TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3977
miRNA Sequence: GUGCUUCAUCGUAAUUAACCUUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr1431112 811 385 ------
NM_000067chr8----1582 --
NM_000084chrX86377 6219 6027 4888 2678 2568 693 104 --15636 --
NM_000112chr5104973 4868 4351 4304 4119 4097 3839 1845 358 136 11298 44088 3421 351 234 --
NM_000125chr642621 1254 1018 980 --11101 23608 2725
NM_000151chr1731756 439 360 ----294 72
NM_000176chr543099 3024 2813 179 13107 22917 1012 --
NM_000217chr12114955 4717 4316 3556 3538 3370 1610 1580 1542 1086 852 14543 13870 --
NM_000222chr41776 11644 ----
NM_000232chr422096 490 1237 1315 --
NM_000233chr22839 213 ------
NM_000252chrX21190 384 --11050 --
NM_000264chr973046 2839 2681 1303 1239 942 731 --11227 122
NM_000280chr112925 340 ------
NM_000297chr411752 --1307 --
NM_000313chr31697 2955 353 1862 --
NM_000314chr1022618 369 ------
NM_000328chrX------175
NM_000332chr645794 4517 1387 305 --15105 12666
NM_000337chr5166480 6305 6121 5699 5545 5016 4553 4369 4034 2276 2162 1854 1437 1270 1237 1159 --11645 --
NM_000345chr41194 --1145 1754
NM_000408chr233293 3208 3063 --1968 1636
NM_000411chr2162842 2709 2594 1170 872 203 --32095 2084 911 --
NM_000416chr6129 ------
NM_000430chr1773594 3449 3210 2843 2348 1056 212 13320 11449 --
NM_000439chr541888 1648 239 73 --21916 1731 --
NM_000461chr361812 1007 891 531 408 124 --34170 3397 1589 --
NM_000462chr151534 11276 ----
NM_000480chr1121616 1478 ------
NM_000484chr213971 942 26 1920 ----
NM_000489chrX33177 924 506 ----11185
NM_000492chr741056 951 79 48 ----11107
NM_000503chr821638 1607 ----11732
NM_000533chrX1631 ----11775
NM_000538chr1331475 1234 595 --1289 --
NM_000555chrX87591 7539 7044 6608 5777 2474 2463 524 25013 983 37612 5963 5955 1721
NM_000573chr132279 2212 104 11778 ----
NM_000599chr243018 2969 1160 732 --1857 21490 247
NM_000611chr11146721 6694 6615 6377 6142 5637 5619 4747 2662 2466 2224 1539 1037 459 --25838 223 --
NM_000618chr12105873 5148 4572 2427 1584 1504 985 702 561 370 ------
NM_000618chr12105873 5148 4572 2427 1584 1504 985 702 561 370 ------
NM_000633chr1854181 3341 1434 1427 1100 21618 1306 24555 1193 --
NM_000651chr132279 2212 104 11778 ----
NM_000724chr1031780 1563 40 ------
NM_000726chr21922 ------
NM_000809chr499231 8948 8897 8541 8515 8008 7696 6173 2026 28625 8040 16956 --
NM_000813chr5--124 --25093 4892
NM_000816chr51615 ------
NM_000817chr21467 ----1787
NM_000831chr1155973 5826 5348 5329 5135 4976 4092 3872 2469 1371 1299 1047 842 411 253 35477 4909 2519 35676 4882 2125 16282
NM_000840chr71367 ------
NM_000859chr51336 1474 ----
NM_000868chrX31818 1017 537 --32066 1844 369 --
NM_000875chr15107004 6073 5305 4608 2078 1889 1607 1536 908 647 --25010 4259 --
NM_000880chr8----1344 --
NM_000926chr11118840 7592 7579 6806 6439 6408 6377 6228 3604 3348 1752 --16395 --
NM_000935chr3168 ------
NM_000937chr171407 ------
NM_000945chr23147 118 102 ------
NM_000958chr541306 926 899 183 ------
NM_000963chr11798 1395 --1971
NM_001001323chr1211025 --12619 11085
NM_001001395chr1232630 2249 1064 11107 22505 316 --
NM_001001396chr124435 409 1437 13699 11024
NM_001001433chr2052908 2418 2281 1270 1098 22519 463 23112 2255 --
NM_001001481chr812361 1793 --1737
NM_001001664chr231641 1432 1426 2960 726 12810 12507
NM_001001665chr263350 2774 2371 2339 2223 969 21155 512 32748 2206 758 12908
NM_001001971chr1021307 103 11076 ----
NM_001002243chr21178 ------
NM_001002257chr231261 815 337 2707 653 --21347 1227
NM_001002860chr1473338 3286 3106 890 782 648 234 11146 14575 11823
NM_001002906chrY1538 ------
NM_001002909chr1751948 1459 1453 654 161 ------
NM_001003407chr1094787 4489 4313 4086 1694 1308 788 192 71 --23569 3557 33959 3690 3204
NM_001003408chr1094787 4489 4313 4086 1694 1308 788 192 71 --23569 3557 33959 3690 3204
NM_001003652chr1878441 6692 6069 2604 2439 1574 519 11994 16869 --
NM_001003674chr18126579 6439 5655 5647 5591 2125 814 703 631 400 357 50 --12460 15666
NM_001003675chr18126579 6439 5655 5647 5591 2125 814 703 631 400 357 50 --12460 15666
NM_001003760chr632974 979 133 --12489 1730
NM_001003792chr311188 ------
NM_001003793chr311188 ------
NM_001003805chr14------192
NM_001003810chr42161 139 --141 --
NM_001003927chr172150 52 ------
NM_001004317chr654023 3055 2925 2913 1242 --44416 3170 2805 398 11299
NM_001004419chr1274206 4181 4097 3157 891 622 109 1389 2767 527 --
NM_001005375chrY31246 619 486 --11749 --
NM_001005404chr1743732 2813 2771 1434 --23818 3256 13352
NM_001005476chr23633 120 102 ------
NM_001005609chrX83377 3241 3009 2530 844 535 455 211 12714 23715 231 --
NM_001005739chr21896 ------
NM_001005746chr21922 ------
NM_001005747chr21922 ------
NM_001005781chr22480 51 --1463 --
NM_001006600chr522134 469 1586 12256 --
NM_001006605chr14872 368 350 227 ----1152
NM_001006605chr14872 368 350 227 ----1152
NM_001007024chr1754056 1460 316 264 166 13071 13225 13413
NM_001007025chr1754056 1460 316 264 166 13071 13225 13413
NM_001007189chr5----136 --
NM_001007246chr21------154
NM_001007544chr11345 ------
NM_001007595chr151271 ------
NM_001008225chr7----1165 --
NM_001008239chr1873498 2657 2337 975 876 713 524 ----11285
NM_001008392chr332745 974 399 --11355 12480
NM_001008495chr821429 630 --11936 --
NM_001008540chr21144 ------
NM_001008541chr1052303 2078 738 601 514 --11838 --
NM_001008541chr1052303 2078 738 601 514 --11838 --
NM_001008701chr19102392 2357 2225 2201 1026 980 795 607 475 89 --32456 711 483 --
NM_001009552chr8137 ------
NM_001009880chr22104401 4127 3543 3522 1889 1406 1168 316 181 111 --44326 3193 1870 957 --
NM_001009881chr1----1619 --
NM_001009882chr1----1619 --
NM_001009899chr365885 5858 5162 4917 4325 1750 ------
NM_001010853chr633190 556 497 ------
NM_001010861chr131098 440 92 ------
NM_001010867chr1146126 5913 5821 4575 2354 2029 1844 1783 1732 1484 1332 822 556 401 --45509 4549 2680 993 --
NM_001010888chrX73918 3458 3241 3108 2875 2816 927 ------
NM_001010891chr5116573 6427 6096 5030 4585 4417 2464 2156 2118 1342 434 --14873 --
NM_001010908chr101258 ------
NM_001010922chr154043 3998 1140 1028 165 21684 887 --1285
NM_001010986chrX----1305 --
NM_001011663chr10------1302
NM_001011666chr765518 5145 4900 4363 2022 1378 --25014 905 --
NM_001011713chr141419 ------
NM_001011885chr1511233 11171 1718 --
NM_001012393chr1174752 4661 4041 3639 1266 713 648 14367 ----
NM_001012755chrX63885 3660 3653 3295 1099 793 ------
NM_001012968chrX22455 376 12040 ----
NM_001013406chr71155 11193 ----
NM_001013415chr41984 ------
NM_001013693chr152982 2175 2133 2117 2015 ------
NM_001013693chr152982 2175 2133 2117 2015 ------
NM_001013839chr1782447 2260 1884 1778 1615 548 421 95 3786 768 710 21761 838 --
NM_001014434chr1--1868 ----
NM_001014797chr10107518 6734 6570 6564 6553 6085 5143 2896 2374 1550 16848 36986 5771 2629 --
NM_001015508chr82687 63 --1185 1725
NM_001015877chrX32912 2757 530 2289 230 32539 2441 1156 12701
NM_001015882chr91862 ------
NM_001017395chr332872 566 83 13035 1290 --
NM_001017424chr121263 627 11699 --1678
NM_001017425chr121263 627 11699 --1678
NM_001017930chrX2973 436 ------
NM_001018050chr22183143 3095 2506 2360 2335 2264 2205 2161 2103 1355 1277 1167 663 630 557 550 443 78 ----1120
NM_001018052chr22183143 3095 2506 2360 2335 2264 2205 2161 2103 1355 1277 1167 663 630 557 550 443 78 ----1120
NM_001018056chr9180 ------
NM_001018065chr965963 4684 2214 770 663 269 1585 13692 11918
NM_001018066chr965963 4684 2214 770 663 269 1585 13692 11918
NM_001018067chr155139 5076 3544 1299 1105 24306 181 1840 --
NM_001018068chr155139 5076 3544 1299 1105 24306 181 1840 --
NM_001018069chr155139 5076 3544 1299 1105 24306 181 1840 --
NM_001018074chr543099 3024 2813 179 13107 22917 1012 --
NM_001018075chr543099 3024 2813 179 13107 22917 1012 --
NM_001018076chr543099 3024 2813 179 13107 22917 1012 --
NM_001018077chr543099 3024 2813 179 13107 22917 1012 --
NM_001023560chr63436 316 159 ------
NM_001024024chr141354 ------
NM_001024070chr141350 ------
NM_001024094chr543099 3024 2813 179 13107 22917 1012 --
NM_001024463chr1531088 250 23 --1269 --
NM_001024647chr12136570 6463 6316 5774 5612 5344 2940 2137 2131 1996 1846 775 135 1387 --12372
NM_001024649chr5----1786 21844 256
NM_001024808chr1282712 2557 2211 1772 1068 576 563 230 ----1192
NM_001024948chr133162 1114 209 33286 1396 1100 13069 --
NM_001024956chr1144261 3593 1187 875 23870 1515 14443 --
NM_001025076chr1065327 5180 4821 4638 4593 4555 11142 1984 --
NM_001025077chr10106685 6538 6179 5996 5951 5913 5099 1035 526 322 12500 22342 973 --
NM_001025233chr1242610 1703 483 81 1125 ----
NM_001025266chr343145 1907 1505 292 --34657 1413 1112 13220
NM_001025356chr1272441 2393 2037 1996 1874 694 22 --22868 650 --
NM_001025389chr1121616 1478 ------
NM_001025390chr1121616 1478 ------
NM_001025579chr171383 ------
NM_001025596chr11------1504
NM_001029875chr5----21994 833 1741
NM_001030007chr1683856 3595 3538 3388 1530 1215 563 199 12571 21435 161 --
NM_001030055chr1423138 499 --23943 1562 --
NM_001031684chr21520 ----1558
NM_001031695chr2295408 5165 4448 4092 1687 1180 974 335 48 13434 25440 4181 14777
NM_001031716chr21871 11021 1747 --
NM_001031732chr433019 2946 107 13011 33463 895 444 --
NM_001031804chr1664253 3815 3696 3610 1350 412 --14032 --
NM_001031812chr512279 --1696 --
NM_001032293chr171198 --1258 --
NM_001033117chr384892 4569 3942 3663 3582 1632 231 145 1272 --1620
NM_001033554chr171283 ------
NM_001033578chr822064 644 1589 --12263
NM_001033723chr832818 346 106 --42313 2249 501 222 12325
NM_001033925chr1071678 840 772 740 575 564 468 ----1865
NM_001034841chr1643620 1631 502 77 1324 15161 --
NM_001034954chr1062818 729 684 441 313 45 2578 114 31114 588 300 1219
NM_001034955chr1062818 729 684 441 313 45 2578 114 31114 588 300 1219
NM_001034956chr1062818 729 684 441 313 45 2578 114 31114 588 300 1219
NM_001034957chr1062818 729 684 441 313 45 2578 114 31114 588 300 1219
NM_001035521chr23599 508 32 ------
NM_001037164chr741675 1529 782 294 --21620 1515 1486
NM_001037172chr32412 285 11264 1539 --
NM_001037317chr131098 440 92 ------
NM_001037738chr51105 ------
NM_001039538chr21973 ------
NM_001039547chr387297 6003 5379 4999 2959 2105 132 63 11101 46495 2236 781 436 17560
NM_001039570chr22124566 4303 3625 3511 3219 3090 1819 1401 808 710 298 156 --22867 1536 --
NM_001039571chr22124566 4303 3625 3511 3219 3090 1819 1401 808 710 298 156 --22867 1536 --
NM_001039577chr1114102 4092 3889 3417 3039 2887 2743 899 722 691 376 14440 11581 --
NM_001039840chrX54685 2108 1509 668 186 ------
NM_001039916chr12138 ------
NM_001039917chr12138 ------
NM_001039918chr12138 ------
NM_001039919chr12138 ------
NM_001039920chr12138 ------
NM_001039937chr1343588 3310 895 640 11187 23742 1329 14016
NM_001040020chr7----11167 --
NM_001040100chr31421 1867 --11013
NM_001040142chr232109 2037 560 11697 11677 --
NM_001040143chr232109 2037 560 11697 11677 --
NM_001040152chr753781 1801 1774 1649 760 23949 225 43144 1262 638 399 14252
NM_001040157chr432099 1877 261 --22562 1842 --
NM_001040159chr41255 ------
NM_001040167chr731163 959 426 ------
NM_001040214chr621553 902 189 --11528
NM_001040272chr952334 2227 744 413 323 31585 1478 681 32175 1997 519 --
NM_001040284chr1675765 5549 5044 4914 4897 2327 2124 ----14831
NM_001040402chr432830 2088 520 --22722 2652 --
NM_001040429chr1343145 1320 1226 138 --1349 --
NM_001040633chr71266 ------
NM_001040876chr4----1115 --
NM_001042355chr16135363 4544 4425 3377 1738 1516 1429 704 666 299 258 242 187 --24655 173 --
NM_001042406chr621055 974 ----198
NM_001042412chr16135363 4544 4425 3377 1738 1516 1429 704 666 299 258 242 187 --24655 173 --
NM_001042413chr964105 3727 3597 3287 1618 399 11231 13205 13367
NM_001042453chrX--1676 21734 600 11488
NM_001042533chr333001 1105 512 --13313 11061
NM_001042555chr1244230 816 522 38 --14711 1260
NM_001042599chr236678 2453 2395 25295 1156 27072 1412 --
NM_001042604chr394785 4618 4494 4246 3225 3211 1854 1593 974 11225 31275 417 338 --
NM_001043351chr141443 1417 871 58 --1357 11698
NM_001044305chr61325 ----11231
NM_001044722chr512279 --1696 --
NM_001044723chr512279 --1696 --
NM_001046chr532574 308 234 ----12093
NM_001071775chr1311435 --1345 --
NM_001079874chr171938 1791 1388 1360 588 417 86 12048 11427 --
NM_001083621chr1114425 4002 3933 3381 1639 1352 1113 920 765 354 300 14505 31422 704 507 --
NM_001085487chr1169 ------
NM_001099678chr365107 4784 4778 2370 1191 74 1729 14919 --
NM_001100108chr1118298 7388 6879 6678 5865 5460 2711 1347 1169 1145 487 37115 632 176 78082 6944 6233 5913 5595 2639 122 --
NM_001106chr359724 6904 3061 1854 701 39116 8339 3522 36083 2038 1022 --
NM_001117chr1852399 2248 1963 1872 910 --12354 1121
NM_001121chr1011499 --1244 1576
NM_001126chr11114 ----1105
NM_001128chr1683856 3595 3538 3388 1530 1215 563 199 12571 21435 161 --
NM_001143chrY------132
NM_001146chr831545 163 133 188 --1946
NM_001148chr451962 1523 879 718 85 --163 1157
NM_001149chr10--180 ----
NM_001151chr4--197 ----
NM_001167chrX76367 5386 4403 4397 1300 362 247 14592 46195 6062 4435 4202 14744
NM_001173chr1423138 499 --23943 1562 --
NM_001186chr2153076 2475 995 475 44 ------
NM_001190chr19185 ------
NM_001199chr8------1243
NM_001200chr201379 --1285 --
NM_001204chr247510 5000 3042 658 21104 375 36583 2956 2216 --
NM_001256chr1722846 2145 --11947 --
NM_001259chr786392 6276 5758 5419 4932 4735 4415 659 14205 25709 5330 14218
NM_001271chr1582960 2450 2001 1290 959 627 539 139 --12331 1793
NM_001293chr112493 78 ------
NM_001310chr1242356 2126 1156 32 --32329 2293 2049 --
NM_001331chr1132366 837 179 --12412 2902 529
NM_001332chr551553 1446 1404 1198 309 --11340 --
NM_001364chr1163796 3719 3497 3484 1448 153 --13991 --
NM_001396chr2141899 1060 596 174 2768 666 ----
NM_001399chrX83377 3241 3009 2530 844 535 455 211 12714 23715 231 --
NM_001402chr631916 1615 758 11883 ----
NM_001415chrX31942 1880 1757 --11854 --
NM_001419chr1964897 4554 3731 3324 3282 1650 --34750 3646 301 --
NM_001432chr41833 2507 300 11514 13739
NM_001448chrX31786 1373 435 ------
NM_001463chr22659 519 1613 ----
NM_001465chr561791 1580 1497 1430 653 49 --12092 --
NM_001491chr632014 878 793 --12321 11793
NM_001521chr23599 508 32 ------
NM_001543chr5134704 4295 4172 3643 3618 3004 1752 1740 1555 1546 1306 179 149 --34069 2975 752 14365
NM_001604chr112925 340 ------
NM_001656chr5126 1715 1404 1396
NM_001663chr1432583 1996 1786 12393 12525 1911
NM_001679chr3------1175
NM_001682chr1221111 739 --12333 1799
NM_001684chr144152 1671 1571 126 1154 13416 1741
NM_001701chr9--134 --1640
NM_001706chr32914 889 ------
NM_001735chr9156 ------
NM_001746chr5----1786 21844 256
NM_001755chr1631660 1522 270 ------
NM_001759chr1265150 2108 1508 1433 804 540 --21829 207 11459
NM_001806chr1922664 2240 22185 666 ----
NM_001839chr1------1237
NM_001859chr953476 3224 2849 1589 1111 --33747 2592 695 11118
NM_001918chr158618 3499 3265 1547 1392 --57456 2540 1806 1530 479 15902
NM_001923chr111460 ------
NM_001924chr1142 ------
NM_001938chr141872 1622 1594 1557 ------
NM_001939chrX73656 3448 3183 810 690 309 194 1465 22439 1458 --
NM_001949chr653038 1292 1112 1030 493 --21987 885 1118
NM_001951chr82494 120 ------
NM_001967chr31594 ------
NM_001969chr142702 399 23573 601 22729 1453 1342
NM_001977chr411644 11550 31321 316 55 --
NM_001980chr1272206 2114 2026 911 669 324 147 ------
NM_001987chr1273975 3738 3721 3270 3203 1676 80 1111 23062 163 13617
NM_002015chr1343350 2416 265 66 12256 ----
NM_002017chr111503 ------
NM_002024chrX21370 766 ------
NM_002025chrX129266 8707 8629 5941 3644 3522 3461 2139 1856 1828 753 328 22353 1031 37949 7213 2255 17247
NM_002026chr24964 701 262 232 ------
NM_002033chr1133866 3557 321 3889 615 22 13527 23270 432
NM_002040chr2132566 2506 717 --22648 343 --
NM_002045chr3186 ------
NM_002048chr931182 1128 190 1313 ----
NM_002069chr721820 1745 --11530 --
NM_002076chr1242621 991 819 54 ------
NM_002106chr4----1232 --
NM_002130chr531317 1098 138 --11120 --
NM_002137chr741836 1620 1599 311 ------
NM_002138chr42161 139 --141 --
NM_002148chr21639 ------
NM_002157chr2153 ------
NM_002158chr253207 2746 1142 685 203 11354 12972 --
NM_002166chr21773 ------
NM_002202chr52957 259 ------
NM_002211chr1031143 959 920 ------
NM_002222chr32952 431 --11361 --
NM_002233chr11----1385 1332
NM_002239chr21998 ------
NM_002241chr192955 2387 1180 547 385 379 364 266 99 ------
NM_002242chr221796 313 ----1379
NM_002267chr1332402 1838 1634 --143 1774
NM_002270chr555491 2037 1841 585 218 1275 24356 660 --
NM_002296chr151764 1459 1422 1222 141 ------
NM_002298chr131608 1639 ----
NM_002310chr554203 2304 1542 430 275 --36343 6261 99 --
NM_002313chr1094787 4489 4313 4086 1694 1308 788 192 71 --23569 3557 33959 3690 3204
NM_002336chr1234434 3446 650 14495 2801 102 21868 301
NM_002349chr21226 ------
NM_002356chr64851 843 443 414 --1546 --
NM_002374chr21973 ------
NM_002395chr6------21229 1140
NM_002429chr1241333 1009 553 43 --21511 1142 21433 1107
NM_002465chr121316 ------
NM_002481chr1137797 7358 7323 7183 6717 5954 5546 5248 1519 1142 1101 1035 538 --32231 1307 227 --
NM_002487chr151722 ------
NM_002545chr1174752 4661 4041 3639 1266 713 648 14367 ----
NM_002590chr131112 ------
NM_002592chr202215 74 ------
NM_002595chr1211783 ------
NM_002628chr31905 ------
NM_002655chr845177 5135 2125 1263 11096 22022 1019 --
NM_002657chr2093918 3684 3114 3014 2770 1493 1087 140 45 --1916 --
NM_002667chr61466 ------
NM_002677chr842490 2048 401 22 ----1416
NM_002687chr1421246 904 ------
NM_002709chr223192 2579 --22814 1233 --
NM_002716chr112979 632 13100 22669 1267 11063
NM_002718chr352329 1908 1874 374 323 --22104 705 --
NM_002720chr161209 ------
NM_002731chr11695 12399 188 12691
NM_002737chr17116373 6365 5978 5813 5757 5524 2209 2158 1870 1151 935 26677 4184 35558 4060 2527 --
NM_002745chr2251217 855 772 696 587 14492 11132 13248
NM_002748chr15--11017 ----
NM_002760chrY95648 5565 2163 2135 1901 1890 1146 861 60 55280 4386 3660 1575 266 14041 1872
NM_002823chr21595 ------
NM_002828chr182965 925 1913 --1975
NM_002830chr2--1372 ----
NM_002834chr1222618 292 --23730 1293 --
NM_002837chr1244491 3069 1619 1128 --11637 --
NM_002848chr1251212 970 486 274 146 ------
NM_002869chr1132180 838 701 ------
NM_002886chr354121 3718 3712 1935 514 34565 3253 1357 1678 --
NM_002890chr5----1990 --
NM_002897chr21577 ------
NM_002923chr13632 457 430 ------
NM_002940chr4----1115 --
NM_002941chr321258 1054 --1649 21125 230
NM_002942chr321212 972 11031 ----
NM_002943chr15----137 --
NM_002945chr171844 ----1338
NM_002959chr153713 3650 3566 1538 741 --33693 3497 1713 --
NM_002994chr42271 215 --11332 --
NM_003028chr973895 3834 3307 3195 3096 2508 1522 --23272 886 --
NM_003034chr1287652 7212 6158 5977 5509 5001 4965 3039 37295 5856 126 36741 1856 666 --
NM_003048chr262856 1094 914 813 799 543 --22832 513 1154
NM_003060chr521291 317 1441 ----
NM_003068chr81214 ------
NM_003081chr2011172 ------
NM_003091chr20125 ------
NM_003100chr51365 ------
NM_003108chr2106977 6832 5587 2729 2633 2497 2286 1664 471 454 26403 4465 16958 15126
NM_003112chr742492 2222 635 155 --1779 21236 1193
NM_003115chr13337 323 93 ------
NM_003144chr652130 1885 855 518 512 ------
NM_003155chr832790 2386 941 ------
NM_003185chr2011299 ------
NM_003189chr122588 2547 --1368 3798 210 100
NM_003199chr1875516 4876 4537 3724 1512 1201 1187 24031 3594 ----
NM_003257chr151527 --1120 1427
NM_003262chr334772 1563 1046 --24868 1819 --
NM_003281chr175326 5076 4081 4072 1883 1833 173 25219 4148 31165 237 89 --
NM_003292chr1--1813 --22135 540
NM_003320chr11104222 3303 3178 2734 1349 706 355 338 110 39 11719 1179 --
NM_003338chr1011542 ----1145
NM_003358chr9141 ------
NM_003383chr9180 ------
NM_003413chrX----1213 11690
NM_003432chr51222 ------
NM_003457chr171198 --1258 --
NM_003463chr673053 3012 2706 2590 2395 668 98 1399 13091 --
NM_003467chr21144 ------
NM_003478chr1132733 983 733 22639 1091 ----
NM_003482chr1251761 1716 327 316 261 12730 21090 137 1870
NM_003483chr1222165 1875 22424 676 ----
NM_003498chr1672203 2189 1758 560 354 296 195 22579 1768 12348 --
NM_003566chr1222300 463 13133 ----
NM_003574chr1833776 2003 1952 25648 5165 64923 4460 1475 1465 1420 525 --
NM_003601chr4------1209
NM_003603chr422102 1700 ----1307
NM_003607chr173830 3310 3054 2968 2832 858 557 ------
NM_003615chr334012 2515 188 --13914 --
NM_003620chr171798 ------
NM_003628chr23633 120 102 ------
NM_003629chr193073 2842 2734 2509 1261 887 639 227 127 --12607 --
NM_003644chr17105962 5589 5216 5038 4764 4656 4361 2426 1419 222 26184 5611 12573 --
NM_003672chr131698 1641 1260 1520 ----
NM_003692chr91895 ------
NM_003725chr121300 ------
NM_003743chr242307 1932 1567 366 11436 --1127
NM_003749chr1331791 1526 539 --1158 1727
NM_003750chr102937 894 ----1378
NM_003756chr8145 ------
NM_003759chr464225 3614 3200 2672 518 455 23914 120 14106 --
NM_003763chr2052908 2418 2281 1270 1098 22519 463 23112 2255 --
NM_003774chr1243275 2548 886 875 --1122 --
NM_003783chr121218 125 1874 ----
NM_003787chr1811234 --31371 386 190 --
NM_003822chr123070 2836 ------
NM_003850chr131189 ----1535
NM_003858chr14173 ------
NM_003861chr1472862 2790 2533 2153 980 882 833 1289 ----
NM_003872chr272507 2475 2285 980 955 749 371 12199 1409 --
NM_003884chr331422 491 180 --21766 1600 --
NM_003885chr1762623 2204 2002 751 438 328 ----1478
NM_003895chr2112147 11572 ----
NM_003899chr1362299 2121 1996 459 142 47 --12326 --
NM_003913chr663855 3480 1222 1125 883 114 ------
NM_003932chr2221566 563 1402 21716 162 11575
NM_003934chr921144 1085 ----1247
NM_003966chr5116618 6204 5436 4809 2968 1179 676 668 531 231 79 21320 1274 47444 7194 698 614 --
NM_003983chr1663551 3408 1682 1182 538 24 11382 21728 1592 13743
NM_004036chr2187 ------
NM_004060chr541034 982 97 36 --2992 201 --
NM_004071chr21227 ------
NM_004075chr121554 ------
NM_004079chr172805 2608 2510 2466 357 208 140 --52553 2304 889 327 41 --
NM_004081chrY31246 619 486 --11749 --
NM_004109chr1112357 ------
NM_004115chr13--1103 ----
NM_004124chr1412991 11416 ----
NM_004136chr1522053 224 13234 182 12220
NM_004156chr8137 ------
NM_004161chr221122 359 1615 --11205
NM_004171chr1189360 8795 8006 6443 1550 1331 1153 736 1470 29487 9139 27661 3775
NM_004183chr111762 ------
NM_004200chr11102775 2642 2372 1272 1229 737 533 425 218 168 --2824 702 --
NM_004227chr752605 2166 828 293 91 --22811 2383 13089
NM_004238chr21261 ------
NM_004272chr521643 498 ----11862
NM_004319chr172293 2124 1962 1157 467 412 402 --22359 37 --
NM_004331chr84987 969 590 42 2680 641 1172 --
NM_004338chr18126579 6439 5655 5647 5591 2125 814 703 631 400 357 50 --12460 15666
NM_004342chr71306 ------
NM_004368chr191394 ------
NM_004384chr512279 --1696 --
NM_004385chr5--183 ----
NM_004397chr1163216 3127 2642 1534 1104 592 13086 --13644
NM_004415chr63698 661 226 ------
NM_004430chr822020 1871 ------
NM_004432chr962309 1972 908 503 482 351 ------
NM_004439chr4----1164 --
NM_004447chr123885 752 247 ------
NM_004449chr2141311 272 266 172 --11146 --
NM_004457chr241504 1222 640 274 11681 ----
NM_004458chrX11660 ------
NM_004464chr433518 204 120 21036 767 33840 2646 959 --
NM_004474chr1196 ------
NM_004484chrX----1130 --
NM_004501chr153648 3577 3215 1566 822 1303 --11235
NM_004520chr51188 --2512 215 1290
NM_004537chr1221462 212 --21536 1338 --
NM_004540chr211618 --1277 --
NM_004588chr11104010 3683 2986 2930 1508 1325 1006 695 277 270 22995 1502 11299 13597
NM_004591chr21144 ------
NM_004593chr31102 ------
NM_004598chr532544 2425 1009 11287 12051 --
NM_004612chr964837 4318 4145 2949 1578 865 ----11666
NM_004654chrY31010 975 189 --21043 914 --
NM_004660chrY11624 ------
NM_004663chr151316 ----11194
NM_004668chr71299 ------
NM_004677chrY1538 ------
NM_004685chr1342421 1079 1038 650 --11096 --
NM_004703chr1752303 1792 800 716 626 ------
NM_004713chr142614 323 ------
NM_004718chr2149 ------
NM_004745chr876369 5108 2763 2434 1711 427 317 36977 2124 1860 1464 --
NM_004748chr1574012 3432 3158 995 727 483 367 24223 494 22625 1573 --
NM_004761chr61133 ------
NM_004772chr51484 ------
NM_004774chr1763001 2912 2587 2426 2345 2311 ----11239
NM_004788chr1112176 ----12068
NM_004798chr2063511 3487 3231 2541 433 117 21090 663 22972 2220 --
NM_004808chr1023009 713 --53399 3351 3090 897 112 --
NM_004834chr242801 2440 1067 77 --22086 448 --
NM_004849chr641705 1310 307 274 21495 92 ----
NM_004850chr211441 ----1190
NM_004859chr1752568 2232 1195 1009 931 1722 1998 12252
NM_004863chr1465252 4868 4723 4315 3222 1954 1429 54842 4706 3891 1700 1564 --
NM_004869chr1811318 ----11656
NM_004871chr1754056 1460 316 264 166 13071 13225 13413
NM_004904chr765518 5145 4900 4363 2022 1378 --25014 905 --
NM_004912chr71155 11193 ----
NM_004921chr131831 163 25 --12097 --
NM_004932chr5147 21809 607 ----
NM_004938chr921116 1007 21033 46 ----
NM_004949chr1842182 2055 193 167 11935 21336 552 --
NM_004973chr61369 ------
NM_004975chr201190 ------
NM_004976chr11115056 4916 4610 4604 4360 4041 3507 3492 752 682 105 ------
NM_004985chr1274470 4015 3395 1761 1470 1301 340 ------
NM_004992chrX158075 7350 7178 7106 6773 6703 6381 6034 5837 3043 2986 2100 1933 790 236 --2485 173 --
NM_004992chrX158075 7350 7178 7106 6773 6703 6381 6034 5837 3043 2986 2100 1933 790 236 --2485 173 --
NM_004999chr654212 4039 3647 3626 1327 --24013 2892 11579
NM_005000chr7------1420
NM_005012chr11130 ------
NM_005028chr1021948 841 1108 189 11995
NM_005032chrX172 ------
NM_005044chrX64204 4121 3125 1748 1165 726 23799 83 11216 --
NM_005045chr71894 ------
NM_005054chr261618 1275 493 475 364 221 ----2709 202
NM_005056chr1285309 4875 4046 3448 2198 1343 627 156 15075 ----
NM_005063chr1073885 3838 3661 3025 1062 874 748 1587 23487 409 --
NM_005065chr1494923 4678 4590 3941 3416 1588 1522 123 108 --34295 3527 909 --
NM_005109chr351025 824 597 543 453 --1431 --
NM_005116chr2063683 1538 1503 655 591 256 173 33640 3217 37 --
NM_005121chr1733858 3497 758 ------
NM_005126chr3----1250 11982
NM_005156chr935191 3363 560 --24340 70 13278
NM_005168chr261696 1408 1400 566 81 70 1554 ----
NM_005180chr1031581 1474 295 ------
NM_005188chr1187398 6857 6391 2354 1958 851 690 105 25332 1656 47065 6751 5843 174 --
NM_005197chr14106024 5699 5580 4466 4028 3865 2037 637 524 214 11971 21561 1364 --
NM_005203chr10190 ------
NM_005207chr2263492 1341 961 355 253 60 --33201 2670 1002 --
NM_005233chr31541 ------
NM_005235chr236678 2453 2395 25295 1156 27072 1412 --
NM_005238chr1143250 996 986 923 13345 --1522
NM_005241chr331176 1077 497 21375 1208 1871 --
NM_005245chr41502 ------
NM_005339chr443242 3052 1282 49 22914 1541 24185 3496 --
NM_005342chrX112446 2383 2103 1823 1139 1059 1015 828 516 461 175 --1195 --
NM_005349chr41623 ------
NM_005399chr153798 3183 258 103 38 11239 14137 --
NM_005415chr21706 1633 ----
NM_005465chr121707 564 1275 1522 --
NM_005493chr6155 ------
NM_005497chr1764652 2418 2232 2002 1402 844 15456 25646 5310 --
NM_005499chr191439 ------
NM_005502chr943038 2348 846 68 2804 110 23237 527 --
NM_005537chr1321101 749 --1976 --
NM_005542chr72739 189 11726 2413 234 --
NM_005566chr111143 ------
NM_005575chr51172 ------
NM_005596chr9126407 6108 5583 5546 4984 4484 4334 3915 2289 1204 804 366 1875 12111 --
NM_005602chr321306 1185 ------
NM_005605chr81270 ------
NM_005607chr81722 ----2899 399
NM_005639chr1221412 660 1742 --11325
NM_005643chr63625 618 41 --1224 --
NM_005665chr144705 3246 1706 323 14844 24037 3702 --
NM_005667chr2186 ------
NM_005684chr1----1120 --
NM_005708chr13--1303 ----
NM_005738chr741675 1529 782 294 --21620 1515 1486
NM_005746chr732792 878 403 --11095 --
NM_005748chr1263405 3323 3251 3163 3088 918 --33396 2841 2720 --
NM_005751chr72365 26 ------
NM_005786chr181344 ------
NM_005801chr173603 192 21 ----1726
NM_005803chr6140 ------
NM_005808chr332745 974 399 --11355 12480
NM_005813chr231612 530 209 12333 --11772
NM_005826chr11496 ------
NM_005828chr17125048 4507 4048 3701 3169 1690 1107 890 699 597 310 27 11627 33943 3139 793 --
NM_005839chr11121 ------
NM_005840chrX86958 6740 5838 2520 2103 1478 1217 869 16100 17495 --
NM_005843chr241499 1240 218 198 21468 670 11227 --
NM_005868chr742496 2460 1820 753 --22237 396 --
NM_005876chr21738 ------
NM_005898chr111318 --1496 12066
NM_005901chr1878441 6692 6069 2604 2439 1574 519 11994 16869 --
NM_005902chr1584319 3753 3219 3074 1792 1717 1096 743 33983 3389 1160 33830 3342 825 --
NM_005906chr631178 606 547 --1259 11257
NM_005909chr564075 3921 3847 1528 1511 306 ----1899
NM_005930chr142294 100 --1903 --
NM_005935chr494989 4452 3621 3614 3577 1748 1475 194 110 13368 --11341
NM_005937chr1793969 3388 2957 2824 2670 1433 737 325 227 11390 2878 74 --
NM_005941chr851435 951 936 360 94 --23732 807 --
NM_005962chr1052303 2078 738 601 514 --11838 --
NM_005962chr1052303 2078 738 601 514 --11838 --
NM_005966chr222094 1598 1333 ----
NM_006007chr962835 2743 1640 1284 670 481 24499 3482 --14096
NM_006015chr111153 ------
NM_006022chr132900 394 ----2882 388
NM_006033chr1822218 807 --42071 1993 568 123 --
NM_006037chr24962 722 358 50 --31104 1038 109 --
NM_006047chr2033532 1007 882 13124 ----
NM_006080chr711906 ------
NM_006095chr434313 3539 833 ----11451
NM_006107chr17--1447 ----
NM_006113chr171938 1791 1388 1360 588 417 86 12048 11427 --
NM_006136chr721114 288 ------
NM_006154chr1542780 2137 882 644 --11887 1704
NM_006190chr221088 398 ------
NM_006198chr211268 ------
NM_006203chr565303 5124 4981 3879 3666 3524 1409 15240 11050
NM_006252chr136892 5781 5071 11514 47241 6560 5045 4714 --
NM_006257chr102806 232 ------
NM_006258chr1011235 ----1236
NM_006282chr2084509 4150 4057 3944 1708 1459 883 633 24162 3689 23385 1477 13551
NM_006283chr854780 3881 3551 3137 229 --23401 561 --
NM_006306chrX95888 5777 5651 5587 5193 4756 1839 1333 998 25793 5520 55669 5635 5385 5244 804 45419 2373 2346 175
NM_006313chr122160 65 ------
NM_006317chr5--1157 ----
NM_006330chr821474 28 --1238 --
NM_006364chr141242 ------
NM_006379chr71124 --2869 692 --
NM_006380chr1733817 3201 1647 ----11738
NM_006393chr1044310 3769 2770 1796 --13956 31083 834 444
NM_006420chr2031319 1061 77 --32196 867 850 --
NM_006434chr1062818 729 684 441 313 45 2578 114 31114 588 300 1219
NM_006464chr274606 3851 3742 3731 3723 3196 780 --54159 3690 3646 3447 824 13949
NM_006496chr11280 ------
NM_006497chr171517 ------
NM_006544chr1485633 5563 5430 5289 5159 5022 2393 1077 24012 832 11507 12243
NM_006546chr1765011 4871 4396 2082 1650 1062 11630 15413 16287
NM_006557chr911354 ----1176
NM_006560chr11------1504
NM_006561chr1065327 5180 4821 4638 4593 4555 11142 1984 --
NM_006565chr161235 ----11004
NM_006570chr91104 ------
NM_006575chr141913 11369 ----
NM_006599chr1687758 6987 3230 2867 2289 1803 1209 1065 ----12333
NM_006628chr1563889 3025 2934 1226 806 618 --1676 --
NM_006629chr1872769 2740 2590 1940 149 124 112 --32829 2024 430 --
NM_006633chr51505 ------
NM_006654chr1244230 816 522 38 --14711 1260
NM_006662chr16183 ------
NM_006703chr6148 ------
NM_006717chr933318 1028 683 --11298 12805
NM_006720chr1094787 4489 4313 4086 1694 1308 788 192 71 --23569 3557 33959 3690 3204
NM_006726chr42789 46 1107 155 1282
NM_006729chrX65539 4628 2163 1953 1641 999 --22068 136 --
NM_006738chr15114677 4191 3232 1739 1703 1461 1378 1325 1250 1088 1045 --24520 23 --
NM_006754chr72923 70 --21194 29 --
NM_006814chr2052213 1830 1796 1043 48 12165 --1677
NM_006826chr21491 ------
NM_006837chr82110 94 ------
NM_006852chr1772640 2596 2500 2342 2306 962 889 12915 ----
NM_006874chr41984 --11049 --
NM_006875chrX1292 ------
NM_006885chr1663783 3703 3184 2919 697 317 --22947 888 --
NM_006897chr121649 ------
NM_006918chr1144261 3593 1187 875 23870 1515 14443 --
NM_006924chr1764333 3638 1641 1513 1446 1064 33848 1693 481 1416 11724
NM_006940chr1251624 1561 1459 735 282 --11783 --
NM_006943chr2042467 2452 1143 707 22983 2333 33161 2599 1114 --
NM_006948chr2142195 2126 2026 1968 --22255 1660 --
NM_006951chr103678 538 122 ------
NM_006996chr12740 671 21410 183 ----
NM_006999chr531661 1452 197 --31601 1344 257 11937
NM_007006chr1632728 2459 833 123 ----
NM_007007chr1243959 3942 1845 1293 13691 11648 --
NM_007011chr15136371 6068 5899 5854 5113 5023 4601 4459 2577 2475 2284 2163 863 14386 36216 5905 612 16082
NM_007013chr81921 ----1233
NM_007034chr11298 ------
NM_007038chr2145145 2156 1903 781 25811 5625 ----
NM_007043chr123752 478 433 ------
NM_007050chr20217995 7132 7054 6998 6831 6456 6420 6172 5946 5449 5207 3208 2595 2507 2277 2193 2145 1640 1203 441 258 26535 1996 17445 --
NM_007052chrX2207 190 ------
NM_007073chr6113405 3381 2801 1674 1567 1300 1277 1235 1067 940 430 --13894 --
NM_007078chr1072575 2476 2465 1101 536 416 130 1112 32711 1894 372 --
NM_007106chr1332754 2720 474 ------
NM_007114chr322948 795 --12208 12962
NM_007124chr6--11931 ----
NM_007175chr852283 887 574 425 282 ----22676 1128
NM_007192chr141101 ------
NM_007195chr18--1148 ----
NM_007200chr15114677 4191 3232 1739 1703 1461 1378 1325 1250 1088 1045 --24520 23 --
NM_007207chr1--1231 ----
NM_007246chr42176 64 ----1341
NM_007249chr13138717 7652 7573 7320 6900 6322 6069 3020 2997 2370 1249 719 509 17782 15841 11914
NM_007274chr11123 ------
NM_007285chr161345 ------
NM_007308chr41194 --1145 --
NM_007345chr1862381 845 757 442 405 39 2807 291 1436 --
NM_007350chr1264370 4290 3300 2951 1403 1023 ----24265 3837
NM_007361chr141585 ------
NM_007373chr1031257 711 279 ----1699
NM_007375chr152717 2313 813 571 519 ------
NM_012064chr122468 444 1308 --21133 944
NM_012089chr141489 1167 319 224 11184 --1501
NM_012104chr11103487 3252 3155 2436 2358 1179 1040 821 357 215 ----12871
NM_012104chr11103487 3252 3155 2436 2358 1179 1040 821 357 215 ----12871
NM_012120chr632613 1855 121 146 ----
NM_012129chr742254 166 143 114 --1728 1932
NM_012141chr1343588 3310 895 640 11187 23742 1329 14016
NM_012156chr2063193 2673 1351 998 937 864 11229 12298 --
NM_012164chr9117344 7263 6720 6176 5920 5914 5214 2659 1948 830 407 36645 1627 1385 --1415
NM_012192chr1151930 1506 942 658 140 21808 435 ----
NM_012193chr1175234 5052 4492 2055 1977 1306 282 11806 25005 2180 --
NM_012199chr133259 3214 731 182 --24618 1778
NM_012214chr266127 6070 5036 1468 472 104 45622 5526 4801 2119 31557 1442 646 --
NM_012249chr272955 2602 2410 1270 1251 196 178 11140 195 --
NM_012252chr721605 1304 1140 24604 1673 15164
NM_012259chr621455 1028 1322 --11018
NM_012262chr164432 3915 3768 3661 717 151 --34164 3934 1162 --
NM_012290chr21149 ------
NM_012294chr773241 3106 2607 1515 1231 702 235 --23087 1007 13682
NM_012296chr11103912 3331 1046 810 753 742 684 650 644 30 1526 43945 3341 1245 1150 --
NM_012309chr1174949 4325 3990 3760 3729 3723 437 ----13918
NM_012316chr1135193 5144 4974 4344 1892 1839 1499 1443 797 760 194 165 35 24540 1418 15118 --
NM_012334chr554630 3232 3030 1135 944 24125 3376 ----
NM_012345chr131625 --2613 33 11241
NM_012388chr1552598 1191 976 868 71 --22007 1165 --
NM_012425chr1052397 2153 873 702 101 --12371 11750
NM_012428chr151988 ------
NM_012463chr122516 383 --1414 --
NM_013231chr1443346 3017 946 351 13497 33476 3357 257 11110
NM_013236chr221877 --1427 11252
NM_013246chr111257 ------
NM_013257chr822064 644 1589 --12263
NM_013261chr453575 2957 1479 858 357 23087 208 --1669
NM_013269chr1274133 4108 4024 3084 818 549 36 1316 2694 454 --
NM_013279chr1172278 1772 918 873 717 386 86 ----12331
NM_013281chr20------1561
NM_013293chr71602 ------
NM_013309chr1582447 2404 2291 2139 1693 739 484 316 12128 ----
NM_013357chr8----1250 --
NM_013447chr1973705 3197 2960 2819 566 547 277 12405 4900 641 348 262 --
NM_013448chr141481 ------
NM_014011chr221849 1836 11736 1838 1281
NM_014021chr12688 212 12542 13266 --
NM_014034chr61542 ----11360
NM_014035chr53289 229 25 21213 32 1907 --
NM_014071chr202343 202 ------
NM_014112chr865195 4504 4354 3684 2155 1159 ----11656
NM_014154chr331336 1068 249 ------
NM_014155chr1146389 5406 1229 739 --24562 958 1222
NM_014181chr242634 2604 2079 517 21052 1023 ----
NM_014210chr172150 52 ------
NM_014217chr121263 627 11699 --1678
NM_014231chr1292018 1849 1781 1514 701 467 340 330 324 ------
NM_014252chr13188 ------
NM_014286chr993428 3342 3240 2568 2423 2303 2234 187 56 --11414 11141
NM_014309chr2295398 5155 4438 4082 1677 1170 964 325 38 13424 25430 4171 14767
NM_014325chr1232032 1837 97 138 --11981
NM_014331chr425750 982 15774 21978 1528 17624
NM_014333chr1122799 939 ------
NM_014372chr121793 407 ------
NM_014382chr311345 --11484 1627
NM_014421chr4139 --31590 1320 488 11994
NM_014423chr574049 2262 1826 1470 1279 1067 790 ------
NM_014449chr121204 ------
NM_014500chrX1283 ------
NM_014506chr931601 1166 440 --1662 11678
NM_014517chr341816 1545 1294 301 ----1616
NM_014552chr211482 --11407 1991
NM_014570chr22180 ------
NM_014572chr1321507 1315 --11202 --
NM_014575chr33487 419 122 ------
NM_014612chr921242 434 --1261 --
NM_014613chr582638 2552 2203 1972 1208 1046 555 481 --1784 11245
NM_014615chr1652244 1008 666 563 95 12389 --1128
NM_014634chr22113348 3107 3028 2983 2621 2369 2307 1400 1369 1037 720 --1393 --
NM_014635chr261596 1238 457 439 328 185 ----2673 166
NM_014636chr973571 3170 2904 1087 865 583 466 24066 3942 24262 968 --
NM_014639chr51135 129 --154
NM_014646chr1892782 2545 1058 1035 959 950 466 359 120 --43111 2610 2380 1070 13007
NM_014647chr1661955 1464 825 707 341 177 ----1465
NM_014659chr1531088 250 23 --1269 --
NM_014663chr13793 100 85 ------
NM_014682chr81359 --12095 --
NM_014689chr2193 ------
NM_014705chr741987 1826 1410 56 11855 42063 832 821 196 --
NM_014717chr191560 ----2684 626
NM_014721chr635732 5059 4609 26209 2781 2474 455 --
NM_014730chr1274732 4663 4008 1469 1407 426 146 --11603 13983
NM_014730chr1274732 4663 4008 1469 1407 426 146 --11603 13983
NM_014732chr1684582 4189 4049 974 848 817 97 35 --23906 792 1638
NM_014733chr541752 1743 1468 900 12188 21764 875 11953
NM_014737chr2072884 1475 1222 1146 1049 450 143 --24050 3870 12836
NM_014739chr633949 3548 1600 --1488 1364
NM_014740chr17161 ------
NM_014746chr263770 2820 2674 430 202 176 11431 ----
NM_014747chr1115273 1813 1739 1429 1321 1073 1011 907 707 658 571 15623 34964 1645 736 --
NM_014751chr81345 1440 --1562
NM_014755chr273853 3102 3033 2991 1583 968 483 13386 1300 --
NM_014764chr1231318 246 90 ------
NM_014772chr1872693 2545 1328 1273 730 234 144 1163 11405 --
NM_014803chr1052479 1119 1098 898 226 --11793 1961
NM_014826chr173830 3310 3054 2968 2832 858 557 ------
NM_014827chr121408 122 ------
NM_014830chr1293571 3079 2991 2924 2848 2395 975 254 87 1184 ----
NM_014835chr2051809 1574 793 709 439 21635 344 21418 678 --
NM_014838chr2252343 1931 1024 823 605 --1401 12861
NM_014840chr1272939 2480 2374 599 452 322 307 2993 52 1708 --
NM_014847chr11462 ------
NM_014850chr384892 4569 3942 3663 3582 1632 231 145 1272 --1620
NM_014870chr1114425 4002 3933 3381 1639 1352 1113 920 765 354 300 14505 31422 704 507 --
NM_014873chr174842 3910 3682 1761 787 696 347 --14160 --
NM_014877chr17107722 6960 6352 5814 5551 5312 5065 2970 2679 1408 15101 15859 15213
NM_014888chr7----11167 --
NM_014893chrY----1473 12039
NM_014904chr1053877 3751 3585 979 312 13324 23635 3427 1182
NM_014906chr1753973 2861 1272 594 182 --11323 23966 1033
NM_014910chr192652 230 ------
NM_014912chr1023398 2436 12419 21153 389 --
NM_014918chr15180 ------
NM_014920chr663836 3408 1025 972 468 40 --13231 --
NM_014921chr19102392 2357 2225 2201 1026 980 795 607 475 89 --32456 711 483 --
NM_014924chr1462821 2594 2473 2384 1153 291 12345 ----
NM_014935chr1123415 3153 1278 1219 870 794 449 277 222 64 41 27 --1952 --
NM_014950chr1421159 88 1514 ----
NM_014953chr1364303 3349 3018 2977 1271 310 1403 11159 --
NM_014962chr20--1720 32821 1929 117 --
NM_014982chr1484980 4797 4498 3381 3325 2150 1429 1024 ------
NM_014988chr452481 2128 2107 1737 866 --2995 922 12452
NM_014989chr62755 650 --21921 601 --
NM_015008chr332872 566 83 13035 1290 --
NM_015020chr1693396 3250 3185 3125 2938 1339 1021 940 65 --11363 --
NM_015026chr1254637 3587 1550 880 782 ----14221
NM_015027chr16154 --11258 --
NM_015035chr20105910 4754 4552 4214 4164 2605 2165 1598 942 561 16298 26518 6326 14354
NM_015039chr183777 3471 3224 3072 2778 2760 2666 1348 ------
NM_015042chr1563332 3068 1603 1307 1091 1031 2756 294 51321 791 771 703 366 --
NM_015045chr1022033 40 21478 780 12230 12185
NM_015046chr962341 2049 1914 1840 1045 225 --11064 12779
NM_015049chr272535 2450 2270 2114 1325 1267 404 1770 --11083
NM_015051chr963129 2783 2744 2458 2262 572 ------
NM_015054chr121133 ------
NM_015057chr132623 66 --1273 --
NM_015064chr1273604 3578 3066 2784 2276 1396 979 179 23449 688 --
NM_015068chr762633 1340 1329 653 626 501 12801 1114 13104
NM_015071chr575282 4226 3967 2181 2036 1786 1418 34349 2494 1813 65639 4252 3941 941 872 837 --
NM_015076chr664439 4270 3408 3100 1721 195 --33432 1758 671 13618
NM_015082chr572557 2234 2224 1020 425 408 197 12272 ----
NM_015090chr195490 4835 4561 4182 4147 1686 1400 1178 225 12378 25638 4099 15566
NM_015093chr61549 ----11330
NM_015115chr432830 2088 520 --22722 2652 --
NM_015116chr1331497 162 130 ----11122
NM_015132chr761995 1842 1389 1266 1214 754 ------
NM_015143chr411395 ------
NM_015149chr161612 1522 1503 1414 851 105 --11835 --
NM_015153chr61562 ------
NM_015156chr1453790 3332 2768 1605 1422 ------
NM_015176chr111612 ----1511
NM_015185chrX52816 2645 1136 988 78 23054 755 ----
NM_015191chr1161740 1028 762 652 423 231 --12642 1257
NM_015192chr2042883 1216 662 101 12037 ----
NM_015200chr442388 1582 100 43 12199 12526 --
NM_015203chr1150 ------
NM_015206chr1543861 2571 2517 115 --1670 2471 80
NM_015215chr142707 2624 1991 704 ------
NM_015219chr1782447 2260 1884 1778 1615 548 421 95 3786 768 710 21761 838 --
NM_015230chr431256 360 145 2539 471 ----
NM_015236chr411307 ------
NM_015247chr16135363 4544 4425 3377 1738 1516 1429 704 666 299 258 242 187 --24655 173 --
NM_015264chr22104401 4127 3543 3522 1889 1406 1168 316 181 111 --44326 3193 1870 957 --
NM_015265chr21746 ------
NM_015269chr1----1619 --
NM_015272chr162148 140 1477 ----
NM_015282chr2--2186 36 21101 799 --
NM_015291chr163497 3180 2932 2894 768 333 ----1682
NM_015299chr1463025 1506 1438 1314 1029 101 --13806 22660 2443
NM_015310chr8157350 7075 6728 6713 6614 6162 3075 2722 2497 2361 1336 652 634 601 588 15960 25747 536 27271 38
NM_015313chr1163194 1888 1866 1520 1254 547 1956 24392 1498 2698 469
NM_015336chr1221651 433 --4977 788 680 22 --
NM_015338chr2031913 1444 111 1554 11723 2583 327
NM_015347chr122896 757 1888 2939 636 1221
NM_015355chr1721398 421 ----1120
NM_015375chr193695 3428 3357 1944 1738 1596 1229 740 293 --31918 875 206 --
NM_015382chr14277 51 ----1761
NM_015385chr1062818 729 684 441 313 45 2578 114 31114 588 300 1219
NM_015423chr1111701 11525 ----
NM_015429chr31810 ------
NM_015455chr533287 533 358 31600 1304 729 43433 2807 1322 1090 --
NM_015465chr51511 ------
NM_015550chr732793 626 57 13154 ----
NM_015564chr543457 2537 504 136 --1145 --
NM_015565chr211550 1911 41693 1462 791 32 1396
NM_015569chr174850 4836 1261 1072 1030 653 566 54654 3699 3576 1414 738 14177 --
NM_015576chr343007 2950 2036 139 11861 22029 848 --
NM_015640chr155139 5076 3544 1299 1105 24306 181 1840 --
NM_015691chrX82703 2612 2548 1841 918 679 604 54 --31967 709 25 --
NM_015693chr41293 ------
NM_015874chr41623 ------
NM_015878chr82752 31 ------
NM_015879chr1898133 6310 5960 5542 5298 5242 1331 1229 190 48485 8047 6797 955 27398 264 --
NM_015886chr843948 1181 1072 861 11953 35044 4570 1013 1893
NM_015906chr111174 23810 3153 ----
NM_015920chr151618 ------
NM_015995chr15195302 5236 5074 5039 4715 4687 4631 4295 4218 3851 3630 1512 1368 778 726 717 619 432 388 14888 25399 3679 --
NM_015999chr1168 ------
NM_016048chr51326 --1717 --
NM_016059chr67913 804 782 706 700 153 112 ------
NM_016071chr71105 ------
NM_016073chr151233 ------
NM_016078chr171996 ------
NM_016131chr221558 563 --12186 --
NM_016132chr1522828 690 11296 ----
NM_016203chr71266 ------
NM_016206chr358061 7762 7141 2521 515 --35896 3153 2035 --
NM_016213chr15----181 --
NM_016231chr1741545 485 338 109 --21710 1571 11468
NM_016257chr173451 2834 2563 2467 2238 484 409 ----23417 600
NM_016260chr236262 2846 149 16998 26692 2455 135
NM_016271chr182451 67 ------
NM_016277chr611482 ------
NM_016279chr52104 36 ------
NM_016287chr131747 1698 414 21878 404 21844 1464 --
NM_016357chr12--1120 ----
NM_016376chr1793927 3388 3332 2833 1463 1329 1214 511 364 --34377 3294 392 13865
NM_016413chr131394 ------
NM_016418chr22143705 3632 3313 2740 2659 2623 2604 2540 2472 2392 821 527 437 303 --12678 --
NM_016436chr2052369 2197 1974 1732 721 11934 22332 2087 12678
NM_016467chr23575 152 104 11166 ----
NM_016513chr663836 3408 1025 972 468 40 --13231 --
NM_016516chr21896 ------
NM_016530chr153365 270 211 1205 ----
NM_016531chr443206 2749 738 484 1748 11256 --
NM_016542chrX--1676 21734 600 11488
NM_016577chr364418 3896 1752 1172 965 630 13373 33788 3759 3648 --
NM_016578chr112155 142 ------
NM_016607chrX51474 1190 1181 1152 646 2505 27 1460 11409
NM_016620chr11216 ------
NM_016621chr11114245 4067 3534 3424 3360 3230 1607 1594 700 554 359 14009 1927 --
NM_016631chr21----1233 --
NM_016824chr1011499 --1244 1576
NM_016836chr21577 ------
NM_016839chr21577 ------
NM_016929chr693625 3546 3540 3299 2885 1723 1545 753 95 24181 2913 24228 3861 --
NM_016946chr152697 2473 1414 922 655 11195 1743 --
NM_016950chr41255 ------
NM_016953chr235236 206 125 --25683 149 12263
NM_017409chr121557 ------
NM_017440chr12184 ------
NM_017455chr151988 ------
NM_017512chr18135 ------
NM_017563chr375902 4740 1911 1783 632 208 91 --15876 11344
NM_017577chr331386 1133 329 11592 ----
NM_017583chr1131728 1442 600 1245 31518 1242 431 --
NM_017594chr942458 968 621 23 --12925 --
NM_017615chr10133 ------
NM_017628chr453948 3422 1100 896 47 11141 --11880
NM_017637chr988744 8032 7645 7621 7044 3405 3007 1224 12991 --38693 5708 1499
NM_017643chr1752976 2228 2116 1945 225 ------
NM_017645chr952903 2818 2282 1190 44 --22196 220 13035
NM_017646chr11668 --1424 --
NM_017650chr796110 5952 5482 5124 4894 2267 1528 1439 364 --14397 11797
NM_017657chr21178 ------
NM_017658chr1424313 160 --1114 --
NM_017676chr551792 1540 425 198 88 31437 1347 1220 ----
NM_017709chr173991 3881 2715 1646 1247 1225 234 ------
NM_017737chr121871 653 21995 105 21778 670 --
NM_017744chr142450 2428 2024 286 --11916 --
NM_017745chrX1199 ------
NM_017746chr9128 ------
NM_017754chr684658 4437 3213 3151 2021 1208 540 123 --34269 3577 1995 --
NM_017780chr83814 366 360 ------
NM_017787chr1062668 2364 2011 1924 433 68 11080 22763 1787 --
NM_017799chr1451910 1757 1565 1469 53 ------
NM_017813chr8--35403 1916 1445 1131 --
NM_017822chr12158 2792 744 ----
NM_017824chr1011051 ----22089 677
NM_017847chr172241 1820 1753 1471 573 409 358 --1542 --
NM_017848chrX1478 ----14090
NM_017902chr10145672 5485 4914 4890 4827 4310 3904 3895 2042 1914 1680 1053 156 150 --23961 1374 13671
NM_017925chr93489 336 173 --2619 596 1113
NM_017944chr1152391 2366 1965 846 557 1461 22671 2398 --
NM_017994chr752634 1189 755 365 341 --32990 2805 2106 --
NM_018009chr121170 ------
NM_018010chr321302 531 11484 ----
NM_018011chr13167 ----1682
NM_018063chr101179 --1364 --
NM_018073chr1161358 1301 1042 462 229 158 --21350 373 11071
NM_018078chr4185 ------
NM_018084chr241080 337 204 70 12304 12688 187
NM_018117chr101681 --1726 --
NM_018121chr103974 260 142 23106 2952 1173 --
NM_018133chr311361 ------
NM_018155chr353015 2733 2422 2295 231 12289 ----
NM_018157chr1272898 2792 2668 2661 1079 408 397 --22952 181 --
NM_018182chr1741952 1657 1581 627 1443 --11468
NM_018184chr32591 434 --11614 170
NM_018200chr1562445 2304 2293 393 221 176 --1828 1626
NM_018211chr111628 1417 --1327
NM_018243chr442836 2638 1157 276 --13950 --
NM_018247chr662840 2802 1191 749 356 101 --12085 --
NM_018293chr321877 1133 ------
NM_018299chr812361 1793 --1737
NM_018313chr351038 925 560 456 32 ------
NM_018315chr41984 ------
NM_018362chr1122581 917 22872 1133 11061 2927 714
NM_018364chr132601 875 52 12835 22708 2550 12558
NM_018371chr821036 218 11256 ----
NM_018383chr252018 1855 729 422 25 ------
NM_018387chr91526 ------
NM_018388chrX31340 573 387 ------
NM_018394chr321184 460 ----1430
NM_018403chr332958 2732 2493 1289 42932 811 540 186 --
NM_018416chr1242171 1773 1716 343 --11850 11724
NM_018440chr8208352 7853 7600 7351 6716 6483 6350 5918 5757 5523 5515 3383 3374 3084 2712 2655 1864 1701 1291 720 27444 6123 36324 2726 2693 --
NM_018444chr821995 699 ----1225
NM_018464chr102313 40 ------
NM_018566chr185163 3698 3386 3188 1475 1179 796 25 ----15004
NM_018638chr1245554 4078 1572 1330 --35003 4882 1098 --
NM_018640chr1232630 2249 1064 11107 22505 316 --
NM_018650chr131858 744 696 ------
NM_018657chr3------1125
NM_018695chr522134 469 1586 12256 --
NM_018698chrX2783 79 --1161 1585
NM_018717chr472607 2510 970 883 773 273 257 --1696 --
NM_018834chr53980 773 231 ------
NM_018841chr173325 2755 2719 2603 1214 950 140 11546 13027 --
NM_018939chr51537 ------
NM_018958chr1553371 2952 1587 1557 492 34035 3613 1497 11309 12739
NM_018963chr211349 --1614 1507
NM_018970chr752914 2519 2367 1043 558 1755 11129 1865
NM_018976chr124683 517 470 106 ------
NM_018999chr1024013 1486 --23314 902 1158
NM_019001chr394785 4618 4494 4246 3225 3211 1854 1593 974 11225 31275 417 338 --
NM_019006chr15------1695
NM_019008chr2253703 3561 3078 3061 551 12587 1427 12825
NM_019036chr621055 974 ----198
NM_019072chr512775 11318 155 --
NM_019106chr2271335 1154 1086 611 563 448 364 12735 1120 13279
NM_019555chr361823 1623 675 493 85 26 ------
NM_019556chrX------129
NM_019593chr2021131 551 --22672 124 1114
NM_019858chr121204 ------
NM_019891chr1--11279 1192 --
NM_019903chr1011499 --1244 1576
NM_020122chr286024 5482 5469 3700 1521 661 506 306 --34880 4060 3674 --
NM_020156chr73595 172 153 ------
NM_020159chr421119 439 --1509 --
NM_020163chr362248 1985 1657 636 218 176 1316 --1526
NM_020180chr181889 ------
NM_020189chr81192 ------
NM_020199chr531237 900 280 ------
NM_020204chr1--1868 ----
NM_020228chr1122600 2382 ----1551
NM_020337chr411988 12781 1814 12208
NM_020338chr1092843 2672 2553 2384 948 757 494 445 210 22569 875 --13455
NM_020341chr2011823 --1214 1516
NM_020390chr344337 4053 3584 1358 11892 1370 11630
NM_020420chrY31246 619 486 --11749 --
NM_020438chr96547 409 393 360 120 86 --11197 1867
NM_020443chr1126934 6120 5953 5685 2811 1921 1811 1085 614 521 506 422 14799 11071 --
NM_020463chr22566 498 --11396 11086
NM_020466chr641954 1747 1626 1424 --34745 1354 482 --
NM_020647chr842181 1677 373 21 --2294 235 --
NM_020653chr172133 124 ------
NM_020673chr2075789 3105 3037 2594 2370 1422 487 12037 36436 2199 35 --
NM_020699chr195112 5066 4656 4586 4452 4276 3692 1924 688 ----11502
NM_020704chr712042 --32527 2126 2034 --
NM_020717chrX54732 4468 3245 3080 1814 14081 24866 3693 --
NM_020718chr1686508 5183 4328 2624 2499 2471 2164 697 25842 5785 25347 1084 --
NM_020728chr782910 2756 2597 2505 2327 2301 1272 747 1634 32794 2294 2190 --
NM_020738chr261594 558 314 173 164 124 1424 21212 417 --
NM_020739chr1574012 3432 3158 995 727 483 367 24223 494 22625 1573 --
NM_020742chrX3490 347 236 ----12107
NM_020748chr1741859 1662 665 313 ------
NM_020752chr10----22634 685 --
NM_020760chr211580 ------
NM_020766chrX73734 3596 3283 2955 976 508 51 --13252 1198
NM_020768chr563159 2983 2732 2138 1278 206 ------
NM_020771chr621347 994 156 ----
NM_020772chr1778286 2108 2049 1634 690 554 436 22473 882 --18263
NM_020782chr1274434 4131 3442 3339 3229 1087 563 1230 ----
NM_020792chr362560 1851 1007 672 342 142 1763 12576 --
NM_020801chr522349 71 ----12230
NM_020808chr131026 880 55 ------
NM_020809chr1152281 1846 1695 692 301 --11938 --
NM_020830chr223070 54 23147 1271 ----
NM_020843chr15----1409 --
NM_020844chr897354 6199 5771 5698 4687 2504 2447 1552 1055 27628 241 21228 845 --
NM_020853chr1252767 2149 395 327 304 1716 11063 --
NM_020854chr1841221 1165 962 380 --170 --
NM_020856chr191457 11430 31536 1199 403 --
NM_020860chr4--1443 ----
NM_020871chrX2582 46 --21899 937 --
NM_020872chr311611 --1698 --
NM_020935chr244548 1582 1049 330 1108 1866 11249
NM_020940chr1022781 2747 ------
NM_020948chr111243 --197 22630 1046
NM_020956chr19274789 4594 4046 3996 3944 3938 3898 3795 3694 3674 3506 3427 3154 3135 3129 1613 1579 1530 1454 1434 1412 1356 1329 1255 1094 991 911 --13310 --
NM_020958chr14147 ------
NM_020977chr451962 1523 879 718 85 --163 1157
NM_020987chr10--180 ----
NM_020993chr1282712 2557 2211 1772 1068 576 563 230 ----1192
NM_021007chr232109 2037 560 11697 11677 --
NM_021033chr132888 845 2803 307 21307 1227 --
NM_021064chr62710 678 --2627 333 11461
NM_021069chr422102 1700 ----1307
NM_021083chrX1380 --12848 12872
NM_021090chr22114870 4577 4314 4207 3800 3775 3100 1046 599 578 495 11998 33278 1865 663 23986 3401
NM_021097chr272628 629 612 594 535 311 208 1151 ----
NM_021111chr911034 --21200 389 --
NM_021116chr7178442 8212 8127 6975 6928 5927 5568 3058 2838 1896 1614 1501 1392 932 691 285 133 --25944 3024 --
NM_021141chr21292 ------
NM_021145chr7--2749 77 --1727
NM_021194chr1197 ------
NM_021205chr12855 322 22784 493 22264 1889 1218
NM_021227chr44531 152 143 53 1391 ----
NM_021229chr1211195 ------
NM_021255chr1433374 385 212 12677 13723 --
NM_021627chr3------1828
NM_021629chr364767 3963 3359 3238 1925 340 13634 34310 3366 1899 --
NM_021637chrX1260 ------
NM_021639chr11787 ------
NM_021809chr2032424 2112 1912 1935 --1950
NM_021813chr6125264 5069 4902 4437 4017 3871 3855 2328 1617 1314 897 150 14213 ----
NM_021911chr5--124 --25093 4892
NM_021935chr32863 203 ------
NM_021940chr61325 ----11231
NM_021945chr6113165 2996 2962 2594 2460 2440 2231 1040 458 441 261 1923 ----
NM_021961chr1156230 5531 4585 205 164 --11341 --
NM_021963chrX2616 245 ------
NM_021964chr356664 5389 2124 799 715 1215 24908 695 11942
NM_021992chrX1332 ------
NM_021999chr131220 ------
NM_022130chr5------11465
NM_022154chr4173 ----1284
NM_022166chr1655208 1868 1666 413 357 --15370 23827 976
NM_022456chr12136570 6463 6316 5774 5612 5344 2940 2137 2131 1996 1846 775 135 1387 --12372
NM_022458chr7102677 2369 2173 1971 969 697 638 509 435 78 ----11992
NM_022459chr1366226 5306 4147 4085 1851 1773 11719 23906 1601 --
NM_022473chr1543802 3218 1481 1343 33610 644 495 73791 3705 2865 1455 1326 1127 723 195
NM_022497chr362780 2660 2606 2483 1402 176 --32575 2508 1514 --
NM_022650chr5----1990 --
NM_022658chr12144 ------
NM_022716chr172645 2450 2188 1252 1226 708 328 1167 ----
NM_022719chr2283056 2699 2588 2357 1265 1002 919 400 1981 1945 23489 353
NM_022726chr61185 179 31316 1163 673 --
NM_022735chr131764 1499 255 --31258 643 83 --
NM_022758chr653114 2844 2068 215 146 --22660 2112 11286
NM_022763chr322461 1001 --22471 682 12770
NM_022771chr1231111 1105 400 ------
NM_022776chr31380 --1426 --
NM_022841chr1531813 1096 702 --1486 12483
NM_022843chr1311443 ------
NM_022845chr1631614 1476 224 ------
NM_022894chr231235 482 136 11715 ----
NM_022900chr71247 ------
NM_022918chr111770 --21959 1676 1496
NM_022977chrX11660 ------
NM_023016chr212058 --11858 22238 1016
NM_023074chr191969 ------
NM_023929chr832145 725 366 1777 --12496
NM_024007chr532999 812 412 ------
NM_024054chr7--131 ----
NM_024086chr17113718 3699 3303 2946 2653 1329 1323 1292 1004 630 554 --42795 2489 764 668 --
NM_024294chr653114 2844 2068 215 146 --22660 2112 11286
NM_024415chr5178 ------
NM_024429chr71266 ------
NM_024548chr311321 ----1657
NM_024567chr81626 ------
NM_024590chr441634 1581 1552 1485 ------
NM_024607chr883656 3637 3508 2764 999 314 208 110 23462 91 33595 1764 1134 --
NM_024615chr51239 ------
NM_024624chr231020 499 95 1285 11379 --
NM_024665chr333913 1696 1524 24282 978 14091 21821 512
NM_024686chr1161 ------
NM_024721chr812533 ------
NM_024725chr111154 ------
NM_024761chr974870 3347 1399 1166 1160 546 210 24715 124 14115 --
NM_024770chr286412 5102 4742 2399 2277 2124 1029 587 25992 4673 46361 4091 2098 692 --
NM_024798chr1592586 2381 2365 2145 2091 2059 1139 778 318 11103 --11851
NM_024803chr102333 303 ------
NM_024817chr15114385 4325 4167 3809 1701 1091 676 631 417 296 288 35710 3962 2179 25579 1122 --
NM_024824chr1451452 642 483 145 122 --1382 --
NM_024834chr1041789 1233 203 194 ----11347
NM_024852chr13242 73 31 ------
NM_024930chr512378 11044 --32180 1034 303
NM_024947chr356198 6129 3308 970 945 13636 --29382 7400
NM_024989chr267187 6664 6641 6276 1756 164 16269 2782 173 15808
NM_024991chr1062818 729 684 441 313 45 2578 114 31114 588 300 1219
NM_025004chr112680 297 ------
NM_025138chr132990 81 1370 --1968
NM_025146chr332539 376 264 --22347 918 12293
NM_025160chr153959 2646 690 356 135 11029 1191 --
NM_025181chr22826 682 --1178 --
NM_025191chr122579 637 12190 1160 1509
NM_025203chr2101462 1427 1408 1353 1283 359 346 314 160 109 ------
NM_025235chr1022165 1682 ------
NM_025238chr1511030 --1515 --
NM_030579chr1693434 3428 2635 2602 2534 1398 1310 512 120 13336 --1620
NM_030621chr1463499 3375 3310 3181 1567 368 24011 1078 ----
NM_030623chr211709 ------
NM_030625chr1022217 888 ----12633
NM_030627chr544056 1452 1340 637 11469 11199 --
NM_030647chr746003 4998 2295 64 24632 1189 21787 89 --
NM_030667chr1251212 970 486 274 146 ------
NM_030668chr1251212 970 486 274 146 ------
NM_030669chr1251212 970 486 274 146 ------
NM_030674chr1295003 4931 4171 4153 3786 3553 2283 1400 722 198 44387 4107 1791 753 --
NM_030751chr102677 530 ------
NM_030751chr102677 530 ------
NM_030802chr171785 ------
NM_030806chr1148500 8105 7370 7002 6899 6703 6668 6657 6565 3357 3289 1766 1446 551 --13559 --
NM_030808chr171297 ------
NM_030809chr1262310 1978 1861 1601 873 87 --1851 --
NM_030816chr132534 1066 414 --22503 270 23357 2798
NM_030915chr262323 2137 753 657 327 204 1624 --1421
NM_030917chr4140 ------
NM_030964chr573637 3167 3136 1100 894 194 99 --13250 --
NM_031217chr11128 ------
NM_031243chr741836 1620 1599 311 ------
NM_031296chr422762 1686 --154 1214
NM_031369chr42161 139 --141 --
NM_031370chr42161 139 --141 --
NM_031372chr4--11555 ----
NM_031435chr1211124 151 1610 1109
NM_031442chrX43196 2401 911 347 --32296 2165 99 11984
NM_031445chr263434 3268 2549 2351 897 572 --2397 64 13321
NM_031844chr153648 3577 3215 1566 822 1303 --11235
NM_031845chr21973 ------
NM_031847chr21973 ------
NM_031885chr16125 --1247 --
NM_032012chr975042 4790 4472 785 699 621 117 25151 4903 ----
NM_032042chr522692 1826 12837 --1428
NM_032102chr1142750 2617 1916 147 275 23 32376 2199 785 21926 264
NM_032105chr1137930 7491 7456 7316 6850 6087 5679 5381 1652 1275 1234 1168 671 --32364 1440 360 --
NM_032128chr41687 ------
NM_032145chr631439 1412 132 ------
NM_032154chr10------1302
NM_032160chr1841096 763 642 266 ----12971
NM_032186chr11216 ------
NM_032199chr1072614 2380 1245 1223 705 357 109 21534 512 1962 1801
NM_032208chr263175 3030 2792 899 731 641 ----1204
NM_032217chr43364 275 111 ------
NM_032221chr2031825 535 213 ----11306
NM_032228chr1122793 469 --33405 2956 824 1125
NM_032256chr122823 351 ------
NM_032291chr121742 790 11209 ----
NM_032303chr931412 1382 357 ----11693
NM_032320chr112740 199 ------
NM_032321chr253261 3187 3165 2636 341 12263 12940 --
NM_032348chr11816 ------
NM_032373chr1065626 5361 5142 3677 695 459 22144 177 25255 4074 --
NM_032433chr192631 245 ----11595
NM_032439chr102443 49 --198 11032
NM_032445chr1522150 1997 11692 --21857 80
NM_032446chr531444 670 148 --21361 246 12446
NM_032457chr433620 3281 878 13406 23756 386 --
NM_032458chrX33242 3087 860 2619 560 22869 2771 23031 70
NM_032505chr321049 444 ----1400
NM_032521chr2031964 395 226 --12105 --
NM_032621chrX2221 22 ------
NM_032622chr41339 ------
NM_032635chr19------162
NM_032704chr12195 ------
NM_032727chr1021336 285 ----2200 182
NM_032778chr333001 1105 512 --13313 11061
NM_032857chr15--1193 ----
NM_032859chr1333851 1254 1196 11496 12797 --
NM_032866chr1592216 1989 1196 865 839 272 80 68 24 12569 ----
NM_032884chr1188 1315 ----
NM_032892chr15----1324 --
NM_032949chr131112 ------
NM_032973chrY12576 34200 4149 2600 --12834
NM_033020chr111174 23810 3153 ----
NM_033083chr372833 2651 825 629 449 398 124 --13352 --
NM_033132chr13------12325
NM_033133chr1783747 3351 3010 2382 2332 1427 894 219 23283 406 11495 --
NM_033138chr71306 ------
NM_033139chr71306 ------
NM_033140chr71306 ------
NM_033143chr443849 535 451 195 21367 1098 34171 2977 1290 --
NM_033157chr71306 ------
NM_033224chr797871 7842 7752 7090 5284 3229 1387 1354 1145 56049 2778 2087 1663 101 35258 2631 2301 --
NM_033226chr161140 ------
NM_033285chr873904 1359 1234 1179 952 853 695 --11654 11501
NM_033360chr1264591 4136 3516 1591 1422 461 ------
NM_033389chr1784448 4339 3797 3510 3030 1523 531 363 --34724 4715 447 --
NM_033411chr61218 ------
NM_033426chr1472910 2836 2395 2306 2192 1178 1094 --12573 --
NM_033429chr1552478 982 509 490 379 13286 1684 147
NM_033430chr443029 1296 896 27 21666 417 13841 --
NM_033437chr443029 1296 896 27 21666 417 13841 --
NM_033505chr2106408 6209 6191 5446 4707 4670 4144 2490 1269 27 12473 25196 2315 --
NM_033542chr2061779 1579 1270 555 208 114 --31595 1537 517 1349
NM_033631chr1103842 3462 2995 2718 2371 1429 1009 952 631 594 --11309 --
NM_033632chr41984 ------
NM_033656chr2184463 3768 2225 1593 1557 1539 1429 368 --11447 15022
NM_033668chr10159 ------
NM_052879chr1232576 554 405 11152 11013 --
NM_052906chr22164111 3953 3769 3643 3457 3395 3380 3267 3171 3113 1324 1297 857 528 412 85 11512 13621 --
NM_052907chr1253240 1293 1236 997 826 --21599 58 --
NM_052911chr183660 638 335 1828 ----
NM_052913chr611041 ------
NM_052927chr531833 1616 323 21906 101 ----
NM_052937chr821939 891 --11830 12695
NM_052940chr11159 ------
NM_052966chr143197 2940 2423 21 1542 12909 2706 163
NM_053016chr9137896 7184 7071 7040 6100 5880 5795 5638 3200 2778 926 730 610 199 56774 5646 3174 2075 776 12576
NM_053035chr71105 ------
NM_053042chr432419 2099 1960 11280 22354 161 --
NM_054016chr1--11254 2402 265 21400 671
NM_054016chr1--11254 2402 265 21400 671
NM_054016chr1--11254 2402 265 21400 671
NM_057161chr61518 ------
NM_057175chr451910 1793 1031 872 492 ------
NM_057749chr811236 ------
NM_058240chr1461383 1313 1162 549 364 103 ------
NM_080491chr11103912 3331 1046 810 753 742 684 650 644 30 1526 43945 3341 1245 1150 --
NM_080617chr20----1947 --
NM_080671chr212130 11462 ----
NM_080672chr20178 ------
NM_080798chr10190 ------
NM_080799chr10190 ------
NM_080800chr10190 ------
NM_080801chr10190 ------
NM_080802chr10190 ------
NM_080803chr10190 ------
NM_080804chr10190 ------
NM_080805chr10190 ------
NM_080806chr10190 ------
NM_080807chr10190 ------
NM_080808chr10190 ------
NM_080809chr10190 ------
NM_080810chr10190 ------
NM_080811chr10190 ------
NM_080812chr10190 ------
NM_080813chr10190 ------
NM_080814chr10190 ------
NM_080815chr10190 ------
NM_080832chrX1107 21672 626 --1282
NM_130436chr2141899 1060 596 174 2768 666 ----
NM_130438chr2142476 1173 751 375 21345 1243 --1508
NM_130439chr1052303 2078 738 601 514 --11838 --
NM_130439chr1052303 2078 738 601 514 --11838 --
NM_130446chr383700 3592 3092 1691 1142 792 567 103 --23379 706 --
NM_130811chr2011172 ------
NM_130830chr393159 2749 2671 2431 1386 1300 940 171 89 --22607 932 --
NM_130838chr151534 11276 ----
NM_130839chr151534 11276 ----
NM_133170chr20217995 7132 7054 6998 6831 6456 6420 6172 5946 5449 5207 3208 2595 2507 2277 2193 2145 1640 1203 441 258 26535 1996 17445 --
NM_133264chr17103618 3589 3305 3104 2935 1260 1104 1039 968 455 ----1470
NM_133370chr433019 2946 107 13011 33463 895 444 --
NM_133445chr973700 2940 2837 2668 1491 705 484 13244 23108 2440 --
NM_133476chr12138 ------
NM_133486chrX1416 ------
NM_133631chr321258 1054 --1649 21125 230
NM_134260chr15----137 --
NM_134261chr15----137 --
NM_134262chr15----137 --
NM_138270chrX33177 924 506 ----11185
NM_138286chr1923801 732 --44055 4040 1518 411 --
NM_138288chr14----21685 1570 --
NM_138333chr941882 1061 549 89 12357 1233 --
NM_138335chr43828 234 188 ------
NM_138338chr22183143 3095 2506 2360 2335 2264 2205 2161 2103 1355 1277 1167 663 630 557 550 443 78 ----1120
NM_138348chr576320 6251 6229 5732 4832 1201 1126 12162 35770 5222 1427 11506
NM_138426chr72969 522 ------
NM_138444chr1364146 3206 3053 1470 1046 589 ----14926
NM_138468chr245148 4623 1934 676 15490 75501 5382 4285 3903 2369 1541 1407 11282
NM_138473chr1274351 3745 3603 3256 1409 1267 842 --2783 101 1863
NM_138479chr141866 1625 725 435 --12058 11278
NM_138569chr6137 ------
NM_138713chr1687758 6987 3230 2867 2289 1803 1209 1065 ----12333
NM_138714chr1687758 6987 3230 2867 2289 1803 1209 1065 ----12333
NM_138727chr142450 2428 2024 286 --11916 --
NM_138728chr142450 2428 2024 286 --11916 --
NM_138731chr1423800 1024 21183 30 12746 --
NM_138773chr5160 1280 --1258
NM_138782chr532102 255 224 ------
NM_138931chr32914 889 ------
NM_138971chr11103487 3252 3155 2436 2358 1179 1040 821 357 215 ----12871
NM_138971chr11103487 3252 3155 2436 2358 1179 1040 821 357 215 ----12871
NM_138972chr11103487 3252 3155 2436 2358 1179 1040 821 357 215 ----12871
NM_138972chr11103487 3252 3155 2436 2358 1179 1040 821 357 215 ----12871
NM_138973chr11103487 3252 3155 2436 2358 1179 1040 821 357 215 ----12871
NM_138973chr11103487 3252 3155 2436 2358 1179 1040 821 357 215 ----12871
NM_139068chr51552 ------
NM_139069chr51552 ------
NM_139126chr62722 242 --1273 --
NM_139135chr111153 ------
NM_139182chr431256 360 145 2539 471 ----
NM_139207chr1222136 886 --22210 2012 --
NM_139242chr15----11499 --
NM_139286chr9157 ------
NM_144498chr2051809 1574 793 709 439 21635 344 21418 678 --
NM_144563chr22655 552 --3710 244 163 --
NM_144563chr22655 552 --3710 244 163 --
NM_144568chr14----1236 --
NM_144571chr496512 5947 5478 5126 4677 2443 1272 709 296 --32567 2052 80 14992
NM_144578chr1445194 2088 1519 960 24803 204 45565 3386 891 42 12032
NM_144599chr1564826 3860 1684 1673 497 145 --21795 74 --
NM_144600chr1631360 526 218 1659 ----
NM_144664chr11164 ----1201
NM_144728chr1--1231 ----
NM_144729chr1--1231 ----
NM_144767chr15114677 4191 3232 1739 1703 1461 1378 1325 1250 1088 1045 --24520 23 --
NM_144949chr221849 1836 11736 1838 1281
NM_144973chr1285038 4811 4603 3837 3549 1982 1681 1630 11205 23904 1803 --
NM_145054chr17----1179 --
NM_145055chr1873498 2657 2337 975 876 713 524 ----11285
NM_145117chr1132522 436 357 1597 12999 1415
NM_145206chr1023162 137 --22376 2364 --
NM_145213chr2--177 ----
NM_145243chr1186 ------
NM_145259chr276050 5779 2725 2200 1148 696 522 --17113 11510
NM_145263chr442284 1845 367 343 1270 ----
NM_145304chr72128 88 ------
NM_145307chr1051835 1387 222 61 47 --33965 3308 669 --
NM_145320chr732793 626 57 13154 ----
NM_145321chr732793 626 57 13154 ----
NM_145322chr732793 626 57 13154 ----
NM_145649chr632014 878 793 --12321 11793
NM_145655chr632014 878 793 --12321 11793
NM_145686chr242801 2440 1067 77 --22086 448 --
NM_145687chr242801 2440 1067 77 --22086 448 --
NM_145735chr1372800 2300 1940 1765 1063 871 654 11895 1828 --
NM_145753chr331045 211 60 ------
NM_145912chr22134715 3935 3898 3471 3244 2876 1762 1476 784 533 514 507 468 23359 590 21105 664 --
NM_147147chr6113405 3381 2801 1674 1567 1300 1277 1235 1067 940 430 --13894 --
NM_147156chr1021295 1237 ------
NM_147171chr72365 26 ------
NM_147175chrX31946 1799 1418 ------
NM_147185chr72365 26 ------
NM_147189chr852128 1768 1510 921 75 --1564 --
NM_147223chr242490 2115 1750 549 11619 --1310
NM_147233chr242307 1932 1567 366 11436 --1127
NM_148174chr82752 31 ------
NM_152271chr81239 ------
NM_152275chr232263 1547 570 11663 ----
NM_152280chr132580 2571 2168 --33289 1032 989 1922
NM_152282chr32412 285 11264 1539 --
NM_152332chr1452739 2258 2166 1044 664 21863 85 12643 --
NM_152375chr172495 2127 1809 686 601 510 479 --1995 11621
NM_152400chr41690 ------
NM_152409chr552863 2614 1405 945 813 --11080 2406 358
NM_152415chr81353 ------
NM_152420chr92741 256 --1239 --
NM_152423chrX41366 280 170 63 ----173
NM_152437chr1252390 1869 1676 852 128 1789 12114 --
NM_152573chr9127 ------
NM_152594chr1551947 1538 1496 889 129 1437 21750 576 --
NM_152622chr523010 905 12570 21048 888 12293
NM_152624chr576408 6224 2873 2744 1988 992 514 1111 --11964
NM_152629chr964105 3727 3597 3287 1618 399 11231 13205 13367
NM_152653chr31485 ------
NM_152724chr1052397 2153 873 702 101 --12371 11750
NM_152729chr631323 1186 24 ------
NM_152736chr63436 316 159 ------
NM_152744chr741383 848 208 93 32587 2180 39 13233 --
NM_152756chr543623 2945 1146 353 13311 24332 1575 --
NM_152758chr822013 233 ----21177 877
NM_152793chr774317 4057 3663 3270 1917 870 697 34905 4815 3835 13246 --
NM_152835chr142083 1993 985 528 --1709 12655
NM_152838chr2033532 1007 882 13124 ----
NM_152904chr171283 ------
NM_152919chr1973705 3197 2960 2819 566 547 277 12405 4900 641 348 262 --
NM_152924chr15136371 6068 5899 5854 5113 5023 4601 4459 2577 2475 2284 2163 863 14386 36216 5905 612 16082
NM_152989chr1251624 1561 1459 735 282 --11783 --
NM_153000chr181178 1654 ----
NM_153035chr173042 2991 2878 2660 598 345 244 12952 32594 2517 989 --
NM_153050chr22114870 4577 4314 4207 3800 3775 3100 1046 599 578 495 11998 33278 1865 663 23986 3401
NM_153051chr22114870 4577 4314 4207 3800 3775 3100 1046 599 578 495 11998 33278 1865 663 23986 3401
NM_153182chr333001 1105 512 --13313 11061
NM_153188chr555491 2037 1841 585 218 1275 24356 660 --
NM_153226chr101860 ------
NM_153251chr13----171 --
NM_153261chr16----1259 --
NM_153262chr142851 2031 1124 279 ------
NM_153267chr91666 ------
NM_153346chrX1530 21591 1359 ----
NM_153347chr1172549 2458 2087 2066 514 235 227 21044 977 ----
NM_153367chr1073381 3010 2832 2770 1339 1045 658 --12482 --
NM_153374chr151155 ------
NM_153456chr1396042 5371 4955 4522 2004 1839 739 345 310 15930 16314 --
NM_153487chr6124254 4090 3464 3279 3249 1745 1659 1122 877 510 466 179 11763 23091 1681 --
NM_153607chr563113 2285 2277 1969 1095 364 --1151 --
NM_153620chr721582 394 --11729 1235
NM_153649chr141443 1417 871 58 --1357 11698
NM_153757chr421021 951 1314 ----
NM_153810chr10134897 4782 4199 4116 3777 3703 3617 1825 1505 1195 1095 965 49 21539 1482 --14891
NM_153831chr81722 ----2899 399
NM_170606chr741548 684 202 189 --11825 --
NM_170706chr183777 3471 3224 3072 2778 2760 2666 1348 ------
NM_170709chr822064 644 1589 --12263
NM_170719chr132990 81 1370 --1968
NM_170740chr683101 2280 1379 1199 743 719 588 247 13154 1578 --
NM_170774chr2072884 1475 1222 1146 1049 450 143 --24050 3870 12836
NM_172058chr821638 1607 ----11732
NM_172059chr821638 1607 ----11732
NM_172060chr821638 1607 ----11732
NM_172071chr196994 4540 2654 2440 1899 1882 1120 719 644 1131 32644 889 367 --
NM_172127chr431688 1481 148 21568 606 21935 1845 --
NM_172128chr431644 1437 104 21524 562 21891 1801 --
NM_173054chr71894 ------
NM_173214chr1687758 6987 3230 2867 2289 1803 1209 1065 ----12333
NM_173359chr311423 --31853 1628 350 11930
NM_173468chr475455 5174 4182 3944 3822 1172 356 22193 1751 45096 1941 1240 40 --
NM_173470chrX1513 ------
NM_173519chr821687 63 11471 ----
NM_173576chr102755 75 --11676 --
NM_173582chr11106305 6044 5705 5144 4981 4871 2508 2370 1700 1654 25043 4272 45278 1637 1419 1286 11047
NM_173595chr1274469 3979 1096 847 563 199 138 24909 3954 1622 --
NM_173602chr1223714 3152 12982 12990 13475
NM_173642chr188545 8103 7250 6651 3649 2601 1382 373 17215 22868 570 12609
NM_173658chr31120 ------
NM_173694chrX----1371 --
NM_173797chr5------2837 467
NM_173808chr143315 1585 1129 1108 11462 23515 199 --
NM_173825chr312460 22807 922 52882 2848 2429 2282 1915 --
NM_173829chr545084 4913 1312 906 --14327 22263 401
NM_173832chr8163407 2502 1353 1328 1303 1289 1278 1253 1228 1214 1203 1178 1153 1128 1012 960 ------
NM_173851chr853854 2808 1581 255 166 23150 263 12968 11569
NM_174911chr871598 987 716 699 577 541 191 13406 22566 1263 1269
NM_174916chr1532318 2002 296 ------
NM_175061chr741509 881 390 81 --11668 --
NM_175069chr94956 879 173 100 --1925 1232
NM_175607chr31188 ------
NM_175610chr151527 --1120 1427
NM_175612chr31188 ------
NM_175623chr12136570 6463 6316 5774 5612 5344 2940 2137 2131 1996 1846 775 135 1387 --12372
NM_175624chr12136665 6558 6411 5869 5707 5439 3035 2232 2226 2091 1941 870 230 1482 --12467
NM_175625chr12136665 6558 6411 5869 5707 5439 3035 2232 2226 2091 1941 870 230 1482 --12467
NM_175736chr12147510 6560 6314 6223 2897 2007 1868 1605 1257 1232 1062 728 131 22 1464 33114 1557 478 11727
NM_175767chr521824 30 ------
NM_175856chr51219 ------
NM_175866chr131297 1227 1051 --11493 1315
NM_175920chr51172 ------
NM_175929chr13--1103 ----
NM_176814chr711051 ------
NM_177422chr13242 73 31 ------
NM_177438chr1463499 3375 3310 3181 1567 368 24011 1078 ----
NM_177947chrX51474 1190 1181 1152 646 2505 27 1460 11409
NM_177948chrX51474 1190 1181 1152 646 2505 27 1460 11409
NM_177966chr331457 38 24 11287 11864 --
NM_177972chr11104222 3303 3178 2734 1349 706 355 338 110 39 11719 1179 --
NM_177990chr2011823 --1214 1516
NM_177996chr2063193 2673 1351 998 937 864 11229 12298 --
NM_177999chr9102968 2635 2619 2485 2314 2288 1307 1276 711 516 13164 1397 --
NM_178010chr1251624 1561 1459 735 282 --11783 --
NM_178037chr1273604 3578 3066 2784 2276 1396 979 179 23449 688 --
NM_178038chr1273604 3578 3066 2784 2276 1396 979 179 23449 688 --
NM_178140chr542388 1710 800 143 12274 1693 12107
NM_178151chrX87591 7539 7044 6608 5777 2474 2463 524 25013 983 37612 5963 5955 1721
NM_178152chrX87591 7539 7044 6608 5777 2474 2463 524 25013 983 37612 5963 5955 1721
NM_178153chrX87591 7539 7044 6608 5777 2474 2463 524 25013 983 37612 5963 5955 1721
NM_178566chr9--11856 --1635
NM_178578chr2052213 1830 1796 1043 48 12165 --1677
NM_178812chr81631 ------
NM_180989chr1322200 873 ----1243
NM_181332chrX3490 347 236 ----12107
NM_181358chr133367 376 309 --2783 139 --
NM_181443chr20--1720 32821 1929 117 --
NM_181453chr261596 1238 457 439 328 185 ----2673 166
NM_181457chr211275 ----2371 98
NM_181458chr211408 ----2504 231
NM_181459chr211174 ----1270
NM_181460chr211221 ----2317 44
NM_181481chr18126579 6439 5655 5647 5591 2125 814 703 631 400 357 50 --12460 15666
NM_181482chr18126579 6439 5655 5647 5591 2125 814 703 631 400 357 50 --12460 15666
NM_181483chr18126579 6439 5655 5647 5591 2125 814 703 631 400 357 50 --12460 15666
NM_181504chr5114146 3222 2924 2898 2807 1377 404 356 156 47 31 11322 ----
NM_181523chr5114146 3222 2924 2898 2807 1377 404 356 156 47 31 11322 ----
NM_181524chr5114146 3222 2924 2898 2807 1377 404 356 156 47 31 11322 ----
NM_181672chrX61896 1462 1339 595 427 384 12026 ----
NM_181673chrX61896 1462 1339 595 427 384 12026 ----
NM_181714chr61148 ------
NM_181784chr241943 1820 513 141 --12446 1919
NM_181828chr22143705 3632 3313 2740 2659 2623 2604 2540 2472 2392 821 527 437 303 --12678 --
NM_181829chr22143705 3632 3313 2740 2659 2623 2604 2540 2472 2392 821 527 437 303 --12678 --
NM_181830chr22143705 3632 3313 2740 2659 2623 2604 2540 2472 2392 821 527 437 303 --12678 --
NM_181832chr22143720 3647 3328 2755 2674 2638 2619 2555 2487 2407 836 542 452 318 --12693 --
NM_181864chr11123 ------
NM_181865chr11123 ------
NM_181866chr11123 ------
NM_181874chr3143 ------
NM_181897chr352329 1908 1874 374 323 --22104 705 --
NM_182472chr4----1164 --
NM_182481chr2151316 1131 369 306 273 --21050 312 --
NM_182482chr2151316 1131 369 306 273 --21050 312 --
NM_182493chr1654258 4055 3509 55 43 --33755 1299 1164 --
NM_182515chr1954754 4056 2277 52 26 14595 76221 4183 2631 2330 1763 1212 976 --
NM_182526chr1482950 2855 2812 2766 1204 796 310 203 21017 365 ----
NM_182551chr231261 815 337 2707 653 --21347 1227
NM_182648chr141481 ------
NM_182649chr202215 74 ------
NM_182688chr2162206 2091 1752 895 874 611 11446 41885 1630 1522 848 --
NM_182715chr72923 70 --21194 29 --
NM_182734chr2043130 909 348 32 12284 --140
NM_182767chr12171 ----31930 1673 855
NM_182848chr1321635 291 --2543 123 --
NM_182898chr765518 5145 4900 4363 2022 1378 --25014 905 --
NM_182899chr765518 5145 4900 4363 2022 1378 --25014 905 --
NM_182918chr2141311 272 266 172 --11146 --
NM_182936chr1461383 1313 1162 549 364 103 ------
NM_182943chr3168 ------
NM_182948chr11695 12399 188 12691
NM_182964chr1132522 436 357 1597 12999 1415
NM_182970chr20104089 4056 3804 3384 2983 2917 1553 1272 1245 120 1986 34204 3941 3693 --
NM_182975chr11345 11023 1752 11056
NM_183002chr1461383 1313 1162 549 364 103 ------
NM_183004chr142702 399 23573 601 22729 1453 1342
NM_183227chr611482 ------
NM_183238chr1253470 3066 2436 965 951 11191 21068 97 --
NM_183244chr20178 ------
NM_183246chr20178 ------
NM_183397chr2064932 4767 4472 3365 3233 1919 14437 31893 1758 804 24158 357
NM_183422chr132900 394 ----2882 388
NM_194247chr223750 1572 --13187 13879
NM_194277chrX167 ------
NM_194282chr412812 1795 12971 22471 734
NM_194286chr1275724 4582 4178 3923 2374 1996 1605 21535 299 16056 --
NM_194291chr842384 1103 926 920 1766 --12959
NM_194298chr1051667 1444 699 417 316 --21542 612 1536
NM_194314chr164782 4373 4165 1515 294 200 --21648 1568 --
NM_194356chr1262329 2237 2149 792 447 270 ------
NM_194434chr1833776 2003 1952 25648 5165 64923 4460 1475 1465 1420 525 --
NM_194442chr151764 1459 1422 1222 141 ------
NM_194454chr71155 11193 ----
NM_194455chr71155 11193 ----
NM_194456chr71155 11193 ----
NM_198066chr1432990 1995 811 --32937 2084 560 --
NM_198077chr11523 ------
NM_198128chr182451 67 ------
NM_198182chr211482 --11407 1991
NM_198215chr1021307 103 11076 ----
NM_198217chr1321101 749 --1976 --
NM_198218chr1321101 749 --1976 --
NM_198219chr1321101 749 --1976 --
NM_198268chr133367 376 309 --2783 139 --
NM_198269chr133367 376 309 --2783 139 --
NM_198273chr522519 247 ----12840
NM_198336chr72651 101 11638 2325 146 --
NM_198391chr20------1561
NM_198400chr1542780 2137 882 644 --11887 1704
NM_198401chr811396 --31588 476 355 124
NM_198427chr1----1440 --
NM_198449chr51432 ------
NM_198467chr7----1160 --
NM_198468chr633760 3119 942 --11333 1518
NM_198485chr34967 953 703 596 --11750 --
NM_198490chr3103190 3171 2823 2804 2337 1070 843 183 127 119 22756 1230 12585 --
NM_198503chr152035 1758 1725 322 137 --11470 --
NM_198507chr51188 ------
NM_198581chr235186 1302 140 --21327 571 --
NM_198700chr11------1504
NM_198721chr4126 ------
NM_198794chr141913 11369 ----
NM_198859chr364366 4279 3725 3472 3349 864 1140 24991 1541 --
NM_198889chr43364 275 111 ------
NM_198896chr1132180 838 701 ------
NM_198900chr12147510 6560 6314 6223 2897 2007 1868 1605 1257 1232 1062 728 131 22 1464 33114 1557 478 11727
NM_198903chr51615 ------
NM_198904chr51615 ------
NM_198965chr121339 ------
NM_198966chr121339 ------
NM_198989chr13----1436 --
NM_199000chr732162 723 489 ------
NM_199044chr172860 2731 2546 2401 441 317 148 --32602 2370 183 122
NM_199188chr1232576 554 405 11152 11013 --
NM_199189chr53980 773 231 ------
NM_199190chr1232576 554 405 11152 11013 --
NM_199245chr1282424 2255 2187 1920 873 746 736 730 ------
NM_199246chr541034 982 97 36 --2992 201 --
NM_199280chr2----1109 --
NM_199320chr441147 674 524 79 --1757 --
NM_199320chr441147 674 524 79 --1757 --
NM_199437chr1122600 2382 ----1551
NM_199438chr1122600 2382 ----1551
NM_199439chr1122600 2382 ----1551
NM_199462chr193695 3428 3357 1944 1738 1596 1229 740 293 --31918 875 206 --
NM_199464chr132230 157 ------
NM_199478chrX1631 ----11775
NM_201263chr131955 1865 342 --1710 1744
NM_201266chr272507 2475 2285 980 955 749 371 12199 1409 --
NM_201269chr11216 ------
NM_201279chr272507 2475 2285 980 955 749 371 12199 1409 --
NM_201413chr213971 942 26 1920 ----
NM_201414chr213971 942 26 1920 ----
NM_201432chr17105962 5589 5216 5038 4764 4656 4361 2426 1419 222 26184 5611 12573 --
NM_201433chr17105962 5589 5216 5038 4764 4656 4361 2426 1419 222 26184 5611 12573 --
NM_201570chr1031780 1563 40 ------
NM_201571chr1031780 1563 40 ------
NM_201572chr1031780 1563 40 ------
NM_201590chr1031780 1563 40 ------
NM_201593chr1031780 1563 40 ------
NM_201596chr1031780 1563 40 ------
NM_201597chr1031780 1563 40 ------
NM_201999chr41984 --11049 --
NM_203282chr1911383 ------
NM_203283chr41623 ------
NM_203284chr41623 ------
NM_203301chr14----11175 --
NM_203327chr2063683 1538 1503 655 591 256 173 33640 3217 37 --
NM_203329chr11146721 6694 6615 6377 6142 5637 5619 4747 2662 2466 2224 1539 1037 459 --25838 223 --
NM_203330chr11146721 6694 6615 6377 6142 5637 5619 4747 2662 2466 2224 1539 1037 459 --25838 223 --
NM_203331chr11146721 6694 6615 6377 6142 5637 5619 4747 2662 2466 2224 1539 1037 459 --25838 223 --
NM_203349chr151110 ------
NM_203354chr142294 100 --1903 --
NM_203355chr142294 100 --1903 --
NM_203356chr142294 100 --1903 --
NM_203364chr112889 289 ------
NM_203372chr241504 1222 640 274 11681 ----
NM_203394chr1232219 2042 273 12260 ----
NM_203406chr5189 22719 273 ----
NM_203437chr21178 ------
NM_203446chr2122957 2025 22382 367 ----
NM_203463chr234852 796 52 13053 13592 --
NM_205860chr123070 2836 ------
NM_206819chr121326 ------
NM_206820chr121326 ------
NM_206821chr121326 ------
NM_206832chr17----1230 --
NM_206853chr664105 3409 2854 2605 1521 359 11228 33585 3203 3153 --
NM_206854chr665366 4670 4115 3866 1620 785 --44846 4464 4414 472 --
NM_206855chr656331 5635 5080 4831 1750 170 45811 5429 5379 1437 --
NM_206866chr2153076 2475 995 475 44 ------
NM_206876chr223192 2579 --22814 1233 --
NM_206909chr8157350 7075 6728 6713 6614 6162 3075 2722 2497 2361 1336 652 634 601 588 15960 25747 536 27271 38
NM_207306chr1104563 4255 4223 4033 3997 3882 3605 3318 290 277 ------
NM_207406chr476031 5706 5346 5259 2611 2127 2101 31729 556 408 15382 --
NM_207660chr1451452 642 483 145 122 --1382 --
NM_207661chr1451452 642 483 145 122 --1382 --
NM_207662chr1451452 642 483 145 122 --1382 --
NM_212460chr741675 1529 782 294 --21620 1515 1486
NM_212474chr24964 701 262 232 ------
NM_212475chr24964 701 262 232 ------
NM_212476chr24964 701 262 232 ------
NM_212478chr24964 701 262 232 ------
NM_212482chr24964 701 262 232 ------
NM_212551chr13982 317 74 128 --1389
NM_213589chr275263 5161 1919 1564 845 540 297 ----24382 1847
NM_213606chr1042099 1954 1948 1820 --22387 2265 --
NM_213654chr331336 1068 249 ------