TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3960
miRNA Sequence: GGCGGCGGCGGAGGCGGGGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000068chr19----164 --
NM_000076chr11139 ------
NM_000080chr17----167 --
NM_000088chr17----11108 --
NM_000135chr161351 --1752 --
NM_000138chr15--12003 ----
NM_000147chr1131 ------
NM_000214chr20--1183 123 --
NM_000217chr121725 ------
NM_000228chr1----139 --
NM_000238chr7150 ------
NM_000242chr1012650 ------
NM_000314chr101636 ------
NM_000362chr2222568 42 ------
NM_000425chrX2641 184 --1594 --
NM_000430chr17--12995 13045 --
NM_000461chr344026 3382 3293 3131 ------
NM_000495chrX1101 ------
NM_000555chrX15491 14981 ----
NM_000609chr1022383 902 ------
NM_000618chr12----16058 --
NM_000618chr12----16058 --
NM_000625chr17128 ------
NM_000756chr8182 ------
NM_000831chr11567 ----1320
NM_000833chr1611092 ------
NM_000834chr121223 ------
NM_000841chr63855 818 785 ------
NM_000875chr1536124 2060 579 --14819 --
NM_000918chr173314 105 26 ------
NM_000939chr2----180 --
NM_000944chr411568 ------
NM_000960chr192506 154 ------
NM_000966chr1221054 24 ------
NM_001001331chr3----146 --
NM_001001438chr211255 ------
NM_001001549chr722155 554 11109 ----
NM_001001550chr722155 554 11109 ----
NM_001001555chr722155 554 11109 ----
NM_001001890chr213265 198 86 --3204 201 40 --
NM_001002860chr1412977 ------
NM_001003407chr1045021 5009 1813 430 1372 1107 --
NM_001003408chr1045021 5009 1813 430 1372 1107 --
NM_001003652chr1823229 394 ------
NM_001003800chr9--125 ----
NM_001003809chr18166 --4330 242 26 23 --
NM_001004051chrX122 ------
NM_001004304chr122863 45 ----12675
NM_001004354chr91165 --3418 415 249 --
NM_001005360chr191851 --180 --
NM_001005361chr191851 --180 --
NM_001005362chr191851 --180 --
NM_001005366chr121243 ------
NM_001005463chr10------11828
NM_001005505chr3--1181 1320 --
NM_001006115chr312772 --12427 22692 1918
NM_001006636chr21406 ------
NM_001007098chr11107 ------
NM_001007226chr171984 ------
NM_001007227chr171984 ------
NM_001007228chr171984 ------
NM_001007229chr171984 ------
NM_001007230chr171984 ------
NM_001007271chr10--1403 ----
NM_001007277chr11----190 --
NM_001007533chr17161 ------
NM_001008392chr311008 ------
NM_001008701chr1942564 1089 1038 456 ------
NM_001008925chr4------12953
NM_001009566chr121401 135 ------
NM_001009880chr2223548 208 ------
NM_001009993chr222956 160 ----12872
NM_001010854chr14150 --128 --
NM_001010926chr11191 --184 --
NM_001010986chrX12191 ------
NM_001012614chr4----1630 --
NM_001012755chrX--13456 ----
NM_001013622chr411002 --5467 406 282 159 35 --
NM_001013690chr1242406 1987 200 137 --149 --
NM_001013693chr122217 1935 ------
NM_001013693chr122217 1935 ------
NM_001014336chr12181 ------
NM_001014839chr11387 ------
NM_001014841chr11387 ------
NM_001015877chrX12399 ------
NM_001017395chr3--13631 11018 --
NM_001017402chr1----139 --
NM_001017405chr41678 --190 --
NM_001017440chr746756 2456 747 666 --13134 --
NM_001017995chr5131 --11815 --
NM_001017999chr11193 ------
NM_001017999chr11193 ------
NM_001018000chr11193 ------
NM_001018000chr11193 ------
NM_001018001chr11193 ------
NM_001018064chr9----177 --
NM_001018070chr11----137 --
NM_001020658chr1134 ------
NM_001020658chr1134 ------
NM_001023587chr311017 ------
NM_001024463chr151442 ------
NM_001024808chr1222112 995 --12391 --
NM_001024858chr143406 86 76 1139 180 --
NM_001024948chr122286 968 ----12279
NM_001025076chr1025696 4889 ------
NM_001025077chr1037054 6247 1355 ----11359
NM_001025105chr521522 1175 ------
NM_001025579chr17--1299 ----
NM_001025596chr11149 ------
NM_001029863chr611030 ------
NM_001029875chr51178 ------
NM_001031680chr12578 25 ------
NM_001031695chr2231458 1310 1277 --13597 --
NM_001031740chr11299 ------
NM_001031804chr1624177 3350 ------
NM_001032280chr6----7141 138 135 132 129 126 123 --
NM_001032289chrX----196 --
NM_001033117chr344463 1554 34 22 --125 --
NM_001034837chr5--1734 ----
NM_001034838chr5--1734 ----
NM_001034954chr1022448 462 ------
NM_001034955chr1022448 462 ------
NM_001034956chr1022448 462 ------
NM_001034957chr1022448 462 ------
NM_001035254chr921664 312 --1667 --
NM_001035256chr2----180 --
NM_001035260chr10168 ------
NM_001035267chr121286 ------
NM_001037582chr42501 30 ------
NM_001037639chr3141 ------
NM_001037954chr1113478 ------
NM_001038493chr23618 472 50 ------
NM_001039467chr20----129 --
NM_001039550chr21676 129 1679 --
NM_001039690chr16----157 --
NM_001040101chr41159 ------
NM_001040113chr162909 749 ------
NM_001040118chr11----137 --
NM_001040144chr16----157 --
NM_001040146chr16----157 --
NM_001040152chr72952 445 11712 51125 1122 1101 1089 434 --
NM_001040446chr52782 709 ----1925
NM_001040633chr7----1748 1390
NM_001042424chr422070 425 11021 2428 181 --
NM_001042425chr6----7141 138 135 132 129 126 123 --
NM_001042478chr1145 ------
NM_001042486chr201980 --31479 986 983 --
NM_001042555chr1213140 11250 ----
NM_001042632chr202260 46 ----1171
NM_001042633chr202260 46 ----1171
NM_001042728chr1221054 24 ------
NM_001043318chr14123 --73445 512 409 406 403 400 394 --
NM_001068chr31236 ------
NM_001083621chr134571 1472 1141 --2949 248 --
NM_001092chr173607 599 571 11682 1610 --
NM_001094chr17----1193 --
NM_001116chr1622407 1147 --1212 --
NM_001122631chr112665 34 ----1110
NM_001126chr11854 ------
NM_001144chr161111 ------
NM_001149chr1021064 113 ------
NM_001157chr10135 ------
NM_001177chr1211924 ------
NM_001194chr19179 --3577 574 422 --
NM_001206chr922133 414 ------
NM_001220chr7123 ------
NM_001259chr736320 6242 376 ------
NM_001265chr131252 ------
NM_001273chr12130 ------
NM_001328chr4----1630 --
NM_001329chr1011320 ------
NM_001332chr51560 --1563 --
NM_001346chr31635 ------
NM_001364chr1133574 3443 3035 ------
NM_001365chr17----1756 --
NM_001391chr18122 ------
NM_001396chr2121916 1748 ------
NM_001418chr11191 ------
NM_001418chr11191 ------
NM_001419chr191538 ------
NM_001426chr21520 --3699 50 47 --
NM_001453chr6----11682 --
NM_001463chr21681 ------
NM_001500chr6169 --2126 123 --
NM_001508chr21644 ------
NM_001518chr71818 ------
NM_001523chr19121 ------
NM_001543chr53379 317 189 ------
NM_001614chr171712 ------
NM_001614chr171712 ------
NM_001635chr71830 ------
NM_001642chr111968 --190 --
NM_001663chr141514 ------
NM_001665chr111393 ------
NM_001681chr12--1748 ----
NM_001683chr3----146 --
NM_001707chr7167 --1617 --
NM_001754chr213265 198 86 --3204 201 40 --
NM_001759chr1223244 1697 13949 ----
NM_001773chr111242 ------
NM_001783chr191296 --1246 --
NM_001810chr20177 ------
NM_001826chr11353 ------
NM_001842chr9----1160 1177
NM_001854chr1--1111 ----
NM_001892chr521522 1175 ------
NM_001894chr221781 --1222 --
NM_001903chr51589 ------
NM_001914chr18----198 --
NM_001958chr20141 ------
NM_001961chr19----2135 26 --
NM_001965chr2132 --135 1150
NM_001980chr12--1180 ----
NM_001986chr17------127
NM_002006chr41823 ------
NM_002039chr41668 ------
NM_002088chr192211 125 ------
NM_002115chr5------133
NM_002119chr61101 ------
NM_002147chr17189 --283 80 --
NM_002167chr1178 ------
NM_002221chr142855 1018 636 422 ------
NM_002226chr144864 854 674 59 ------
NM_002229chr19--1114 1308 --
NM_002249chr11376 ------
NM_002254chr2----176 --
NM_002264chr323232 1253 ------
NM_002313chr1045021 5009 1813 430 1372 1107 --
NM_002375chr32899 263 ------
NM_002382chr1421279 356 ------
NM_002397chr5----12114 --
NM_002442chr121318 --196 --
NM_002501chr1923482 1134 --31092 1089 1086 --
NM_002515chr1412020 ------
NM_002522chr1711574 --1112 --
NM_002582chr162901 27 ------
NM_002586chr6------11046
NM_002588chr51211 ------
NM_002650chr22----186 --
NM_002653chr52257 110 --1859 --
NM_002697chr11103 ------
NM_002698chr1932781 2536 70 ------
NM_002699chr131101 194 23 133 1262 1934
NM_002717chr81656 ------
NM_002761chr161127 ------
NM_002821chr61808 ------
NM_002823chr2----145 --
NM_002833chr15160 ------
NM_002835chr71241 ------
NM_002871chr1----189 --
NM_002874chr9--1197 ----
NM_002892chr1411206 ------
NM_002911chr1921113 495 11079 ----
NM_002918chr1921152 834 --2725 231 --
NM_002941chr31329 ------
NM_002945chr171658 ------
NM_003021chr1911016 --11132 --
NM_003030chr3----170 --
NM_003042chr34701 427 371 177 --2651 276 --
NM_003045chr1323422 795 ----1307
NM_003072chr191390 1302 ----
NM_003099chr1535708 1088 38 ------
NM_003106chr311002 ------
NM_003110chr173423 374 320 ------
NM_003139chr11129 ------
NM_003178chr31795 ------
NM_003185chr201538 ------
NM_003220chr6----7141 138 135 132 129 126 123 --
NM_003253chr21174 11732 ----
NM_003269chr6----1170 --
NM_003317chr14----183 --
NM_003325chr222293 51 ------
NM_003344chr7--11516 ----
NM_003345chr161140 --2410 143 --
NM_003371chr92798 274 ------
NM_003378chr71298 --138 --
NM_003459chr2------1710
NM_003474chr101139 ------
NM_003482chr1232057 472 114 ------
NM_003485chr143154 145 88 --2208 69 --
NM_003486chr1642814 2245 122 22 --11107 --
NM_003490chr2211045 ------
NM_003502chr162510 22 ------
NM_003528chr141603 658 512 40 ------
NM_003563chr171984 ------
NM_003603chr41113 --2161 158 --
NM_003629chr11201 ----1205
NM_003632chr17----1591 --
NM_003655chr171243 ------
NM_003660chr193685 501 87 --1489 --
NM_003671chr913097 ------
NM_003673chr17126 1421 ----
NM_003685chr191104 ------
NM_003701chr13--1932 ----
NM_003704chr41166 ------
NM_003735chr51211 ------
NM_003736chr51211 ------
NM_003791chr161243 --1225 --
NM_003827chr192425 108 ------
NM_003876chr171263 ------
NM_003924chr43685 168 100 ------
NM_003936chr22832 280 --294 82 --
NM_003938chr1921131 463 --1135 --
NM_003954chr1721004 32 ------
NM_003988chr1051467 1446 427 357 25 --7611 324 305 61 58 52 49 --
NM_004036chr21260 ------
NM_004055chr112468 304 ------
NM_004093chr1331023 606 253 --1147 --
NM_004169chr17153 ------
NM_004205chr114485 448 409 129 ------
NM_004227chr731190 355 255 ------
NM_004302chr1222764 499 --2532 56 --
NM_004321chr263475 2890 2544 2196 1242 283 --22958 76 --
NM_004327chr2221816 421 ------
NM_004350chr12578 25 ------
NM_004356chr111467 ------
NM_004370chr611376 --1482 --
NM_004393chr31742 --12100 --
NM_004395chr51603 --174 --
NM_004405chr2--1439 294 91 --
NM_004420chr1142354 2324 869 333 --2589 27 --
NM_004421chr1------155
NM_004430chr83742 645 301 --2765 762 1467
NM_004438chr21190 ----12673
NM_004472chr51128 --1132 --
NM_004500chr1411444 ------
NM_004501chr1--13941 ----
NM_004571chr211314 ------
NM_004583chr17----122 --
NM_004588chr1122507 337 ------
NM_004625chr3------130
NM_004667chr15158 ------
NM_004732chr171268 139 ----
NM_004742chr3----11615 --
NM_004746chr18166 --4330 242 26 23 --
NM_004758chr172849 829 --11068 --
NM_004762chr1751707 1470 1280 614 81 ------
NM_004776chr204361 350 339 185 11012 1265 --
NM_004801chr21494 ------
NM_004840chrX2152 57 ------
NM_004861chr22165 ------
NM_004906chr6----1198 --
NM_004925chr9----131 --
NM_004926chr14----11767 --
NM_004945chr191851 --180 --
NM_004947chr32149 27 ------
NM_004953chr32345 335 ------
NM_004968chr7134 ------
NM_004973chr631662 496 217 ------
NM_004981chr22144 ------
NM_004991chr3387 45 38 ------
NM_004998chr151372 ------
NM_005076chr1--127 --1172
NM_005103chr11--128 ----
NM_005116chr2033798 1283 853 ------
NM_005121chr1713737 158 ----
NM_005137chr22----12199 1114
NM_005187chr16123 1310 ----
NM_005229chrX----2935 813 --
NM_005249chr14--1788 ----
NM_005311chr722155 554 11109 ----
NM_005316chr11--1780 ----
NM_005324chr1711957 ------
NM_005334chrX1117 --2257 254 --
NM_005354chr191244 ------
NM_005386chr20178 1564 ----
NM_005461chr2021684 221 --194 11852
NM_005505chr12140 ------
NM_005515chr7----1117 --
NM_005539chr1051335 1323 521 489 443 --11283 --
NM_005546chr51554 ------
NM_005574chr11148 ------
NM_005575chr53824 608 98 --163 --
NM_005596chr921721 372 ------
NM_005599chr1170 --173 --
NM_005618chr62217 167 ------
NM_005627chr61255 ------
NM_005634chrX3603 548 230 --1233 --
NM_005639chr1211469 ------
NM_005688chr3--11039 ----
NM_005717chr1----179 --
NM_005736chr1011430 ------
NM_005756chrX----1977 --
NM_005785chr1211723 ------
NM_005808chr311008 ------
NM_005819chr12413 245 ------
NM_005873chr20----129 --
NM_005882chr41678 --190 --
NM_005895chr1233389 2692 28 --131 --
NM_005901chr1823229 394 ------
NM_005920chr112482 ------
NM_005923chr6--1100 ----
NM_005934chr1962082 1925 762 518 351 31 --1765 1139
NM_005964chr171350 ------
NM_005986chr132408 195 1436 ----
NM_005996chr122612 47 ------
NM_006007chr9----13663 --
NM_006015chr11847 ------
NM_006022chr131106 ------
NM_006030chr3--1181 1320 --
NM_006037chr244128 3317 338 298 13257 34642 3251 156 --
NM_006038chr20--1355 ----
NM_006039chr171735 ------
NM_006078chr22186 ------
NM_006079chr6----1612 --
NM_006091chr152212 40 ------
NM_006133chr113496 134 76 ------
NM_006160chr1731602 1226 433 --1129 --
NM_006161chr5--1155 170 --
NM_006176chr113730 79 47 --1168 --
NM_006180chr9----177 --
NM_006243chr1124 ------
NM_006312chr122859 81 1628 ----
NM_006313chr121433 ------
NM_006317chr51367 --1345 --
NM_006329chr14127 ------
NM_006361chr1721750 1606 ----11336
NM_006372chr6175 ------
NM_006387chr192790 168 1225 1811 --
NM_006390chr12--137 ----
NM_006434chr1022448 462 ------
NM_006454chr442826 1154 919 171 ------
NM_006459chr1021840 505 ----1791
NM_006489chr1412020 ------
NM_006494chr192857 597 ------
NM_006517chrX11761 ------
NM_006526chr201332 ------
NM_006547chr711478 ------
NM_006548chr31149 ------
NM_006549chr122208 34 ------
NM_006560chr11149 ------
NM_006561chr1025696 4889 ------
NM_006562chr102237 74 --2220 24 --
NM_006654chr1213140 11250 ----
NM_006698chr2011027 ------
NM_006717chr9----1333 --
NM_006720chr1045021 5009 1813 430 1372 1107 --
NM_006734chr611078 ------
NM_006736chr221686 583 --11689 --
NM_006749chr81821 178 ----
NM_006763chr1244 28 --131 --
NM_006825chr121706 ------
NM_006854chr711960 ------
NM_006856chr121463 ------
NM_006884chr3----170 --
NM_006927chr162528 170 ------
NM_006943chr2041299 688 515 230 ------
NM_006997chr10150 ------
NM_007008chr2--1313 ----
NM_007011chr1526357 868 14566 ----
NM_007030chr563405 1801 1581 1218 1015 29 ------
NM_007038chr2115784 ------
NM_007039chr1411509 ------
NM_007050chr2025137 24 ------
NM_007084chr13166 ------
NM_007106chr1312227 ------
NM_007118chr5198 ------
NM_007144chr1711112 1805 ----
NM_007146chr1712750 ------
NM_007185chr12743 120 ------
NM_007192chr141248 ------
NM_007245chr163774 91 40 --195 --
NM_007260chr11299 ------
NM_007368chr1341280 1217 951 112 --1163 --
NM_007371chr9155 ------
NM_009588chr62601 198 ------
NM_012083chr1031162 176 89 --136 --
NM_012164chr922730 21 ------
NM_012183chr11226 --1103 --
NM_012199chr11761 ------
NM_012247chr10--1287 ----
NM_012281chr71253 ------
NM_012288chr645592 5377 1100 451 --14474 --
NM_012309chr1113770 --23709 271 --
NM_012330chr101456 ------
NM_012405chr1----23261 77 --
NM_012425chr101762 12331 ----
NM_012460chr141145 ------
NM_012479chr721834 958 ------
NM_013261chr41606 ------
NM_013275chr16----1209 --
NM_013283chr51688 ------
NM_013392chr22342 273 ------
NM_013433chr19--168 ----
NM_013449chr121714 ------
NM_014021chr113067 ------
NM_014079chr31297 --1160 --
NM_014112chr814299 ------
NM_014191chr121307 ------
NM_014212chr122134 93 ------
NM_014216chr1421175 52 ------
NM_014233chr171661 --11574 --
NM_014235chrX------146
NM_014240chr333682 2989 2789 ------
NM_014268chr181111 ------
NM_014284chr11387 ------
NM_014299chr191625 ------
NM_014351chr2211216 ------
NM_014360chr141634 1750 1158 --
NM_014368chr9158 ------
NM_014392chr41159 ------
NM_014417chr191879 --1302 --
NM_014426chr201678 ------
NM_014494chr16170 ------
NM_014520chr172136 111 ------
NM_014572chr132114 31 ------
NM_014573chr1711780 ------
NM_014592chr5--1734 ----
NM_014630chr151235 ------
NM_014659chr151442 ------
NM_014665chr893057 1443 1388 1290 1151 1088 686 677 279 --13060 11318
NM_014667chr312327 ------
NM_014676chr1134 ------
NM_014682chr81365 ------
NM_014746chr22903 140 --12759 --
NM_014747chr115725 ----1526
NM_014751chr8--11803 ----
NM_014765chr111856 ------
NM_014767chr1021243 23 ------
NM_014774chr122894 610 ------
NM_014788chr9--138 ----
NM_014820chr3------11762
NM_014824chr1111300 ------
NM_014830chr1213687 ------
NM_014847chr1----1104 --
NM_014850chr344463 1554 34 22 --125 --
NM_014870chr134571 1472 1141 --2949 248 --
NM_014871chr121528 ------
NM_014902chr201980 --31479 986 983 --
NM_014906chr171762 ------
NM_014912chr101805 ------
NM_014913chr18----11534 --
NM_014916chr71277 1611 ----
NM_014921chr1942564 1089 1038 456 ------
NM_014944chr121401 135 ------
NM_014952chr15----1442 --
NM_014974chr1011494 ------
NM_014982chr141226 ------
NM_015008chr3--13631 11018 --
NM_015024chr81193 ------
NM_015035chr2015938 --1161 --
NM_015068chr7--1564 ----
NM_015069chr162139 51 ----1249
NM_015075chrX----21981 50 1870
NM_015076chr6------14388
NM_015080chr114834 699 650 181 ------
NM_015092chr161326 ------
NM_015093chr6------1458
NM_015101chr131974 1937 850 12754 ----
NM_015143chr4------1297
NM_015155chr1023114 85 ------
NM_015162chr151466 1399 ----
NM_015163chr141187 ------
NM_015171chr162159 128 --2162 141 --
NM_015200chr4--1354 ----
NM_015209chr11193 ------
NM_015213chr112268 238 ------
NM_015215chr11454 ------
NM_015229chr1731129 930 775 --1289 --
NM_015242chr11----137 --
NM_015246chr1661991 1972 610 527 511 316 ------
NM_015264chr2223548 208 ------
NM_015265chr21727 ------
NM_015267chr121656 ------
NM_015284chr1----11368 --
NM_015288chr543767 3741 1045 120 --23770 1141 --
NM_015310chr812441 15280 12765 --
NM_015315chr521222 690 ------
NM_015317chr212217 ------
NM_015321chr1954710 4645 1766 507 118 --124 --
NM_015328chr71111 ------
NM_015339chr20------1131
NM_015374chr22----159 --
NM_015385chr1022448 462 ------
NM_015444chr33545 126 60 ------
NM_015447chr91238 ------
NM_015481chr122977 829 ------
NM_015483chr721055 1011 ------
NM_015535chr243548 1615 1140 70 13537 ----
NM_015550chr7--12573 ----
NM_015557chr132805 619 58 ------
NM_015564chr512812 ------
NM_015575chr2140 ------
NM_015609chr142128 74 34 23 --2670 26 --
NM_015686chrX----1895 --
NM_015694chr71304 --122 --
NM_015892chr101459 ------
NM_015980chr521557 215 ------
NM_015981chr521254 22 136 ----
NM_015989chr12121 ------
NM_015995chr1514405 --1298 --
NM_016147chr11--153 ----
NM_016203chr7----1748 1390
NM_016243chr1--134 ----
NM_016423chr142386 42 ------
NM_016525chr9------128
NM_016530chr1512502 ------
NM_016545chr11344 ------
NM_016547chr13464 182 42 --4683 523 261 46 --
NM_016569chr122612 47 ------
NM_016603chr51767 ------
NM_016604chr51153 ------
NM_016605chr51302 ------
NM_016607chrX1224 ------
NM_016620chr11443 ------
NM_016621chr1134047 3286 760 13342 23145 2821 --
NM_016626chr1811417 ------
NM_016830chr121100 ------
NM_016929chr61634 ----130
NM_016946chr1----1677 --
NM_017450chr1721125 336 1936 126 --
NM_017456chr1751707 1470 1280 614 81 ------
NM_017550chr194421 271 215 48 --3301 252 51 --
NM_017582chr1181 ------
NM_017594chr9171 ------
NM_017596chr114593 --11339 --
NM_017602chrX1177 --1180 --
NM_017637chr915976 ----19117
NM_017670chr111665 --1868 --
NM_017679chr17--1695 ----
NM_017715chr71486 ------
NM_017902chr10--1101 ----
NM_018014chr2141 ------
NM_018028chr192326 188 ------
NM_018103chr1----1291 --
NM_018172chr11------5570 518 466 414 362
NM_018198chr11286 11135 1321 11419
NM_018211chr1162 ------
NM_018246chr812757 --12350 --
NM_018412chr7----238 35 --
NM_018416chr121157 ------
NM_018419chr20170 --176 --
NM_018486chrX1482 ------
NM_018622chr3141 ------
NM_018660chr832033 862 38 ------
NM_018667chr1632021 408 153 ------
NM_018836chr1145 ------
NM_018898chr5------1270
NM_018899chr5------1270
NM_018900chr5------1270
NM_018901chr5------1270
NM_018902chr5------1270
NM_018903chr5------1270
NM_018904chr5------1270
NM_018905chr5------1270
NM_018906chr5------1270
NM_018907chr5------1270
NM_018908chr5------1270
NM_018909chr5------1270
NM_018910chr5------1270
NM_018911chr5------1270
NM_018912chr51211 ------
NM_018913chr51211 ------
NM_018914chr51211 ------
NM_018915chr51211 ------
NM_018916chr51211 ------
NM_018917chr51211 ------
NM_018918chr51211 ------
NM_018919chr51211 ------
NM_018920chr51211 ------
NM_018921chr51211 ------
NM_018922chr51211 ------
NM_018923chr51211 ------
NM_018924chr51211 ------
NM_018925chr51211 ------
NM_018926chr51211 ------
NM_018927chr51211 ------
NM_018928chr51211 ------
NM_018929chr51211 ------
NM_018945chr62304 203 ------
NM_019116chr1621349 898 --1653 --
NM_019593chr2043042 2735 2603 41 ------
NM_019606chr7143 --1148 --
NM_019613chr172906 381 --138 1291
NM_020121chr13----150 --
NM_020134chr21328 1806 139 --
NM_020180chr1851318 1307 1285 1263 370 --51334 1331 1328 1325 1322 --
NM_020182chr2023265 2919 --13523 11193
NM_020310chr171270 --12025 --
NM_020336chr2011145 ------
NM_020337chr41744 ------
NM_020441chr11----137 --
NM_020449chrX1739 ------
NM_020532chr2--1313 ----
NM_020692chr141101 ------
NM_020693chr112533 38 144 ----
NM_020695chr195688 622 195 41 33 ----1184
NM_020699chr113474 --1220 --
NM_020708chr206611 483 407 264 234 61 22375 278 5471 377 184 129 74 --
NM_020718chr161183 --15547 --
NM_020747chr5--1304 ----
NM_020753chr17131 ----1215
NM_020766chrX23765 529 ------
NM_020791chr172191 29 ------
NM_020804chr621813 364 --32518 2511 44 --
NM_020807chr162173 45 ------
NM_020899chr17--12425 ----
NM_020947chr1611571 515 496 477 458 439 420 401 382 363 344 ----11928
NM_020956chr1964317 3649 3479 1852 762 653 --42937 1425 837 834 --
NM_020972chr4--167 3106 103 100 1857
NM_020987chr1021064 113 ------
NM_020988chr161490 --21041 397 --
NM_020993chr1222112 995 --12391 --
NM_021025chr53424 397 34 --122 --
NM_021064chr61525 --2497 421 1529
NM_021069chr41113 --2161 158 --
NM_021104chr121286 ------
NM_021132chr101203 ------
NM_021159chr41135 ------
NM_021168chr1631574 481 81 ------
NM_021255chr1412818 ------
NM_021267chr19101429 1266 1208 1176 1134 1120 975 874 564 342 --61385 1183 946 382 231 112 1283
NM_021574chr2221816 421 ------
NM_021724chr17----227 24 --
NM_021784chr20------1174
NM_021943chr61757 11418 --11658
NM_021956chr61117 ------
NM_021962chr173607 599 571 11682 1610 --
NM_022006chr19----125 1144
NM_022062chr112217 50 ------
NM_022066chr171176 --2336 50 --
NM_022121chr6131 ------
NM_022123chr141224 ------
NM_022307chr7134 ------
NM_022356chr1------1470
NM_022553chr6129 ------
NM_022574chr722045 654 ----11801
NM_022648chr221425 811 --14526 --
NM_022737chr19145 ------
NM_022758chr6--13079 ----
NM_022802chr1011320 ------
NM_022844chr162909 749 ------
NM_022894chr211119 ------
NM_022898chr1421879 806 ------
NM_023000chr1411206 ------
NM_023001chr1411206 ------
NM_023004chr222204 69 ------
NM_023010chrX1109 ------
NM_023012chr121313 ------
NM_023018chr1----136 1282
NM_023067chr341092 484 432 82 --185 --
NM_023076chr1642735 2469 2216 794 ------
NM_024003chrX2641 184 --1594 --
NM_024016chr17162 --3145 68 65 --
NM_024052chr1731933 1052 596 ----1499
NM_024085chr21993 --148 --
NM_024294chr6--13079 ----
NM_024320chr171162 ------
NM_024337chr5----1140 --
NM_024429chr7----1748 1390
NM_024554chr12223 57 ------
NM_024631chr11188 --191 --
NM_024645chr821590 50 ------
NM_024659chr21406 ------
NM_024676chr121084 220 --1198 --
NM_024692chr211443 ------
NM_024698chr111110 ------
NM_024721chr8--1590 12000 --
NM_024742chr1631540 781 426 ------
NM_024830chr53724 285 264 ------
NM_024871chr3129 --170 --
NM_024953chr121756 ------
NM_024991chr1022448 462 ------
NM_025079chr11268 ------
NM_025080chr1111105 ------
NM_025195chr811824 ------
NM_025237chr171408 ------
NM_025245chr19279 30 ------
NM_025248chr1732817 2763 1243 ------
NM_030621chr1411211 ------
NM_030629chr162344 187 ------
NM_030647chr7172 ------
NM_030661chr731562 1177 1108 ------
NM_030808chr17--1213 ----
NM_030884chr32899 263 ------
NM_030923chr2----1176 --
NM_030957chr19----145 --
NM_030984chr7158 ------
NM_031216chr18194 ------
NM_031297chr9245 30 1137 ----
NM_031309chr821442 851 22110 371 22236 2233 --
NM_031314chr1411444 ------
NM_031407chrX----1189 --
NM_031411chr5------1270
NM_031417chr19----6828 206 80 77 74 71 --
NM_031434chr74320 181 59 28 1138 1114 --
NM_031439chr81172 ------
NM_031445chr21149 ------
NM_031468chr746756 2456 747 666 --13134 --
NM_031844chr1--13941 ----
NM_031849chr5------1270
NM_031857chr5------1270
NM_031860chr5------1270
NM_031890chr2212329 ------
NM_031908chr5----1999 --
NM_032017chr131888 744 372 1412 --11799
NM_032042chr542719 2661 324 234 --1376 1363
NM_032088chr51211 ------
NM_032092chr51211 ------
NM_032109chr511147 --1417 --
NM_032153chr332010 587 395 12759 ----
NM_032186chr11443 ------
NM_032195chr211385 ------
NM_032199chr1011072 ------
NM_032207chr1941239 1088 804 457 --11242 --
NM_032211chr10131 ------
NM_032283chr1157 ------
NM_032289chr51453 ------
NM_032301chr19133 ------
NM_032389chr11------1997
NM_032403chr51211 ------
NM_032420chr5140 ----1766
NM_032458chrX12729 ------
NM_032505chr3----11951 --
NM_032590chr121415 ------
NM_032595chr1721491 266 ------
NM_032638chr31177 11362 1205 --
NM_032687chr8137 ------
NM_032737chr1972521 2371 2195 1926 736 193 183 --2574 197 --
NM_032808chr151659 ------
NM_032837chr1712142 ------
NM_032978chr18122 ------
NM_032979chr18122 ------
NM_032981chr18122 ------
NM_032983chr72778 417 --1582 --
NM_032999chr71818 ------
NM_033000chr71818 ------
NM_033001chr71818 ------
NM_033012chr13--1932 ----
NM_033023chr721042 933 ------
NM_033102chr1181 ------
NM_033102chr1181 ------
NM_033129chr2021441 343 --21563 496 --
NM_033132chr131327 ------
NM_033198chr17185 ------
NM_033201chr16------1203
NM_033225chr832877 2848 278 ------
NM_033259chr32132 76 --5222 219 141 138 135 --
NM_033331chr913097 ------
NM_033380chrX1101 ------
NM_033381chrX1101 ------
NM_033420chr195383 276 162 108 78 --1310 --
NM_033425chr1113478 ------
NM_033449chr511742 ------
NM_033455chr111110 --1300 --
NM_033551chr521222 690 ------
NM_052851chr13------12190
NM_052854chr111582 ------
NM_052896chr11201 --1165 --
NM_052900chr811471 ------
NM_052905chr211235 ------
NM_052934chr122005 679 ------
NM_053046chr19----191 --
NM_053056chr1122740 1965 --12766 --
NM_053064chr1412541 ------
NM_058004chr22----186 --
NM_080552chr201560 --389 86 24 --
NM_080607chr202777 62 ----1976
NM_080629chr1--1111 ----
NM_080630chr1--1111 ----
NM_080632chrX1109 ------
NM_080645chr611376 --1482 --
NM_080732chr19----191 --
NM_080743chr6127 ------
NM_080881chr51603 --174 --
NM_130436chr2121916 1748 ------
NM_130438chr2122493 2325 ------
NM_133170chr2025137 24 ------
NM_133330chr422070 425 11021 2428 181 --
NM_133331chr422070 425 11021 2428 181 --
NM_133335chr422070 425 11021 2428 181 --
NM_133499chrX1887 ------
NM_133631chr31329 ------
NM_133633chr2211161 ------
NM_138333chr91249 ------
NM_138415chr2211780 1678 1565 --
NM_138430chr13------1384
NM_138437chrX122 ------
NM_138444chr131830 1871 1833 --
NM_138559chr2131 ------
NM_138576chr1421879 806 ------
NM_138689chr11147 ------
NM_138732chr114834 699 650 181 ------
NM_138734chr114834 699 650 181 ------
NM_138735chr21494 ------
NM_138795chr1--11211 1227 --
NM_138966chr18------1169
NM_139135chr11847 ------
NM_139170chr163543 518 489 ------
NM_139181chr11----137 --
NM_139283chr1222438 196 ------
NM_139316chr71830 ------
NM_144564chr19137 --125 --
NM_144568chr14----1495 --
NM_144583chr211686 ------
NM_144631chr2164 ------
NM_144994chr21125 --21065 22 --
NM_145065chr112440 289 --1413 --
NM_145112chr1421279 356 ------
NM_145113chr1421551 628 ------
NM_145159chr144864 854 674 59 ------
NM_145173chr192712 521 --3151 49 26 --
NM_145285chr102745 48 --1760 --
NM_145313chr10----11306 --
NM_145320chr7--12573 ----
NM_145321chr7--12573 ----
NM_145322chr7--12573 ----
NM_145351chr173939 844 837 ------
NM_145735chr131158 ------
NM_145804chr11121 ------
NM_145868chr10135 ------
NM_145869chr10135 ------
NM_145891chr1621616 1597 ------
NM_145892chr1621616 1597 ------
NM_145893chr1621738 1719 ------
NM_147164chr9----1160 1177
NM_147202chr9124 ------
NM_147223chr2----1563 11579
NM_148414chr161322 ------
NM_148918chr17153 ------
NM_148955chr1535708 1088 38 ------
NM_152221chr221781 --1222 --
NM_152227chr201678 ------
NM_152237chr221300 --21413 499 --
NM_152253chr2212887 23364 172 171 --
NM_152346chr173991 200 100 --2728 233 --
NM_152441chr121175 ------
NM_152556chr7--1929 ----
NM_152557chr7127 1214 ----
NM_152563chr11------5570 518 466 414 362
NM_152572chr9124 ------
NM_152588chr122474 458 ------
NM_152600chr19----125 --
NM_152624chr512085 ------
NM_152724chr101762 12331 ----
NM_152739chr7----1191 --
NM_152744chr743427 2736 2206 1126 1201 ----
NM_152748chr71125 ------
NM_152756chr514079 ------
NM_152780chrX1109 ------
NM_152793chr71856 ------
NM_152826chr1535708 1088 38 ------
NM_152868chr22144 ------
NM_152924chr1526357 868 14566 ----
NM_153035chr1158 --2399 396 --
NM_153181chr18------1169
NM_153273chr312772 --12427 22692 1918
NM_153334chr222643 48 ------
NM_153350chr163668 281 64 --2594 311 --
NM_153367chr1033498 897 54 ------
NM_153449chr12--1314 ----
NM_153499chr122306 132 ------
NM_153500chr122306 132 ------
NM_153619chr1511155 ------
NM_153631chr731562 1177 1108 ------
NM_153632chr731562 1177 1108 ------
NM_153675chr20------1174
NM_153828chr2--1313 ----
NM_153832chr1174 ------
NM_170665chr1213528 14583 --13313
NM_170675chr151302 ------
NM_170676chr151302 ------
NM_170711chr193620 189 111 ------
NM_170782chr11376 ------
NM_171825chr521254 22 136 ----
NM_171999chr181128 1152 ----
NM_172057chr7150 ------
NM_172078chr7123 ------
NM_172079chr7123 ------
NM_172080chr7123 ------
NM_172081chr7123 ------
NM_172082chr7123 ------
NM_172083chr7123 ------
NM_172084chr7123 ------
NM_172216chr122208 34 ------
NM_172226chr122306 132 ------
NM_173156chr11146 ------
NM_173468chr41310 ------
NM_173595chr1244738 4535 1005 26 --14319 --
NM_173602chr121405 ------
NM_173633chr19136 ----1155
NM_173694chrX12257 ------
NM_175063chr192464 22 --1885 --
NM_175884chr7128 ------
NM_175898chr1541055 648 493 410 1166 61567 457 347 338 114 47 --
NM_175920chr53824 608 98 --163 --
NM_175931chr16123 1310 ----
NM_177438chr1411211 ------
NM_177947chrX1224 ------
NM_177948chrX1224 ------
NM_177999chr943228 3019 2717 2694 13112 13632 --
NM_178006chr13------12190
NM_178007chr13------12190
NM_178013chr1452930 2485 2246 407 23 ------
NM_178151chrX15491 14981 ----
NM_178152chrX15491 14981 ----
NM_178153chrX15491 14981 ----
NM_178423chr71207 ------
NM_178425chr71207 ------
NM_178493chr17----151 --
NM_178502chr122600 397 ------
NM_178565chr81301 ------
NM_178830chr19--1186 1548 --
NM_178835chr4----177 --
NM_178864chr111571 --1473 --
NM_181050chr162510 22 ------
NM_181291chr141160 1488 1171 --
NM_181442chr20------1131
NM_181689chr20178 1564 ----
NM_181784chr21163 --1191 --
NM_181809chr123762 1488 ------
NM_182663chr111917 ------
NM_182664chr112047 ------
NM_182665chr111917 ------
NM_182697chr7--11516 ----
NM_182700chr74580 529 495 241 1748 ----
NM_182705chr1722504 40 ------
NM_182779chr1------155
NM_182796chr51688 ------
NM_182895chr222643 48 ------
NM_182917chr32345 335 ------
NM_182920chr311087 ----11105
NM_182972chr132093 697 289 ------
NM_183006chr201980 --31479 986 983 --
NM_183377chr17----1193 --
NM_183422chr131106 ------
NM_183425chr2041403 1212 1121 160 1274 41206 211 208 72 --
NM_194259chr161140 --2410 143 --
NM_194260chr161140 --2410 143 --
NM_194261chr161140 --2410 143 --
NM_194272chr15----2699 696 --
NM_194278chr14123 --73445 512 409 406 403 400 394 --
NM_194282chr4----11228 --
NM_194358chr1211723 ------
NM_194359chr1211723 ------
NM_194449chr181361 ------
NM_198066chr14----12203 --
NM_198123chr811471 ------
NM_198124chr811471 ------
NM_198241chr32345 335 ------
NM_198242chr32345 335 ------
NM_198244chr32345 335 ------
NM_198261chr121313 ------
NM_198262chr121313 ------
NM_198270chrX12865 ------
NM_198390chr162344 187 ------
NM_198563chr3145 ------
NM_198576chr12283 27 --1707 --
NM_198700chr11149 ------
NM_198850chr193202 85 44 ------
NM_198956chr74580 529 495 241 1748 ----
NM_199054chr191749 --1753 11705
NM_199131chr101569 11125 ----
NM_199141chr194779 208 160 65 --2163 57 --
NM_199169chr2023265 2919 --13523 11193
NM_199170chr2023265 2919 --13523 11193
NM_199171chr2023265 2919 --13523 11193
NM_199245chr1212144 --1105 --
NM_199355chr16----1114 --
NM_201269chr11443 ------
NM_201434chr17----122 --
NM_201568chr11146 ------
NM_201569chr11146 ------
NM_201634chr511489 --165 --
NM_203304chr19----1168 --
NM_203305chr921664 312 --1667 --
NM_203327chr2033798 1283 853 ------
NM_203382chr511451 ------
NM_203403chr9----162 --
NM_203456chr1126 ------
NM_206860chr10150 ------
NM_206861chr10150 ------
NM_206862chr10150 ------
NM_206909chr812441 15280 12765 --
NM_207113chr7150 ------
NM_207123chr41668 ------
NM_207306chr11143 --175 --
NM_207325chr1911555 ------
NM_207442chr142909 298 ------
NM_207520chr2--1313 ----
NM_207521chr2--1313 ----
NM_207577chr1122596 238 ------