TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-409-3p
miRNA Sequence: GAAUGUUGCUCGGUGAACCCCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX63367 2790 688 603 405 82 23030 895 23055 52 --
NM_000081chr151824 1766 1322 544 220 1311 --11715
NM_000084chrX116884 6618 6002 5311 5015 4547 4497 2672 2486 2020 312 2556 38 26341 548 --
NM_000091chr292910 2857 2841 2807 2763 2006 829 475 328 32881 2647 2540 21846 100 --
NM_000092chr2134549 4504 4415 4091 3639 3389 3383 3375 1794 1773 1321 1276 778 44290 4254 819 694 1466 1660
NM_000109chrX62606 2558 2342 1909 890 128 12399 ----
NM_000138chr1582311 2285 2253 1867 1067 830 821 628 ------
NM_000163chr572052 1823 516 294 265 217 64 --12223 --
NM_000167chrX81501 1397 1351 726 547 495 278 194 11638 ----
NM_000176chr553188 3006 2412 1415 429 21497 652 13562 --
NM_000176chr553188 3006 2412 1415 429 21497 652 13562 --
NM_000216chrX53763 2887 2739 1126 735 21547 961 23929 2807 --
NM_000217chr1295258 5018 4915 4699 3584 1872 1325 485 330 14160 --11114
NM_000232chr462908 2159 1976 821 559 24 22014 1105 ----
NM_000242chr1082415 2150 2081 942 860 724 617 214 11905 ----
NM_000245chr7102256 1867 1613 1575 1486 838 818 503 461 328 ------
NM_000259chr15196290 6091 6002 5986 5911 5565 5537 5270 4049 2457 2380 2337 1909 1420 1365 1138 821 625 520 --21780 314 --
NM_000264chr9102953 2537 2480 1047 446 400 366 344 178 166 12400 ----
NM_000314chr10133180 2867 2794 2575 2213 2206 2148 1306 1076 744 619 243 92 22242 860 ----
NM_000325chr43617 508 266 1275 --1631
NM_000329chr19943 869 832 754 731 686 647 354 250 1857 ----
NM_000332chr6146924 6278 5541 4416 2400 2329 2263 2060 1806 1587 1120 615 601 525 16956 ----
NM_000337chr5156531 6217 6183 6173 6007 4868 4324 4272 2512 2322 2077 1947 402 33 22 26614 5666 26286 328 --
NM_000362chr2273411 3222 3038 2486 1157 1144 126 13256 ----
NM_000393chr251925 1741 594 212 169 --31912 763 123 11725
NM_000408chr2113315 3250 1378 1315 1151 701 695 460 368 337 128 12860 42624 2253 825 561 --
NM_000430chr1783688 3586 3323 2743 2357 988 442 93 --11366 --
NM_000461chr383840 2816 1723 1491 951 684 589 555 34253 3700 605 34042 3609 3522 --
NM_000489chrX133334 3032 2761 2551 2536 2114 2096 1370 1341 963 903 645 179 --23424 592 --
NM_000493chr641040 716 173 43 1835 --1247
NM_000522chr761235 1190 999 928 858 502 11294 1917 --
NM_000538chr1361802 1627 1255 533 224 112 11505 11765 11129
NM_000555chrX156343 6298 6075 5945 5259 4878 2676 2059 1867 1300 1263 1231 945 801 666 11343 47771 7158 1570 243 --
NM_000572chr12706 127 --1226 1209
NM_000584chr411226 11101 --11043
NM_000610chr1152802 2756 1201 1100 353 43050 3036 1877 585 42712 2472 2312 190 --
NM_000618chr12104930 4217 2315 1839 1792 1586 1392 1301 155 110 25889 1869 34708 2199 163 12476
NM_000619chr123550 491 55 163 122 --
NM_000633chr18115246 4218 4174 4052 4006 1933 1694 1429 892 768 749 11487 13373 --
NM_000726chr251284 1262 553 85 22 --1221 --
NM_000793chr14124267 3819 3688 3595 1951 1878 1588 1541 1430 936 872 270 21917 448 14467 --
NM_000806chr581939 1925 1715 1600 1490 528 389 357 41731 1465 1411 1325 ----
NM_000809chr4249113 8960 8608 8174 8073 7913 7774 7753 6986 6493 5972 5656 3642 3575 3243 1317 1065 901 889 869 847 484 329 81 89264 8951 8872 7939 6642 2419 1753 1035 28692 218 1790
NM_000813chr5205579 5268 4975 4898 4769 4747 4583 4373 3985 3748 3601 3569 3411 1642 1590 1457 905 886 824 666 23965 419 25221 330 --
NM_000814chr15154192 3759 3706 3520 3422 3294 3244 2746 1587 1077 986 834 452 387 154 32947 355 52 23333 1516 --
NM_000826chr4132576 2244 2128 1696 1624 842 829 790 754 557 540 385 333 ------
NM_000860chr471615 1565 652 486 440 263 134 21326 315 1270 --
NM_000866chr361750 1663 1428 1340 1297 353 1685 2709 230 --
NM_000875chr15126804 6462 6380 6199 5822 5371 2615 1664 1184 1124 1106 190 --35547 4937 1602 17017
NM_000899chr12134061 3906 3470 3386 3196 3169 2916 1692 1396 1264 981 785 556 21462 1295 --13675
NM_000901chr462138 1748 439 425 381 86 ----11949
NM_000935chr36337 308 237 137 105 95 ------
NM_000944chr492420 2246 2192 2033 1808 1502 831 584 452 12428 ----
NM_000945chr272097 1838 1355 563 329 221 133 21911 832 ----
NM_001001395chr1252490 1110 709 563 309 11717 --1528
NM_001001481chr8122944 2649 2541 2369 2223 2114 1163 968 910 657 558 548 --23113 2216 1482
NM_001001664chr284098 3726 3528 3432 3067 1249 605 325 23246 3214 ----
NM_001001665chr283408 2987 2911 2659 1196 1170 669 367 33378 3030 463 31252 516 291 --
NM_001001971chr1071253 987 896 871 499 307 287 --11088 --
NM_001001974chr10112291 2262 2145 2075 1784 1720 1517 659 441 283 242 22057 333 32333 1961 402 --
NM_001001995chrX71836 1715 1429 1348 486 378 193 21734 1167 11781 --
NM_001002860chr1484577 3875 3565 3308 3143 1674 1603 920 14063 13933 11593
NM_001003407chr1094627 3695 3683 3314 3159 1994 1651 1327 1269 11718 ----
NM_001003652chr18248556 8511 8274 8218 8080 7253 6981 6885 6826 6534 6337 6254 5889 5686 5451 3334 3004 2215 2161 2025 1751 1495 775 60 48700 6098 1985 173 57694 6789 1647 1393 1069 12904
NM_001003674chr18126872 6853 6216 2796 2039 1596 1577 1562 1524 1367 738 605 1403 46730 4518 4510 867 15210
NM_001003679chr181888 1675 1466 1403 612 461 405 136 1307 ----
NM_001003712chr12143717 3613 3166 2975 2802 2774 1541 1246 1219 861 829 652 356 224 13279 196 --
NM_001003760chr6103589 2793 2681 2538 2297 1046 664 575 96 90 13434 --13327
NM_001004317chr694541 3621 3338 2837 1519 1327 1134 697 222 21539 401 23503 1170 13074
NM_001004346chr44489 480 472 406 3499 317 263 ----
NM_001004360chr291378 801 725 652 616 483 149 71 34 1537 11900 --
NM_001005404chr1754234 3423 3153 1560 55 54538 3943 3937 3912 2916 ----
NM_001005463chr1072128 975 932 460 403 174 34 --32616 757 710 --
NM_001005473chr5216443 6358 6287 5994 5730 5694 5531 4991 4841 4199 2484 2172 2127 2026 1568 1420 1130 768 579 283 188 25166 2137 25221 434 --
NM_001005474chr341318 570 548 255 21331 317 1408 --
NM_001005845chr841897 1386 599 194 11374 11659 --
NM_001006600chr532055 1741 71 12028 11521 11652
NM_001007097chr971887 1663 1568 1464 1061 735 358 --21746 1394 --
NM_001007102chr63663 345 150 --130 1512
NM_001007257chr161122 1097 1085 997 435 137 11296 11421 --
NM_001008239chr1883453 3238 2734 2651 1289 963 314 189 --11162 --
NM_001008392chr343468 2756 2494 448 --23133 3080 13494
NM_001008401chr1941196 911 527 295 2935 925 --11175
NM_001008408chr795186 4939 4449 4391 3973 1260 883 393 293 24495 353 ----
NM_001008539chr8124518 3271 1930 1748 1690 1676 1428 1299 1289 1143 148 80 54615 3476 3375 3328 1701 ----
NM_001008541chr1062205 1757 304 219 210 36 --21705 888 --
NM_001008660chr1151486 1262 1191 1044 528 1576 11429 11307
NM_001008707chr1481596 1471 1296 759 387 339 202 29 11195 2625 243 --
NM_001008738chr562660 973 842 246 141 65 3815 678 293 ----
NM_001009569chr1061436 1414 1337 1319 329 189 ------
NM_001009899chr3126475 6422 6205 5605 5500 4674 4513 4096 1958 1039 989 442 35007 4276 926 24144 2460 --
NM_001009959chr272517 2290 2207 975 555 517 244 ------
NM_001009960chr7112483 2401 2370 2016 1770 1015 753 639 475 132 50 ------
NM_001010000chr1893474 3384 3325 2945 2784 2628 2330 1020 765 --3619 519 105 --
NM_001010861chr141118 505 483 291 22413 490 ----
NM_001010888chrX104260 4251 3895 3243 3163 3138 1524 1170 837 162 22997 41 21232 1162 --
NM_001010891chr5126703 5997 5914 4838 4670 4275 2356 2253 1428 1075 655 628 1605 36874 6796 4323 --
NM_001010986chrX52330 2231 697 541 134 ----12406
NM_001011513chr4133822 3393 3367 3298 3071 3020 2988 2950 2831 2577 1232 620 160 23699 3688 183 --
NM_001011666chr7166591 6321 6188 5651 5391 5214 4523 4315 4248 4092 2397 1412 1042 995 689 330 1522 36412 4292 2080 --
NM_001011708chr292731 2523 2490 2225 2070 2032 2015 1004 408 --32677 1923 647 --
NM_001011713chr142486 387 --1146 1465
NM_001012755chrX185063 5037 4883 4500 4329 4300 4126 4052 3862 3514 1664 994 926 747 725 689 257 199 44720 4203 3218 1160 13760 --
NM_001013620chr12248510 8197 8117 7648 7109 6594 6237 5682 5635 5628 5603 5539 5411 5333 5179 5115 2761 2283 1405 1380 1216 1167 509 464 26062 2678 17827 --
NM_001014342chr171862 1746 1737 1263 361 166 100 11683 1460 --
NM_001014797chr10147831 6044 5938 5900 5515 3139 2724 2076 2031 1820 373 293 76 28 1229 27785 6152 --
NM_001015877chrX102999 2948 2541 2373 2276 961 745 722 582 332 12354 ----
NM_001017420chr851410 1386 1349 1275 1139 ------
NM_001017440chr7107842 7360 6547 6146 5696 5616 5349 5092 1759 801 25042 2041 1709 --
NM_001017926chr861691 1583 1194 287 95 86 11263 ----
NM_001018089chr1573091 1084 861 639 260 155 98 23589 225 ----
NM_001023567chr1562109 2062 892 470 374 217 11971 11544 --
NM_001024649chr582578 2057 448 279 249 228 222 93 12903 ----
NM_001024847chr362280 2192 398 265 197 181 11875 --1467
NM_001024948chr193500 3344 1195 788 666 502 199 170 47 23042 156 12818 --
NM_001024956chr11185889 5839 5730 5560 4983 4964 4920 4776 4487 4432 4263 3834 2306 2247 2063 1421 723 130 25376 4498 24809 464 --
NM_001025076chr10166239 5979 5810 5665 4310 2359 1918 1829 1310 1192 1153 986 634 418 326 254 25956 5771 --13931
NM_001025079chr3113981 3600 3550 3522 3003 2538 1423 1375 1241 1094 890 44117 3961 3948 3624 ----
NM_001025105chr551504 1238 1128 606 491 21216 212 2166 49 --
NM_001025108chr273922 3783 3740 3472 1650 1612 114 --3125 93 54 13861
NM_001025252chr8112984 2166 880 769 615 522 508 432 365 260 70 ----12197
NM_001025580chrX103960 3889 2884 1559 1053 935 822 655 233 138 33693 841 268 13710 24199 1219
NM_001029858chr672161 2112 984 814 649 395 162 12311 11180 12756
NM_001029875chr5112724 1134 992 911 905 853 768 581 474 343 244 2802 491 ----
NM_001030007chr16113956 3470 3171 3080 2961 2947 2618 1331 1125 479 163 23822 515 1290 --
NM_001030055chr14144765 4656 4442 4183 3899 3631 3499 3477 3287 1471 1232 954 881 363 33882 3538 3174 ----
NM_001031679chr12113280 3262 3130 3088 2892 2782 2375 1179 975 768 667 33444 1309 620 11153 --
NM_001031684chr221071 179 1301 1953 1263
NM_001031695chr2264974 3621 2107 1806 1798 808 21024 359 21558 65 --
NM_001031732chr4113426 3354 2547 2474 1480 1315 1200 1014 958 580 438 22251 1307 13002 22369 570
NM_001031804chr16104291 3856 3755 3376 2977 2814 1678 1271 737 397 1962 13508 --
NM_001031812chr5102072 1848 1729 1652 1491 746 610 552 456 294 --22286 2139 --
NM_001032282chr861192 1067 516 461 249 98 1413 11298 --
NM_001032380chr1051354 687 574 347 101 1468 1620 1762
NM_001033045chr2124163 4100 4066 4060 3814 3772 3689 2926 2808 2782 1287 442 14392 14229 1951
NM_001033112chr56892 862 703 655 558 185 ------
NM_001033117chr384327 4266 3817 3134 1953 1353 623 264 --2327 255 --
NM_001033578chr892205 2143 2066 1978 1657 691 491 369 319 1255 12342 --
NM_001033925chr1071786 1767 1672 833 797 534 96 --1602 --
NM_001034841chr16135245 5180 4921 4827 3489 2212 1473 1229 851 808 791 727 261 1560 ----
NM_001034915chr851546 1329 1035 239 232 ----11138
NM_001035260chr1041594 1557 612 508 --31297 585 233 --
NM_001037174chr291710 1702 1652 1613 1506 694 296 257 228 22160 1862 1411 --
NM_001037334chr1861709 1565 887 735 445 227 12112 --12311
NM_001038702chr592483 2470 2238 1963 1711 1012 700 497 269 --12289 12498
NM_001039538chr293342 3310 3142 3135 2327 1077 608 530 33 1834 22288 1472 --
NM_001039547chr3267922 7469 7344 7189 7117 6669 6034 6021 5574 5432 3176 2988 2953 2634 2513 2476 2462 2022 1565 1220 802 787 755 704 646 134 51969 1576 525 489 253 26402 3170 --
NM_001039590chrX123391 3171 3152 2790 1404 1262 1189 1182 649 163 112 81 22743 772 ----
NM_001039618chr11205972 5362 4962 4905 4868 4681 4618 4066 3931 3607 2204 2095 1973 1671 1486 878 840 352 185 121 --14529 14432
NM_001039693chr2134144 4007 3767 3613 3421 3261 3209 3146 2890 2559 1402 744 190 23272 3101 1377 --
NM_001039840chrX205509 5455 5036 5009 4968 4395 4101 4072 3972 3694 2221 2196 2103 1942 1448 1256 705 563 537 121 31751 1192 618 14446 --
NM_001039937chr13143384 3284 3048 1618 1447 1390 1348 1314 1158 733 618 480 241 216 33604 3233 1542 13265 --
NM_001040157chr4142944 2409 2366 2266 2199 2091 2052 1996 1966 1824 662 367 292 168 11122 ----
NM_001040202chr482224 2205 2034 2006 1913 1843 748 42 22215 570 22153 889 --
NM_001040272chr941983 1772 856 383 --1639 21806 1608
NM_001040284chr16205601 5500 5130 5018 4722 4611 4296 4049 3992 3879 3860 3757 3635 1957 1765 1492 1466 1356 644 470 32204 2051 574 25756 697 13889
NM_001040402chr473202 1054 754 607 449 410 235 --22208 1091 1556
NM_001040429chr13103403 3380 3021 2617 1430 1419 1126 773 593 549 33322 2670 527 12188 --
NM_001040624chr872765 1085 746 681 569 506 92 ------
NM_001040665chr7184964 4906 4442 4245 4082 3652 3595 3478 3337 3216 3075 1744 1221 1089 740 498 205 186 23143 1265 ----
NM_001040665chr7184964 4906 4442 4245 4082 3652 3595 3478 3337 3216 3075 1744 1221 1089 740 498 205 186 23143 1265 ----
NM_001040712chr963125 2441 2185 889 452 45 --11223 --
NM_001042355chr16135271 5220 5102 4971 4889 4346 1901 1415 1365 1266 766 189 49 13869 ----
NM_001042404chr161886 1768 1383 557 62 51 11301 21746 353 --
NM_001042440chr532056 438 154 --32008 1929 1709 --
NM_001042473chr1071833 1562 1533 333 302 194 178 1276 ----
NM_001042494chr1593391 2901 1453 1245 831 797 496 214 204 23700 2424 --33623 1091 361
NM_001042533chr383251 2749 2642 2456 2327 1113 744 473 --12720 --
NM_001042550chr962069 1921 1818 1779 1531 781 11762 11586 21479 382
NM_001042555chr12184817 4713 4464 4123 4067 3959 3755 3460 3060 1797 1553 1359 1163 1086 742 450 443 124 24599 1343 34039 290 219 --
NM_001042599chr2197898 6913 5950 5713 5281 3003 2681 2359 2350 2268 2071 1803 1786 1466 1148 833 766 500 488 47388 4901 2238 168 1884 --
NM_001042604chr373865 1464 966 874 680 648 381 2814 299 44504 1937 1769 1556 1729
NM_001044385chr243631 3592 3174 2827 52854 1570 1148 196 181 --1137
NM_001044387chr1993614 3099 1318 941 929 551 183 53 25 ------
NM_001046chr552926 2770 1139 932 83 52840 2199 2079 1997 1116 32337 2148 2021 --
NM_001048183chr183795 3562 2336 1261 821 533 149 28 11473 1225 13782
NM_001099678chr3176364 6012 5917 4830 4471 4341 2339 1546 1407 1193 842 780 770 597 337 200 137 46038 5744 5693 4705 26171 5659 --
NM_001100108chr178021 7954 6366 6147 1275 852 556 52988 2313 1869 1626 862 38377 3238 1652 --
NM_001106chr3139546 9532 8652 8284 7711 7159 6757 3782 2481 1879 889 705 206 43761 1158 776 175 22008 1296 --
NM_001146chr852366 2231 2140 1499 892 --3922 515 96 12336
NM_001148chr4102118 2021 1976 1879 1673 1541 1534 581 215 40 --1278 --
NM_001167chrX146433 6108 4669 4527 4114 2447 2157 1833 1571 1539 1070 611 152 100 15149 12681 --
NM_001186chr2193086 2967 2262 1258 1189 873 498 416 319 52663 2419 2394 2245 2184 12464 1836
NM_001204chr2197709 6763 6404 6235 6058 5836 5796 5664 5562 4748 3014 3002 2626 2337 2218 2163 1817 711 294 67618 6734 5729 2766 2702 881 45289 2327 1742 1391 --
NM_001233chr7142213 2088 2050 1919 1891 1820 1722 967 870 775 670 575 319 60 ------
NM_001241chr272209 1924 1850 651 409 60 34 21688 362 1217 --
NM_001256chr1762651 2548 1800 1148 1090 775 --1178 --
NM_001259chr7125648 4985 4829 4794 4573 4495 4245 3859 2511 2233 2028 1993 --75504 5198 4775 2407 2151 2097 611 --
NM_001304chr1773490 3394 3366 3117 861 415 28 1387 --12962
NM_001310chr12153103 2764 2750 2360 2331 2243 1999 1158 808 646 631 553 249 243 206 --139 --
NM_001351chr361729 1675 1587 597 501 369 149 ----
NM_001356chrX42288 1818 1806 1795 --22316 764 --
NM_001364chr11164789 4590 4449 3751 3651 1732 1571 1248 1179 1007 813 790 773 198 63 38 14782 11578 --
NM_001390chr1853396 1118 796 405 66 --23469 837 1457
NM_001419chr1994705 4563 1333 1107 912 904 856 850 161 --21278 448 --
NM_001427chr762002 1533 314 194 136 109 ----195
NM_001438chr173326 3214 3125 2746 1196 700 96 --2770 679 23669 2886
NM_001455chr6104489 4245 4217 3998 3712 3601 3427 3306 874 351 21503 1026 ----
NM_001609chr10104304 4216 4125 3453 2969 1327 1032 900 702 115 33141 3095 878 24485 107 33373 1276 643
NM_001616chr2103486 3327 3175 2194 1325 1193 1070 923 758 477 1565 ----
NM_001621chr742432 2412 2068 328 2869 645 12641 12902
NM_001627chr342405 2027 1640 93 21953 1668 21757 829 12187
NM_001650chr18174148 4059 3645 3487 3442 3400 3388 3286 2910 2867 1165 1093 668 391 364 213 147 2961 523 --14018
NM_001656chr571786 1538 1448 1426 830 812 292 21945 1394 2624 450 --
NM_001668chr172149 1911 1712 765 720 433 175 1894 ----
NM_001690chr361967 963 944 493 463 176 --11026 --
NM_001695chr884214 4124 3559 3213 1533 928 470 364 11136 23841 156 --
NM_001701chr931436 1075 465 11024 11125 --
NM_001709chr1182865 2051 1768 1072 929 690 637 394 12279 12749 --
NM_001717chr1551468 1291 1222 1079 602 11054 31193 1184 432 --
NM_001748chr13406 364 107 ----2908 313
NM_001759chr12114210 3940 3810 1784 1524 1167 943 513 325 213 189 --11181 --
NM_001830chrX93997 3959 3631 3223 3182 3100 1525 629 479 34016 3829 3727 33452 2599 852 11179
NM_001918chr1199081 8927 8518 8445 8433 6758 6738 5977 3475 3374 3049 2452 2191 1709 1576 1347 1047 712 390 58044 6132 2704 2290 1603 21309 137 --
NM_001938chr191896 1837 1735 1521 701 673 561 534 435 ------
NM_001969chr1483740 3078 1561 755 585 391 103 73 ------
NM_001977chr421564 57 21528 1521 --1426
NM_001981chr151970 1591 846 541 29 31977 1846 631 ----
NM_001987chr1294091 3879 3746 3364 2884 2844 2822 1506 1050 --21527 794 --
NM_001993chr171077 1015 929 859 754 261 157 ----1178
NM_002006chr4155597 5557 5315 5233 4703 4485 4391 4376 4044 2316 1378 1164 1047 1002 658 35058 935 915 25194 4164 14901
NM_002009chr153814 759 351 12371 22212 486 1908
NM_002024chrX51746 1725 508 362 213 41522 1490 655 578 22145 1680 --
NM_002025chrX189179 8312 8118 8064 8004 7960 7593 7499 6659 6467 6352 5759 1377 1348 692 540 223 95 68366 7170 6532 3343 2242 2013 48904 6327 931 288 --
NM_002069chr74655 572 550 373 2489 479 --1314
NM_002128chr1341696 769 426 43 1965 --11919
NM_002137chr772383 2288 2121 2060 1489 432 313 32393 2361 207 ----
NM_002158chr2113330 2890 2761 2598 2569 2332 1519 940 715 457 124 1759 13187 --
NM_002214chr7155719 5514 5403 5321 5231 5144 4547 4277 4087 4069 3946 1630 1601 366 268 24515 4145 44990 3866 1013 639 --
NM_002239chr261133 1045 797 790 360 352 --154 --
NM_002241chr172871 2791 2775 2164 907 850 490 ----11924
NM_002264chr3125012 4158 4003 3850 3754 3691 3352 3254 1984 1810 1165 359 1379 13570 --
NM_002270chr5165592 5292 5066 5027 4485 4372 4204 3912 3763 3610 3454 2162 1389 1006 211 204 55317 4658 2253 781 328 12282 14461
NM_002336chr1294679 4346 3822 1169 1061 844 803 466 34 13904 34930 4106 1406 --
NM_002395chr631354 1181 598 ----1340
NM_002397chr592048 1895 1834 1657 801 735 614 407 355 ----1325
NM_002515chr1472015 1854 1813 1708 794 541 514 --1472 1283
NM_002552chr261227 1129 827 101 90 75 ------
NM_002577chr353861 3132 3015 1087 577 34015 3417 1468 ----
NM_002594chr2052417 2263 2228 1980 212 32497 2095 1800 ----
NM_002610chr262653 2440 2280 2245 973 354 12426 42913 2627 2256 959 12531
NM_002641chrX92043 1591 1358 696 689 480 324 221 32 1287 21326 138 --
NM_002645chr11103151 3077 2897 2881 2873 2829 2476 2145 1977 1095 12494 12560 --
NM_002655chr8115161 4994 4556 3981 1894 1832 1696 1509 1436 751 585 25214 1563 34220 3572 1243 14427
NM_002709chr2143262 2736 2587 2454 2299 2190 1439 1343 1119 1079 763 680 488 451 ------
NM_002715chr551028 832 413 363 101 31226 1093 311 1221 --
NM_002718chr322018 1815 12530 --1935
NM_002731chr182709 2342 2325 2131 1938 1023 962 195 --2790 409 --
NM_002737chr1776367 6255 5733 4979 4256 1915 574 26659 189 35043 896 353 --
NM_002745chr22104549 4270 3333 3270 3073 2873 1160 1061 1053 628 13722 24287 841 14497
NM_002834chr1233762 3169 723 23976 3948 12797 1258
NM_002838chr161175 1007 890 846 835 155 --1117 --
NM_002843chr11103432 3251 2952 2374 2226 1000 958 650 607 76 --1783 --
NM_002858chr131312 487 165 1173 ----
NM_002869chr11112175 2135 2001 1991 1926 1804 1475 271 228 221 81 11654 ----
NM_002906chr1182388 2211 1912 1692 1542 938 579 359 11785 --1161
NM_002941chr351128 1100 592 583 486 ------
NM_002956chr1251308 249 191 134 56 --168 11073
NM_002959chr174430 4368 3838 1455 1363 222 26 23763 2781 1713 --
NM_002968chr1651050 749 292 139 27 ----1129
NM_002994chr491818 1750 1684 1652 1475 1334 672 482 368 11977 ----
NM_002998chr8112183 2157 1882 1848 1832 1802 1713 341 190 172 148 1226 --11383
NM_003012chr862908 2648 2599 1231 1017 115 12109 23176 145 --
NM_003016chr1772021 1980 1954 1903 519 315 264 --11405 --
NM_003022chrX61238 1119 520 494 206 138 21069 171 ----
NM_003042chr352167 1500 1408 668 249 11446 --11912
NM_003043chr3154338 4325 4312 4118 4050 4029 3797 3424 3349 3306 3256 2855 1414 1040 1032 151 14261 --
NM_003051chr1111576 1539 1524 1421 1374 611 529 487 457 107 58 ------
NM_003108chr2137080 6758 6261 6101 5494 4933 4562 1652 1509 1433 996 915 246 27110 6529 24434 1212 --
NM_003112chr773240 3141 2594 2224 876 788 301 --13054 --
NM_003155chr862556 1917 956 647 310 163 --2188 172 --
NM_003161chr1793408 3108 2513 2216 2188 1422 1401 1235 244 33368 2775 2323 13004 --
NM_003205chr15102329 2318 2095 1888 1502 858 811 632 511 452 21961 618 ----
NM_003221chr6103896 3102 1620 1208 1175 929 835 380 194 82 11669 ----
NM_003262chr3114913 3973 3961 2079 1896 1812 1662 753 166 128 94 45204 3933 2073 1261 41761 909 663 376 --
NM_003292chr162265 2149 1634 493 311 79 1546 22243 113 --
NM_003304chr351606 1543 1104 549 131 11644 21212 448 --
NM_003319chr26680 359 262 142 86 52 --1335 1895
NM_003337chr551427 1307 1273 525 315 1390 11301 --
NM_003338chr1071845 1828 1582 1229 618 223 193 11216 --2767 61
NM_003339chr531347 1194 1086 --41280 1111 559 201 --
NM_003340chr461412 1376 1229 960 423 344 ----1411
NM_003373chr1071937 1814 1617 1527 641 579 157 ----11655
NM_003410chrX93020 2892 2135 1010 980 513 483 300 221 22970 2744 --12638
NM_003412chr353090 2850 2448 1987 670 22638 2625 23160 925 2630 67
NM_003463chr6103219 3115 2300 1079 1046 850 530 461 220 73 --12119 --
NM_003477chr113682 224 135 1275 --1554
NM_003478chr1183296 1344 1171 1069 888 614 561 209 43107 2689 2681 112 31196 500 23 --
NM_003480chr1272103 2093 1928 606 285 236 168 --32056 2040 428 --
NM_003483chr1262872 2695 2094 1974 849 689 ----12305
NM_003489chr2193057 2611 1354 1310 1067 1002 808 773 617 33222 284 177 22264 1209 --
NM_003506chr871218 1188 1087 958 913 224 189 41268 1101 1004 924 11075 --
NM_003566chr12123489 3235 3173 3054 2599 2212 1345 1113 1057 989 838 450 43476 1107 40 29 13405 1631
NM_003583chr12143507 3498 3438 3407 3360 3067 1332 1233 895 611 603 513 334 271 23793 3525 22451 42 --
NM_003590chr293463 3456 3214 3175 3110 2660 1494 468 165 32857 2504 80 21108 196 --
NM_003597chr261742 1475 739 623 387 281 12266 31881 1441 269 --
NM_003615chr3133876 3577 3402 3186 2914 1260 1233 1086 1050 765 462 219 80 23489 1076 ----
NM_003618chr241075 933 903 375 1880 --159
NM_003644chr17116099 6030 5438 4768 2509 1980 1934 1714 1686 1567 1208 11848 ----
NM_003762chr151344 560 323 310 146 --1442 --
NM_003774chr1293270 2904 2384 2271 2169 608 290 241 192 1311 ----
NM_003822chr173186 2584 2533 2419 2264 2032 258 22248 762 --1956
NM_003829chr941018 989 228 179 --11203 1859
NM_003873chr1092567 2461 2403 2261 2002 1959 1868 1704 925 --1997 --
NM_003887chr262136 1979 1833 653 540 198 123 --11773
NM_003895chr2172177 1998 1741 1525 1346 601 343 --12122 --
NM_003913chr6154014 4003 3835 3666 3400 2980 1715 1700 1488 923 551 425 369 305 91 12883 1518 --
NM_003934chr971123 1052 924 913 815 300 293 1843 ----
NM_003968chr32600 188 1485 1563 1611
NM_003972chr1061356 1304 537 173 125 119 11345 11296 --
NM_003980chr641456 907 551 356 21354 472 1267 --
NM_004004chr1391330 1319 1232 1198 1162 930 439 90 38 11411 ----
NM_004060chr53495 312 203 1156 21240 457 --
NM_004093chr1373278 3128 3066 2282 2044 1168 177 --12111 --
NM_004100chr652654 2491 2162 759 603 --31807 673 357 --
NM_004124chr1463596 3358 3340 3245 3209 3125 33423 1251 1076 ----
NM_004171chr11159567 9120 8689 8200 7377 6817 6045 3514 3382 2957 2842 1847 1087 814 790 26970 6928 29628 6602 --
NM_004215chr83405 239 220 1578 162 1540
NM_004229chrX82081 2074 1793 752 726 702 265 118 --1506 --
NM_004232chr1893542 3518 3159 2782 2643 1036 860 792 575 1832 1927 1990
NM_004274chr1473171 2579 1976 1237 876 660 522 11124 3685 614 505 --
NM_004293chr9103786 3701 3417 3187 2903 2786 2546 1186 1049 966 41444 1230 737 457 13799 --
NM_004331chr882687 2502 2278 2240 1705 572 376 210 --1150 --
NM_004337chr871899 1554 884 821 681 426 254 ------
NM_004342chr761926 1864 873 832 790 125 --22330 2037 --
NM_004379chr251286 1231 633 93 77 --21206 702 --
NM_004392chr1362198 958 725 653 629 55 32359 2211 1767 ----
NM_004397chr1184143 3252 3142 2848 2777 1379 1308 133 32895 1496 226 11322 12817
NM_004438chr2123111 2975 2967 2953 2765 2376 2294 1302 1054 778 445 130 --22937 2883 --
NM_004501chr1133787 3702 3597 3441 3254 3117 3055 2752 2555 1280 1181 393 90 34133 3810 1498 1212 --
NM_004525chr231453 1353 80 ----1493
NM_004586chrX105111 4543 3746 3639 3571 1985 1577 934 353 335 21128 318 45406 1515 1191 447 --
NM_004598chr563144 3053 2965 2660 2349 388 22381 2277 32868 2470 2070 --
NM_004612chr9114877 4242 4028 3930 3918 3670 1496 1449 1258 1000 908 33583 1156 611 --14488
NM_004666chr671388 1345 1295 1105 1044 569 207 31379 1084 83 ----
NM_004748chr15134033 4024 3898 3695 3123 3111 3061 3022 1383 1298 570 149 22 23435 2652 ----
NM_004760chr762319 1786 1654 596 531 497 153 12301 --
NM_004774chr1772920 2721 2564 2248 1935 597 321 43139 2811 2510 850 11065 --
NM_004808chr1073367 3001 1078 808 491 154 48 --13209 22784 555
NM_004840chrX62444 2104 2063 1980 1929 1829 ------
NM_004852chr181812232 11860 11401 11339 11315 10875 10400 8963 8808 4743 3749 2859 2851 2658 2224 1847 1307 552 613009 12385 10505 3799 2317 1445 613332 10254 4696 4486 3806 978 110828
NM_004857chr14124464 4172 3687 3529 3483 3378 3103 1443 1430 1303 397 238 34741 3150 1120 --23859 3200
NM_004859chr17112764 2353 2316 2016 1197 1142 1050 920 844 348 92 12454 21161 282 --
NM_004863chr14114752 3893 3711 3399 2003 1610 1259 1044 256 154 111 11114 --11941
NM_004898chr472889 2812 2265 2121 1082 983 596 22035 283 ----
NM_004921chr1102397 2328 2297 2259 2247 2030 1859 1668 923 716 --41922 1901 1801 64 --
NM_004929chr871155 1146 1087 558 430 391 253 --11030 --
NM_004956chr7103070 2849 1752 1529 1193 1131 1078 773 346 208 44362 3933 1090 716 ----
NM_004985chr12104490 4246 3695 3438 2952 1360 1180 1046 437 77 64406 1278 1234 940 592 90 ----
NM_004992chrX98031 7257 7224 6223 5145 2703 1054 175 115 26328 3314 38122 5583 2932 --
NM_004993chr1451240 274 267 219 62 1188 --143
NM_005045chr73671 360 34 ----1915
NM_005116chr20164521 4495 4479 4154 4126 4088 3827 3690 3549 3358 3330 2952 2932 2828 661 283 --21739 1027 --
NM_005121chr17113667 3598 2989 2878 2611 933 842 831 365 232 133 32556 1076 323 1802 --
NM_005126chr392283 2258 2132 2047 1815 1479 1430 666 325 11902 1856 --
NM_005156chr9125369 5008 4919 4718 4503 4271 4257 3780 3257 1134 900 312 15229 35020 4435 349 --
NM_005188chr11118338 8159 7400 5837 3036 2217 2097 2072 1353 1026 846 37717 7543 1197 36629 3022 2429 --
NM_005233chr372617 2585 2485 2178 1927 962 391 22519 230 11796 --
NM_005259chr261194 1030 621 507 363 272 11305 21276 969 --
NM_005342chrX62713 2417 1083 643 591 235 --22490 782 11798
NM_005359chr18135610 4949 4629 4434 4358 4157 4088 2445 1477 1309 1260 949 556 25692 1002 ----
NM_005388chr961709 1633 1100 1069 565 384 21405 649 21621 276 --
NM_005433chr1852634 2613 775 641 260 22827 1711 1850 11829
NM_005502chr972937 2830 2152 1287 924 670 625 22884 1226 32316 2034 585 --
NM_005504chr12106010 5382 4761 4478 2626 2268 1648 1619 753 256 44111 2579 2230 238 12006 11121
NM_005509chr571881 1821 1808 1758 1362 1148 534 --11650 --
NM_005525chr11155 --1420 1305
NM_005570chr1851171 1063 835 252 127 --1323 1771
NM_005578chr3164624 4526 4411 4208 4159 4023 3919 3314 3184 2013 1681 1200 1178 902 866 827 1775 1707 1791
NM_005596chr9166258 5740 5005 4720 4714 4425 4318 4102 2456 2390 1810 1617 843 435 403 347 24758 1339 35769 4685 1749 --
NM_005603chr1881762 1652 1567 1333 1272 801 595 302 ----11931
NM_005665chr1184891 4593 4580 4570 4489 4129 3744 3704 3443 3036 1646 1585 1419 1343 1211 1127 1072 448 1268 1378 --
NM_005668chr5144460 4094 3867 3360 3298 3233 2880 1595 1324 1240 1195 187 93 24 43860 1463 1346 1052 21535 957 --
NM_005715chr652291 2265 991 838 118 22842 351 12493 --
NM_005742chr27829 810 777 268 240 181 74 --1615 --
NM_005748chr12133400 2950 2853 2758 2200 1363 1135 795 695 649 355 196 182 1772 12633 --
NM_005807chr15726 538 204 85 67 1756 ----
NM_005822chr661980 1819 1600 1561 580 538 --32253 491 464 --
NM_005832chr351241 1217 987 927 415 11025 21399 373 --
NM_005868chr782470 2448 1915 913 903 298 81 72 2897 291 22214 2018 --
NM_005885chr551484 1408 1218 1193 646 2486 185 1133 --
NM_005898chr11103026 2902 2392 2046 1953 1130 754 505 353 278 --11238 --
NM_005909chr594248 3866 3773 3093 2849 2655 1611 1335 257 23384 2630 22886 820 --
NM_005935chr494580 3812 2084 2006 1095 493 294 131 74 24282 1422 24556 908 --
NM_005941chr8113695 3521 3496 3449 3198 3005 1560 1397 999 912 680 13061 22602 1638 13913
NM_005955chr1105463 4925 4498 4447 4221 3732 2070 1398 738 450 25338 4313 14145 15526
NM_005966chr2102295 1896 1867 828 623 609 569 555 287 219 21823 1481 21989 278 --
NM_006047chr2083462 3064 2867 2717 2186 181 139 131 33134 2702 2567 13474 --
NM_006060chr7114199 4109 4000 3904 3073 2818 1707 1586 1274 1188 85 --33515 1667 922 --
NM_006073chr662065 1963 860 685 380 113 22204 748 ----
NM_006108chr1192317 1976 1721 1673 1461 949 932 548 382 ------
NM_006154chr1552145 490 393 325 137 22346 831 ----
NM_006166chr1282487 2130 1990 1624 607 556 498 224 1540 ----
NM_006195chr961349 1132 1078 886 342 237 --1283 --
NM_006197chr862233 1628 1593 772 693 586 ------
NM_006206chr4102683 2636 2217 1830 1147 795 780 705 541 299 --1348 --
NM_006246chr142496 463 11133 --123
NM_006251chr593293 3259 2633 2479 2471 2255 1188 934 376 1305 ----
NM_006252chr1157476 7144 6965 6864 6809 6802 6414 6103 5986 4956 2330 1919 1579 710 228 11462 --23032 2670
NM_006256chr132511 2464 1771 21975 485 31990 1072 716 11879
NM_006281chr851079 992 815 775 67 --1348 --
NM_006283chr884856 3808 3478 1937 1725 1671 1334 836 --24055 924 --
NM_006290chr641796 1632 698 433 ----11971
NM_006298chr663436 2804 2630 2240 1341 555 42609 2100 260 29 1627 139
NM_006306chrX75565 5338 4433 3892 3707 2011 1613 25225 1794 --1936
NM_006315chr493915 3440 3412 2868 2829 2798 1810 118 74 33977 1773 548 24327 462 --
NM_006320chr45925 820 737 442 106 2878 166 --3801 713 279
NM_006345chr471282 1224 1193 1075 861 252 135 --2887 430 --
NM_006371chr364401 4102 4093 3838 1051 705 24508 1783 24386 3506 --
NM_006403chr661763 1410 1368 411 125 118 ------
NM_006460chr1741819 565 384 370 162 ----
NM_006504chr1051904 1023 901 606 21 2235 84 32681 1007 438 --
NM_006534chr2041074 1068 373 182 --23253 749 --
NM_006544chr14225803 5792 5647 5615 5459 4833 4788 4754 4737 4702 4337 4166 3983 3779 3729 2246 1792 1529 1069 893 457 355 65967 3854 1992 1540 820 641 32423 1920 114 1579
NM_006546chr1796101 5747 4591 2654 2218 1851 1792 1595 1253 15668 21562 1298 --
NM_006572chr1783507 2902 2792 2698 2357 2287 788 382 12829 12218 13226
NM_006577chr281236 1220 1108 1069 1037 1011 796 332 1415 ----
NM_006595chr1151609 1393 799 490 460 21783 599 3536 81 71 --
NM_006599chr16188239 7656 7604 7453 7433 6887 6667 6142 6057 5376 5003 2498 2397 2124 1477 540 469 193 38210 6136 1344 25790 3184 --
NM_006614chr3103647 3565 3296 3214 2578 1403 1140 913 634 126 22710 967 22522 1447 --
NM_006624chr10122138 2113 1782 1748 749 709 608 573 424 354 270 199 --11525 --
NM_006628chr15114226 4152 4111 3783 3103 2870 2851 1434 958 625 212 14470 24165 563 --
NM_006682chr7142892 2523 2473 2405 2394 2337 2330 2184 1956 1852 1142 1017 921 579 32886 2437 1827 3791 230 140 --
NM_006699chr172558 2492 1880 1854 1072 429 107 --1416 --
NM_006717chr963394 3328 2187 2086 628 176 12096 12856 12461
NM_006726chr441016 459 322 113 1311 1384 --
NM_006729chrX74615 4500 3588 876 641 634 29 22130 488 ----
NM_006734chr671484 1440 1264 483 396 390 278 ------
NM_006750chr16198019 7077 6893 6731 6689 6404 6169 5829 5579 5106 3222 2322 1772 1455 1384 1130 469 353 45 12373 28027 1704 17575
NM_006754chr771250 1174 991 944 490 307 108 173 ----
NM_006775chr672818 2418 2350 2212 2125 2015 990 ----13058
NM_006777chrX42493 2148 839 400 11837 --11126
NM_006827chr1463068 3018 2953 1182 916 623 --22306 294 1680
NM_006851chr1252301 2011 1943 517 98 32743 337 194 12064 --
NM_006873chr2103161 2862 2685 2672 2471 2447 2408 2323 1384 765 32388 1392 1101 31338 1138 1035 --
NM_006874chr461263 916 832 311 102 56 --21160 1042 --
NM_006902chr193245 2884 2553 2408 1157 991 768 289 77 11247 190 --
NM_006920chr231921 1333 321 --12044 11463
NM_006948chr2152388 1723 1532 849 512 42401 2274 331 315 1120 --
NM_006981chr942766 2317 2218 1921 12294 22930 1206 --
NM_006999chr552028 1763 1733 1724 481 --11814 --
NM_007006chr1663569 2609 2291 1228 890 818 23180 1029 --1238
NM_007007chr12204741 4455 4289 4085 3897 3720 3711 3694 3491 3342 3298 1815 1714 1634 1086 903 671 548 499 383 21862 1746 34143 3040 527 --
NM_007010chr1791913 1560 1396 1267 627 367 356 106 52 1542 11189 --
NM_007030chr585193 4906 4106 3949 3489 3423 1850 1572 14932 ----
NM_007038chr21156049 6031 6013 5638 5466 5325 5118 4917 4472 4074 3943 1275 276 202 110 55925 4586 4021 1198 1119 25208 5190 12140
NM_007049chr62876 310 --2974 942 --
NM_007054chr573972 3525 3236 1558 1262 713 515 63832 2586 2555 1597 995 182 ----
NM_007106chr1372733 2621 2257 2132 1893 1756 177 22700 816 172 --
NM_007107chr332066 1589 819 --1911 1389
NM_007114chr3183064 2693 2618 2555 2342 2210 1284 1128 933 845 774 445 405 386 235 158 56 41 --1185 --
NM_007146chr1772872 700 675 666 625 134 40 11977 2555 234 1324
NM_007175chr883497 2967 2621 2355 1218 1099 769 496 13596 ----
NM_007191chr124675 633 564 484 ------
NM_007195chr1851355 1028 587 268 260 13301 12427 13647
NM_007249chr13279386 8318 8092 7874 7251 7098 6994 6987 6930 6787 6708 6146 5804 5765 3722 3443 3411 2999 2591 2565 1928 1836 1752 1589 1339 488 317 39039 7342 1983 46494 2659 1104 632 11808
NM_007345chr1862165 2108 1798 1501 643 357 21903 1566 ----
NM_007347chr1582999 2882 2593 2156 1111 933 796 292 12903 22989 469 --
NM_007351chr431145 324 169 1304 --11097
NM_007375chr1102661 2486 2301 2141 2064 599 514 299 215 149 ------
NM_012069chrX72352 2322 2262 1761 970 926 160 --12415 --
NM_012081chr592864 2627 1470 1251 1194 936 737 508 474 32923 1396 596 12439 13509
NM_012095chr1073092 2765 2348 1298 1218 816 105 1779 13525 --
NM_012096chr383258 1229 887 474 418 396 364 215 ----1486
NM_012104chr1193853 3802 3424 3024 3000 2724 2515 1116 512 21326 1282 ----
NM_012120chr692954 2787 2713 2543 2265 912 754 687 183 23032 1165 ----
NM_012199chr174625 4463 4281 3561 1337 1128 996 --21184 525 --
NM_012214chr2146257 5840 5717 5625 5595 4658 2481 1807 1763 1564 1044 690 678 213 21198 576 12324 --
NM_012234chr363055 1368 1271 1168 1080 411 --33229 3011 568 --
NM_012238chr1041300 591 439 116 --1342 142
NM_012262chr1195210 4811 4613 4541 4510 4407 4087 3347 1881 1862 1799 1767 1427 965 931 702 671 344 215 22102 1959 24651 3405 --
NM_012281chr7101819 1534 915 445 398 362 304 210 85 59 22101 1924 ----
NM_012287chr353820 3266 3190 2919 1686 43928 3911 1156 1143 ----
NM_012294chr7124005 3848 3606 3588 993 469 354 330 314 299 237 123 13374 12804 --
NM_012297chr452429 2375 2339 1812 502 32536 2276 159 12646 --
NM_012309chr1174891 4400 4009 1073 278 247 157 13155 23200 1724 --
NM_012329chr1761222 1106 1097 514 461 74 1600 1580 --
NM_012343chr531013 877 404 1931 1798 1367
NM_012345chr1351948 1660 555 497 441 21805 572 11650 --
NM_012347chr6133031 3016 2939 2927 2549 2307 2144 1182 850 742 733 423 386 42774 2481 1213 859 ----
NM_012382chr5134511 4370 3933 3698 3623 3268 1557 1450 567 478 469 416 69 24110 3757 11601 --
NM_012395chr753422 3131 1033 805 658 53278 2883 2149 724 69 ----
NM_012420chr102135 106 --32023 793 236 --
NM_012431chr793300 3064 2952 1387 1288 1201 591 387 328 11099 12786 --
NM_013255chr7177973 7143 6341 6035 5981 5974 5830 5813 5779 5526 5375 3197 3043 2412 2365 1463 694 16980 --12668
NM_013261chr483543 3097 3049 2898 2368 1252 1210 850 --13304 --
NM_013309chr1562577 2472 1920 1899 832 637 11614 22117 332 21052 722
NM_013322chr771668 1575 1441 1139 531 357 337 51688 1422 1354 655 237 11088 --
NM_013372chr1583175 3126 2975 2499 2114 709 430 24 ----12991
NM_013374chr393118 3065 2972 2755 1215 983 970 693 286 21111 646 ----
NM_013943chr1143039 2976 2891 2799 2487 2387 2342 2123 723 656 632 501 458 430 1543 ----
NM_014016chr331490 1454 1278 31522 1339 1142 11209 21305 1253
NM_014048chr16185321 4834 4565 3849 3826 3780 3607 3448 3352 1637 1404 1049 874 801 781 665 202 165 13933 ----
NM_014057chr971627 1384 1304 1108 392 214 126 21227 93 --1226
NM_014112chr8104783 4769 4218 3408 1935 1782 1723 1228 605 120 64853 3767 3641 1500 1266 1140 15248 --
NM_014141chr7135294 5248 5174 4526 4188 3542 3276 1955 1763 1517 736 188 149 11706 1424 --
NM_014157chr1693810 3698 3664 3329 3158 1053 712 634 384 --33756 408 245 --
NM_014223chr13569 280 234 1272 2227 182 --
NM_014253chrX52327 1844 1611 308 161 ----12226
NM_014294chr871120 1107 1030 916 411 268 187 11391 --166
NM_014313chr161622 1592 1091 1014 439 420 ------
NM_014331chr4237844 7819 7696 7207 6942 6919 6883 6324 5606 5394 3037 3024 2864 2154 2063 2042 2018 1980 1440 1123 895 490 306 15330 26636 6383 --
NM_014342chr1151221 1070 1013 168 26 11292 --11429
NM_014372chr162057 2015 2000 1594 1486 1444 2836 756 11804 --
NM_014388chr1134659 4646 1673 1651 1643 1630 1207 998 955 791 775 414 274 --15295 --
NM_014415chr371584 630 477 244 143 133 59 1345 ----
NM_014421chr441907 1894 1407 490 --21953 586 1401
NM_014445chr362312 2264 2132 1945 912 603 --1619 12280
NM_014494chr1621777 1769 --1885 21656 178
NM_014570chr223995 841 145 ----1923
NM_014584chr1481672 1529 530 516 415 364 243 100 ------
NM_014586chr2164669 4238 3586 1905 730 416 ----11017
NM_014622chr113298 254 189 --1341 1936
NM_014637chr881140 1131 964 509 488 462 301 207 21249 956 ----
NM_014666chr541212 1014 861 293 11340 --11007
NM_014670chr241438 1304 1118 513 11485 ----
NM_014682chr862285 1958 1942 1881 917 300 --2932 122 --
NM_014701chr1563473 3022 2375 2097 303 124 12333 176 --
NM_014702chr6123096 2531 2519 2344 1072 947 856 768 571 394 225 60 32877 2592 509 1248 --
NM_014705chr752081 1664 1583 219 71 12139 --1157
NM_014707chr7101869 1757 1659 1588 1578 1528 1447 916 393 366 31980 807 621 1765 1743
NM_014746chr283745 3605 3444 3085 1580 1417 1374 725 ------
NM_014755chr233124 3110 1389 ----14162
NM_014787chr162683 2253 2222 925 865 99 11962 1281 --
NM_014803chr1092938 2818 2309 2135 1931 1909 1023 115 81 12327 ----
NM_014810chr163435 3228 2723 2580 1474 998 23192 425 11279 13111
NM_014819chr552252 2197 1809 831 181 42184 2110 578 137 ----
NM_014832chr135700 535 493 461 418 --21981 1368 21932 770
NM_014839chr162180 2049 1017 955 697 676 1825 11948 --
NM_014848chr1582201 1958 1088 754 567 526 304 160 12084 22496 763 --
NM_014877chr17167078 6457 5527 5496 4758 2993 2628 1559 1380 1313 1213 1186 1028 683 495 371 31008 392 110 25293 1916 24897 2563
NM_014893chrY62285 2273 913 396 368 319 22011 1459 12043 --
NM_014903chr1272260 2218 2044 1629 926 801 209 ------
NM_014904chr10103977 3637 2913 2890 2806 1326 851 827 548 398 53880 3681 1161 946 150 ----
NM_014906chr17103932 3460 3293 2825 2746 903 748 672 637 75 12583 23739 1203 12982
NM_014912chr1063416 3055 2721 2526 2499 927 33313 2369 1257 ----
NM_014920chr683667 3396 3332 3236 826 355 285 176 1387 2257 148 --
NM_014951chr10132593 2543 2316 2263 2009 1990 1783 1754 1642 803 452 86 48 12634 ----
NM_014962chr2052623 2548 1923 1170 211 --21868 176 12788
NM_014982chr14175332 5145 4582 4258 4177 3610 3339 1842 1421 1348 1204 802 741 604 236 208 24 24271 1698 25241 3394 --
NM_014988chr492580 2338 2054 1976 1902 900 761 701 569 --32227 1869 99 --
NM_014991chr4103122 2884 2683 2557 2544 1224 1072 868 755 476 1584 ----
NM_015000chr12123114 2926 2763 2708 2677 2477 2275 2104 765 480 377 201 --21977 1208 --
NM_015026chr12144192 3733 3669 3521 3315 3239 3106 2995 1865 1853 1811 1161 445 80 --21710 966 --
NM_015032chr1382546 2401 2081 2003 1910 1173 968 189 42536 2465 2073 907 ----
NM_015045chr1052081 1784 685 437 102 31775 836 744 ----
NM_015049chr223041 814 --11289 22148 550
NM_015051chr983038 2279 1289 1258 993 598 286 40 22485 2344 ----
NM_015055chr1162858 2844 2827 2518 2301 1891 --1530 --
NM_015076chr694085 3884 3583 1697 1319 740 719 143 54 --1287 --
NM_015097chr361920 1875 471 419 389 226 11626 ----
NM_015141chr3102787 2616 1927 1916 1065 765 489 455 337 84 ----1413
NM_015144chr16103879 3872 3845 3585 3413 2923 2850 1446 1024 295 126 13541 --
NM_015156chr1463944 3853 2822 2485 1372 1290 13916 24011 738 --
NM_015170chr852296 1795 1767 690 592 --32350 875 394 1358
NM_015176chr171739 1651 1635 1332 1100 149 83 11151 1568 --
NM_015205chr1395129 5067 5043 4964 1987 1704 1481 1447 377 15202 ----
NM_015206chr15103460 3428 3046 1351 945 939 602 410 284 231 22912 1131 33580 3071 2360 12864
NM_015215chr182709 2002 1105 1082 1052 924 379 35 11245 ----
NM_015230chr4101702 1661 1342 1258 713 667 381 247 147 41 21884 1314 ----
NM_015238chr54671 574 467 48 ----2483 230
NM_015252chr24876 817 626 95 1370 2794 32 --
NM_015265chr292576 2427 1958 1884 1782 1744 975 967 164 ------
NM_015271chr484095 3779 3581 3201 2882 1676 1611 485 33494 3322 1054 ----
NM_015272chr1641913 1849 1326 480 --1299 11520
NM_015275chr1242069 1435 646 614 32180 1957 1951 1462 --
NM_015278chr683305 3274 2836 2614 2568 2237 737 557 12690 23233 3206 --
NM_015313chr1164649 4555 3873 3646 913 751 13937 24468 4445 --
NM_015317chr262835 2152 1953 1827 685 514 2618 506 22082 962 --
NM_015347chr1232971 1162 265 1179 31119 775 280 --
NM_015355chr1761966 1920 1737 765 372 214 --1242 1178
NM_015375chr1125052 4959 4883 4592 4210 3314 3290 3152 1653 1182 785 77 ------
NM_015455chr583774 3149 1092 1030 800 370 280 188 33689 3066 1621 12858 --
NM_015458chr895248 5116 5104 5095 4879 4678 4345 1247 698 13898 1337 --
NM_015541chr321408 894 ----1315
NM_015569chr194868 4168 3824 3503 3484 3404 3374 1173 53 --13560 13728
NM_015576chr3112750 2441 2413 2275 2247 1166 1110 1094 1086 1071 358 12185 187 --
NM_015578chr19101936 1823 1447 1430 1381 1347 1334 792 694 58 2641 212 11553 11853
NM_015888chr1113360 3084 2555 2394 2094 2075 1275 728 254 136 62 52897 2547 2229 2107 377 33298 2636 563 --
NM_015892chr1062420 2414 2301 2290 2007 760 ----12063
NM_015906chr1114571 4013 3946 3453 3392 3052 1936 1525 1252 1200 302 --34266 1683 1015 --
NM_016021chr6122434 2419 2336 1132 1121 1031 905 897 566 531 156 49 11077 ----
NM_016045chr2071632 1525 1447 1235 568 537 23 ------
NM_016072chr1282404 1570 772 680 572 411 65 34 11961 12088 --
NM_016076chr163184 2728 2395 2300 1159 899 --33205 2685 2080 --
NM_016083chr6143848 3736 3716 3684 3386 2652 1489 1441 1432 895 845 704 607 476 13659 ----
NM_016107chr541355 1199 864 462 --1923 --
NM_016131chr232386 1726 1691 12241 11866 1292
NM_016132chr15113408 2671 2354 2305 2222 2121 1148 1068 829 78 23 22167 1194 12405 --
NM_016206chr3237730 7552 7097 6787 6509 6493 6415 6409 6258 5791 5628 3233 2935 2678 2575 1871 1741 1068 430 270 192 179 33 27025 6044 28459 6908 16932
NM_016217chr683700 3615 3455 2810 2560 1369 1175 74 22405 85 11452 --
NM_016255chr673136 1130 1032 953 895 307 250 22608 1079 13311 --
NM_016262chr66557 436 429 248 207 113 --167 --
NM_016271chr1861903 1855 1807 1685 1492 538 32205 281 199 ----
NM_016275chr362781 2628 1910 995 949 407 3795 295 69 32240 2232 1871 --
NM_016289chr262282 2097 1512 940 634 59 191 22017 39 --
NM_016308chr171700 1653 1498 1456 835 499 41 --21886 341 --
NM_016315chr281812 1502 1404 1160 756 657 118 110 1716 ----
NM_016351chr74629 531 452 232 1221 ----
NM_016356chr672800 2581 2312 2199 1011 594 509 32039 228 132 12287 --
NM_016357chr1251243 1210 1190 271 96 21069 406 1790 1320
NM_016395chr1541959 587 529 142 21189 730 11626 --
NM_016436chr2052112 989 772 475 145 --42682 2601 1083 751 --
NM_016442chr5102225 1945 1937 1828 1735 1538 1531 1493 799 274 1596 21716 295 22192 1487
NM_016530chr15103416 3262 3131 2842 2729 2535 875 783 486 406 33043 792 470 ----
NM_016531chr4103740 3670 3581 2921 2884 961 936 430 405 308 23862 3777 54123 3332 2715 809 788 --
NM_016559chr371363 1225 1067 1045 1033 497 101 --11013 --
NM_016617chr1372099 2079 2060 2037 797 87 44 1329 21535 737 --
NM_016625chr34420 181 155 41 ----172
NM_016653chr261041 1002 497 449 410 248 ------
NM_017420chr1473711 3593 2582 1392 1139 348 74 13542 2897 508 1862
NM_017423chr482237 2151 1719 1466 859 759 713 142 1170 ----
NM_017508chr1172496 2444 2406 913 594 371 37 --1670 --
NM_017577chr371567 1553 476 417 148 134 94 11676 11530 --
NM_017594chr9103029 2985 2721 2709 2606 2360 2051 321 232 108 --22855 2075 --
NM_017610chr1581724 1634 1618 675 480 465 214 102 1797 ----
NM_017628chr4155330 4982 4024 3707 3214 1686 1605 1454 1168 1118 1086 964 689 669 318 1595 24168 3464 11548
NM_017633chr6133916 3803 3564 3385 3164 2771 2665 1347 1169 980 916 810 314 --23924 497 --
NM_017637chr9146738 6596 6309 5937 5711 3184 3174 2587 1956 1888 1742 1234 1041 531 22689 674 22061 1135 --
NM_017641chr1261141 1110 1099 1033 726 414 11053 ----
NM_017643chr1773055 2901 2708 1156 588 248 96 23072 313 12667 --
NM_017644chr394720 4613 4337 4314 3627 3331 1706 1649 1441 --44399 1487 1308 835 --
NM_017645chr983192 3131 3028 2824 2427 726 458 153 1285 12533 --
NM_017650chr7145927 5512 5079 4404 3928 2168 1800 1785 1669 1506 1093 943 721 275 32428 2027 767 1824 25575 1237
NM_017684chr1552042 1928 1453 787 744 1282 11462 --
NM_017714chr203803 697 368 ----1849
NM_017741chr462430 2162 1074 1067 702 506 12678 11724 --
NM_017752chrX61974 1840 1781 293 284 40 32062 2012 530 1710 --
NM_017769chr1493258 2850 2702 2535 2392 2140 802 768 251 31033 423 147 ----
NM_017813chr8105671 4861 4621 4582 4120 4056 3617 1354 525 320 55611 4310 4152 3994 924 1707 --
NM_017824chr1022584 518 1313 --1633
NM_017831chr1863971 3617 1097 979 958 414 33200 1333 473 34646 4308 947 --
NM_017845chr44843 674 641 267 --3769 158 127 --
NM_017847chr1112284 1826 1671 1570 1530 1459 1426 1396 701 630 40 2340 216 ----
NM_017919chr9115576 5563 5402 3983 3772 1961 1701 1256 961 322 32 34327 3723 2296 34726 4036 910 14537
NM_017945chr36563 498 359 211 112 65 2991 411 ----
NM_017987chr1052240 2113 1738 1568 420 21433 862 1525 --
NM_017994chr771141 1027 682 406 394 343 129 12211 12358 --
NM_018017chr10142890 2703 2202 2020 1885 1092 862 502 469 419 394 220 152 109 1284 32620 2269 2070 --
NM_018036chr14144486 4405 4285 3084 2947 2712 1035 933 451 235 174 152 141 119 33738 3203 1280 43696 3462 2824 1627 1518
NM_018045chr142114 1114 1047 261 1567 148 13042
NM_018046chr561820 1643 1610 1537 543 272 --1615 --
NM_018061chr161733 1468 1459 659 566 509 --1496 --
NM_018084chr2113302 3260 3126 2480 2274 2108 1219 1213 1069 1042 709 ------
NM_018157chr1293288 3268 3256 2826 1256 802 141 83 41 --128 --
NM_018184chr361516 1505 843 832 429 380 1643 11887 --
NM_018243chr4114102 3990 3910 3460 3228 1418 1082 1055 922 761 550 2572 522 --13737
NM_018247chr682448 2426 2198 2104 2065 1226 963 883 ----12675
NM_018254chr172153 1947 1815 1743 946 680 375 --1489 --
NM_018293chr371923 1890 1184 1148 907 725 264 1942 1625 1395
NM_018361chr8113488 3460 3419 3218 2821 1446 1354 967 908 618 436 33400 801 331 23600 3469 --
NM_018362chr11133999 3676 3635 3590 3045 1402 1294 1173 976 707 699 508 151 32787 736 306 11516 --
NM_018364chr172759 2698 1451 1345 1334 1175 128 53945 3646 3254 3107 1482 11496 --
NM_018374chr7105261 4568 4218 4115 4080 3579 3394 1306 915 509 34630 3339 709 1489 --
NM_018403chr3114001 3758 3643 3313 3132 2843 2734 1161 598 154 82 14049 --1651
NM_018439chr1892669 2649 2509 1625 861 765 597 402 118 1617 --1132
NM_018440chr8197933 7855 7504 7494 7211 6811 6588 6232 6020 5453 5316 3271 3208 3086 2600 2260 1961 1049 516 25287 2472 38164 1386 1378 11657
NM_018475chr45700 688 590 521 225 --1606 --
NM_018482chr852585 2435 1689 699 572 21604 781 22090 917 1410
NM_018490chr1141268 649 358 274 11718 11866 1616
NM_018566chr1154929 4918 4461 4411 4291 4072 1776 1757 1716 1655 1645 1592 1560 864 488 54020 3718 3564 3224 624 34993 4791 3649 --
NM_018569chr451446 1414 993 648 272 1371 11289 1464
NM_018638chr1294526 4435 3631 3515 1861 1523 934 684 418 24604 3937 --2601 79
NM_018650chr162144 2137 2067 885 820 674 12251 ----
NM_018712chr111581 ----21213 306
NM_018718chr782250 2219 1762 1647 1579 555 250 59 --11542 --
NM_018958chr1584101 3640 3172 3040 2776 1160 242 159 23750 3067 43805 973 632 342 159
NM_018970chr782151 1999 1131 664 560 465 430 348 --1127 1760
NM_018976chr1242615 2546 993 406 1570 12359 12328
NM_018993chr2051096 591 583 556 537 ------
NM_018999chr10104128 3844 1844 1785 1703 1646 1538 1023 473 446 23033 170 13881 11627
NM_019004chr7102420 1985 1818 1722 1715 1599 1466 656 444 341 31855 837 117 ----
NM_019035chr431647 1607 726 31710 404 135 22096 1450 1741
NM_019045chrX5875 854 785 198 81 1210 ----
NM_019050chr482194 1922 1884 1771 1685 1455 648 268 ------
NM_019072chr5104212 3854 3597 3396 1126 1079 1018 531 250 207 34130 732 484 ----
NM_019084chr1072338 2294 799 760 685 271 260 12283 1944 12534
NM_019094chr1263809 3087 2712 697 283 183 2711 430 --1387
NM_019098chr851856 1566 1243 1135 89 --1706 --
NM_019610chr182212 1968 1916 1907 1705 1392 583 205 --21734 857 --
NM_020119chr753940 3032 2842 1342 1094 23520 788 21509 1456 --
NM_020122chr276006 5318 4499 2270 2055 1823 1467 35238 483 330 35583 5420 4237 --
NM_020177chr532680 2290 224 1133 53364 903 169 155 86 13132
NM_020198chr1771583 1410 1371 1274 1127 466 282 11433 ----
NM_020228chr1162496 2310 1900 1602 1008 284 1320 ----
NM_020337chr483160 2818 2551 2540 2140 1066 606 31 --22798 531 --
NM_020341chr2041911 1351 788 321 31869 1721 1713 ----
NM_020342chr23553 396 372 12276 22220 1733 11930
NM_020357chr351564 1411 1115 611 198 11606 --11292
NM_020390chr3144633 4512 4059 4003 3857 3823 3806 3550 3244 1855 883 754 223 179 41801 1577 1380 1252 21974 809 11364
NM_020403chr1351400 1313 1211 1176 160 2465 432 --1491
NM_020432chr792337 2165 1936 1819 1790 1587 427 396 212 12131 ----
NM_020466chr684663 4642 3549 3234 1993 1956 1411 392 23530 871 34286 3957 1699 14191
NM_020640chr362300 2110 1985 1647 601 219 --2898 234 --
NM_020647chr891932 1710 1683 1510 894 781 618 590 551 21479 904 22163 515 --
NM_020651chr251365 1203 392 375 131 --1669 --
NM_020666chr57773 763 671 365 125 82 74 195 ----
NM_020673chr20217773 7734 7705 7688 7212 7143 7105 6905 6775 6129 5561 5514 4792 4706 2539 1702 1417 1269 966 441 323 46938 5842 5394 5388 26699 5297 --
NM_020698chr1253045 2871 2829 2544 865 22841 780 --12125
NM_020699chr175405 5331 4061 4050 1636 503 482 ----13914
NM_020718chr16106536 6014 5644 2357 2285 1794 1456 1430 678 227 22249 1483 25914 551 --
NM_020728chr762974 2700 2034 1181 223 145 32398 595 536 --1168
NM_020742chrX72372 2343 1860 977 414 337 50 12079 22744 2111 --
NM_020748chr1762170 2156 2068 1689 133 48 --11958 --
NM_020752chr10142910 2878 2862 2771 2668 2628 2491 2348 888 551 289 248 172 74 --22317 1035 --
NM_020760chr271657 1604 1261 736 564 477 73 11422 1377 --
NM_020768chr5102802 2779 2517 2495 2380 870 845 723 642 166 --22446 2276 --
NM_020772chr17187995 7971 7939 7466 6957 6824 6751 6373 6066 5283 3078 2092 2069 1678 1415 1385 975 841 23202 1259 22629 475 139
NM_020774chr18156279 5753 5675 5579 5473 4538 4501 4405 4082 2428 1843 1266 1152 895 642 24135 4023 36237 5358 4351 14003
NM_020794chr141558 1549 1521 428 1107 1486 11345
NM_020800chr351352 1344 1320 332 301 3573 313 220 --1488
NM_020801chr5102599 2368 2185 2072 2015 1706 1689 499 480 192 --32244 804 174 12489
NM_020858chr1582335 2122 2112 1878 1498 516 385 145 22185 1972 --22060 1475
NM_020859chr483988 3926 3507 3089 1088 470 421 311 ------
NM_020871chrX142370 2291 2112 1997 1932 1623 955 733 671 621 548 158 82 59 --11005 11770
NM_020872chr361705 1481 1348 1233 1189 505 2389 189 11275 --
NM_020940chr10112723 2639 2511 2377 2213 2166 1136 796 372 273 156 --1301 --
NM_021033chr13123454 3255 2872 2845 2733 2638 2296 1283 847 418 381 167 33220 2653 2185 --1516
NM_021038chr362253 2243 2137 968 944 529 --2264 170 --
NM_021045chr1072252 2118 1896 989 501 441 203 --21847 281 1343
NM_021072chr552172 1945 660 583 217 ----1887
NM_021097chr283019 2289 2071 1963 1182 1031 929 83 12670 1801 --
NM_021145chr751177 1095 857 419 407 --1894 --
NM_021167chr772765 2479 1845 1808 719 414 152 11106 22237 2031 --
NM_021183chrX112467 2314 1828 1671 988 780 717 697 652 309 132 12304 21020 762 --
NM_021783chrX92432 2310 2212 2197 1959 1951 686 567 193 ------
NM_021813chr685721 4556 3920 2056 1066 962 757 606 24624 2095 1557 11993
NM_021814chr661715 1631 1090 284 195 53 ------
NM_021815chr2162985 2959 2884 2784 2705 2060 1978 1239 1221 1077 914 868 843 570 522 76 33118 2836 2414 ----
NM_021818chr1471259 1069 990 487 405 198 45 1432 1570 11355
NM_021914chr1462352 2111 1883 861 786 433 22461 1764 22364 974 --
NM_021961chr11187445 6743 6258 5815 5199 5075 4587 2660 1821 1804 1499 1162 947 750 419 375 361 348 --24735 2503 --
NM_021964chr3226285 6198 5909 5561 5196 4860 4655 4628 4176 4037 2404 2242 2211 2202 1947 1770 1670 1610 1375 917 382 316 --26009 175 --
NM_021998chrX61522 1250 989 976 587 143 21385 1142 ----
NM_022041chr1642605 2474 414 50 22467 2124 --22521 2276
NM_022048chr1596356 5202 2498 2233 2201 1527 1395 894 381 12039 34322 4250 549 --
NM_022049chr161509 1377 1371 1365 449 430 21885 1711 11598 --
NM_022058chr272091 1911 1685 812 556 330 30 1508 11334 --
NM_022080chr2052712 2475 2201 2109 551 --12510 --
NM_022145chr54656 467 250 234 185 1276 --
NM_022166chr16115904 5763 5561 5200 5185 4950 4181 4021 2540 1190 1131 25747 5136 16238 --
NM_022336chr242307 1733 731 549 1470 --12369
NM_022351chr883142 3004 2601 2389 1287 1056 309 202 --2664 211 --
NM_022458chr793067 2577 2239 1009 993 840 762 264 80 --21016 59 --
NM_022459chr13116003 5854 5376 5115 4838 4716 4664 4649 2130 572 328 34965 4577 2290 ----
NM_022474chr1492289 2176 1725 1036 795 614 425 366 259 52574 2056 1830 1113 1080 ----
NM_022483chr541747 494 298 240 51609 1457 775 622 396 --2217 64
NM_022497chr363920 3743 3342 2434 1057 735 13882 33775 3497 3254 --
NM_022725chr1162031 1969 1806 1388 596 422 ----12074
NM_022726chr691716 1628 1552 1536 1481 1460 1290 1113 201 --11186 --
NM_022771chr1271041 766 722 385 319 278 211 ------
NM_022781chr973148 2975 2680 877 659 512 255 ----1902
NM_022784chr1561185 1081 981 832 736 296 --1956 1894
NM_022817chr251761 770 644 531 141 --1598 11946
NM_022824chr551623 1516 1188 764 742 21772 1523 11857 --
NM_022836chr151785 1744 1695 1560 1284 --21843 28 --
NM_022841chr15122798 2727 2716 2448 1075 1055 938 857 678 473 455 104 32183 1890 594 ----
NM_022898chr14114848 4770 4696 4680 4503 4095 3727 3083 1436 1359 1338 --1856 --
NM_022912chr243092 1126 606 134 --2758 458 --
NM_022918chr113785 635 359 21791 241 --1278
NM_023073chr551265 1239 1077 890 167 21037 958 ----
NM_024052chr1763043 2982 2849 2368 1975 1044 --22481 991 --
NM_024345chr9136145 5989 5885 5015 4423 3929 2284 1635 876 722 383 202 166 43869 1342 679 425 24691 218 1770
NM_024524chr3102842 2339 2096 2014 1955 1261 1231 1200 1052 832 22805 238 13177 1334
NM_024548chr371749 1678 1566 1194 1148 709 648 ------
NM_024583chr22918 834 3828 320 24 1190 --
NM_024594chr551883 1723 702 410 358 --1281 --
NM_024613chr861881 1834 1731 1710 682 140 --11142 --
NM_024624chr261500 1352 1278 1269 1022 343 21608 1048 ----
NM_024636chr762289 1928 917 841 312 142 1521 32156 927 28 --
NM_024638chr362431 2380 2330 2266 577 57 12498 ----
NM_024639chr652945 2431 2325 1166 551 12217 --129
NM_024665chr3104309 4183 3084 2992 1851 1567 1499 981 577 249 --43768 3742 1810 1779 --
NM_024670chr1061174 525 202 132 55 36 ------
NM_024692chr261632 1536 1474 1409 1318 1296 --11721 --
NM_024713chr1551637 1355 588 513 25 1292 --1507
NM_024721chr892564 2377 2200 1974 1922 832 513 434 158 --12079 --
NM_024817chr1585467 5385 4441 4137 3745 615 559 31 25425 515 ----
NM_024841chr1162366 1927 1878 1843 1540 711 --12456 --
NM_024854chr1261434 1282 1195 1097 447 431 ------
NM_024884chr14104278 3769 3568 3559 3471 3375 1555 636 423 144 23244 1347 11460 13913
NM_024913chr771621 1156 677 640 619 521 421 21586 250 1396 --
NM_024947chr3249514 9504 9392 9059 8661 7988 7971 7870 7767 6979 6777 6722 5963 5936 5797 3639 3034 1308 909 718 625 229 195 144 69174 7125 6101 2970 2124 987 --29417 7165
NM_024953chr1272825 2474 2143 2072 1712 392 72 1984 ----
NM_024989chr2168118 7063 7042 6692 6465 5986 5685 5266 3266 3098 2622 2526 1143 959 945 361 98092 7273 6210 6062 6027 2074 1692 1066 980 1125 26130 338
NM_025054chr8104186 3832 3594 3242 3231 1533 1269 582 306 51 13878 ----
NM_025133chr261066 455 308 173 79 38 1211 ----
NM_025134chr1692440 2197 2164 2151 2089 991 916 164 108 12141 12449 --
NM_025146chr382727 2500 1076 1037 524 471 349 282 12068 ----
NM_025160chr1124081 4040 3529 3484 3321 3061 1431 1221 1186 963 206 154 23280 842 --1600
NM_025191chr193557 3308 3281 3265 3209 3154 2476 777 285 1840 43437 3103 2338 2287 --
NM_030621chr14144100 3796 3451 3298 2899 2777 1661 1520 1196 847 590 281 167 161 ------
NM_030625chr1062660 2430 2204 910 544 470 --12581 --
NM_030627chr5144132 3935 3645 3463 3270 2992 2827 2656 1489 1165 1092 881 370 188 32687 1298 306 23665 280 1612
NM_030648chr4135548 5385 5060 4097 3643 3511 2152 1288 1197 1143 946 231 205 1731 35294 2239 890 --
NM_030650chr2134103 3751 3304 3276 3107 2861 2780 2773 2617 1386 1162 1027 727 23645 761 --11270
NM_030751chr1041797 1549 599 269 --11286 21226 56
NM_030755chr14122929 2915 2870 2848 2285 1215 1174 1112 914 725 360 97 127 ----
NM_030763chrX9928 671 664 624 173 165 111 71 34 --1355 --
NM_030806chr1169433 9205 9054 8787 8196 7730 7270 6661 6515 6506 3681 3647 2531 1281 754 177 59301 8820 2730 2565 907 28964 669 11496
NM_030816chr1133460 3451 3350 3178 3115 2835 2803 2366 1117 1019 538 460 450 1503 ----
NM_030820chr63994 678 317 2936 670 --1210
NM_030885chr361828 1430 844 636 402 361 11574 184 --
NM_030918chr1125445 5365 5063 4860 4542 4535 3820 1378 774 461 117 35 25186 955 ----
NM_030965chr13770 314 245 --1521 1333
NM_031216chr1861990 1821 644 553 456 249 32168 2043 565 1872 --
NM_031271chr8101732 1678 1618 1570 1336 1237 470 185 75 51 21718 1417 21525 1325 --
NM_031435chr12133522 3406 3316 2742 2575 2562 2258 2221 892 681 597 586 399 22509 114 22794 393 13342
NM_031442chrX122725 2430 2393 2256 2212 2095 2052 897 768 497 239 152 12511 1365 --
NM_031461chr861950 1936 885 665 343 229 3530 174 78 21523 49 --
NM_031483chr2093006 2625 2290 2172 1164 834 379 340 218 13497 32772 1298 287 --
NM_032047chr352362 1677 827 464 110 1921 2834 369 --
NM_032102chr1162971 2111 937 868 78 26 --1407 --
NM_032144chr281847 1782 1660 1332 1235 1139 121 78 11510 ----
NM_032145chr661937 1915 1876 1246 422 400 41686 1468 1398 87 ----
NM_032175chr531633 1615 191 11647 1298 --
NM_032208chr252794 2414 1144 972 534 13500 --12968
NM_032228chr11133569 3407 3391 3372 2773 2343 1336 1308 694 395 351 238 149 32667 1000 97 12883 12439
NM_032373chr10155773 5561 5533 5298 5188 4747 3985 3843 2204 1412 1317 604 591 294 112 44667 975 951 580 14585 --
NM_032439chr1081666 1041 584 558 535 426 385 51 11165 11312 --
NM_032440chr1052895 2710 2472 2465 2003 12736 12021 --
NM_032445chr1592322 1981 1870 1780 918 442 272 247 42 21749 756 ----
NM_032457chr4113939 3813 3608 2848 2496 1460 1338 1329 714 597 80 21407 1102 11355 --
NM_032458chrX103329 3278 2871 2703 2606 1291 1075 1052 912 662 22684 271 ----
NM_032505chr382748 2412 2011 946 471 403 321 171 1926 21758 215 --
NM_032521chr2063085 2936 2611 2568 2452 118 --22553 457 1135
NM_032622chr441300 439 413 386 11388 1232 --
NM_032682chr3113569 3378 3336 3275 3265 2761 2691 2659 1151 824 281 --22346 350 --
NM_032826chr7114535 4527 4321 4168 4126 3537 1967 1362 840 700 264 35378 4721 4005 14191 --
NM_032833chr1102662 2388 2069 2048 2015 1933 718 165 147 91 --1340 --
NM_032859chr13123919 3765 3706 3413 2774 2759 1571 1448 1439 1431 786 378 21416 106 1486 --
NM_032968chrX84107 3813 3303 3197 3105 1699 1649 1562 34037 1353 433 --23455 316
NM_032973chrY94099 3805 3298 3192 3100 1693 1643 1561 820 24029 1353 --23451 316
NM_033030chr241133 657 628 268 2641 478 ----
NM_033081chr2051311 1277 1190 204 103 1119 ----
NM_033132chr1352096 1761 622 596 336 1404 1675 --
NM_033211chr571641 756 648 537 504 491 458 --11500 --
NM_033224chr7127192 6304 5923 5848 5169 2980 1959 1920 1609 1389 1217 236 23050 2264 27041 477 --
NM_033285chr894405 4394 4226 2795 1638 1187 310 243 193 42991 674 481 475 23112 299 --
NM_033550chr2071969 1961 1578 1560 1509 658 466 21908 288 1440 --
NM_033656chr2185986 5854 4820 4286 3921 1086 738 632 21687 315 22056 187 11467
NM_052832chr873003 2727 910 730 685 663 368 42691 2496 1910 494 ----
NM_052879chr12114081 3391 2955 2856 2706 2516 1007 662 407 392 209 23126 1425 --12598
NM_052885chr12124735 4581 4356 4301 4203 3359 3048 1851 1809 1636 277 203 33208 1910 650 24403 191 14437
NM_052904chr64994 314 272 200 1443 1194 1478
NM_052905chr261417 1408 1197 729 358 106 1719 21787 1655 21839 746
NM_052907chr12194332 4324 4311 4268 4237 4179 4096 4080 3976 3594 3012 2842 2787 1206 1128 941 864 836 294 ------
NM_052927chr572099 1958 1464 885 698 545 192 ------
NM_053025chr341325 1270 668 298 2603 594 11513 11402
NM_057175chr442521 2095 388 55 2344 180 22652 746 --
NM_058170chr161571 1343 633 555 395 116 1486 ----
NM_078476chr621684 621 1384 21782 1750 --
NM_080546chr9112058 1999 1830 1700 1681 1447 903 571 312 46 34 --11785 1613
NM_080872chr883821 3475 3467 1247 1021 958 509 46 --13104 --
NM_133334chr4196279 6106 5804 5376 5348 5188 4563 4408 4195 2436 2023 1716 1618 1612 1471 917 904 497 63 --11787 --
NM_133496chr1104475 4009 3995 3801 3252 2792 1107 1086 631 67 14351 33374 2775 1497 --
NM_138286chr19214152 4116 4107 4047 3905 3872 3731 3683 3425 3156 3131 3067 2933 2840 1614 1019 574 490 434 218 145 63677 1670 1521 957 723 247 ----
NM_138288chr1481842 1759 1615 660 644 453 227 102 1734 --1287
NM_138426chr772126 1797 1573 904 805 571 115 22229 2067 1220 --
NM_138444chr1384985 3944 3446 3267 1994 1806 1555 1412 13838 13784 --
NM_138468chr2166038 5831 4941 4809 4715 4466 2280 2245 1911 1770 1662 1451 1347 870 319 51 56334 5452 4341 244 220 --11962
NM_138473chr1254591 3906 3383 1622 245 34099 208 104 --11769
NM_138731chr14173922 3823 3786 3777 3314 3289 3141 2947 2882 2851 2777 1008 899 719 446 387 274 23268 1646 ----
NM_138782chr582360 1713 1669 1659 1487 909 877 661 22002 135 21947 215 --
NM_139136chr1241041 996 361 298 1720 1955 --
NM_139319chr12101777 1633 1424 1364 1267 707 631 312 193 99 1145 ----
NM_144571chr4176902 6807 5892 5107 5050 5001 4985 4537 2405 2195 2023 1985 1720 1089 1004 608 223 12101 55498 2756 2267 2241 268 --
NM_144578chr1495496 5109 4192 3933 1890 1661 1545 1449 694 14268 24049 456 --
NM_144599chr15205502 5154 4958 4461 4339 3836 3808 3334 2204 1873 1467 1314 1191 966 828 752 565 470 298 280 1307 1760 12033
NM_144664chr11122557 2441 2384 2030 1843 1830 1614 580 299 172 93 21 52108 2069 2059 2053 567 22583 153 --
NM_144778chr13142776 2731 2626 2601 2482 2223 2048 2024 1917 980 518 384 316 54 32391 681 413 ----
NM_144778chr13142776 2731 2626 2601 2482 2223 2048 2024 1917 980 518 384 316 54 32391 681 413 ----
NM_144778chr13142776 2731 2626 2601 2482 2223 2048 2024 1917 980 518 384 316 54 32391 681 413 ----
NM_144963chr882706 2503 2367 2308 2131 1773 573 550 42654 876 122 55 ----
NM_144997chr1751367 1255 467 386 365 --11414 --
NM_145011chr10102251 2197 1792 1459 1424 780 713 551 339 288 1207 11578 --
NM_145117chr1163047 2456 1270 1126 771 375 --22689 2326 --
NM_145176chr6133345 3319 2721 2708 2680 2465 2263 1214 1197 1066 1006 687 641 43463 3354 775 652 ----
NM_145251chr1461614 1354 1253 1234 1021 462 21094 508 1154 --
NM_145257chr1114179 3613 3392 2714 1542 906 730 586 433 211 164 24220 3928 13755 --
NM_145263chr432349 2336 776 ----1451
NM_145808chr772796 2441 2221 1249 946 773 300 --12830 --
NM_147188chr1541459 923 348 277 11405 --1501
NM_152400chr4122072 2018 1860 1460 820 654 574 545 476 373 343 29 --11619 --
NM_152407chr563261 3229 2987 2548 1264 1013 12131 1396 --
NM_152409chr5133473 3389 3379 3187 2854 2702 2401 2319 1252 991 895 815 466 11398 ----
NM_152422chr941443 308 267 21 1255 1503 --
NM_152556chr771714 1698 1642 612 604 237 72 --1533 --
NM_152594chr1582283 2261 2246 1693 1444 626 261 86 1872 11726 --
NM_152622chr5103430 3291 3199 3088 3021 2414 1285 1199 1000 493 13461 12358 --
NM_152624chr5147031 6964 6396 5611 5573 4955 4881 4678 2799 2247 1083 1038 729 127 16129 11751 1458
NM_152641chr1292710 1905 1019 1001 621 563 499 379 337 32013 694 373 12222 --
NM_152666chr15788 658 617 157 123 ----1639
NM_152695chrX82228 1849 1726 1513 1468 845 734 334 --12043 --
NM_152707chr1061010 919 899 694 220 208 3194 80 57 ----
NM_152723chr1141062 717 458 45 21024 60 1888 --
NM_152731chr671227 999 851 820 283 261 142 ------
NM_152745chr721067 876 1953 --11111
NM_152756chr5114196 4157 4125 3800 3758 3625 2961 2906 1577 1378 762 32925 983 886 13441 11425
NM_152758chr862464 2265 1125 1090 629 592 12411 12145 11158
NM_152774chr782392 2163 2081 1920 1735 762 471 197 ------
NM_152787chrX73614 3365 2898 2738 2430 1230 501 ----11059
NM_152835chr152791 2502 1917 816 320 ----163
NM_152996chr151362 849 833 801 782 11926 11909 --
NM_153184chr3102009 1984 1880 1760 1627 1544 762 501 242 203 ------
NM_153207chr12134121 3978 3667 2994 2543 1437 1193 1081 737 472 390 164 145 11558 13521 --
NM_153223chr51475 11169 1986 11354
NM_153235chr6112242 2090 2039 1944 1921 821 614 512 343 123 51 11862 --11895
NM_153240chr381228 1144 1123 1028 995 442 64 55 --11152 --
NM_153332chr893247 2963 2442 2323 2110 1256 1116 373 108 12398 --23021 2220
NM_153371chr1342317 1849 1654 1467 11530 2852 788 --
NM_153619chr1593573 3360 3350 3116 2736 2485 1383 584 212 23423 3210 --23298 2713
NM_153689chr2132350 2160 1974 1934 1796 1668 1620 1573 843 743 549 405 371 --1288 --
NM_153810chr10115108 4610 3835 3779 3507 1944 1761 1725 1310 820 187 33973 1069 516 13476 14743
NM_170665chr12114465 4255 3773 1689 1499 1309 834 774 681 322 240 --1788 --
NM_172071chr187095 6506 6428 6309 5588 5114 1175 639 --27480 972 12165
NM_172193chr1461285 1154 514 444 342 223 1479 --21109 940
NM_173075chr441454 1445 1365 256 21157 266 21294 432 11409
NM_173083chr151311 478 250 216 35 11031 1164 1178
NM_173355chr22374 260 ----2757 282
NM_173468chr4126025 5849 5691 4345 3989 3893 1787 1242 1153 596 491 273 55286 5239 4626 1416 1104 25212 4169 1450
NM_173511chr273841 3408 3399 1155 733 362 264 12802 33876 3740 675 --
NM_173552chr382439 2377 2362 2262 2042 1827 278 144 41601 910 621 163 ----
NM_173576chr1072148 2058 1997 1570 1513 608 283 1195 ----
NM_173602chr12103809 3745 3063 1495 1401 636 557 536 436 198 --23532 661 --
NM_173631chr1951107 939 284 223 48 2360 192 21157 850 --
NM_173642chr1138079 7922 7192 7104 6988 6948 5634 3398 3192 1929 596 558 208 29114 8265 2128 22 --
NM_173808chr1113972 3211 1225 1131 964 630 605 472 391 350 301 21502 1043 ----
NM_173822chr262142 2049 1855 1369 91 48 22184 1400 11911 --
NM_173829chr5175831 5274 5025 4831 4704 4482 4255 4224 2478 2151 1782 1552 1190 1013 335 156 121 35723 4841 1924 ----
NM_174909chr52833 105 1632 1746 1234
NM_175607chr371725 1513 1333 1222 397 318 85 --145 --
NM_175607chr371725 1513 1333 1222 397 318 85 --145 --
NM_175607chr371725 1513 1333 1222 397 318 85 --145 --
NM_175854chr1352628 2564 2261 744 375 21792 461 22579 1965 11725
NM_175907chr1852464 1975 882 529 102 22081 1962 12167 12883
NM_176814chr771306 1117 973 530 514 129 117 --21097 427 --
NM_177424chr161896 1467 540 458 332 91 1722 ----
NM_177968chr261865 1457 379 191 139 90 1623 1109 11840
NM_178123chr25859 682 231 180 54 ----166
NM_178815chr1092434 2422 2187 1001 739 707 315 85 49 --22790 678 12074
NM_181077chr1552102 892 534 470 374 12061 21542 217 --
NM_181354chr871585 1563 1374 1257 447 92 57 --2550 258 --
NM_181358chr1103758 3137 2791 1247 1214 1183 1068 552 327 62 ----13625
NM_181457chr241352 1055 314 196 --1118 11009
NM_181457chr241352 1055 314 196 --1118 11009
NM_181457chr241352 1055 314 196 --1118 11009
NM_181489chr376556 5675 5460 5216 4923 4163 447 15880 ----
NM_181705chr5165428 5366 5343 5121 4979 4840 4583 4110 3910 1933 1261 1042 899 574 216 82 45438 4754 612 424 14415 --
NM_181714chr651294 662 71 45 37 31881 1644 642 1540 11615
NM_181723chr882335 1909 1893 1832 1625 1448 605 451 21916 1490 162 1318
NM_181782chr652007 1844 682 367 187 31440 572 29 12311 11633
NM_181784chr242227 853 699 583 12366 --1897
NM_181836chr572545 2118 1760 510 226 83 41 21912 704 192 --
NM_182485chr4143737 3728 3604 3472 2798 2791 2710 2383 1446 1403 1017 930 697 572 33366 3267 655 ----
NM_182493chr16105367 5289 5169 4849 3399 1703 528 432 188 75 ----11525
NM_182700chr751977 1926 1796 1624 1409 11463 11604 --
NM_182757chr693181 3148 2422 1287 1267 1186 366 331 150 1919 ----
NM_182767chr12112084 1862 1768 1607 1576 804 531 488 278 160 52 174 51934 1847 1788 1689 1515 --
NM_194071chr7105481 4653 4642 4586 4464 4018 2115 1668 1198 1086 24047 118 23435 3398 --
NM_194247chr2134522 4453 4322 3884 3863 3231 1758 1731 1689 1667 1544 1363 684 44092 3122 1813 703 1390 --
NM_194282chr443089 2538 2368 461 42482 2104 801 621 ----
NM_194285chr11123451 3233 2798 2405 1372 1358 1291 852 797 680 602 162 3971 931 811 12358 12113
NM_194291chr872755 2409 1124 830 484 351 330 --2242 70 --
NM_194314chr1104507 4392 4380 4101 3743 1635 1028 839 194 169 14788 11600 21919 460
NM_194356chr1262297 1721 421 404 397 186 1413 21946 116 --
NM_197941chr552571 2383 2173 805 463 ----1158
NM_198270chrX93287 2973 2801 2230 2166 2129 626 311 175 12528 23350 898 --
NM_198273chr563163 3085 2223 866 583 409 22333 938 ----
NM_198465chrX92746 2724 2558 2215 2188 1893 905 897 311 1265 ----
NM_198549chr1103147 3007 1290 886 689 589 576 421 69 42 22447 762 21274 281 --
NM_198581chr2147173 6110 5818 2158 1647 1402 1304 1155 781 647 573 487 365 177 12228 12210 1554
NM_198715chr1155599 5350 5086 4403 4319 1741 1361 1007 954 893 530 506 400 317 270 12029 14574 --
NM_198859chr3124818 4568 3983 3752 3739 1866 1712 1478 1076 936 680 447 1192 14177 --
NM_198904chr562121 2030 1894 1421 547 248 11951 1814 --
NM_198935chr20103105 2844 2597 2203 1243 1213 992 904 863 320 32517 1139 1110 ----
NM_199328chr215905 798 350 321 277 1328 ----
NM_203282chr19121858 1707 1533 1354 1223 1194 1159 631 456 318 290 244 2475 394 11346 --
NM_203349chr1571862 1711 715 677 604 553 376 --21404 521 --
NM_203364chr1171264 994 792 435 337 316 303 ------
NM_203459chr182531 2320 2062 1849 1677 641 175 29 1116 1580 11881
NM_203463chr294669 4353 4021 3827 3568 1264 968 862 127 21675 254 --11175
NM_206853chr6114158 3630 3326 3178 3109 2793 2767 2707 2678 1303 659 23382 175 --1569
NM_206854chr6155419 4891 4587 4439 4370 4054 4028 3968 3939 3285 1920 1076 594 487 474 24643 1436 --21830 202
NM_207015chr371761 774 614 449 181 165 78 ----22330 1728
NM_207303chr10124195 4014 3449 3371 2914 2582 1632 982 809 663 523 348 21279 245 14147 --
NM_207325chr19102077 1802 1778 1711 1645 1582 1290 565 502 315 --11392 1528
NM_207404chr32698 133 1677 21759 907 --
NM_207406chr4166454 6428 5691 4817 4711 2624 2431 2073 1874 1822 1620 1459 1427 1044 559 413 2515 200 56435 5767 4741 2003 1689 --
NM_207445chr1571604 1423 695 483 356 263 196 1751 11505 --
NM_212554chr1061621 1594 1349 1341 479 459 11471 21533 75 --
NM_212558chr9114081 3942 3490 3334 2925 2824 1705 960 875 751 666 22894 1126 --1793
NM_213589chr295021 4721 4593 4450 3548 1816 1634 1091 1040 35224 4909 1345 ----
NM_214711chr483876 3792 2903 2754 2451 2375 432 182 33939 3928 1060 13459 --