TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-409-5p
miRNA Sequence: AGGUUACCCGAGCAACUUUGCAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000267chr1742481 1023 961 56 12401 --1924
NM_001001664chr243916 3874 2890 857 --12731 11476
NM_001003652chr1888184 7771 6902 6618 6532 6018 2403 314 11120 27829 6182 27350 5424
NM_001005386chr232094 858 590 --1937 11522
NM_001005473chr586440 5978 5914 5705 5360 5133 4439 254 14561 --12568
NM_001012755chrX95012 4614 4436 3946 3242 1552 531 263 229 1798 13113 --
NM_001018038chr9--1627 1120 1620
NM_001018054chr121282 1019 ----1158
NM_001020658chr111639 11580 --1270
NM_001025079chr344091 1457 809 120 43778 3426 3126 3043 13400 1336
NM_001033117chr384031 3967 3308 3114 2970 1751 607 89 ----11036
NM_001042555chr1233842 3313 1674 14082 11541 1386
NM_001042749chrX11876 ----21503 674
NM_001106chr359600 6463 1917 1885 1154 26039 3364 17964 1738
NM_001124chr111489 ----1447
NM_001259chr755640 5190 4957 4704 361 11689 24109 334 --
NM_001343chr521501 1087 ----11618
NM_001918chr1118691 6200 5798 2833 2384 2051 1639 1506 1500 959 320 46662 6296 5873 2747 12304 29155 617
NM_002024chrX21887 1664 ----1373
NM_002264chr364616 4156 3922 1747 1059 840 1922 --1213
NM_003410chrX21121 246 --3806 366 352 --
NM_003574chr1845283 2315 2222 1099 --22058 1709 1101
NM_003617chr143969 3747 3192 1107 15001 11375 --
NM_003941chr752088 1918 973 835 182 --22338 847 --
NM_004171chr1169023 6172 3292 1413 663 472 27105 7005 156 --
NM_004464chr412884 12778 11244 21364 1165
NM_004852chr181313906 13733 12284 11437 11032 10977 10397 4076 3791 3216 3021 1071 564 1160 29875 1944 12132
NM_005065chr1444690 1888 1879 179 13815 14563 14763
NM_005126chr342277 2218 1694 434 22087 137 136 --
NM_005277chr431427 1343 120 --1429 1411
NM_005433chr1862281 2129 1792 1065 266 255 12784 12600 1725
NM_005436chr1044012 3235 3174 2617 12961 --13271
NM_005596chr985979 5003 1736 1449 689 625 550 351 11303 --15790
NM_006380chr1743294 3004 1374 1289 24352 4323 11761 14003
NM_006538chr284120 3882 2974 2848 1507 1329 428 128 13952 ----
NM_006750chr1678095 8053 5481 5386 1710 1452 693 --14928 --
NM_007038chr2185940 5290 4928 4772 2086 1706 1578 745 1155 1193 --
NM_007114chr333305 2131 1223 12107 --11101
NM_012120chr642781 2030 972 363 22375 411 ----
NM_012234chr353300 3205 2723 1374 935 1835 ----
NM_012316chr185317 4951 4870 4771 4638 1598 428 371 14501 23813 1009 1319
NM_014048chr1633223 1159 343 14613 23671 2091 1940
NM_014112chr884873 4549 3893 3694 3637 1812 1721 1649 --1988 --
NM_014751chr841861 682 656 172 ----11812
NM_014873chr154503 4266 3800 3320 1054 34274 4188 3032 --14799
NM_015045chr1042061 1480 419 32 ----11835
NM_015170chr8----12124 1861
NM_015215chr152648 876 863 853 682 22216 770 ----
NM_015310chr867259 6604 5082 3221 1941 1444 36043 2093 1865 169 26204 5543
NM_015349chr632030 1134 320 13025 --11181
NM_015569chr163490 3382 2940 992 944 333 23016 118 ----
NM_015878chr832095 1732 528 --22167 1966 --
NM_015879chr1833226 1532 1115 12694 46711 6703 6119 622 11051
NM_016374chr11440 11425 1237 1551
NM_017548chr341779 1488 769 518 ----2682 34
NM_018440chr878181 7845 6824 6162 2625 2232 536 16126 33137 1028 27 --
NM_018566chr13510 456 349 23689 1306 24178 79 --
NM_018638chr1255503 3728 1271 625 437 12132 15119 --
NM_018841chr133382 3036 1071 33680 1493 654 11359 2226 92
NM_020133chr6116090 6045 5764 2175 1983 1803 1753 1347 374 181 80 --16369 --
NM_020772chr1747543 7231 2825 25 45845 2259 1693 1552 18125 --
NM_020774chr1886176 5835 4904 2041 1651 1303 678 225 24484 1202 ----
NM_021116chr757993 2815 1465 725 56 26831 6778 38856 6176 6040 16573
NM_022041chr1642135 623 385 181 --21646 117 --
NM_024524chr333068 2987 2420 --21289 603 12518
NM_024749chr121539 260 --1376 1153
NM_030647chr795334 5273 4911 4539 4525 4133 2409 2311 1790 31004 781 510 14337 --
NM_030816chr131386 805 447 13146 --1592
NM_032458chrX42835 932 754 427 32160 1265 190 --12200
NM_033224chr767557 5333 5113 2855 2345 1669 37054 5790 2523 21585 407 --
NM_053023chr1122828 337 ----11130
NM_080867chr1454446 4054 1419 546 382 11288 24483 4269 23799 988
NM_133265chrX43586 2981 2347 1017 23600 856 --22745 2380
NM_138731chr1443866 1438 520 230 1258 --23490 46
NM_144571chr476328 6242 5203 2573 1735 1717 761 36466 6263 2117 25353 2615 --
NM_144963chr832615 2111 326 12465 --11968
NM_144973chr1275126 4306 4083 3568 3378 1340 1252 1451 ----
NM_152622chr552804 2260 1309 843 763 ------
NM_152787chrX43233 2871 2736 561 ----1725
NM_153619chr1583528 3339 3329 2801 2477 693 292 237 12976 ----
NM_172069chr212224 --1591 21925 1521
NM_172071chr196391 6280 5952 5676 4580 2786 2567 1548 822 ------
NM_198273chr533075 1978 1118 ----12953
NM_206854chr674173 2075 1996 1764 1451 500 493 ------
NM_213589chr264808 3858 3557 1973 1338 407 137 13898 1628