NM_005509chr531643 750 452 --1631 --
NM_005520chr53687 633 285 ------
NM_005524chr31344 1305 ----
NM_005542chr741823 1772 1543 53 21576 25 11877 --
NM_005575chr53687 265 170 1563 ----
NM_005578chr365168 4457 3793 2050 1719 315 23641 1117 ----
NM_005584chr132605 519 1597 2741 708 1755
NM_005587chr151877 ------
NM_005595chr11788 1647 1216 --
NM_005596chr944779 979 762 69 35922 5460 699 ----
NM_005607chr83132 121 38 1959 ----
NM_005613chr12796 278 41994 1445 1376 50 21960 672 --
NM_005618chr61595 ------
NM_005622chr16--1161 ----
NM_005626chr1--1212 ----
NM_005637chr1811967 --21477 787 11341
NM_005638chrX31447 1385 704 ----11211
NM_005639chr1231199 734 544 11835 1629 --
NM_005655chr83296 256 245 ------
NM_005664chr1521022 309 ------
NM_005665chr194345 3699 3578 3571 3432 3043 468 451 321 --13758 --
NM_005667chr2184 ------
NM_005668chr553911 1786 486 239 40 53841 3209 1847 584 538 --33503 1278 61
NM_005715chr642681 2317 1078 1056 2747 434 1940 12220
NM_005719chr12------1187
NM_005721chr23988 431 73 11023 21093 215 --
NM_005722chr252404 2293 2202 892 65 --21663 185 12422
NM_005725chr132369 1654 920 2675 231 32270 1925 626 --
NM_005731chr21367 ------
NM_005734chr114755 565 99 41 ------
NM_005738chr751646 1639 482 291 48 21380 550 ----
NM_005739chr1521550 874 3905 890 346 --12148
NM_005746chr742264 1916 907 249 --1401 2730 559
NM_005748chr1262837 2301 2122 1300 386 115 13267 22790 1368 --
NM_005751chr71456 ------
NM_005754chr53983 439 427 21253 402 ----
NM_005759chr2114592 3463 3144 2964 1563 1043 829 671 317 219 171 23729 3684 21673 59 13209
NM_005779chr563533 3453 2618 780 647 69 23404 1430 12234 --
NM_005795chr252440 1044 1032 297 104 32634 1950 1075 ----
NM_005808chr372739 2354 2326 2304 1370 1352 409 42892 2595 2336 39 23472 3084 --
NM_005813chr242350 2072 1819 654 --22259 1027 --
NM_005819chr142747 2345 2333 1288 23398 3382 33262 2396 1391 12800
NM_005822chr672397 2058 1976 1866 805 507 435 12303 21662 869 11941
NM_005826chr1--1542 ----
NM_005828chr1784717 4532 4513 4240 1545 1336 1085 697 24666 3295 11006 11559
NM_005839chr11395 ------
NM_005840chrX107679 7517 6884 6698 6580 5658 2091 1007 644 280 27396 5530 37501 7261 7148 16303
NM_005841chr411111 ------
NM_005842chr13--1777 1630 --
NM_005843chr241800 1570 1238 196 11542 --21671 683
NM_005845chr1311227 --21143 128 --
NM_005857chr151457 1261 1158 425 194 31084 1045 340 ----
NM_005863chr1031183 457 293 31287 1154 934 --1413
NM_005871chr103870 354 159 ------
NM_005881chr161297 ------
NM_005885chr531371 1024 116 21224 198 --11472
NM_005888chr12180 ------
NM_005895chr12104094 3904 3261 2949 2786 1207 284 255 246 64 33994 2598 918 12792 13817
NM_005898chr1163175 2236 2138 2090 770 587 21034 693 22375 316 --
NM_005901chr18118716 7882 7742 7193 6548 6394 3279 2167 1572 1469 1353 78310 7098 3221 2668 2517 1599 602 1168 27941 6821
NM_005902chr1594380 4269 4245 4235 4136 3378 3339 1715 228 31237 721 150 ----
NM_005903chr564409 3629 3364 3268 1777 1242 45181 4920 4479 1907 24616 522 1318
NM_005906chr661704 1387 1253 545 478 264 21098 103 ----
NM_005907chr651049 526 461 327 252 31607 1267 1057 ----
NM_005909chr5104273 4102 3573 3096 1532 1509 1087 846 700 581 13782 132 23706 62
NM_005910chr1764021 3610 1404 1079 944 675 23897 352 --22898 451
NM_005930chr142292 215 ------
NM_005935chr454711 1323 1249 969 875 35120 1200 365 11858 --
NM_005941chr8103969 3755 3189 1527 1433 1069 949 804 364 358 ----21288 1276
NM_005955chr1105567 5409 5011 3907 3373 1633 1057 663 435 346 1112 2441 87 --
NM_005957chr1104597 4520 3588 3575 3549 3296 3192 1585 664 621 44313 4229 3798 1881 ----
NM_005962chr1052334 2048 1835 874 283 2610 557 ----
NM_005962chr1052334 2048 1835 874 283 2610 557 ----
NM_005966chr22627 572 21892 28 12191 --
NM_005977chr131120 1813 ----
NM_005986chr1352292 2084 2073 1906 873 22264 2100 1603 --
NM_005999chr141003 418 326 230 21528 1257 ----
NM_006007chr983958 3611 3002 1802 1724 1679 1379 668 33192 2892 2752 43589 1741 851 827 --
NM_006011chr1523302 1445 43649 2844 2801 773 --11566
NM_006015chr11440 1252 ----
NM_006022chr131744 1931 --2856 267
NM_006030chr31444 ------
NM_006031chr21140 ------
NM_006036chr262466 2447 1799 569 460 452 22520 792 1503 --
NM_006037chr2104710 3448 3361 2982 1653 1619 1028 960 726 720 13408 ----
NM_006047chr2022852 1332 23338 2378 2880 209 12400
NM_006048chr121161 371 1877 --11144
NM_006055chr243200 2879 2087 705 21197 481 3983 767 540 --
NM_006060chr732809 903 796 44350 3766 1224 181 ----
NM_006080chr711163 1892 32207 2159 1949 --
NM_006089chrX31563 1191 603 11216 ----
NM_006094chr852238 1534 1492 582 143 1268 12255 --
NM_006095chr444014 3622 3512 866 --23888 115 21409 1315
NM_006106chr1162646 1202 1112 1087 477 454 --1503 13169
NM_006107chr17--1355 ----
NM_006109chr141293 --1236 --
NM_006136chr73873 286 69 11364 ----
NM_006139chr231145 812 65 22494 177 --12467
NM_006141chr1662412 1095 832 612 364 259 --11967 --
NM_006152chr121201 --152 --
NM_006166chr1272492 2328 2027 1819 869 448 421 22597 58 ----
NM_006180chr941907 797 323 314 11986 11742 --
NM_006190chr251072 327 300 241 86 ------
NM_006196chr2------1366
NM_006197chr852097 1926 489 175 78 1687 --1679
NM_006203chr595578 5156 4993 4410 4345 3732 2054 1304 1045 54829 3622 3612 2233 2097 25263 5149 23872 3510
NM_006206chr462767 1852 1161 513 418 46 2954 175 ----
NM_006209chr81123 ----177
NM_006212chr1134823 4071 3994 3826 3774 1873 1739 1732 1111 809 802 718 510 34856 1474 198 35056 624 269 25385 3467
NM_006226chr221288 433 21269 204 --1389
NM_006237chr13------21866 1763
NM_006241chr362324 2180 1849 1732 1624 387 11974 12194 11559
NM_006246chr1421147 474 ----21221 866
NM_006251chr532048 1089 473 22466 300 --22552 2140
NM_006252chr1187563 7076 6961 6449 5925 5868 5779 5464 4753 3021 2884 2424 2005 1728 1586 1145 1052 163 67197 6651 5366 4845 2619 1075 25215 4711 27618 723
NM_006254chr31405 ------
NM_006256chr12447 95 --12595 --
NM_006258chr1031315 1005 200 150 11155 31510 1301 306
NM_006267chr221669 70 2415 92 1373 --
NM_006275chr2041942 1580 393 126 2930 842 ----
NM_006282chr2083382 2945 1778 1587 1120 881 631 55 1345 34068 3547 1076 --
NM_006283chr874441 3764 3549 1788 1765 485 375 54034 3712 3062 1797 625 54803 4533 3193 1378 708 --
NM_006306chrX134797 4702 4107 3996 2286 1226 887 705 429 171 68 61 30 34940 4379 213 12002 11098
NM_006313chr1221501 1141 195 --21696 1199
NM_006315chr453603 3196 1310 288 107 --21576 342 13832
NM_006323chr42228 129 ----182
NM_006330chr811492 11060 --31245 1135 317
NM_006334chr91203 1227 ----
NM_006345chr42890 393 --1929 1221
NM_006346chr132508 460 --1120 --
NM_006353chr631345 1124 232 21423 50 ----
NM_006359chrX82420 2330 2199 2127 1760 1004 535 93 1661 --12016
NM_006364chr14----21272 240 --
NM_006371chr374598 3415 1744 1531 966 846 632 34170 2114 1714 22079 1973 --
NM_006380chr1794246 3042 2695 1645 1626 1404 1381 1249 630 --1591 11168
NM_006391chr112267 244 ----1297
NM_006393chr1074468 3953 3195 1536 1153 948 219 73673 3010 2808 1739 1189 905 344 ----
NM_006400chr121110 ------
NM_006407chr31218 2934 87 --1941
NM_006420chr2042982 2189 1174 571 23369 834 32202 1136 477 33118 2753 2294
NM_006421chr871253 1214 1006 475 381 108 95 ----1503
NM_006431chr12--156 1239 --
NM_006434chr1073214 2289 2120 751 720 477 291 13080 22790 1079 --
NM_006457chr463918 3181 2607 2562 1560 151 1100 135 1327
NM_006460chr1721366 259 11829 --1332
NM_006464chr2114633 4363 3904 2854 1352 1273 1210 1102 1079 576 300 54194 4048 3192 868 23 23643 821 --
NM_006467chr562295 2089 1889 743 664 44 21990 922 1259 --
NM_006476chr114602 43 31 21 --2275 81 --
NM_006504chr1052842 2547 1923 1161 1000 ------
NM_006519chr61224 1289 --1255
NM_006526chr2031907 1672 1527 ----11838
NM_006534chr2062277 929 501 403 276 150 1902 22934 2876 --
NM_006538chr234007 937 761 42902 1523 1221 594 ----
NM_006544chr14125912 5533 4705 4446 4413 3840 2213 2100 1381 1119 1075 568 46069 5855 4894 1368 ----
NM_006547chr772014 1880 1860 1630 1486 147 129 51686 1651 1314 615 188 21366 828 --
NM_006557chr911304 11624 ----
NM_006559chr14916 777 412 375 ------
NM_006560chr111500 ------
NM_006561chr1094856 4090 2454 1987 1970 1492 1427 1147 490 25242 199 --11460
NM_006572chr1783474 3314 2630 2532 1083 878 639 591 32752 2404 2362 22759 2608 23386 2864
NM_006577chr241135 823 125 43 1288 --1274
NM_006595chr1131420 1406 675 32053 1537 417 61963 1778 1699 1652 1316 696 11680
NM_006597chr11----150 --
NM_006599chr16147472 5558 3228 2775 2766 2544 2133 2108 1892 1714 1411 1207 1063 242 77600 6291 5984 3190 2661 2194 425 25296 805 16856
NM_006601chr1231138 1097 957 1989 ----
NM_006603chrX31883 263 198 --1318 --
NM_006609chr222461 2038 22835 598 12924 12103
NM_006614chr31949 23642 391 --22889 2825
NM_006620chr6104607 3835 3821 3588 3535 1417 1179 1062 430 29 2590 231 24590 291 --
NM_006625chr12867 293 2161 102 ----
NM_006625chr12867 293 2161 102 ----
NM_006625chr12867 293 2161 102 ----
NM_006628chr1584176 3917 3286 3099 2874 2829 1863 98 23767 483 ----
NM_006629chr1862406 2139 2039 1803 553 132 12364 ----
NM_006636chr2--1822 ----
NM_006646chr1342801 565 556 471 12344 12405 --
NM_006654chr1264745 2924 992 812 295 120 2935 398 43397 1599 754 670 1747
NM_006682chr742716 2686 2501 112 1741 1689 1145
NM_006699chr152711 2265 2074 308 69 2166 85 1563 11082
NM_006704chr132429 81 1101 ----
NM_006706chr56818 776 721 563 143 106 --1839 --
NM_006708chr621103 322 11134 ----
NM_006717chr942969 767 755 146 11001 42860 2429 932 681 --
NM_006720chr10114795 4487 4133 4053 3955 3554 3162 1777 1692 786 569 24917 3757 11655 --
NM_006722chr342664 920 332 271 32840 758 661 ----
NM_006726chr421019 401 --179 --
NM_006727chr5172 ------
NM_006729chrX65491 4790 4519 1639 1346 1074 21859 1017 1190 45016 1707 1682 1513
NM_006731chr9101713 1530 1462 1290 898 474 352 305 142 121 45529 3786 2066 1256 24102 2222 24718 3686
NM_006738chr1563862 3098 1737 1376 1043 350 --11122 11571
NM_006750chr16137893 7338 6373 6203 6052 5582 5211 2968 2490 1483 1361 1009 658 57871 6117 3242 2307 1916 36348 1849 898 25182 1948
NM_006751chr21165 31015 984 126 ----
NM_006754chr711101 1899 --1204
NM_006756chr81529 11461 127 --
NM_006759chr21298 ------
NM_006761chr172809 97 ----1335
NM_006775chr673097 2511 2440 2314 522 437 23 32503 2453 647 2701 598 --
NM_006777chrX82498 2449 2181 2139 2088 870 295 96 41865 1796 471 308 3585 286 114 21024 877
NM_006790chr5153 169 1414 --
NM_006800chrX1577 1671 ----
NM_006802chr13948 736 358 11052 --11113
NM_006805chr531676 1519 196 21727 1294 ----
NM_006807chr1731004 111 32 ------
NM_006815chr123211 182 96 ------
NM_006820chr143940 3892 3334 1109 23430 2858 1879 12691
NM_006822chr172524 265 ------
NM_006828chr6------125
NM_006832chr141398 ------
NM_006836chr122464 454 3545 533 63 ----
NM_006838chr1251449 475 344 285 39 ----2528 441
NM_006852chr1752080 1156 945 265 96 1612 2887 854 --
NM_006854chr741791 1769 1441 632 41818 818 479 348 1764 1486
NM_006874chr411016 11104 11046 --
NM_006884chr331846 741 281 1698 11388 --
NM_006885chr1633475 976 261 24218 2763 ----
NM_006888chr1442919 2227 1025 740 12326 13097 13391
NM_006895chr231464 386 40 2771 313 ----
NM_006901chr15--1522 2375 221 --
NM_006902chr183034 2522 2178 2034 953 788 663 582 1749 12634 22728 2297
NM_006910chr161140 --1292 --
NM_006913chr61301 ------
NM_006914chr91150 1205 ----
NM_006915chrX72390 2379 2283 2123 909 582 62 12292 1665 --
NM_006918chr11104967 4856 4696 3607 3571 1305 873 803 704 617 --21185 780 --
NM_006922chr212103 1601 1635 --
NM_006924chr1723958 1283 44421 4158 3729 2715 43548 3241 1251 375 --
NM_006931chr1242174 1683 686 96 ------
NM_006939chr141344 ------
NM_006948chr214989 287 280 38 --42252 2193 778 425 --
NM_006951chr101180 --2560 143 1119
NM_006980chr72252 229 1612 ----
NM_006981chr931924 976 757 22963 2004 12360 --
NM_006997chr101143 ------
NM_006999chr571598 1541 1501 1450 1388 1302 642 1452 ----
NM_007005chr921208 375 11011 ----
NM_007006chr1643151 3034 797 142 42196 1424 805 458 1474 13574
NM_007007chr12101934 1645 1598 1399 1358 1065 931 840 758 461 24205 4096 2213 139 11338
NM_007011chr15156892 6307 5790 5739 5142 5099 4658 4477 2431 1481 1169 923 321 272 101 56649 6599 6236 1329 42 26066 1285 11504
NM_007013chr82995 229 --2954 351 --
NM_007017chr5--1703 ----
NM_007018chr91376 1117 1297 --
NM_007023chr231009 844 182 ------
NM_007027chr32549 149 ------
NM_007035chr121749 ----1715
NM_007038chr2175616 5432 5139 3768 1830 1394 928 34572 654 644 25112 280 15045
NM_007042chr372551 1978 1828 1656 181 106 70 --21706 323 --
NM_007043chr1271771 1681 671 421 287 253 94 42136 734 339 175 ----
NM_007050chr20167659 7070 6868 6772 6723 5934 5621 2593 1809 1578 1415 873 516 315 166 94 15423 11152 16342
NM_007073chr684242 4199 3378 3361 1275 1094 909 394 33261 3125 1059 13077 --
NM_007106chr1342586 2423 1952 243 --22637 849 --
NM_007107chr362368 1887 938 851 472 403 1868 --1486
NM_007114chr333325 2205 789 3572 420 203 33033 390 189 22215 618
NM_007124chr631991 1456 660 21950 1554 ----
NM_007125chrY21450 1193 11303 2444 267 --
NM_007129chr132221 109 --11002 --
NM_007137chrX75148 4474 3851 1991 1435 1267 796 14885 --11201
NM_007145chr1921197 82 11012 2938 300 --
NM_007153chr1954042 3200 2998 1347 551 1764 1256 --
NM_007157chrX72821 2443 2107 1835 542 247 67 32861 2714 580 22224 210 --
NM_007159chr351710 1439 376 341 263 31623 678 451 ----
NM_007172chr2293296 3016 2958 2679 1231 1160 1028 526 378 33004 2471 1082 22487 224 11037
NM_007173chr1141696 566 281 222 2798 417 1334 1179
NM_007174chr1211869 11751 1466 --
NM_007175chr862305 2228 1012 929 499 350 --32625 1363 1262 --
NM_007187chr131124 ------
NM_007195chr1832556 2330 783 43465 1471 1151 25 13632 --
NM_007200chr1563862 3098 1737 1376 1043 350 --11122 11571
NM_007203chr973887 3617 3137 2621 2525 1542 190 13310 ----
NM_007207chr11833 1629 ----
NM_007212chr121922 120 123 1232 11578
NM_007218chr82794 715 --1264 --
NM_007220chrX104266 3656 3433 1954 1877 1825 1672 803 401 94 14917 ----
NM_007222chr881797 1668 1598 1205 737 308 292 52 ----11639
NM_007231chrX52011 1935 1710 1584 313 1811 --1441
NM_007240chr11192 ------
NM_007249chr1398754 8724 8519 7629 3211 1832 865 305 161 98133 7380 6363 3291 3228 2609 1842 1214 122 49358 7650 3018 446 48543 7022 6792 3160
NM_007257chr822612 803 2743 437 --32437 2360 631
NM_007269chr1--1574 ----
NM_007270chr7--11444 ----
NM_007271chr661875 1610 1466 1249 676 256 11480 --1170
NM_007276chr72239 185 1128 ----
NM_007282chr35997 647 625 153 60 ----1841
NM_007292chr1774823 2018 2011 1702 1562 1079 386 23323 1484 21574 674 --
NM_007308chr4----1685 --
NM_007331chr451862 1109 575 276 184 22277 348 12589 --
NM_007345chr1831629 632 37 32189 1439 508 ----
NM_007347chr1532687 2597 884 22790 701 --13197
NM_007349chr71455 ----1365
NM_007350chr1283685 3582 3342 3199 2949 1164 504 360 24498 238 --13087
NM_007358chr141733 1703 1458 801 ------
NM_007373chr1071543 1382 1320 557 456 237 210 ------
NM_007375chr132806 2715 771 22011 781 32442 2409 391 11897
NM_009585chr33847 269 156 ----1713
NM_009585chr33847 269 156 ----1713
NM_009588chr61562 ------
NM_012081chr562991 2849 2600 2568 1321 1084 23308 1418 23567 2838 22552 743
NM_012082chr8293 83 1798 ----
NM_012089chr121353 615 1150 11462 1107
NM_012090chr13238 74 38 1899 ----
NM_012092chr231961 1474 96 1505 11662 1140
NM_012096chr322801 38 33243 2359 2341 33614 2847 2510 13389
NM_012097chr221483 301 11580 21917 1448 1148
NM_012110chr4----1293 --
NM_012120chr652428 2342 1107 794 383 ------
NM_012137chr172627 2176 1901 1785 457 335 129 42348 1174 1050 465 ----
NM_012141chr1344057 3739 3387 473 1938 13834 21489 112
NM_012156chr2073217 3165 1025 935 782 624 75 1810 23180 257 12164
NM_012157chr3--1901 ----
NM_012158chr1321698 108 1336 ----
NM_012161chr41404 1878 1905 --
NM_012180chr44624 553 506 465 1456 --1478
NM_012183chr12434 417 ----1462
NM_012193chr11105242 5021 4356 3828 2096 2018 1179 350 100 34 54851 4328 3486 1802 961 1620 15128
NM_012199chr174614 4484 3967 3290 1111 729 243 13328 23427 924 13592
NM_012214chr285968 5913 5898 4787 4330 788 499 308 56124 5690 2210 517 176 25551 2486 26396 5857
NM_012216chrX1107 ------
NM_012219chr333199 935 412 23061 612 13017 31280 597 536
NM_012223chr23858 236 136 1963 ----
NM_012224chr431057 1049 297 --145 11095
NM_012238chr1031779 1322 452 21719 1391 11497 --
NM_012242chr10--1552 ----
NM_012249chr253596 3015 2789 2683 830 --22408 194 --
NM_012259chr651087 1005 430 309 128 21374 230 ----
NM_012262chr194161 3908 3859 3723 3230 1773 714 78 40 11377 14660 24794 1693
NM_012281chr721993 496 12370 ----
NM_012287chr3104304 4075 3846 3825 3770 3697 3258 3161 1183 33 33576 3132 1197 13866 23746 901
NM_012290chr2271 32 ------
NM_012297chr442024 1844 1739 491 11960 ----
NM_012300chr572508 2348 2213 2122 2103 2023 555 12333 ----
NM_012302chr11906 ------
NM_012309chr1154947 4863 4747 3478 3169 34665 4640 1630 21884 71 --
NM_012316chr195244 4610 4026 3654 2089 1722 1332 926 174 21927 1364 25596 192 --
NM_012319chr182907 345 ------
NM_012322chr72342 129 --1390 --
NM_012326chr21336 ------
NM_012328chr721095 116 ----11395
NM_012330chr102562 68 11747 ----
NM_012333chr171552 618 593 550 378 275 80 21702 1050 ----
NM_012334chr574272 3212 2989 1233 1180 1024 130 33301 792 117 1449 14522
NM_012343chr541016 801 708 389 1382 --1457
NM_012347chr642615 2120 710 486 2497 248 12521 11956
NM_012382chr5144351 4290 3627 3078 2929 2915 1677 901 616 574 563 323 218 78 74383 4313 2805 1713 939 525 396 31178 257 25 --
NM_012383chr91353 ------
NM_012388chr1573194 3135 2982 2526 2358 1936 491 12961 ----
NM_012399chr22102020 1918 1490 1349 1231 666 639 613 598 101 ------
NM_012416chr92966 289 ------
NM_012417chr172502 439 1541 ----
NM_012419chr61537 ------
NM_012448chr1762557 2469 1736 1685 916 394 41870 505 256 93 ----
NM_012454chr61551 ------
NM_012464chr452610 859 847 499 107 41936 1083 653 600 1195 --
NM_012465chr1033284 2912 1220 12340 2364 152 12720
NM_012471chrX41954 1709 1431 768 127 21812 1631 1762
NM_013227chr15--1826 ----
NM_013229chr122408 43 22754 1818 ----
NM_013230chrY41660 1200 606 161 169 1171 --
NM_013231chr1474245 3947 2960 767 739 535 90 34331 3573 1411 23271 123 1636
NM_013233chr21442 11194 11026 1332
NM_013236chr224890 406 314 87 ------
NM_013243chr1511407 21005 272 --1182
NM_013252chr772653 2075 878 779 609 485 45 1712 12267 --
NM_013254chr122225 110 ------
NM_013255chr7136477 6052 5792 3433 3418 2703 1615 1248 1034 944 738 395 118 48540 7065 5390 2161 16090 1679
NM_013257chr81957 2921 487 ----
NM_013261chr483569 2609 2381 1477 1288 980 856 803 11032 ----
NM_013264chr113197 163 64 ------
NM_013269chr1264022 3922 3741 1425 1304 451 33393 788 748 --33369 2748 929
NM_013283chr52353 269 ------
NM_013293chr71207 168 --1538
NM_013322chr721583 1062 11618 ----
NM_013325chr21358 11506 ----
NM_013341chr262125 958 411 352 319 48 51958 918 897 801 74 ----
NM_013363chr3--2102 47 ----
NM_013374chr321253 169 --12635 2291 229
NM_013386chr141376 564 403 52 41634 1618 731 208 11354 2701 279
NM_013411chr152376 2355 2306 970 307 12772 --1498
NM_013436chr21280 2767 315 --1247
NM_013437chr821327 307 ------
NM_013447chr1943657 2320 1404 259 --2421 49 23605 392
NM_013448chr14----128 --
NM_013449chr1252682 2183 1837 1189 228 1777 11880 --
NM_013937chr62408 108 --1819 --
NM_013943chr142862 2547 2466 660 22576 2113 13029 --
NM_013951chr252261 1945 1846 1801 1535 11663 --22338 2272
NM_013952chr252338 2022 1923 1878 1612 11740 --22415 2349
NM_013953chr252338 2022 1923 1878 1612 11740 --22415 2349
NM_013989chr1475147 4354 4180 1804 1146 978 308 23464 619 33684 1434 646 14192
NM_013992chr252338 2022 1923 1878 1612 11740 --22415 2349
NM_013995chrX32470 596 511 1339 1540 --
NM_014011chr232587 2558 272 1376 --11033
NM_014021chr163509 2403 839 657 217 109 21070 443 13086 22768 2368
NM_014023chr1022070 1901 22425 682 12634 11968
NM_014028chr652986 2938 2911 291 88 42836 532 400 357 11325 --
NM_014033chr1221939 843 32288 2205 1736 11748 --
NM_014034chr631386 1314 232 31056 371 223 1149 1487
NM_014038chr73434 393 69 ----1269
NM_014048chr1665153 4696 4123 3337 1834 992 3221 160 23 23992 2042 --
NM_014055chr123419 404 165 179 ----
NM_014056chr31129 --21709 910 12156
NM_014057chr92292 113 2546 420 11607 21405 1055
NM_014059chr13----1381 --
NM_014079chr31122 1406 --1983
NM_014089chr1362029 1936 1882 1515 418 215 1131 22104 137 --
NM_014106chr152422 213 22179 2054 22302 2102 --
NM_014112chr815166 14486 15327 1354
NM_014141chr731506 1094 594 13316 11202 33591 1288 834
NM_014153chr16165 2648 590 ----
NM_014154chr3137 --21248 462 --
NM_014155chr1197256 7098 4871 4559 2867 1977 1857 1716 418 55162 2569 2448 786 72 36473 2843 2020 15142
NM_014171chr23741 655 124 1728 ----
NM_014181chr262632 2261 1944 1176 601 48 162 185 --
NM_014182chr121203 ------
NM_014243chr441863 1480 555 274 11621 ----
NM_014253chrX21997 1623 21895 1724 42331 2074 1607 392 1416
NM_014263chr1021240 323 1216 ----
NM_014267chr111354 ------
NM_014268chr1851477 1394 458 365 54 ------
NM_014283chr13454 424 50 11170 31558 1106 71 --
NM_014286chr953629 2566 2216 1137 347 13254 ----
NM_014294chr831110 264 153 ------
NM_014300chr151313 1382 ----
NM_014309chr2294864 4515 1459 1024 755 481 408 370 165 ----11824
NM_014325chr121306 --11788 2573 502
NM_014329chr16--1313 ----
NM_014331chr4137847 6627 6314 6081 5884 5831 5805 5675 2126 2075 1793 980 566 46007 1890 429 75 26760 2417 37091 5341 1874
NM_014332chrX1419 ------
NM_014333chr11--22498 2270 --11861
NM_014350chr5--1452 3168 151 41 --
NM_014352chr111425 1938 1474 --
NM_014363chr1341232 364 197 134 --1235 --
NM_014372chr131667 1590 405 ------
NM_014382chr3288 45 --1623 --
NM_014386chr5193 ------
NM_014393chr842326 1555 601 432 32192 1503 811 1530 --
NM_014397chr921207 1153 1403 21167 299 1932
NM_014399chr731011 825 208 --3908 756 334 3930 193 105
NM_014415chr31247 11190 ----
NM_014423chr575242 4979 3749 2216 1824 880 667 24694 1639 --25050 541
NM_014445chr341948 1766 441 231 21591 1486 32128 1989 396 --
NM_014447chr411061 1276 1206 --
NM_014454chr621053 961 41035 1006 989 31 ----
NM_014458chr121234 242 1333 ----
NM_014461chr3--136 ----
NM_014462chr8184 1107 ----
NM_014494chr1651861 1602 739 701 152 32270 2256 638 21786 1773 --
NM_014504chr72192 29 ------
NM_014517chr341793 1399 548 235 11451 11387 11572
NM_014554chr1212130 12100 --32286 1531 1463
NM_014570chr223987 664 164 ----1959
NM_014572chr1341828 1460 1420 1199 31791 241 173 ----
NM_014573chr1711394 11870 --21542 106
NM_014577chr221287 ------
NM_014583chr3----1461 --
NM_014584chr142602 32 21066 567 21430 486 --
NM_014586chr2194875 4513 4002 3895 3884 3817 3233 1569 1284 34314 3412 922 14710 --
NM_014587chr1621565 627 --1530 --
NM_014612chr92407 239 11300 21516 59 --
NM_014613chr541204 922 800 594 --12723 22230 1918
NM_014615chr1663557 2806 2668 1415 1394 93 22534 1325 32364 1166 288 --
NM_014616chr362932 2729 2530 845 548 213 33199 3021 89 32136 198 192 13351
NM_014630chr15103777 3740 3595 3239 1466 1110 1052 1002 812 204 13365 12841 --
NM_014633chr113443 182 32 ----1487
NM_014635chr241594 1285 1236 326 21617 283 ----
NM_014637chr831010 588 512 1265 ----
NM_014646chr1843116 1206 723 118 13051 ----
NM_014647chr1652228 1862 705 461 44 11931 1222 --
NM_014655chr162263 1717 249 218 152 131 32335 1544 1465 ----
NM_014660chr72978 297 ------
NM_014666chr51337 ------
NM_014667chr372201 1852 977 752 540 476 55 11652 ----
NM_014670chr221378 1309 --1218 11454
NM_014676chr131494 1150 497 21684 97 ----
NM_014677chr841267 1151 1103 109 --21284 258 --
NM_014679chr1111402 ------
NM_014682chr822244 357 --11721 1767
NM_014683chr171549 1537 21425 462 1140
NM_014701chr1562931 2456 2433 916 903 387 1309 13311 13305
NM_014702chr643322 2534 771 65 53340 2526 1081 436 385 32933 2318 107 --
NM_014707chr782093 2077 2035 1719 812 673 353 70 1836 1228 --
NM_014709chr21455 ------
NM_014713chr22454 212 --1421 --
NM_014720chr1011149 21773 1295 11563 11498
NM_014721chr677404 7395 4805 2991 2248 643 471 11837 189 --
NM_014729chr81130 1154 --21495 597
NM_014730chr12135210 5143 4895 4805 3659 1405 1168 1123 939 792 571 423 320 --11702 2803 560
NM_014730chr12135210 5143 4895 4805 3659 1405 1168 1123 939 792 571 423 320 --11702 2803 560
NM_014733chr561935 1794 1761 729 486 102 42222 1943 1465 111 --11835
NM_014735chrX52028 1828 1727 1711 385 21517 150 ----
NM_014737chr2094213 4151 4112 4017 2849 2641 1242 617 23 --1401 12909
NM_014743chr432888 889 472 12843 13102 1221
NM_014746chr284253 4185 4150 2818 1755 1517 662 408 34285 4200 1265 --12999
NM_014751chr83782 513 259 31846 1669 127 21916 1349 1570
NM_014755chr243914 3371 3025 1442 24046 3777 33115 3031 251 23736 3269
NM_014761chr16------1908
NM_014766chr783556 2658 2399 1518 1069 758 383 121 22992 2610 --1984
NM_014774chr173229 2326 2161 2047 545 504 137 12474 1933 --
NM_014781chr821292 938 --1887 --
NM_014783chr1511552 41782 1195 718 583 11717 --
NM_014787chr182686 2399 2386 2044 1081 684 435 65 21885 349 ----
NM_014790chr5------1519
NM_014795chr2--11400 ----
NM_014802chr122411 124 --1865 --
NM_014803chr1062472 1992 957 775 513 399 1202 1998 1172
NM_014810chr1103396 2747 2261 774 612 527 505 336 304 100 22949 383 12328 11309
NM_014819chr512115 22138 886 12356 --
NM_014820chr321826 343 32018 1491 468 ----
NM_014824chr1131591 428 165 11384 --21802 770
NM_014827chr151241 1045 618 204 132 1404 11660 --
NM_014829chr51831 1448 22326 298 --
NM_014830chr1273876 3529 2846 2787 2678 921 890 ----13943
NM_014836chr1031848 1239 47 ----11551
NM_014839chr142174 1909 1585 906 1845 11002 --
NM_014840chr1263308 2892 2088 773 637 353 13214 13186 --
NM_014841chr63846 383 356 11379 11266 --
NM_014844chr1454160 3115 3047 3039 1651 14045 ----
NM_014846chr8----168 --
NM_014848chr1531770 817 560 1343 ----
NM_014864chr174047 3901 3413 3309 1591 1498 334 44389 3944 2753 960 13588 --
NM_014868chr124834 103 96 32 --1763 --
NM_014870chr174699 4609 3375 2903 1081 1036 674 34292 1629 310 1185 --
NM_014873chr1104765 4157 3908 3767 3728 3364 3316 3304 1512 673 --14319 33843 3618 303
NM_014877chr17187111 7091 6641 5509 5490 5437 5397 5310 5190 2968 2691 2634 2495 2127 1237 1112 984 744 45698 5413 5383 668 16588 --
NM_014883chr422447 812 21848 75 32301 2127 1854 --
NM_014893chrY11721 1691 12020 11978
NM_014897chr1722804 2773 21286 1019 11026 1799
NM_014899chr5103015 2947 2929 2105 1256 1227 932 736 530 359 1840 2605 564 --
NM_014900chr21800 11078 ----
NM_014903chr1252004 1536 971 380 153 11657 --12302
NM_014904chr1064013 1570 1403 1001 855 178 33460 1366 1294 1840 33867 963 600
NM_014905chr251378 447 236 157 82 1646 ----
NM_014912chr1063396 3296 2915 2430 1056 381 43443 2335 2206 89 ----
NM_014914chr24997 833 495 445 11298 11111 --
NM_014918chr153178 149 78 ----11144
NM_014920chr653643 3124 1085 963 130 43740 2546 771 372 1184 --
NM_014923chr1371945 1790 1508 1498 939 807 435 11472 ----
NM_014932chr331917 257 217 2321 148 21732 1264 --
NM_014934chr1383116 3048 2554 1578 1199 1156 856 359 23011 2683 ----
NM_014935chr193603 3362 3216 3151 1229 991 699 447 62 23105 2518 ----
NM_014936chr642740 1919 1050 622 198 --1601
NM_014939chr1871390 1249 1038 577 479 107 70 2590 344 ----
NM_014943chr851202 1167 1103 960 55 --1891 --
NM_014947chr152814 2349 594 176 130 42758 2270 2127 893 ----
NM_014949chr13798 304 62 --2977 102 --
NM_014953chr1323629 160 24121 1462 13280 --
NM_014961chr431820 258 125 1616 --168
NM_014962chr2062554 2290 1143 356 312 45 2857 447 --22326 1058
NM_014978chr1011613 21831 1496 ----
NM_014982chr14105317 5304 4594 4514 4459 3811 3604 3504 2148 1417 45216 2112 2059 590 13354 --
NM_014988chr442488 2267 506 427 42772 1846 128 115 ----
NM_014990chr1421172 290 --122 --
NM_014991chr462758 2721 2506 527 395 120 12597 13190 --
NM_014992chr144879 555 195 183 --1622 --
NM_015000chr1263094 2755 2503 2338 836 325 22721 2190 ----
NM_015002chr121904 --21734 572 21747 220
NM_015008chr373389 3332 3108 3092 580 466 81 23256 903 22771 287 --
NM_015009chr3----1781 --
NM_015017chr121132 872 ------
NM_015020chr162910 486 53839 2912 2426 1477 1328 23034 3026 --
NM_015024chr821179 355 ------
NM_015025chr281071 920 559 416 364 288 183 100 ----1107
NM_015026chr1274351 4217 3229 1345 982 909 725 44755 4004 3728 789 14028 --
NM_015027chr1611618 21941 1609 21690 1379 21634 758
NM_015032chr1332783 1802 294 32516 1925 1094 1851 1367
NM_015040chr221270 550 42490 2264 865 472 ----
NM_015045chr1032131 431 321 ----11842
NM_015049chr293253 2885 2708 2448 2311 822 510 434 79 ------
NM_015051chr9112862 2815 2541 2477 2275 2244 724 704 570 438 104 13217 22561 2219 12198
NM_015052chr72919 418 ----11394
NM_015055chr11--42785 1913 577 561 --11108
NM_015057chr131210 ------
NM_015061chr94839 709 604 576 ----1196
NM_015064chr1243363 1448 999 613 23439 2777 --13348
NM_015068chr793359 3202 3088 2774 2631 2424 1196 1082 157 33164 204 128 ----
NM_015071chr5116535 5883 5758 4684 4304 4248 2179 1734 1059 814 233 56465 1677 1593 1356 1254 --11707
NM_015074chr1124833 4721 4476 4363 1765 1685 1558 1457 650 518 318 309 ------
NM_015075chrX12270 ------
NM_015076chr683098 1571 1463 986 915 733 295 254 23496 3157 14159 --
NM_015090chr196213 6202 5960 5320 4202 4136 1949 1734 808 65251 5139 1578 777 661 424 36091 4026 2208 --
NM_015092chr1684212 3491 3116 1171 927 812 453 121 44276 4246 3141 618 ----
NM_015097chr3--1583 21752 505 --
NM_015101chr1162890 2676 2643 2625 2598 2549 2535 2261 2111 2092 2040 1171 1113 991 717 697 12801 ----
NM_015107chrX--1799 ----
NM_015110chr9--21679 647 --1889
NM_015115chr482828 2753 2733 2719 2674 2536 2043 371 2490 322 1589 --
NM_015122chr191215 ------
NM_015130chr411129 ----1519
NM_015132chr72630 519 11818 ----
NM_015137chr822472 2098 32624 2559 770 1980 11023
NM_015138chr1532489 1072 579 ----1718
NM_015143chr431481 1366 136 2357 170 11339 --
NM_015144chr1663898 3891 3501 3467 2485 354 31289 1167 557 11547 12522
NM_015155chr1041067 322 246 107 32933 2865 2614 --13342
NM_015170chr841710 598 421 311 11873 2414 345 1475
NM_015172chr1----11446 --
NM_015173chr421696 634 --31730 696 668 --
NM_015176chr131682 1386 1120 31690 481 472 ----
NM_015192chr2042777 2685 746 317 22093 2011 22881 1920 1625
NM_015199chr352834 2344 1979 805 134 41904 1036 842 538 12633 22827 610
NM_015203chr1127 ------
NM_015206chr15113859 3227 3017 2917 2482 2467 1505 1355 1288 1104 607 53345 2930 2447 1553 1017 13006 1775
NM_015208chr1822738 966 51442 1410 1214 980 487 13199 --
NM_015213chr111248 ------
NM_015215chr153164 3132 2320 1139 226 1619 12790 11057
NM_015216chr551159 1014 567 401 325 ----2981 152
NM_015225chr972870 2603 2325 1949 1095 891 730 12010 ----
NM_015234chr631320 962 937 1918 ----
NM_015238chr51127 ------
NM_015247chr1684811 4645 4042 3280 1874 1427 1164 664 --14351 15131
NM_015252chr22741 653 ----1365
NM_015263chr1531239 1133 273 --1119 --
NM_015265chr231941 672 608 11754 --21818 1051
NM_015267chr1232036 2010 542 11588 --11845
NM_015269chr1----1616 --
NM_015271chr42577 136 33847 3402 1226 13124 --
NM_015275chr1221538 726 21608 110 21808 252 11834
NM_015291chr193553 3272 2665 1344 1045 877 461 362 188 12174 124 23366 495
NM_015305chr1421700 1456 21916 1563 11223 --
NM_015310chr8168201 7344 7088 7072 6759 6476 6048 5924 5681 3073 2742 2504 2359 2320 1334 710 48032 7983 3089 2590 26463 2941 25993 1104
NM_015313chr11104769 4535 3211 3192 3010 1586 1495 1431 606 348 34521 3864 3771 --23714 367
NM_015314chr761930 863 410 266 221 113 32583 907 439 --1541
NM_015315chr573245 3091 2523 1137 1038 1000 523 --23083 323 21304 941
NM_015317chr232728 1945 950 21775 1054 --12644
NM_015323chr611082 --11173 --
NM_015328chr792793 2274 2171 2030 1228 1175 1114 1104 788 33054 902 380 --12360
NM_015335chr1282424 2311 2018 1868 1737 1630 581 447 ----22496 2208
NM_015336chr1262494 1715 808 670 656 92 11800 ----
NM_015346chr1481807 1633 1435 1318 1171 646 323 223 1382 --1678
NM_015347chr1242720 936 820 467 --12680 1270
NM_015349chr662763 2731 2680 1892 1231 238 11122 --41213 1051 770 381
NM_015352chr2073239 3040 3006 2767 1155 300 49 1404 --13790
NM_015355chr1731894 1572 1367 1530 11924 11994
NM_015358chr2121107 237 21192 181 ----
NM_015361chr22786 132 ------
NM_015365chrX64147 3946 3585 2939 2756 1470 33885 3083 554 --23396 3383
NM_015379chr72236 78 ------
NM_015382chr141757 ------
NM_015385chr1073214 2289 2120 751 720 477 291 13080 22790 1079 --
NM_015387chr251860 1834 1529 1362 1312 32107 1849 1623 ----
NM_015393chr483788 3482 3455 3245 3096 2651 2334 504 --13445 12719
NM_015396chr351461 995 515 229 73 ------
NM_015423chr111389 --11614 --
NM_015435chr811392 --1228 --
NM_015454chr41254 ------
NM_015455chr553860 2772 180 132 124 --2438 55 --
NM_015458chr843674 3490 3437 1133 54385 3640 3631 3380 1461 25333 4883 --
NM_015460chr331684 1475 345 22070 1590 21851 755 1693
NM_015465chr53516 180 144 --1609 --
NM_015469chr9----196 --
NM_015475chr23306 194 81 1356 ----
NM_015485chr11106 1302 ----
NM_015508chr3264 28 ------
NM_015509chr12----11590 --
NM_015520chr362668 2468 2352 1101 796 433 11780 --3843 700 614
NM_015535chr23838 499 430 33342 2700 443 13355 24153 475
NM_015548chr6153 1384 --1887
NM_015555chr62266 145 ----1112
NM_015560chr352738 2618 2516 670 501 1393 22605 40 22772 709
NM_015564chr543455 3357 2741 134 53117 3074 3021 2959 1354 --13555
NM_015565chr2172145 2106 1445 772 755 729 230 3560 124 69 2696 546 --
NM_015567chr1331327 1087 75 ----11048
NM_015569chr1114848 4773 4634 4174 4028 3748 3586 3358 3171 1935 59 11450 34873 3531 3513 23856 294
NM_015570chr711471 1157 1260 --
NM_015571chr672188 1913 1048 1021 691 475 327 12572 11714 12486
NM_015576chr363005 2500 844 644 352 320 --1397 12585
NM_015602chr111610 31645 89 40 ----
NM_015608chr101645 1541 ----
NM_015626chr172187 114 --1997 --
NM_015635chr941945 534 199 79 32071 1444 58 ----
NM_015640chr133256 2043 1983 34425 4238 3985 24951 3369 --
NM_015641chr71199 ----176
NM_015652chr103653 186 130 1521 ----
NM_015660chr7192 --1118 --
NM_015691chrX42354 705 285 217 52933 2752 2138 1182 988 11964 --
NM_015693chr4--1282 ----
NM_015711chr191128 2726 621 1627 --
NM_015713chr821327 635 1794 13071 13157
NM_015714chr1--1372 ----
NM_015833chr2152362 2174 1990 937 258 --22188 73 --
NM_015859chr14--166 ----
NM_015874chr4------1162
NM_015878chr862183 2061 1593 902 648 473 1622 32023 1994 29 22236 2017
NM_015879chr18127431 6706 5362 3402 3089 2997 2502 2096 1935 1892 1522 261 25692 417 17518 16360
NM_015886chr8145435 5295 5196 4598 4567 4456 4094 3946 3843 2297 1010 854 621 326 35326 1742 175 33798 3550 1792 2563 184
NM_015888chr1103301 2647 2506 2300 1345 1101 1065 686 575 199 22070 635 32952 2825 213 --
NM_015891chr671830 1591 1472 726 225 147 77 11484 21990 692 --
NM_015906chr12850 249 34813 4766 4332 --14411
NM_015907chr4166 ------
NM_015912chr852237 2138 2080 1598 896 12040 11769 12319
NM_015932chr13166 ------
NM_015956chr191228 ------
NM_015984chr11481 ------
NM_016002chr13222 88 58 --1177 167
NM_016021chr662998 2427 2212 2059 1932 226 2816 316 32818 797 789 12143
NM_016025chr162523 363 11835 21824 613 --
NM_016061chr231433 1174 305 1636 11314 21566 1519
NM_016072chr1231588 562 349 1435 2595 58 --
NM_016073chr1521111 78 ------
NM_016075chr1333218 3048 530 32353 1107 650 --12615
NM_016078chr1721101 839 ------
NM_016081chr452230 2072 1648 1547 625 ------
NM_016083chr663073 2798 2770 1421 1047 775 12407 23593 690 12999
NM_016087chr721342 170 11693 11391 --
NM_016094chr3----130 1751
NM_016096chr8--1827 11950 1852
NM_016103chr5154 1370 1148 --
NM_016107chr51860 11375 1170 --
NM_016121chr12933 878 --1922 --
NM_016125chr171234 ------
NM_016131chr2--22216 1926 --11986
NM_016132chr1552390 2319 2124 1254 481 22859 991 ----
NM_016200chr7158 1247 --1715
NM_016203chr71219 3974 738 684 --1720
NM_016205chr4--21015 145 31422 1135 447 --
NM_016206chr3188788 8185 8166 6820 5893 5806 5446 3106 2940 2657 2390 2084 1989 1370 1230 1072 894 710 48347 6899 2609 2463 32063 1058 218 23290 2193
NM_016213chr151204 ------
NM_016216chr32870 543 ------
NM_016227chr13454 424 50 11170 31558 1106 71 --
NM_016228chr4--1487 ----
NM_016231chr172413 71 --41742 1707 1422 1411 --
NM_016239chr17--1759 ----
NM_016247chr3--1458 ----
NM_016248chr1393638 3501 3111 2885 2496 1486 426 297 137 32961 1503 1013 2258 81 --
NM_016252chr21706 --1723 2757 738
NM_016255chr653282 3122 3090 2839 2587 2320 136 ----
NM_016258chr11642 ------
NM_016260chr297513 6425 5688 5543 5448 2840 2683 1698 1201 25499 292 1658 --
NM_016271chr1852332 677 552 381 289 1316 1413 12081
NM_016282chr931787 1200 242 4679 347 191 105 11587 --
NM_016287chr121841 585 12088 ----
NM_016289chr232326 637 256 12108 32121 2044 368 1469
NM_016297chr273052 2742 697 628 538 254 85 13720 169 12768
NM_016300chr31496 ------
NM_016303chrX2162 21 ------
NM_016308chr141798 1737 1347 670 11982 ----
NM_016315chr241844 393 287 106 1124 ----
NM_016316chr21557 ------
NM_016322chr962766 2162 2127 2041 1141 29 13126 1666 --
NM_016329chr3132 ------
NM_016338chr521207 257 1427 1329 --
NM_016340chr541064 1004 531 476 --1451 2433 22
NM_016374chr131201 601 383 11602 ----
NM_016374chr131201 601 383 11602 ----
NM_016377chr61366 11562 31536 1325 380 --
NM_016395chr1551707 1325 566 201 45 31926 643 498 ----
NM_016396chr1552769 2727 2424 1945 556 11921 22105 592 --
NM_016401chr11149 133 ----
NM_016410chr92195 111 ------
NM_016422chr1133159 2102 1008 52349 2233 903 720 344 --1402
NM_016424chr172747 156 11860 ----
NM_016426chr2221840 569 ----1399
NM_016448chr12259 170 11630 --21345 478
NM_016470chr20----1533 --
NM_016472chr1441507 1305 1230 195 21010 497 --11051
NM_016480chr53710 596 361 --1580 --
NM_016507chr1762725 2709 1257 484 424 63 22785 932 32099 2038 537 22854 2613
NM_016513chr653643 3124 1085 963 130 43740 2546 771 372 1184 --
NM_016530chr1543191 3009 2893 2664 23611 58 1787 --
NM_016531chr444245 127 118 104 23974 3165 21539 567 23133 3065
NM_016542chrX51563 1484 1172 597 582 21761 178 11290 11647
NM_016575chr1295504 5480 5322 4761 3936 3443 1676 758 75 13760 ----
NM_016577chr3104150 3655 3452 3364 1799 1640 1542 1337 508 413 41589 1121 870 571 --21611 333
NM_016578chr112175 168 ----1684
NM_016586chr14--1177 ----
NM_016587chr72239 185 1128 ----
NM_016603chr521963 789 --11739 1443
NM_016607chrX1101 41487 1384 490 196 1457 --
NM_016612chr81477 ------
NM_016613chr472706 1046 995 927 680 260 252 2300 188 --1783
NM_016620chr12981 32 ----21245 50
NM_016626chr1831646 1156 206 ------
NM_016630chr152232 212 --1218 --
NM_016631chr21--1675 1773 --
NM_016648chr41254 ------
NM_016649chr202122 22 1408 --1374
NM_016824chr1041885 1171 279 199 1622 ----
NM_016831chr172338 1840 1612 1458 935 557 150 1646 --21923 1676
NM_016834chr1764021 3610 1404 1079 944 675 23897 352 --22898 451
NM_016835chr1764021 3610 1404 1079 944 675 23897 352 --22898 451
NM_016841chr1764021 3610 1404 1079 944 675 23897 352 --22898 451
NM_016929chr684305 2974 1681 1295 1274 1247 1184 249 21799 1088 24557 4225 --
NM_016931chr11--162 ----
NM_016946chr152961 2601 2501 1341 368 ------
NM_016950chr42584 253 1353 --1132
NM_016952chr1153963 3159 2944 2700 645 23581 755 12688 --
NM_016953chr265552 5343 4663 1964 1440 321 36000 5270 1450 15435 34765 3743 1505
NM_016954chrX1258 ------
NM_017412chr841218 1124 1065 564 ----11134
NM_017413chrX32569 2498 76 --12386 --
NM_017415chr5104428 3048 2943 1548 1436 1321 1038 493 446 58 --13526 --
NM_017416chrX2103 23 ------
NM_017420chr1441461 1321 767 665 33812 1524 620 23745 1104 --
NM_017423chr452176 2099 1648 457 135 2518 339 ----
NM_017426chr4--1200 --1163
NM_017437chr1462295 1967 1790 676 501 67 1385 11764 --
NM_017440chr12--4669 623 491 110 1604 --
NM_017444chr821475 340 21635 749 1457 --
NM_017447chr2163521 1568 750 471 73 63 34342 1602 931 1617 13310
NM_017450chr1741495 1164 358 32 --11464 --
NM_017489chr821193 1151 164 ----
NM_017512chr18133 ----1300
NM_017519chr6----1166 --
NM_017548chr3102144 1732 1715 1500 1460 675 480 385 74 27 --12007 --
NM_017554chr312103 --12021 11512
NM_017563chr3105537 5159 5038 4447 4178 2562 1558 1124 735 235 45140 1869 820 215 15348 31647 461 396
NM_017577chr351652 1232 553 333 156 ------
NM_017588chr92135 121 21952 528 31912 1589 1580 --
NM_017594chr942922 2729 2388 183 53353 3105 2098 2047 1035 ----
NM_017599chr1251843 1757 478 219 140 11714 11957 1154
NM_017610chr1542031 1630 531 210 12125 ----
NM_017628chr464624 4171 3374 1876 1054 752 21611 990 2179 45 13677
NM_017632chr4133 1413 2404 41 --
NM_017633chr663874 2989 2559 1568 992 512 22458 838 33527 2891 845 12637
NM_017634chr841344 705 356 249 21980 1859 --11748
NM_017637chr9118958 8801 7866 7597 6857 5775 2442 1348 774 195 55 56465 2774 1514 1473 490 ----
NM_017640chr62762 250 --1325 --
NM_017641chr12----2298 124 11105
NM_017643chr1752886 2290 2200 1152 643 32962 1914 233 1223 11013
NM_017644chr364271 3518 1745 941 723 235 24867 3438 --11233
NM_017650chr7105862 5826 5772 4384 3718 2019 1363 1110 712 522 15756 11643 32173 1636 447
NM_017655chr141078 513 434 21 21545 136 --21478 1388
NM_017657chr21229 2914 316 ----
NM_017658chr1454514 2847 1527 1429 819 34408 3332 77 21778 556 14064
NM_017666chrX42055 1756 545 71 ------
NM_017672chr151280 --1949 --
NM_017693chr1351548 1254 1211 1168 1066 --1238 1325
NM_017694chr2--11798 ----
NM_017709chr164039 3743 2777 1331 1027 618 44172 1727 1463 1265 ----
NM_017719chr312064 41017 620 426 405 1360 21659 273
NM_017736chr1683090 2902 2423 2044 2015 1986 1264 640 1608 --12148
NM_017737chr122090 1840 1736 11576 --
NM_017742chr1821685 337 31565 741 379 --21903 1268
NM_017746chr9126 ------
NM_017752chrX41985 1843 729 108 31490 749 403 ----
NM_017754chr6114959 4935 4466 4260 4189 3745 3513 1649 1484 1155 826 34023 3867 1571 ----
NM_017762chr154395 310 81 54 32255 795 553 --1737
NM_017770chr672806 2720 2095 1030 868 832 812 12896 ----
NM_017780chr81223 1883 ----
NM_017786chr84506 456 254 118 ------
NM_017789chr21849 ------
NM_017799chr1451605 1544 1279 607 51 3541 240 59 11550 11942
NM_017811chr943058 2566 677 210 22972 705 11154 --
NM_017812chr72177 162 --2477 86 --
NM_017813chr865840 5243 4711 3671 3647 3546 45395 4364 4113 1702 15831 11290
NM_017824chr1022187 430 22490 2222 1534 --
NM_017848chrX104532 4139 3334 3268 3222 2961 2865 1590 367 194 23592 1482 --21445 1191
NM_017866chr81282 1171 --1107
NM_017910chr21332 1137 ----
NM_017919chr9135566 5477 5219 4412 2151 1833 1808 1732 1523 1420 1019 607 237 23741 2029 12186 --
NM_017922chr14197 ------
NM_017925chr911721 11834 2334 183 157
NM_017934chr61116 ------
NM_017935chr41747 1288 --2563 232
NM_017938chrX51901 1730 1623 1562 516 ------
NM_017943chr141210 1860 --1400
NM_017944chr1173107 3027 2454 2002 1096 999 980 1611 --12931
NM_017958chr262653 2150 1980 584 263 174 2280 119 12799 --
NM_017988chr123843 776 22 ------
NM_017994chr722987 2525 1900 23025 1094 1411
NM_017998chr93967 583 36 ------
NM_018004chr3----1149 --
NM_018017chr1052694 2633 2486 2125 888 1790 32799 2533 1953 22544 2516
NM_018018chr1221689 1479 --167 11595
NM_018040chr1183 1476 ----
NM_018043chr1131379 1343 362 11169 11517 --
NM_018061chr121404 1089 1247 ----
NM_018064chr6--1275 ----
NM_018084chr232429 1310 83 31243 1038 746 12127 22754 627
NM_018085chr1107627 7516 7232 6969 5169 2167 2090 1518 796 686 22929 2839 38090 3261 1911 --
NM_018086chr221790 1719 11373 1574 1194
NM_018092chr1611169 ------
NM_018094chrX------1417
NM_018098chr34848 786 235 137 11155 ----
NM_018112chr93885 377 165 --3671 368 243 --
NM_018117chr103679 635 27 1228 ----
NM_018119chr16------1244
NM_018128chr1741021 959 936 239 1454 ----
NM_018131chr104818 746 654 71 1356 ----
NM_018155chr353105 3091 2731 2420 862 12408 32895 2582 897 --
NM_018159chrX2420 118 11710 11588 21435 325
NM_018167chr142984 36 ------
NM_018171chr123924 754 372 1287 ----
NM_018181chr184550 383 271 182 11222 11781 --
NM_018191chr1351921 1349 724 315 126 --22002 1693 --
NM_018211chr122018 323 32211 2201 1548 ----
NM_018214chr641122 843 807 354 ------
NM_018227chr462426 2132 1193 751 286 230 22828 2668 12814 --
NM_018237chr10174 ------
NM_018243chr453179 1523 1008 341 261 43821 3596 1176 624 1635 --
NM_018246chr882587 2571 2494 1879 1113 1098 601 537 52365 480 318 83 30 ----
NM_018247chr632232 99 81 1979 12717 --
NM_018254chr142044 981 886 62 11511 12026 11651
NM_018257chr2031991 1039 477 22334 676 --12360
NM_018287chr1021188 253 1451 ----
NM_018293chr332302 2158 1104 22587 1886 12489 --
NM_018299chr842954 1011 733 75 --12490 --
NM_018302chr472288 1965 1928 1680 1665 1511 804 --2235 181 --
NM_018312chr1131646 532 61 21673 1389 --1361
NM_018313chr322182 1899 1573 22599 1641 --
NM_018323chr421544 133 1395 1496 --
NM_018340chr1663207 1965 933 363 301 260 2678 571 13605 --
NM_018362chr1173794 3134 3010 2556 1165 702 532 ------
NM_018364chr134137 2563 476 43057 1457 1422 294 --11330
NM_018367chr1152093 1030 706 468 382 --21669 859 --
NM_018372chr13624 277 96 185 ----
NM_018373chr1456101 4127 3947 1476 188 34806 2423 1597 24067 105 14765
NM_018374chr7104919 4429 4270 3507 3308 1818 1463 888 371 354 33362 1443 635 14958 33926 3317 906
NM_018387chr9189 ------
NM_018388chrX21181 385 --1237 --
NM_018394chr311245 11365 --2438 390
NM_018400chr11114318 4091 3667 3436 3390 3286 3156 2816 731 602 166 64513 4182 3275 1544 1479 1312 24064 3845 11508
NM_018402chr12--3420 353 39 ----
NM_018403chr383727 2693 1293 1215 888 713 449 73 53953 3544 3374 3255 788 23591 660 --
NM_018424chr961716 1609 1437 1261 709 676 --1150 1458
NM_018429chr542585 921 174 121 12288 32719 2248 143 12794
NM_018431chr201479 1627 --1668
NM_018440chr8117699 6803 5981 3381 3274 2796 2523 2128 1957 1620 44 77663 7159 3196 3073 1174 781 165 1612 11391
NM_018444chr821519 564 11956 21811 543 12039
NM_018448chr1231019 995 859 11295 --1249
NM_018452chr6_random72372 1483 1466 1407 724 716 53 11387 --21268 1125
NM_018456chr31125 ------
NM_018460chr2----1163 --
NM_018482chr842291 2230 2148 1643 --22488 1868 --
NM_018486chrX--1533 --1109
NM_018490chr1151883 1709 1327 1278 80 1229 ----
NM_018557chr241234 384 257 136 1533 ----
NM_018566chr165000 4495 4091 1914 1177 532 11701 44729 3941 1920 1649 --
NM_018569chr421581 328 --31293 607 161 --
NM_018590chr1011080 ----31358 1094 519
NM_018593chr63738 195 40 1229 1252 --
NM_018638chr12105652 5008 4221 4189 2031 1570 1492 1384 1328 1155 65332 4234 3926 1481 892 155 14879 14598
NM_018640chr1252643 2601 1896 1079 1025 --21788 313 --
NM_018650chr162256 2058 808 742 735 60 21627 415 --1346
NM_018652chr152899 301 --1171 --
NM_018657chr33743 630 92 1808 --1671
NM_018662chr154328 4224 3005 499 283 53474 3159 1677 694 335 1650 --
NM_018682chr73584 255 244 ------
NM_018695chr512433 22395 1501 22469 467 1582
NM_018700chr511161 11201 ----
NM_018703chr161140 --1292 --
NM_018704chr151987 483 331 301 70 31632 683 548 ----
NM_018710chr8163 11136 41299 1207 937 205 --
NM_018834chr52771 763 ----1406
NM_018841chr153722 3127 3113 267 138 2890 802 --13880
NM_018844chr721703 159 21798 412 11409 11721
NM_018846chr71855 ------
NM_018847chr931756 1628 1429 21278 170 1463 21768 647
NM_018898chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018899chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018900chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018901chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018902chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018903chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018904chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018905chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018906chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018907chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018908chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018909chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018910chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018911chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_018940chr5------21008 434
NM_018945chr642486 2296 380 100 23618 992 12597 --
NM_018947chr764301 4005 1626 1476 757 186 24488 1537 11464 14765
NM_018948chr141440 1305 1070 482 11107 ----
NM_018963chr214611 499 491 188 --11224 21252 32
NM_018964chr21--11044 ----
NM_018970chr722867 416 1967 12792 12043
NM_018976chr1261022 502 368 132 104 35 ------
NM_018983chr4----2276 265 --
NM_018993chr202337 227 21516 1023 --11184
NM_018999chr1084628 4303 4164 4088 3104 914 394 154 24358 3437 23961 1677 24494 511
NM_019000chr571655 1601 1460 1394 1353 1093 580 11592 11411 11253
NM_019001chr341940 1290 690 545 11874 14244 --
NM_019022chr1863089 3080 2786 2753 2627 1287 33149 861 197 1280 --
NM_019027chr432357 674 132 1437 --12547
NM_019030chr51199 ----166
NM_019036chr63500 439 232 --11200 21131 62
NM_019040chr11191 ------
NM_019044chr2114720 4269 3968 3606 3269 1671 1623 962 848 816 322 21709 83 11809 --
NM_019045chrX1879 1929 --1834
NM_019050chr43641 296 59 ----11880
NM_019054chr101591 163 ----
NM_019060chr12293 281 ------
NM_019063chr222301 2007 1319 1341 --
NM_019072chr554253 3328 1092 988 109 34160 627 221 ----
NM_019083chr11431 11070 --3466 425 283
NM_019087chr52591 341 21557 681 1636 --
NM_019091chr241051 306 239 155 ------
NM_019094chr1262831 764 591 307 100 78 22998 2965 --11161
NM_019114chr962489 2466 2249 1684 351 228 ----22522 569
NM_019116chr1683594 3503 3461 2941 2469 1144 1132 570 21289 93 2263 126 --
NM_019117chrX33010 2968 2904 --22428 1284 22666 413
NM_019555chr35690 585 551 335 232 21820 1471 ----
NM_019556chrX31380 205 25 --2228 161 --
NM_019590chr10--11291 --1559
NM_019593chr2043018 2484 2442 350 62818 2635 2594 2534 362 303 12895 --
NM_019605chr1269 24 ------
NM_019891chr141330 1189 105 89 ----1524
NM_019903chr1041885 1171 279 199 1622 ----
NM_020066chr11211 ------
NM_020116chr4--21386 1214 ----
NM_020120chr22138 131 ----136
NM_020122chr285102 4611 4180 4129 2324 1392 585 515 44414 1888 1594 1572 16045 14686
NM_020135chr6--1180 ----
NM_020159chr451364 1130 400 256 219 --2506 437 --
NM_020177chr532843 2571 2120 22412 644 32893 2246 739 --
NM_020185chr6----1120 --
NM_020193chr1111350 3975 938 393 ----
NM_020199chr531311 539 450 1277 21066 824 11291
NM_020204chr11273 ----1703
NM_020205chr122614 2139 --22387 487 1538
NM_020208chr362672 2657 2495 2334 2297 419 12912 23057 966 12978
NM_020226chr43692 565 302 ------
NM_020243chr22158 144 ----
NM_020245chr624667 485 --15083 21074 987
NM_020307chr31103 1155 ----
NM_020336chr2063558 3134 2834 1088 662 155 33015 2720 647 ----
NM_020337chr432062 1071 300 12471 22633 649 --
NM_020341chr203750 602 541 11375 ----
NM_020342chr231863 935 129 1488 12190 11661
NM_020344chr91134 ------
NM_020353chr351693 1543 750 587 567 42008 1483 1452 39 --11643
NM_020357chr3--21062 157 --1616
NM_020390chr364413 3986 3961 290 196 36 --24095 3266 13545
NM_020405chr1774501 4120 3920 3421 2908 1708 23 11310 --14522
NM_020409chr31319 --1325 --
NM_020420chrY51338 734 457 172 132 ----1435
NM_020429chr752913 2333 1965 1946 447 22647 613 ----
NM_020432chr731718 1643 1424 ----22308 669
NM_020440chr122852 160 12746 12885 1563
NM_020443chr1126965 6948 6722 5471 2673 2470 1793 1524 997 670 499 414 11874 12071 26787 6060
NM_020445chr74726 717 653 279 1302 ----
NM_020455chr642749 2205 890 566 --1511 12297
NM_020456chr1332237 387 363 12181 ----
NM_020466chr651971 1942 1838 1542 1385 21743 183 11486 13780
NM_020473chrX41832 1701 563 476 ------
NM_020474chr182723 317 12044 --11733
NM_020640chr342273 2155 869 572 31942 1610 822 --21700 500
NM_020648chr1842186 480 304 222 52768 2700 2128 1767 346 21114 284 --
NM_020651chr281690 1476 287 263 218 211 168 157 31391 226 195 ----
NM_020661chr125741 516 398 389 223 1760 ----
NM_020666chr52874 308 2243 218 ----
NM_020673chr20107492 5787 5476 3103 2951 2609 2214 2178 962 484 26913 1726 12205 26752 1138
NM_020689chr203576 358 267 11259 ----
NM_020693chr111217 ------
NM_020696chr3--133 ----
NM_020699chr154471 4428 1498 1170 573 22160 749 34927 4720 4371 11972
NM_020706chr211134 ------
NM_020718chr1695847 5429 4904 4858 4844 1730 1423 1240 411 86548 6532 5628 4918 4696 2185 828 343 35141 2176 2162 25239 2393
NM_020727chr2143597 2983 1156 207 12562 43229 2784 876 820 23205 2667
NM_020728chr712291 1518 22503 2048 1726
NM_020732chr6----1166 --
NM_020734chr1222306 2273 43082 2596 767 463 12733 --
NM_020739chr1593884 1652 1487 1085 870 831 635 365 34 23680 618 24029 3820 --
NM_020742chrX12044 41745 1000 706 363 22376 1787 --
NM_020747chr5------187
NM_020748chr1732152 1397 311 ------
NM_020752chr102772 308 22381 2187 --22852 2678
NM_020754chr321443 1199 3375 352 27 --148
NM_020755chr621654 381 2464 374 --149
NM_020766chrX74546 3866 1744 593 506 389 291 33477 3118 1645 14195 --
NM_020771chr631407 985 304 21378 951 ----
NM_020772chr1778507 8315 7479 6350 1708 1631 1143 67199 6768 5419 2710 1231 705 17028 22412 834
NM_020774chr18156079 6030 5823 5808 5039 4142 2306 2008 1783 1759 1461 915 879 868 562 25849 410 --56127 6104 1697 1509 207
NM_020782chr1254462 1772 1270 1085 896 23628 1262 24779 3942 --
NM_020783chr1842283 2239 549 520 22139 1827 ----
NM_020786chr1641748 695 397 279 21778 344 ----
NM_020795chr1741283 753 206 192 21575 1364 --11511
NM_020800chr331378 1023 372 31158 345 38 ----
NM_020801chr5--2468 180 --1318
NM_020803chr481498 882 773 631 569 456 191 37 1851 11710 --
NM_020805chr181420 ----1704
NM_020808chr121106 53 ------
NM_020810chr1433045 2512 1425 43657 3561 2914 283 13302 --
NM_020818chr14169 1368 ----
NM_020839chr321482 536 ------
NM_020841chr1263366 3102 3002 1093 187 40 21342 342 43787 3721 3306 865 --
NM_020843chr15125 ----1380
NM_020853chr1262424 2320 2160 1060 985 458 1449 22005 1952 --
NM_020854chr1811133 31487 1434 1231 2582 378 --
NM_020856chr192400 391 ----11087
NM_020858chr1522042 239 21915 735 ----
NM_020859chr473930 3380 1355 1052 532 96 88 1187 14005 160
NM_020860chr421022 897 11136 ----
NM_020868chr231982 1637 1266 21954 1750 21911 153 11873
NM_020871chrX72475 2041 1896 1762 1626 407 213 --3871 363 44 --
NM_020872chr31650 --11534 2420 176
NM_020899chr1742261 2037 407 332 12331 12276 --
NM_020918chr1033266 1398 419 53477 2610 2529 2475 362 --13436
NM_020919chr221079 388 11182 159 1277
NM_020922chrX41683 1211 153 109 ----11458
NM_020926chrX----1112 --
NM_020935chr294188 4098 4084 4045 1808 1626 1240 1039 739 33483 3245 1722 --13854
NM_020943chr2------1190
NM_020948chr1113530 2838 2736 2431 1293 1042 966 796 631 437 335 41249 977 681 105 63523 2626 301 258 223 112 --
NM_020952chr92679 180 ------
NM_020977chr431687 1586 861 --11481 11400
NM_020980chr1541728 1243 632 406 ----11754
NM_020988chr16129 ----1220
NM_021003chr142833 194 ------
NM_021005chr1521184 822 1302 1848 --
NM_021007chr2--12256 --12304
NM_021033chr1373341 2849 2740 2442 2353 947 161 11262 --1271
NM_021061chr834530 3882 3694 --31295 953 291 24457 427
NM_021069chr432037 1986 302 11857 --1856
NM_021072chr512142 ----1998
NM_021079chr1792724 2620 2324 2114 1311 1190 887 553 23 32182 2091 693 32745 1152 527 --
NM_021083chrX61394 1071 1045 727 512 188 33149 3061 1306 1291 13301
NM_021090chr2255014 3396 1810 1669 1135 25059 4349 44467 4421 3852 1634 1391
NM_021097chr243086 770 661 514 ----12781
NM_021111chr941150 1119 1011 386 31230 1138 513 ----
NM_021116chr788335 7773 7402 7156 2800 1125 1118 702 69079 8291 6222 3258 1355 431 36926 5762 2289 18342
NM_021144chr91381 ------
NM_021148chr721936 283 1755 ----
NM_021156chr2011088 ------
NM_021159chr421342 616 21680 1274 ----
NM_021163chr7103835 3772 3484 3440 2717 2437 1375 596 422 33 13046 1774 182
NM_021183chrX52159 1787 1739 1000 660 1837 --1681
NM_021188chr145452 341 190 104 38 ------
NM_021190chr141131 905 458 58 21356 1234 11178 --
NM_021194chr13301 293 25 ------
NM_021201chr1121837 1766 1458 --11882
NM_021205chr131155 865 214 32288 458 244 1307 22082 503
NM_021238chr1231409 396 362 2729 53 145 11843
NM_021239chr1441321 268 81 63 --1187 11432
NM_021244chr61179 127 ----
NM_021252chr1032109 362 32 11377 11676 --
NM_021255chr1442915 2774 1585 1373 21058 538 23136 1526 --
NM_021619chr911242 ------
NM_021622chr1052250 2032 1596 745 236 41907 1656 668 516 12230 11833
NM_021627chr331068 866 435 2778 451 1824 --
NM_021629chr363086 1473 544 486 452 219 34867 4107 193 54773 1034 882 633 39 --
NM_021637chrX183 11400 --11001
NM_021638chr434176 3590 134 44754 3556 950 261 ----
NM_021643chr231755 1467 1359 11321 ----
NM_021647chr494625 4569 3497 3282 2953 1318 1271 779 328 23414 2999 11731 --
NM_021813chr695311 5287 3583 1615 1596 1571 1421 752 361 23973 2299 11437 --
NM_021814chr651310 1243 1110 610 38 11502 ----
NM_021818chr1421470 1285 1413 11361 --
NM_021821chr12167 ------
NM_021911chr595146 5058 2066 2043 1951 1710 828 660 538 24398 1755 15089 --
NM_021912chr1574154 3589 2874 2841 1315 1209 682 3699 654 470 ----
NM_021914chr1442247 1693 953 736 22184 1742 124 12267
NM_021925chr231581 372 84 11828 --11809
NM_021935chr331037 878 321 ------
NM_021940chr63250 163 130 ------
NM_021942chr43734 681 259 ----1204
NM_021947chr1731230 913 318 21317 868 11080 --
NM_021954chr13113189 3180 2989 2707 1068 1059 945 788 547 285 221 --23575 3529 --
NM_021956chr651519 508 445 317 245 --1563 --
NM_021960chr152262 1115 943 912 775 3977 728 204 --12015
NM_021961chr1147083 6918 6353 5435 56136 5911 5830 5460 592 22670 951 --
NM_021963chrX2243 147 1744 ----
NM_021964chr3146014 5199 4826 4739 4541 4007 2561 1938 1787 1427 797 605 581 182 35951 4837 2274 34684 4429 411 14820
NM_021973chr42545 101 1712 1220 --
NM_021977chr693525 3511 3223 1376 1058 479 454 416 382 53842 3624 3585 1090 731 23003 688 12968
NM_021988chr2031453 1169 1060 21475 631 --1185
NM_021998chrX--2333 176 1147 --
NM_022048chr1595809 5163 4645 1894 1843 1752 1683 957 209 35506 1562 1066 14425 15955
NM_022068chr18--1214 140 --
NM_022073chr1441534 1048 660 500 1371 1456 1356
NM_022080chr2052073 1991 1089 742 662 31731 621 241 22445 397 12552
NM_022118chr13--1170 ----
NM_022123chr14189 ------
NM_022133chr831752 1442 390 ----1533
NM_022143chr7------11504
NM_022154chr421184 71 21375 208 ----
NM_022160chr93554 516 27 --1215 1173
NM_022165chr19181 ------
NM_022166chr1666226 4123 4010 1456 1036 680 15120 36071 4348 4340 16039
NM_022351chr863152 3027 3009 2807 2410 1276 42776 2565 1217 1159 --12947
NM_022366chr1------171
NM_022373chr7135 --3839 682 180 --
NM_022374chr23397 172 113 --131 --
NM_022405chr362672 2657 2495 2334 2297 419 12912 23057 966 12978
NM_022442chr2031453 1169 1060 21475 631 --1185
NM_022456chr12127653 7291 6934 6770 6195 6016 5650 2853 1529 1352 1195 400 55415 1694 1551 1003 524 1494 --
NM_022457chr11281 ------
NM_022459chr1395542 5480 5372 4463 4389 4371 1688 555 232 --11607 --
NM_022461chr3----1131 1218
NM_022474chr1432620 922 39 12165 12675 11777
NM_022476chr162980 271 --1442 --
NM_022485chr31414 ------
NM_022491chr12153480 3064 3015 2950 2791 2764 2682 2356 1388 1064 847 419 326 320 37 33216 2491 308 --13074
NM_022497chr383778 2481 809 393 369 250 173 38 22770 110 12857 11338
NM_022550chr55494 426 412 387 181 1339 ----
NM_022650chr53906 722 242 ------
NM_022652chr1231075 1057 857 ----1368
NM_022716chr192878 2366 2022 1283 1223 797 632 507 426 1593 12478 22572 2141
NM_022728chr72281 118 ------
NM_022734chr141137 ------
NM_022735chr13700 119 22 1599 --1397
NM_022739chr1721192 486 1171 ----
NM_022753chr132426 1002 499 --22464 490 --
NM_022763chr322951 2413 32317 962 162 ----
NM_022770chr1621387 1272 ------
NM_022771chr121353 1313 11103 2932 77
NM_022777chr711400 --11497 166
NM_022781chr942944 1033 1024 562 11225 23197 924 22895 2856
NM_022784chr152406 355 1181 188 --
NM_022828chr521338 1168 --41519 629 380 274 --
NM_022841chr1532564 2523 1093 31798 1035 921 ----
NM_022843chr13----11418 --
NM_022845chr1632110 1480 1390 22078 1399 21612 222 --
NM_022893chr223003 258 1449 12253 --
NM_022897chr511005 3451 267 204 1803 --
NM_022898chr1452974 1625 1591 861 295 33450 1661 447 11363 --
NM_022900chr711079 11100 177 --
NM_022901chr91332 21641 503 ----
NM_022912chr292917 2657 2449 2248 1028 865 850 497 307 12755 --22859 1136
NM_022918chr1132096 456 220 --1492 --
NM_022977chrX21704 928 2754 691 1725 --
NM_023000chr1411495 --31084 412 292 --
NM_023001chr1411495 --31084 412 292 --
NM_023012chr121510 ------
NM_023016chr272792 2591 2052 876 853 372 251 ------
NM_023037chr131249 ------
NM_023074chr192893 543 11233 ----
NM_023923chr193515 3468 3303 607 453 273 213 140 123 13198 --1665
NM_023927chr551395 1056 255 209 48 ------
NM_023929chr832492 2186 801 11123 --1923
NM_024007chr583047 2937 2619 2596 1226 810 771 63 --12538 --
NM_024045chr101186 ------
NM_024047chr41284 ------
NM_024052chr1732992 2985 2894 42467 1142 1127 958 ----
NM_024061chr71140 ------
NM_024071chr141642 ------
NM_024077chr92720 249 2611 50 --2267 116
NM_024295chr861956 1916 1596 1534 1294 283 11930 --11342
NM_024332chrX41834 1750 600 506 31459 413 233 ----
NM_024344chr15--1507 ----
NM_024345chr986026 5796 3985 3969 1972 1477 1202 853 25178 2366 25889 916 --
NM_024416chr92292 113 2546 420 11607 21405 1055
NM_024423chr1883523 3039 2887 1665 1470 715 328 255 24139 2662 ----
NM_024429chr71219 3974 738 684 --1720
NM_024496chr141734 1186 1213 --
NM_024511chr452871 2430 843 114 91 22611 1318 43076 2392 1082 939 --
NM_024520chr2178 ------
NM_024524chr372275 2255 1144 1116 1060 492 130 --32158 2116 1026 --
NM_024529chr14857 454 333 109 3962 417 26 ----
NM_024539chrX11031 2987 882 --21209 435
NM_024546chr131306 31125 862 175 ----
NM_024558chr145845 797 710 367 329 ------
NM_024567chr81624 ------
NM_024573chr62162 38 1924 1671 1948
NM_024583chr22840 110 1732 ----
NM_024594chr531525 1517 354 11283 11432 11888
NM_024613chr83629 575 74 21569 1394 11458 41739 1579 1185 42
NM_024615chr5162 ------
NM_024627chr2264327 3771 3469 1481 1068 723 23236 3140 ----
NM_024636chr742692 1810 74 61 --21040 444 --
NM_024638chr382370 2175 622 476 421 409 390 331 12186 186 --
NM_024639chr642303 623 247 235 32955 711 222 2982 603 --
NM_024646chr193520 3421 3141 3062 2713 2648 1549 1187 254 ------
NM_024665chr384205 4041 4018 3911 1590 1046 595 361 --14701 14713
NM_024666chr1561743 1702 1206 580 567 444 21548 49 ----
NM_024676chr111323 --1496 --
NM_024721chr832531 883 812 32658 2574 779 12643 1625
NM_024740chr1183792 3566 3425 1570 1408 737 620 126 --44005 3327 1616 861 1401
NM_024749chr11308 11830 1140 11902
NM_024761chr985254 5161 5059 5042 1780 1034 452 180 33315 1253 553 24238 2014 --
NM_024763chr12165 110 21185 962 ----
NM_024770chr2106649 5933 5395 5153 4132 2601 1805 986 411 225 44518 4226 523 199 14700 1544
NM_024817chr1545106 4430 3725 318 31494 270 188 12061 --
NM_024818chr341562 1468 1155 305 21342 135 ----
NM_024824chr14--2536 91 1143 11628
NM_024834chr104756 656 254 201 ------
NM_024837chr1531585 662 83 21293 1206 --11925
NM_024841chr1152369 2200 1931 1637 353 --1876 11650
NM_024920chr441278 1134 1036 92 ------
NM_024921chrX11921 1617 ----
NM_024941chr52160 151 ----2279 186
NM_024945chr921175 1011 1171 --11121
NM_024947chr3129646 9533 9262 8466 7028 6402 3433 3306 2306 1819 1507 703 35929 3688 2888 16817 25945 565
NM_024949chr484744 4231 3371 1988 1675 1642 1582 890 13301 11136 --
NM_024953chr1282729 2495 1984 1821 629 556 208 76 11861 22646 2278 --
NM_024971chr92679 180 ------
NM_024979chr1351669 1171 533 521 300 ------
NM_024989chr2188200 8191 7176 7071 6976 6662 6639 5544 5111 5042 2962 2774 1995 1604 968 579 408 310 77517 7035 6405 5680 5016 4972 220 45804 5436 5179 1455 --
NM_024991chr1073214 2289 2120 751 720 477 291 13080 22790 1079 --
NM_024993chr221291 56 1323 --11472
NM_024997chr1621184 1028 11258 ----
NM_025004chr112627 102 --1678 1665
NM_025027chr1921194 34 1998 ----
NM_025054chr844094 3828 662 196 1343 31550 1220 451 12902
NM_025073chr194600 4476 4371 3774 1485 1376 569 435 98 1304 --13663
NM_025076chr23625 204 130 1563 --1597
NM_025107chr642146 1689 1616 845 ----12277
NM_025126chr121488 ------
NM_025133chr21903 1283 1879 --
NM_025146chr382344 2077 1859 1040 639 500 224 191 32546 1930 147 --12744
NM_025151chr871663 1435 751 614 594 472 279 --12051 --
NM_025152chr143689 419 139 21266 209 3769 702 480 --
NM_025160chr183969 3627 3464 3225 870 607 425 133 23204 798 ----
NM_025164chr112755 263 42159 529 389 170 ----
NM_025179chr133401 1303 328 13118 14244 23860 1072
NM_025181chr23770 583 571 2126 102 1297 --
NM_025184chrX3893 329 295 ------
NM_025191chr143513 2535 945 315 31072 825 742 1157 12638
NM_025208chr1172500 2239 1785 1726 982 813 458 1441 ----
NM_025221chr45569 445 380 262 159 11043 ----
NM_025222chr342785 2194 905 94 32234 1910 408 1315 --
NM_025235chr1032163 1622 556 ----11893
NM_025238chr1541037 512 407 368 ------
NM_030579chr1663658 3183 2589 2342 1491 576 23374 2845 --32376 1170 156
NM_030594chr1511033 ----11086
NM_030621chr1424084 1618 --23637 1665 23543 3002
NM_030625chr1021668 114 22653 510 --12381
NM_030627chr563562 3321 2916 1338 819 426 23422 1395 ----
NM_030634chr12965 54 --2256 37 1149
NM_030637chr144608 486 215 174 1458 2529 128 --
NM_030647chr7154958 4588 4380 2447 2125 1965 1834 1823 1502 1346 898 562 530 517 409 16282 16336 --
NM_030648chr485176 4680 3385 2124 1954 1306 234 66 35530 4729 1471 45359 4445 4187 1005 --
NM_030650chr284071 3534 2977 2586 1625 842 756 213 23499 2788 43819 749 141 118 --
NM_030660chr1431384 1373 1147 21320 608 --11095
NM_030664chr1022453 1956 31532 555 152 22338 909 --
NM_030674chr1245001 797 574 191 55534 5249 5185 368 321 25674 5493 1527
NM_030751chr1041845 1527 757 352 11664 ----
NM_030751chr1041845 1527 757 352 11664 ----
NM_030755chr1462089 930 370 287 93 72 4963 296 226 176 22341 1927 --
NM_030763chrX2924 279 ------
NM_030786chr14767 754 608 334 11838 1616 --
NM_030791chr1451524 1345 699 673 316 --1420 11802
NM_030799chr562119 1716 1630 1414 827 113 ------
NM_030806chr1149313 9237 9019 8903 8851 8550 8103 8022 7236 6563 2860 2057 1482 715 39362 9351 2511 37206 3183 2560 --
NM_030809chr1241615 786 586 202 22449 2084 2965 347 1901
NM_030816chr133132 1203 904 12299 1524 11392
NM_030817chr1242942 496 400 134 53330 2290 1419 1103 846 23398 3037 --
NM_030820chr61349 ----1990
NM_030885chr351907 1499 621 513 330 31999 1875 867 --1898
NM_030918chr14973 483 364 59 53904 1841 1350 989 400 13525 --
NM_030920chr152114 2084 1482 648 454 11899 ----
NM_030939chr6--1129 11126 1309
NM_030945chr552309 2273 1877 544 403 11661 2769 66 22599 2508
NM_030949chr621399 402 11462 ----
NM_030958chr81463 ------
NM_030965chr13718 689 552 1305 ----
NM_030979chr131142 ------
NM_031216chr1821630 1416 2272 218 2441 331 1209
NM_031243chr7--1392 --11983
NM_031262chr9199 1204 ----
NM_031268chr1674511 4261 3535 3492 3406 2122 1175 34372 3878 994 15158 --
NM_031271chr841467 1079 326 189 21405 1094 --21366 1301
NM_031296chr452612 763 552 368 51 --1232 --
NM_031369chr42172 159 --3671 70 58 --
NM_031370chr42172 159 --3671 70 58 --
NM_031371chr131201 601 383 11602 ----
NM_031371chr131201 601 383 11602 ----
NM_031411chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_031419chr331405 502 219 --1235 1584
NM_031422chr181479 ------
NM_031427chr1495953 5833 5680 4501 3981 3734 2324 2181 1881 14554 34458 1722 824 21588 386
NM_031431chr1341606 1535 1163 497 31682 1210 530 ----
NM_031435chr1223503 2751 2592 245 1601 32908 458 177
NM_031439chr861504 572 548 445 413 118 11890 11216 --
NM_031442chrX53107 2769 2009 1980 1280 12108 --11085
NM_031453chr1032187 2108 150 22443 1051 32294 1652 1009 --
NM_031469chr694037 3811 3434 3343 1425 1405 795 432 37 33009 402 143 23851 807 1681
NM_031476chr1621756 899 22388 954 42837 381 274 248 --
NM_031483chr2053184 1391 1120 650 498 22318 1402 42587 2247 599 113 --
NM_031844chr1103654 3646 3535 3184 2852 2748 2678 2564 1603 1151 22898 746 23865 3575 --
NM_031849chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_031850chr33847 269 156 ----1713
NM_031850chr33847 269 156 ----1713
NM_031857chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_031860chr572353 2205 2187 2069 1823 1813 751 11842 --11860
NM_031905chr751149 1045 344 303 36 ----1328
NM_031911chr452763 2730 2335 957 43 12094 1677 --
NM_031914chr145993 894 699 646 159 ------
NM_031946chr72448 172 ------
NM_031966chr5--1536 1135 --
NM_032012chr9125080 5069 5062 4848 4733 4247 3980 3581 1592 1497 576 44 45285 5115 4743 3250 13351 --
NM_032047chr331987 1778 488 21605 116 1861 --
NM_032049chr33847 269 156 ----1713
NM_032049chr33847 269 156 ----1713
NM_032102chr1151922 1914 856 259 145 42346 2006 842 308 ----
NM_032105chr1117148 6620 6208 5728 5659 5228 3231 2743 1347 1091 936 68053 7541 7484 3178 2129 634 21273 387 --
NM_032116chr13125363 5041 4980 4768 3673 1998 1590 1567 1506 1388 1221 1023 34906 3765 1617 35760 4005 630 15086
NM_032121chrX32677 2378 347 2531 69 21941 189 1199
NM_032138chr131424 1129 ----
NM_032141chr171525 1706 --1678
NM_032145chr631410 427 130 21259 189 --1746
NM_032148chr122447 222 ------
NM_032154chr1031000 785 298 2959 758 ----
NM_032160chr1893995 3986 3670 3474 3220 2800 1033 685 677 84123 2937 2811 2771 1178 937 445 221 ----
NM_032175chr56593 343 255 196 49 33 1398 ----
NM_032182chr1051654 1464 1271 1221 77 21280 1105 ----
NM_032186chr12981 32 ----21245 50
NM_032189chr1374677 4360 4081 3711 1478 1252 494 14900 11514 --
NM_032199chr1083532 3495 3371 3245 2641 2542 959 343 12519 2318 107 --
NM_032208chr243567 3120 2723 1257 22455 1443 23427 327 --
NM_032228chr11143562 3193 2867 2519 2426 2321 2194 2170 1316 1157 845 821 585 435 22754 321 11396 --
NM_032233chr141762 1571 ----
NM_032236chr12813 423 2932 800 ----
NM_032246chr152853 511 1137 --11259
NM_032288chr382346 1777 1686 1597 1583 680 509 132 139 ----
NM_032293chr91262 ------
NM_032312chr24721 706 344 184 ------
NM_032320chr111197 --1537 --
NM_032321chr242850 2037 1162 45 43291 2500 2172 2157 43135 2456 215 98 --
NM_032325chr1141762 664 186 125 11868 --1695
NM_032352chr1411394 ------
NM_032373chr1074717 4643 4548 3653 1527 1415 290 45522 3629 1377 1356 25878 5424 --
NM_032379chr112901 53 --2229 68 --
NM_032424chr1151511 1320 1151 353 310 31565 1276 34 --11590
NM_032434chr231214 1132 994 41459 1330 1178 1004 11089 --
NM_032435chr192238 2038 1666 850 758 649 540 192 71 ----11801
NM_032438chr641658 1403 603 501 ----11107
NM_032440chr1072954 2797 2608 2327 744 717 159 ------
NM_032445chr1511995 22428 54 --1314
NM_032446chr553002 2756 2706 1023 572 23232 2661 21295 352 --
NM_032457chr473327 3212 2899 2781 2577 1316 425 22607 513 23613 1402 11015
NM_032466chr841605 1560 516 138 21135 593 11620 --
NM_032468chr841605 1560 516 138 21135 593 11620 --
NM_032521chr2032474 2230 399 ------
NM_032539chrX--2625 123 ----
NM_032557chr42898 743 1868 ----
NM_032558chr931032 982 455 31408 1224 41 --1229
NM_032581chr751698 1579 1553 740 123 1693 1754 1508
NM_032632chr1441523 1377 1288 595 --21383 291 --
NM_032664chr811682 --174 --
NM_032682chr352637 2422 1357 331 107 1138 --13518
NM_032765chr54871 805 269 127 ------
NM_032778chr363362 3310 3150 2499 2106 1225 12088 --11046
NM_032802chr15174 ----188
NM_032804chr1042310 1857 653 455 11885 1265 --
NM_032815chr1642486 1726 786 557 ------
NM_032828chr1921864 1404 --1644 11138
NM_032833chr142479 1039 741 175 21054 831 --22112 397
NM_032857chr15139 2217 51 --195
NM_032859chr1384011 3006 2878 1444 1194 715 534 94 1116 43878 3849 2763 775 --
NM_032867chr111646 ------
NM_032873chr1163245 3084 2773 1321 750 204 33574 1524 913 24384 3061 --
NM_032876chr14102218 2097 1887 1472 829 746 280 273 235 65 32178 1873 811 1725 --
NM_032892chr152321 288 ------
NM_032900chr10103850 3309 2762 2470 1040 962 880 658 617 111 43922 2517 326 196 ----
NM_032906chr4----1749 --
NM_032918chr123807 484 468 31071 256 103 1231 --
NM_032927chr4146 --1140 --
NM_032943chr112901 53 --2229 68 --
NM_032961chr43951 930 503 --11193 --
NM_032968chrX33680 2703 988 ----24113 2887
NM_032969chrX33680 2703 988 ----24113 2887
NM_032973chrY53672 2698 1689 988 816 ----24105 2882
NM_032975chr1863589 3421 3335 1395 1138 490 32512 1458 907 12405 13433
NM_032980chr1863589 3421 3335 1395 1138 490 32512 1458 907 12405 13433
NM_032993chr4----2276 265 --
NM_033012chr1321052 396 --1378 --
NM_033014chr92292 113 2546 420 11607 21405 1055
NM_033020chr12850 249 34813 4766 4332 --14411
NM_033030chr22386 167 11352 1600 --
NM_033031chrX1173 ------
NM_033044chr13238 74 38 1899 ----
NM_033083chr333036 502 193 33196 3113 131 12831 --
NM_033084chr31191 ----2232 152
NM_033089chr2071495 1094 1018 928 601 172 92 1545 1586 --
NM_033132chr1311998 --1895 --
NM_033135chr1172500 2239 1785 1726 982 813 458 1441 ----
NM_033138chr721946 1902 32094 804 470 2304 281 1492
NM_033139chr721946 1902 32094 804 470 2304 281 1492
NM_033140chr721946 1902 32094 804 470 2304 281 1492
NM_033143chr453978 3965 3605 3389 403 14040 --14111
NM_033157chr721946 1902 32094 804 470 2304 281 1492
NM_033181chr663073 2798 2770 1421 1047 775 12407 23593 690 12999
NM_033208chr16--1129 ----
NM_033211chr5----1152 --
NM_033222chr911123 21249 1177 --2947 59
NM_033224chr7137088 6900 6585 6513 6327 5522 5071 2627 2298 1723 1590 539 410 --47315 7074 7045 7015 25818 2757
NM_033227chr5171 ------
NM_033255chr132497 22 1388 ----
NM_033260chr6185 1581 ----
NM_033274chr5103210 2407 2260 1342 1160 738 703 201 99 41 23062 3037 --13240
NM_033276chr121291 ------
NM_033285chr854027 3679 3282 1497 1292 43937 3128 536 231 21232 1016 --
NM_033290chrX73583 3132 2660 1326 768 675 471 33198 2366 725 22778 517 13592
NM_033309chr16------11105
NM_033326chr1151970 1780 584 556 426 1600 1709 --
NM_033331chr962718 2253 1013 468 365 156 12341 --23552 74
NM_033338chr1031268 296 166 --1449 21145 918
NM_033339chr1031268 296 166 --1449 21145 918
NM_033340chr1041384 412 282 37 --1565 21261 1034
NM_033360chr1294134 3600 3409 3204 3130 1505 1033 468 332 --13881 --
NM_033364chr331611 1573 1269 52008 1744 1469 1423 807 ----
NM_033389chr1764344 3666 3508 3383 3252 963 43454 868 657 329 44721 3493 1057 195 --
NM_033402chr8--194 --1442
NM_033425chr1173280 2378 1169 541 469 260 175 21388 780 23059 218 1337
NM_033426chr1442775 2599 980 613 21900 835 --22142 712
NM_033430chr493645 3078 2910 1594 1434 1226 1023 850 358 2665 545 23897 1440 --
NM_033437chr493645 3078 2910 1594 1434 1226 1023 850 358 2665 545 23897 1440 --
NM_033480chr642615 2120 710 486 2497 248 12521 11956
NM_033481chr642615 2120 710 486 2497 248 12521 11956
NM_033484chr52646 487 ------
NM_033505chr286189 6016 5706 5018 4898 2659 1107 656 36632 5815 1601 26207 145 12060
NM_033506chr71192 ------
NM_033535chr41404 1878 1905 --
NM_033540chr34753 745 711 172 1307 ----
NM_033542chr2031869 1432 340 21708 1421 --2222 93
NM_033551chr573245 3091 2523 1137 1038 1000 523 --23083 323 21304 941
NM_033624chr121904 --21734 572 21747 220
NM_033644chr572508 2348 2213 2122 2103 2023 555 12333 ----
NM_033645chr572508 2348 2213 2122 2103 2023 555 12333 ----
NM_033656chr21155954 5766 5632 4342 4220 3780 2366 1625 1591 1537 1427 694 559 353 246 1269 15279 --
NM_044472chr1--2748 95 ----
NM_052818chr1372095 1433 1399 348 213 190 126 ----1249
NM_052821chr92135 121 21952 528 31912 1589 1580 --
NM_052832chr842623 2251 1975 598 22189 473 ----
NM_052867chr1331451 1022 527 ----2959 469
NM_052874chr161512 ------
NM_052879chr1243594 3475 2924 399 23703 631 --1588
NM_052885chr1244685 3932 645 89 11008 ----
NM_052896chr122587 1733 ----12567
NM_052897chr12125 2909 553 ----
NM_052898chr821258 138 --11304 --
NM_052904chr6----11060 11266
NM_052905chr231681 757 228 --11454 --
NM_052907chr1244083 3291 922 48 34232 529 517 13728 --
NM_052910chr1331678 1658 1560 12158 ----
NM_052917chr273367 2684 1353 1324 1242 482 183 12517 ----
NM_052918chr1082763 1472 1440 1160 1086 1006 384 200 2635 373 ----
NM_052937chr831827 1809 604 11083 31999 980 374 11875
NM_052953chr33314 219 121 --1235 197
NM_052958chr81287 ------
NM_052966chr123178 271 133 33054 823 116 1929
NM_053002chr331015 934 298 1281 --1431
NM_053016chr9147855 7713 6988 6489 6457 5875 5485 5326 2633 1928 1649 1275 873 773 57637 5125 1773 1547 1332 15051 12198
NM_053023chr115970 870 812 485 352 43027 2743 2324 1011 --12114
NM_053025chr341569 1204 621 305 1479 ----
NM_053026chr341569 1204 621 305 1479 ----
NM_053027chr341569 1204 621 305 1479 ----
NM_053028chr341569 1204 621 305 1479 ----
NM_053031chr341569 1204 621 305 1479 ----
NM_053032chr341569 1204 621 305 1479 ----
NM_053043chr796388 6023 5400 4807 4564 1230 931 396 309 22083 2035 ----
NM_053064chr142201 150 3887 318 120 22745 95 12667
NM_054016chr111698 11440 ----
NM_054016chr111698 11440 ----
NM_054016chr111698 11440 ----
NM_054027chr5--1662 21489 730 11873
NM_057168chr721342 170 11693 11391 --
NM_057178chr1752483 2464 1952 1945 1775 12578 --11752
NM_057749chr821204 401 11289 ----
NM_058170chr1--11520 --11059
NM_058238chr22--1784 ----
NM_058241chr231470 783 361 1148 21692 327 22286 911
NM_058241chr231470 783 361 1148 21692 327 22286 911
NM_078629chrX1577 1671 ----
NM_078630chrX1577 1671 ----
NM_080422chr18141 ------
NM_080423chr18141 ------
NM_080546chr931773 1717 305 21806 1438 --21883 791
NM_080591chr951025 628 486 465 24 --13100 1157
NM_080629chr151133 1038 608 454 83 21479 180 1267 --
NM_080630chr151133 1038 608 454 83 21479 180 1267 --
NM_080645chr651448 850 836 548 38 32182 294 62 ----
NM_080676chr2053138 2517 1122 666 527 12925 --32882 2484 977
NM_080743chr631620 793 678 1894 21690 761 --
NM_080759chr1342596 1002 966 300 32685 1976 355 22092 369 22126 644
NM_080760chr1342596 1002 966 300 32685 1976 355 22092 369 22126 644
NM_080764chr2262601 2237 1181 216 194 160 2830 672 21302 166 --
NM_080798chr10--178 ----
NM_080799chr10--178 ----
NM_080800chr10--178 ----
NM_080801chr10--178 ----
NM_080802chr10--178 ----
NM_080803chr10--178 ----
NM_080804chr10--178 ----
NM_080805chr10--178 ----
NM_080806chr10--178 ----
NM_080807chr10--178 ----
NM_080808chr10--178 ----
NM_080809chr10--178 ----
NM_080810chr10--178 ----
NM_080811chr10--178 ----
NM_080812chr10--178 ----
NM_080813chr10--178 ----
NM_080814chr10--178 ----
NM_080815chr10--178 ----
NM_080832chrX3568 360 105 1121 ----
NM_080867chr1484383 3495 1988 1483 929 683 648 639 1812 45078 4651 1032 347 1319
NM_080872chr823833 3436 1351 21125 540 13964
NM_080927chr342994 2416 2354 474 12120 --1819
NM_080928chr71199 --1857 --
NM_130391chr932193 64 21 --1237 1706
NM_130392chr932193 64 21 --1237 1706
NM_130393chr932193 64 21 --1237 1706
NM_130395chr6--1180 ----
NM_130434chr151438 ------
NM_130435chr1052842 2547 1923 1161 1000 ------
NM_130436chr2142788 2180 2005 806 12822 1651 --
NM_130438chr2163365 2757 2582 2123 497 392 13399 11228 --
NM_130439chr1052334 2048 1835 874 283 2610 557 ----
NM_130439chr1052334 2048 1835 874 283 2610 557 ----
NM_130798chr1521464 1099 --11503 11347
NM_130831chr352738 2618 2516 670 501 1393 22605 40 22772 709
NM_130832chr352738 2618 2516 670 501 1393 22605 40 22772 709
NM_130833chr352738 2618 2516 670 501 1393 22605 40 22772 709
NM_130834chr352738 2618 2516 670 501 1393 22605 40 22772 709
NM_130835chr352738 2618 2516 670 501 1393 22605 40 22772 709
NM_130836chr352738 2618 2516 670 501 1393 22605 40 22772 709
NM_130837chr352738 2618 2516 670 501 1393 22605 40 22772 709
NM_130838chr1521860 307 21504 526 ----
NM_130839chr1521860 307 21504 526 ----
NM_130846chr124847 794 213 109 1970 ----
NM_130847chr1175653 5299 5128 4150 3751 670 606 24859 1964 25417 108 --
NM_133170chr20167659 7070 6868 6772 6723 5934 5621 2593 1809 1578 1415 873 516 315 166 94 15423 11152 16342
NM_133265chrX62781 2694 2441 1006 689 245 22884 1027 ----
NM_133326chr1------1313
NM_133329chr211156 11581 2747 295 1551
NM_133334chr475720 5527 5486 4568 4472 4364 2087 35764 5224 1897 12027 36393 2319 1462
NM_133370chr443234 2761 2389 1248 13443 11319 --
NM_133372chr51241 12699 1108 1251
NM_133378chr22920 75 1282 ----
NM_133432chr22920 75 1282 ----
NM_133437chr22920 75 1282 ----
NM_133446chr10------1290
NM_133468chr73846 764 438 22034 29 1803 --
NM_133477chr422951 579 42872 2686 2435 1102 22330 2087 13246
NM_133478chr231560 1025 720 ----12312
NM_133493chr674147 3917 3888 3582 3348 1053 588 24576 94 33455 3070 1143 --
NM_133494chr11115 ------
NM_133496chr184113 3852 3469 2799 1695 1511 798 252 24399 401 12757 23362 1615
NM_133503chr122670 209 1503 ----
NM_133504chr122670 209 1503 ----
NM_133505chr122670 209 1503 ----
NM_133506chr122670 209 1503 ----
NM_133507chr122848 387 1681 1626 --
NM_133631chr311410 --21364 1104 11503
NM_133645chr63569 133 45 ------
NM_133646chr2115486 5382 5307 4788 3595 2137 1717 1528 1430 379 333 74844 4545 4464 3387 2104 1975 1285 21554 852 1874
NM_134265chr172187 114 --1997 --
NM_134442chr21708 --11185 --
NM_134447chr193510 211 174 193 --1153
NM_138285chr2----1401 --
NM_138316chr1031321 1272 468 31159 548 285 --1905
NM_138333chr962195 1670 594 446 103 86 42208 2082 1945 122 11775 --
NM_138370chr21735 ------
NM_138423chr1522290 2184 11733 ----
NM_138426chr752431 2272 2043 255 84 ------
NM_138437chrX1309 ------
NM_138444chr13104642 4555 3615 3240 3196 3115 1468 1284 563 527 1620 14542 34598 4189 1070
NM_138459chr6113670 3656 3125 2839 2585 1322 992 736 646 478 23 33338 1425 711 23059 2377 1748
NM_138468chr256003 2248 1278 1113 535 15874 76243 4133 2116 1898 1102 923 161 --
NM_138471chr111372 ------
NM_138473chr1271805 1228 1194 1003 953 743 194 44784 3916 2067 1208 --24269 1891
NM_138492chr531420 983 333 31116 439 103 --11210
NM_138494chr742867 2147 588 165 11031 12185 156
NM_138565chr111119 1180 11343 --
NM_138576chr1452974 1625 1591 861 295 33450 1661 447 11363 --
NM_138609chr5------1498
NM_138610chr5------1498
NM_138621chr234007 937 761 42902 1523 1221 594 ----
NM_138633chr61366 11562 31536 1325 380 --
NM_138635chr742957 2887 333 234 22907 2228 23091 3065 --
NM_138638chr1442247 1693 953 736 22184 1742 124 12267
NM_138694chr693673 3216 2629 2614 1421 1090 345 122 56 23579 2869 1467 --
NM_138713chr16147472 5558 3228 2775 2766 2544 2133 2108 1892 1714 1411 1207 1063 242 77600 6291 5984 3190 2661 2194 425 25296 805 16856
NM_138714chr16147472 5558 3228 2775 2766 2544 2133 2108 1892 1714 1411 1207 1063 242 77600 6291 5984 3190 2661 2194 425 25296 805 16856
NM_138730chr6----1328 --
NM_138731chr1494195 4187 4038 3892 1663 861 727 363 40 --1740 11614
NM_138735chr21555 ----2534 54
NM_138771chr711030 1530 --1448
NM_138779chr13294 42 1260 1277 --
NM_138782chr562100 1774 1762 842 551 116 1401 ----
NM_138799chr231691 1593 1354 --2559 342 1502
NM_138931chr31887 ------
NM_138959chr196283 6268 6093 5796 4639 4490 2702 591 209 24668 2279 25647 5605 12638
NM_138966chr181470 ------
NM_138969chr871375 1153 553 478 441 81 29 21214 161 2133 99 --
NM_138980chr4----1724 --
NM_138982chr4----1724 --
NM_139045chr91576 --1561 --
NM_139046chr10--1201 ----
NM_139048chr33455 159 152 --153 --
NM_139072chr23843 729 358 --1667 --
NM_139078chr12------137
NM_139126chr63720 612 240 ------
NM_139135chr11440 1252 ----
NM_139157chr11--1510 ----
NM_139160chr11------198
NM_139169chr1032165 1932 282 --142 --
NM_139241chr12--1199 ----
NM_139244chr61855 ------
NM_139279chr253559 2965 2791 1405 1119 33535 2784 1307 --23284 725
NM_139283chr1282590 2583 2358 1850 1754 1568 923 851 --22093 225 --
NM_139286chr92218 199 ------
NM_139312chr1021240 323 1216 ----
NM_139321chr2084265 3081 2675 1204 961 919 628 130 44250 3938 3809 3685 1446 1694
NM_139343chr2199 1438 ----
NM_139344chr2199 1438 ----
NM_139345chr2199 1438 ----
NM_139346chr2199 1438 ----
NM_139347chr2199 1438 ----
NM_139348chr2199 1438 ----
NM_139349chr2199 1438 ----
NM_139350chr2199 1438 ----
NM_139351chr2199 1438 ----
NM_144567chr132567 513 110 22701 134 ----
NM_144571chr476700 6228 5936 5589 2172 343 293 11412 15476 25741 567
NM_144574chr142167 159 ------
NM_144578chr1495562 4970 4692 3448 2043 1455 818 751 39 33946 3746 1240 24170 2129 15075
NM_144590chr1012629 31917 1130 455 21020 442 22636 2343
NM_144591chr102436 369 ------
NM_144599chr1544218 3881 3858 692 44981 2181 1480 834 11616 --
NM_144629chr23908 229 102 11084 1845 1814
NM_144632chr252232 2135 1810 1510 809 12336 ----
NM_144642chr321417 1380 --1565 --
NM_144643chr41383 ------
NM_144644chr4125 ------
NM_144660chr101357 ------
NM_144664chr1142546 924 217 197 21890 1687 ----
NM_144710chr211463 11351 31391 1127 247 1225
NM_144721chr432688 704 116 32635 537 157 2789 738 12790
NM_144728chr11833 1629 ----
NM_144729chr11833 1629 ----
NM_144767chr1563862 3098 1737 1376 1043 350 --11122 11571
NM_144770chr21--1108 ----
NM_144775chr1794912 4829 3931 3499 3217 3016 1222 272 197 24847 1235 ----
NM_144778chr1352425 2357 1722 1020 135 --1584 --
NM_144949chr232587 2558 272 1376 --11033
NM_144963chr862687 2432 1973 1693 924 153 1426 22398 947 --
NM_144969chrX2580 177 --1659 1139
NM_144973chr1295158 4804 4744 4601 4001 851 783 468 73 44295 4046 1231 689 45229 4490 560 172 15248
NM_144982chr121593 --2751 54 --
NM_145000chr51244 1425 ----
NM_145010chr1082233 2190 1937 1753 1443 635 102 40 32052 762 22 ----
NM_145020chr181144 ------
NM_145037chr351513 1425 1118 536 387 --2283 124 --
NM_145049chr52405 160 ----11017
NM_145055chr1833342 874 349 23808 3158 22655 755 --
NM_145117chr1142903 2082 1322 925 42667 2334 883 364 ----
NM_145165chr1482500 2404 2295 2287 2243 876 719 496 1474 22547 1106 1983
NM_145174chr2231397 446 146 --129 --
NM_145176chr653034 396 298 222 117 1131 12199 --
NM_145203chr132769 348 1790 --1830
NM_145204chr153637 603 28 --1250 --
NM_145235chr10--1137 ----
NM_145243chr1184 ------
NM_145259chr264787 2499 2449 1707 1499 966 57046 2103 1009 379 219 36228 5628 5601 15239
NM_145268chr73988 738 406 1349 --1247
NM_145274chr173941 626 357 --2767 228 181
NM_145284chrX61789 1648 1613 1570 377 195 22247 2084 --22394 2321
NM_145304chr73412 140 132 195 1126 --
NM_145305chrX21131 282 21061 903 1909 --
NM_145307chr1043634 3392 1833 1725 1474 24496 3277 13707
NM_145309chr1121351 69 11274 ----
NM_145330chr2----154 --
NM_145331chr62657 110 126 ----
NM_145649chr682697 2041 1789 906 790 525 390 201 22568 799 ----
NM_145655chr682697 2041 1789 906 790 525 390 201 22568 799 ----
NM_145698chr101716 22038 825 ----
NM_145725chr14----154 --
NM_145726chr14----154 --
NM_145733chr2211248 ------
NM_145735chr1342479 2290 2260 315 22545 955 12740 12716
NM_145753chr311477 11207 --11699
NM_145793chr10--1889 ----
NM_145808chr763021 2302 906 397 351 304 1954 ----
NM_145858chr212449 437 1171 150 1160
NM_145893chr1631527 747 329 11259 ----
NM_146387chr191228 ------
NM_147147chr684242 4199 3378 3361 1275 1094 909 394 33261 3125 1059 13077 --
NM_147150chr973887 3617 3137 2621 2525 1542 190 13310 ----
NM_147166chr71541 1721 1119 --
NM_147171chr71456 ------
NM_147181chr45569 445 380 262 159 11043 ----
NM_147182chr45569 445 380 262 159 11043 ----
NM_147183chr45569 445 380 262 159 11043 ----
NM_147185chr71456 ------
NM_147189chr832245 935 900 32206 1779 387 1945 12078
NM_147190chr12--1149 ----
NM_147233chr222107 897 175 1313 1763
NM_148174chr862183 2061 1593 902 648 473 1622 32023 1994 29 22236 2017
NM_148957chr1352236 1785 500 164 85 11863 2140 120 --
NM_148976chr11183 1194 ----
NM_148977chr1031321 1272 468 31159 548 285 --1905
NM_148978chr1031321 1272 468 31159 548 285 --1905
NM_152261chr1242257 1997 263 214 ----11561
NM_152263chr1105411 4478 3870 3859 3692 740 695 366 77 27 12353 ----
NM_152265chr141460 1023 543 160 --1470 --
NM_152277chr552023 1974 513 360 128 31631 792 693 --1232
NM_152284chr8--1656 ----
NM_152291chr4--1951 1890 --
NM_152305chr362137 1986 1526 1465 514 248 12110 12243 --
NM_152327chr14--276 63 ----
NM_152330chr1432369 694 310 ------
NM_152332chr1462697 2640 2019 1965 152 140 12722 ----
NM_152347chr172587 63 172 ----
NM_152380chr131339 453 276 2585 93 ----
NM_152387chr21228 31078 744 733 1717 --
NM_152388chr2103496 3307 3031 2978 2789 2702 1296 1243 796 642 34064 558 455 --13257
NM_152391chr211028 ------
NM_152400chr421562 196 21666 1439 1688 --
NM_152402chr41148 186 ----
NM_152407chr543162 2627 2039 647 --2273 202 --
NM_152414chr83636 516 371 11107 ----
NM_152422chr931417 241 112 2531 200 21887 152 --
NM_152423chrX61363 1130 998 445 242 122 1579 11332 11274
NM_152437chr1282450 2388 1674 521 466 198 184 122 11683 21935 1792 --
NM_152450chr151717 2346 256 ----
NM_152457chr16----1223 --
NM_152512chr222626 404 ----1234
NM_152519chr261959 1684 1479 844 792 67 2833 164 1597 --
NM_152529chr263520 1747 1683 1650 553 103 --33909 1698 311 --
NM_152542chr43533 383 358 22075 1971 2643 346 --
NM_152546chr521130 1054 --1246 --
NM_152556chr752138 2090 1829 598 521 31953 1928 846 ----
NM_152594chr154672 622 573 345 1477 21913 1536 --
NM_152605chr1911203 11043 ----
NM_152608chr131675 469 175 22030 167 11763 --
NM_152622chr563517 3099 3024 2224 387 90 13332 1794 22774 1110
NM_152624chr5126222 5597 5020 4846 2958 2951 2850 1627 1230 533 121 52 37309 1837 569 37374 5646 5218 --
NM_152629chr963604 3257 1468 1256 1244 1177 ----13177
NM_152638chr1261174 913 819 312 152 42 1341 1251 --
NM_152641chr124603 441 269 160 --1976 12231
NM_152665chr13920 133 42 134 ----
NM_152666chr11130 1667 ----
NM_152680chr462302 1881 1839 1818 1696 240 1877 11591 --
NM_152682chr441787 1516 1285 1188 1549 1506 --
NM_152685chr51400 ------
NM_152695chrX31923 923 204 1861 22103 2047 --
NM_152699chr383150 2596 1359 1311 1178 606 557 28 43768 2585 417 328 13293 1943
NM_152705chr1331314 1001 550 ----11368
NM_152736chr63818 757 314 3885 868 697 2743 719 --
NM_152740chr71747 ------
NM_152753chr661786 1468 1439 1363 1332 559 ------
NM_152754chr773763 2765 1520 1507 1202 1050 322 --43473 1030 177 129 --
NM_152756chr534134 2635 375 23994 2984 11271 --
NM_152758chr892687 2390 2276 1927 1227 723 435 323 115 32504 1001 53 32949 1877 1099 1577
NM_152765chr821931 633 2695 225 1686 21953 1513
NM_152774chr742149 1835 1024 307 22757 409 21717 992 --
NM_152787chrX63723 2913 2732 2537 2483 352 21210 428 ----
NM_152793chr7144867 4802 4236 3913 3735 3646 3506 1376 1321 868 695 339 253 109 14348 14495 13988
NM_152829chr71199 ----176
NM_152835chr171824 1095 955 874 717 669 493 62849 2472 2138 908 385 294 1886 11102
NM_152836chr831752 1442 390 ----1533
NM_152837chr831752 1442 390 ----1533
NM_152838chr2022852 1332 23338 2378 2880 209 12400
NM_152857chr64823 738 375 312 ------
NM_152858chr64823 738 375 312 ------
NM_152862chr21367 ------
NM_152889chr3--1689 ----
NM_152896chr91108 ----1793
NM_152902chr151432 1287 1258 217 35 21925 559 ----
NM_152910chr132367 195 --1506 --
NM_152919chr1943657 2320 1404 259 --2421 49 23605 392
NM_152924chr15156892 6307 5790 5739 5142 5099 4658 4477 2431 1481 1169 923 321 272 101 56649 6599 6236 1329 42 26066 1285 11504
NM_152995chr41849 ----161
NM_152998chr71242 298 31 ----
NM_152999chr764697 4622 3498 3382 624 390 35007 4731 3720 23204 529 --
NM_153000chr183435 190 176 1418 ----
NM_153013chr562408 2207 2006 1562 618 398 2594 442 --22311 322
NM_153035chr132887 2551 937 13072 32591 649 539 32459 2178 1005
NM_153042chr641684 1175 289 241 11557 21755 50 --
NM_153050chr2255014 3396 1810 1669 1135 25059 4349 44467 4421 3852 1634 1391
NM_153051chr2255014 3396 1810 1669 1135 25059 4349 44467 4421 3852 1634 1391
NM_153181chr181470 ------
NM_153182chr363362 3310 3150 2499 2106 1225 12088 --11046
NM_153183chrX21139 956 136 21004 945 --
NM_153188chr545396 4466 3896 801 14812 23658 216 --
NM_153201chr11----150 --
NM_153207chr1273684 3472 3342 2919 2726 2691 842 33828 1129 772 2792 454 22974 2956
NM_153208chr16--1796 ----
NM_153223chr52256 150 1495 21330 400 --
NM_153226chr102269 136 1764 --178
NM_153235chr652034 1928 1829 1757 318 12198 1191 --
NM_153261chr1631497 1488 1061 11344 ----
NM_153262chr152283 2260 1080 955 98 33157 2344 2057 22029 277 --
NM_153267chr93808 664 653 ----1935
NM_153280chrX--1167 ----
NM_153332chr843173 2872 2598 2075 42852 2453 2156 785 1769 --
NM_153354chr5--21000 318 ----
NM_153361chr51113 ------
NM_153371chr1331481 878 484 42135 1930 1684 52 11578 --
NM_153456chr13105525 5338 5230 4841 3986 1706 1442 1057 100 91 25545 578 66111 5490 5366 4870 1673 528 --
NM_153607chr562709 2502 2463 2191 739 340 23017 1254 ----
NM_153613chr15185 ------
NM_153616chr1522042 239 21915 735 ----
NM_153617chr1522042 239 21915 735 ----
NM_153618chr1522042 239 21915 735 ----
NM_153645chr2293296 3016 2958 2679 1231 1160 1028 526 378 33004 2471 1082 22487 224 11037
NM_153688chr1611421 ----1409
NM_153713chr1------1201
NM_153757chr441203 275 198 185 1331 ----
NM_153809chr91617 1641 ----
NM_153810chr1075064 4511 4443 1829 1193 1076 299 44597 4553 1857 215 23503 1064 13862
NM_153816chr61360 2320 112 ----
NM_153825chr441231 1107 139 91 21114 322 1538 132
NM_153831chr83132 121 38 1959 ----
NM_170606chr731822 1609 1477 1118 --11304
NM_170709chr81957 2921 487 ----
NM_170710chr442967 2423 2334 1166 12314 2617 401 12551
NM_170731chr1111764 32273 2227 925 22214 384 --
NM_170732chr1111764 32273 2227 925 22214 384 --
NM_170733chr1111764 32273 2227 925 22214 384 --
NM_170734chr1111764 32273 2227 925 22214 384 --
NM_170735chr1111764 32273 2227 925 22214 384 --
NM_170739chr111234 ------
NM_170774chr2094213 4151 4112 4017 2849 2641 1242 617 23 --1401 12909
NM_170782chr11433 ------
NM_171998chrX2942 352 22026 853 --21735 791
NM_172037chr82959 554 31225 524 511 ----
NM_172069chr221613 147 1845 ----
NM_172070chr21350 11780 1193 --
NM_172071chr1126981 6638 5470 5136 2836 2686 2114 1701 1666 1118 975 717 15410 57004 5991 5207 981 886 17057
NM_172103chr62395 338 12680 1430 12585
NM_172105chr62395 338 12680 1430 12585
NM_172110chr203514 432 214 1179 ----
NM_172111chr203514 432 214 1179 ----
NM_172112chr203514 432 214 1179 ----
NM_172113chr203514 432 214 1179 ----
NM_172159chr361875 1809 1683 1521 953 85 12038 11458 21613 173
NM_172160chr361875 1809 1683 1521 953 85 12038 11458 21613 173
NM_172193chr142839 300 21130 233 ----
NM_172344chr211156 11581 2747 295 1551
NM_173060chr5121729 1254 805 637 497 487 288 229 191 141 68 24 11364 --11646
NM_173061chr5121729 1254 805 637 497 487 288 229 191 141 68 24 11364 --11646
NM_173063chr5121729 1254 805 637 497 487 288 229 191 141 68 24 11364 --11646
NM_173083chr1----1270 11178
NM_173087chr15--1507 ----
NM_173088chr15--1507 ----
NM_173089chr15--1507 ----
NM_173090chr15--1507 ----
NM_173156chr111927 21759 1750 ----
NM_173165chr16----1364 --
NM_173198chr931924 976 757 22963 2004 12360 --
NM_173200chr931924 976 757 22963 2004 12360 --
NM_173214chr16147472 5558 3228 2775 2766 2544 2133 2108 1892 1714 1411 1207 1063 242 77600 6291 5984 3190 2661 2194 425 25296 805 16856
NM_173359chr371926 1868 1850 1741 1490 1187 432 --11281 --
NM_173468chr4175671 5610 5276 5093 4823 4773 4482 4249 3942 3820 1973 1915 1237 986 875 551 404 45342 4473 1576 977 35545 4737 86 --
NM_173473chr1012257 1703 12651 --
NM_173475chr161261 --31494 535 230 1133
NM_173491chr561160 526 472 279 235 86 11327 --11219
NM_173500chr1521089 999 2288 24 ----
NM_173508chr131073 339 320 11114 --11263
NM_173511chr223402 803 31285 455 138 --12708
NM_173519chr841957 343 308 160 1376 1705 --
NM_173526chr14----177 --
NM_173531chr1943468 2541 632 547 31014 996 190 ----
NM_173550chr9157 ------
NM_173552chr352368 1973 1522 392 303 1484 12435 176
NM_173557chr182522 201 --1582 --
NM_173560chr61425 ------
NM_173576chr1032156 1558 560 --21913 730 --
NM_173582chr1195951 5439 4566 2453 1933 1003 987 978 104 44836 3921 1558 177 25159 959 24365 520
NM_173591chr121409 --11027 1766
NM_173602chr1283749 2955 2944 1344 1242 1198 361 35 42862 2306 1266 1060 33712 1361 595 --
NM_173607chr1431936 647 507 1328 --2179 124
NM_173609chr15--1656 ----
NM_173642chr1148852 8180 7814 6451 5810 5570 3647 3230 3124 2660 2599 1380 669 116 37776 3514 2130 26465 73 --
NM_173654chr342236 1632 903 536 12065 32393 2197 1768 22078 1502
NM_173694chrX31625 888 706 --12212 1964
NM_173698chrX21847 64 4827 315 225 183 --1752
NM_173808chr174495 3722 3580 3134 1701 1477 65 84432 4407 3967 3465 3330 1177 239 40 23777 3313 33026 1152 685
NM_173812chr122610 389 21022 421 ----
NM_173825chr343088 2790 2609 1116 --12952 12093
NM_173826chr351717 1372 1292 1203 74 21082 565 ----
NM_173829chr565121 5076 3995 3755 2077 968 35507 5452 1777 ----
NM_173851chr8113803 3272 2827 2820 2806 2594 1590 1579 1277 524 31 23251 1006 1343 --
NM_173872chr41344 ------
NM_174890chr101676 1745 ----
NM_174902chr112516 483 31193 677 618 --11270
NM_174911chr863004 2906 1361 697 309 109 ----13850
NM_174921chr43377 343 208 ------
NM_175056chr382176 1832 1653 1639 1560 544 76 25 ----11550
NM_175061chr721475 653 42108 1542 850 55 11665 --
NM_175085chr212611 141 ----1546
NM_175605chr13--1224 ----
NM_175607chr32185 62 1420 --1392
NM_175610chr152336 130 ----1922
NM_175612chr32185 62 1420 --1392
NM_175623chr12127653 7291 6934 6770 6195 6016 5650 2853 1529 1352 1195 400 55415 1694 1551 1003 524 1494 --
NM_175634chr81280 ------
NM_175635chr81280 ------
NM_175636chr81280 ------
NM_175767chr541858 1785 1515 407 11424 --11595
NM_175854chr1341830 931 662 328 22028 1978 11693 --
NM_175856chr51253 1291 ----
NM_175861chr1285748 5510 4653 3833 2310 2163 2069 1195 54497 3692 926 221 47 35488 5329 1756 --
NM_175863chr6----1166 --
NM_175873chr54940 432 198 168 11450 --11119
NM_175876chr1--22066 253 1877 12774
NM_175907chr1852550 679 600 554 313 32430 1017 363 --12290
NM_175920chr53687 265 170 1563 ----
NM_176081chr1095439 5321 4652 4487 3738 3693 1540 729 76 25977 64 35672 4914 638 --
NM_176083chr1095439 5321 4652 4487 3738 3693 1540 729 76 25977 64 35672 4914 638 --
NM_176814chr71976 1590 1437 --
NM_176824chr42397 124 11175 11274 --
NM_177414chr11292 11467 ----
NM_177424chr121685 615 1503 2580 469 1378
NM_177438chr1424084 1618 --23637 1665 23543 3002
NM_177452chr1472281 2169 2069 2059 2025 918 865 11645 ----
NM_177947chrX1101 41487 1384 490 196 1457 --
NM_177948chrX1101 41487 1384 490 196 1457 --
NM_177952chr142833 194 ------
NM_177966chr331847 1728 1182 31822 1355 30 1688 --
NM_177968chr231408 1366 477 41794 691 339 36 ----
NM_177969chr2--1612 192 --
NM_177972chr1154469 4423 3025 2976 674 23339 1002 --11705
NM_177974chr1522290 2184 11733 ----
NM_177985chr221483 301 11580 21917 1448 1148
NM_177988chr31319 --1325 --
NM_177990chr203750 602 541 11375 ----
NM_177995chr931417 241 112 2531 200 21887 152 --
NM_177996chr2073217 3165 1025 935 782 624 75 1810 23180 257 12164
NM_178009chr131158 --1469 --
NM_178011chr1033184 2931 2748 12671 --12657
NM_178037chr1243363 1448 999 613 23439 2777 --13348
NM_178038chr1243363 1448 999 613 23439 2777 --13348
NM_178039chr1242998 1083 634 248 23074 2412 --12983
NM_178040chr1242998 1083 634 248 23074 2412 --12983
NM_178123chr221040 304 ------
NM_178140chr572580 2386 1759 1708 936 842 394 --12153 1306
NM_178151chrX117900 7222 7036 6330 5941 5071 4891 2372 2298 908 449 57508 6946 5268 1559 132 16544 27362 1381
NM_178152chrX117900 7222 7036 6330 5941 5071 4891 2372 2298 908 449 57508 6946 5268 1559 132 16544 27362 1381
NM_178153chrX117900 7222 7036 6330 5941 5071 4891 2372 2298 908 449 57508 6946 5268 1559 132 16544 27362 1381
NM_178190chr1--173 ----
NM_178191chr111144 11414 --11172
NM_178313chr242122 2051 1949 1706 1547 ----
NM_178326chr21417 31565 61 45 ----
NM_178423chr741089 822 302 140 21165 859 ----
NM_178424chr52180 116 1440 ----
NM_178425chr741089 822 302 140 21165 859 ----
NM_178426chr152387 2243 518 482 330 2605 324 12358 --
NM_178427chr152287 2143 418 382 230 2505 224 12258 1879
NM_178439chr2--169 ----
NM_178450chr51269 --1573 --
NM_178496chr31449 2558 160 ----
NM_178509chr1754105 2727 593 399 133 2236 68 23617 1438 13886
NM_178539chr1221360 264 --3625 252 216 21938 1669
NM_178566chr9--31574 1460 1303 ----
NM_178584chr211463 11351 31391 1127 247 1225
NM_178585chr462758 2721 2506 527 395 120 12597 13190 --
NM_178586chr1411831 2716 434 ----
NM_178812chr811410 --1414 --
NM_178815chr1011059 32512 311 116 1981 22704 716
NM_180989chr1352028 1600 1570 478 213 22162 189 22490 709 --
NM_181077chr15--12093 195 --
NM_181265chr442967 2423 2334 1166 12314 2617 401 12551
NM_181302chr142167 159 ------
NM_181308chr142167 159 ------
NM_181332chrX12044 41745 1000 706 363 22376 1787 --
NM_181349chr752913 2333 1965 1946 447 22647 613 ----
NM_181351chr1162838 2593 1872 1086 973 487 22125 957 ----
NM_181354chr821478 685 11426 ----
NM_181358chr153932 3887 3524 449 307 24036 321 ----
NM_181443chr2062554 2290 1143 356 312 45 2857 447 --22326 1058
NM_181453chr241594 1285 1236 326 21617 283 ----
NM_181457chr2155 ------
NM_181481chr1896094 5934 5414 4864 4649 1927 316 282 198 46322 6185 2740 2159 16788 --
NM_181482chr1896094 5934 5414 4864 4649 1927 316 282 198 46322 6185 2740 2159 16788 --
NM_181483chr1896094 5934 5414 4864 4649 1927 316 282 198 46322 6185 2740 2159 16788 --
NM_181489chr395063 2085 1808 1450 1325 1198 809 299 223 14090 36589 2525 1204 1144
NM_181504chr563289 2999 2775 384 354 80 24215 55 --11648
NM_181523chr563289 2999 2775 384 354 80 24215 55 --11648
NM_181524chr563289 2999 2775 384 354 80 24215 55 --11648
NM_181552chr71791 1784 ----
NM_181659chr2062277 929 501 403 276 150 1902 22934 2876 --
NM_181659chr2062277 929 501 403 276 150 1902 22934 2876 --
NM_181670chr1241430 1313 1125 109 ------
NM_181671chr173813 750 592 1852 2308 26 --
NM_181672chrX61601 766 580 490 352 258 31750 1548 251 ----
NM_181673chrX61601 766 580 490 352 258 31750 1548 251 ----
NM_181674chr52397 83 ------
NM_181675chr52397 83 ------
NM_181676chr52397 83 ------
NM_181677chr52397 83 ------
NM_181678chr52397 83 ------
NM_181705chr585481 4562 3783 3575 3560 994 320 301 44836 4643 2198 593 --25101 1098
NM_181782chr61809 31750 524 164 ----
NM_181787chr853436 3067 1503 707 427 --1323 1100
NM_181809chr153391 3243 1530 322 262 34065 4038 3840 143 --
NM_181836chr522220 2197 32640 2451 1968 12247 11724
NM_181838chr521397 79 152 ----
NM_181861chr122408 43 22754 1818 ----
NM_181868chr122408 43 22754 1818 ----
NM_181869chr122493 128 22839 1903 ----
NM_181897chr362378 2355 1906 1898 715 155 22649 423 ----
NM_182488chr131323 --1742 1825
NM_182493chr1695192 5138 4727 4718 4070 3296 1289 882 230 44037 3724 745 689 --15362
NM_182501chr263189 3026 2861 2075 1119 319 ------
NM_182503chr6105092 3676 3610 3498 3383 1934 1221 1193 957 176 15468 23449 650 21382 894
NM_182515chr19126448 6403 6382 6218 6135 6017 5931 5427 4378 1209 1117 434 45959 5587 1619 1589 2510 41 --
NM_182522chr351315 1256 392 235 222 --1989 --
NM_182524chr41707 ------
NM_182551chr273538 2992 2653 2607 1223 687 184 32939 880 675 --1346
NM_182643chr852238 1534 1492 582 143 1268 12255 --
NM_182648chr14----128 --
NM_182649chr201298 ------
NM_182662chr4--1487 ----
NM_182687chr16----1224 --
NM_182715chr711101 1899 --1204
NM_182717chr1031321 452 311 1129 11016 11128
NM_182720chr1031321 452 311 1129 11016 11128
NM_182721chr1031321 452 311 1129 11016 11128
NM_182722chr1031321 452 311 1129 11016 11128
NM_182723chr1031321 452 311 1129 11016 11128
NM_182752chr111495 ------
NM_182757chr673485 2994 1304 840 409 334 128 33344 3331 104 13432 --
NM_182762chr785301 5105 4549 4421 2296 609 413 389 15076 25706 4952 14412
NM_182763chr162251 1119 1104 932 901 764 3966 717 193 --12004
NM_182796chr52353 269 ------
NM_182797chr2051408 681 361 158 68 --11685 1135
NM_182830chr1442283 2112 2037 277 1290 32195 2141 1530 --
NM_182848chr1321510 556 11293 1120 1418
NM_182853chr1031321 452 311 1129 11016 11128
NM_182896chr361822 1412 1377 1177 490 138 21657 1467 --2564 381
NM_182898chr776285 5143 5115 4796 4297 2347 1635 26127 2416 44601 4101 4030 1832 14570
NM_182899chr776285 5143 5115 4796 4297 2347 1635 26127 2416 44601 4101 4030 1832 14570
NM_182907chr631951 442 278 31645 570 135 1637 --
NM_182931chr73584 255 244 ------
NM_182943chr341049 487 189 66 1264 --1142
NM_182944chr14----1362 --
NM_182948chr152687 2670 2661 2074 506 --42762 2528 368 23 12441
NM_182964chr1142903 2082 1322 925 42667 2334 883 364 ----
NM_182972chr152290 2236 1974 569 143 1912 ----
NM_182975chr1--1969 ----
NM_182976chr12825 740 ------
NM_182977chr541016 801 708 389 1382 --1457
NM_183004chr1483925 2796 2680 1564 1226 700 538 324 22469 235 13372 23720 647
NM_183011chr1031321 452 311 1129 11016 11128
NM_183012chr1031321 452 311 1129 11016 11128
NM_183013chr1031321 452 311 1129 11016 11128
NM_183043chr131120 1813 ----
NM_183044chr131120 1813 ----
NM_183050chr622215 1505 42373 2254 2037 218 ----
NM_183078chr6123406 3233 2809 2737 2665 2559 2524 1207 832 690 296 181 43326 1544 1343 822 1666 --
NM_183079chr2021576 1071 21489 332 31349 1139 272 --
NM_183234chr1521331 729 --21737 424 --
NM_183235chr1521331 729 --21737 424 --
NM_183236chr1521331 729 --21737 424 --
NM_183238chr1273601 3521 2984 2761 2473 1141 448 --23831 2913 --
NM_183376chr1542607 2223 1944 1631 22415 2365 ----
NM_183380chr6153 1384 --1887
NM_183381chr35997 647 625 153 60 ----1841
NM_183383chr35997 647 625 153 60 ----1841
NM_183384chr35997 647 625 153 60 ----1841
NM_183416chr171673 762 744 657 397 343 64 2239 203 ----
NM_183419chr811392 --1228 --
NM_183422chr131744 1931 --2856 267
NM_194247chr233213 1621 1311 33973 978 919 21009 860 --
NM_194250chr2--1133 ----
NM_194271chr121488 ------
NM_194282chr432968 2787 2477 42552 2491 522 72 22467 730 --
NM_194283chr533474 603 347 144 31590 658 207 13944
NM_194285chr1143215 2254 554 150 33106 900 334 12362 1820
NM_194286chr1285624 5551 5224 4155 4043 2291 2111 1204 25990 459 ----
NM_194291chr862955 2904 2256 2033 1027 728 32596 937 790 22146 1013 --
NM_194314chr145546 4207 2129 1804 --31690 499 198 --
NM_194318chr1342312 2132 1738 1678 22181 1009 1994 --
NM_194328chr942944 1033 1024 562 11225 23197 924 22895 2856
NM_194329chr942944 1033 1024 562 11225 23197 924 22895 2856
NM_194330chr942944 1033 1024 562 11225 23197 924 22895 2856
NM_194332chr942944 1033 1024 562 11225 23197 924 22895 2856
NM_194356chr1232167 888 790 22366 1678 12235 --
NM_194434chr18105741 5121 4952 4658 4376 4097 2024 1510 1472 905 1930 11950 --
NM_194439chr451263 1245 311 303 174 11150 1960 1125
NM_194463chrX11031 2987 882 --21209 435
NM_197941chr552796 2160 900 622 522 ------
NM_197968chr131237 ------
NM_197970chr22386 167 11352 1600 --
NM_198057chrX3937 865 196 ----11021
NM_198066chr1442930 2670 1993 557 12827 32833 1216 809 --
NM_198081chr652336 2028 476 334 162 31000 506 463 1579 --
NM_198086chr14102218 2097 1887 1472 829 746 280 273 235 65 32178 1873 811 1725 --
NM_198087chr164292 243 67 25 --1304 1415
NM_198088chr164292 243 67 25 --1304 1415
NM_198120chr81550 --1510 --
NM_198128chr1852332 677 552 381 289 1316 1413 12081
NM_198158chr342664 920 332 271 32840 758 661 ----
NM_198159chr342664 920 332 271 32840 758 661 ----
NM_198177chr342664 920 332 271 32840 758 661 ----
NM_198178chr342664 920 332 271 32840 758 661 ----
NM_198181chr1541853 1149 842 320 21926 574 22220 80 --
NM_198212chr742193 2053 1833 1692 --12074 --
NM_198225chr1031848 1239 47 ----11551
NM_198240chr1241316 1151 1084 243 --21171 501 --
NM_198252chr91234 ------
NM_198256chr272020 1963 1740 1391 593 489 72 --11288 21546 194
NM_198261chr121510 ------
NM_198262chr121510 ------
NM_198268chr153932 3887 3524 449 307 24036 321 ----
NM_198269chr153932 3887 3524 449 307 24036 321 ----
NM_198270chrX52178 2125 901 636 384 ----22797 2279
NM_198273chr552366 2141 2055 428 197 33151 1945 144 23008 2122 2754 46
NM_198279chrX3500 375 281 ----1788
NM_198329chr341562 1468 1155 305 21342 135 ----
NM_198336chr731735 1684 1455 11488 11789 --
NM_198395chr53983 439 427 21253 402 ----
NM_198465chrX1871 --22439 1943 32960 2563 2243
NM_198467chr71548 169 ----
NM_198468chr684079 3878 3413 3392 1330 1120 906 579 33288 796 272 ----
NM_198484chr366088 4666 4559 2143 1484 365 15673 11146 --
NM_198489chr111118 ------
NM_198503chr152181 1822 972 598 252 1152 22033 195 1220
NM_198504chr34960 744 650 178 ------
NM_198512chrX--1571 ----
NM_198513chr8--11317 2721 224 --
NM_198549chr142670 2654 2563 25 --1549 12643
NM_198555chr2--1118 --132
NM_198569chr642616 2072 757 433 --1378 12164
NM_198581chr2117546 6234 5903 5878 5588 3008 2380 2152 2135 1641 1236 --1577 --
NM_198584chr8--32339 2185 1076 ----
NM_198595chr434176 3590 134 44754 3556 950 261 ----
NM_198700chr111500 ------
NM_198793chr363882 3401 1422 1409 953 783 24040 3505 33794 983 911 --
NM_198859chr385086 4581 3640 1779 1419 1104 950 529 24641 4630 45175 4099 1331 1209 23346 1167
NM_198904chr531884 407 189 --21773 107 --
NM_198935chr2022249 1216 22313 1017 --32961 2746 2348
NM_198968chr1383116 3048 2554 1578 1199 1156 856 359 23011 2683 ----
NM_198991chr18--1833 ----
NM_198992chr123503 448 166 ----193
NM_199003chr821425 376 1264 ----
NM_199005chr92247 235 2711 222 1977 --
NM_199040chr1262831 764 591 307 100 78 22998 2965 --11161
NM_199053chr43756 703 281 ----1226
NM_199072chr752932 2370 2081 1094 864 42873 2798 1258 139 22900 2147 --
NM_199144chr2031453 1169 1060 21475 631 --1185
NM_199168chr1031025 988 142 --21301 383 1949
NM_199188chr1243594 3475 2924 399 23703 631 --1588
NM_199189chr52771 763 ----1406
NM_199190chr1243594 3475 2924 399 23703 631 --1588
NM_199203chr2031453 1169 1060 21475 631 --1185
NM_199229chr251699 1337 1077 665 244 21223 359 ----
NM_199246chr531245 1112 34 --1186 --
NM_199280chr21106 ------
NM_199320chr43960 855 522 32855 2657 1812 ----
NM_199320chr43960 855 522 32855 2657 1812 ----
NM_199324chr473568 2570 1496 1233 678 411 54 22276 815 13694 --
NM_199327chr411111 ------
NM_199328chr2121126 878 --1816 11150
NM_199418chr112505 109 ------
NM_199421chr1484383 3495 1988 1483 929 683 648 639 1812 45078 4651 1032 347 1319
NM_199461chr1053006 1107 1054 478 418 1139 11428 11404
NM_199482chr251860 1834 1529 1362 1312 32107 1849 1623 ----
NM_201263chr141388 788 691 584 32092 1553 609 11462 --
NM_201266chr222472 25 22311 1152 ----
NM_201269chr12981 32 ----21245 50
NM_201279chr222472 25 22311 1152 ----
NM_201432chr1796565 5444 5158 4213 1809 1294 1204 538 220 34750 718 264 22236 2009 --
NM_201433chr1796565 5444 5158 4213 1809 1294 1204 538 220 34750 718 264 22236 2009 --
NM_201437chr81529 11461 127 --
NM_201438chr121325 ------
NM_201559chr653959 3790 1145 744 413 13931 34702 3605 3274 --
NM_201568chr111927 21759 1750 ----
NM_201569chr111927 21759 1750 ----
NM_201570chr103810 414 38 ------
NM_201571chr103810 414 38 ------
NM_201572chr103810 414 38 ------
NM_201590chr103810 414 38 ------
NM_201591chr421398 510 31905 367 234 131 --
NM_201592chr421398 510 31905 367 234 131 --
NM_201593chr103810 414 38 ------
NM_201595chr14--166 ----
NM_201596chr103810 414 38 ------
NM_201597chr103810 414 38 ------
NM_201624chr121132 872 ------
NM_201999chr411016 11104 11046 --
NM_203283chr4------1162
NM_203284chr4------1162
NM_203291chr18--1240 ----
NM_203292chr18--1233 ----
NM_203327chr2084260 3672 2782 1501 1076 665 578 415 --1254 --
NM_203342chr162646 1194 970 718 701 192 23392 1255 ----
NM_203343chr162646 1194 970 718 701 192 23392 1255 ----
NM_203351chr1782450 2388 2208 1740 1551 924 793 423 12011 12022 --
NM_203354chr142292 215 ------
NM_203355chr142292 215 ------
NM_203356chr142292 215 ------
NM_203364chr1121039 158 1374 1805 --
NM_203372chr241622 1130 533 258 --11300 --
NM_203391chrX41253 653 513 374 21807 580 ----
NM_203417chr21--11308 ----
NM_203418chr21--11308 ----
NM_203437chr21229 2914 316 ----
NM_203446chr2152019 1857 1116 942 353 --166 --
NM_203458chr143646 3137 2551 1199 31454 1166 250 ----
NM_203463chr264553 4299 3316 777 612 132 54751 4438 1232 638 494 13589 --
NM_203488chr141335 ------
NM_203504chr442024 1844 1739 491 11960 ----
NM_203505chr442024 1844 1739 491 11960 ----
NM_205842chr21280 2767 315 --1247
NM_205846chr531420 983 333 31116 439 103 --11210
NM_205860chr163005 2391 683 500 407 93 ------
NM_206594chr131261 966 825 ----1401
NM_206595chr131261 966 825 ----1401
NM_206819chr12----1324 --
NM_206820chr12----1324 --
NM_206821chr12----1324 --
NM_206853chr643035 2683 2602 1306 33822 1171 555 32852 1501 42 1664
NM_206854chr644296 3944 3863 3480 25083 1816 34113 1303 106 21925 226
NM_206855chr685261 4909 4828 4445 400 330 268 247 36048 146 44 35078 2268 1071 11191
NM_206860chr101143 ------
NM_206861chr101143 ------
NM_206862chr101143 ------
NM_206866chr2142955 993 737 401 53009 2694 2543 2078 427 1859 11113
NM_206876chr222999 91 --33457 2811 2577 --
NM_206907chr532048 1089 473 22466 300 --22552 2140
NM_206909chr8168201 7344 7088 7072 6759 6476 6048 5924 5681 3073 2742 2504 2359 2320 1334 710 48032 7983 3089 2590 26463 2941 25993 1104
NM_206927chr112901 53 --2229 68 --
NM_206928chr112901 53 --2229 68 --
NM_206929chr112901 53 --2229 68 --
NM_206930chr112901 53 --2229 68 --
NM_206937chr132967 36 ----1999
NM_206938chr1121837 1766 1458 --11882
NM_206939chr1121837 1766 1458 --11882
NM_206940chr1121837 1766 1458 --11882
NM_206944chr92679 180 ------
NM_206945chr92679 180 ------
NM_206946chr92679 180 ------
NM_206947chr92679 180 ------
NM_207015chr34501 312 262 204 3948 874 700 --12192
NM_207033chr2021375 1072 --1521 --
NM_207034chr2021375 1072 --1521 --
NM_207123chr4263 24 1691 1179 --
NM_207303chr1043967 3068 1589 1181 54040 2604 1457 559 258 12704 13570
NM_207304chr1352312 2244 1609 907 22 --1471 --
NM_207330chr4--1206 --1165
NM_207344chr121338 153 11401 --
NM_207352chr411797 1214 --11076
NM_207366chr751714 1562 1431 815 83 123 22186 899 --
NM_207372chr1051820 1635 768 666 50 32422 2195 95 ----
NM_207406chr4136249 5819 4967 4893 4885 4864 2586 2370 2006 1217 648 640 228 66101 4206 2053 1360 966 297 15695 15047
NM_207413chr8----143 --
NM_207445chr153627 266 102 21804 1633 2345 259 --
NM_207481chr251468 1075 1041 525 111 ------
NM_207578chr1267 59 ------
NM_207647chr932329 2290 1632 52617 2225 1754 1038 758 22553 1583 12157
NM_207660chr14--2536 91 1143 11628
NM_207661chr14--2536 91 1143 11628
NM_207662chr14--2536 91 1143 11628
NM_212460chr751646 1639 482 291 48 21380 550 ----
NM_212465chr15--1507 ----
NM_212471chr1752227 1924 1805 1622 839 2710 666 --11583
NM_212472chr1752227 1924 1805 1622 839 2710 666 --11583
NM_212474chr22713 119 1331 --1779
NM_212475chr22713 119 1331 --1779
NM_212476chr22713 119 1331 --1779
NM_212478chr22713 119 1331 --1779
NM_212482chr22713 119 1331 --1779
NM_212539chr31405 ------
NM_212554chr101462 21603 1292 --2317 59
NM_212558chr974186 3527 2941 2717 1265 606 407 23402 3192 --3928 800 732
NM_213589chr255440 4000 2233 1156 815 ----24299 265
NM_213609chr3--2335 42 1275 1302
NM_213611chr12180 ------
NM_213618chr11--1510 ----
NM_213651chr141376 564 403 52 31634 1618 208 11354 2701 279
NM_213654chr3137 --21248 462 --