TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3974
miRNA Sequence: AAAGGUCAUUGUAAGGUUAAUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000020chr124826 702 606 195 ----11836
NM_000037chr862442 703 410 256 217 156 ------
NM_000038chr511929 --12020 --
NM_000053chr1371625 1472 829 378 212 181 156 --11676 --
NM_000067chr8----2556 276 --
NM_000081chr121312 59 ------
NM_000084chrX75948 5747 5482 5241 4332 781 358 16703 25294 659 --
NM_000088chr171127 ------
NM_000090chr21731 --1927 --
NM_000093chr952362 855 219 124 41 --1421 --
NM_000109chrX22155 1782 --1750 --
NM_000114chr204975 521 197 93 --1912 --
NM_000117chrX----1286 --
NM_000125chr663703 3549 1565 1510 897 449 ----21642 760
NM_000141chr1011154 11006 11050 11401
NM_000161chr1411649 --21866 1809 --
NM_000167chrX199 1658 1644 --
NM_000168chr722507 2150 --165 --
NM_000176chr553208 1076 1004 864 389 ------
NM_000178chr202306 25 ------
NM_000179chr2268 31 ------
NM_000192chr121159 --1199 --
NM_000202chrX2990 146 --23766 1434 --
NM_000208chr19104764 4563 4227 3893 3772 3072 3050 1599 1476 1147 11702 13326 --
NM_000210chr21454 ------
NM_000214chr2031538 521 95 ----1471
NM_000216chrX23499 3361 --23270 3074 1126
NM_000217chr1284728 4398 4198 3982 3561 1751 1120 627 15382 ----
NM_000232chr472662 2537 2523 2515 1292 1167 40 --2924 46 --
NM_000248chr32585 352 1261 12697 --
NM_000259chr1556042 4812 4415 4121 950 14206 15842 --
NM_000264chr92715 233 --13079 --
NM_000267chr1753432 2596 1354 553 500 --12372 --
NM_000271chr181170 ------
NM_000284chrX51722 1710 1522 464 212 ----11335
NM_000304chr1721059 997 ------
NM_000314chr1032587 811 66 ----11192
NM_000332chr686236 6004 5327 5021 4984 4753 2528 906 --46598 2866 2302 2104 --
NM_000337chr586464 4790 1494 804 598 473 107 42 --11084 1888
NM_000346chr1751810 1493 375 292 203 21639 755 ----
NM_000368chr964310 3668 3009 926 899 515 --23058 193 --
NM_000378chr111951 --1109 21204 885
NM_000390chrX63437 3160 944 477 347 196 12573 12187 12390
NM_000393chr242016 1957 462 150 ------
NM_000399chr1031025 777 380 ------
NM_000406chr431040 830 246 --22927 2240 1872
NM_000408chr223434 270 11047 ----
NM_000411chr2123047 348 --32330 709 619 --
NM_000430chr1753421 2611 817 383 375 --11442 11270
NM_000447chr12185 96 ------
NM_000449chr11300 --2452 173 1226
NM_000461chr343271 3178 1697 868 --13461 13940
NM_000484chr211880 ------
NM_000486chr1272825 2736 2136 2095 999 786 654 --23077 2508 --
NM_000489chrX53293 3014 1289 72 47 ----1991
NM_000492chr7----11233 --
NM_000495chrX21112 962 --1255 --
NM_000496chr22189 ------
NM_000503chr83548 493 139 ----11811
NM_000509chr4--141 ----
NM_000522chr721027 868 ------
NM_000525chr1141226 1063 613 162 --11460 --
NM_000533chrX2581 253 ----1705
NM_000551chr33408 154 64 1604 ----
NM_000554chr1973299 2236 2026 1086 979 810 670 11112 ----
NM_000555chrX46627 5852 5149 3157 12954 36514 5519 276 --
NM_000599chr273976 3820 3528 3502 3115 2891 424 11810 24595 3085 --
NM_000610chr1162762 2423 2356 1039 692 261 --12926 --
NM_000611chr1196837 6473 5415 5402 2817 2320 1530 233 163 --46461 2308 1194 1165 11901
NM_000615chr1122897 907 12087 22999 749 --
NM_000618chr1296494 6222 5355 4942 4564 4464 4276 2207 529 25624 4024 45832 5522 1241 227 --
NM_000618chr1296494 6222 5355 4942 4564 4464 4276 2207 529 25624 4024 45832 5522 1241 227 --
NM_000633chr1884196 3964 3941 3725 1862 1042 902 566 --64502 3434 3416 2087 1398 1358 13842
NM_000668chr41300 11310 11350 --
NM_000719chr1246560 5029 4763 88 --15294 14931
NM_000724chr1051696 1558 797 206 106 ------
NM_000725chr122976 864 ------
NM_000726chr221449 1407 --1585 --
NM_000788chr4----21473 1136 --
NM_000792chr131021 132 92 ------
NM_000810chr15------1542
NM_000811chr5----1213 --
NM_000813chr544598 4446 458 127 --11737 --
NM_000814chr1544244 2815 1470 1394 --13911 --
NM_000826chr43475 259 161 ------
NM_000828chrX----2767 133 --
NM_000831chr154587 4419 4151 3807 203 12283 11007 11453
NM_000838chr662513 2355 2245 1781 942 824 --1975 --
NM_000844chr33397 330 240 1946 1733 --
NM_000845chr7------145
NM_000859chr5----31587 1572 362 --
NM_000861chr311743 22024 479 ----
NM_000866chr3----11881 --
NM_000872chr102142 106 ------
NM_000875chr1575391 5094 4423 4413 1954 239 114 --46831 5125 1391 1295 15466
NM_000876chr621082 1023 --21254 395 --
NM_000899chr1214016 --11633 1147
NM_000901chr432229 2069 759 ------
NM_000903chr1631116 1065 69 --11147 --
NM_000912chr852762 2322 2254 917 56 --1323 13280
NM_000921chr12140 ------
NM_000926chr1167931 7554 6888 3166 2407 771 28112 5930 38464 8138 6676 25973 1369
NM_000933chr2021624 145 --11139 --
NM_000935chr311115 ------
NM_000945chr212057 ----11308
NM_000949chr51929 ------
NM_000950chrX23460 91 ------
NM_000961chr2063441 3104 3020 3004 2847 1577 1391 13735 --
NM_000962chr952670 2434 2423 2316 871 12292 1385 12933
NM_000965chr31329 --11066 --
NM_000983chr11163 ----1231
NM_001001132chr213981 387 110 --1295 --
NM_001001323chr1222733 532 --12315 --
NM_001001331chr332343 2073 1733 --11748 --
NM_001001342chr1051412 1277 1172 1154 1144 --11296 --
NM_001001389chr1162762 2423 2356 1039 692 261 --12926 --
NM_001001390chr1162762 2423 2356 1039 692 261 --12926 --
NM_001001391chr1162762 2423 2356 1039 692 261 --12926 --
NM_001001392chr1162808 2469 2402 1085 738 307 --12972 --
NM_001001395chr1222744 2499 22385 2150 12163 --
NM_001001396chr152769 1444 1312 476 364 13302 13965 --
NM_001001419chr563794 1862 906 701 638 402 --11960 1260
NM_001001420chr563794 1862 906 701 638 402 --11960 1260
NM_001001433chr2062443 2431 2118 912 222 62 --23132 2824 --
NM_001001481chr842670 1273 324 101 13079 ----
NM_001001484chr1021936 492 --12480 --
NM_001001549chr742685 2227 1144 822 1775 22367 2298 --
NM_001001550chr742685 2227 1144 822 1775 22367 2298 --
NM_001001555chr742685 2227 1144 822 1775 22367 2298 --
NM_001001556chr153554 235 58 ------
NM_001001664chr263490 1460 750 588 359 228 1210 137 --
NM_001001702chr531699 1560 1261 1554 21642 66 --
NM_001001852chr222284 114 --3752 132 74 --
NM_001001890chr2143602 1702 663 383 13669 ----
NM_001001936chr102338 43 --11162 --
NM_001002233chr842164 1695 625 38 ------
NM_001002257chr222604 2466 --11091 13523
NM_001002265chr10----1774 --
NM_001002266chr10----1774 --
NM_001002269chr92195 159 197 ----
NM_001002295chr101869 ----1318
NM_001002838chrX1491 21690 1426 1647 --
NM_001002843chr15----2967 843 --
NM_001002860chr1422948 549 --23749 3727 14680
NM_001003665chr172949 2765 2230 1130 668 558 76 --23114 305 --
NM_001003674chr1865943 5574 1751 875 827 342 --26181 2736 --
NM_001003675chr1865943 5574 1751 875 827 342 --26181 2736 --
NM_001003688chr43265 253 112 ------
NM_001003810chr41544 ------
NM_001003937chr22412 161 --1108 11452
NM_001003940chr15163492 3368 3348 3324 3105 3022 2948 2937 2685 2673 2529 2491 711 209 195 171 --11109 --
NM_001003942chr15163492 3368 3348 3324 3105 3022 2948 2937 2685 2673 2529 2491 711 209 195 171 --11109 --
NM_001003943chr15163496 3372 3352 3328 3109 3026 2952 2941 2689 2677 2533 2495 715 213 199 175 --11113 --
NM_001004019chr31121 ------
NM_001004023chr1----1217 150
NM_001004065chr953378 2593 1486 749 219 11009 ----
NM_001004196chr331120 307 145 ------
NM_001004317chr673951 3914 3614 3375 3233 1143 94 1977 23307 1279 23794 1266
NM_001004329chr121505 1449 11510 --
NM_001004360chr221430 1308 --1394 --
NM_001005266chr151461 --1241 --
NM_001005267chr151461 --1241 --
NM_001005268chr151461 --1241 --
NM_001005269chr151461 --1241 --
NM_001005375chrY11341 --21570 406 11709
NM_001005404chr1751582 684 492 339 109 --12871 --
NM_001005463chr1062387 2009 901 847 749 137 12177 ----
NM_001005473chr522431 1188 12472 35135 4833 81 --
NM_001005474chr331002 296 243 --1506 1427
NM_001005476chr21184 ------
NM_001005502chr1265050 5042 4876 4346 116 93 14673 1381 24783 4568
NM_001005609chrX83709 3261 3102 2468 1136 1018 578 262 11218 2186 173 --
NM_001005743chr1431230 411 78 ----11282
NM_001005744chr1431230 411 78 ----11282
NM_001005745chr1431230 411 78 ----11282
NM_001005746chr221449 1407 --1585 --
NM_001005747chr221449 1407 --1585 --
NM_001005781chr2----1457 --
NM_001005782chr21701 --3906 380 325 --
NM_001006115chr342713 2520 1862 325 ----1558
NM_001006600chr532430 2214 1619 ------
NM_001006605chr11805 ----1259
NM_001006605chr11805 ----1259
NM_001006624chr171702 1694 1680 725 518 465 136 ------
NM_001006657chr262986 2730 2708 2082 1167 935 13238 ----
NM_001007024chr17103384 3192 3153 2666 1760 1743 1528 1475 736 693 --11769 11537
NM_001007025chr17103384 3192 3153 2666 1760 1743 1528 1475 736 693 --11769 11537
NM_001007088chrX183 ------
NM_001007097chr974290 3965 1954 1719 1011 395 367 --33863 1265 526 --
NM_001007102chr6----1595 --
NM_001007226chr173979 231 142 ------
NM_001007227chr173979 231 142 ------
NM_001007228chr173979 231 142 ------
NM_001007229chr173979 231 142 ------
NM_001007230chr173979 231 142 ------
NM_001007246chr2141580 1336 1291 549 ------
NM_001007255chr1121 1197 ----
NM_001007257chr11507 11073 ----
NM_001007466chr664602 973 812 615 249 54 --43782 3444 1323 1104 --
NM_001007471chr92183 152 ------
NM_001007527chr5--1258 ----
NM_001008220chr553968 2493 441 393 110 1661 1387 --
NM_001008222chrX31365 265 21 ------
NM_001008239chr1873254 2849 2801 2428 869 649 590 --1275 13422
NM_001008388chr441022 1013 312 188 --1408 --
NM_001008393chr462118 1781 664 626 356 90 1733 22470 1835 11000
NM_001008408chr7156188 5588 4923 4829 4488 4011 2266 2146 2105 982 852 801 767 746 333 --45388 2010 1884 530 125
NM_001008495chr821963 229 --21483 915 --
NM_001008539chr865070 4485 3576 967 559 462 ----14396
NM_001008660chr1121478 975 11211 ----
NM_001008707chr1441751 1629 1440 618 11183 ----
NM_001008738chr532595 2286 188 ------
NM_001008744chr1421121 572 ------
NM_001008801chr1932181 1755 26 1854 --11691
NM_001008860chr152799 191 ----1635
NM_001008892chr152799 191 ----1635
NM_001008894chr152799 191 ----1635
NM_001008925chr432742 2319 1311 12903 1573 --
NM_001009554chr473631 3615 3042 1500 1054 558 263 --24321 1742 11394
NM_001009554chr473631 3615 3042 1500 1054 558 263 --24321 1742 11394
NM_001009881chr1--1408 ----
NM_001009882chr1--1408 ----
NM_001009899chr395197 5172 5046 4016 2038 1623 1557 1549 1391 1332 35946 5725 4716 --
NM_001009959chr232632 2197 1894 ------
NM_001009960chr742659 891 735 528 ------
NM_001009993chr264581 3888 3707 1224 94 74 ------
NM_001010000chr1822989 2750 23225 2844 31196 418 200 --
NM_001010846chr1104077 4060 3986 3349 3308 3019 1408 864 485 372 --23365 1768 13980
NM_001010862chrX43123 2782 2405 2115 22100 812 ----
NM_001010874chr432226 1515 913 ------
NM_001010888chrX103958 3528 3461 3432 1793 1508 1098 664 640 523 --13198 --
NM_001010891chr566513 6236 5309 4993 2728 2144 11672 14984 --
NM_001010895chr92705 695 --11974 --
NM_001010917chr1081957 1493 663 636 579 270 217 48 --12003 --
NM_001010924chr10----1194 --
NM_001010989chr161462 ------
NM_001010990chr161462 ------
NM_001011537chr341459 689 359 254 --11587 --
NM_001011666chr742151 1842 658 22 ------
NM_001011885chr1521708 488 ----1699
NM_001012393chr1144871 1635 1477 401 154 34993 3936 3930 14131
NM_001012418chr653858 1649 923 793 107 14284 1807 1308
NM_001012420chr1542887 1871 809 431 ------
NM_001012423chr1542887 1871 809 431 ------
NM_001012426chr673373 3071 2758 1170 1001 521 151 ------
NM_001012427chr673373 3071 2758 1170 1001 521 151 ------
NM_001012643chr193534 391 236 ------
NM_001012751chr101409 --11743 11813
NM_001012968chrX------11083
NM_001012977chrX1892 ------
NM_001012980chrX176 --1226 --
NM_001012989chrX1421 --1581 --
NM_001013031chr1072485 1409 1017 919 792 645 105 --13217 --
NM_001013399chr611124 ------
NM_001013406chr711154 11436 11177 --
NM_001013415chr421417 271 --1440 --
NM_001013620chr12108136 7028 6003 3053 2888 2735 2007 1842 1079 1016 --27556 2108 --
NM_001013635chr121167 --11137 --
NM_001013690chr1262358 2346 1873 1838 865 845 1296 21547 543 11697
NM_001013693chr152955 426 341 313 163 --22735 872 --
NM_001013693chr152955 426 341 313 163 --22735 872 --
NM_001013699chr12----167 --
NM_001013843chr152111 88 ------
NM_001014283chr1341807 1550 731 476 ------
NM_001014434chr1188 --1636 --
NM_001014797chr10118137 8090 3280 2290 2115 1678 1327 1045 817 690 270 17370 1194 --
NM_001015045chr41193 22295 422 1528 --
NM_001015048chr1452626 2541 2043 1034 806 --22948 2424 --
NM_001015049chr1452626 2541 2043 1034 806 --22948 2424 --
NM_001015508chr8------1156
NM_001015877chrX13120 --33128 1954 496 --
NM_001017395chr322887 2515 13579 22478 1232 --
NM_001017396chr242107 2098 1748 798 --31884 1854 870 --
NM_001017415chr1------1701
NM_001017416chr1------1701
NM_001017424chr111239 --11281 --
NM_001017425chr111239 --11281 --
NM_001017440chr796265 5060 2984 2764 2526 2129 1598 1167 460 --87672 7164 5954 3051 2506 1346 1175 1027 --
NM_001017523chr1251797 1317 388 302 160 --11377 --
NM_001017920chr2------1138
NM_001017923chr1421605 472 --1256 --
NM_001017926chr81303 --11835 --
NM_001017930chrX1186 150 --1226
NM_001017995chr574809 4012 3934 3263 1332 1029 127 13588 22969 424 --
NM_001017999chr141948 1897 904 677 ------
NM_001017999chr141948 1897 904 677 ------
NM_001018000chr141948 1897 904 677 ------
NM_001018000chr141948 1897 904 677 ------
NM_001018001chr141948 1897 904 677 ------
NM_001018065chr976006 5988 5896 5602 5470 3936 1491 25367 3765 1789 --
NM_001018066chr976006 5988 5896 5602 5470 3936 1491 25367 3765 1789 --
NM_001018067chr164972 4029 3773 3474 3276 1835 11675 25026 3515 --
NM_001018068chr164972 4029 3773 3474 3276 1835 11675 25026 3515 --
NM_001018069chr164972 4029 3773 3474 3276 1835 11675 25026 3515 --
NM_001018072chr1251797 1317 388 302 160 --11377 --
NM_001018074chr553208 1076 1004 864 389 ------
NM_001018075chr553208 1076 1004 864 389 ------
NM_001018076chr553208 1076 1004 864 389 ------
NM_001018077chr553208 1076 1004 864 389 ------
NM_001018090chr1532854 2512 54 --1163 --
NM_001018091chr1542964 2622 1824 164 --1273 --
NM_001018100chr151317 ------
NM_001018102chr1532854 2512 54 --1163 --
NM_001018111chr783389 2613 1498 1389 1376 1053 910 338 2270 140 ----
NM_001023567chr1552279 1892 812 654 433 ------
NM_001024094chr553208 1076 1004 864 389 ------
NM_001024218chr141107 --1724 --
NM_001024455chrX52464 2043 984 741 429 ------
NM_001024593chr104846 712 663 226 1904 1802 --
NM_001024647chr12137651 7155 6773 6456 5037 2490 2327 1735 1410 1273 802 159 104 ------
NM_001024649chr52328 22 --32426 2355 778 --
NM_001024666chrX2638 218 ------
NM_001024668chr122906 731 ------
NM_001024688chr832121 1946 119 ------
NM_001024808chr1262722 2649 2513 2445 2318 442 1623 ----
NM_001024847chr322110 697 --12307 --
NM_001024934chr61632 ------
NM_001024935chr61632 ------
NM_001024936chr61632 ------
NM_001024948chr143531 3211 3129 2542 --1146 1360
NM_001025068chr321638 1441 ----1337
NM_001025069chr321638 1441 ----1337
NM_001025076chr1076233 2439 2242 1857 213 183 147 --56254 2136 1473 194 177 --
NM_001025077chr1077591 1571 1541 1505 1303 1157 500 --57612 2831 1552 1535 1124 --
NM_001025079chr361669 1234 955 564 325 208 --22646 80 --
NM_001025105chr511115 --11281 --
NM_001025108chr284107 3593 3296 3007 2970 1667 1487 384 14063 1138 --
NM_001025205chr31438 ------
NM_001025232chr122315 275 ----146
NM_001025252chr842841 1239 638 274 --1349 --
NM_001025253chr842841 1239 638 274 --1349 --
NM_001025266chr374633 4107 3942 3934 1447 651 216 --21807 1644 --
NM_001025580chrX23348 2641 --43627 3164 2903 1483 --
NM_001025595chr41600 ------
NM_001025603chr11300 --2452 173 1226
NM_001025616chr42535 68 ----11722
NM_001025777chr271601 1499 1291 1029 173 147 73 --11609 --
NM_001025780chr931160 1149 1141 11496 ----
NM_001029858chr652993 2580 2562 2186 195 12861 1587 --
NM_001029859chr111950 --21643 766 22374 2327
NM_001029860chr8149 ------
NM_001029875chr532702 2148 380 --11113 --
NM_001029891chrX3694 314 279 ------
NM_001030007chr1633046 1090 650 --33338 2481 155 --
NM_001030272chr111112 ------
NM_001030273chr111112 ------
NM_001031623chr63694 684 480 11408 2149 34 11746
NM_001031679chr1243149 3107 637 428 12877 1420 --
NM_001031684chr22454 412 21096 403 ----
NM_001031692chr71274 ------
NM_001031695chr2275313 4859 4411 3669 1846 1788 459 --11640 --
NM_001031710chr7----1852 --
NM_001031712chr6----1305 --
NM_001031723chr41147 1488 ----
NM_001031732chr462234 1401 1129 1093 919 341 --33150 1296 1282 --
NM_001031804chr1664404 3626 3192 3132 813 371 1946 64187 3516 3460 3333 1104 828 --
NM_001031812chr512015 --11689 --
NM_001032282chr811281 ------
NM_001032293chr17----1541 1102
NM_001033045chr223737 203 11065 32874 1654 73 --
NM_001033047chr492639 2242 1869 862 733 496 467 426 153 --2851 514 1776
NM_001033057chr311973 ------
NM_001033059chr631814 1779 394 --11642 --
NM_001033081chr151624 1549 733 712 658 ------
NM_001033082chr151624 1549 733 712 658 ------
NM_001033085chr2------172
NM_001033117chr3104415 4400 4373 3968 3867 3644 3399 1693 1418 577 --41397 688 97 61 --
NM_001033503chr5190 ------
NM_001033518chr74763 609 85 58 1115 1622 --
NM_001033519chr74763 609 85 58 1115 1622 --
NM_001033520chr74763 609 85 58 1115 1622 --
NM_001033564chr641779 1692 1276 67 ------
NM_001033578chr8--22185 1688 12125 --
NM_001033659chr1721328 1069 --21452 1092 --
NM_001033723chr852301 2051 1725 492 52 --12095 --
NM_001034025chr122872 77 1329 ----
NM_001034837chr52148 67 ------
NM_001034838chr52148 67 ------
NM_001034841chr1695517 5237 4854 4637 4627 4313 4102 3725 1770 24485 1988 24842 4436 --
NM_001034845chr41261 ------
NM_001034850chr511457 ------
NM_001034954chr1032950 294 64 ------
NM_001034955chr1032950 294 64 ------
NM_001034956chr1032950 294 64 ------
NM_001034957chr1032950 294 64 ------
NM_001035235chr54611 457 200 52 ------
NM_001037334chr1842425 2100 1756 775 ----1569
NM_001037339chr121865 190 --21485 115 --
NM_001037340chr121865 190 --21485 115 --
NM_001037341chr121865 190 --21485 115 --
NM_001037341chr121865 190 --21485 115 --
NM_001037533chr1--1209 ----
NM_001037631chr21923 --2981 432 --
NM_001037954chr1162450 2174 1324 1268 635 391 23189 281 21025 856 1874
NM_001038702chr542610 2510 2382 923 --52781 960 613 217 206 12462
NM_001038707chr122324 100 --12169 --
NM_001038707chr122324 100 --12169 --
NM_001039091chrX61018 377 276 121 46 39 --1257 --
NM_001039590chrX33358 3350 212 148 ----
NM_001039591chrX33358 3350 212 148 ----
NM_001039618chr11--14008 22057 563 14445
NM_001039693chr232790 928 229 --43930 1522 983 977 --
NM_001039711chr1--11086 ----
NM_001039712chr1--11086 ----
NM_001039715chr131021 132 92 ------
NM_001039716chr131085 196 156 ------
NM_001039840chrX55943 5629 5570 5364 3966 14257 2986 839 13846
NM_001039937chr1373926 3484 3255 2854 1198 1163 605 --52648 1082 768 162 74 --
NM_001040101chr43401 237 53 11555 11376 --
NM_001040110chr7196 11737 21408 720 --
NM_001040142chr212118 11952 ----
NM_001040143chr212118 11952 ----
NM_001040151chr1144153 1226 1061 29 --33619 3519 332 --
NM_001040152chr754908 3218 1381 1337 289 11653 34035 3482 1602 --
NM_001040159chr41398 ----11463
NM_001040214chr662367 366 285 202 61 35 11586 21936 499 --
NM_001040284chr16114931 4714 4272 4172 4154 4106 1047 707 446 112 41 --34385 1223 919 --
NM_001040429chr1353505 2356 499 443 393 ------
NM_001040441chr144164 1419 121 49 14157 --1109
NM_001040450chr1542496 2053 438 159 --1709 --
NM_001040453chr1542496 2053 438 159 --1709 --
NM_001040633chr72732 212 ------
NM_001040665chr774567 4271 4218 3770 1802 133 61 --24814 854 --
NM_001040709chr1102436 2019 1930 1614 1608 968 642 555 508 69 --11874 --
NM_001042353chr204545 493 403 386 139 ----
NM_001042355chr1685050 4592 3627 3350 3267 1852 1602 943 14474 21203 521 11257
NM_001042357chr1031104 422 377 --21462 199 --
NM_001042358chr1031104 422 377 --21462 199 --
NM_001042360chr1031104 422 377 --21462 199 --
NM_001042361chr1031135 453 408 --31493 230 24 --
NM_001042363chr1031104 422 377 --21462 199 --
NM_001042364chr1031135 453 408 --31493 230 24 --
NM_001042365chr1031135 453 408 --31493 230 24 --
NM_001042383chr3112939 2629 2515 2120 2106 1254 1197 955 926 287 236 ------
NM_001042387chr1031135 453 408 --31493 230 24 --
NM_001042388chr184942 683 104 75 ----1211
NM_001042389chr1031104 422 377 --21462 199 --
NM_001042390chr1031104 422 377 --21462 199 --
NM_001042392chr1031104 422 377 --21462 199 --
NM_001042393chr1031135 453 408 --31493 230 24 --
NM_001042395chr1031104 422 377 --21462 199 --
NM_001042396chr1031135 453 408 --31493 230 24 --
NM_001042397chr1031135 453 408 --31493 230 24 --
NM_001042404chr13519 328 298 11449 11893 --
NM_001042412chr1685050 4592 3627 3350 3267 1852 1602 943 14474 21203 521 11257
NM_001042413chr931031 408 36 --13188 12580
NM_001042414chr13------1229
NM_001042440chr531279 1270 808 --164 --
NM_001042441chr531279 1270 808 --164 --
NM_001042442chr531279 1270 808 --164 --
NM_001042443chr531279 1270 808 --164 --
NM_001042444chr531279 1270 808 --164 --
NM_001042445chr531279 1270 808 --164 --
NM_001042446chr531279 1270 808 --164 --
NM_001042473chr1041510 1452 1428 46 1464 ----
NM_001042475chr6290 31 ------
NM_001042490chr51109 ------
NM_001042492chr1753432 2596 1354 553 500 --12372 --
NM_001042494chr1542767 1150 177 27 12382 --13302
NM_001042495chr1542767 1150 177 27 12382 --13302
NM_001042496chr1542767 1150 177 27 12382 --13302
NM_001042497chr1542767 1150 177 27 12382 --13302
NM_001042506chrX1892 ------
NM_001042510chr84808 627 532 516 156 --11847
NM_001042511chr84808 627 532 516 156 --11847
NM_001042517chr131852 --1729 196
NM_001042533chr322902 2637 12142 12339 --
NM_001042537chrX82460 2299 2022 1920 1854 1657 655 505 1666 1539 --
NM_001042543chr4--1574 ----
NM_001042550chr92550 29 1677 11701 --
NM_001042555chr1264705 1596 1313 1123 490 436 13110 14608 --
NM_001042599chr247345 5618 2943 2047 14777 15450 --
NM_001042603chr1274932 4507 4031 2014 1718 1392 564 154 24266 114 --
NM_001042604chr344648 3434 1581 325 14606 --13810
NM_001042631chr191441 ------
NM_001042669chr42535 68 ----11722
NM_001042681chr142605 1722 589 62 --12350 --
NM_001042682chr142605 1722 589 62 --12350 --
NM_001042682chr142605 1722 589 62 --12350 --
NM_001043318chr1473522 3321 3104 2841 1393 1117 572 --12669 --
NM_001043351chr142335 2129 2105 1806 --41624 395 98 80 --
NM_001044305chr631677 1626 128 ------
NM_001044385chr284010 3713 3282 3138 2773 2689 2503 410 --23918 3035 --
NM_001044722chr512015 --11689 --
NM_001044723chr512015 --11689 --
NM_001046chr532344 2042 867 --21897 105 --
NM_001068chr3172 ------
NM_001071775chr1321962 386 --21742 1522 --
NM_001078chr12681 235 --1553 --
NM_001083620chr43474 258 161 ------
NM_001087chr21139 --1119 --
NM_001092chr172888 387 --11733 12428
NM_001096chr17----1241 --
NM_001099678chr3136260 5868 5681 5252 4631 4178 4072 2413 2089 2047 1962 1913 1412 --12251 --
NM_001100108chr1107817 7761 7544 7510 6841 6485 3192 1414 1376 1037 11264 13328 --
NM_001106chr3199578 9489 8125 7801 7415 6840 3622 3433 3254 3197 3073 2865 2813 2756 2715 1810 1192 828 759 12430 33788 870 130 18612
NM_001113490chrX83475 2787 2776 2688 2300 982 801 126 ------
NM_001116chr1632785 2092 267 --1331 --
NM_001117chr1832478 1838 1011 ------
NM_001121chr101294 1122 11312 --
NM_001126chr1275 52 ------
NM_001128chr1633046 1090 650 --33338 2481 155 --
NM_001167chrX126578 5901 5842 5832 5707 5448 2525 2082 1915 1246 1171 823 12310 --24707 71
NM_001177chr1242291 1636 622 559 ------
NM_001178chr111112 ------
NM_001198chr641668 1649 537 42 --1884 11876
NM_001200chr2021065 832 1121 ----
NM_001201chr443522 3425 2868 1009 ------
NM_001202chr14------1193
NM_001204chr2107059 6590 6570 5145 2575 2530 1548 1434 1194 753 --26453 2253 47466 5393 1868 1165
NM_001206chr953055 2986 632 434 427 --13010 --
NM_001241chr21175 1743 --12438
NM_001241chr21175 1743 --12438
NM_001248chr32335 226 --2957 806 --
NM_001256chr1742907 2095 883 503 --42487 2389 972 426 --
NM_001257chr161253 --1259 --
NM_001259chr741576 1355 1261 109 --65496 4960 4639 1501 1048 465 --
NM_001261chr941137 854 395 55 --1272 --
NM_001262chr11306 --2228 65 --
NM_001270chr56443 376 336 101 81 31 --11100 --
NM_001271chr1563116 2850 1309 328 237 160 1376 --12689
NM_001289chrX31329 1297 1265 ------
NM_001290chr43917 215 136 --1406 --
NM_001304chr1732931 2722 2360 13739 ----
NM_001315chr631469 573 51 ----1221
NM_001319chr192198 58 ------
NM_001329chr1041633 1506 434 402 ----11482
NM_001331chr1172429 1944 1857 1085 821 772 463 --1315 --
NM_001345chr121230 ------
NM_001346chr372750 2116 1793 1154 1038 1028 295 ------
NM_001351chr331563 1365 1315 ----11682
NM_001356chrX22268 877 ------
NM_001364chr1194363 4020 3492 2930 2895 1610 1356 1066 873 --23216 1415 --
NM_001386chr842213 1895 1644 699 ------
NM_001390chr1863225 3018 1077 879 691 648 --13088 --
NM_001394chr82568 243 ------
NM_001396chr2131033 973 955 ----1837
NM_001399chrX83709 3261 3102 2468 1136 1018 578 262 11218 2186 173 --
NM_001400chr1----11321 --
NM_001401chr921064 302 --21458 1414 --
NM_001407chr371587 1367 1279 647 560 447 213 11101 ----
NM_001408chr131553 311 147 --11380 --
NM_001412chrX43141 3040 2535 366 --1718 --
NM_001416chr171510 ------
NM_001417chr122732 115 --21977 1448 --
NM_001419chr1964151 4088 3987 3849 3411 950 11301 11756 13213
NM_001420chr1913138 ------
NM_001421chrX31602 1566 244 --21536 198 --
NM_001426chr22542 297 ------
NM_001429chr22155 --1710 --
NM_001440chr842660 2017 1897 79 12815 1527 --
NM_001448chrX1347 --31355 150 79 --
NM_001453chr621592 1573 ------
NM_001491chr652409 2052 298 290 73 --11786 --
NM_001494chr101705 ------
NM_001497chr93761 656 580 --52736 2577 2515 2082 421 --
NM_001498chr621166 920 ------
NM_001527chr654579 3127 3113 1233 264 --34117 3150 285 --
NM_001543chr594823 3955 3897 3760 3109 3019 1719 1176 646 11194 ----
NM_001546chr611326 1348 ----
NM_001609chr1083702 3483 3302 3169 2827 1570 511 351 23970 3346 44407 3200 3016 153 --
NM_001621chr7------11130
NM_001621chr7------11130
NM_001622chr32361 84 --1303 1278
NM_001634chr631814 1779 394 --11642 --
NM_001642chr1151308 924 856 238 117 ------
NM_001659chr1212198 --22389 2228 --
NM_001663chr1442692 538 285 240 --2965 587 --
NM_001668chr121686 273 --21948 1483 --
NM_001677chr11277 --11119 --
NM_001678chr1741150 482 145 115 --2631 527 --
NM_001681chr12------1692
NM_001682chr1232447 1059 246 --12029 --
NM_001683chr332343 2073 1733 --11748 --
NM_001693chr831292 1067 961 2325 180 ----
NM_001701chr931538 1249 53 11114 21353 240 11443
NM_001706chr31313 ----1320
NM_001718chr621176 104 ------
NM_001746chr52328 22 --32426 2355 778 --
NM_001750chr531279 1270 808 --164 --
NM_001753chr711441 --11557 --
NM_001754chr2143602 1702 663 383 13669 ----
NM_001755chr16133 --21729 921 --
NM_001759chr1255341 4972 3218 348 139 23771 1240 1875 --
NM_001777chr361669 1234 955 564 325 208 --22646 80 --
NM_001781chr121101 --1850 --
NM_001802chr164912 870 814 225 ------
NM_001806chr1972751 2396 2374 2042 1181 637 295 122 12348 11011
NM_001819chr202191 49 ------
NM_001826chr11375 ------
NM_001844chr122143 100 ------
NM_001855chr92750 636 ------
NM_001858chr665115 4313 936 905 894 315 1954 1369 --
NM_001859chr922965 332 13206 12732 125
NM_001863chr191104 ------
NM_001873chr41574 --1500 --
NM_001874chr1265050 5042 4876 4346 116 93 14673 1381 24783 4568
NM_001880chr2145 ------
NM_001892chr511115 --11281 --
NM_001895chr201973 ------
NM_001903chr5--1792 ----
NM_001924chr1----1169 --
NM_001931chr1111291 --2506 255 --
NM_001938chr1----11883 --
NM_001939chrX73438 2403 1423 1353 1219 1128 638 ------
NM_001941chr1831563 1290 1268 22590 1140 23920 505 --
NM_001949chr653191 2404 960 810 378 ----13211
NM_001951chr81538 ------
NM_001955chr6------11099
NM_001964chr51213 ------
NM_001969chr1483106 3062 2855 2624 2476 1331 610 330 23472 1512 12896 12612
NM_001980chr1232153 739 581 --51535 877 596 258 120 --
NM_001981chr131767 1672 612 ------
NM_001993chr15912 746 692 354 139 ------
NM_001995chr43496 350 121 --164 --
NM_001998chr31121 ------
NM_001999chr51133 ------
NM_002006chr454690 3750 2185 1841 725 13839 24151 251 14800
NM_002017chr1131168 1093 917 --21328 73 --
NM_002024chrX1543 --21783 1653 --
NM_002025chrX108678 8635 8494 7411 2845 2745 2321 2154 1785 625 --27226 2068 --
NM_002035chr1863900 2619 1414 871 394 78 --52868 2759 1441 1066 1010 --
NM_002039chr43679 128 72 ------
NM_002040chr2143035 1008 762 162 1931 12672 --
NM_002044chr153554 235 58 ------
NM_002048chr92477 210 1377 ----
NM_002051chr101869 ----1318
NM_002063chrX126 ----1871
NM_002069chr71172 --11401 1301
NM_002072chr9----1981 --
NM_002077chr932053 1993 165 ------
NM_002081chr221177 164 --141 11465
NM_002114chr6----1537 --
NM_002128chr1312279 12060 ----
NM_002130chr541467 1206 1127 665 ------
NM_002135chr12----1508 --
NM_002137chr72714 535 1949 ----
NM_002138chr41544 ------
NM_002139chrX----1193 --
NM_002148chr21190 --1159 --
NM_002167chr12193 128 --1436 --
NM_002196chr201696 ------
NM_002196chr201696 ------
NM_002202chr51749 ----1253
NM_002204chr172357 39 1387 ----
NM_002210chr232799 2338 204 32663 485 405 ----
NM_002211chr102894 787 --1251 --
NM_002213chr33480 244 117 ------
NM_002214chr753898 1866 1400 1390 1376 --1182 13667
NM_002223chr1233938 2570 1318 ------
NM_002227chr11401 11333 ----
NM_002228chr12497 282 1892 11228 --
NM_002232chr151380 1206 543 509 428 ------
NM_002235chr1251558 1364 1217 1195 96 ------
NM_002264chr332005 1748 1170 ----11199
NM_002265chr1721058 216 --2837 427 --
NM_002267chr1332069 1743 429 ----12249
NM_002270chr585345 5071 4642 4364 3655 3644 1100 507 --24808 1724 11433
NM_002285chr284107 3593 3296 3007 2970 1667 1487 384 14063 1138 --
NM_002293chr132654 1890 715 ------
NM_002312chr13134 --1845 --
NM_002317chr5----1359 --
NM_002334chr1112039 22081 1869 ----
NM_002336chr1274215 4123 3698 3465 1612 1559 1550 13158 24880 4049 14391
NM_002349chr241594 1567 1234 578 1130 ----
NM_002356chr631819 1116 904 --12295 22219 762
NM_002359chr17104153 3620 3408 2895 1621 1461 1223 1113 694 175 --44172 3531 1534 1217 --
NM_002380chr8--1398 ----
NM_002397chr532172 835 375 12140 ----
NM_002398chr21451 ----11142
NM_002399chr152916 378 11124 ----
NM_002430chr2221631 345 --12110 --
NM_002445chr83328 144 87 --2156 121 --
NM_002449chr521112 479 ------
NM_002467chr81157 ------
NM_002480chr1211237 1974 11283 --
NM_002481chr167542 5881 5132 3159 3073 764 --87850 7584 6866 5985 4906 2835 988 573 16286
NM_002485chr832121 1946 119 ------
NM_002489chr7--1292 ----
NM_002500chr2----1472 --
NM_002501chr1962618 1509 1211 1139 437 376 ------
NM_002522chr1783804 3366 1110 1011 984 832 358 59 --12572 --
NM_002524chr12750 69 ------
NM_002538chr52555 498 --2523 74 --
NM_002545chr1144871 1635 1477 401 154 34993 3936 3930 14131
NM_002563chr31831 ------
NM_002576chr114988 906 135 117 ------
NM_002577chr353687 2783 2739 2549 596 --54034 3693 872 306 179 --
NM_002581chr985588 5226 5022 4444 1938 1195 816 92 --14250 14575
NM_002588chr561663 1591 1388 714 479 471 ------
NM_002589chr41341 --149 --
NM_002590chr13----1229 --
NM_002597chr11332 ------
NM_002600chr121865 190 --21485 115 --
NM_002605chr152464 400 ------
NM_002613chr1655111 4741 1714 1394 912 --23782 1311 --
NM_002618chr23481 371 171 ------
NM_002645chr1133120 1040 288 --12783 --
NM_002646chr1122105 1762 1641 1627 1619 1454 783 722 664 494 465 136 ------
NM_002648chr621000 991 11288 ----
NM_002649chr741441 1154 676 277 --21424 621 --
NM_002655chr875258 4574 4254 3993 3737 1086 244 1320 ----
NM_002657chr2083577 3413 2697 2441 774 506 369 258 --23459 824 --
NM_002668chrX1140 ------
NM_002687chr14----11186 --
NM_002703chr431944 1224 723 --21765 446 11597
NM_002709chr223548 3427 1143 ----
NM_002710chr121964 --21065 310 --
NM_002716chr112148 25 --33302 3046 1413 --
NM_002718chr361896 1769 617 530 458 95 1664 22684 2382 12489
NM_002719chr1432107 336 177 1422 ----
NM_002729chr103875 679 186 1176 ----
NM_002734chr1731723 784 222 --11809 --
NM_002736chr711646 --4781 594 512 228 --
NM_002737chr1796193 5573 5362 4914 4906 2659 2417 1989 94 --22015 1751 --
NM_002745chr2274370 4306 4128 3864 1319 1239 232 ------
NM_002748chr1541099 905 290 148 ------
NM_002750chr10173 ------
NM_002765chrX61018 377 276 121 46 39 --1257 --
NM_002787chr72654 83 --1269 --
NM_002806chr141310 ------
NM_002808chr31151 ------
NM_002822chr1211130 2654 357 1553 --
NM_002825chr71228 --1542 --
NM_002828chr181818 ------
NM_002834chr1273632 3347 3055 1464 1103 1027 43 --31537 1394 576 --
NM_002837chr1244519 4179 3779 277 --14386 13273
NM_002847chr7163 ----170
NM_002852chr31462 1216 ----
NM_002858chr11338 ----11111
NM_002868chr1251801 1651 932 851 196 12292 2922 601 12207
NM_002869chr1122043 153 ------
NM_002874chr931838 356 76 --12306 --
NM_002886chr384973 4262 4025 3596 1738 1451 1000 136 --13264 14537
NM_002906chr1132130 921 63 ----11760
NM_002941chr31271 ------
NM_002942chr321442 1157 ------
NM_002945chr171672 ------
NM_002959chr194471 4459 3679 3602 3377 3274 1644 889 325 --23203 1134 --
NM_002970chrX------1242
NM_002998chr82698 79 ----21933 358
NM_002999chr201102 131 3557 396 231 --
NM_003013chr42672 322 ------
NM_003016chr1741785 1514 1334 718 --21343 1291 --
NM_003026chr92490 144 --1135 --
NM_003037chr1125 ------
NM_003043chr344102 3883 3571 1356 11515 23231 380 --
NM_003045chr1383766 3486 3166 1738 1041 749 360 144 14062 11553 --
NM_003046chr865070 4485 3576 967 559 462 ----14396
NM_003068chr8--11070 ----
NM_003069chrX1557 ------
NM_003071chr341498 586 335 216 ------
NM_003095chr123309 277 72 ------
NM_003107chr611673 ------
NM_003108chr276888 5514 2427 2204 1149 1023 764 11307 14870 --
NM_003112chr71588 2339 317 ----
NM_003129chr8160 ------
NM_003130chr731198 870 103 ------
NM_003133chr1121 ------
NM_003142chr2149 ------
NM_003144chr622234 1759 ----22226 657
NM_003155chr862505 2296 2115 1070 602 503 --1916 --
NM_003161chr1712367 --11245 11434
NM_003174chr101574 ------
NM_003178chr342095 1689 843 471 ----1290
NM_003185chr202392 24 21132 965 1239 --
NM_003188chr62219 44 ------
NM_003189chr163099 2268 2073 1046 421 310 --13302 12826
NM_003199chr1864999 3647 3507 1370 708 227 1613 23814 1639 --
NM_003200chr1992243 2056 1775 1738 1474 953 266 219 204 12332 ----
NM_003206chr6----1357 --
NM_003216chr2273027 2821 2407 2220 1217 1052 163 ----23255 2448
NM_003234chr352450 1845 1829 433 322 2797 608 11822 --
NM_003236chr283039 2681 2452 744 196 147 116 104 --12614 --
NM_003239chr142941 248 ------
NM_003242chr322110 697 --12307 --
NM_003247chr6--1248 11432 1117
NM_003253chr211129 --11572 11453
NM_003262chr324256 3904 --24624 878 21166 944
NM_003270chrX2905 378 11127 1446 --
NM_003274chr2142046 254 186 93 12976 12878 12452
NM_003288chr202599 384 ------
NM_003292chr162186 2162 1738 460 292 216 ----1734
NM_003314chr5131 ------
NM_003317chr141101 ------
NM_003337chr531438 1407 434 ----11663
NM_003338chr101664 1791 1598 --
NM_003340chr441407 1311 1107 1016 ------
NM_003342chr1773285 2986 2872 2855 2332 2077 656 12760 1848 --
NM_003348chr1231171 1063 422 ------
NM_003352chr21701 --3906 380 325 --
NM_003368chr1------1701
NM_003369chr1152759 2696 2341 2264 133 --1681 --
NM_003370chr19179 ------
NM_003385chr22637 316 ------
NM_003390chr1151103 957 916 322 124 ------
NM_003392chr354048 3559 3512 3414 234 ------
NM_003400chr21806 ------
NM_003404chr203536 109 22 ----1819
NM_003407chr191154 1509 ----
NM_003409chr182403 156 ------
NM_003410chrX1824 --2141 38 --
NM_003412chr332362 2292 2065 --11247 --
NM_003413chrX21784 1271 ------
NM_003418chr31160 ------
NM_003457chr17----1541 1102
NM_003458chr353193 2641 1547 1055 251 --33941 2905 2457 --
NM_003463chr61287 1429 1255 --
NM_003468chr233732 3250 1255 --13827 14206
NM_003470chr1641614 1552 1480 413 --1443 --
NM_003473chr10----1167 --
NM_003478chr1162893 2716 961 595 382 96 ------
NM_003482chr1232234 516 387 12560 ----
NM_003483chr1232386 320 44 --22772 2087 --
NM_003489chr2132726 1105 29 --22214 1113 --
NM_003506chr82821 55 --11327 --
NM_003528chr11674 11727 ----
NM_003559chr1783830 3250 3134 2826 1309 1261 1003 328 1163 11110 13396
NM_003563chr173979 231 142 ------
NM_003566chr1232836 2495 1170 ------
NM_003574chr1864964 4620 4481 4352 4104 147 11956 25373 5316 --
NM_003582chr1----1217 150
NM_003583chr1253474 3458 2861 1405 1195 12947 ----
NM_003590chr233911 2970 2705 --11046 --
NM_003597chr232259 1551 546 --32190 2180 537 1924
NM_003603chr411429 --32034 1489 1401 --
NM_003607chr174373 4110 4025 3726 3670 1732 202 13235 13860 --
NM_003615chr313583 13394 --12826
NM_003618chr211021 --11262 1989
NM_003622chr1232472 1036 553 --41029 869 662 646 --
NM_003628chr21184 ------
NM_003629chr173084 2827 2560 2520 2502 2394 927 --23211 1393 12771
NM_003631chr10183 ------
NM_003633chr53579 324 251 ----1627
NM_003637chr11132 --21494 138 --
NM_003642chr2------172
NM_003663chr333069 1350 1140 12752 23429 1368 --
NM_003671chr9103314 2920 2900 2883 2655 2374 2350 1004 982 703 --1345 --
NM_003677chr1261871 818 781 661 68 30 --1417 --
NM_003679chr193447 3293 3129 2910 2533 2447 2409 864 854 ------
NM_003693chr172586 232 --1861 --
NM_003701chr13----1145 2833 272
NM_003704chr41505 ------
NM_003705chr21642 ------
NM_003713chr141704 1302 1289 322 1569 1153 1468
NM_003716chr32908 667 --1167 --
NM_003718chr7146 ------
NM_003728chr41504 ------
NM_003735chr561663 1591 1388 714 479 471 ------
NM_003736chr561663 1591 1388 714 479 471 ------
NM_003744chr1431230 411 78 ----11282
NM_003749chr1332156 1660 682 1555 1303 --
NM_003750chr101882 ------
NM_003759chr433192 2861 563 --14241 --
NM_003763chr2062443 2431 2118 912 222 62 --23132 2824 --
NM_003774chr1232723 2078 600 11220 33334 2861 2585 --
NM_003779chr12498 329 ------
NM_003800chr62878 309 --11909 12086
NM_003818chr2031011 847 78 ------
NM_003822chr132484 1963 346 1822 22512 1203 --
NM_003825chr1511259 11307 ----
NM_003831chr182275 77 ----11298
NM_003842chr872214 2194 2030 1910 1832 483 29 --11714 1697
NM_003861chr1452112 1803 1096 534 364 1804 ----
NM_003872chr242706 2599 2489 543 --32089 2058 389 --
NM_003877chr122918 685 ------
NM_003884chr31506 1431 1745 --
NM_003899chr1372427 2200 1881 1670 1658 673 304 1853 ----
NM_003902chr11531 192 1631 --
NM_003913chr624331 3647 23423 804 1647 11148
NM_003916chrX123 ------
NM_003919chr7----1247 1221
NM_003921chr11679 11700 159 --
NM_003924chr42607 432 ------
NM_003927chr185996 742 735 388 31 ------
NM_003931chr61632 ------
NM_003939chr1043671 1349 818 337 --54055 3632 3315 2779 2585 11510
NM_003941chr722441 1667 1433 11978 --
NM_003947chr311174 ------
NM_003948chr482364 1810 981 753 701 688 640 144 ------
NM_003983chr1611436 21447 884 --1426
NM_003994chr1214016 --11633 1147
NM_004006chrX22155 1782 --1750 --
NM_004007chrX22155 1782 --1750 --
NM_004009chrX22155 1782 --1750 --
NM_004010chrX22155 1782 --1750 --
NM_004011chrX22155 1782 --1750 --
NM_004012chrX22155 1782 --1750 --
NM_004013chrX22155 1782 --1750 --
NM_004014chrX22155 1782 --1750 --
NM_004015chrX22155 1782 --1750 --
NM_004016chrX22069 1696 --1664 --
NM_004017chrX22155 1782 --1750 --
NM_004018chrX22069 1696 --1664 --
NM_004020chrX22155 1782 --1750 --
NM_004021chrX22069 1696 --1664 --
NM_004022chrX22069 1696 --1664 --
NM_004023chrX22069 1696 --1664 --
NM_004035chr17105144 4534 4265 4146 4115 3722 3314 3201 1500 246 --34865 3877 285 --
NM_004036chr22606 74 1105 ----
NM_004040chr2----1979 --
NM_004050chr1462497 2243 2078 1728 1109 994 --22720 738 --
NM_004052chr102176 21 ------
NM_004068chr31438 ------
NM_004081chrY11341 --21570 406 11709
NM_004087chr32395 232 --1550 --
NM_004096chr10----21359 294 --
NM_004098chr101489 ------
NM_004099chr932080 502 271 --31969 1963 1326 1385
NM_004100chr631071 958 376 --1534 2519 405
NM_004103chr82849 677 ------
NM_004109chr1121512 656 1276 --1576
NM_004114chrX31055 264 153 ------
NM_004115chr13126 ------
NM_004124chr1432579 831 242 ------
NM_004126chr71111 ------
NM_004161chr211261 --1156 --
NM_004162chr32878 90 ------
NM_004171chr1198628 7358 6158 3684 3376 3309 2191 2169 1701 13165 16759 --
NM_004193chr102529 187 ------
NM_004200chr1142658 2548 1127 250 --11180 --
NM_004225chr821003 588 11026 ----
NM_004230chr1971873 1804 923 901 574 566 408 ------
NM_004232chr18------21141 703
NM_004241chr10--1813 --182
NM_004263chr251541 1401 1337 499 179 11165 21720 335 --
NM_004267chr31496 ------
NM_004272chr531452 1243 135 ------
NM_004274chr1471190 1022 314 195 139 96 72 --22701 2221 --
NM_004281chr10--179 --2490 435
NM_004293chr963870 3614 3516 3254 1390 948 12932 33374 2332 555 11290
NM_004311chr1042868 2356 281 176 --1731 --
NM_004316chr12139 ------
NM_004326chr1--1450 ----
NM_004329chr1031190 416 397 ------
NM_004330chr1521020 137 --1122 --
NM_004331chr832000 201 35 --1862 --
NM_004338chr1865943 5574 1751 875 827 342 --26181 2736 --
NM_004341chr21243 ------
NM_004342chr72894 251 --12025 --
NM_004349chr83329 283 202 ------
NM_004380chr16144 1379 ----
NM_004381chr6122 ------
NM_004384chr512015 --11689 --
NM_004385chr51716 ------
NM_004393chr392160 2083 2030 2007 470 202 193 115 79 --11575 --
NM_004395chr5----1167 --
NM_004397chr1133762 3627 1164 --23479 3074 --
NM_004405chr24901 857 672 237 ------
NM_004408chr93465 113 65 ------
NM_004415chr62692 34 ------
NM_004417chr52575 159 --1629 --
NM_004423chr3--12357 2837 343 1466
NM_004430chr852811 2448 1991 836 107 ------
NM_004431chr15838 540 318 158 58 193 ----
NM_004432chr942324 840 721 273 ------
NM_004434chr1441751 1629 1440 618 11183 ----
NM_004436chr12665 194 ------
NM_004438chr222045 844 22456 718 11004 --
NM_004440chr63481 449 298 --157 1358
NM_004442chr131615 1076 382 ------
NM_004443chr34693 254 77 61 ----193
NM_004449chr2131359 1220 396 --31271 1048 241 --
NM_004458chrX32129 1928 1795 --22250 2099 --
NM_004464chr423380 787 --21229 316 --
NM_004482chr2----2897 669 --
NM_004485chr1114365 4302 3902 3529 3199 3155 1546 1532 1522 782 616 --137 --
NM_004491chr1974351 4158 3715 3705 3293 1424 862 14343 33930 363 63 --
NM_004492chr15174 ------
NM_004494chr141099 219 165 77 --11036 --
NM_004500chr1431750 622 259 --21520 1259 --
NM_004501chr144025 3174 2952 1606 --33066 2708 276 --
NM_004504chr252954 2712 2631 2533 421 --1734 32244 677 91
NM_004505chr1711553 ----11859
NM_004514chr1742844 2083 1046 494 --32660 1163 847 1142
NM_004516chr1911058 1804 ----
NM_004519chr8144 ----1216
NM_004529chr91404 ----1529
NM_004540chr211686 ----185
NM_004566chr10102492 2456 2449 2051 1947 836 640 494 364 278 ------
NM_004571chr2143189 2576 1309 885 11159 23088 26 --
NM_004576chr5------196
NM_004577chr73539 441 120 --1450 --
NM_004580chr152585 50 31509 1361 381 1626 --
NM_004586chrX54511 3977 3680 3588 1248 --35134 3849 3668 --
NM_004593chr31859 --1113 --
NM_004595chrX4409 379 325 48 ------
NM_004602chr2061146 1057 970 575 433 218 ------
NM_004612chr954610 2972 1169 533 455 21679 488 --21830 1628
NM_004650chrX41843 1516 463 377 --1348 --
NM_004654chrY11427 ------
NM_004655chr172299 146 --11281 11133
NM_004660chrY42174 1572 612 408 ----1315
NM_004664chr12----2312 218 --
NM_004666chr611262 --1397 --
NM_004673chr1----21191 1140 --
NM_004685chr1322717 1826 --12736 --
NM_004687chr1721349 50 11372 21951 1554 --
NM_004703chr1742484 2293 200 184 1564 22468 742 --
NM_004709chrX31339 247 238 ------
NM_004711chr2263624 3321 1187 1166 876 731 --33135 2545 1278 --
NM_004713chr141640 ------
NM_004717chr731574 1025 477 ------
NM_004719chr122733 688 --52563 1881 1078 765 407 --
NM_004723chr15942 915 852 812 347 ------
NM_004726chrX55649 3900 2081 2057 49 25047 4660 2138 34 15617
NM_004730chr521476 1349 ------
NM_004734chr1362935 2513 2371 2215 486 198 ----12797
NM_004737chr2251194 984 506 157 72 --1814 --
NM_004738chr2052485 2337 1777 313 185 --32047 1850 237 --
NM_004739chr112591 476 ------
NM_004742chr331548 170 157 --1698 --
NM_004744chr443893 3349 3207 2971 13517 ----
NM_004745chr886760 6287 6253 5635 5012 4408 2414 229 12080 26681 943 --
NM_004748chr1564130 3789 3751 2706 818 175 11285 1866 --
NM_004760chr72829 554 --12382 --
NM_004768chr121174 972 --1918 --
NM_004774chr1742503 2479 880 505 ------
NM_004779chr521076 135 ------
NM_004781chr151444 1196 242 56 50 11381 --1709
NM_004781chr151444 1196 242 56 50 11381 --1709
NM_004787chr41143 ------
NM_004788chr1142767 2202 1023 479 12098 ----
NM_004789chr91347 ------
NM_004796chr142585 344 --11923 --
NM_004798chr2042990 2881 2761 124 --33530 3524 281 --
NM_004805chr231358 305 77 1392 ----
NM_004808chr1062804 2459 2333 2309 1039 206 12837 22512 638 --
NM_004834chr2129 12201 23194 1075 --
NM_004845chrX93592 3191 1571 1277 1246 1208 1126 713 307 24047 3539 ----
NM_004856chr152488 389 ------
NM_004863chr1423903 1405 --23336 57 15301
NM_004871chr17103384 3192 3153 2666 1760 1743 1528 1475 736 693 --11769 11537
NM_004873chr1452626 2541 2043 1034 806 --22948 2424 --
NM_004874chr8--1465 ----
NM_004884chr153499 410 269 --11255 11722
NM_004887chr5160 ------
NM_004888chr9----1292 11119
NM_004891chr2----122 --
NM_004897chr101923 ----1910
NM_004898chr431820 307 69 ----12302
NM_004902chr20----1816 --
NM_004904chr742151 1842 658 22 ------
NM_004912chr711154 11436 11177 --
NM_004926chr1421619 1504 --11278 --
NM_004932chr531645 1363 151 --11339 --
NM_004937chr1761085 1003 931 481 322 34 --31968 1656 369 --
NM_004952chr15923 880 697 222 67 --2948 688 --
NM_004955chr62419 110 ------
NM_004956chr722873 598 ----13714
NM_004958chr12358 309 --2709 98 --
NM_004966chr102732 291 ------
NM_004972chr91289 ------
NM_004976chr1165120 3686 3620 1762 1328 390 --15026 --
NM_004983chr11287 --1243 --
NM_004985chr1254475 4380 3107 1521 413 ------
NM_004992chrX166682 6054 5932 5904 5829 3283 2655 2431 1687 1641 1451 1425 886 818 699 539 ------
NM_004992chrX166682 6054 5932 5904 5829 3283 2655 2431 1687 1641 1451 1425 886 818 699 539 ------
NM_004993chr1441508 1091 305 109 --2957 178 --
NM_004996chr1611725 ------
NM_005011chr7196 11737 21408 720 --
NM_005026chr122025 155 ------
NM_005028chr10----1209 --
NM_005032chrX1112 ------
NM_005045chr73742 235 181 ------
NM_005056chr1265176 4751 4275 1962 1636 808 2298 230 24510 358 --
NM_005063chr1053463 3381 2710 2576 2448 ------
NM_005065chr1454711 4599 4092 658 79 13853 14702 --
NM_005068chr631439 528 255 ------
NM_005079chr842841 1239 638 274 --1349 --
NM_005095chr141550 1452 132 102 1346 1612 --
NM_005096chrX41184 928 861 392 --11094 --
NM_005116chr2073298 1584 1370 729 541 517 22 --24336 3924 --
NM_005121chr1743064 2591 2495 143 23544 1493 11180 --
NM_005124chr6----1960 --
NM_005126chr34428 307 274 100 ------
NM_005134chr184942 683 104 75 ----1211
NM_005135chr1542767 1150 177 27 12382 --13302
NM_005141chr4----1122 --
NM_005151chr1842425 2100 1756 775 ----1569
NM_005156chr964771 4582 3808 3366 2134 507 --54551 4383 4095 1460 810 --
NM_005168chr231336 487 220 ----2459 158
NM_005180chr1031611 635 235 ------
NM_005184chr1921107 40 --11225 --
NM_005188chr11147098 7024 6972 6904 6722 6181 5705 2900 2459 2305 1843 1823 908 94 --57687 7006 6806 5220 1044 16024
NM_005190chr611124 ------
NM_005197chr1475483 5247 4638 4544 4322 4170 982 11927 35838 5070 2235 12330
NM_005201chr321178 271 ------
NM_005204chr102119 40 --1725 --
NM_005207chr2273743 3624 3057 2318 1010 869 800 --13547 --
NM_005214chr21886 --2944 395 --
NM_005221chr72250 231 ------
NM_005233chr332550 2371 2192 --22320 1594 --
NM_005235chr247345 5618 2943 2047 14777 15450 --
NM_005238chr1151363 1069 1030 248 38 ------
NM_005239chr2142030 1542 1495 795 12003 11610 1135
NM_005240chr11630 --2558 275 --
NM_005241chr31223 ----1134
NM_005243chr22--1229 ----
NM_005245chr41654 ----131
NM_005252chr14--2488 118 ----
NM_005263chr121194 388 --1104 --
NM_005277chr42200 122 ------
NM_005296chrX----1288 --
NM_005308chr101399 ------
NM_005311chr742685 2227 1144 822 1775 22367 2298 --
NM_005324chr1731969 343 269 --167 --
NM_005329chr1672116 1542 1478 902 793 733 162 --1532 --
NM_005337chr123344 306 38 ------
NM_005339chr453601 3088 1515 551 463 --13535 --
NM_005349chr4133 --1634 --
NM_005358chr131302 --21547 313 --
NM_005359chr1864861 2374 2330 2306 2142 1794 15244 65935 5315 5213 1814 1201 1054 14837
NM_005375chr62772 49 ------
NM_005382chr81382 ------
NM_005388chr941049 608 533 187 ----1327
NM_005397chr783389 2613 1498 1389 1376 1053 910 338 2270 140 ----
NM_005398chr1031181 916 30 11244 ----
NM_005400chr232774 2358 22 --22647 2315 --
NM_005402chr721741 329 --11728 --
NM_005406chr1831073 461 354 ----11126
NM_005430chr121983 ------
NM_005433chr181706 --1820 --
NM_005436chr1074062 3696 2601 2503 473 200 98 --13242 --
NM_005442chr3--1223 1537 --
NM_005443chr43528 417 393 ------
NM_005455chr121595 1446 ------
NM_005458chr93617 183 117 --11528 --
NM_005465chr111347 --41867 1652 1403 344 --
NM_005475chr1232983 2765 375 --180 --
NM_005476chr94885 346 338 25 --1116 --
NM_005493chr61643 --1714 --
NM_005494chr72162 98 ------
NM_005497chr1786132 3843 2465 1674 1460 1386 603 68 ------
NM_005502chr931096 1076 49 ------
NM_005517chr12523 457 --2934 282 --
NM_005524chr3198 ------
NM_005573chr5----1268 1136
NM_005578chr355102 4746 3195 211 201 ------
NM_005593chr12125 --1504 --
NM_005595chr11283 ------
NM_005596chr966334 5380 5344 4504 4365 2571 14784 25045 418 --
NM_005599chr11327 ------
NM_005603chr182185 70 --12048 --
NM_005610chr11870 188 ----
NM_005613chr151896 758 648 266 73 --11945 --
NM_005614chr71696 ----11081
NM_005630chr351450 1336 1254 718 41 ------
NM_005644chr1----1405 --
NM_005647chrX62905 2795 1340 975 597 97 1887 23053 2878 --
NM_005652chr1631040 314 148 ------
NM_005655chr811281 ------
NM_005659chr223424 175 153 ------
NM_005665chr144774 3696 3619 3359 --11425 23401 560
NM_005667chr2--1286 ----
NM_005668chr564345 1371 908 886 665 379 --13062 1196
NM_005676chrX----1155 --
NM_005698chr1146 ------
NM_005717chr111210 ------
NM_005721chr21103 --1909 --
NM_005725chr12860 217 --11777 --
NM_005734chr112771 230 ------
NM_005737chr252735 2568 682 252 183 --11830 --
NM_005739chr1542296 388 308 44 12211 ----
NM_005746chr73940 458 159 --22223 259 1526
NM_005748chr1222381 2238 --13431 --
NM_005751chr71498 ------
NM_005754chr531106 1014 237 --1185 --
NM_005756chrX31554 1452 356 ------
NM_005759chr284795 4590 3338 1733 1474 906 323 184 --24312 3588 --
NM_005779chr532342 2310 941 23644 1128 12742 --
NM_005786chr1831099 119 67 --2829 210 --
NM_005789chr1741655 1315 574 509 ------
NM_005795chr222004 615 --2489 99 --
NM_005813chr242554 2530 2016 501 ------
NM_005822chr622053 1869 --31692 665 410 --
NM_005828chr1753963 3796 3727 1374 868 11142 24972 4584 --
NM_005832chr311101 --11419 --
NM_005839chr11864 ------
NM_005840chrX127489 7156 6760 6408 6256 6046 5151 2803 1709 1347 1293 647 16500 --27295 2709
NM_005859chr51192 ----1470
NM_005868chr721786 681 ------
NM_005875chr3197 ------
NM_005885chr561322 381 336 176 119 84 1474 21186 26 --
NM_005898chr1132792 2434 2085 --33083 801 344 --
NM_005899chr1711221 --147 --
NM_005900chr43265 253 112 ------
NM_005902chr1553589 3082 1517 1294 536 --14457 --
NM_005903chr563794 1862 906 701 638 402 --11960 1260
NM_005906chr631132 1042 267 11397 21467 1238 --
NM_005907chr651654 1409 607 488 311 ------
NM_005909chr583839 1716 1668 1150 1085 954 801 290 --13164 --
NM_005910chr17103920 3674 3622 3424 3326 3043 2545 1402 860 818 1994 22605 838 13168
NM_005911chr211338 --1340 --
NM_005935chr4125208 5182 5133 4902 4492 4146 1869 1329 1195 1121 980 690 --2439 226 --
NM_005937chr1784099 3806 3596 3111 1472 1345 501 53 --23383 672 --
NM_005943chr621309 643 ------
NM_005944chr331120 307 145 ------
NM_005955chr1135166 4716 4555 4100 4063 3771 3500 2212 2151 1846 1448 1099 661 13352 22163 1162 --
NM_005963chr17----181 --
NM_005966chr231718 821 721 ------
NM_005968chr19----1235 --
NM_005977chr13--1346 ----
NM_005986chr1342247 2228 1904 251 ------
NM_006007chr974520 3875 2917 2830 1753 685 513 ------
NM_006011chr1541683 1165 357 172 --1322 --
NM_006015chr131354 959 282 ------
NM_006016chr622308 108 ------
NM_006023chr101167 1202 ----
NM_006032chr141185 --1205 --
NM_006037chr263573 3491 3139 3110 822 582 --24218 4145 13697
NM_006047chr202721 32 13426 1948 --
NM_006048chr121067 820 ----1970
NM_006054chr1121504 1434 --11007 --
NM_006055chr243203 2675 616 453 --1887 12884
NM_006080chr742456 2196 621 591 ----12511
NM_006091chr1531624 362 171 --21760 1362 --
NM_006095chr423426 251 --24452 633 1714
NM_006106chr1152893 2607 2502 2371 187 --22970 590 12586
NM_006107chr172351 202 --1468 --
NM_006134chr2121557 262 ------
NM_006135chr12561 290 11211 ----
NM_006139chr242545 2129 958 260 ------
NM_006141chr1651864 1817 1034 904 54 ----12601
NM_006147chr11183 --1404 --
NM_006148chr1782932 2908 2676 2077 1822 967 872 286 ----12628
NM_006154chr1552489 2119 300 113 61 12205 12839 --
NM_006162chr1861395 1287 325 107 90 22 ------
NM_006166chr1232444 969 163 ------
NM_006178chr1771486 1117 655 613 402 66 58 ------
NM_006194chr141516 ----1207
NM_006195chr91424 ----1323
NM_006197chr8181 --12240 --
NM_006203chr575234 5127 5091 4837 4790 816 548 11983 1131 11931
NM_006206chr422939 2434 --12531 --
NM_006224chr1742413 1698 550 442 --32320 1569 977 --
NM_006226chr221385 436 ----1468
NM_006241chr32535 89 11930 12400 --
NM_006251chr542385 1162 398 322 ----12714
NM_006252chr122678 1630 12513 45918 5681 1110 906 16389
NM_006253chr12----11233 --
NM_006254chr3186 --1348 --
NM_006257chr1011013 --1146 --
NM_006265chr82963 617 11077 ----
NM_006267chr221779 1593 --21693 169 --
NM_006282chr2084565 2984 1883 1785 1356 1123 818 351 --23264 724 --
NM_006283chr884361 4296 3920 3661 3027 446 389 215 21565 1018 --24210 3676
NM_006306chrX85182 5102 5023 1999 1569 763 632 207 1984 44808 2206 891 872 --
NM_006311chr172113 98 --1341 --
NM_006319chr162747 604 ------
NM_006330chr81397 --1172 --
NM_006333chr21434 ------
NM_006345chr431254 536 34 --1894 --
NM_006350chr5157 ------
NM_006352chr121877 522 --11761 --
NM_006359chrX82460 2299 2022 1920 1854 1657 655 505 1666 1539 --
NM_006367chr1----1194 1714
NM_006370chr141229 --141 --
NM_006371chr3144668 4634 4131 4006 3659 3423 3382 2091 1796 1490 1085 849 462 438 ------
NM_006378chr931274 1069 173 ------
NM_006379chr722328 2139 --21490 615 --
NM_006380chr1754402 3052 2728 1436 609 13117 34276 2920 651 13801
NM_006393chr1074356 4125 3275 1539 1506 1151 159 1301 23379 1378 1535
NM_006403chr641745 1736 1495 517 --11344 --
NM_006420chr2032222 136 121 12484 12783 --
NM_006434chr1032950 294 64 ------
NM_006451chr521076 758 ------
NM_006464chr244228 1280 678 152 --32939 1789 834 13060
NM_006474chr171702 1694 1680 725 518 465 136 ------
NM_006475chr13183 ----157
NM_006482chr1253474 3458 2861 1405 1195 12947 ----
NM_006510chr61842 ------
NM_006521chrX128 ------
NM_006529chr4--1565 ----
NM_006534chr2043381 3274 2191 1141 12085 21133 980 12339
NM_006537chr151140 ------
NM_006544chr1424986 4484 1784 35356 5075 449 --
NM_006546chr17106233 5977 5894 5258 5210 5145 2015 2008 704 169 ----1400
NM_006561chr1076233 2439 2242 1857 213 183 147 --56254 2136 1473 194 177 --
NM_006572chr1761255 631 457 268 218 152 --22661 882 --
NM_006574chr31122 --1284 --
NM_006587chr431111 241 23 1218 152 --
NM_006595chr112280 201 ----11853
NM_006599chr16107819 7804 7769 5980 2891 2204 1268 1160 961 53 --11699 --
NM_006601chr121242 ------
NM_006618chr111442 ------
NM_006621chr122061 1819 1287 ----
NM_006624chr1031924 1314 312 1694 1642 --
NM_006628chr1553662 3498 2982 1821 1330 11704 23944 968 24322 519
NM_006629chr1842538 2286 2248 2037 ------
NM_006644chr131435 --1481 --
NM_006650chr553968 2493 441 393 110 1661 1387 --
NM_006654chr1264705 1596 1313 1123 490 436 13110 14608 --
NM_006658chr73379 107 57 ------
NM_006675chr1273204 2930 2555 2292 1302 948 779 --1621 --
NM_006698chr2041251 1191 326 131 ------
NM_006699chr142578 2398 2118 668 12540 1371 --
NM_006702chr192165 129 ------
NM_006703chr61524 ------
NM_006706chr51282 --1706 --
NM_006713chr53777 759 320 --1262 --
NM_006717chr963232 2530 2312 2107 1126 1076 1294 12144 --
NM_006722chr32585 352 1261 12697 --
NM_006726chr411072 --1161 --
NM_006729chrX45624 5023 4199 264 --24139 1921 11838
NM_006731chr953570 2308 1551 741 499 12001 1798 --
NM_006734chr6121 ------
NM_006736chr271710 1420 672 368 307 33 21 ------
NM_006738chr1564132 3269 1870 1180 414 275 --21535 1431 --
NM_006742chr1681926 1913 1892 1769 1242 655 381 241 --31291 333 307 11546
NM_006750chr1677888 7584 2199 2023 1460 1144 404 16483 14946 --
NM_006751chr22681 263 ------
NM_006756chr82134 123 11090 11016 --
NM_006761chr17----1101 --
NM_006766chr822543 84 --32300 1754 160 --
NM_006775chr643101 2583 2064 44 --12498 --
NM_006777chrX62912 1975 1790 1042 652 99 1940 --12885
NM_006802chr151176 1088 875 361 222 ------
NM_006805chr531679 1082 274 1601 ----
NM_006815chr1221141 500 --21274 895 --
NM_006827chr1472722 2712 2135 416 319 129 69 --1902 --
NM_006838chr1281680 1666 1647 1304 720 552 268 197 --21777 1631 --
NM_006851chr1232724 2440 220 1454 ----
NM_006852chr1762629 2107 1964 1121 497 204 12013 22677 2375 --
NM_006854chr721980 590 --11336 --
NM_006873chr253365 2511 2291 1351 93 --12610 --
NM_006885chr1614081 --1819 --
NM_006888chr1482558 2230 2189 1397 1149 1036 749 349 ------
NM_006899chr202272 77 ------
NM_006906chr111140 ----1906
NM_006908chr721502 381 --11462 --
NM_006910chr16125 ------
NM_006915chrX22238 1938 --21618 848 --
NM_006920chr211793 --2685 198 --
NM_006922chr242101 2026 1790 153 ------
NM_006924chr1723676 783 22955 1035 13436 1534
NM_006947chr441357 1277 482 178 --1286 --
NM_006948chr2132364 839 44 11745 ----
NM_006962chrX183 ------
NM_006981chr932534 778 136 ------
NM_006996chr12375 112 --21260 230 --
NM_006999chr541949 1778 1536 1391 ------
NM_007005chr931570 1183 565 ------
NM_007010chr1731255 460 248 --31449 648 329 --
NM_007011chr1576670 6303 5140 2075 2022 104 93 1419 11886 14248
NM_007013chr8--1246 ----
NM_007026chr17193 ------
NM_007034chr11672 ------
NM_007038chr2175576 5533 5406 5237 5167 4773 1101 11623 35391 1848 195 16067
NM_007042chr352201 1831 1046 333 260 ----1794
NM_007050chr20187795 7636 7047 6614 5802 5595 4928 3227 3034 2885 2786 2247 1776 1397 1000 804 631 277 --26415 2820 1530
NM_007054chr532980 2935 2632 11569 12870 1549
NM_007067chr1751511 994 562 413 150 ------
NM_007068chr221425 ------
NM_007084chr1311098 11002 21483 355 --
NM_007107chr362371 927 728 482 290 44 ------
NM_007125chrY11275 --11299 --
NM_007137chrX95237 4968 4262 3849 3840 3719 3625 1986 1659 --34527 813 793 --
NM_007146chr1732757 2366 644 --32027 1918 712 --
NM_007159chr341493 1082 650 277 ----1193
NM_007166chr1121478 975 11211 ----
NM_007175chr841015 255 216 42 --2503 249 13103
NM_007178chr12------1352
NM_007192chr14----1438 11061
NM_007200chr1564132 3269 1870 1180 414 275 --21535 1431 --
NM_007203chr953378 2593 1486 749 219 11009 ----
NM_007212chr1192 --1408 --
NM_007222chr81303 --11835 --
NM_007225chr17----11007 --
NM_007229chr22----2327 287 --
NM_007236chr1562330 1976 1702 947 801 554 --32102 1538 740 --
NM_007245chr165908 859 789 319 213 ------
NM_007247chr173986 828 269 --2879 27 --
NM_007249chr13108446 7753 6895 6801 6768 6605 3354 1744 1026 374 --13172 13216
NM_007257chr872562 2403 1885 932 761 297 44 12078 22682 108 --
NM_007266chr22636 623 --1216 --
NM_007282chr33852 151 145 --1979 --
NM_007286chr541358 1332 558 81 --1649 11720
NM_007292chr17105144 4534 4265 4146 4115 3722 3314 3201 1500 246 --34865 3877 285 --
NM_007325chrX----2767 133 --
NM_007345chr1811632 12005 22233 890 --
NM_007347chr1563230 3004 2466 989 581 227 --2880 778 --
NM_007350chr1274124 3976 3316 983 956 836 219 --14186 --
NM_007361chr141151 ------
NM_007372chr17----2853 844 --
NM_012081chr542845 2661 729 582 ----13133
NM_012089chr11171 134 ----
NM_012090chr11382 ------
NM_012092chr231799 1693 99 1589 ----
NM_012095chr102665 196 --22668 2540 1408
NM_012096chr333146 572 161 23627 1422 22981 178 --
NM_012102chr142605 1722 589 62 --12350 --
NM_012110chr4125 ------
NM_012120chr652740 2670 2631 2452 68 1201 1959 --
NM_012121chr1761203 311 290 211 150 129 --170 --
NM_012141chr1373926 3484 3255 2854 1198 1163 605 --52648 1082 768 162 74 --
NM_012164chr9146321 5677 5486 5438 5382 2882 2872 2548 2458 2434 2270 2165 1341 225 --22191 30 --
NM_012180chr42509 474 ------
NM_012193chr11195250 5147 4951 4750 4606 4441 4402 4219 4161 4153 3990 3886 3480 3287 1590 1315 1203 868 191 --25190 1551 11085
NM_012197chr931108 252 83 --11228 --
NM_012199chr174135 3644 3513 3196 1679 1380 935 --34009 1771 1052 --
NM_012207chr102194 55 ----1867
NM_012215chr1021481 257 ------
NM_012224chr43746 285 124 --1415 --
NM_012234chr343294 2953 2662 733 ------
NM_012238chr10----11783 --
NM_012249chr22797 78 --12439 12997
NM_012257chr71830 ------
NM_012262chr123731 3424 --44210 4007 2022 1248 13305
NM_012281chr732433 506 192 11810 1228 --
NM_012287chr311461 13581 --13380
NM_012288chr664271 3724 1904 1313 1013 860 14079 ----
NM_012290chr231381 1055 593 ------
NM_012300chr532153 512 352 22218 205 32441 2176 2099 --
NM_012301chr731660 628 467 1794 --11878
NM_012307chr182172 97 --1139 --
NM_012308chr1152438 1973 1891 226 37 --12124 11718
NM_012309chr1174755 4220 4027 3167 458 440 289 13331 23179 1853 --
NM_012316chr1155294 5095 4519 4435 4406 4149 3476 2244 1427 1391 1010 805 420 373 138 --22038 1081 --
NM_012323chr2231592 1552 407 --1482 --
NM_012329chr171272 ----1111
NM_012330chr1021589 51 --21595 1396 --
NM_012333chr121611 47 --1649 --
NM_012343chr5----11112 --
NM_012347chr632618 2162 828 1613 32225 1940 560 12952
NM_012383chr9--1457 ----
NM_012405chr132984 2874 1213 --33004 2360 23 1855
NM_012420chr1052111 1687 1615 1498 558 --21646 461 --
NM_012421chr11378 ------
NM_012425chr1032682 687 104 --2526 26 --
NM_012428chr152159 50 --1815 --
NM_012434chr6----11404 --
NM_012448chr1721008 376 --21601 942 1135
NM_012464chr41993 --41136 613 436 380 11918
NM_012486chr12185 96 ------
NM_013240chr21104101 3903 3715 2841 2521 1029 574 482 413 272 23216 1043 23296 1503 --
NM_013255chr7148803 8707 8673 8200 7830 5569 3085 2037 1618 1159 1105 573 421 167 35899 5862 127 26847 742 --
NM_013257chr8--22185 1688 12125 --
NM_013261chr443668 3485 3474 2300 --1914 --
NM_013262chr61263 11490 1569 11191
NM_013272chr151146 ------
NM_013277chr1211030 --1344 --
NM_013279chr1131459 542 226 --21613 685 --
NM_013281chr201318 ------
NM_013283chr53734 302 116 --1365 --
NM_013309chr1542544 2422 1892 183 ------
NM_013354chr8--21237 170 --2491 214
NM_013357chr8----1744 --
NM_013372chr1522192 1338 13003 22819 325 --
NM_013390chr931663 1414 426 11600 --11460
NM_013396chr21--1149 ----
NM_013397chr64768 690 191 178 ------
NM_013438chr9----1411 --
NM_013444chrX11123 ----1921
NM_013446chr72309 36 ------
NM_013450chr221276 1128 --1105 --
NM_013986chr22--1229 ----
NM_013995chrX22327 836 12156 2515 175 --
NM_014001chr173260 216 21 ------
NM_014011chr211601 ------
NM_014016chr33542 453 156 11646 --1611
NM_014023chr1032416 780 45 --1804 --
NM_014028chr622346 396 --22990 633 --
NM_014043chr321039 248 ------
NM_014048chr1665234 4603 3728 658 551 215 ----23569 1570
NM_014056chr341974 1934 1706 816 --11853 --
NM_014071chr20----273 44 --
NM_014106chr1521171 1154 12184 1798 141
NM_014112chr824306 557 ----11340
NM_014117chr161806 --12437 1290
NM_014153chr161246 ------
NM_014154chr321063 596 ------
NM_014155chr1186740 6304 5992 5487 2946 1501 670 525 12892 57438 7164 7008 614 53 --
NM_014157chr1662842 2805 2603 2462 525 39 --54050 3316 2907 1165 274 --
NM_014181chr222790 2578 12659 1448 --
NM_014190chr4----11748 --
NM_014191chr1221031 171 ------
NM_014212chr121274 ------
NM_014217chr111239 --11281 --
NM_014231chr1232120 2003 385 1620 11870 --
NM_014243chr421531 1431 --22058 317 --
NM_014248chr22----153 --
NM_014263chr1011494 ------
NM_014264chr4----2216 53 --
NM_014265chr83778 665 144 ------
NM_014268chr1821397 530 11023 --11176
NM_014271chrX----1218 --
NM_014283chr141474 1293 552 31 ------
NM_014286chr973043 3015 2530 2475 2412 2324 800 --22556 1281 12591
NM_014288chr12291 253 ------
NM_014289chrX21073 1046 ------
NM_014290chr9----1178 --
NM_014299chr1961516 1387 816 727 500 414 ----12059
NM_014300chr151465 ------
NM_014305chr13----1122 --
NM_014309chr2275303 4849 4401 3659 1836 1778 449 --11630 --
NM_014319chr12------1261
NM_014325chr1242080 1928 1877 258 ----12062
NM_014331chr477432 7039 6809 6567 5678 5631 1965 23141 2395 37109 6362 5428 15184
NM_014338chr223274 256 35 ----1410
NM_014350chr51301 1115 ----
NM_014372chr151884 1369 658 248 22 --22087 55 --
NM_014382chr331730 1616 1088 1148 ----
NM_014386chr5------151
NM_014392chr43401 237 53 11555 11376 --
NM_014399chr71916 --3732 266 39 --
NM_014405chr1792244 2127 1893 1789 812 655 563 380 124 --3607 299 209 --
NM_014408chr11506 ------
NM_014410chr18----1385 --
NM_014415chr31538 --21498 1186 --
NM_014417chr19186 ------
NM_014421chr41630 --22089 308 11627
NM_014423chr5125567 4618 4523 4449 3828 3629 2185 2121 1854 1806 1607 530 13497 14502 --
NM_014445chr332435 2203 706 --21509 117 --
NM_014447chr41600 ------
NM_014454chr63735 399 366 ------
NM_014491chr72962 952 1749 147 --
NM_014494chr1672217 2123 1973 1901 1876 661 564 --42307 2299 2043 1639 --
NM_014515chr121864 ------
NM_014517chr32680 416 --21625 133 --
NM_014554chr1272026 1920 1775 561 526 70 24 2826 377 ----
NM_014592chr52148 67 ------
NM_014606chr42425 116 ------
NM_014607chr231527 778 717 --11789 1533
NM_014608chr152392 150 ------
NM_014612chr92992 121 11413 1959 11155
NM_014615chr1623392 2917 --13313 --
NM_014618chr9125 ------
NM_014629chr851347 1260 988 454 48 ------
NM_014636chr984175 3533 3450 3215 2862 824 142 25 11091 11291 --
NM_014647chr162575 117 11751 ----
NM_014655chr151952 1587 258 149 125 11847 --11619
NM_014660chr72932 762 --1982 --
NM_014670chr241626 1589 1286 294 ------
NM_014674chr333930 3320 3156 138 11064 --
NM_014677chr831233 1101 547 ------
NM_014682chr812043 1218 ----
NM_014685chr161462 ------
NM_014701chr151150 1266 --11300
NM_014702chr643237 2965 2633 2576 --1381 --
NM_014705chr71171 ----11624
NM_014707chr742221 1968 1413 145 --11795 --
NM_014711chr1631312 664 486 150 ----
NM_014713chr22465 380 ------
NM_014715chr112740 194 1602 ----
NM_014720chr10----1237 --
NM_014721chr646746 5432 1693 1371 --1878 --
NM_014729chr81374 --12167 --
NM_014730chr1284529 4318 3759 3375 1827 1434 996 703 ----21291 1051
NM_014730chr1284529 4318 3759 3375 1827 1434 996 703 ----21291 1051
NM_014732chr1695549 5174 3850 2177 2043 1663 1058 1013 88 --13589 --
NM_014733chr521893 679 --1146 --
NM_014739chr663617 3335 3305 2577 1083 665 22854 1371 13777 --
NM_014741chr1141832 1590 1417 1357 --31938 1696 223 --
NM_014743chr433145 2592 845 1817 1647 1347
NM_014746chr2113350 3340 2988 2869 2701 1507 918 911 593 329 319 --44413 3436 1261 1175 12791
NM_014747chr1115553 4958 4781 4651 4389 4315 4230 1873 1697 1348 392 --24849 696 --
NM_014751chr822087 758 --1189 --
NM_014752chr114535 279 214 36 ------
NM_014755chr283761 2750 1510 1132 1102 901 473 459 --11665 --
NM_014757chr542083 1746 1570 98 --22020 929 --
NM_014764chr1211038 --1352 --
NM_014765chr132402 1011 891 ----12552
NM_014766chr751262 1251 1072 488 110 23115 1023 1753 12506
NM_014774chr193222 2943 2709 2427 2389 1224 543 525 431 33070 304 229 ----
NM_014779chr321048 1039 --2841 118 --
NM_014783chr1531203 233 56 2533 256 ----
NM_014787chr142689 1787 900 509 12619 22806 232 --
NM_014791chr9----1252 --
NM_014802chr123968 787 730 --1710 --
NM_014810chr163400 2997 862 295 104 50 ----13050
NM_014812chr13519 328 298 11449 11893 --
NM_014819chr532353 2228 1770 --11549 1737
NM_014820chr332066 1832 1296 ----11841
NM_014822chr41481 ------
NM_014826chr174373 4110 4025 3726 3670 1732 202 13235 13860 --
NM_014829chr532341 1789 1766 --12315 --
NM_014830chr1283776 3412 3314 1396 1320 1149 1129 788 11556 12775 --
NM_014832chr1321969 1594 ------
NM_014838chr2211140 12835 ----
NM_014839chr122101 1583 ----11590
NM_014840chr1242757 2160 750 635 --33176 3135 951 12403
NM_014848chr1552377 2177 1054 971 542 --22704 122 --
NM_014850chr3104415 4400 4373 3968 3867 3644 3399 1693 1418 577 --41397 688 97 61 --
NM_014859chr174954 220 213 153 --3521 246 232 --
NM_014860chr242431 2408 1621 339 ----12552
NM_014862chr1573696 3596 3040 1328 1262 1104 1009 --34224 3928 2985 --
NM_014873chr161439 1429 1415 676 190 45 --14663 --
NM_014877chr1797114 6705 6140 6132 5966 5485 5427 3116 2535 14797 27551 1335 --
NM_014883chr41193 22295 422 1528 --
NM_014892chr61159 ------
NM_014897chr1723106 982 --32691 2526 250 --
NM_014899chr553123 2950 2756 2551 2375 ------
NM_014903chr1242090 418 313 30 --12001 --
NM_014905chr231883 324 160 1575 ----
NM_014909chr1453865 3374 2856 2816 2455 12865 13270 --
NM_014912chr1073287 2829 1357 1083 654 600 573 --22878 2184 --
NM_014918chr151227 ------
NM_014920chr653602 3583 3481 1088 509 11479 ----
NM_014923chr1341642 1565 657 350 --11621 --
NM_014926chr33293 245 114 ------
NM_014932chr311373 --11769 1485
NM_014939chr183529 357 129 11254 1604 --
NM_014946chr2102833 2734 2585 2439 2289 1129 759 207 105 58 --32598 1917 1239 --
NM_014961chr41138 --2611 122 --
NM_014962chr2022873 648 12038 ----
NM_014974chr1041808 602 217 27 --11722 --
NM_014977chr141575 ------
NM_014978chr101278 --138 --
NM_014982chr1453772 3683 1224 456 342 --35231 3283 2162 --
NM_014989chr621410 833 11669 11284 --
NM_014991chr453097 2077 698 443 398 --22970 2625 --
NM_014996chr32390 134 --1204 --
NM_014997chr762281 2144 2092 2018 2007 857 1113 ----
NM_014999chr1221182 296 1153 2561 463 --
NM_015000chr1243028 2605 1176 1100 --22611 714 --
NM_015001chr15920 795 707 378 371 ------
NM_015008chr322887 2515 13579 22478 1232 --
NM_015012chr11--164 ----
NM_015020chr1663310 2846 2821 2682 1083 335 --13569 22434 1305
NM_015025chr2--31976 825 483 22423 586 --
NM_015026chr1254426 3722 922 833 118 --24270 1285 11458
NM_015027chr1621779 224 ------
NM_015039chr143115 1036 192 118 12791 ----
NM_015040chr243053 2688 2187 553 ------
NM_015044chr1672959 2672 2600 1281 570 520 140 2726 454 --13160
NM_015045chr1022039 1752 --12177 --
NM_015046chr922175 247 --22638 1116 --
NM_015049chr242903 2199 625 82 --23257 22 --
NM_015054chr12188 ------
NM_015064chr1223334 2647 --12892 --
NM_015068chr743760 1473 233 189 1505 22887 454 --
NM_015069chr162617 241 ------
NM_015070chr1341628 1501 609 53 --21419 209 11320
NM_015071chr5116357 5947 4854 4488 4202 4146 4127 1448 1390 1214 591 --26547 1882 14841
NM_015074chr1104743 4731 4624 4378 3768 3566 3173 1992 1858 223 --54715 3536 1386 757 522 --
NM_015076chr684466 3094 2800 1691 634 257 236 175 11684 24556 3521 --
NM_015082chr552386 963 520 383 281 --12042 12566
NM_015087chr1322049 417 12578 --1194
NM_015090chr1136109 6003 5417 5083 4979 4965 4739 4663 4335 1625 1351 625 314 --25964 2184 11797
NM_015094chr2254635 4193 3218 1719 601 13879 24697 1154 --
NM_015097chr331987 1936 572 --21885 659 --
NM_015100chr121763 145 --21907 259 --
NM_015101chr182671 2589 2487 2294 1999 1882 620 131 --42553 2539 2443 2144 12136
NM_015138chr1542820 2499 2133 860 --1435 --
NM_015143chr441376 1104 555 461 11294 ----
NM_015144chr1643424 1524 867 439 --13145 --
NM_015149chr121903 367 1323 2629 527 --
NM_015153chr61763 --1661 --
NM_015155chr1032158 591 470 --21316 450 --
NM_015156chr1433689 2478 384 --21079 442 12462
NM_015158chr91281 --1567 --
NM_015161chr1621098 438 --31024 622 241 --
NM_015163chr1431921 1222 353 ------
NM_015170chr831823 1636 257 --2328 315 --
NM_015173chr431703 1124 641 21721 49 21391 519 --
NM_015176chr1--1326 31686 1130 463 --
NM_015180chr142763 85 ------
NM_015185chrX62079 2028 1199 1062 261 64 --32885 2830 2228 --
NM_015186chr9157 ------
NM_015187chr41267 ------
NM_015191chr1122742 2649 ----1919
NM_015192chr2052207 1917 820 792 428 ------
NM_015199chr343002 2903 2309 1023 --12085 --
NM_015200chr431980 923 251 ------
NM_015206chr1573880 3808 2773 1291 611 590 514 ------
NM_015208chr1833507 1589 860 1178 ----
NM_015209chr141948 1897 904 677 ------
NM_015215chr132487 2323 2239 ------
NM_015216chr531131 428 148 --1337 --
NM_015226chr1631356 1145 587 --13197 --
NM_015235chr1041569 869 369 76 11687 --11788
NM_015239chr91374 ------
NM_015245chr672682 2293 2022 772 474 253 144 --22572 1069 --
NM_015247chr1685050 4592 3627 3350 3267 1852 1602 943 14474 21203 521 11257
NM_015251chr1642309 2096 527 204 ------
NM_015254chr873104 2218 2028 1994 1246 872 147 1325 23034 299 1956
NM_015265chr252389 2124 1630 834 468 ------
NM_015269chr1--1408 ----
NM_015271chr423961 162 --21626 1371 --
NM_015272chr1622015 1560 ------
NM_015275chr123862 351 345 --11530 --
NM_015277chr1861678 1608 1391 1312 752 74 ------
NM_015282chr262768 2209 2176 2033 1017 60 --22663 555 --
NM_015285chr1832082 800 751 11729 ----
NM_015288chr583355 3309 3257 2955 2813 2715 1433 186 --12457 --
NM_015291chr153135 2802 2290 2266 37 --33470 2380 781 12164
NM_015294chr17124 ------
NM_015296chr133500 430 277 11141 ----
NM_015299chr1483938 3800 3720 3312 3125 2640 1583 1567 --1559 1167
NM_015310chr835906 5298 59 36368 6006 5982 26480 1172 15496
NM_015313chr1164538 1779 1750 1267 429 351 13787 23969 1456 --
NM_015314chr73987 843 320 1162 11900 12013
NM_015317chr211905 ----1129
NM_015322chr15152 ------
NM_015326chr122839 1915 ------
NM_015335chr1252571 1732 550 453 420 --1230 21678 641
NM_015338chr2051901 1654 1373 714 515 --1564 163
NM_015339chr201405 --21000 818 --
NM_015340chr331127 170 121 --11276 --
NM_015352chr2031169 941 805 --21198 1131 1445
NM_015365chrX23348 2641 --43627 3164 2903 1483 --
NM_015367chr2221563 521 11045 ----
NM_015378chr142851 2499 1893 409 ------
NM_015382chr141295 135 ----
NM_015385chr1032950 294 64 ------
NM_015387chr211832 --11619 --
NM_015397chr951806 1718 1218 443 390 --21928 467 --
NM_015409chr1262329 2196 694 633 575 395 --32779 2607 2260 --
NM_015415chr11181 ------
NM_015416chr122906 731 ------
NM_015426chr32627 578 ------
NM_015447chr92726 138 ------
NM_015455chr553210 1138 791 602 116 ------
NM_015458chr894770 4569 1611 1577 1003 407 265 194 31 13484 ----
NM_015460chr332064 1687 328 --11968 1321
NM_015464chr72874 156 --1958 --
NM_015475chr22720 377 ------
NM_015509chr122477 306 1243 21384 50 --
NM_015511chr2051116 841 785 227 58 --1432 --
NM_015520chr322671 59 1667 ----
NM_015532chr1532854 2512 54 --1163 --
NM_015534chr11419 ----1255
NM_015535chr2123883 3875 3631 2965 2596 1128 1104 994 940 391 220 193 --12583 --
NM_015550chr753417 3134 2507 2235 1034 12379 23004 927 --
NM_015553chr675079 4256 4246 1906 1896 1317 874 --24930 3846 --
NM_015554chr1542800 1943 1153 714 1413 12524 --
NM_015555chr63694 684 480 11408 2149 34 11746
NM_015564chr543506 2819 1183 748 --11058 --
NM_015565chr213896 368 116 --1652 --
NM_015569chr123364 1887 --12997 --
NM_015570chr721727 194 ----11368
NM_015571chr622566 935 --147 --
NM_015575chr261200 1182 1104 753 706 690 13273 ----
NM_015576chr312002 ----12194
NM_015601chr102370 300 --1938 --
NM_015602chr111774 ----11787
NM_015605chr1031135 453 408 --31493 230 24 --
NM_015608chr10------1560
NM_015609chr152487 1920 766 177 115 --1156 --
NM_015610chr74763 609 85 58 1115 1622 --
NM_015630chr2123 --11051 --
NM_015634chr103550 526 417 --145 --
NM_015640chr164972 4029 3773 3474 3276 1835 11675 25026 3515 --
NM_015678chr131306 ------
NM_015691chrX22486 288 --12221 1387
NM_015695chr621790 735 --21764 1449 12022
NM_015719chr191120 ------
NM_015726chr141405 1189 244 106 --1446 --
NM_015866chr11507 11073 ----
NM_015874chr4133 --1634 --
NM_015878chr861867 1681 1421 519 424 275 ------
NM_015885chr113842 726 122 ------
NM_015888chr123272 477 --53027 2709 744 591 290 1166
NM_015891chr62723 630 --21855 217 --
NM_015895chr61214 ------
NM_015906chr144284 3566 3284 3038 --14179 --
NM_015975chrX3521 356 82 ----11680
NM_015986chr17--11210 21381 510 --
NM_015995chr15175003 4991 4761 4331 4018 3948 3790 2192 2152 2100 1957 1345 1084 1077 649 524 485 --35429 3966 53 13607
NM_016003chr74763 609 85 58 1115 1622 --
NM_016009chr114733 --34724 134 37 --
NM_016018chr822701 2352 11850 ----
NM_016019chr72248 141 --1393 --
NM_016021chr632173 2062 229 ----33048 1946 514
NM_016025chr16----2806 508 --
NM_016032chrX31365 265 21 ------
NM_016045chr2021670 144 --1340 --
NM_016072chr1211591 ----11749
NM_016073chr151800 --1786 --
NM_016081chr432045 1753 1651 --12081 --
NM_016083chr633455 3093 509 --43340 1313 855 832 --
NM_016096chr84808 627 532 516 156 --11847
NM_016103chr5190 ------
NM_016107chr511325 --11046 --
NM_016121chr11259 --1991 --
NM_016131chr232043 1701 1473 --1707 21835 170
NM_016132chr1522796 2699 ------
NM_016133chr231408 1256 223 11149 ----
NM_016141chr3----1776 --
NM_016152chr31329 --11066 --
NM_016169chr1063206 2634 1314 1193 886 55 --22508 2417 --
NM_016172chr9----1407 1149
NM_016203chr72732 212 ------
NM_016205chr421009 114 ------
NM_016206chr3158594 8380 8169 7636 7622 7614 7264 7243 6923 6849 6810 6331 2340 972 148 27111 3507 28465 3099 --
NM_016221chr53688 342 86 --22331 2223 --
NM_016224chr641711 1372 818 46 ------
NM_016226chr121331 --1477 --
NM_016227chr141474 1293 552 31 ------
NM_016231chr1721408 170 ------
NM_016248chr1333807 1452 1149 --33992 3115 483 --
NM_016250chr141290 --3159 134 128 --
NM_016257chr152947 1091 159 76 63 ----13466
NM_016258chr12104 84 --2559 66 --
NM_016260chr286428 6300 6159 5291 2993 1193 1078 397 ----1672
NM_016271chr1821737 743 22156 1576 11477 --
NM_016275chr332727 2610 711 ------
NM_016284chr16----196 --
NM_016287chr131350 571 231 ------
NM_016298chr363323 2404 1334 875 781 211 13142 ----
NM_016306chr3121 ------
NM_016308chr111918 --12089 1762
NM_016322chr953060 2637 2590 771 234 --133 --
NM_016351chr7--1511 ----
NM_016356chr652725 2699 2443 1951 501 --11795 12577
NM_016374chr12247 135 ----11092
NM_016374chr12247 135 ----11092
NM_016376chr1753590 3459 3115 2717 463 --12895 1620
NM_016396chr1542705 495 354 306 1165 12773 --
NM_016410chr92577 255 --1450 --
NM_016418chr2263066 2892 2644 2434 390 282 1700 144 --
NM_016424chr1731856 1789 1707 --31973 1492 766 --
NM_016433chr12198 ----3973 261 216
NM_016436chr204923 578 187 113 --21958 377 --
NM_016441chr231870 477 110 1132 ----
NM_016442chr532164 1979 78 --1721 --
NM_016448chr111871 11320 11171 11381
NM_016467chr221409 1100 --11294 --
NM_016507chr1732079 2056 525 1740 11278 --
NM_016513chr653602 3583 3481 1088 509 11479 ----
NM_016522chr1121645 421 --11139 --
NM_016529chr1331276 1062 1008 ----2127 26
NM_016530chr1543281 2648 757 166 ----13813
NM_016544chr282903 2463 1272 1117 917 714 179 48 ----1449
NM_016545chr11335 1799 ----
NM_016570chr12--1462 ----
NM_016575chr1295341 5075 4243 4053 3376 1546 1502 1221 62 --35332 4904 3353 --
NM_016578chr11----1112 --
NM_016603chr522238 657 ------
NM_016607chrX----21643 1308 --
NM_016617chr1312122 --11926 --
NM_016623chr8----1528 --
NM_016628chr10191 ------
NM_016824chr101294 1122 11312 --
NM_016834chr17103920 3674 3622 3424 3326 3043 2545 1402 860 818 1994 22605 838 13168
NM_016835chr17103920 3674 3622 3424 3326 3043 2545 1402 860 818 1994 22605 838 13168
NM_016841chr17103920 3674 3622 3424 3326 3043 2545 1402 860 818 1994 22605 838 13168
NM_016929chr694457 3480 3162 2856 1221 988 976 247 183 12823 13354 13309
NM_016931chr11158 ------
NM_016932chr23660 634 37 ------
NM_016946chr1123334 3320 2834 2596 2342 2320 1445 1382 1352 364 286 213 ------
NM_016950chr41398 ----11463
NM_016952chr1193680 2877 2850 2787 844 723 655 501 436 186 33336 2948 853 --
NM_017412chr82962 449 --1943 --
NM_017413chrX72513 2255 1857 1807 898 449 349 --1251 --
NM_017415chr573548 3523 2817 1313 205 134 70 --1589 --
NM_017420chr1433084 2707 140 1131 11003 13184
NM_017437chr1422204 1609 11490 134 1333
NM_017447chr2124254 1526 --14112 --
NM_017449chr131615 1076 382 ------
NM_017450chr1731205 512 427 ----11023
NM_017452chr2061146 1057 970 575 433 218 ------
NM_017453chr2061146 1057 970 575 433 218 ------
NM_017454chr2061146 1057 970 575 433 218 ------
NM_017455chr152159 50 --1815 --
NM_017488chr231366 584 523 --21301 1224 --
NM_017489chr821201 333 --11155 --
NM_017519chr61295 ----1350
NM_017548chr351844 837 823 490 77 ----1521
NM_017582chr131535 694 209 --11264 --
NM_017583chr1121580 1284 ----1679
NM_017593chr4140 ------
NM_017594chr952767 2217 1066 805 560 --13209 --
NM_017596chr1124394 4200 3860 3799 3724 3161 1461 1079 973 901 522 146 11828 34341 4078 723 --
NM_017599chr1251829 1760 1380 183 150 --1621 --
NM_017610chr1542070 1820 1602 79 ------
NM_017617chr911549 11539 ----
NM_017629chr151540 676 579 474 94 1288 1495 --
NM_017632chr4----157 --
NM_017633chr662992 2503 1511 1103 990 185 --1546 --
NM_017634chr821515 1284 --1172 --
NM_017637chr989184 8847 7928 6405 3321 1948 240 44 --38216 5779 3155 16804
NM_017643chr1732505 2278 1181 --12451 --
NM_017644chr331523 1067 397 --34200 719 231 24081 589
NM_017649chr1041038 801 132 73 ------
NM_017650chr734613 2233 2084 13815 1801 --
NM_017654chr731474 486 33 21293 546 ----
NM_017658chr1454461 2850 1102 893 235 --21364 1161 --
NM_017661chr15----2967 843 --
NM_017666chrX51365 656 619 589 271 --1574 1712
NM_017667chr7155 --1169 --
NM_017672chr152521 158 --1284 --
NM_017680chr93840 362 135 ----1241
NM_017693chr132527 109 --1347 --
NM_017694chr222025 243 --22033 1629 --
NM_017709chr163580 1334 1150 1089 511 240 --53338 2917 1570 1233 698 --
NM_017712chr1975150 2464 2260 1678 1301 439 131 --25144 1245 --
NM_017742chr1811688 --1341 1558
NM_017745chrX1647 ------
NM_017753chr91664 1778 ----
NM_017754chr664543 4294 1722 1538 1364 463 --14470 1935
NM_017762chr1522427 813 ----1660
NM_017779chr152568 2225 1094 890 508 11982 ----
NM_017780chr81756 --1830 --
NM_017787chr1042830 1030 588 90 --2831 80 11817
NM_017798chr201243 --139 --
NM_017799chr1441814 1784 1394 253 ------
NM_017810chr163566 209 163 1119 190 --
NM_017811chr963076 2240 1151 694 602 174 --1965 12995
NM_017813chr864940 4787 4631 3774 2003 1629 11617 35345 3656 2256 --
NM_017816chr4140 ------
NM_017824chr1042644 2072 1980 1054 --12191 --
NM_017848chrX94145 3789 3281 3031 1693 1686 1645 552 438 23293 1672 44320 3771 2965 654 --
NM_017866chr81768 ------
NM_017873chr962814 2708 2584 2263 662 94 --1887 1897
NM_017896chr2072894 2379 968 869 738 407 128 --31139 769 157 --
NM_017910chr22110 26 ------
NM_017922chr142593 468 --1653 --
NM_017925chr931819 1724 1459 --11277 --
NM_017944chr1142938 2612 2376 1945 ------
NM_017964chr21681 ----1291
NM_017987chr1062048 1932 1825 1500 887 632 1280 ----
NM_017988chr122797 329 ------
NM_017994chr742947 2760 2723 1983 12388 ----
NM_018015chrX21005 268 ------
NM_018045chr121923 1232 1618 2385 338 1113
NM_018061chr12443 430 ------
NM_018078chr42279 259 --1246 --
NM_018084chr232024 930 140 --22791 1262 --
NM_018085chr197613 6795 6679 6632 5970 5690 2200 538 125 15466 48124 7848 690 70 --
NM_018092chr1631299 1156 112 11471 11096 11664
NM_018097chr15----1161 --
NM_018098chr3166 ------
NM_018121chr1021214 190 --1216 --
NM_018126chr421001 94 --31213 611 575 --
NM_018139chr14121 ------
NM_018145chr15277 26 ------
NM_018154chr194235 179 145 85 ------
NM_018155chr343305 2480 1066 778 --53440 2513 2183 395 172 13062
NM_018156chr142851 2499 1893 409 ------
NM_018182chr1731790 1461 608 --1723 --
NM_018184chr332085 1808 419 ----11497
NM_018191chr1331690 524 446 --2551 229 --
NM_018199chr143907 319 244 11143 ----
NM_018200chr1532078 493 355 ------
NM_018206chr163693 257 234 1170 ----
NM_018211chr142053 1433 673 443 --11407 --
NM_018222chr1151909 1694 1525 747 487 --11344 --
NM_018230chr12486 188 ------
NM_018246chr862862 2791 2023 906 60 25 1299 12560 11069
NM_018247chr683064 2023 1993 950 809 416 299 164 ------
NM_018254chr142198 1898 380 244 ------
NM_018266chr311085 --1175 --
NM_018287chr101375 ------
NM_018293chr3--1804 --2328 97
NM_018299chr842670 1273 324 101 13079 ----
NM_018302chr412059 --21932 1704 1648
NM_018312chr1151976 1882 1840 1727 268 --11598 --
NM_018313chr332422 2301 842 ----1195
NM_018314chr11----1519 --
NM_018315chr421417 271 --1440 --
NM_018318chr122606 163 ------
NM_018319chr1421121 572 ------
NM_018327chr2021166 33 --11260 --
NM_018330chr101472 --1426 --
NM_018351chr1223988 1713 23659 3573 ----
NM_018362chr1183640 3398 3384 3226 2695 2554 244 61 ------
NM_018364chr133837 3052 1219 --23653 2626 13927
NM_018373chr1485644 4832 4772 4312 2445 1883 1755 251 --44585 1030 418 395 1615
NM_018374chr774943 4421 1882 1826 1220 418 199 188 21692 700 --
NM_018387chr91494 ------
NM_018400chr1144153 1226 1061 29 --33619 3519 332 --
NM_018403chr343663 2680 1539 1109 1571 23901 2690 --
NM_018409chr412082 1735 12265 --
NM_018424chr95673 482 440 412 69 11683 21577 1265 --
NM_018425chr1032524 1034 711 --32313 2040 1736 --
NM_018427chr16--1455 ----
NM_018433chr22215 70 ------
NM_018439chr1842220 2173 2162 182 --32037 809 458 --
NM_018440chr8108473 8182 7523 5984 5973 5806 5570 5341 3049 2362 11643 56651 2190 1931 1800 504 28171 430
NM_018451chr131865 1805 2585 39 --
NM_018462chr32788 561 --1143 --
NM_018465chr9145 ------
NM_018469chr1741279 426 398 86 ----11212
NM_018471chr2----1170 --
NM_018477chr14----2793 158 --
NM_018482chr821958 1939 --22234 2213 12241
NM_018490chr112243 221 1256 ----
NM_018509chr1731438 1370 610 --11387 --
NM_018557chr241737 1540 1482 1088 --21374 1114 --
NM_018566chr185141 4890 4101 1917 1551 1368 815 272 13884 13440 15113
NM_018593chr62571 550 --1295 --
NM_018638chr1232178 1517 1297 13740 11138 --
NM_018640chr1222744 2499 22385 2150 12163 --
NM_018650chr122061 473 ------
NM_018658chr1731684 781 755 12250 ----
NM_018682chr7----3660 633 269 --
NM_018683chr2031518 441 374 --11672 --
NM_018689chr1522197 581 --11738 1458
NM_018695chr532430 2214 1619 ------
NM_018697chr752416 1892 1568 1528 197 ------
NM_018703chr16125 ------
NM_018710chr81127 ----1488
NM_018712chr1121296 278 1467 ----
NM_018834chr51249 1706 1890 --
NM_018846chr7----1852 --
NM_018847chr921381 41 ------
NM_018890chr721502 381 --11462 --
NM_018898chr521816 562 ----12192
NM_018899chr521816 562 ----12192
NM_018900chr521816 562 ----12192
NM_018901chr521816 562 ----12192
NM_018902chr521816 562 ----12192
NM_018903chr521816 562 ----12192
NM_018904chr521816 562 ----12192
NM_018905chr521816 562 ----12192
NM_018906chr521816 562 ----12192
NM_018907chr521816 562 ----12192
NM_018908chr521816 562 ----12192
NM_018909chr521816 562 ----12192
NM_018910chr521816 562 ----12192
NM_018911chr521816 562 ----12192
NM_018912chr561663 1591 1388 714 479 471 ------
NM_018913chr561663 1591 1388 714 479 471 ------
NM_018914chr561663 1591 1388 714 479 471 ------
NM_018915chr561663 1591 1388 714 479 471 ------
NM_018916chr561663 1591 1388 714 479 471 ------
NM_018917chr561663 1591 1388 714 479 471 ------
NM_018918chr561663 1591 1388 714 479 471 ------
NM_018919chr561663 1591 1388 714 479 471 ------
NM_018920chr561663 1591 1388 714 479 471 ------
NM_018921chr561663 1591 1388 714 479 471 ------
NM_018922chr561663 1591 1388 714 479 471 ------
NM_018923chr561663 1591 1388 714 479 471 ------
NM_018924chr561663 1591 1388 714 479 471 ------
NM_018925chr561663 1591 1388 714 479 471 ------
NM_018926chr561663 1591 1388 714 479 471 ------
NM_018927chr561663 1591 1388 714 479 471 ------
NM_018928chr561663 1591 1388 714 479 471 ------
NM_018929chr561663 1591 1388 714 479 471 ------
NM_018945chr643672 3340 3147 390 23322 965 --1628
NM_018970chr722804 2006 1423 12467 --
NM_018976chr1242755 2737 2712 2008 --11960 --
NM_018983chr43105 54 33 ------
NM_018999chr1043745 3691 3497 683 --14544 13050
NM_019000chr511457 ------
NM_019001chr344648 3434 1581 325 14606 --13810
NM_019002chr2----1104 --
NM_019004chr722292 76 ----12204
NM_019005chr72323 98 ------
NM_019006chr152688 52 ------
NM_019012chr12259 23 ------
NM_019022chr1832889 1242 1129 11951 52863 2008 656 234 84 --
NM_019050chr43765 631 578 ------
NM_019071chr71143 161 ----
NM_019080chr132372 365 11405 --11100
NM_019083chr151217 434 279 271 123 ----11149
NM_019087chr531308 367 35 --11233 --
NM_019094chr1233790 3376 2658 --22858 961 --
NM_019102chr7----169 --
NM_019102chr7----169 --
NM_019106chr2243241 1300 735 697 13428 12867 1890
NM_019555chr331749 1262 415 11206 --31807 655 511
NM_019557chr13325 207 98 2702 661 ----
NM_019592chr92882 276 1132 --1169
NM_019593chr2042892 2344 2018 81 --12300 11943
NM_019596chr2132854 2106 1884 1903 1801 11913
NM_019605chr11224 ------
NM_019610chr142060 1881 833 340 ----1198
NM_019859chr102173 137 ------
NM_019862chr1611725 ------
NM_019891chr121143 92 ------
NM_019898chr1611725 ------
NM_019899chr1611725 ------
NM_019900chr1611725 ------
NM_019903chr101294 1122 11312 --
NM_020066chr13111 61 42 --1662 --
NM_020120chr271601 1499 1291 1029 173 147 73 --11609 --
NM_020122chr295074 4364 4076 4020 2378 1310 1235 735 221 --1409 --
NM_020123chr10----1528 --
NM_020127chr151459 681 518 337 89 --1594 --
NM_020133chr6125777 5596 5295 5206 4650 4299 2433 2290 1598 1122 792 49 --26168 6062 11756
NM_020139chr431916 1842 537 ------
NM_020141chr131765 344 213 --12159 --
NM_020144chr762118 1986 1737 331 159 134 ------
NM_020150chr1032158 1622 635 --1860 11429
NM_020177chr522346 2109 ------
NM_020178chr172475 400 ----1986
NM_020182chr2052682 2422 1232 1117 758 1684 ----
NM_020184chr272134 2026 1912 1738 1514 848 152 --1424 --
NM_020193chr112934 244 ------
NM_020199chr511079 --147 --
NM_020204chr1188 --1636 --
NM_020205chr183125 2617 2520 2499 2240 1336 833 227 12810 11008 11166
NM_020228chr1142375 2196 1692 220 --12360 --
NM_020239chr122324 100 --12169 --
NM_020240chr542610 2510 2382 923 --52781 960 613 217 206 12462
NM_020245chr654508 879 718 521 155 --43688 3350 1229 1010 --
NM_020310chr175935 928 515 440 331 12742 ----
NM_020337chr453041 2669 931 454 116 --12312 --
NM_020341chr2021664 1264 --11606 --
NM_020342chr241688 1676 385 264 ------
NM_020346chr1121523 226 ------
NM_020348chr1042393 2366 2344 2305 ------
NM_020381chr652007 1368 758 340 271 --21942 91 --
NM_020384chrX11326 --1129 --
NM_020390chr384826 1777 1712 1599 1436 1148 824 742 --14464 --
NM_020403chr13----11721 --
NM_020405chr1753329 1609 321 83 29 --174 --
NM_020416chr452252 1866 778 544 349 12013 161 --
NM_020420chrY11341 --21570 406 11709
NM_020429chr793143 2753 2426 2232 2156 1943 845 711 164 --1753 --
NM_020440chr183267 2932 2902 2765 2300 1308 1130 307 --23208 1178 --
NM_020443chr186915 5962 2451 1699 1427 1117 288 239 25107 2005 32692 1280 253 14426
NM_020456chr1341858 1694 739 75 ------
NM_020466chr653788 1940 1774 1527 1307 24675 3313 14163 --
NM_020474chr1821541 1246 ------
NM_020475chr862379 640 347 193 154 93 ------
NM_020476chr862379 640 347 193 154 93 ------
NM_020477chr862379 640 347 193 154 93 ------
NM_020478chr862442 703 410 256 217 156 ------
NM_020480chr862379 640 347 193 154 93 ------
NM_020630chr10----1115 --
NM_020644chr11----2331 237 --
NM_020647chr81577 --22211 1790 --
NM_020666chr51951 --1279 --
NM_020673chr2097594 7434 6546 6194 5356 5274 5264 2646 378 17499 87409 6397 5802 5696 2095 1900 639 244 12219
NM_020699chr174317 4157 3449 1968 1869 1814 264 --25137 4407 --
NM_020703chr12582 113 ------
NM_020708chr2042235 1593 712 323 --22396 2168 --
NM_020711chr232632 2197 1894 ------
NM_020715chr143569 555 545 1914 32264 2154 1698 --
NM_020717chrX124954 4523 4475 4030 4022 3522 3155 1305 1127 1094 799 688 11392 21100 859 1228
NM_020718chr1686110 5300 5001 4910 4852 4538 4223 2335 --1320 --
NM_020728chr772666 2244 2221 1058 1036 838 494 --1312 11176
NM_020732chr61295 ----1350
NM_020734chr1233052 1298 903 12839 13078 11206
NM_020739chr1564130 3789 3751 2706 818 175 11285 1866 --
NM_020742chrX51966 1012 937 611 130 --12618 --
NM_020747chr5--1847 ----
NM_020752chr1042763 2116 305 194 --22243 769 11995
NM_020762chr125928 796 349 113 36 ------
NM_020766chrX34383 3074 231 14130 44003 3920 3473 3203 --
NM_020768chr573035 2353 2217 2152 2038 1079 308 --2993 478 --
NM_020769chrX3749 696 688 --2711 165 --
NM_020770chr121227 186 --1947 --
NM_020772chr17107891 7385 7046 6596 3328 2916 2795 1405 994 86 1758 48532 6054 5609 500 28146 5925
NM_020773chr462669 2446 2192 2037 1784 1720 ----2998 137
NM_020774chr1855940 4451 958 877 67 31240 1052 52 35526 2290 606 --
NM_020776chr1842909 2803 1086 52 ------
NM_020778chr15154447 4408 4213 4167 3983 3953 3936 1780 941 817 533 483 440 199 73 24107 3676 24538 619 14454
NM_020779chr262986 2730 2708 2082 1167 935 13238 ----
NM_020782chr1284486 4351 4083 3278 1852 1657 1541 899 13762 23744 3624 --
NM_020791chr171546 ----11232
NM_020792chr332002 569 40 12185 32672 2657 374 --
NM_020794chr1--1541 ----
NM_020796chr532161 2037 985 1538 11122 --
NM_020800chr32990 375 ------
NM_020806chr141107 --1724 --
NM_020810chr1453372 3306 995 477 470 --33131 1346 734 --
NM_020819chr6------11026
NM_020824chr101556 ------
NM_020825chr16113861 2903 2855 2700 2630 2409 1527 1275 883 506 394 1686 ----
NM_020830chr23502 490 387 --2987 784 --
NM_020839chr351272 1063 1013 290 39 1319 ----
NM_020854chr1841554 1224 1072 448 ------
NM_020856chr19177 ------
NM_020859chr432480 1271 636 --2355 181 --
NM_020865chr31153 ------
NM_020868chr221430 1308 --1394 --
NM_020871chrX11629 --22456 1746 --
NM_020872chr341619 1222 659 234 1580 11162 --
NM_020873chr3184 --199 --
NM_020888chr171882 1781 1727 1630 1393 1327 137 --1657 1246
NM_020909chr264123 2648 1495 449 413 126 ----11364
NM_020918chr1022913 122 --21142 165 13452
NM_020921chr14103466 3038 2951 2607 2467 2427 1233 1094 1069 979 --13674 --
NM_020922chrX1491 21690 1426 1647 --
NM_020924chr92440 87 ------
NM_020935chr274367 4117 3897 3535 3425 1821 614 --14517 --
NM_020940chr10--11921 1318 12027
NM_020947chr1651942 1491 763 586 330 ------
NM_020952chr92183 152 ------
NM_020958chr14--1239 --1248
NM_020960chr994781 4476 4098 4032 3250 3104 3049 1813 1667 --33992 3765 510 --
NM_020971chr191574 ------
NM_020981chr21254 ------
NM_020993chr1262722 2649 2513 2445 2318 442 1623 ----
NM_021007chr212118 11952 ----
NM_021012chr1753220 2647 2088 578 236 11277 --1416
NM_021013chr17----177 --
NM_021033chr1342351 2262 503 262 --12572 --
NM_021038chr322323 2279 12498 33359 2947 2444 --
NM_021069chr411429 --32034 1489 1401 --
NM_021072chr542444 1674 684 130 163 1633 --
NM_021079chr17103056 2933 2800 2587 2482 2054 1059 923 760 661 ------
NM_021088chr242107 2098 1748 798 --31884 1854 870 --
NM_021097chr2----11910 --
NM_021101chr312339 180 32455 1733 786 --
NM_021132chr1041249 1201 523 389 ------
NM_021133chr1176 --21152 324 1643
NM_021140chrX2279 30 1875 ----
NM_021145chr711060 --3451 443 152 --
NM_021155chr196959 942 867 808 633 53 ------
NM_021159chr441486 1355 611 309 --1189 --
NM_021161chr14193 ------
NM_021174chr8----2719 304 --
NM_021183chrX42162 2144 817 522 1191 1173 --
NM_021190chr1------11136
NM_021194chr1----129 --
NM_021201chr1131646 517 65 --1654 --
NM_021202chr2072959 2744 2573 2096 1243 363 326 --11138 --
NM_021213chr1721101 1027 --1495 --
NM_021215chr2042287 2214 2046 233 ------
NM_021222chr131342 990 339 --1520 --
NM_021229chr1211277 2866 805 ----
NM_021238chr1211284 --1141 --
NM_021253chr641366 1088 337 197 ----1910
NM_021255chr1443570 3009 2639 571 2330 27 11396 1519
NM_021614chr5132 ------
NM_021627chr33901 790 163 ------
NM_021629chr345034 3818 3707 793 13930 ----
NM_021637chrX2169 28 --1414 --
NM_021638chr483803 3580 3374 3362 3162 504 210 94 11567 ----
NM_021644chr102194 55 ----1867
NM_021647chr473631 3615 3042 1500 1054 558 263 --24321 1742 11394
NM_021722chr7--1470 ----
NM_021723chr7--1511 ----
NM_021738chr101574 ------
NM_021784chr20181 ------
NM_021813chr665081 4872 4156 2307 1424 1407 --34847 1958 1841 --
NM_021814chr62558 101 21053 664 ----
NM_021911chr544598 4446 458 127 --11737 --
NM_021912chr1544244 2815 1470 1394 --13911 --
NM_021940chr631677 1626 128 ------
NM_021952chr1--1129 ----
NM_021959chr62845 145 ------
NM_021960chr152593 1078 542 419 266 12389 22039 28 --
NM_021961chr11116845 6651 5400 5260 2636 2377 2064 2010 1869 1390 141 --22475 1425 --
NM_021962chr172888 387 --11733 12428
NM_021964chr3106132 5758 4484 4219 4010 2417 2356 2298 2269 288 11321 15065 26483 4048
NM_021965chr931237 886 206 --197 1938
NM_021967chr551286 965 910 417 25 --1894 11201
NM_021998chrX--1136 --1113
NM_022048chr1586059 2083 1887 1438 1406 1225 1046 916 --46108 5699 743 565 --
NM_022051chr1----1174 --
NM_022058chr241496 515 429 102 ------
NM_022063chr1041791 598 423 166 ------
NM_022079chr102370 300 --1938 --
NM_022114chr184123 3390 3363 3282 2914 1039 525 143 --1862 --
NM_022121chr62912 78 ------
NM_022130chr54406 329 180 65 --21483 284 --
NM_022133chr821684 1589 --1561 --
NM_022138chr631289 1271 521 --21504 226 --
NM_022140chr53878 456 371 11809 --11586
NM_022143chr7182 ------
NM_022166chr1674920 4708 3884 2282 1483 1110 324 12139 1885 25474 5130
NM_022170chr751596 1368 511 437 109 --21761 1671 --
NM_022340chr353667 3191 1440 1360 1192 1288 ----
NM_022373chr72735 38 ------
NM_022456chr12137651 7155 6773 6456 5037 2490 2327 1735 1410 1273 802 159 104 ------
NM_022459chr1396186 4603 4374 2366 2238 1658 1275 473 67 --35765 5220 4186 --
NM_022462chr19123631 3058 2869 2653 2506 2478 2400 1111 778 675 578 211 32716 2684 1463 1519 13330
NM_022465chr1242646 374 199 120 --22876 1020 --
NM_022474chr1472643 2324 2117 860 648 412 37 --1713 11128
NM_022482chr2062489 2033 919 204 195 114 ------
NM_022484chr721321 567 ------
NM_022576chr11332 ------
NM_022648chr263694 3320 1801 1318 613 97 --32936 1845 1839 --
NM_022662chr2137 ------
NM_022716chr133068 1103 419 12883 ----
NM_022726chr631645 667 570 11141 1257 --
NM_022735chr131891 517 506 ----1317
NM_022739chr17----2436 270 --
NM_022745chr132978 1211 284 --11863 1334
NM_022748chr741050 580 198 135 --1183 --
NM_022756chr121372 58 --1133 --
NM_022758chr632942 2174 1104 --21178 50 --
NM_022766chr2252684 2629 2575 2089 256 --1665 --
NM_022776chr32191 87 --1354 --
NM_022780chr221701 316 ------
NM_022781chr962999 1122 1087 222 140 121 --32653 2433 315 --
NM_022802chr1041633 1506 434 402 ----11482
NM_022817chr252287 2013 1544 812 70 ------
NM_022818chr1641625 1587 459 293 ------
NM_022824chr54613 489 361 74 ------
NM_022826chr23942 195 26 ------
NM_022828chr511163 --2327 65 --
NM_022836chr11534 --11264 --
NM_022841chr1552260 2143 524 324 286 --22519 667 --
NM_022843chr1321014 51 --144 --
NM_022845chr16----21683 875 --
NM_022893chr231205 661 268 --23007 2888 --
NM_022898chr14104859 3410 3386 3326 2938 1673 1214 984 720 66 --21616 501 --
NM_022912chr232972 2564 1193 --32750 294 188 --
NM_022913chr5----1237 --
NM_022970chr1011154 11006 11050 11401
NM_022977chrX32129 1928 1795 --22250 2099 --
NM_022978chr551286 965 910 417 25 --1894 11201
NM_023009chr12555 25 ------
NM_023010chrX1736 ----1723
NM_023067chr351040 916 248 223 96 --2383 233 --
NM_023071chr1221018 278 161 1202 --
NM_023929chr842673 2598 2568 656 ------
NM_023940chr42814 742 ------
NM_024007chr572967 2660 2560 821 774 154 99 ------
NM_024076chr1961869 1817 969 848 744 149 --32234 961 59 --
NM_024077chr9158 --1605 --
NM_024086chr1733680 3656 54 11432 32440 1240 1085 12584
NM_024087chrX1584 ------
NM_024095chr1221408 442 ------
NM_024294chr632942 2174 1104 --21178 50 --
NM_024295chr811966 --1478 --
NM_024296chr1----153 --
NM_024345chr962343 2111 1996 881 237 43 191 1512 1147
NM_024408chr143294 2493 530 425 11370 137 --
NM_024423chr1821504 1482 22804 1354 44134 719 157 151 --
NM_024424chr111951 --1109 21204 885
NM_024425chr111951 --1109 21204 885
NM_024426chr111951 --1109 21204 885
NM_024429chr72732 212 ------
NM_024491chr3------170
NM_024501chr2132 --1482 1701
NM_024511chr4102730 2317 2154 1139 905 819 764 544 379 188 1670 1924 1896
NM_024513chr352908 2359 1439 991 151 ----13656
NM_024520chr2--131 182 --
NM_024539chrX2902 431 --1799 --
NM_024551chr1222270 940 1509 12431 --
NM_024551chr1222270 940 1509 12431 --
NM_024556chr112459 436 ------
NM_024567chr82674 59 ------
NM_024581chr6------153
NM_024586chr12205 137 ------
NM_024590chr441648 1576 479 99 --11628 1793
NM_024613chr8----11860 --
NM_024626chr141589 1500 1463 81 ------
NM_024631chr112595 492 ------
NM_024632chr51185 ------
NM_024639chr652564 2306 2025 488 83 1862 11108 12587
NM_024665chr311699 --44303 3105 3094 696 --
NM_024686chr11411 --1358 --
NM_024721chr811979 2546 67 1481 --
NM_024740chr1173824 1613 1478 633 470 390 58 --13158 --
NM_024744chr242299 1683 1051 39 ------
NM_024755chr152111 88 ------
NM_024761chr9105159 4919 4554 3832 3601 2020 1588 1008 516 316 ------
NM_024770chr296647 6037 5444 4512 2509 2459 1478 1124 915 --25020 1653 --
NM_024814chr7------1158
NM_024831chr82582 167 ------
NM_024834chr1051815 1733 1464 616 172 ------
NM_024835chr17186 ------
NM_024841chr1191770 1600 947 884 859 801 647 287 142 --1404 --
NM_024854chr1241300 1266 1047 461 ------
NM_024859chrX1242 ------
NM_024874chr131225 1214 912 --11327 --
NM_024881chr19113776 3246 3187 3163 1521 997 915 898 872 788 282 ------
NM_024884chr1484519 4269 4068 1265 1245 1151 986 588 --31804 1234 918 --
NM_024896chr942519 2352 1674 191 ----2818 275
NM_024909chr631434 441 155 1193 ----
NM_024920chr431478 1050 147 1488 ----
NM_024930chr542675 2232 1886 584 ------
NM_024947chr3119265 8989 8279 8167 7654 7552 7528 3727 3554 2835 561 --38114 2288 2079 --
NM_024953chr1231735 916 127 1544 ----
NM_024971chr92183 152 ------
NM_024989chr2117918 7158 5396 5048 4966 3194 2405 2052 1572 1110 546 --47896 6742 6310 5775 17633
NM_024991chr1032950 294 64 ------
NM_025054chr812576 --22979 235 --
NM_025076chr2--191 1559 --
NM_025077chr1------1200
NM_025106chr111670 11657 11751 11443
NM_025134chr1642011 814 698 150 --21954 768 --
NM_025146chr342140 1907 1705 794 1171 1784 --
NM_025151chr842164 1695 625 38 ------
NM_025152chr142142 50 --11316 --
NM_025154chr721448 381 11060 ----
NM_025160chr184219 3923 1735 1043 920 766 711 502 ------
NM_025179chr184546 4496 4137 3832 3095 1590 1427 1414 --34556 3729 1102 --
NM_025180chr3112939 2629 2515 2120 2106 1254 1197 955 926 287 236 ------
NM_025184chrX----1325 --
NM_025191chr141194 796 585 492 --1181 --
NM_025195chr831899 1818 1710 --1655 1165
NM_025222chr321898 577 --21049 126 12022
NM_025235chr1041450 774 152 59 --21677 547 --
NM_025238chr1521505 285 ----1496
NM_025248chr1783100 2039 1200 1061 737 727 582 282 --1537 --
NM_030579chr1673668 3405 2902 2801 2520 2295 1376 --11122 --
NM_030583chr8--1398 ----
NM_030594chr153919 550 25 --11096 --
NM_030621chr1433516 3458 3201 --32973 900 705 --
NM_030623chr271639 1358 1236 1225 1123 1076 498 ------
NM_030629chr162239 222 11546 ----
NM_030647chr7116159 5551 4919 4791 4290 4251 3904 2123 1208 1015 234 15398 15821 --
NM_030648chr474644 4390 3739 1483 1423 488 135 --11643 14817
NM_030650chr293884 3835 3677 3544 3044 3000 2847 1215 902 ------
NM_030660chr1441508 1091 305 109 --2957 178 --
NM_030664chr1021936 492 --12480 --
NM_030670chr1251914 1892 198 154 123 ----1265
NM_030671chr1251914 1892 198 154 123 ----1265
NM_030674chr1255012 2298 1737 1010 621 --15335 --
NM_030758chr224903 387 371 186 ------
NM_030784chr61380 ------
NM_030786chr151714 1619 689 239 154 1656 ----
NM_030797chr22245 36 --1251 --
NM_030806chr1169440 8970 8868 8600 8202 8067 7939 7324 6813 5809 2991 2684 2060 1971 1813 1244 17219 67961 7276 2216 1995 1479 954 28464 6319
NM_030816chr1------13434
NM_030885chr321682 737 --42291 1794 374 47 --
NM_030918chr1115006 4846 4753 4002 3868 3557 3531 2056 1325 147 54 --24271 3744 --
NM_030920chr111608 --11848 --
NM_030922chr152799 191 ----1635
NM_030939chr61785 ------
NM_030949chr62577 70 --11354 --
NM_030962chr1111391 --1478 --
NM_030964chr533216 3185 2785 --32816 2345 106 --
NM_031203chr19----1235 --
NM_031216chr1832072 155 101 22197 1833 ----
NM_031243chr72714 535 1949 ----
NM_031267chr7146 ------
NM_031268chr1655111 4741 1714 1394 912 --23782 1311 --
NM_031283chr2--179 --1172
NM_031291chr4------1554
NM_031305chr42535 68 ----11722
NM_031314chr1431750 622 259 --21520 1259 --
NM_031369chr41544 ------
NM_031370chr41544 ------
NM_031371chr12247 135 ----11092
NM_031371chr12247 135 ----11092
NM_031372chr461449 1328 1311 1253 110 84 ------
NM_031411chr521816 562 ----12192
NM_031417chr1972811 2498 2091 1771 620 547 105 --22446 229 --
NM_031419chr331002 296 243 --1506 1427
NM_031424chr204545 493 403 386 139 ----
NM_031426chr972229 1777 999 419 380 80 53 --12035 --
NM_031427chr1465255 5141 4545 2330 687 571 14746 22231 2020 15903
NM_031431chr1321227 611 --11670 --
NM_031442chrX----12341 --
NM_031453chr1042454 1902 778 115 12427 11774 --
NM_031461chr8----1872 21684 623
NM_031468chr796265 5060 2984 2764 2526 2129 1598 1167 460 --87672 7164 5954 3051 2506 1346 1175 1027 --
NM_031483chr2043461 1423 635 501 ------
NM_031492chr11----1170 --
NM_031844chr144025 3174 2952 1606 --33066 2708 276 --
NM_031849chr521816 562 ----12192
NM_031857chr521816 562 ----12192
NM_031858chr1711221 --147 --
NM_031860chr521816 562 ----12192
NM_031862chr1711221 --147 --
NM_031866chr1021053 424 --1721 1845
NM_031890chr2272345 1151 942 683 336 329 245 ------
NM_031892chrX2638 218 --1846 --
NM_031904chr1162143 1869 1861 1435 796 426 --1150 --
NM_031992chr751596 1368 511 437 109 --21761 1671 --
NM_032012chr973623 3344 3305 3220 1902 1172 1164 --23566 3323 24301 134
NM_032015chr111158 --1631 --
NM_032042chr522806 963 --22574 2506 1844
NM_032052chr2231435 957 24 --11418 --
NM_032088chr561663 1591 1388 714 479 471 ------
NM_032092chr561663 1591 1388 714 479 471 ------
NM_032102chr1152786 2512 766 629 338 --21077 347 12718
NM_032153chr31237 --22682 684 --
NM_032182chr10----1545 11448
NM_032189chr1345015 4680 147 80 --1260 --
NM_032192chr171122 ------
NM_032199chr1053197 3097 2651 477 268 12756 ----
NM_032221chr20132 ------
NM_032228chr1173227 2490 2429 2167 918 232 44 11114 23188 1041 --
NM_032236chr11680 ------
NM_032239chr42340 36 --1496 --
NM_032256chr121409 ----1251
NM_032268chr162593 133 --11995 --
NM_032272chr81501 ------
NM_032281chr1913138 ------
NM_032288chr341459 689 359 254 --11587 --
NM_032295chr74461 143 114 89 --11502 --
NM_032300chr1211106 ------
NM_032316chr352447 2350 2049 1798 360 --32495 1654 30 12014
NM_032333chr101665 ------
NM_032373chr1065810 5657 3753 2358 2015 682 ----1902
NM_032403chr561663 1591 1388 714 479 471 ------
NM_032410chr82920 141 ------
NM_032412chr5----1237 --
NM_032420chr53654 289 134 ------
NM_032433chr1941473 1466 418 220 --142 --
NM_032434chr211062 --1115 --
NM_032438chr6----1595 --
NM_032440chr1022758 128 --2540 214 --
NM_032445chr152896 73 1610 22424 2203 --
NM_032457chr453658 3585 3250 767 149 --12554 11384
NM_032458chrX13450 --33458 2284 826 --
NM_032466chr83415 110 79 --11232 --
NM_032468chr83415 110 79 --11232 --
NM_032471chr621116 806 1841 ----
NM_032491chr12--186 2907 305 --
NM_032505chr31426 22364 416 32113 653 368 --
NM_032521chr2031092 936 214 --12651 --
NM_032536chr91465 ------
NM_032539chrX2735 119 ------
NM_032547chr421383 873 1216 --11327
NM_032550chr102338 43 --11162 --
NM_032560chr142375 133 --11113 --
NM_032582chr1721742 1576 ----11871
NM_032595chr1741311 440 277 190 1324 ----
NM_032632chr1421863 126 --11880 11590
NM_032663chr1261885 1808 1609 1342 768 372 --11615 11682
NM_032682chr351197 672 646 536 328 12474 11157 --
NM_032711chr17104153 3620 3408 2895 1621 1461 1223 1113 694 175 --44172 3531 1534 1217 --
NM_032727chr10154 --1239 --
NM_032778chr322902 2637 12142 12339 --
NM_032781chr111140 ----1906
NM_032802chr15157 --170 --
NM_032804chr1042445 2136 1943 527 --1817 --
NM_032828chr19124526 4226 3276 3210 1700 1488 1040 1003 989 961 951 361 181 1429 --
NM_032833chr141825 581 489 288 ------
NM_032840chr122174 70 --21076 1040 --
NM_032842chr721307 608 1445 ----
NM_032859chr13------22492 1518
NM_032876chr1441808 433 389 268 --31961 774 214 --
NM_032883chr202740 234 ------
NM_032900chr1073556 3040 2739 2602 1475 1311 661 --11548 --
NM_032918chr123958 901 133 ----11283
NM_032947chr551257 1065 439 279 112 ------
NM_032949chr13----1229 --
NM_032960chr121172 265 --11215 --
NM_032961chr411129 --1948 --
NM_032975chr1863225 3018 1077 879 691 648 --13088 --
NM_032980chr1863225 3018 1077 879 691 648 --13088 --
NM_032993chr43105 54 33 ------
NM_032998chr1--11086 ----
NM_033012chr13----1145 2833 272
NM_033020chr144284 3566 3284 3038 --14179 --
NM_033044chr11382 ------
NM_033056chr101608 ------
NM_033058chr81265 ----1341
NM_033082chr121162 ------
NM_033083chr31737 13207 22718 2336 --
NM_033121chr1231187 483 423 --11754 --
NM_033128chr7----2807 570 --
NM_033132chr13--11954 --1660
NM_033138chr72894 251 --12025 --
NM_033139chr72894 251 --12025 --
NM_033140chr72894 251 --12025 --
NM_033143chr453711 2907 2899 2882 1118 --31560 647 347 --
NM_033150chr122143 100 ------
NM_033157chr72894 251 --12025 --
NM_033181chr633455 3093 509 --43340 1313 855 832 --
NM_033201chr1641025 875 800 376 ------
NM_033211chr52630 344 ------
NM_033224chr7128036 7822 7360 7032 6832 6822 6656 5734 2929 2831 917 519 --25526 2991 11930
NM_033225chr873106 2904 2305 2264 1171 310 114 ------
NM_033274chr5103514 2995 2863 2568 2268 1136 1023 894 207 199 33052 2491 2429 1870 --
NM_033284chrY2118 46 ------
NM_033285chr863513 1709 1278 1154 877 527 --11107 --
NM_033290chrX52889 2695 1418 1170 612 ----12991
NM_033296chr43731 342 165 ------
NM_033331chr9103314 2920 2900 2883 2655 2374 2350 1004 982 703 --1345 --
NM_033360chr1264596 4501 3228 2807 1642 534 ------
NM_033380chrX21112 962 --1255 --
NM_033381chrX21112 962 --1255 --
NM_033389chr1764004 3803 3515 3231 958 192 --124 --
NM_033393chr472513 1843 948 809 639 369 52 --12453 --
NM_033402chr81140 --190 --
NM_033425chr1162450 2174 1324 1268 635 391 23189 281 21025 856 1874
NM_033429chr1542993 408 271 184 --2769 311 --
NM_033480chr632618 2162 828 1613 32225 1940 560 12952
NM_033481chr632618 2162 828 1613 32225 1940 560 12952
NM_033503chr15163492 3368 3348 3324 3105 3022 2948 2937 2685 2673 2529 2491 711 209 195 171 --11109 --
NM_033505chr2126204 5353 4923 4323 2421 2217 2087 1749 1092 808 605 82 --31937 1843 1593 --
NM_033512chr862294 1093 555 385 277 87 22674 115 1295 --
NM_033540chr31147 --1998 --
NM_033626chrX101625 1611 1603 1250 1134 611 574 485 168 133 ------
NM_033631chr163019 2416 1475 1084 817 601 --11404 --
NM_033632chr421417 271 --1440 --
NM_033637chr1043671 1349 818 337 --54055 3632 3315 2779 2585 11510
NM_033642chrX31055 264 153 ------
NM_033644chr532153 512 352 22218 205 32441 2176 2099 --
NM_033645chr532153 512 352 22218 205 32441 2176 2099 --
NM_033656chr2165450 5072 4720 4603 4476 1125 ------
NM_044472chr11643 ------
NM_052832chr882670 2415 2114 956 886 703 131 105 ------
NM_052834chr1832082 800 751 11729 ----
NM_052837chr1146 ------
NM_052851chr1332050 1959 1645 --12152 --
NM_052855chr172529 74 ------
NM_052860chr5----1661 2943 704
NM_052879chr1222716 2700 --1485 23297 654
NM_052880chr2251467 1213 1082 490 363 ------
NM_052885chr1283904 3698 1086 849 436 291 119 67 --33653 912 168 --
NM_052900chr821683 412 --11418 1533
NM_052904chr611460 --1210 1364
NM_052907chr1274255 4128 3159 1016 511 404 369 --24202 1189 --
NM_052910chr1321900 493 11391 ----
NM_052911chr182990 391 --1981 165
NM_052913chr631083 733 232 ------
NM_052918chr1062684 1216 1118 991 844 304 --13416 --
NM_052937chr821028 371 ----12150
NM_052954chr2142025 1712 1560 40 1726 11630 --
NM_053016chr9107667 7187 6265 5804 5033 2411 1652 793 432 136 1504 46904 6223 5136 2933 --
NM_053023chr1132092 502 39 12515 ----
NM_053043chr7156188 5588 4923 4829 4488 4011 2266 2146 2105 982 852 801 767 746 333 --45388 2010 1884 530 125
NM_053046chr193363 170 42 --1104 --
NM_053056chr1162922 2170 1977 1131 897 173 ------
NM_053064chr1432717 2216 190 --1368 --
NM_054012chr9191 ------
NM_054027chr53494 239 125 --21959 832 --
NM_057158chr82568 243 ------
NM_057159chr921064 302 --21458 1414 --
NM_057175chr462695 2511 2255 1744 1694 945 --21636 31 --
NM_057180chr121331 --1477 --
NM_058240chr1441523 1425 1051 75 1208 ----
NM_058241chr2175 1643 --12338
NM_058241chr2175 1643 --12338
NM_058243chr19----250 25 --
NM_078470chr1072348 2305 2271 2067 1933 832 666 --32492 1019 90 1388
NM_078626chr11306 --2228 65 --
NM_080392chr1175 ------
NM_080546chr932101 1989 1568 1433 --1754
NM_080550chr173986 828 269 --2879 27 --
NM_080591chr952670 2434 2423 2316 871 12292 1385 12933
NM_080616chr202221 152 ------
NM_080617chr201380 ------
NM_080632chrX1736 ----1723
NM_080654chr112978 381 --1180 --
NM_080664chr1441772 1329 525 47 --1162 --
NM_080669chr17103476 3174 1947 1725 1276 1200 1192 984 565 508 --43462 1732 1253 991 --
NM_080671chr222047 673 --5781 661 642 629 254 11749
NM_080682chr12681 235 --1553 --
NM_080717chr121159 --1199 --
NM_080732chr193363 170 42 --1104 --
NM_080737chrX21140 1085 --11234 --
NM_080738chr181718 1685 1666 1474 1351 1291 586 26 ------
NM_080764chr2262736 2599 2431 1167 1152 163 --22692 129 1528
NM_080792chr203849 581 403 --31663 898 365 --
NM_080867chr14105075 4979 4618 4610 4192 3789 3299 1687 1186 1094 --34874 3094 539 --
NM_080872chr853903 2911 2775 945 500 --13247 --
NM_080874chr431551 1363 744 ------
NM_080881chr5----1167 --
NM_080927chr342629 2573 639 566 --147 12591
NM_100264chr10191 ------
NM_100486chr10191 ------
NM_130387chr3187 ------
NM_130436chr2131033 973 955 ----1837
NM_130438chr2132275 2215 361 ------
NM_130798chr1511259 11307 ----
NM_130808chr31417 ------
NM_130809chr573164 2975 2110 2054 1964 1149 30 ------
NM_130850chr14------1193
NM_130851chr14------1193
NM_133170chr20187795 7636 7047 6614 5802 5595 4928 3227 3034 2885 2786 2247 1776 1397 1000 804 631 277 --26415 2820 1530
NM_133264chr1772769 2605 1300 1270 1082 496 41 1921 ----
NM_133265chrX83475 2787 2776 2688 2300 982 801 126 ------
NM_133334chr4106335 5167 4898 4871 4217 4102 2394 2386 2315 367 --14537 --
NM_133370chr462234 1401 1129 1093 919 341 --33150 1296 1282 --
NM_133372chr532595 2286 188 ------
NM_133433chr51761 ------
NM_133444chr1941607 429 224 125 ------
NM_133452chr1951203 1094 998 419 366 1128 1338 --
NM_133477chr44953 769 761 597 12248 1828 --
NM_133493chr644338 1852 1832 962 --21267 184 --
NM_133496chr1103894 3855 3743 3129 1693 1252 903 895 247 204 ------
NM_133507chr122300 33 ------
NM_133625chr311083 1540 198 1291
NM_133631chr31271 ------
NM_133638chr51369 ------
NM_133642chr2251194 984 506 157 72 --1814 --
NM_133646chr274696 4604 1504 1394 736 481 276 --11798 1338
NM_133647chr1542767 1150 177 27 12382 --13302
NM_138270chrX53293 3014 1289 72 47 ----1991
NM_138288chr1452003 1907 1563 1454 620 ------
NM_138290chr72346 75 ------
NM_138316chr1021138 410 --21237 155 --
NM_138317chr14193 ------
NM_138318chr14193 ------
NM_138333chr952193 2185 2016 1736 354 --11893 --
NM_138376chr141117 ------
NM_138391chr1----2961 306 1625
NM_138423chr153686 662 202 --173 --
NM_138426chr742046 1962 1760 498 --1143 12085
NM_138453chr5------1186
NM_138457chr673373 3071 2758 1170 1001 521 151 ------
NM_138459chr642673 685 614 457 ------
NM_138473chr12115112 4708 4360 4227 4050 3638 3499 1803 1637 1511 1142 1809 25133 3437 --
NM_138494chr742659 891 735 528 ------
NM_138555chr152488 389 ------
NM_138576chr14104859 3410 3386 3326 2938 1673 1214 984 720 66 --21616 501 --
NM_138619chr173260 216 21 ------
NM_138635chr7102946 2782 2223 1959 1231 1089 758 595 495 168 --1265 --
NM_138689chr111205 ------
NM_138713chr16107819 7804 7769 5980 2891 2204 1268 1160 961 53 --11699 --
NM_138714chr16107819 7804 7769 5980 2891 2204 1268 1160 961 53 --11699 --
NM_138731chr1432913 216 181 12577 ----
NM_138736chr1694152 3204 3115 2625 951 904 537 526 40 --22584 1231 --
NM_138931chr31313 ----1320
NM_138959chr1106419 5875 5799 5022 4947 4833 4802 2306 1642 701 16309 35670 2259 213 --
NM_138962chr171348 ------
NM_138970chr142585 344 --11923 --
NM_139012chr631469 573 51 ----1221
NM_139014chr641549 653 131 21 ----1301
NM_139015chr1241583 570 543 81 --11420 --
NM_139035chrX1557 ------
NM_139046chr10173 ------
NM_139135chr131354 959 282 ------
NM_139167chr81473 ------
NM_139168chr5----1140 --
NM_139169chr1042108 561 472 290 --21923 182 --
NM_139199chr52262 58 --123 --
NM_139242chr1561439 1142 397 380 322 80 --1315 --
NM_139245chr331254 674 40 ------
NM_139246chr971884 1442 884 824 784 395 348 --31493 936 855 1923
NM_139283chr1262361 2090 978 729 154 99 --1235 --
NM_139312chr1011494 ------
NM_139321chr2043657 3586 2934 964 1803 ----
NM_139323chr203536 109 22 ----1819
NM_144563chr22572 322 ------
NM_144563chr22572 322 ------
NM_144571chr466243 2144 950 884 241 139 --1467 --
NM_144574chr14----139 --
NM_144578chr1455052 4562 4538 4029 3399 --11430 --
NM_144600chr164618 457 447 189 ------
NM_144618chr11392 --1310 --
NM_144628chr2062793 2444 2360 2129 1185 1029 32810 2685 1103 12648 --
NM_144633chr32405 245 --1315 --
NM_144664chr1111772 --1722 12211
NM_144710chr21266 ------
NM_144721chr462644 2528 2429 2109 504 150 ----11941
NM_144726chr51985 ----11183
NM_144767chr1564132 3269 1870 1180 414 275 --21535 1431 --
NM_144778chr131794 ----11031
NM_144949chr211601 ------
NM_144963chr832172 1081 658 1952 1706 --
NM_144967chrX1299 --2405 272 --
NM_144981chr11122 ------
NM_145021chr10----1774 --
NM_145037chr351121 524 206 140 54 11349 142 --
NM_145049chr5----1357 --
NM_145055chr1873254 2849 2801 2428 869 649 590 --1275 13422
NM_145117chr1193245 2980 2852 2832 2461 2274 1146 261 80 --12599 --
NM_145165chr1422407 659 ------
NM_145176chr642282 2151 1398 211 1446 ----
NM_145206chr1062953 2415 2156 783 768 573 ------
NM_145251chr141644 ----11419
NM_145259chr246558 6325 470 181 --26401 6064 --
NM_145268chr72850 89 ------
NM_145284chrX22454 207 1999 22519 710 1184
NM_145307chr1044651 3792 2995 1292 24557 3074 2756 539 --
NM_145313chr1011045 ------
NM_145320chr753417 3134 2507 2235 1034 12379 23004 927 --
NM_145321chr753417 3134 2507 2235 1034 12379 23004 927 --
NM_145322chr753417 3134 2507 2235 1034 12379 23004 927 --
NM_145331chr62219 44 ------
NM_145332chr62367 192 ------
NM_145333chr62367 192 ------
NM_145349chr1731980 1626 215 --22255 1401 --
NM_145351chr1732472 2118 707 --22747 1893 --
NM_145649chr652409 2052 298 290 73 --11786 --
NM_145655chr652409 2052 298 290 73 --11786 --
NM_145686chr2129 12201 23194 1075 --
NM_145687chr2129 12201 23194 1075 --
NM_145698chr1041510 1452 1428 46 1464 ----
NM_145714chr163373 324 30 ------
NM_145733chr2211030 11217 ----
NM_145735chr1362640 2525 2513 2288 557 371 --12240 1405
NM_145798chr171923 ------
NM_145805chr15------1620
NM_145808chr742721 2175 1237 47 --2918 308 1551
NM_145861chr181718 1685 1666 1474 1351 1291 586 26 ------
NM_147150chr953378 2593 1486 749 219 11009 ----
NM_147156chr101118 --1153 --
NM_147171chr71498 ------
NM_147185chr71498 ------
NM_147188chr151405 --1512 1284
NM_148174chr861867 1681 1421 519 424 275 ------
NM_148414chr164456 407 337 113 ------
NM_148415chr164396 347 277 53 ------
NM_148416chr163373 324 30 ------
NM_148898chr72962 952 1749 147 --
NM_148899chr72962 952 1749 147 --
NM_148904chr12205 137 ------
NM_148905chr12205 137 ------
NM_148906chr12205 137 ------
NM_148907chr12205 137 ------
NM_148908chr12205 137 ------
NM_148909chr12205 137 ------
NM_148977chr1021138 410 --21237 155 --
NM_148978chr1021138 410 --21237 155 --
NM_152253chr2264248 3833 3400 2836 1528 822 --33927 1669 1171 --
NM_152261chr1232588 2462 2325 --1325 --
NM_152263chr1126059 5806 5791 5783 5769 5427 5082 2363 2193 1532 364 302 --15623 --
NM_152280chr133203 1098 867 --43012 2984 2257 1312 --
NM_152300chr1731255 460 248 --31449 648 329 --
NM_152313chr111638 1670 1604 --
NM_152332chr1422635 2085 1403 12402 --
NM_152344chr1721441 1055 11239 1320 --
NM_152347chr17166 ------
NM_152363chr191205 ------
NM_152388chr284010 3713 3282 3138 2773 2689 2503 410 --23918 3035 --
NM_152400chr421584 240 --11566 --
NM_152407chr553043 2992 2855 1071 163 22601 482 23085 229 --
NM_152410chr6187 ------
NM_152414chr831096 544 162 ------
NM_152424chrX64643 4279 3151 753 728 619 14376 34292 4257 1770 --
NM_152437chr1232453 2135 1670 1876 1181 --
NM_152450chr151844 1838 ----
NM_152451chr151317 ------
NM_152470chr1874166 4112 3573 2792 2524 1197 817 12659 ----
NM_152495chr1------11042
NM_152510chr222881 767 ------
NM_152520chr22399 347 ------
NM_152527chr242146 2122 792 488 1199 ----
NM_152529chr223737 203 11065 32874 1654 73 --
NM_152556chr742311 984 829 719 --11004 --
NM_152581chrX51504 1178 1147 421 288 --1511 --
NM_152594chr151333 --11935 --
NM_152608chr121828 467 2995 181 3884 473 253 1927
NM_152609chr1153 --11154 11207
NM_152621chr4--1243 ----
NM_152622chr51403 ----12439
NM_152624chr5146664 6315 6286 6112 5412 4899 4757 2229 1994 1427 1233 969 805 468 16734 36490 1639 901 --
NM_152629chr931031 408 36 --13188 12580
NM_152638chr12----11171 --
NM_152641chr1242447 723 612 155 --12111 --
NM_152678chr332747 2303 159 --12124 --
NM_152680chr421830 1814 --12306 --
NM_152682chr431268 166 94 ----1305
NM_152724chr1032682 687 104 --2526 26 --
NM_152734chr684670 3862 2107 1510 1313 867 272 260 --54530 3577 912 898 288 --
NM_152737chr61138 11522 ----
NM_152739chr71324 ------
NM_152740chr71653 --1240 --
NM_152748chr71104 ----1488
NM_152754chr713612 12683 22935 1511 --
NM_152756chr523703 3408 --1162 --
NM_152758chr81797 --42658 1861 1011 807 --
NM_152774chr752156 989 678 556 247 --11959 11092
NM_152780chrX21133 851 --11104 --
NM_152787chrX63583 3383 2581 2466 1206 965 --12927 --
NM_152793chr744839 1999 1845 189 ----1379
NM_152835chr132302 961 797 --12930 --
NM_152836chr821684 1589 --1561 --
NM_152837chr821684 1589 --1561 --
NM_152838chr202721 32 13426 1948 --
NM_152856chrX----1155 --
NM_152860chr1241355 1320 528 498 --11386 --
NM_152878chr2231592 1552 407 --1482 --
NM_152914chr17114334 3738 3068 2969 2849 1697 1672 1503 1409 1207 702 --2826 51 --
NM_152924chr1576670 6303 5140 2075 2022 104 93 1419 11886 14248
NM_152996chr151871 1404 1310 742 288 ------
NM_152999chr774567 4271 4218 3770 1802 133 61 --24814 854 --
NM_153020chr641714 1590 1259 89 ------
NM_153029chr1673845 3720 3172 3054 1301 1222 830 --13423 --
NM_153182chr322902 2637 12142 12339 --
NM_153183chrX1837 1939 31181 437 222 --
NM_153186chr91281 --1567 --
NM_153188chr585345 5071 4642 4364 3655 3644 1100 507 --24808 1724 11433
NM_153207chr1234108 2804 2768 12633 13128 13574
NM_153226chr1011065 1946 21204 417 --
NM_153235chr642190 2129 639 159 ------
NM_153251chr132211 192 ------
NM_153260chr152587 40 21367 534 1146 --
NM_153262chr112053 21150 823 ----
NM_153267chr91573 ----1118
NM_153273chr342713 2520 1862 325 ----1558
NM_153321chr1721059 997 ------
NM_153322chr1721059 997 ------
NM_153350chr1641738 248 162 42 ------
NM_153354chr51933 1785 ----
NM_153365chr462760 2430 2195 1833 201 159 ------
NM_153456chr13116115 5659 5406 5228 5122 4961 4861 4279 1440 536 296 --32139 1205 54 --
NM_153464chr191651 ------
NM_153605chr32996 247 11268 ----
NM_153607chr532741 2499 1998 11043 11250 --
NM_153619chr1533147 885 661 ------
NM_153634chr1231387 1091 1045 --11398 21588 1202
NM_153646chr142916 30 11952 1487 22567 2190
NM_153647chr142916 30 11952 1487 22567 2190
NM_153648chr142916 30 11952 1487 22567 2190
NM_153649chr142335 2129 2105 1806 --41624 395 98 80 --
NM_153675chr20181 ------
NM_153686chr422309 996 --2757 78 --
NM_153690chr3----1748 --
NM_153757chr421224 480 --1189 --
NM_153810chr1055014 4072 4001 3574 1695 11605 35049 5036 3136 --
NM_170606chr72544 400 1461 1112 --
NM_170665chr1253506 2956 2791 1069 542 --13745 14527
NM_170674chr152916 378 11124 ----
NM_170675chr15154 1800 ----
NM_170676chr15154 1800 ----
NM_170677chr152916 378 11124 ----
NM_170706chr143115 1036 192 118 12791 ----
NM_170709chr8--22185 1688 12125 --
NM_170724chr621018 795 --1240 1808
NM_170739chr11----1231 --
NM_170741chr1731684 781 755 12250 ----
NM_170742chr1731684 781 755 12250 ----
NM_170775chr5132 ------
NM_172016chr641366 1088 337 197 ----1910
NM_172020chr732059 1953 51 ------
NM_172058chr83548 493 139 ----11811
NM_172059chr83548 493 139 ----11811
NM_172060chr83548 493 139 ----11811
NM_172070chr211821 --22191 1420 --
NM_172071chr196111 6018 5678 5244 5074 4838 2720 2257 2172 17011 36242 2400 2036 1359
NM_172103chr631071 958 376 --1534 2519 405
NM_172105chr631071 958 376 --1534 2519 405
NM_172127chr431804 1316 770 --11308 --
NM_172128chr431760 1272 726 --11264 --
NM_172315chr152916 378 11124 ----
NM_172316chr152916 378 11124 ----
NM_172373chr13----1136 1474
NM_172387chr1851348 1240 278 60 43 ------
NM_172388chr1861395 1287 325 107 90 22 ------
NM_172389chr1861395 1287 325 107 90 22 ------
NM_173054chr73742 235 181 ------
NM_173060chr531279 1270 808 --164 --
NM_173061chr531279 1270 808 --164 --
NM_173063chr531279 1270 808 --164 --
NM_173065chr153139 2582 2462 2230 100 --21345 555 --
NM_173078chrX164 ------
NM_173083chr121334 1127 ------
NM_173157chr12----1508 --
NM_173163chr163537 434 182 ------
NM_173172chr2----1133 --
NM_173174chr82849 677 ------
NM_173175chr82849 677 ------
NM_173176chr82849 677 ------
NM_173177chr21434 ------
NM_173198chr932534 778 136 ------
NM_173200chr932534 778 136 ------
NM_173214chr16107819 7804 7769 5980 2891 2204 1268 1160 961 53 --11699 --
NM_173354chr2172086 1535 838 683 577 173 74 ------
NM_173355chr22836 653 1125 ----
NM_173359chr321805 1487 --21233 761 --
NM_173454chr152464 400 ------
NM_173468chr443772 3695 1976 1249 --25430 1357 14254
NM_173470chrX32811 2312 774 --32917 543 104 --
NM_173473chr102418 57 --32700 536 176 12719
NM_173474chr16137 --2149 135 --
NM_173495chrX22439 2177 ------
NM_173500chr1531280 1177 37 11332 21408 100 --
NM_173510chr2241055 1045 291 168 12325 1721 --
NM_173513chr2----193 --
NM_173552chr3--1134 11858 12503
NM_173560chr61518 ------
NM_173570chr362152 1709 1698 1361 306 274 --1147 --
NM_173576chr1011484 12073 12116 --
NM_173582chr1176047 5474 4341 4304 4220 1153 906 32086 1723 874 15443 --
NM_173595chr1264789 2043 1977 1186 1091 171 --14173 --
NM_173609chr151461 --1241 --
NM_173642chr1128672 8313 6589 5600 2523 1423 1186 817 735 643 605 158 --26279 301 --
NM_173681chr711789 ------
NM_173797chr511288 ------
NM_173808chr1------14066
NM_173809chr1051412 1277 1172 1154 1144 --11296 --
NM_173814chr151389 ------
NM_173822chr241801 1780 1529 1431 --1489 --
NM_173829chr585917 5499 5119 4556 4200 2454 1886 568 --23895 2424 11962
NM_173851chr832860 1595 1274 --12425 --
NM_173854chr152285 2134 1949 645 200 --32230 793 611 --
NM_174856chr202272 77 ------
NM_174902chr1141826 432 196 45 ------
NM_174911chr832666 898 653 --23242 1365 --
NM_174916chr1532260 1829 1691 ----11738
NM_174934chr1173579 3542 3478 3220 3129 2715 332 ------
NM_175061chr72846 656 1500 ----
NM_175623chr12137651 7155 6773 6456 5037 2490 2327 1735 1410 1273 802 159 104 ------
NM_175624chr12137746 7250 6868 6551 5132 2585 2422 1830 1505 1368 897 254 199 ------
NM_175625chr12137746 7250 6868 6551 5132 2585 2422 1830 1505 1368 897 254 199 ------
NM_175634chr83329 283 202 ------
NM_175635chr83329 283 202 ------
NM_175636chr83329 283 202 ------
NM_175736chr12117390 7097 7056 6463 2860 2126 1792 1588 943 221 139 --46398 5407 4810 893 --
NM_175852chr192567 2446 2257 1923 890 844 337 185 111 --11858 --
NM_175854chr1321690 314 141 22662 324 --
NM_175856chr51169 --1286 --
NM_175863chr61295 ----1350
NM_175898chr1541396 1237 617 122 ------
NM_175907chr1842875 2770 2749 1836 1872 ----
NM_175929chr13126 ------
NM_176801chr4----11748 --
NM_176814chr7--2383 55 1266 --
NM_176823chr183483 2423 2378 1363 575 223 207 95 ----13819
NM_176863chr1741655 1315 574 509 ------
NM_177414chr141704 1302 1289 322 1569 1153 1468
NM_177438chr1433516 3458 3201 --32973 900 705 --
NM_177559chr201973 ------
NM_177560chr201973 ------
NM_177925chr1233033 985 325 --22555 882 --
NM_177947chrX----21643 1308 --
NM_177948chrX----21643 1308 --
NM_177966chr331913 1340 554 ----1696
NM_177974chr153686 662 202 --173 --
NM_177990chr2021664 1264 --11606 --
NM_177999chr973377 3271 3147 2826 1225 657 470 --11450 11460
NM_178006chr1332050 1959 1645 --12152 --
NM_178007chr1332050 1959 1645 --12152 --
NM_178011chr102895 219 ------
NM_178033chr12468 210 ------
NM_178037chr1223334 2647 --12892 --
NM_178038chr1223334 2647 --12892 --
NM_178140chr552590 561 330 150 58 ------
NM_178151chrX46627 5852 5149 3157 12954 36514 5519 276 --
NM_178152chrX46627 5852 5149 3157 12954 36514 5519 276 --
NM_178153chrX46627 5852 5149 3157 12954 36514 5519 276 --
NM_178234chr8------161
NM_178313chr221626 849 --156 --
NM_178426chr131786 373 72 --22048 1583 --
NM_178427chr121686 273 --21948 1483 --
NM_178509chr1753418 3274 591 291 137 21210 256 ----
NM_178549chr11170 1226 ----
NM_178554chr322609 1308 --1161 --
NM_178565chr81225 11193 31270 680 372 --
NM_178584chr21266 ------
NM_178585chr453097 2077 698 443 398 --22970 2625 --
NM_178586chr1432107 336 177 1422 ----
NM_178812chr821620 1382 2390 250 --11492
NM_178864chr11----2677 497 --
NM_181077chr1542272 812 654 433 ------
NM_181302chr14----139 --
NM_181308chr14----139 --
NM_181332chrX51966 1012 937 611 130 --12618 --
NM_181349chr793143 2753 2426 2232 2156 1943 845 711 164 --1753 --
NM_181351chr1122897 907 12087 22999 749 --
NM_181354chr821069 646 --11224 --
NM_181361chr311101 --11419 --
NM_181442chr201405 --21000 818 --
NM_181443chr2022873 648 12038 ----
NM_181471chr74553 490 439 24 ------
NM_181481chr1865943 5574 1751 875 827 342 --26181 2736 --
NM_181482chr1865943 5574 1751 875 827 342 --26181 2736 --
NM_181483chr1865943 5574 1751 875 827 342 --26181 2736 --
NM_181486chr121159 --1199 --
NM_181492chr221313 --1473 11190
NM_181504chr584189 3295 2642 2600 1644 419 324 83 --13014 --
NM_181505chr171122 ------
NM_181523chr584189 3295 2642 2600 1644 419 324 83 --13014 --
NM_181524chr584189 3295 2642 2600 1644 419 324 83 --13014 --
NM_181659chr2043381 3274 2191 1141 12085 21133 980 12339
NM_181659chr2043381 3274 2191 1141 12085 21133 980 12339
NM_181672chrX3583 514 261 ----11815
NM_181673chrX3583 514 261 ----11815
NM_181674chr5------196
NM_181675chr5------196
NM_181676chr5------196
NM_181677chr5------196
NM_181678chr5------196
NM_181705chr544636 4489 3690 1164 1735 2476 288 2699 306
NM_181723chr821468 619 ------
NM_181782chr642171 1875 1649 227 12328 ----
NM_181783chr1231859 1787 1683 ------
NM_181794chr621116 806 1841 ----
NM_181795chr621116 806 1841 ----
NM_181828chr2263066 2892 2644 2434 390 282 1700 144 --
NM_181829chr2263066 2892 2644 2434 390 282 1700 144 --
NM_181830chr2263066 2892 2644 2434 390 282 1700 144 --
NM_181832chr2263081 2907 2659 2449 405 297 1715 159 --
NM_181836chr53685 562 241 1672 --1863
NM_181869chr1261849 906 892 884 483 24 179 ----
NM_181876chr452252 1866 778 544 349 12013 161 --
NM_181886chr441407 1311 1107 1016 ------
NM_181887chr441407 1311 1107 1016 ------
NM_181888chr441407 1311 1107 1016 ------
NM_181889chr441407 1311 1107 1016 ------
NM_181890chr441407 1311 1107 1016 ------
NM_181891chr441407 1311 1107 1016 ------
NM_181892chr441454 1358 1154 1063 ------
NM_181893chr441407 1311 1107 1016 ------
NM_181897chr361896 1769 617 530 458 95 1664 22684 2382 12489
NM_182485chr453169 973 895 702 520 ------
NM_182503chr6105068 4855 4704 4240 3907 1209 538 472 317 40 14378 --14167
NM_182526chr1472998 2723 2393 2055 1179 857 375 --2600 303 --
NM_182551chr222604 2466 --11091 13523
NM_182565chr172770 516 --1613 --
NM_182646chr453169 973 895 702 520 ------
NM_182664chr111512 22204 103 ----
NM_182691chr71116 --11327 --
NM_182692chr71116 --11327 --
NM_182717chr1061499 1301 1293 1282 1061 199 ------
NM_182720chr1061499 1301 1293 1282 1061 199 ------
NM_182721chr1061499 1301 1293 1282 1061 199 ------
NM_182722chr1061499 1301 1293 1282 1061 199 ------
NM_182723chr1061499 1301 1293 1282 1061 199 ------
NM_182734chr2062454 2164 1067 1039 675 265 ------
NM_182757chr683536 3339 1415 956 846 610 504 125 --177 --
NM_182758chr1532747 1395 881 --33864 3149 684 --
NM_182760chr34876 397 166 48 --1344 --
NM_182762chr785367 5164 5118 4834 4780 908 812 530 15243 --11405
NM_182767chr12--11979 1123 --
NM_182789chr521076 758 ------
NM_182796chr53734 302 116 --1365 --
NM_182797chr2021644 165 --11159 --
NM_182830chr1452138 1581 414 237 219 ------
NM_182853chr1061499 1301 1293 1282 1061 199 ------
NM_182898chr742151 1842 658 22 ------
NM_182899chr742151 1842 658 22 ------
NM_182907chr641668 1649 537 42 --1884 11876
NM_182910chr142763 85 ------
NM_182913chr142763 85 ------
NM_182914chr142763 85 ------
NM_182918chr2131359 1220 396 --31271 1048 241 --
NM_182920chr331056 557 110 --1964 --
NM_182931chr7----3660 633 269 --
NM_182936chr1441523 1425 1051 75 1208 ----
NM_182943chr311115 ------
NM_182964chr1193245 2980 2852 2832 2461 2274 1146 261 80 --12599 --
NM_182970chr20134221 3543 3470 3275 3174 3119 2714 1636 1461 239 223 56 34 --23448 1602 --
NM_182972chr152561 2288 2011 1977 282 --32346 2255 2244 --
NM_182977chr5----11112 --
NM_183002chr1441523 1425 1051 75 1208 ----
NM_183004chr1483106 3062 2855 2624 2476 1331 610 330 23472 1512 12896 12612
NM_183011chr1061499 1301 1293 1282 1061 199 ------
NM_183012chr1061499 1301 1293 1282 1061 199 ------
NM_183013chr1061499 1301 1293 1282 1061 199 ------
NM_183043chr13--1346 ----
NM_183044chr13--1346 ----
NM_183075chr432311 2195 1863 --32122 1991 1158 --
NM_183234chr152585 50 31509 1361 381 1626 --
NM_183235chr152585 50 31509 1361 381 1626 --
NM_183236chr152585 50 31509 1361 381 1626 --
NM_183323chr521076 758 ------
NM_183376chr1532193 1939 878 --12383 --
NM_183381chr33852 151 145 --1979 --
NM_183383chr33852 151 145 --1979 --
NM_183384chr33852 151 145 --1979 --
NM_183393chr32908 667 --1167 --
NM_183394chr32908 667 --1167 --
NM_184085chr81153 ----1229
NM_184086chr81153 ----1229
NM_184087chr81153 ----1229
NM_184234chr20----1816 --
NM_194071chr733973 3647 95 --15348 --
NM_194247chr244529 4502 3439 548 ------
NM_194272chr152294 234 ------
NM_194278chr1473522 3321 3104 2841 1393 1117 572 --12669 --
NM_194282chr442869 1171 938 399 --1343 --
NM_194283chr574246 3409 2820 2685 418 214 93 ------
NM_194285chr1163371 1216 938 473 443 381 12649 22178 551 --
NM_194286chr1265210 4046 3918 1297 608 515 --34169 3799 2321 1964
NM_194291chr832626 2283 303 --2753 158 21982 597
NM_194314chr133600 1084 579 14430 34915 4148 1871 14311
NM_194317chr242045 2033 747 77 --12577 21727 1016
NM_194328chr962999 1122 1087 222 140 121 --32653 2433 315 --
NM_194329chr962999 1122 1087 222 140 121 --32653 2433 315 --
NM_194330chr962999 1122 1087 222 140 121 --32653 2433 315 --
NM_194332chr962999 1122 1087 222 140 121 --32653 2433 315 --
NM_194434chr1864964 4620 4481 4352 4104 147 11956 25373 5316 --
NM_194454chr711154 11436 11177 --
NM_194455chr711154 11436 11177 --
NM_194456chr711154 11436 11177 --
NM_194463chrX2902 431 --1799 --
NM_197941chr522604 406 ------
NM_198047chr23518 475 40 ------
NM_198066chr1433032 1959 92 ----12923
NM_198077chr11204 ------
NM_198081chr692719 2456 2296 2279 871 471 421 361 180 --12997 --
NM_198086chr1441808 433 389 268 --31961 774 214 --
NM_198098chr751879 1291 1266 586 194 --1553 --
NM_198123chr821683 412 --11418 1533
NM_198124chr821683 412 --11418 1533
NM_198128chr1821737 743 22156 1576 11477 --
NM_198158chr32585 352 1261 12697 --
NM_198159chr32585 352 1261 12697 --
NM_198177chr32585 352 1261 12697 --
NM_198178chr32585 352 1261 12697 --
NM_198181chr1532202 822 664 --22600 1821 --
NM_198270chrX22568 2363 ------
NM_198273chr532669 1174 1163 ------
NM_198277chr1111144 --128 --
NM_198281chr441356 1288 1239 156 --23396 3193 12282
NM_198320chr1265050 5042 4876 4346 116 93 14673 1381 24783 4568
NM_198390chr162239 222 11546 ----
NM_198391chr201318 ------
NM_198392chr682054 1909 1692 1624 838 276 243 169 --1332 --
NM_198395chr531106 1014 237 --1185 --
NM_198399chr321638 1441 ----1337
NM_198400chr1552489 2119 300 113 61 12205 12839 --
NM_198465chrX32861 2223 2030 ------
NM_198503chr132268 796 39 --21964 500 --
NM_198513chr81791 ------
NM_198560chr3123186 3069 2620 868 744 703 667 292 234 168 99 31 --33428 2515 799 --
NM_198570chr7196 --129 --
NM_198571chr751576 1273 1201 260 218 ------
NM_198581chr266706 6638 5704 5390 5366 210 --67215 6050 5530 5353 5053 838 16680
NM_198595chr483803 3580 3374 3362 3162 504 210 94 11567 ----
NM_198793chr361665 1230 951 560 321 204 --22642 76 --
NM_198829chr721502 381 --11462 --
NM_198830chr17----1241 --
NM_198844chr172955 892 --1819 --
NM_198859chr375055 4813 3828 3585 1689 880 612 --14290 13631
NM_198896chr1122043 153 ------
NM_198900chr12117390 7097 7056 6463 2860 2126 1792 1588 943 221 139 --46398 5407 4810 893 --
NM_198901chr731198 870 103 ------
NM_198904chr532130 1511 104 ------
NM_198995chr18----1191 --
NM_199005chr9183 1857 ----
NM_199040chr1233790 3376 2658 --22858 961 --
NM_199044chr12896 518 ------
NM_199072chr732815 2350 825 --12374 --
NM_199076chr1041038 801 132 73 ------
NM_199132chr1932181 1755 26 1854 --11691
NM_199167chr18----1385 --
NM_199169chr2052682 2422 1232 1117 758 1684 ----
NM_199170chr2052682 2422 1232 1117 758 1684 ----
NM_199171chr2052682 2422 1232 1117 758 1684 ----
NM_199188chr1222716 2700 --1485 23297 654
NM_199189chr51249 1706 1890 --
NM_199190chr1222716 2700 --1485 23297 654
NM_199205chr8----2719 304 --
NM_199245chr1232526 2409 791 11026 12276 --
NM_199320chr422078 452 11963 1783 --
NM_199320chr422078 452 11963 1783 --
NM_199321chr172955 892 --1819 --
NM_199324chr432948 1060 553 --22292 1445 --
NM_199328chr212889 762 ------
NM_199351chr16592 568 544 440 122 89 ------
NM_199359chr202599 384 ------
NM_199360chr202599 384 ------
NM_199361chr202599 384 ------
NM_199362chr202599 384 ------
NM_199363chr202599 384 ------
NM_199421chr14105075 4979 4618 4610 4192 3789 3299 1687 1186 1094 --34874 3094 539 --
NM_199436chr2102833 2734 2585 2439 2289 1129 759 207 105 58 --32598 1917 1239 --
NM_199437chr1142375 2196 1692 220 --12360 --
NM_199438chr1142375 2196 1692 220 --12360 --
NM_199439chr1142375 2196 1692 220 --12360 --
NM_199454chr184123 3390 3363 3282 2914 1039 525 143 --1862 --
NM_199478chrX2581 253 ----1705
NM_199482chr211832 --11619 --
NM_201266chr242706 2599 2489 543 --32089 2058 389 --
NM_201279chr242706 2599 2489 543 --32089 2058 389 --
NM_201413chr211880 ------
NM_201414chr211880 ------
NM_201437chr82134 123 11090 11016 --
NM_201444chr121230 ------
NM_201445chr121230 ------
NM_201535chr141290 --3159 134 128 --
NM_201536chr141290 --3159 134 128 --
NM_201537chr141290 --3159 134 128 --
NM_201538chr141290 --3159 134 128 --
NM_201539chr141290 --3159 134 128 --
NM_201540chr141290 --3159 134 128 --
NM_201541chr141290 --3159 134 128 --
NM_201554chr121230 ------
NM_201570chr1051696 1558 797 206 106 ------
NM_201571chr1051696 1558 797 206 106 ------
NM_201572chr1051696 1558 797 206 106 ------
NM_201590chr1051696 1558 797 206 106 ------
NM_201591chr42200 122 ------
NM_201592chr42200 122 ------
NM_201593chr1051696 1558 797 206 106 ------
NM_201596chr1051696 1558 797 206 106 ------
NM_201597chr1051696 1558 797 206 106 ------
NM_201599chrX41184 928 861 392 --11094 --
NM_201628chr193060 3022 2799 2196 1110 1073 821 556 214 ------
NM_203283chr4133 --1634 --
NM_203284chr4133 --1634 --
NM_203301chr1411691 1512 11502 --
NM_203304chr193854 764 355 --1326 --
NM_203327chr2073298 1584 1370 729 541 517 22 --24336 3924 --
NM_203329chr1196837 6473 5415 5402 2817 2320 1530 233 163 --46461 2308 1194 1165 11901
NM_203330chr1196837 6473 5415 5402 2817 2320 1530 233 163 --46461 2308 1194 1165 11901
NM_203331chr1196837 6473 5415 5402 2817 2320 1530 233 163 --46461 2308 1194 1165 11901
NM_203390chr81118 --21626 1620 11525
NM_203391chrX199 1658 1644 --
NM_203394chr1232069 977 236 ------
NM_203403chr91399 --1102 --
NM_203413chr173946 860 312 --163 1235
NM_203434chr91916 1192 ----
NM_203446chr212767 488 1799 ----
NM_203459chr121605 94 ------
NM_203487chr13----11721 --
NM_203499chr17----2853 844 --
NM_205768chr121877 522 --11761 --
NM_205860chr132484 1963 346 1822 22512 1203 --
NM_206853chr61107 --12876 --
NM_206854chr663716 3623 3294 1368 624 171 --44137 177 162 136 --
NM_206855chr674681 4588 4259 2333 1589 1136 968 --45102 1142 1127 1101 --
NM_206876chr223548 3427 1143 ----
NM_206907chr542385 1162 398 322 ----12714
NM_206909chr835906 5298 59 36368 6006 5982 26480 1172 15496
NM_206914chr1241804 486 227 126 21952 757 32159 1603 892 --
NM_206937chr13134 --1845 --
NM_206938chr1131646 517 65 --1654 --
NM_206939chr1131646 517 65 --1654 --
NM_206940chr1131646 517 65 --1654 --
NM_206944chr92183 152 ------
NM_206945chr92183 152 ------
NM_206946chr92183 152 ------
NM_206947chr92183 152 ------
NM_207012chr102665 196 --22668 2540 1408
NM_207015chr32488 383 ------
NM_207042chr12665 194 ------
NM_207043chr132040 514 86 ------
NM_207044chr132040 514 86 ------
NM_207045chr12665 194 ------
NM_207046chr12665 194 ------
NM_207047chr132040 514 86 ------
NM_207113chr751014 610 292 263 238 --21651 103 --
NM_207121chr204545 493 403 386 139 ----
NM_207123chr43679 128 72 ------
NM_207171chr121763 145 --21907 259 --
NM_207292chr322323 2279 12498 33359 2947 2444 --
NM_207293chr322323 2279 12498 33359 2947 2444 --
NM_207294chr322323 2279 12498 33359 2947 2444 --
NM_207295chr322323 2279 12498 33359 2947 2444 --
NM_207296chr322323 2279 12498 33359 2947 2444 --
NM_207297chr332348 2304 2069 12523 33384 2972 2469 --
NM_207299chr91664 1778 ----
NM_207303chr1043365 3168 997 904 14180 22600 72 --
NM_207304chr131681 ----1918
NM_207306chr164125 3406 3236 2996 2974 131 14571 ----
NM_207317chr5------1450
NM_207371chr1011096 ----11343
NM_207381chr15258 24 ------
NM_207405chr452217 2132 1914 1497 177 ------
NM_207406chr475559 4888 4779 2507 643 460 190 --1997 11951
NM_207429chr1182655 2153 1942 681 622 449 361 94 1749 32248 715 615 11965
NM_207481chr2--11442 ----
NM_207491chr4162 --21120 346 --
NM_212471chr1731723 784 222 --11809 --
NM_212472chr1731723 784 222 --11809 --
NM_212539chr3186 --1348 --
NM_212558chr924157 107 13216 24062 1602 --
NM_213593chr131021 132 92 ------
NM_213594chr12--186 2907 305 --
NM_213654chr321063 596 ------
NM_213662chr1741941 1669 292 68 ----12169