TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-411-5p
miRNA Sequence: UAGUAGACCGUAUAGCGUACG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51527 ------
NM_000038chr552069 2055 1627 524 504 12000 11970 --
NM_000044chrX3333 150 111 --1368 --
NM_000051chr1173542 3503 3268 2954 2556 679 195 2961 359 ----
NM_000052chrX53301 2804 910 256 124 13254 1869 --
NM_000055chr32407 319 ------
NM_000074chrX1886 ------
NM_000081chr171589 1364 1327 1284 1148 716 189 --2414 132 --
NM_000084chrX76669 6596 5917 5642 4929 4709 730 16685 ----
NM_000089chr71116 ------
NM_000091chr282767 2455 2278 2272 1886 1781 978 720 ------
NM_000092chr274531 3827 3077 3028 493 261 234 14330 ----
NM_000097chr34770 490 467 249 11210 ----
NM_000108chr761866 1565 1377 712 580 464 --1627 --
NM_000109chrX72659 2591 1715 896 690 272 163 ------
NM_000112chr554933 4210 3704 811 675 --25264 4138 15565
NM_000115chr1341931 1782 329 178 ------
NM_000125chr663802 3454 3245 2706 2615 297 13752 ----
NM_000129chr611287 11390 ----
NM_000138chr152918 348 --12577 --
NM_000161chr1471821 1475 664 619 586 571 186 ------
NM_000165chr6--11336 ----
NM_000167chrX31840 1274 711 21596 528 ----
NM_000176chr563949 3567 3019 1448 793 465 11423 ----
NM_000192chr1211196 --11120 --
NM_000204chr4127 ------
NM_000212chr1732075 788 71 ------
NM_000214chr2011214 ------
NM_000216chrX63830 3806 3756 3274 1248 289 --13544 --
NM_000217chr1225317 129 31867 1527 107 34801 3461 3312 --
NM_000230chr72830 718 22644 1918 11893 --
NM_000233chr22650 157 1614 ----
NM_000248chr33910 816 184 1884 12133 --
NM_000252chrX31307 1121 1043 ------
NM_000253chr4294 22 --1232 --
NM_000255chr61123 --1321 --
NM_000259chr1566035 5480 2528 1753 708 244 35946 5219 1159 1618 --
NM_000264chr942415 2390 830 378 ------
NM_000266chrX2834 371 ------
NM_000267chr1753516 3326 2207 1339 210 13091 12172 --
NM_000276chrX21953 541 1576 196 --
NM_000288chr61391 1251 ----
NM_000297chr432056 1624 1340 ------
NM_000302chr12606 247 1713 ----
NM_000314chr1032910 2785 1264 21204 997 ----
NM_000315chr112214 31 180 ----
NM_000317chr111337 ------
NM_000319chr125759 434 381 344 253 ------
NM_000321chr13--1573 21789 1099 --
NM_000325chr41641 ------
NM_000328chrX1319 1307 ----
NM_000332chr676982 6255 4951 2699 2440 1894 735 24864 743 17004 --
NM_000335chr32431 349 11384 ----
NM_000337chr556495 5736 4239 1702 1008 36155 692 80 25553 1469 15887
NM_000345chr421016 35 --1861 --
NM_000346chr1722005 435 ------
NM_000351chrX54024 3185 1647 1419 409 ----23814 2869
NM_000361chr2041666 1558 853 136 --21368 647 --
NM_000362chr2283535 2959 2788 2780 1107 573 300 141 --13437 --
NM_000368chr964126 3890 3795 505 371 279 --1921 --
NM_000378chr112960 280 1449 11273 1418
NM_000382chr1751886 1647 1491 365 35 11691 --11873
NM_000391chr1131659 543 369 --31652 604 382 11769
NM_000393chr251920 1601 1438 666 178 ------
NM_000396chr15560 489 465 447 437 ------
NM_000397chrX42412 1938 1881 467 1816 --1599
NM_000401chr11--11135 ----
NM_000408chr242595 2146 2140 540 32780 2672 2158 13240 --
NM_000411chr2163028 2224 2192 962 896 362 22578 732 ----
NM_000421chr171230 1323 ----
NM_000428chr1411054 1848 1938 --
NM_000448chr1182116 2103 2058 814 693 662 437 83 --21050 776 --
NM_000449chr111124 --1146 --
NM_000451chrX--31782 446 320 1373 --
NM_000459chr91871 ------
NM_000461chr363956 3845 3113 2828 1472 486 ------
NM_000462chr1511255 ------
NM_000474chr71578 ------
NM_000484chr212746 112 ------
NM_000489chrX23363 137 33260 1237 1225 ----
NM_000495chrX3967 851 234 3210 199 92 ----
NM_000503chr831236 475 258 --2434 173 --
NM_000508chr41867 1948 ----
NM_000509chr4125 ------
NM_000522chr731010 795 405 21242 1031 1450 --
NM_000523chr231171 200 167 ------
NM_000527chr1922234 448 ------
NM_000531chrX1272 ------
NM_000553chr81442 1618 ----
NM_000555chrX97335 6347 5351 3123 3028 3020 850 360 68 22005 1363 ----
NM_000560chr11698 ------
NM_000572chr12169 161 1727 ----
NM_000585chr42218 53 ------
NM_000599chr244366 3912 995 127 --13101 --
NM_000615chr1172777 2689 2632 2624 1059 880 727 ------
NM_000617chr122921 777 12241 161 --
NM_000618chr12116534 6192 4996 4423 4327 4200 4085 2295 1921 1797 483 --26144 6102 --
NM_000618chr12116534 6192 4996 4423 4327 4200 4085 2295 1921 1797 483 --26144 6102 --
NM_000619chr12145 1150 ----
NM_000627chr2--1312 ----
NM_000633chr1863833 3625 3595 3252 1466 205 ------
NM_000663chr1622861 2449 ------
NM_000681chr1021383 1257 --1157 --
NM_000684chr1021243 1054 --165 --
NM_000693chr1531747 721 125 ------
NM_000698chr101329 --1291 --
NM_000719chr12104879 4216 4196 4111 2008 1849 1346 819 361 191 15120 --16219
NM_000721chr142508 2245 1897 356 22708 2627 12379 --
NM_000722chr71256 ------
NM_000724chr1051429 1335 1267 527 86 11975 ----
NM_000726chr22994 100 --1407 --
NM_000759chr17136 --153 --
NM_000782chr2071226 1045 508 365 354 284 101 11074 --1896
NM_000788chr421358 576 --1567 --
NM_000792chr11955 1420 ----
NM_000793chr1454471 4172 4054 408 376 23814 3450 ----
NM_000800chr531493 1195 364 ------
NM_000801chr202969 215 1436 ----
NM_000806chr5180 --1705 --
NM_000809chr4229290 8193 8136 7476 7425 6868 6575 6223 6130 6016 5963 5822 5739 5700 5650 3505 2185 1549 1478 1420 915 538 67152 5795 5634 1393 702 89 --18969
NM_000812chr42254 44 --1161 --
NM_000813chr555447 4341 1749 1540 833 34357 4150 168 ----
NM_000814chr1563991 3846 3428 3232 2668 1157 ------
NM_000816chr5--1485 ----
NM_000817chr22979 906 ------
NM_000820chr13--1245 ----
NM_000826chr462500 2446 2423 2407 850 344 ------
NM_000827chr532236 2085 1657 22344 1715 ----
NM_000838chr632798 2386 2142 21931 1822 ----
NM_000844chr31973 ------
NM_000866chr341902 1602 1524 313 1407 ----
NM_000868chrX91790 1718 1664 1046 968 606 506 469 188 ------
NM_000875chr1577034 6664 5992 5634 2803 1346 344 --26989 6616 15806
NM_000876chr641422 1295 945 183 ------
NM_000879chr5153 ------
NM_000880chr82809 63 ------
NM_000891chr1763262 3222 3102 2979 2952 986 ------
NM_000899chr1254066 2921 772 245 184 14246 --13900
NM_000901chr452573 2261 930 838 661 --22391 1823 --
NM_000908chr51531 --1766 --
NM_000912chr843146 2417 1082 315 13468 ----
NM_000917chr10185 ------
NM_000919chr52521 135 ------
NM_000929chr121155 1009 ------
NM_000933chr203655 425 150 1216 --1455
NM_000937chr17------1424
NM_000944chr43417 407 148 11882 ----
NM_000945chr261857 1780 1613 1297 689 60 1782 ----
NM_000949chr55956 874 638 361 209 ------
NM_000950chrX73568 3286 2875 1210 892 849 21 ----12498
NM_000956chr142945 352 ------
NM_000958chr52994 369 1272 ----
NM_000961chr2053984 3173 2818 866 525 24026 1363 21086 247 --
NM_000963chr132396 900 260 1675 1514 146
NM_000964chr1721410 1388 ------
NM_000965chr351267 923 450 250 78 --1871 --
NM_000966chr1251080 1034 861 840 765 ------
NM_000983chr141425 1415 1045 178 11621 --1515
NM_001001132chr2121054 166 ------
NM_001001323chr1253132 2012 867 738 682 11066 13164 1236
NM_001001330chr1041311 1298 483 371 --1126 --
NM_001001342chr1021229 229 ------
NM_001001395chr1252787 1038 786 607 520 12345 ----
NM_001001396chr174168 3207 2851 2818 1074 530 336 ------
NM_001001415chr19--124 ----
NM_001001419chr595233 4359 3737 3649 1979 1018 821 720 280 15165 15056 --
NM_001001420chr595233 4359 3737 3649 1979 1018 821 720 280 15165 15056 --
NM_001001433chr2083159 2797 2610 2561 1192 931 728 309 12951 ----
NM_001001481chr841069 619 141 130 12759 ----
NM_001001484chr1071821 1719 1538 927 635 597 267 ------
NM_001001521chr2--190 ----
NM_001001549chr7----1374 --
NM_001001550chr7----1374 --
NM_001001555chr7----1374 --
NM_001001557chr822097 687 1322 ----
NM_001001664chr253672 3146 3087 849 664 --11109 --
NM_001001701chr462284 2141 1657 797 744 708 1167 21804 1721 1360
NM_001001787chr12417 180 ------
NM_001001890chr2173871 3650 3371 3105 3037 2701 961 --23927 209 --
NM_001001924chr872093 1773 767 674 612 468 51 11523 ----
NM_001001925chr872093 1773 767 674 612 468 51 11523 ----
NM_001001931chr872093 1773 767 674 612 468 51 11523 ----
NM_001001933chr11203 ------
NM_001001971chr1031351 1315 1123 1504 --1525
NM_001001974chr1032337 2170 863 ------
NM_001001995chrX41883 1816 1653 631 ------
NM_001002026chr36863 612 432 367 268 242 ------
NM_001002033chr172330 321 ------
NM_001002233chr83695 674 185 1647 ----
NM_001002243chr23729 705 26 ------
NM_001002255chr62125 22 ------
NM_001002257chr243110 2615 2546 1387 ------
NM_001002269chr9------1397
NM_001002295chr101771 ------
NM_001002814chr883765 3382 2867 2615 2594 695 674 185 32373 1127 647 12730 --
NM_001002838chrX31485 1223 518 --21877 116 11737
NM_001002860chr1494650 4642 4489 3900 3833 3006 2873 1837 1607 11461 13812 13822
NM_001002901chr13479 452 406 ------
NM_001002909chr172338 325 ----1178
NM_001003652chr1888725 8544 8053 5995 2782 1876 1662 1089 16280 48521 8031 2706 2194 188
NM_001003665chr133077 2566 162 --2466 346 --
NM_001003674chr1867037 6591 5178 4490 2202 1949 26766 897 ----
NM_001003675chr1867037 6591 5178 4490 2202 1949 26766 897 ----
NM_001003679chr142157 1896 813 56 22007 345 11830 --
NM_001003688chr441196 971 227 211 ----1314
NM_001003712chr1273466 3343 2967 971 619 405 250 13980 12952 --
NM_001003760chr653098 2886 2268 1218 983 2821 102 ----
NM_001003800chr943209 2911 615 38 ------
NM_001004051chrX1306 ------
NM_001004065chr933445 2948 655 --33468 3011 731 --
NM_001004127chr132822 102 ------
NM_001004196chr351110 1096 945 198 150 --141 --
NM_001004317chr654310 3036 1634 1620 47 1965 ----
NM_001004328chr1242191 2064 1705 537 ------
NM_001004346chr41333 178 11099 --
NM_001004360chr232012 1261 425 --21979 173 1464
NM_001004419chr1264328 4110 3580 1567 1012 549 --14611 --
NM_001004720chr21888 ------
NM_001004722chr211057 --153 --
NM_001005207chr171224 ------
NM_001005217chr441048 775 450 57 --1827 --
NM_001005360chr19--1823 ----
NM_001005361chr19--1823 ----
NM_001005362chr19--1823 ----
NM_001005375chrY11465 11196 ----
NM_001005386chr232007 690 300 12082 1238 --
NM_001005404chr1764321 4118 3631 3047 1700 1042 --14306 --
NM_001005463chr1042531 1862 1645 815 --11605 --
NM_001005473chr575043 1437 640 367 348 320 218 --1303 --
NM_001005474chr3--11325 ----
NM_001005476chr22710 196 ------
NM_001005732chr211175 1253 ----
NM_001005733chr211175 ------
NM_001005739chr22716 226 1607 ----
NM_001005743chr1431334 1265 330 ------
NM_001005744chr1431334 1265 330 ------
NM_001005745chr1431334 1265 330 ------
NM_001005746chr22994 100 --1407 --
NM_001005747chr22994 100 --1407 --
NM_001005753chr282046 1568 923 555 495 312 303 250 --1641 --
NM_001005849chr172122 22 ------
NM_001005861chr33786 656 372 ------
NM_001005862chr172485 67 ------
NM_001006600chr532240 2095 797 11550 ----
NM_001006612chrX189 ------
NM_001006613chrX189 ------
NM_001006614chrX189 ------
NM_001006623chr221744 135 1405 1386 1592
NM_001006657chr252653 2112 1213 669 583 ------
NM_001006684chrX184 --1176 --
NM_001007023chr1454471 4172 4054 408 376 23814 3450 ----
NM_001007024chr1743840 3272 1763 1114 ------
NM_001007025chr1743840 3272 1763 1114 ------
NM_001007067chr82259 233 1677 11077 --
NM_001007068chr82259 233 1677 11077 --
NM_001007069chr82259 233 1677 11077 --
NM_001007070chr82259 233 1677 11077 --
NM_001007088chrX157 124 1492 --
NM_001007097chr944251 3305 979 919 24343 4329 ----
NM_001007098chr12195 150 ------
NM_001007156chr1521490 1439 ------
NM_001007237chr152611 1822 528 368 283 --12549 --
NM_001007245chr74643 619 49 37 ------
NM_001007277chr114927 748 56 29 --1949 --
NM_001007466chr6114963 4564 4542 3734 1666 1068 1050 857 845 422 395 ----11368
NM_001007538chr1371890 1791 1765 1647 1430 1244 28 ------
NM_001007553chr131237 832 115 ------
NM_001007559chr181213 2638 35 ----
NM_001007565chr3--1337 ----
NM_001007794chr11698 ------
NM_001008222chrX41404 1272 1256 868 ------
NM_001008239chr1833581 3080 265 12758 --13055
NM_001008388chr4----1141 --
NM_001008393chr472865 2076 1933 1895 1016 735 442 ------
NM_001008401chr1941500 376 185 103 1411 ----
NM_001008405chr761546 1508 1337 1292 422 30 --1312 --
NM_001008408chr7125946 5739 5670 4889 4645 3990 3935 2545 2245 1667 1175 601 21634 1302 ----
NM_001008495chr831619 312 239 21949 1403 ----
NM_001008539chr865307 4968 4247 3861 1567 663 1315 21999 657 --
NM_001008564chr131321 --158 --
NM_001008566chr222524 403 ------
NM_001008660chr1131300 1291 376 ------
NM_001008707chr1441656 1206 606 246 11842 11771 --
NM_001008711chr841269 520 282 60 ----11721
NM_001008723chr103512 381 47 ------
NM_001008738chr522834 663 12402 ----
NM_001008777chr173688 638 570 1478 ----
NM_001008779chr21311 --137 --
NM_001008783chr63730 273 251 ------
NM_001008801chr1922073 1883 ------
NM_001008895chr1311367 ------
NM_001008925chr433514 2330 1064 13307 ----
NM_001008938chr111168 ----142
NM_001009185chr52579 509 --1645 --
NM_001009555chr431774 1412 366 --1526 --
NM_001009567chr10----1690 --
NM_001009569chr1021551 658 2666 124 ----
NM_001009881chr13627 466 30 1242 ----
NM_001009882chr13627 466 30 1242 ----
NM_001009931chr1125 ------
NM_001009955chr11608 ------
NM_001009955chr11608 ------
NM_001009958chr72557 182 ------
NM_001009959chr232504 1046 54 2856 503 12353 --
NM_001009960chr752579 2247 2154 1124 810 11791 ----
NM_001009993chr252883 1657 1293 942 268 1794 23441 1231 --
NM_001010000chr1843114 2788 567 478 --11411 --
NM_001010853chr632474 2155 994 ----13221
NM_001010854chr141507 ------
NM_001010861chr192777 2497 2068 1000 971 663 635 412 375 42250 1865 1829 876 ----
NM_001010862chrX42988 2853 2398 1309 11127 ----
NM_001010867chr175321 4868 2412 2049 1063 543 421 24481 851 22462 91 --
NM_001010888chrX94653 4506 4265 4009 3818 3693 3183 1072 480 11702 ----
NM_001010891chr5116827 6500 6300 5947 5209 5038 1734 1129 1082 442 139 21615 146 35689 4313 708 12078
NM_001010895chr92828 133 12052 ----
NM_001010923chr6--1292 1201 --
NM_001010924chr10----1126 --
NM_001010934chr72366 28 1303 1264 --
NM_001010986chrX42246 1999 764 510 ------
NM_001010989chr162511 367 1579 ----
NM_001010990chr162511 367 1579 ----
NM_001011515chr43854 242 49 ------
NM_001011516chr43854 242 49 ------
NM_001011537chr322341 87 ------
NM_001011538chr4--1949 1679 --
NM_001011546chr202740 338 ------
NM_001011551chrX1430 ------
NM_001011553chr72318 282 1883 ----
NM_001011645chrX3333 150 111 --1368 --
NM_001011666chr785236 4650 4122 2585 1986 1737 1503 1083 56014 5397 4043 2248 645 26339 5486 --
NM_001011708chr222810 393 --12827 --
NM_001011720chr83567 481 209 --21437 1319 --
NM_001011885chr1511161 ----11787
NM_001012393chr11104196 3712 3460 1499 951 903 838 735 616 287 --1255 --
NM_001012420chr152419 86 ------
NM_001012423chr15186 1420 ----
NM_001012426chr643116 3080 1145 570 ------
NM_001012427chr643116 3080 1145 570 ------
NM_001012478chr191645 ------
NM_001012514chr251144 1122 984 804 198 ------
NM_001012516chr251144 1122 984 804 198 ------
NM_001012751chr1051747 1580 1319 772 141 ------
NM_001012754chr1321949 1852 12102 ----
NM_001012761chr52447 38 ------
NM_001012977chrX21424 58 --1331 --
NM_001012985chr11194 ------
NM_001012989chrX--1672 ----
NM_001013031chr101209 13466 ----
NM_001013406chr731732 1682 1406 ------
NM_001013415chr421555 609 1363 1212 --
NM_001013438chr31176 ------
NM_001013439chr3122 ------
NM_001013620chr12167868 7839 7416 7226 7191 6868 5345 5138 2997 2383 1983 1848 1597 1116 920 622 37087 2595 2059 ----
NM_001013635chr1241100 457 348 339 --1937 --
NM_001013699chr121153 ------
NM_001013843chr15159 ------
NM_001014286chr13170 ------
NM_001014380chr1395600 5452 5146 5071 4542 2219 598 542 257 32092 570 481 14608 --
NM_001014434chr13676 211 175 1621 ----
NM_001014443chr1165 --181 --
NM_001014797chr1097919 7024 6229 2988 2012 1573 1111 822 283 11431 15272 --
NM_001014809chr41900 ------
NM_001014812chr151429 ------
NM_001015053chr1711298 159 ----
NM_001015877chrX62664 2307 1207 925 320 104 12804 ----
NM_001015880chr1071654 1300 1277 1076 265 134 53 ------
NM_001015882chr92389 207 1856 ----
NM_001015887chr341753 1682 1181 227 ------
NM_001017368chr1772821 2187 2167 2108 2043 742 533 --12292 --
NM_001017369chr421003 165 ------
NM_001017371chr231049 488 349 ------
NM_001017395chr353653 3018 1404 438 121 --12958 --
NM_001017405chr41963 ------
NM_001017424chr131608 1525 369 ------
NM_001017425chr131608 1525 369 ------
NM_001017926chr83676 397 58 ------
NM_001017930chrX21476 241 --1949 --
NM_001017962chr10185 ------
NM_001017975chr11394 1444 ----
NM_001017979chr41117 ------
NM_001017992chr521039 587 1987 1455 --
NM_001017999chr142101 1711 1669 641 11773 1863 --
NM_001017999chr142101 1711 1669 641 11773 1863 --
NM_001018000chr142101 1711 1669 641 11773 1863 --
NM_001018000chr142101 1711 1669 641 11773 1863 --
NM_001018001chr142101 1711 1669 641 11773 1863 --
NM_001018004chr15188 1458 ----
NM_001018005chr151147 ------
NM_001018006chr15188 1458 ----
NM_001018007chr15188 1458 ----
NM_001018020chr15188 1458 ----
NM_001018037chr91250 11389 ----
NM_001018054chr1----11442 11138
NM_001018056chr91193 ------
NM_001018064chr92537 499 ------
NM_001018067chr174984 4277 3316 1511 1172 1117 733 15353 ----
NM_001018068chr174984 4277 3316 1511 1172 1117 733 15353 ----
NM_001018069chr174984 4277 3316 1511 1172 1117 733 15353 ----
NM_001018074chr563949 3567 3019 1448 793 465 11423 ----
NM_001018075chr563949 3567 3019 1448 793 465 11423 ----
NM_001018076chr563949 3567 3019 1448 793 465 11423 ----
NM_001018077chr563949 3567 3019 1448 793 465 11423 ----
NM_001018100chr151807 1865 ----
NM_001018111chr743937 3853 2531 948 --33798 1481 774 --
NM_001020658chr11239 --11453 --
NM_001020658chr11239 --11453 --
NM_001020825chr531424 1042 494 ------
NM_001023560chr62685 134 ------
NM_001023567chr15186 1420 ----
NM_001023587chr34995 989 982 884 ------
NM_001024024chr143875 177 22 ------
NM_001024070chr142871 173 ------
NM_001024094chr563949 3567 3019 1448 793 465 11423 ----
NM_001024226chr12986 39 --11064 --
NM_001024227chr12986 39 --11064 --
NM_001024228chr12986 39 --11064 --
NM_001024401chr1632877 2326 2272 ------
NM_001024455chrX31655 701 246 ------
NM_001024649chr532922 1825 1122 22792 920 12285 --
NM_001024660chr31393 ------
NM_001024666chrX1253 1506 ----
NM_001024668chr125860 741 623 293 282 ------
NM_001024680chr231535 1417 484 21672 1282 ----
NM_001024809chr1721410 1388 ------
NM_001024847chr331611 935 343 1878 1997 --
NM_001024937chr171104 ------
NM_001024948chr163428 2759 2557 577 339 185 ------
NM_001025068chr331750 1130 588 ------
NM_001025069chr331750 1130 588 ------
NM_001025076chr1065985 5204 4845 4292 2327 2080 25860 1653 35075 4684 865 24474 2426
NM_001025077chr1097343 6562 6203 5650 1382 1105 880 861 209 37218 3011 572 46433 6042 2223 643 15832
NM_001025079chr354010 3308 2622 754 494 23678 2633 13091 --
NM_001025105chr53517 248 119 ------
NM_001025108chr284176 3072 2688 1446 1324 1296 1248 359 1660 --1598
NM_001025252chr853191 2087 1180 1052 175 122 12564 --
NM_001025253chr853191 2087 1180 1052 175 122 12564 --
NM_001025266chr374016 3703 3263 1343 1337 1092 906 24790 3501 24042 831 13478
NM_001025366chr61403 ------
NM_001025366chr61403 ------
NM_001025367chr61403 ------
NM_001025367chr61403 ------
NM_001025368chr61403 ------
NM_001025368chr61403 ------
NM_001025369chr61419 ------
NM_001025369chr61419 ------
NM_001025370chr61403 ------
NM_001025370chr61403 ------
NM_001025579chr1741002 996 421 189 ------
NM_001025580chrX32955 441 89 11293 11061 --
NM_001025595chr41371 ------
NM_001025603chr111124 --1146 --
NM_001025777chr241073 483 393 79 ------
NM_001025780chr911517 1618 ----
NM_001029835chr71150 --1378 --
NM_001029839chr341464 611 593 513 ------
NM_001029840chr341464 611 593 513 ------
NM_001029858chr653228 2216 836 623 102 32125 721 90 ----
NM_001029860chr8139 ------
NM_001029863chr642837 2781 2451 352 ------
NM_001029875chr562645 2162 1894 1093 843 432 12821 1257 --
NM_001029884chr642660 2378 2064 1047 --12644 --
NM_001030006chr1732289 906 404 ------
NM_001030007chr1663982 3810 2735 733 537 400 11047 13214 --
NM_001030055chr1464369 3733 3211 1748 995 575 11862 ----
NM_001030272chr11--1439 ----
NM_001030273chr11--1439 ----
NM_001030287chr1------11073
NM_001031684chr231325 961 42 --11502 --
NM_001031692chr72302 68 ------
NM_001031695chr2244759 3949 1404 1098 23339 70 14248 --
NM_001031710chr71350 ------
NM_001031716chr221096 319 ------
NM_001031732chr483210 2352 1427 1109 1060 950 98 69 --11026 --
NM_001031746chr1071418 1196 1135 364 357 282 27 ------
NM_001031804chr1643092 1167 857 525 ----11614
NM_001031806chr1751942 1703 1547 421 91 11747 --11929
NM_001031812chr531914 1529 48 ------
NM_001032296chr131893 12876 22480 562 --
NM_001032394chr672826 2163 947 933 807 798 489 12685 1664 --
NM_001032395chr682693 2030 1070 814 800 674 665 356 12552 1531 --
NM_001032999chr2075354 5256 4209 3432 3302 3241 180 11125 ----
NM_001033047chr432515 2179 518 --21718 129 --
NM_001033049chr2162103 1968 1692 1550 311 290 --21983 785 --
NM_001033057chr31708 ------
NM_001033059chr621604 506 3482 423 272 ----
NM_001033081chr141638 1608 1511 277 ------
NM_001033082chr141638 1608 1511 277 ------
NM_001033087chr2043078 2863 786 126 --1339 --
NM_001033117chr374624 4244 4056 3719 3165 1734 702 11096 24675 3323 --
NM_001033507chr141789 1284 554 355 ------
NM_001033557chr2----1382 --
NM_001033561chr171605 --1732 --
NM_001033566chr171387 172 ----
NM_001033568chr171387 172 ----
NM_001033578chr841864 311 63 41 1712 ----
NM_001033723chr821975 792 ------
NM_001033756chr61337 ------
NM_001033756chr61337 ------
NM_001034025chr122867 152 --11024 --
NM_001034841chr1645530 4874 1488 508 15168 --22071 1913
NM_001034845chr411282 ------
NM_001035003chr411303 ----1998
NM_001035004chr411303 ----1998
NM_001035260chr1011430 11390 ----
NM_001037132chr741681 1669 678 109 ------
NM_001037133chr741681 1669 678 109 ------
NM_001037164chr781915 1816 1743 1251 603 324 93 73 11337 ----
NM_001037165chr788850 7709 6601 6105 6044 2326 1018 963 28890 7904 12398 --
NM_001037172chr311229 --2919 909 --
NM_001037174chr211418 11812 ----
NM_001037317chr192777 2497 2068 1000 971 663 635 412 375 42250 1865 1829 876 ----
NM_001037334chr1832368 1776 1654 --1356 --
NM_001037339chr151754 1302 1197 624 389 1572 ----
NM_001037340chr151754 1302 1197 624 389 1572 ----
NM_001037341chr151754 1302 1197 624 389 1572 ----
NM_001037341chr151754 1302 1197 624 389 1572 ----
NM_001037494chr121214 ------
NM_001037495chr121214 ------
NM_001037535chrX31528 1278 264 1528 1164 --
NM_001037536chrX31528 1278 264 1528 1164 --
NM_001037540chrX31528 1278 264 1528 1164 --
NM_001037738chr51113 1240 ----
NM_001037872chr24648 265 213 196 1523 ----
NM_001037954chr1173357 3274 3098 1255 1001 969 250 12289 ----
NM_001038603chr52391 296 ----1286
NM_001038707chr142015 1559 626 168 1576 11646 --
NM_001038707chr142015 1559 626 168 1576 11646 --
NM_001039199chr2094521 4207 3356 1962 840 746 494 268 240 34334 3580 1373 ----
NM_001039348chr211057 ------
NM_001039349chr211057 ------
NM_001039395chr932330 2306 2285 12298 ----
NM_001039479chr1472096 2058 2040 1805 977 905 381 12205 --1877
NM_001039538chr253467 3219 1120 250 148 12702 ----
NM_001039547chr3127819 7273 6183 6177 6039 3036 1736 1660 1598 1053 593 228 37490 6202 5595 27159 997 --
NM_001039569chr2--33005 2083 1248 12168 --
NM_001039570chr2254670 4341 4108 1083 405 21467 876 13959 --
NM_001039571chr2254670 4341 4108 1083 405 21467 876 13959 --
NM_001039577chr121726 849 14510 --1995
NM_001039590chrX73468 3278 2562 1396 1135 1119 753 --1808 --
NM_001039591chrX73468 3278 2562 1396 1135 1119 753 --1808 --
NM_001039618chr11105712 5215 5024 4715 4242 3967 1468 827 326 32 35393 1692 1228 25259 338 --
NM_001039693chr2104032 4015 3720 3307 1600 1551 1339 1199 275 137 22580 750 ----
NM_001039709chr2075354 5256 4209 3432 3302 3241 180 11125 ----
NM_001039715chr11955 1420 ----
NM_001039716chr111019 ------
NM_001039840chrX84576 4450 4345 4143 4107 1280 604 440 --24804 882 --
NM_001039888chr13610 598 193 ------
NM_001039937chr1353902 3557 1010 522 299 1700 24066 1582 --
NM_001040001chr641929 1432 563 177 ------
NM_001040033chr11698 ------
NM_001040057chr721483 194 21270 84 11293 11309
NM_001040100chr31437 ------
NM_001040101chr431107 367 254 ------
NM_001040108chr1462004 1317 1145 994 923 417 1535 --13128
NM_001040113chr162945 713 ------
NM_001040142chr261938 1725 525 216 93 41 --1617 1447
NM_001040143chr261938 1725 525 216 93 41 --1617 1447
NM_001040147chr182710 473 ------
NM_001040152chr775100 4161 3707 3405 863 590 530 2834 505 11434 13664
NM_001040153chr1331002 344 122 ------
NM_001040157chr442893 2708 677 350 ------
NM_001040158chr51405 ------
NM_001040159chr441513 1496 1128 546 ------
NM_001040179chr64881 700 677 42 --11030 --
NM_001040181chr321040 125 --1187 --
NM_001040182chr321040 125 --1187 --
NM_001040183chr321040 125 --1187 --
NM_001040199chr321040 125 --1187 --
NM_001040200chr321040 125 --1187 --
NM_001040202chr422238 299 ----12595
NM_001040214chr61895 1879 ----
NM_001040284chr1674531 4398 4340 4275 4071 3683 1257 25395 674 12018 --
NM_001040402chr453029 2581 2560 2500 158 1824 12643 --
NM_001040409chr2193 ------
NM_001040429chr1352307 1266 1004 479 403 12752 ----
NM_001040432chr31133 ------
NM_001040441chr145426 2115 317 34 45124 1748 893 499 13549 --
NM_001040446chr542554 2504 878 499 ----1301
NM_001040450chr1532517 2034 872 22762 1149 22068 1861 --
NM_001040453chr1532517 2034 872 22762 1149 22068 1861 --
NM_001040633chr7----1831 --
NM_001040653chr332570 1982 99 ------
NM_001040665chr794837 4334 3702 3365 3184 3130 1555 953 39 13094 ----
NM_001040708chr81299 --1155 --
NM_001040712chr943151 1377 926 412 130 ----
NM_001042355chr1685244 5188 3931 3301 1333 610 539 531 43812 3471 1370 907 1455 --
NM_001042357chr1041576 1410 959 108 --2453 189 --
NM_001042358chr1041576 1410 959 108 --2453 189 --
NM_001042360chr1041576 1410 959 108 --2453 189 --
NM_001042361chr1041607 1441 990 139 --2484 220 --
NM_001042363chr1041576 1410 959 108 --2453 189 --
NM_001042364chr1041607 1441 990 139 --2484 220 --
NM_001042365chr1041607 1441 990 139 --2484 220 --
NM_001042387chr1041607 1441 990 139 --2484 220 --
NM_001042389chr1041576 1410 959 108 --2453 189 --
NM_001042390chr1041576 1410 959 108 --2453 189 --
NM_001042392chr1041576 1410 959 108 --2453 189 --
NM_001042393chr1041607 1441 990 139 --2484 220 --
NM_001042395chr1041576 1410 959 108 --2453 189 --
NM_001042396chr1041607 1441 990 139 --2484 220 --
NM_001042397chr1041607 1441 990 139 --2484 220 --
NM_001042399chr12192 ----1400
NM_001042403chr124981 788 383 216 ------
NM_001042404chr161861 1833 1342 748 607 435 11899 ----
NM_001042406chr6----1993 --
NM_001042412chr1685244 5188 3931 3301 1333 610 539 531 43812 3471 1370 907 1455 --
NM_001042413chr943588 2849 1219 918 23654 1051 ----
NM_001042424chr451140 704 509 298 187 --2975 912 --
NM_001042437chr23722 321 314 1809 ----
NM_001042440chr511448 ------
NM_001042441chr511448 ------
NM_001042442chr511448 ------
NM_001042443chr511448 ------
NM_001042444chr511448 ------
NM_001042445chr511448 ------
NM_001042446chr511448 ------
NM_001042473chr1021656 308 21752 223 1807 --
NM_001042481chr1472311 2184 1966 928 866 755 261 ------
NM_001042486chr2041190 360 323 197 --11450 --
NM_001042492chr1753516 3326 2207 1339 210 13091 12172 --
NM_001042493chr62732 692 21678 1473 1372 --
NM_001042494chr1563814 3396 2703 1470 802 578 11123 ----
NM_001042495chr1563814 3396 2703 1470 802 578 11123 ----
NM_001042496chr1563814 3396 2703 1470 802 578 11123 ----
NM_001042497chr1563814 3396 2703 1470 802 578 11123 ----
NM_001042506chrX21385 58 --1331 --
NM_001042510chr851907 1350 539 435 43 12064 ----
NM_001042511chr851907 1350 539 435 43 12064 ----
NM_001042533chr343144 905 752 611 22577 111 1987 --
NM_001042537chrX12079 --11901 --
NM_001042555chr1244162 1299 1288 645 33090 1786 1559 11065 --
NM_001042575chr32184 22 ------
NM_001042599chr286979 6943 6903 6294 4751 2697 1055 729 11861 --11976
NM_001042601chr343080 3042 2840 2686 2864 807 ----
NM_001042603chr1255367 4915 1243 1147 766 --3992 559 252 --
NM_001042632chr2022472 149 ------
NM_001042633chr2022472 149 ------
NM_001042724chr192688 131 ------
NM_001042728chr1251080 1034 861 840 765 ------
NM_001042749chrX51825 1357 404 390 361 11972 ----
NM_001042750chrX51825 1357 404 390 361 11972 ----
NM_001042751chrX51825 1357 404 390 361 11972 ----
NM_001043318chr1484123 3672 3476 2939 1386 959 776 768 ------
NM_001044385chr222746 1513 --13737 --
NM_001044722chr531914 1529 48 ------
NM_001044723chr531914 1529 48 ------
NM_001071775chr1361806 574 329 311 195 117 11405 ----
NM_001083620chr462498 2444 2421 2405 849 343 ------
NM_001092chr1772460 2385 2343 857 826 795 775 --11722 --
NM_001099678chr386235 5966 5582 5127 4271 2374 1766 1068 25590 4851 12198 --
NM_001100108chr176811 5986 2759 2421 1722 1305 150 36168 5526 5162 16974 --
NM_001105518chr14955 901 647 242 1841 1784 --
NM_001106chr3149592 8591 7262 7168 7064 6105 5907 3155 2592 2544 1971 1474 1092 217 29638 1242 13803 --
NM_001109977chr42541 95 ------
NM_001112808chr12130 95 ------
NM_001113490chrX22848 1341 --1177 --
NM_001121chr1021813 1631 ------
NM_001124chr111702 ------
NM_001128chr1663982 3810 2735 733 537 400 11047 13214 --
NM_001140chr171163 ------
NM_001148chr421654 706 ------
NM_001149chr10136 ------
NM_001159chr21707 ------
NM_001167chrX86708 6400 6354 2252 1920 1651 836 209 24135 1237 ----
NM_001173chr1464369 3733 3211 1748 995 575 11862 ----
NM_001178chr11--1439 ----
NM_001186chr2153163 2950 1095 465 118 12197 ----
NM_001189chr461119 938 866 314 266 173 ------
NM_001198chr6102388 2376 2345 2308 1935 1812 1593 1520 413 254 ------
NM_001200chr201450 1318 ----
NM_001204chr285570 5498 5206 3116 3110 2019 1828 1608 44937 2286 2068 1575 --12403
NM_001206chr952879 2344 2113 884 620 22515 1024 12650 --
NM_001219chr722302 343 11907 ----
NM_001233chr742108 1635 616 398 ------
NM_001237chr41829 2896 137 1319 1329
NM_001237chr41829 2896 137 1319 1329
NM_001239chr51119 ------
NM_001241chr23911 559 130 ------
NM_001241chr23911 559 130 ------
NM_001254chr172426 112 ------
NM_001256chr1721054 82 11095 --12714
NM_001257chr16188 ------
NM_001259chr7156100 5740 5467 5232 5203 4906 4765 4512 2459 2080 1486 1122 750 725 139 11068 55802 2167 1326 765 165 --
NM_001260chr13----1251 --
NM_001261chr91456 147 ----
NM_001270chr51369 ----2260 149
NM_001278chr103816 478 439 21137 139 ----
NM_001280chr192620 249 ------
NM_001282chr1732289 906 404 ------
NM_001284chr53522 72 57 1389 ----
NM_001290chr441064 431 118 67 ------
NM_001299chr191495 ------
NM_001304chr1762798 2547 2442 1524 939 774 13840 --1333
NM_001310chr1252654 1026 860 593 496 194 ----
NM_001313chr41900 ------
NM_001332chr531155 642 365 --1403 --
NM_001343chr541726 1454 1197 153 ------
NM_001346chr332129 1144 680 ------
NM_001351chr311439 1713 ----
NM_001356chrX2869 399 ------
NM_001358chr4----1441 --
NM_001363chrX1689 --1637 1296
NM_001364chr1184548 4062 3806 3237 3134 3093 1869 1633 --12969 --
NM_001386chr842118 1727 1673 907 ------
NM_001390chr1883618 3329 2907 2689 2415 1380 979 444 13022 13163 --
NM_001391chr181432 21209 1036 ----
NM_001396chr2142203 1963 1113 292 22659 2454 ----
NM_001402chr621743 805 --11934 --
NM_001407chr361501 1189 1156 1148 1120 695 11614 11081 --
NM_001408chr131347 1039 419 11543 ----
NM_001412chrX62915 2840 2696 1420 1178 454 23657 728 23326 2479 1247
NM_001417chr12----11737 --
NM_001418chr111186 --3691 569 280 --
NM_001418chr111186 --3691 569 280 --
NM_001420chr1951926 719 638 598 178 ------
NM_001422chr1131358 1154 169 ------
NM_001423chr1231913 1656 165 --11357 --
NM_001427chr742037 1877 1298 435 ------
NM_001429chr221381 ------
NM_001430chr2--21864 391 ----
NM_001431chr62937 182 1817 1296 --
NM_001438chr183449 3309 3025 1330 1210 531 327 189 ------
NM_001448chrX21693 1653 2289 119 ----
NM_001453chr61189 ------
NM_001463chr25780 330 232 163 102 ----1110
NM_001482chr152840 200 3217 184 150 ----
NM_001491chr612579 12252 --11050
NM_001497chr952599 2145 1854 70 49 ------
NM_001498chr61465 --1355 --
NM_001511chr41148 ------
NM_001518chr731101 427 125 --1145 --
NM_001527chr664598 4137 1770 1280 888 776 1268 ----
NM_001530chr141145 --163 --
NM_001542chr152611 1822 528 368 283 --12549 --
NM_001543chr564304 4013 1598 1051 766 196 --11516 13436
NM_001546chr651238 1196 1074 1064 440 1399 ----
NM_001550chr74643 619 49 37 ------
NM_001584chr1131134 990 39 ------
NM_001587chrX21953 541 1576 196 --
NM_001609chr1021315 285 ------
NM_001614chr171648 ------
NM_001614chr171648 ------
NM_001616chr253352 2715 2406 1167 1016 ----11134
NM_001634chr621604 506 3482 423 272 ----
NM_001635chr72976 443 ------
NM_001642chr1131135 886 241 ------
NM_001650chr1841110 1073 356 336 1401 ----
NM_001656chr531993 1353 788 ----11609
NM_001658chr12986 39 --11064 --
NM_001660chr33724 232 149 ------
NM_001663chr1411866 --11045 --
NM_001664chr31407 ------
NM_001674chr1------11073
NM_001677chr151055 818 400 251 197 ------
NM_001681chr121778 ------
NM_001682chr1242846 581 452 396 1780 12878 --
NM_001684chr163885 2924 2568 791 247 53 ------
NM_001693chr84952 895 850 98 ------
NM_001698chr9----1349 --
NM_001699chr19--1370 ----
NM_001701chr921382 222 11217 ----
NM_001702chr81545 ------
NM_001703chr1149 ------
NM_001704chr63614 558 391 ------
NM_001707chr72295 39 --1191 --
NM_001709chr1182846 2326 517 453 402 216 155 50 ------
NM_001718chr61420 1839 11133 --
NM_001730chr1331123 404 227 11104 ----
NM_001730chr1331123 404 227 11104 ----
NM_001731chr121792 ------
NM_001740chr165531 516 480 65 49 ------
NM_001742chr741606 1597 1530 1211 ------
NM_001744chr52477 447 ------
NM_001745chr52111 89 ------
NM_001746chr532922 1825 1122 22792 920 12285 --
NM_001748chr131063 282 111 ------
NM_001750chr511448 ------
NM_001753chr731597 1493 184 ------
NM_001754chr2173871 3650 3371 3105 3037 2701 961 --23927 209 --
NM_001755chr1692298 1945 1893 1793 926 636 613 542 435 12137 1161 --
NM_001759chr1274805 4412 3839 3500 2075 1805 615 --24598 1997 --
NM_001769chr122365 33 ------
NM_001777chr354010 3308 2622 754 494 23678 2633 13091 --
NM_001788chr72318 282 1883 ----
NM_001792chr181733 ----198
NM_001795chr1621539 1500 11366 ----
NM_001797chr162655 568 ------
NM_001799chr5--126 ----
NM_001801chr52121 28 ------
NM_001806chr1932930 2229 426 ------
NM_001812chr4----1305 --
NM_001827chr9----2247 234 --
NM_001829chr43918 646 87 ------
NM_001830chrX74062 4033 3645 2878 1242 342 333 ------
NM_001842chr9182 ------
NM_001845chr131170 1551 --1879
NM_001854chr131299 1239 1080 ------
NM_001855chr9--1111 ----
NM_001858chr654470 4223 1981 1639 240 1426 24142 1474 --
NM_001859chr963901 3869 1574 1164 343 165 43679 3022 1534 627 11077 --
NM_001861chr161122 ------
NM_001880chr21116 ------
NM_001881chr101379 ------
NM_001882chr51444 ------
NM_001891chr41335 ------
NM_001892chr53517 248 119 ------
NM_001893chr172357 49 170 ----
NM_001901chr63984 799 173 ------
NM_001903chr5--1858 ----
NM_001904chr33997 906 55 ------
NM_001914chr182375 342 ------
NM_001918chr1139034 7073 6970 6395 5700 3103 3071 2926 2662 2472 1427 678 164 43370 2258 411 153 49189 1270 1136 1079 1915
NM_001920chr12--2775 486 ----
NM_001923chr112488 477 ------
NM_001924chr1--1473 ----
NM_001931chr1141201 1101 1046 463 11297 ----
NM_001938chr161842 1751 1302 742 150 23 ----1134
NM_001939chrX63848 2919 2499 1400 1387 434 1536 ----
NM_001949chr622129 932 --22677 877 1456
NM_001951chr81145 ------
NM_001957chr422326 417 32237 1999 299 --12206
NM_001964chr531097 472 140 --2975 157 --
NM_001969chr1453835 3507 2805 1190 1161 1133 ----
NM_001977chr431648 538 38 21243 117 ----
NM_001980chr1212184 12294 ----
NM_001981chr14556 509 284 253 ------
NM_001987chr1221606 1119 1415 ----
NM_002006chr4145751 5703 5574 4938 4574 4095 3608 2233 1817 1628 1577 590 405 216 25037 4709 ----
NM_002009chr1552507 2156 917 520 361 ------
NM_002015chr1342729 1144 1138 675 22170 605 1830 --
NM_002017chr11--1940 ----
NM_002025chrX167887 7551 6679 6653 6600 6302 5784 5724 5650 3372 2406 2333 2103 1915 1123 421 ----13043
NM_002026chr25952 904 710 379 224 ------
NM_002031chr61335 ------
NM_002033chr1143818 989 927 62 13784 ----
NM_002035chr1873240 2796 2702 2657 902 614 320 ------
NM_002040chr2173156 3051 2714 2328 403 221 168 12369 12818 --
NM_002051chr101771 ------
NM_002061chr11236 31816 1341 503 11662 --
NM_002069chr721715 1450 ------
NM_002089chr42233 148 --1463 --
NM_002090chr42434 158 ------
NM_002092chr454924 3840 3788 1028 681 ------
NM_002106chr41121 ------
NM_002114chr6----1531 --
NM_002126chr1773767 3137 2905 2837 1661 621 391 2636 285 --11382
NM_002128chr1361888 1742 834 739 602 35 ------
NM_002129chr41387 ------
NM_002130chr51181 ------
NM_002136chr121433 ------
NM_002137chr762254 2193 1610 1569 955 642 ------
NM_002156chr2--1310 1174 --
NM_002158chr243219 2787 694 477 12389 23300 1243 --
NM_002166chr21471 --1533 --
NM_002182chr372773 2268 2003 740 427 281 158 12061 ----
NM_002190chr61430 --1241 --
NM_002202chr51716 1199 ----
NM_002203chr553182 2708 2600 1514 275 1778 ----
NM_002205chr122211 59 ------
NM_002210chr243555 2665 1134 101 1287 1463 --
NM_002211chr1021138 96 1717 11040 --
NM_002214chr755104 4419 4324 1662 240 34932 4870 4456 ----
NM_002228chr1--1885 ----
NM_002229chr192470 173 ------
NM_002233chr11--1392 ----
NM_002246chr22443 383 ------
NM_002247chr1021801 1618 ------
NM_002252chr21311 ------
NM_002264chr374873 4179 3763 3330 3307 3297 573 --24792 1994 --
NM_002267chr1332134 1707 1514 ------
NM_002268chr331703 1433 131 --1730 --
NM_002269chr62400 249 ------
NM_002270chr5125351 5203 4873 3969 2181 1998 1826 1659 1613 1089 995 292 --23748 301 --
NM_002271chr1332124 1574 247 ------
NM_002285chr284176 3072 2688 1446 1324 1296 1248 359 1660 --1598
NM_002310chr545912 5879 2460 1609 26488 4646 21915 450 16042
NM_002312chr132783 300 ------
NM_002314chr71916 ------
NM_002334chr1131939 1923 154 ------
NM_002336chr1243749 1294 1199 732 11695 ----
NM_002350chr841236 324 288 245 ------
NM_002356chr661949 1939 1074 553 134 93 11933 --12770
NM_002374chr253467 3219 1120 250 148 12702 ----
NM_002382chr141447 11317 ----
NM_002387chr594953 4825 4738 3988 3485 3190 1305 905 275 24515 3651 11444 1491
NM_002395chr651460 1117 567 382 112 129 ----
NM_002397chr562073 1841 1731 1515 648 379 --1756 --
NM_002398chr22412 345 11321 ----
NM_002399chr1531279 1233 442 ----11201
NM_002402chr71128 11214 ----
NM_002408chr14295 33 2817 228 1749 --
NM_002416chr431321 277 45 --11523 --
NM_002438chr10----1690 --
NM_002444chrX32008 1407 715 11867 ----
NM_002445chr831439 620 191 133 ----
NM_002448chr41653 ------
NM_002460chr653607 1333 1248 474 467 11462 ----
NM_002466chr20137 ------
NM_002467chr81423 ------
NM_002473chr2271344 1095 1076 911 426 361 186 --1884 --
NM_002478chr111463 ------
NM_002480chr121285 ------
NM_002481chr1127881 7662 7238 6595 6509 5622 5423 5037 3000 1523 1251 546 43079 2162 1555 1383 16930 --
NM_002487chr152735 640 ------
NM_002499chr151721 ------
NM_002500chr23926 217 66 1409 ----
NM_002501chr1933895 3649 1274 --13983 --
NM_002505chr621445 1084 1106 ----
NM_002507chr1721821 1536 ------
NM_002508chr131991 534 51 ------
NM_002509chr201259 ------
NM_002514chr831188 459 296 ------
NM_002515chr1442033 1698 1686 582 ------
NM_002519chr11----11455 --
NM_002522chr1753887 2709 867 328 314 ------
NM_002524chr14780 418 358 166 ------
NM_002526chr671448 1232 1083 647 629 334 241 1269 ----
NM_002544chr172354 322 ------
NM_002545chr11104196 3712 3460 1499 951 903 838 735 616 287 --1255 --
NM_002552chr231301 1258 132 --1292 --
NM_002553chr72310 102 ------
NM_002556chr1141972 1744 1413 644 ------
NM_002568chr81332 ------
NM_002569chr1511516 ------
NM_002570chr1521102 460 --1309 --
NM_002572chr111392 ------
NM_002575chr181108 1128 --1172
NM_002576chr1121228 835 ------
NM_002577chr352968 2727 725 295 101 1399 ----
NM_002581chr954890 1970 927 670 129 --14651 --
NM_002583chr12--1629 1457 --
NM_002594chr2032274 659 180 1633 --1878
NM_002595chr1231847 428 109 --1737 --
NM_002600chr151754 1302 1197 624 389 1572 ----
NM_002601chr21424 --163 --
NM_002605chr151801 --2958 341 --
NM_002610chr262762 2658 2397 2318 2269 533 ------
NM_002612chr741796 1354 438 43 --1528 --
NM_002613chr1615278 14826 ----
NM_002628chr341232 1074 779 367 ------
NM_002629chr101559 ----1306
NM_002635chr122154 32 --1101 --
NM_002641chrX31607 639 385 ------
NM_002645chr1132692 2337 770 --11915 12169
NM_002655chr854104 3889 1775 195 103 11584 ----
NM_002657chr2073482 1342 934 748 661 583 242 ------
NM_002670chr351237 1210 605 344 54 11570 ----
NM_002687chr141145 ------
NM_002707chr21278 ------
NM_002709chr232538 750 520 ------
NM_002715chr53514 446 357 --11066 --
NM_002716chr1183285 2798 2353 994 868 522 386 185 21197 30 11056 --
NM_002727chr102535 189 ------
NM_002731chr152976 2241 2234 1157 1053 ------
NM_002734chr1752166 2018 1935 919 846 --11975 --
NM_002737chr1756155 5102 1701 1508 1358 ----16248
NM_002740chr342818 2791 2730 28 2708 166 ----
NM_002745chr2284463 4450 3580 3501 2951 1518 1451 1234 ------
NM_002748chr1561185 1102 1090 1077 839 85 ------
NM_002753chr4--1697 ----
NM_002760chrY85692 5130 4494 4289 3854 1836 1799 752 13973 ----
NM_002763chr11428 ------
NM_002768chr161462 --11139 --
NM_002811chr161521 ------
NM_002814chrX1214 --1610 --
NM_002815chr172181 97 ------
NM_002819chr191130 ------
NM_002822chr1241719 1328 502 180 ----11393
NM_002825chr71443 ------
NM_002827chr2031784 1325 189 11761 ----
NM_002828chr182998 73 1675 --1956
NM_002834chr1262760 1242 1155 1145 780 524 11492 23920 2559 --
NM_002836chr20--1129 ----
NM_002837chr1244590 3752 2967 1623 14216 ----
NM_002839chr943151 1377 926 412 130 ----
NM_002843chr1142962 1169 1005 509 --1404 --
NM_002844chr621173 50 ------
NM_002847chr711466 188 ----
NM_002849chr1241037 759 714 682 1690 ----
NM_002851chr71190 1555 ----
NM_002852chr31584 ------
NM_002855chr1173674 3379 3170 2591 1485 922 774 --1883 --
NM_002865chr81204 ------
NM_002869chr1111453 21536 157 ----
NM_002874chr932188 1681 704 --32009 757 178 --
NM_002886chr3104837 4382 3599 1755 1373 1039 779 771 637 412 34034 1792 1113 1746 14360
NM_002890chr54965 931 706 152 ------
NM_002892chr143668 240 143 11575 ----
NM_002894chr181209 ------
NM_002897chr2------1697
NM_002902chr152505 59 ------
NM_002906chr1112133 11669 1789 --
NM_002912chr61760 --1301 --
NM_002923chr1------1438
NM_002924chr11561 1213 1195 --
NM_002938chr441627 1569 1408 377 21999 1864 11983 --
NM_002941chr31596 ------
NM_002942chr341216 1078 472 328 ------
NM_002945chr171718 ------
NM_002956chr1251421 1157 1036 537 461 ------
NM_002957chr953572 3495 3331 2468 445 ------
NM_002958chr33786 656 372 ------
NM_002959chr184237 3615 3044 2945 1017 873 432 119 ------
NM_002970chrX135 ------
NM_002971chr331029 769 460 2924 45 ----
NM_002973chr123533 495 48 1408 ----
NM_002977chr243343 839 79 26 32172 393 382 12366 --
NM_002993chr44962 682 218 174 ------
NM_002994chr421628 710 31928 259 237 ----
NM_002995chr13746 307 127 --1204 --
NM_002996chr1631507 640 247 11989 ----
NM_002998chr831812 1726 23 --21913 1520 --
NM_003010chr1782383 2048 1948 1881 1795 876 745 496 ------
NM_003017chr62564 371 ------
NM_003026chr941219 1101 344 260 ------
NM_003030chr311566 ------
NM_003034chr12168114 7968 6214 5592 5457 5118 5037 2492 2143 1584 1554 951 760 601 578 150 57810 7590 3128 2137 1084 15718 --
NM_003036chr131005 260 179 ------
NM_003043chr321407 74 ----145
NM_003046chr865307 4968 4247 3861 1567 663 1315 21999 657 --
NM_003051chr13731 351 63 1568 11559 --
NM_003068chr831072 951 939 --121 --
NM_003069chrX3797 765 586 ------
NM_003070chr91117 --1598 --
NM_003075chr12--1293 ----
NM_003077chr172322 117 --2856 104 --
NM_003079chr1721005 308 --1414 --
NM_003095chr12--1298 ----
NM_003100chr51351 ------
NM_003106chr321071 1000 ------
NM_003108chr2106570 6235 5652 5527 5476 5090 4913 4851 824 486 --36564 5177 780 --
NM_003110chr171882 ----1924
NM_003111chr231049 488 349 ------
NM_003112chr7143 11050 12630 --
NM_003113chr2132 --1755 --
NM_003114chr85804 778 171 132 114 1623 ----
NM_003126chr12437 52 ------
NM_003128chr242001 1138 805 411 ------
NM_003131chr632201 1883 690 ------
NM_003133chr11198 1745 ----
NM_003137chr642210 2161 1555 826 21495 751 ----
NM_003149chr321183 40 11159 ----
NM_003153chr1221148 753 142 ----
NM_003161chr1773549 1137 1131 1122 1112 793 779 13012 11188 12747
NM_003162chr23837 751 107 1758 ----
NM_003170chr171604 ------
NM_003176chr1--2330 256 ----
NM_003176chr1--2330 256 ----
NM_003178chr321467 170 ------
NM_003179chrX2274 156 11292 ----
NM_003185chr2031285 1038 380 --11068 --
NM_003188chr62614 185 ------
NM_003189chr183152 2489 2394 2308 983 723 668 151 --1595 --
NM_003199chr1845292 1717 845 762 14138 13578 11355
NM_003202chr531904 473 49 21511 529 ----
NM_003211chr1241401 709 102 23 ------
NM_003216chr2252960 2360 1038 544 258 12984 12495 --
NM_003217chr123588 255 137 11703 ----
NM_003221chr623932 1255 23626 881 1212 --
NM_003222chr2011074 ------
NM_003236chr21962 13262 1175 --
NM_003242chr331611 935 343 1878 1997 --
NM_003246chr1521851 267 11956 ----
NM_003247chr631675 1274 316 ------
NM_003250chr171339 ------
NM_003253chr2151901 1834 1738 1363 575 11592 11882 --
NM_003255chr1752415 1868 1856 719 137 ------
NM_003257chr15--21293 376 ----
NM_003262chr374973 3732 3480 3284 1971 326 111 53359 2029 1977 1730 1602 11212 --
NM_003269chr61505 ------
NM_003274chr2152699 2573 1972 1901 477 --2975 328 12912
NM_003286chr2011123 ------
NM_003292chr141560 1409 577 229 2413 265 1840 --
NM_003300chr14----1496 --
NM_003302chr71145 ------
NM_003304chr331462 612 559 --1495 --
NM_003309chr63529 91 50 11791 ----
NM_003315chr171241 ------
NM_003318chr62244 229 ------
NM_003336chrX31057 963 87 ------
NM_003337chr531446 1287 493 1609 11075 --
NM_003338chr1031778 453 430 11302 185 --
NM_003339chr521326 127 ------
NM_003340chr41130 ------
NM_003342chr1742697 994 950 914 12276 13226 --
NM_003345chr16158 ------
NM_003350chr82268 44 1762 ----
NM_003371chr932140 785 425 --11596 --
NM_003372chrX----1318 --
NM_003373chr1041783 1292 692 324 21704 39 ----
NM_003376chr61403 ------
NM_003376chr61403 ------
NM_003383chr91193 ------
NM_003390chr111112 ------
NM_003392chr363014 2947 2937 2911 1144 417 14357 11506 --
NM_003400chr23881 827 247 ------
NM_003403chr14--1176 ----
NM_003406chr891922 1753 1719 1635 1457 566 121 91 23 ------
NM_003407chr19----2667 558 --
NM_003410chrX2497 186 1439 23047 603 --
NM_003411chrY51856 1241 651 606 422 2401 276 ----
NM_003418chr31118 ------
NM_003430chr191483 1253 ----
NM_003432chr52521 31 ------
NM_003439chr743154 2624 688 626 12359 ----
NM_003442chr112790 283 ------
NM_003453chr13----189 --
NM_003463chr683099 2962 2849 2502 2241 942 507 299 11021 ----
NM_003468chr234130 202 86 11471 14316 --
NM_003469chr23460 448 330 --1150 --
NM_003470chr1651653 1415 1264 603 166 --1704 --
NM_003471chr351527 1446 667 575 201 1883 1147 1718
NM_003472chr621239 987 ------
NM_003478chr1133204 2863 1218 ----2859 839
NM_003482chr1212443 ------
NM_003483chr1242836 791 744 704 ------
NM_003489chr2153323 3298 2633 1359 1167 32402 1032 732 13440 --
NM_003506chr841211 328 288 273 ------
NM_003507chr242019 1985 429 113 ------
NM_003557chr141586 1352 1199 95 11450 ----
NM_003558chr91502 ----1553
NM_003559chr1773208 2527 2488 2442 2434 984 227 --13902 --
NM_003566chr1242635 1125 1118 169 1552 1687 13279
NM_003567chr1--1288 ----
NM_003569chr62685 466 --1669 --
NM_003574chr1844911 1670 1649 65 ------
NM_003576chr131893 12876 22480 562 --
NM_003580chr8139 1379 1528 --
NM_003581chr21888 ------
NM_003583chr1241251 1241 787 107 13577 ----
NM_003586chr162607 79 --1147 --
NM_003589chr1311367 ------
NM_003590chr242895 923 266 144 23062 101 12955 --
NM_003592chr7--1485 ----
NM_003595chr222524 403 ------
NM_003597chr241425 815 328 298 ------
NM_003603chr431974 1740 499 ------
NM_003607chr153419 3354 3071 1569 1473 34255 3897 519 13513 --
NM_003615chr373934 3926 2955 2603 939 479 434 --24035 287 --
NM_003618chr21976 ------
NM_003620chr17--1328 ----
NM_003622chr1251850 911 221 119 47 --197 --
NM_003626chr1141249 1238 1127 851 11285 11333 --
NM_003628chr22710 196 ------
NM_003629chr163279 3238 3130 3038 1373 403 --12180 12439
NM_003630chr6139 --1676 --
NM_003631chr1031015 231 221 ------
NM_003633chr53613 140 72 12091 1547 --
NM_003646chr111568 ------
NM_003651chr12----1163 --
NM_003659chr21769 ------
NM_003663chr373307 3147 2440 986 909 817 534 23339 1317 1977 --
NM_003672chr131943 1871 1268 ----11326
NM_003685chr193773 717 360 ------
NM_003690chr22627 520 --1472 --
NM_003692chr91369 ------
NM_003713chr131245 1134 452 1144 ----
NM_003714chr572669 2641 2543 2414 2326 2160 876 13043 12391 --
NM_003716chr32208 200 --123 --
NM_003722chr331056 472 451 12550 --11064
NM_003728chr41175 --1469 --
NM_003743chr241664 1467 791 254 ------
NM_003744chr1431334 1265 330 ------
NM_003746chr121214 ------
NM_003749chr1362074 1685 909 887 617 426 ------
NM_003758chr1511563 11021 ----
NM_003758chr1511563 11021 ----
NM_003759chr464233 3076 2982 2707 693 275 1438 13265 --
NM_003762chr11229 1919 ----
NM_003763chr2083159 2797 2610 2561 1192 931 728 309 12951 ----
NM_003764chr62757 548 ------
NM_003766chr173529 387 104 ------
NM_003778chr33776 749 741 1681 ----
NM_003779chr11366 ------
NM_003784chr182710 473 ------
NM_003787chr1831393 535 275 ------
NM_003794chr33875 757 390 1348 ----
NM_003797chr113186 152 143 ------
NM_003799chr1883385 3058 2996 2915 1521 1288 346 224 11181 ----
NM_003800chr622339 818 11649 ----
NM_003816chr81953 21118 961 ----
NM_003822chr132881 1947 24 2831 649 11228 --
NM_003828chrX----1517 --
NM_003842chr85981 771 707 639 40 ------
NM_003846chr15622 557 295 258 89 ------
NM_003858chr141606 ------
NM_003861chr1462857 2714 2461 2070 1807 428 ----11148
NM_003862chr51104 ------
NM_003864chr41182 --147 --
NM_003870chr1542043 1765 1507 1341 ------
NM_003872chr252969 2011 555 288 245 ------
NM_003873chr1052318 942 800 737 569 ------
NM_003876chr17----1307 --
NM_003877chr122974 899 ------
NM_003884chr311594 1226 2665 407 --
NM_003887chr221992 1845 --32298 1680 930 --
NM_003888chr1551723 1486 1462 1259 52 ------
NM_003896chr23722 321 314 1809 ----
NM_003913chr633558 1211 775 21563 866 11162 --
NM_003927chr181286 2691 177 ----
NM_003930chr742526 711 36 29 1829 --1317
NM_003934chr91466 --11027 --
NM_003938chr191189 ------
NM_003939chr1052984 2691 1388 662 172 --33193 698 194 --
NM_003941chr752212 1717 1697 320 221 ------
NM_003947chr331133 361 210 1435 ----
NM_003953chr151964 829 505 423 171 --11808 --
NM_003958chr663881 3747 2678 1565 776 712 13833 23354 403 --
NM_003968chr3----1577 --
NM_003971chr17----1244 --
NM_003983chr1683227 2971 1173 874 728 687 286 250 13313 24033 3053 12923
NM_003994chr1254066 2921 772 245 184 14246 --13900
NM_003998chr41675 ------
NM_004006chrX72659 2591 1715 896 690 272 163 ------
NM_004007chrX72659 2591 1715 896 690 272 163 ------
NM_004009chrX72659 2591 1715 896 690 272 163 ------
NM_004010chrX72659 2591 1715 896 690 272 163 ------
NM_004011chrX72659 2591 1715 896 690 272 163 ------
NM_004012chrX72659 2591 1715 896 690 272 163 ------
NM_004013chrX72659 2591 1715 896 690 272 163 ------
NM_004014chrX72659 2591 1715 896 690 272 163 ------
NM_004015chrX72659 2591 1715 896 690 272 163 ------
NM_004016chrX72573 2505 1629 810 604 186 77 ------
NM_004017chrX72659 2591 1715 896 690 272 163 ------
NM_004018chrX72573 2505 1629 810 604 186 77 ------
NM_004019chrX3402 294 100 ------
NM_004020chrX72659 2591 1715 896 690 272 163 ------
NM_004021chrX72573 2505 1629 810 604 186 77 ------
NM_004022chrX72573 2505 1629 810 604 186 77 ------
NM_004023chrX72573 2505 1629 810 604 186 77 ------
NM_004028chr1841110 1073 356 336 1401 ----
NM_004035chr1764199 1822 1459 1025 525 28 14211 11060 --
NM_004040chr221314 954 11244 1128 --
NM_004050chr1422594 676 ------
NM_004055chr1142257 900 334 302 --11803 --
NM_004056chr82860 774 ------
NM_004074chr111214 ------
NM_004081chrY11465 11196 ----
NM_004085chrX2796 242 ------
NM_004086chr142724 633 ------
NM_004090chr1772675 2569 2498 2305 721 122 21 ------
NM_004093chr1353180 2782 2776 2179 695 --11100 --
NM_004094chr1452916 2594 2484 2074 674 --11066 --
NM_004098chr1021138 1050 ------
NM_004100chr672195 1861 1783 1656 1014 962 510 ------
NM_004103chr82843 726 ------
NM_004105chr211057 ------
NM_004109chr1132069 1901 309 1117 ----
NM_004124chr1432675 2164 964 13519 --12617
NM_004136chr1533125 2133 1139 11044 --23158 2371
NM_004145chr192308 23 1383 ----
NM_004161chr2----11634 --
NM_004162chr321230 36 ------
NM_004163chr183491 404 132 ------
NM_004170chr931349 404 391 21362 228 ----
NM_004171chr11129010 8948 7974 7631 7052 6705 3798 3481 3436 2769 1690 998 21442 453 1115 --
NM_004172chr511803 ------
NM_004180chr22610 259 1145 ----
NM_004185chr11113 1506 ----
NM_004193chr10--1411 ----
NM_004202chrY369 60 26 ------
NM_004209chr1611085 ------
NM_004210chr10--1120 ----
NM_004215chr82595 524 ------
NM_004225chr841379 1277 1206 933 ------
NM_004226chr21250 ------
NM_004229chrX21716 894 ------
NM_004232chr1873883 3714 2926 2631 2460 1234 63 23182 2776 1687 --
NM_004235chr9156 --2791 624 --
NM_004242chr62439 290 1105 1432 --
NM_004244chr121430 ------
NM_004251chrX1180 1102 ----
NM_004267chr31357 1112 ----
NM_004272chr531738 1438 376 --21324 673 --
NM_004274chr1432977 2669 2561 33222 1031 666 ----
NM_004279chr74757 672 315 252 1728 ----
NM_004280chr6--131 ----
NM_004290chr52982 882 --1470 --
NM_004293chr933878 2813 1090 ----11009
NM_004302chr1242940 2328 2258 194 ------
NM_004313chr17--1454 ----
NM_004316chr12--11089 ----
NM_004321chr22673 385 --13224 --
NM_004326chr12830 335 --1493 --
NM_004329chr1021358 558 ------
NM_004331chr852656 2621 2356 2245 366 32507 1946 180 1235 --
NM_004338chr1867037 6591 5178 4490 2202 1949 26766 897 ----
NM_004342chr731817 1695 257 193 12113 12353
NM_004349chr8----1955 --
NM_004354chr42845 126 1723 1525 --
NM_004356chr111129 1112 ----
NM_004359chr19129 ------
NM_004370chr61331 1172 ----
NM_004379chr221271 243 11627 1285 --
NM_004384chr531914 1529 48 ------
NM_004385chr51254 ------
NM_004392chr1312032 --22627 2459 --
NM_004393chr341532 512 506 404 ------
NM_004397chr1163748 3407 2885 1436 1279 814 --14262 --
NM_004414chr2131445 395 56 ------
NM_004417chr51663 --1417 --
NM_004423chr342603 2254 668 80 32666 1817 425 ----
NM_004426chr1241398 711 594 206 11520 ----
NM_004430chr842331 1805 1097 608 ------
NM_004432chr95696 661 486 435 248 ------
NM_004433chr121319 518 ------
NM_004434chr1441656 1206 606 246 11842 11771 --
NM_004438chr243171 929 83 41 1835 ----
NM_004440chr611666 ------
NM_004441chr311341 ------
NM_004448chr172485 67 ------
NM_004450chr141295 ------
NM_004451chr111693 ------
NM_004454chr362193 1936 1853 1731 1612 1488 ------
NM_004457chr21411 ------
NM_004458chrX--12213 1165 --
NM_004459chr1721794 752 21432 231 1340 --
NM_004472chr53620 503 195 ------
NM_004481chr142308 2178 506 484 ------
NM_004482chr21247 ------
NM_004484chrX186 ------
NM_004497chr191666 ----1119
NM_004499chr52417 98 ------
NM_004500chr14----21899 715 --
NM_004501chr143506 1167 1064 344 ------
NM_004504chr232968 564 518 ------
NM_004505chr172584 324 11720 ----
NM_004514chr1732859 929 486 --32652 2636 1056 --
NM_004520chr54572 279 247 164 ------
NM_004521chr104306 282 248 91 ------
NM_004523chr1031358 1169 1148 ------
NM_004529chr921008 407 11466 ----
NM_004537chr123522 51 43 --1493 --
NM_004538chrX2647 145 ------
NM_004540chr211310 ------
NM_004563chr141158 ------
NM_004575chr411391 11536 ----
NM_004576chr5----2433 322 --
NM_004586chrX65314 5119 4855 4728 3658 2180 33704 1598 537 ----
NM_004593chr32305 273 ------
NM_004598chr573354 3346 1183 1172 1035 1003 923 ------
NM_004600chr131354 953 179 2554 185 ----
NM_004612chr994601 4519 3102 1562 811 396 310 239 44 ------
NM_004615chrX1170 1780 ----
NM_004631chr1----11442 11138
NM_004637chr341302 1232 376 251 11045 ----
NM_004641chr1021551 658 2666 124 ----
NM_004643chr141526 ------
NM_004654chrY1448 ------
NM_004655chr1711303 ------
NM_004660chrY1508 22336 398 ----
NM_004663chr1521509 1055 --1257 --
NM_004667chr151448 ----1262
NM_004670chr1071654 1300 1277 1076 265 134 53 ------
NM_004673chr1--11132 ----
NM_004685chr1331962 1211 238 --11005 --
NM_004687chr1761789 1695 823 685 484 185 --11898 --
NM_004690chr62644 311 ------
NM_004694chr172594 96 1635 ----
NM_004705chr112598 308 ------
NM_004713chr142756 186 --1652 --
NM_004714chr191228 ------
NM_004715chr181661 1180 1194 --
NM_004717chr731568 1373 392 --1981 --
NM_004719chr1231921 661 165 2886 256 12847 --
NM_004721chr31242 ------
NM_004726chrX105561 4915 4313 2298 1662 1598 815 625 168 40 11352 25425 765 --
NM_004730chr531471 274 268 21948 1749 1692 --
NM_004734chr1352962 927 519 270 122 ------
NM_004736chr141960 285 225 206 ------
NM_004737chr2231273 1236 906 ------
NM_004744chr4103896 3767 3759 2753 1207 929 673 505 396 385 22437 1004 ----
NM_004745chr8126528 5934 5721 5455 4422 2210 2112 1750 1088 508 349 196 --16830 --
NM_004747chr102321 97 11252 1357 --
NM_004748chr1544005 2747 653 360 --23081 2894 13450
NM_004759chr171570 1554 1341 572 423 362 294 22174 1422 1152 --
NM_004760chr71967 12162 12261 1411
NM_004762chr174448 324 286 26 --11819 --
NM_004768chr13948 797 461 1238 ----
NM_004770chr8--1250 ----
NM_004772chr541538 1202 1074 230 ------
NM_004775chr1821726 135 12031 ----
NM_004776chr2033293 894 84 ------
NM_004779chr53908 892 144 ------
NM_004781chr151530 1105 674 568 485 ------
NM_004781chr151530 1105 674 568 485 ------
NM_004788chr1112268 2466 129 12529 1951
NM_004791chr131123 --1697 --
NM_004796chr1432267 1885 1581 31981 1592 350 ----
NM_004798chr2053365 3103 2874 797 637 ------
NM_004799chr11322 ------
NM_004801chr22246 75 ------
NM_004808chr1062869 2839 2107 1045 458 198 23022 829 ----
NM_004815chr174905 4278 4241 3896 3342 3230 565 11204 13786 --
NM_004816chr92589 248 --2644 141 --
NM_004820chr82123 64 ------
NM_004831chr19------1208
NM_004834chr243134 3095 2717 909 13303 23374 1149 --
NM_004841chr13814 723 83 --1916 --
NM_004842chr631443 1295 55 --11704 --
NM_004845chrX34063 2821 312 1133 ----
NM_004849chr63685 531 189 11322 1543 --
NM_004857chr1473949 3751 3652 3458 3261 2919 749 --14041 13718
NM_004859chr1712243 ----1758
NM_004862chr1621085 1076 ------
NM_004863chr1473966 2051 1266 1198 1190 1033 277 24773 1631 --15275
NM_004867chrX3697 106 94 ------
NM_004869chr1821453 458 1352 162 --
NM_004871chr1743840 3272 1763 1114 ------
NM_004874chr81507 ------
NM_004879chr112805 626 --1827 --
NM_004893chr51405 ------
NM_004896chr1011345 11305 ----
NM_004897chr103645 247 216 1913 ----
NM_004898chr421960 703 --12512 --
NM_004902chr201101 ------
NM_004904chr785236 4650 4122 2585 1986 1737 1503 1083 56014 5397 4043 2248 645 26339 5486 --
NM_004912chr731732 1682 1406 ------
NM_004923chr112682 259 1705 1137 --
NM_004926chr1431775 729 356 ------
NM_004929chr831045 545 213 --1565 --
NM_004932chr5--21407 318 ----
NM_004938chr921196 230 ------
NM_004945chr19--1823 ----
NM_004947chr322498 145 ------
NM_004948chr18--21308 287 --11020
NM_004956chr7103895 3401 3380 3105 1686 1111 1057 489 271 159 34143 3130 1153 13064 13772
NM_004964chr1178 ------
NM_004969chr101447 ------
NM_004972chr93754 728 139 ------
NM_004973chr6----11722 --
NM_004985chr1244252 3514 930 429 ------
NM_004992chrX138057 7779 7617 7080 6998 6614 3065 2534 2059 1804 1570 1435 421 16229 25658 640 --
NM_004992chrX138057 7779 7617 7080 6998 6614 3065 2534 2059 1804 1570 1435 421 16229 25658 640 --
NM_005010chr741681 1669 678 109 ------
NM_005021chr62100 32 ------
NM_005022chr17--1244 ----
NM_005023chr521120 350 ------
NM_005026chr141753 1604 554 133 ------
NM_005028chr1052092 2069 1954 1692 122 ------
NM_005032chrX1250 ------
NM_005037chr32169 130 ------
NM_005045chr71678 1771 ----
NM_005054chr231527 1493 81 21774 61 ----
NM_005056chr1255611 5159 1487 1391 1010 --31236 803 496 --
NM_005057chr111770 11412 ----
NM_005063chr1033621 963 798 23822 2377 22801 2604 --
NM_005065chr1475025 3452 2148 1558 933 685 50 --1293 --
NM_005066chr13720 305 226 ------
NM_005068chr6--21376 79 ----
NM_005069chr2121714 1100 ------
NM_005079chr853191 2087 1180 1052 175 122 12564 --
NM_005086chr121171 11476 ----
NM_005087chr3122 ------
NM_005088chrX1754 --1353 --
NM_005093chr2075354 5256 4209 3432 3302 3241 180 11125 ----
NM_005095chr121923 1753 ------
NM_005096chrX2887 443 ------
NM_005097chr101343 ------
NM_005104chr61168 ------
NM_005109chr332552 1859 64 ------
NM_005113chr141433 --1393 --
NM_005114chr43554 493 173 ------
NM_005116chr2054028 3118 1155 884 146 ------
NM_005119chr111246 1860 ----
NM_005121chr1721304 186 11104 12701 --
NM_005124chr61329 1940 ----
NM_005126chr341729 1640 1541 477 --1515 --
NM_005135chr1563814 3396 2703 1470 802 578 11123 ----
NM_005151chr1832368 1776 1654 --1356 --
NM_005156chr994788 4775 3462 3442 3293 1683 1036 909 882 13849 ----
NM_005160chr22116519 5637 5559 5377 2336 2030 1791 1531 1343 176 86 26478 1575 14790 --
NM_005164chr1232581 1024 815 22447 286 ----
NM_005168chr221277 356 ------
NM_005171chr121834 ------
NM_005180chr1041545 1484 1464 630 11223 ----
NM_005188chr1167133 5322 1005 587 498 380 18251 ----
NM_005189chr1742524 2496 2331 2262 ------
NM_005194chr201504 ------
NM_005197chr1425185 993 1760 --15813
NM_005201chr331019 953 885 --1370 --
NM_005203chr101174 ------
NM_005222chr72832 180 1850 ----
NM_005224chr192627 471 --1448 --
NM_005229chrX41226 1095 835 447 ------
NM_005230chr122543 67 ------
NM_005233chr332206 2100 672 1488 12494 --
NM_005235chr286979 6943 6903 6294 4751 2697 1055 729 11861 --11976
NM_005238chr1133080 869 89 ------
NM_005239chr2122034 205 ----11597
NM_005244chr202703 476 ------
NM_005249chr141285 ----1882
NM_005254chr1541349 1079 168 29 ------
NM_005257chr1831070 937 888 1977 161 --
NM_005259chr221428 1003 11335 21251 340 --
NM_005261chr83885 686 273 ------
NM_005264chr102916 375 1851 ----
NM_005271chr1021254 68 ------
NM_005274chr11130 ------
NM_005277chr4--1254 ----
NM_005296chrX2314 220 ------
NM_005308chr102362 350 ------
NM_005311chr7----1374 --
NM_005316chr111119 --1307 --
NM_005327chr4--1707 ----
NM_005328chr81558 ------
NM_005329chr1641987 1883 798 428 --1246 --
NM_005339chr4104079 3979 3571 3549 3502 3309 3068 2802 983 443 --44124 4034 4023 3847 --
NM_005342chrX32291 596 168 1868 ----
NM_005359chr18106420 5382 5362 2393 1982 1713 1577 1424 503 98 44230 2499 1528 1398 11629 --
NM_005378chr21161 1724 194 --
NM_005381chr2158 ------
NM_005382chr82355 114 ------
NM_005385chr362445 2012 1939 1839 739 84 --32470 974 300 --
NM_005386chr20--1685 ----
NM_005387chr112264 161 ------
NM_005388chr92538 429 --1229 11095
NM_005392chr941306 547 332 27 11400 ----
NM_005397chr743937 3853 2531 948 --33798 1481 774 --
NM_005398chr1011414 11276 ----
NM_005400chr242540 2253 1103 330 1382 1131 --
NM_005402chr73531 391 160 ------
NM_005406chr1811525 ------
NM_005410chr52262 127 1560 ----
NM_005415chr23762 522 270 ------
NM_005429chr4--136 ----
NM_005430chr121969 ------
NM_005433chr1832123 1949 95 ------
NM_005436chr1094082 3984 3703 3650 820 728 435 218 180 --155 --
NM_005450chr171235 ------
NM_005455chr161733 1607 1570 1414 714 671 1204 21342 610 --
NM_005460chr51523 ------
NM_005465chr1--12002 ----
NM_005471chr531308 280 242 11327 ----
NM_005474chr1711298 159 ----
NM_005475chr1243029 902 506 216 1153 2733 464 --
NM_005476chr931214 921 309 1522 ----
NM_005493chr63856 142 68 ------
NM_005494chr71149 ------
NM_005499chr192518 120 ------
NM_005502chr973308 3109 2986 2555 752 578 568 32910 2188 270 --1920
NM_005504chr1265591 5118 4993 2602 2124 347 65710 4567 4387 4380 4136 4028 15740 --
NM_005509chr51555 11763 ----
NM_005513chr31232 ----1621
NM_005517chr121173 99 ------
NM_005520chr5------1524
NM_005522chr721090 457 ------
NM_005523chr721179 357 ------
NM_005539chr1021188 198 ------
NM_005540chr1124 ------
NM_005542chr751944 1248 783 588 98 ------
NM_005544chr231021 378 259 --2345 161 --
NM_005550chr162637 546 ------
NM_005558chr141022 666 412 317 ------
NM_005562chr1--11527 ----
NM_005563chr13786 252 192 ------
NM_005575chr52312 260 ------
NM_005578chr354190 3721 1762 1498 375 1111 11082 --
NM_005589chr14--1451 ----
NM_005593chr12--1613 ----
NM_005595chr11857 ------
NM_005596chr955656 4883 4727 1242 480 11777 ----
NM_005598chr131240 1232 309 1286 ----
NM_005603chr1811765 1616 144 --
NM_005604chr652165 1593 846 766 547 --12288 12193
NM_005618chr62605 536 ------
NM_005625chr82259 233 1677 11077 --
NM_005627chr61680 ------
NM_005637chr181213 2638 35 ----
NM_005638chrX1273 1338 11728 --
NM_005639chr1261557 1257 533 449 377 207 ------
NM_005647chrX93483 3306 2824 2751 2370 694 530 147 72 --13123 --
NM_005655chr821327 322 ------
NM_005656chr21178 ------
NM_005664chr151434 --3287 127 31 150
NM_005665chr184794 4700 4614 4401 1612 1348 832 441 34660 4298 1415 14916 --
NM_005668chr554448 4201 4107 3054 260 13251 ----
NM_005669chr552292 385 324 168 162 1860 1883 1592
NM_005684chr1194 ------
NM_005686chr141554 1413 431 302 ------
NM_005711chr51929 --1703 --
NM_005713chr5--198 ----
NM_005721chr21853 ------
NM_005722chr232007 690 300 12082 1238 --
NM_005733chr51194 ------
NM_005737chr242866 2161 2048 907 ------
NM_005738chr781915 1816 1743 1251 603 324 93 73 11337 ----
NM_005746chr732303 2186 827 12785 12719 --
NM_005748chr1253376 2395 1167 1063 611 2573 321 --1670
NM_005751chr71392 ------
NM_005754chr531172 807 129 ------
NM_005759chr244017 3744 1459 966 13620 14299 --
NM_005760chr2134 ------
NM_005762chr191132 ------
NM_005765chrX2847 819 ------
NM_005767chr131341 ------
NM_005768chr122563 136 1588 ----
NM_005779chr571468 1261 1209 980 945 364 184 ------
NM_005783chr25635 229 150 80 40 172 ----
NM_005785chr1231934 581 222 ------
NM_005786chr1811103 ------
NM_005788chr112792 201 1723 ----
NM_005789chr1731379 200 168 ------
NM_005796chr161279 ------
NM_005802chr9--1521 277 67 --
NM_005807chr13698 687 185 1485 ----
NM_005810chr121912 ------
NM_005813chr262672 2370 2093 1707 921 797 22105 647 ----
NM_005822chr611545 ------
NM_005826chr11661 ------
NM_005828chr1794977 4364 3973 3839 1931 1800 1515 784 526 24564 4436 21040 334 --
NM_005832chr321168 1054 ----1395
NM_005838chr11121 --1335 --
NM_005840chrX137090 6243 5986 5955 3011 2822 2766 2451 2177 1629 1589 558 376 36209 1364 756 36816 2357 552 --
NM_005841chr4--11062 ----
NM_005859chr5----11086 --
NM_005862chr31790 136 21064 1014 --
NM_005866chr9182 1886 ----
NM_005868chr722340 261 1710 12103 --
NM_005870chr1321311 126 11449 ----
NM_005880chr161118 ----11425
NM_005882chr41963 ------
NM_005888chr122154 32 --1101 --
NM_005896chr24739 145 58 50 ------
NM_005898chr1132303 195 84 1166 11964 --
NM_005900chr441196 971 227 211 ----1314
NM_005901chr1888725 8544 8053 5995 2782 1876 1662 1089 16280 48521 8031 2706 2194 188
NM_005903chr595233 4359 3737 3649 1979 1018 821 720 280 15165 15056 --
NM_005906chr64540 156 92 75 --186 --
NM_005909chr554122 3820 549 516 250 21190 296 ----
NM_005911chr221426 1372 1465 ----
NM_005920chr153499 2745 1447 1379 1180 ----13888
NM_005923chr64684 551 520 182 --1124 --
NM_005924chr72159 73 1783 ----
NM_005930chr141325 1735 ----
NM_005935chr494024 3767 3568 3560 1060 989 870 771 300 11087 ----
NM_005938chrX161 ----11226
NM_005941chr863597 3132 3078 2990 2682 206 --14043 --
NM_005944chr351110 1096 945 198 150 --141 --
NM_005955chr1125024 4858 4751 4687 4462 4349 4159 3934 1312 1167 880 104 15483 ----
NM_005964chr171243 11350 11531 --
NM_005966chr241886 1536 645 389 --1408 --
NM_005977chr132896 682 ------
NM_005996chr1221144 559 11379 ----
NM_005999chr121229 317 ------
NM_006007chr954166 1325 809 759 703 --1426 --
NM_006015chr12313 106 ------
NM_006016chr672256 2059 2021 1709 1619 1580 695 ------
NM_006031chr21137 ------
NM_006033chr1822317 824 12158 1624 --
NM_006037chr274293 3529 3398 3227 3050 1765 556 ----14398
NM_006041chr17282 42 ------
NM_006047chr2043399 3211 2907 153 ----11137
NM_006060chr753817 3675 3388 1256 460 ------
NM_006068chr42276 40 ------
NM_006070chr3--1337 ----
NM_006079chr62840 282 ------
NM_006080chr742909 958 455 110 31042 595 403 ----
NM_006086chr162277 236 ------
NM_006089chrX21874 304 11206 1217 --
NM_006090chr11698 ------
NM_006091chr15148 11522 11285 --
NM_006094chr812283 11635 ----
NM_006095chr453664 1771 1761 1468 1202 12947 1598 172
NM_006099chr11868 ------
NM_006106chr1172853 1329 1101 913 539 447 143 ------
NM_006108chr1121753 962 12116 ----
NM_006133chr111525 ------
NM_006135chr151313 1191 968 424 309 ------
NM_006136chr721055 457 1308 ----
NM_006141chr1632363 2145 2069 2890 58 1827 --
NM_006143chr12----1137 --
NM_006154chr1552956 2593 966 948 31 3903 674 472 1627 11124
NM_006158chr851682 1251 675 643 287 11392 ----
NM_006159chr123573 213 206 ------
NM_006166chr1241726 1691 647 613 ------
NM_006167chr832234 1969 1805 ------
NM_006180chr92537 499 ------
NM_006187chr1283245 3229 884 753 671 634 575 171 --13057 --
NM_006195chr91104 ------
NM_006206chr442872 2567 2483 1842 ------
NM_006207chr8--1289 ----
NM_006226chr21322 ------
NM_006232chr32279 236 ------
NM_006237chr1331428 681 71 --22103 1933 --
NM_006241chr332412 2224 574 --1660 --
NM_006243chr121076 946 --1347 --
NM_006244chr11----2585 404 --
NM_006252chr187148 2969 2137 1568 1114 812 198 176 36026 4977 2491 25629 381 --
NM_006256chr132564 2339 720 --42065 1916 902 289 --
NM_006258chr1031528 1290 267 1458 ----
NM_006264chr4----1445 1468
NM_006267chr221879 1443 1702 ----
NM_006275chr2042387 974 572 332 ------
NM_006283chr884997 4750 1897 998 974 887 871 317 --21985 816 --
NM_006287chr251727 1720 849 487 71 32096 507 33 12314 1952
NM_006294chr83447 173 95 --1112 --
NM_006305chr151204 ------
NM_006306chrX74388 1975 1878 1767 1366 1151 586 ------
NM_006307chrX2321 41 --1117 --
NM_006310chr173310 172 31 1902 ----
NM_006312chr123768 671 230 ------
NM_006313chr1231688 1666 637 ------
NM_006315chr483838 2752 1782 1747 1502 776 316 178 ------
NM_006321chr362220 1413 857 735 497 428 ------
NM_006322chr131597 1618 ----
NM_006330chr841366 1090 632 404 21520 219 11044 --
NM_006334chr9--1103 ----
NM_006335chr11146 ------
NM_006346chr131196 ----1522
NM_006350chr51333 ------
NM_006352chr121523 502 ------
NM_006353chr651410 1047 953 531 42 ------
NM_006357chr22391 113 ------
NM_006359chrX12079 --11901 --
NM_006364chr1441058 997 884 282 --11040 --
NM_006371chr343561 1947 318 105 11501 ----
NM_006373chr1731384 1266 1161 11012 ----
NM_006379chr742149 2043 1969 1846 ------
NM_006386chr2232313 2120 1670 1881 ----
NM_006390chr1251493 1434 553 484 149 ------
NM_006391chr11189 ------
NM_006393chr1063666 2983 2934 1433 662 599 22903 556 11499 24325 1680
NM_006400chr12--183 ----
NM_006401chr91337 ------
NM_006403chr6186 ------
NM_006408chr72983 295 ------
NM_006410chr112402 352 2489 106 ----
NM_006420chr2033167 1233 720 --1228 --
NM_006421chr831032 960 41 ------
NM_006424chr441960 1585 554 216 ------
NM_006427chr141126 ------
NM_006439chr41467 165 ----
NM_006451chr551044 807 705 319 231 3853 778 765 --11016
NM_006459chr1031865 548 349 12034 ----
NM_006467chr531950 1806 155 ------
NM_006469chr121603 230 ------
NM_006482chr1241251 1241 787 107 13577 ----
NM_006483chr191228 ------
NM_006484chr191228 ------
NM_006489chr1442033 1698 1686 582 ------
NM_006495chr171129 1195 ----
NM_006496chr131631 1599 1502 1395 ----
NM_006504chr1032939 644 624 1229 ----
NM_006517chrX32152 633 603 --21517 570 --
NM_006520chrX11694 11271 1552 183
NM_006526chr2051833 804 583 261 70 1498 ----
NM_006534chr2063450 3312 2678 2599 2481 210 1514 ----
NM_006538chr274132 3802 3281 3141 2878 2611 294 --13831 --
NM_006540chr821462 997 1117 180 --
NM_006542chr1----134 --
NM_006544chr14106047 6025 5953 5383 4552 3908 3789 1710 1039 665 11928 14911 1692
NM_006546chr1746471 5885 5115 211 --1914 --
NM_006547chr751987 1981 1922 714 556 ------
NM_006549chr1222797 1993 12851 ----
NM_006561chr1065985 5204 4845 4292 2327 2080 25860 1653 35075 4684 865 24474 2426
NM_006565chr1611267 --1228 --
NM_006572chr1762820 698 620 305 238 82 ------
NM_006574chr31244 --182 --
NM_006575chr1431351 941 178 ------
NM_006595chr1141855 394 269 53 1112 ----
NM_006599chr16158231 7920 7660 7469 7193 6603 6106 5995 5640 5498 5116 1659 888 239 132 27015 683 27835 368 --
NM_006601chr122939 852 ------
NM_006602chr203833 701 83 ------
NM_006603chrX51825 1357 404 390 361 11972 ----
NM_006609chr272664 2316 968 902 698 548 44 12275 12060 --
NM_006614chr353690 3335 2978 1226 807 2533 317 12570 --
NM_006621chr12655 238 11842 ----
NM_006624chr102681 469 ------
NM_006625chr11449 --1966 --
NM_006625chr11449 --1966 --
NM_006625chr11449 --1966 --
NM_006626chr942710 2610 797 775 22245 44 --12117
NM_006628chr15134698 4608 3859 3073 3032 1706 1670 1237 1092 868 552 373 67 34336 3121 29 11720 --
NM_006629chr1832507 967 605 12418 1213 --
NM_006636chr2193 ------
NM_006646chr1352108 574 527 258 164 12734 1301 --
NM_006654chr1244162 1299 1288 645 33090 1786 1559 11065 --
NM_006658chr73785 200 83 1854 ----
NM_006667chrX2781 25 ------
NM_006670chr61534 ------
NM_006675chr1273341 2431 2391 1002 593 523 443 ------
NM_006699chr142499 2182 1716 42 11870 1620 --
NM_006700chr121757 ------
NM_006706chr5131 ------
NM_006710chr231030 1014 913 ------
NM_006716chr731187 1167 104 ------
NM_006717chr922651 2347 --1220 --
NM_006722chr33910 816 184 1884 12133 --
NM_006726chr421077 976 1884 1250 --
NM_006727chr51123 1503 ----
NM_006729chrX85204 4081 3686 3417 1444 913 762 595 24280 847 --11303
NM_006732chr191561 11573 ----
NM_006734chr651245 561 491 322 255 ------
NM_006738chr1584401 4288 3917 3415 811 479 440 198 --13499 --
NM_006745chr421003 165 ------
NM_006746chrX31528 1278 264 1528 1164 --
NM_006749chr821146 278 ------
NM_006750chr1687550 6698 5459 4882 676 499 277 176 15850 13041 --
NM_006751chr21279 ------
NM_006754chr71290 ----1220
NM_006756chr831403 1222 450 ------
NM_006759chr2--190 ----
NM_006761chr172623 210 ------
NM_006775chr6--33045 2112 937 12674 --
NM_006777chrX22894 375 1512 --12041
NM_006802chr151200 920 428 64 55 1302 ----
NM_006805chr551415 1098 447 252 164 --1396 --
NM_006806chr212372 329 ------
NM_006807chr17168 --1992 --
NM_006815chr122398 43 1364 ----
NM_006822chr171238 1549 ----
NM_006823chr811285 11194 ----
NM_006826chr2--31221 1078 1026 ----
NM_006827chr1453041 2395 2316 1318 492 ----1237
NM_006832chr143356 318 278 1860 ----
NM_006838chr1211855 ------
NM_006839chr22236 111 1283 ----
NM_006850chr14830 276 242 209 ------
NM_006851chr1242830 2054 521 88 --12702 1399
NM_006852chr1742801 2348 2284 404 ------
NM_006856chr1231024 985 702 ------
NM_006870chr202740 338 ------
NM_006873chr233584 1286 954 22432 928 ----
NM_006874chr431246 1058 890 1467 ----
NM_006884chr311566 ------
NM_006888chr1462495 1152 826 629 474 58 13308 23064 445 --
NM_006892chr2051422 1285 1193 454 315 1977 --1953
NM_006892chr2051422 1285 1193 454 315 1977 --1953
NM_006901chr151507 ------
NM_006908chr7--1227 ----
NM_006910chr16----1267 --
NM_006915chrX2718 156 32195 609 98 ----
NM_006920chr221604 40 ------
NM_006922chr282126 1908 890 868 842 448 334 38 1985 ----
NM_006924chr1723226 264 13479 23573 2898 --
NM_006936chr212859 86 11301 ----
NM_006937chr172122 22 ------
NM_006939chr1431154 1136 445 2843 835 ----
NM_006940chr124764 688 575 548 ------
NM_006951chr102638 107 ------
NM_006952chr31969 --11069 --
NM_006962chrX157 124 1492 --
NM_006963chr1021231 1174 ------
NM_006979chr61549 ------
NM_006982chr122251 197 ------
NM_006988chr211432 2418 285 ----
NM_006991chr3195 2257 103 1808 --
NM_006996chr141443 1208 459 357 11458 ----
NM_006997chr101454 ------
NM_006999chr552070 1691 1589 1582 431 ------
NM_007005chr921242 625 --2342 215 --
NM_007007chr1284365 4199 3347 1140 684 533 468 178 --14718 24322 1564
NM_007008chr21290 ------
NM_007010chr1731321 1217 591 --11736 1733
NM_007011chr1586520 6345 6319 4544 2736 2293 1610 942 36831 5497 2049 26109 1064 --
NM_007013chr831031 730 171 ------
NM_007018chr91394 --1134 --
NM_007023chr2--1800 ----
NM_007033chr1--1872 ----
NM_007034chr111001 1754 166 --
NM_007040chr192985 437 --1444 --
NM_007045chr61102 1161 195 --
NM_007052chrX159 --1538 --
NM_007054chr573691 3669 3036 1015 978 742 163 ------
NM_007064chr31393 ------
NM_007067chr1741591 1567 1172 1157 ------
NM_007078chr1053055 2410 2078 1989 1124 12642 ----
NM_007106chr1342119 1993 1717 100 ------
NM_007107chr362317 2285 2269 1805 461 35 11610 12137 --
NM_007111chr133823 807 227 1886 ----
NM_007114chr342808 1170 853 108 21317 806 ----
NM_007118chr51836 ------
NM_007124chr631659 413 137 11842 11533 --
NM_007125chrY5457 293 160 107 37 11399 ----
NM_007129chr131743 ------
NM_007137chrX54559 4447 4180 3538 556 11925 1360 1784
NM_007145chr1921422 974 ------
NM_007150chrX61971 1629 1604 1497 738 485 --1472 --
NM_007157chrX42829 2395 2166 273 --12250 --
NM_007158chr131237 832 115 ------
NM_007159chr361773 1676 497 336 200 167 ------
NM_007166chr1131300 1291 376 ------
NM_007173chr1132351 1561 687 21977 172 ----
NM_007175chr873559 3356 3190 3109 2223 1035 521 23053 899 ----
NM_007191chr121151 ------
NM_007195chr1883661 3533 3202 3179 3039 2787 2607 2447 --12353 --
NM_007197chr122868 133 ------
NM_007200chr1584401 4288 3917 3415 811 479 440 198 --13499 --
NM_007202chr172241 29 --1716 --
NM_007203chr933445 2948 655 --33468 3011 731 --
NM_007212chr14792 710 491 134 --12230 --
NM_007214chr63523 304 120 1970 11307 --
NM_007217chr31392 ------
NM_007218chr81679 1906 1141 --
NM_007222chr83676 397 58 ------
NM_007231chrX41862 769 251 213 1347 ----
NM_007236chr155690 514 480 388 263 12334 11829 --
NM_007245chr162912 765 1802 ----
NM_007249chr1399111 8692 8184 7006 6615 3552 2428 2048 1150 27889 3324 19199 12136
NM_007270chr711259 11460 ----
NM_007276chr711022 171 11091 --
NM_007279chr191645 ------
NM_007282chr31654 ------
NM_007292chr1764199 1822 1459 1025 525 28 14211 11060 --
NM_007294chr173319 184 103 --1396 --
NM_007295chr173319 184 103 --1396 --
NM_007296chr173319 184 103 --1396 --
NM_007297chr173319 184 103 --1396 --
NM_007298chr173319 184 103 --1396 --
NM_007299chr173319 184 103 --1396 --
NM_007300chr173319 184 103 --1396 --
NM_007302chr173319 184 103 --1396 --
NM_007303chr173319 184 103 --1396 --
NM_007304chr173319 184 103 --1396 --
NM_007305chr173319 184 103 --1396 --
NM_007324chr11322 ------
NM_007331chr422724 335 ----12038
NM_007332chr871127 1112 1095 1085 1028 451 164 1640 ----
NM_007345chr1882352 2244 2204 2130 1757 798 538 210 ------
NM_007347chr1562055 1961 689 584 44 23 12923 1327 --
NM_007350chr1264661 3386 2905 1009 776 67 11464 ----
NM_007351chr431062 471 77 --1148 --
NM_007358chr142003 1632 1559 1322 183 ----
NM_007361chr142519 33 1181 ----
NM_007372chr171889 2913 337 ----
NM_007373chr1041788 1588 481 75 2567 131 ----
NM_007374chr141418 ------
NM_007375chr142766 2236 1740 621 ------
NM_012064chr1241178 1048 720 43 ------
NM_012081chr563264 2390 2315 1403 265 151 23388 2575 --12537
NM_012082chr82922 868 ------
NM_012084chrX168 ------
NM_012089chr131399 387 213 ------
NM_012092chr271567 1456 1446 1257 700 289 119 ------
NM_012095chr1042838 1038 787 466 13113 ----
NM_012096chr323446 1238 --23332 1110 --
NM_012097chr211418 11812 ----
NM_012100chr22745 516 ------
NM_012104chr1153123 2478 2428 270 222 ------
NM_012104chr1153123 2478 2428 270 222 ------
NM_012118chr4----137 --
NM_012120chr652848 1850 891 563 518 12165 ----
NM_012127chr9197 146 ----
NM_012129chr71898 11548 12429 --
NM_012137chr182221 2024 1168 942 574 451 120 91 22227 2059 ----
NM_012141chr1353902 3557 1010 522 299 1700 24066 1582 --
NM_012153chr1121774 273 --1733 --
NM_012154chr83640 344 294 ------
NM_012155chr19295 42 --159 --
NM_012158chr1351747 1443 1246 1135 273 31720 696 87 ----
NM_012161chr42923 64 --31151 764 26 --
NM_012164chr9127466 7102 6345 6218 5716 5508 4824 2679 2512 2196 2142 2100 1337 ----
NM_012183chr1--1536 ----
NM_012193chr1155365 5031 4246 3423 926 2859 70 31646 1185 540 --
NM_012199chr164686 4124 3028 2977 2968 1622 14000 ----
NM_012207chr10--2790 300 --149
NM_012214chr286104 5078 5068 5010 1965 1650 934 82 31373 750 370 21584 109 --
NM_012218chr193830 685 600 --1282 --
NM_012219chr312349 --13079 --
NM_012224chr431010 489 190 1306 ----
NM_012234chr3133745 3485 3310 2961 2735 1443 1420 1208 1019 965 289 264 136 --23732 3127 --
NM_012238chr1031741 1664 619 --174 11765
NM_012247chr103871 100 46 ------
NM_012249chr283229 2940 2712 2561 2433 2185 1196 427 21348 208 11377 23247 3143
NM_012250chr1141043 509 240 68 ------
NM_012255chr201138 ------
NM_012257chr72249 28 ------
NM_012259chr641298 971 567 548 ------
NM_012262chr184964 4676 4133 4099 3802 1087 529 423 1902 23755 1475 --
NM_012281chr732083 1551 984 ------
NM_012287chr354398 4024 1042 91 77 13248 34282 3605 1577 --
NM_012288chr665532 4786 3801 2148 352 309 11474 35147 4780 4735 --
NM_012294chr743782 896 393 57 --13623 --
NM_012297chr452640 2299 856 594 324 1905 ----
NM_012301chr7----12194 --
NM_012302chr171171 821 783 423 315 261 88 ------
NM_012304chr521923 1593 22580 2488 ----
NM_012307chr182877 767 ------
NM_012309chr1184311 4273 4073 3695 1681 1112 869 397 --13937 11752
NM_012316chr1115467 3874 3548 3481 1995 1949 1911 1855 1321 1130 113 11579 1890 11449
NM_012319chr181840 ------
NM_012327chr1831274 619 107 ------
NM_012328chr721212 312 21459 387 ----
NM_012329chr1741583 1393 1190 260 2385 299 11636 --
NM_012334chr553495 3444 1292 834 206 24461 227 1848 --
NM_012338chr751193 449 362 257 40 ------
NM_012395chr773106 2860 2441 2361 908 651 608 1506 ----
NM_012399chr2231739 707 42 --21954 1688 --
NM_012402chr112889 201 11243 ----
NM_012405chr153779 3276 2531 1306 556 ------
NM_012412chr73870 639 320 ------
NM_012416chr931119 929 879 133 ----
NM_012417chr171627 ------
NM_012425chr1042695 2146 861 551 12303 ----
NM_012426chr16----1311 --
NM_012428chr153898 318 66 ------
NM_012429chr2221383 178 ------
NM_012430chr32525 106 ------
NM_012434chr631445 1119 213 130 ----
NM_012463chr1231286 473 178 ------
NM_012465chr1063167 2856 2792 1322 1171 214 --1738 --
NM_012470chr71476 ------
NM_012475chr1165 --181 --
NM_012479chr742219 1995 1735 590 ------
NM_013230chrY31719 439 221 1112 ----
NM_013231chr1453654 2794 2744 1450 186 23981 3385 ----
NM_013233chr251412 1406 1152 1033 200 ------
NM_013235chr52201 30 1369 158 --
NM_013238chr131622 21450 1169 ----
NM_013246chr113935 786 181 ------
NM_013248chr202241 233 ------
NM_013255chr7118778 8452 6453 6098 5494 1950 1629 1503 1013 499 313 28807 2485 17579 --
NM_013257chr841864 311 63 41 1712 ----
NM_013261chr442731 2593 482 183 ------
NM_013262chr631346 1244 550 ------
NM_013269chr1264255 4037 3507 1494 939 476 --14538 --
NM_013281chr2041106 304 292 78 ------
NM_013283chr52811 293 ------
NM_013286chr343158 2889 942 479 --23024 245 12843
NM_013302chr1674526 4491 2909 1306 1276 903 600 ----11066
NM_013309chr1522609 225 ------
NM_013316chr72926 335 ------
NM_013341chr222810 393 --12827 --
NM_013354chr831153 527 130 ------
NM_013357chr81716 ------
NM_013372chr1553169 1132 939 849 247 1214 13219 --
NM_013374chr332924 1135 137 ------
NM_013377chr121206 ------
NM_013380chr194810 779 648 324 ------
NM_013381chr1252445 2438 1952 877 202 1902 1896 --
NM_013396chr211552 1974 11476 --
NM_013437chr811193 ----2495 183
NM_013441chr11436 ------
NM_013444chrX189 ------
NM_013448chr142624 235 ------
NM_013450chr241111 929 388 373 ------
NM_013989chr1454471 4172 4054 408 376 23814 3450 ----
NM_013995chrX1254 ------
NM_014000chr1041783 1292 692 324 21704 39 ----
NM_014011chr232536 1758 312 ------
NM_014016chr32287 64 1186 11511 --
NM_014021chr142482 601 377 165 --23187 2591 --
NM_014023chr1052131 627 513 468 188 ------
NM_014031chr51349 ------
NM_014034chr61360 --1385 --
NM_014038chr71377 ----1348
NM_014039chr11--2921 478 21308 217 --
NM_014043chr321600 1534 ------
NM_014048chr1695065 4291 4156 3546 1929 1855 1659 561 251 33832 1608 732 11627 13768
NM_014055chr123558 445 29 ------
NM_014057chr941572 643 376 186 ------
NM_014089chr131321 --158 --
NM_014106chr1522848 1945 --11014 --
NM_014112chr855423 1918 1667 1622 362 13734 14010 --
NM_014117chr1652729 2564 2112 2044 907 1994 12196 --
NM_014154chr31339 ----11538
NM_014155chr11116963 6315 5256 5181 4614 2954 2190 1781 1224 1021 411 26213 5003 36103 2880 1565 --
NM_014171chr2140 ------
NM_014181chr262865 2583 2556 2120 809 670 ------
NM_014190chr421868 731 ------
NM_014212chr122895 700 ------
NM_014213chr21201 ------
NM_014216chr1431560 256 231 --11316 --
NM_014217chr131608 1525 369 ------
NM_014220chr33820 526 39 --1116 --
NM_014232chr171677 1327 11409 --
NM_014232chr171677 1327 11409 --
NM_014240chr324127 2930 34105 3790 3611 ----
NM_014241chr10--1342 ----
NM_014243chr41372 12077 11964 1540
NM_014253chrX52340 1769 910 622 340 1747 12235 --
NM_014255chr12187 ------
NM_014263chr10--2604 316 21363 68 --
NM_014267chr11----1697 --
NM_014268chr182571 270 --11378 --
NM_014278chr41302 ------
NM_014294chr821483 43 151 ----
NM_014309chr2244749 3939 1394 1088 23329 60 14238 --
NM_014315chr141165 ------
NM_014317chr101265 ------
NM_014319chr1221258 630 ------
NM_014331chr487855 7809 6766 6498 6238 852 401 62 11461 ----
NM_014333chr1142068 964 463 186 21788 1742 ----
NM_014342chr112239 139 --11138 --
NM_014346chr221425 ------
NM_014350chr541155 1030 473 376 ------
NM_014363chr1341258 1182 1052 308 ------
NM_014368chr911475 1393 11911 --
NM_014372chr111842 22092 738 ----
NM_014379chr82937 658 1146 ----
NM_014381chr1462004 1317 1145 994 923 417 1535 --13128
NM_014382chr341520 1460 1124 434 ------
NM_014392chr431107 367 254 ------
NM_014393chr83586 446 272 12103 11709 1499
NM_014415chr33584 97 66 1209 21393 87 --
NM_014418chr1432013 1808 146 ------
NM_014421chr461805 1669 1412 540 393 222 42128 1769 1739 1546 ----
NM_014423chr545579 3882 1461 375 --11159 --
NM_014432chr631483 1022 142 11155 ----
NM_014445chr31608 ----21704 825
NM_014447chr41371 ------
NM_014452chr62970 350 ------
NM_014456chr101580 11548 ----
NM_014458chr121374 1314 ------
NM_014487chr4--1697 ----
NM_014491chr72790 89 ------
NM_014494chr1651558 911 752 310 199 1497 3793 462 265 --
NM_014504chr722028 794 11610 1476 --
NM_014505chr123468 375 194 1453 ----
NM_014506chr921665 330 ------
NM_014515chr122765 314 ------
NM_014517chr331554 1334 730 --11722 --
NM_014521chr21222 ------
NM_014548chr1551658 1439 1271 439 394 --1629 --
NM_014552chr22179 108 1313 11564 1535
NM_014554chr1261854 1471 790 597 97 57 ------
NM_014572chr1351801 1612 729 460 137 1676 11642 --
NM_014574chr1441241 1135 1033 54 ------
NM_014575chr32449 173 ------
NM_014584chr1431595 1305 177 ------
NM_014585chr21948 ------
NM_014597chr1147 ------
NM_014606chr441184 1098 294 87 ------
NM_014607chr261365 813 586 452 106 67 22079 191 11463 --
NM_014613chr563079 3036 2240 2174 1230 1164 ------
NM_014615chr1662933 2663 2373 2230 522 50 ------
NM_014616chr393212 3193 2902 2301 2273 592 439 399 389 ----1736
NM_014620chr122734 677 ------
NM_014630chr1563555 3041 738 630 395 131 ------
NM_014633chr111459 ------
NM_014634chr2232822 2257 831 --12950 --
NM_014635chr241630 1499 1465 42 11752 ----
NM_014636chr963686 3543 3104 2656 680 328 --14370 --
NM_014637chr811078 ------
NM_014646chr1862570 1173 865 794 178 73 ----12133
NM_014647chr1622005 659 11727 12219 --
NM_014665chr863245 2365 930 601 373 123 ------
NM_014667chr31990 1850 1289 --
NM_014670chr231598 1592 271 ------
NM_014671chr731203 500 459 ------
NM_014673chr8--173 ----
NM_014676chr11239 --11453 --
NM_014677chr811342 ------
NM_014679chr112293 68 1474 ----
NM_014682chr81363 11859 --11828
NM_014683chr1731363 780 672 ------
NM_014685chr162511 367 1579 ----
NM_014686chr1942098 2079 2067 1951 12269 ----
NM_014689chr21120 ------
NM_014699chr16----1350 --
NM_014701chr1582800 2645 2586 2559 1186 668 378 139 ------
NM_014702chr673352 2949 2883 2441 1342 1293 72 32183 1360 1048 ----
NM_014705chr75668 617 600 359 43 --1748 --
NM_014707chr762186 1562 773 686 654 467 11440 ----
NM_014709chr21110 --2426 22 --
NM_014711chr1652030 787 303 262 72 ------
NM_014720chr1021595 405 ------
NM_014721chr6136992 5908 5300 4948 4624 2516 2147 2034 1566 1376 1309 1236 685 11328 35246 2401 1888 --
NM_014723chr2042141 2048 2007 1021 --22229 2130 --
NM_014729chr832210 1688 546 ------
NM_014730chr1264985 4610 4057 3316 977 880 ------
NM_014730chr1264985 4610 4057 3316 977 880 ------
NM_014733chr541896 1885 384 271 ------
NM_014735chrX1685 ------
NM_014736chr152386 40 1847 ----
NM_014746chr232886 1300 334 14080 11543 --
NM_014751chr811980 1370 ----
NM_014752chr112786 217 1755 1140 --
NM_014755chr233692 3243 3095 --23264 350 --
NM_014756chr111168 ----142
NM_014757chr572358 2319 2176 2120 938 570 216 ------
NM_014772chr18--13121 ----
NM_014774chr133144 183 43 ----12631
NM_014779chr341025 819 788 254 ------
NM_014781chr8----1142 --
NM_014782chrX1274 1330 ----
NM_014783chr1531540 1115 120 --21638 556 --
NM_014790chr5153 ------
NM_014795chr21311 ------
NM_014803chr1041978 1961 940 88 22152 496 ----
NM_014810chr153259 2827 2741 488 399 23163 2322 33502 966 748 --
NM_014812chr161861 1833 1342 748 607 435 11899 ----
NM_014813chr12387 101 157 ----
NM_014820chr361897 1619 1543 1359 356 41 ------
NM_014826chr153419 3354 3071 1569 1473 34255 3897 519 13513 --
NM_014827chr131519 600 63 ------
NM_014828chr145819 768 690 205 38 12341 ----
NM_014829chr54307 69 62 37 21535 655 ----
NM_014830chr1263804 3519 3304 3155 629 570 --42648 1086 549 327 23798 2824
NM_014832chr1361765 1704 842 714 541 529 ------
NM_014835chr2042257 2086 1839 185 12185 ----
NM_014838chr2232405 355 68 1308 --1557
NM_014839chr1102338 2286 2219 2068 1623 747 665 500 312 106 ------
NM_014841chr631272 1050 897 ------
NM_014846chr8------1118
NM_014850chr374624 4244 4056 3719 3165 1734 702 11096 24675 3323 --
NM_014857chr1184 ------
NM_014858chr12762 461 --1993 --
NM_014871chr12138 ------
NM_014873chr174875 4487 1796 1535 899 647 385 1163 24647 1701 --
NM_014877chr17117765 7688 6647 6617 5609 5466 4974 2424 1909 1271 991 11711 ----
NM_014884chr19169 ------
NM_014887chr132713 307 ------
NM_014893chrY12220 11783 ----
NM_014897chr1732047 933 883 32930 1295 561 ----
NM_014902chr2041190 360 323 197 --11450 --
NM_014903chr1232379 2193 338 ------
NM_014904chr1043015 1340 1218 616 12748 ----
NM_014906chr1754017 3751 3612 3338 2753 --11235 --
NM_014907chr9------1100
NM_014909chr1493620 3506 2802 2790 2624 1447 1429 350 278 --1729 --
NM_014912chr1043481 3082 731 566 --2872 249 --
NM_014913chr182984 187 --11507 --
NM_014917chr11912 ------
NM_014918chr1521576 544 11333 ----
NM_014920chr692693 2401 1364 1168 808 630 586 542 443 ------
NM_014923chr1311668 129 2678 651 --
NM_014932chr311349 11489 ----
NM_014934chr1333590 3268 1286 1895 13775 --
NM_014938chr1282401 2357 2216 2022 1857 1615 546 462 ------
NM_014946chr252277 1087 435 97 35 1636 ----
NM_014947chr133164 2415 1152 --1696 --
NM_014950chr1431358 392 240 11584 ----
NM_014952chr1512005 ------
NM_014961chr41565 11723 ----
NM_014962chr2032425 939 195 11809 ----
NM_014966chr3161 ------
NM_014969chr161039 876 807 298 241 22 ------
NM_014978chr1041805 1310 253 106 ------
NM_014988chr462403 2355 2258 1922 388 41 ------
NM_014989chr642082 2000 1657 37 11938 ----
NM_014991chr452582 2549 2168 1311 94 21247 1013 11182 --
NM_014994chr1521476 892 ----11696
NM_014996chr33938 360 320 ------
NM_014997chr7----22549 1137 --
NM_014999chr1231413 1187 1073 ------
NM_015000chr1262993 2498 2316 2161 969 418 12400 12081 --
NM_015001chr11197 ------
NM_015008chr363653 3018 2217 1404 438 121 --12958 --
NM_015009chr3----1161 --
NM_015020chr1663896 3501 3273 3159 2765 412 1696 12589 12376
NM_015024chr831495 1097 494 ------
NM_015026chr1274516 1701 1649 942 624 587 133 13823 ----
NM_015027chr162285 60 --1575 --
NM_015032chr134825 583 437 358 --1543 --
NM_015033chr953128 3002 2602 2523 990 --2487 54 --
NM_015035chr2096063 4709 4537 4450 2531 1274 744 584 80 15382 16242 --
NM_015037chr101271 ------
NM_015039chr143999 3794 3695 2644 1454 ----
NM_015040chr273439 3326 2670 2349 997 779 389 11186 12736 --
NM_015042chr1574291 3828 1728 1338 1154 1124 987 --23117 357 --
NM_015045chr1051427 805 659 567 265 ------
NM_015051chr942962 2868 2214 490 ------
NM_015052chr71501 --1346 --
NM_015068chr743952 3013 2559 1066 --1286 12516
NM_015071chr576020 4666 2156 1892 1662 1097 443 --1865 --
NM_015072chr141629 ------
NM_015073chr1931942 1460 699 ------
NM_015074chr164178 3621 1964 1906 935 697 23957 1188 ----
NM_015076chr673278 1725 1052 992 786 493 60 23666 541 ----
NM_015087chr1372035 1907 1028 923 782 330 156 --12432 1843
NM_015092chr1654423 3190 3019 1308 1216 53702 3294 2954 1627 1081 ----
NM_015093chr631770 1199 215 1129 1658 --
NM_015094chr2243629 1821 1074 214 ------
NM_015097chr342341 2142 1550 174 --1646 --
NM_015100chr121817 106 1238 ----
NM_015107chrX52214 2017 1889 1512 266 ------
NM_015115chr453029 2581 2560 2500 158 1824 12643 --
NM_015120chr2137 ------
NM_015124chr2222164 138 --12352 --
NM_015130chr431325 1083 543 ------
NM_015137chr832424 754 681 1892 175 --
NM_015138chr152676 174 --22768 1847 --
NM_015144chr1633749 1331 118 --1745 --
NM_015153chr61683 1110 ----
NM_015156chr1484002 3880 3619 3410 3053 2838 664 396 ------
NM_015158chr92790 249 ------
NM_015161chr1651539 1494 1107 462 61 --2420 407 --
NM_015172chr1----11500 --
NM_015173chr411416 1662 11738 --
NM_015176chr11196 11368 ----
NM_015184chr3------1140
NM_015185chrX52393 710 524 377 344 --11886 --
NM_015186chr9124 ------
NM_015187chr4----1250 --
NM_015192chr2032290 1997 620 ----1207
NM_015200chr432246 1888 794 --1462 12026
NM_015203chr1--1165 ----
NM_015206chr1553286 2780 1180 1160 575 ------
NM_015208chr1842766 2681 2671 1416 23917 289 1995 --
NM_015209chr142101 1711 1669 641 11773 1863 --
NM_015213chr111158 ------
NM_015225chr951274 1190 872 542 310 12426 1155 --
NM_015236chr421153 1063 ------
NM_015247chr1685244 5188 3931 3301 1333 610 539 531 43812 3471 1370 907 1455 --
NM_015251chr1612033 ------
NM_015252chr23696 600 130 ------
NM_015256chr52579 509 --1645 --
NM_015265chr222446 50 --12417 11772
NM_015266chr2043142 1081 656 601 --21659 927 --
NM_015267chr1221920 133 ------
NM_015268chr31270 ------
NM_015269chr13627 466 30 1242 ----
NM_015271chr474240 3387 3109 2618 1577 397 210 11270 11556 --
NM_015272chr1631589 676 182 --22140 284 --
NM_015275chr125740 682 629 248 178 ------
NM_015277chr1831252 535 45 --1365 --
NM_015278chr633434 3010 2547 ------
NM_015282chr222417 832 ------
NM_015285chr1862488 2099 1890 863 513 493 --21843 713 --
NM_015288chr52725 85 --22637 499 --
NM_015291chr11755 --22605 528 --
NM_015294chr1731061 1051 375 1248 11125 1291
NM_015299chr1481308 1252 1120 941 689 582 206 80 11338 ----
NM_015308chr11----1754 --
NM_015310chr8118095 7811 7184 6766 6068 3372 2179 2144 1252 811 131 21292 1217 31707 1276 303 --
NM_015313chr1174717 4404 3756 3104 809 583 226 ------
NM_015315chr553386 2507 2246 1189 668 13294 12307 --
NM_015317chr252692 2576 2066 1045 395 11914 ----
NM_015319chr12----1456 --
NM_015323chr621199 1192 21771 1328 11713 --
NM_015328chr752690 2674 1193 774 706 --1733 --
NM_015329chr1952851 1989 1952 1797 429 ------
NM_015331chr12602 231 ------
NM_015336chr122521 317 ------
NM_015344chr841886 1431 830 611 21660 380 ----
NM_015345chr622249 980 ----1714
NM_015347chr1272766 2640 2511 987 927 401 317 1704 22403 1979 1387
NM_015349chr612814 --12402 --
NM_015354chr9----1387 --
NM_015355chr1731846 354 157 ------
NM_015358chr2121175 120 11002 ----
NM_015361chr22970 316 ------
NM_015365chrX32955 441 89 11293 11061 --
NM_015375chr141144 1038 595 505 24231 806 ----
NM_015378chr152532 2517 2021 452 414 12912 ----
NM_015382chr141700 ------
NM_015384chr5------136
NM_015387chr22578 388 1365 ----
NM_015393chr473077 2774 2645 1064 998 497 388 --1710 --
NM_015394chr1221624 749 ------
NM_015396chr32496 84 ------
NM_015397chr921419 449 21745 217 ----
NM_015416chr125860 741 623 293 282 ------
NM_015423chr112448 184 11474 ----
NM_015429chr33418 366 107 2985 874 --192
NM_015435chr81472 ------
NM_015436chr433333 2149 883 13126 ----
NM_015447chr94706 639 496 107 --1567 --
NM_015455chr553640 3505 697 609 397 1763 21510 1440 --
NM_015457chr111343 ------
NM_015460chr311522 21902 1485 ----
NM_015461chr182781 61 --1720 --
NM_015463chr2147 ------
NM_015465chr51494 ------
NM_015472chr33531 201 84 ------
NM_015472chr33531 201 84 ------
NM_015474chr20122 --1249 --
NM_015475chr21763 1390 ----
NM_015484chr13795 601 237 153 ----
NM_015488chr271670 1663 1528 1303 1185 1174 1157 ------
NM_015508chr32611 394 1203 ----
NM_015509chr1271429 1226 1200 1072 625 546 487 ------
NM_015523chr111294 ------
NM_015530chr22959 788 ------
NM_015535chr253575 3211 2852 394 248 1139 11275 --
NM_015542chr101876 ------
NM_015550chr783293 3255 3012 2920 2886 656 507 142 ------
NM_015553chr674991 4212 3886 3644 1108 903 729 21702 1341 1791 --
NM_015554chr1552753 2467 2177 933 34 --22321 1815 --
NM_015564chr563281 2901 1045 842 471 322 12501 ----
NM_015565chr2121407 813 21482 248 1166 --
NM_015568chr20103975 2815 2664 1360 952 290 249 206 188 113 ------
NM_015569chr184672 4593 4391 1503 849 788 594 438 2892 127 24587 841 14477
NM_015570chr731554 1344 458 11371 11400 --
NM_015571chr6127 2862 770 ----
NM_015575chr282425 1469 858 819 373 303 87 38 11122 ----
NM_015576chr352602 2341 1066 624 199 ------
NM_015601chr10--2944 261 ----
NM_015602chr121819 1435 21316 1236 ----
NM_015605chr1041607 1441 990 139 --2484 220 --
NM_015607chr11163 ------
NM_015622chr71249 ------
NM_015626chr1741147 957 903 66 --11010 --
NM_015630chr21365 ------
NM_015635chr932093 1843 213 1141 12220 --
NM_015640chr174984 4277 3316 1511 1172 1117 733 15353 ----
NM_015641chr74944 294 58 49 ------
NM_015642chr31110 ------
NM_015660chr72295 25 ------
NM_015676chr141291 ------
NM_015678chr132160 90 ------
NM_015695chr622002 1816 --11980 --
NM_015713chr873380 3130 2776 2767 2441 1363 65 13374 155 --
NM_015716chr171104 ------
NM_015723chr71578 1530 ----
NM_015833chr2162103 1968 1692 1550 311 290 --21983 785 --
NM_015855chr11--1617 ----
NM_015869chr32169 130 ------
NM_015878chr832219 566 322 11626 ----
NM_015885chr111770 ------
NM_015886chr863998 3559 1484 1278 935 198 22074 740 11805 --
NM_015888chr173254 2790 2163 1299 890 819 497 --22644 979 --
NM_015902chr82926 69 ------
NM_015904chr22574 255 ------
NM_015906chr183989 3937 3770 3569 1941 1851 611 493 24840 4349 34319 1096 673 --
NM_015915chr141282 2303 293 1256 --
NM_015920chr151587 ----1560
NM_015926chr31294 ------
NM_015933chr3163 ------
NM_015949chr72949 873 ------
NM_015955chr21505 ------
NM_015981chr532901 780 633 13131 12322 --
NM_015994chr143575 283 231 --1137 --
NM_015995chr1555567 4508 2005 1752 1139 14595 ----
NM_016002chr12738 55 ------
NM_016009chr1134561 3772 3470 3058 1776 1379 964 782 708 517 343 293 257 --23655 3348 --
NM_016013chr15--127 ----
NM_016018chr852696 2307 1968 1820 731 --12483 --
NM_016021chr673050 2601 1866 974 669 232 80 --1810 --
NM_016023chr842115 1990 847 397 --11814 --
NM_016032chrX41404 1272 1256 868 ------
NM_016040chr122278 492 1355 ----
NM_016070chr172246 40 ------
NM_016073chr15----11032 --
NM_016076chr173041 2498 2065 2046 965 299 277 --21228 1218 --
NM_016078chr172845 398 11136 ----
NM_016079chr282046 1568 923 555 495 312 303 250 --1641 --
NM_016083chr643395 3069 625 197 --33936 943 70 --
NM_016090chr111757 1434 ----
NM_016094chr31125 1274 ----
NM_016096chr851907 1350 539 435 43 12064 ----
NM_016098chr63194 168 127 1116 ----
NM_016100chr20--183 ----
NM_016106chr14130 ------
NM_016121chr12463 57 11116 ----
NM_016122chr12192 ----1400
NM_016131chr222360 321 11742 --11848
NM_016132chr1543078 2342 2250 757 12703 1764 --
NM_016133chr231640 1430 663 --11652 --
NM_016152chr351267 923 450 250 78 --1871 --
NM_016166chr151184 ------
NM_016179chr13123 ------
NM_016185chr172330 321 ------
NM_016203chr7----1831 --
NM_016205chr4--159 ----
NM_016206chr3128815 8414 6971 6558 6429 6272 6051 3366 2423 1237 980 397 28262 5477 --1558
NM_016213chr15161 ------
NM_016217chr642865 2598 2374 465 11028 32801 2394 508 --
NM_016224chr61232 ------
NM_016230chr6--1193 ----
NM_016231chr1711150 1102 ----
NM_016252chr2--1338 1305 --
NM_016255chr643316 941 865 422 ----11175
NM_016258chr11678 1304 ----
NM_016260chr2116584 5772 5663 5653 5396 5382 4973 2328 2260 1114 849 67263 6204 5807 5222 1980 1270 21360 560 17214
NM_016269chr4----1215 --
NM_016271chr181340 1544 --11667
NM_016272chr2212772 ------
NM_016281chr1231086 876 235 ------
NM_016289chr231704 691 104 ------
NM_016303chrX189 ------
NM_016312chr122442 158 ------
NM_016315chr231332 295 232 21766 1475 ----
NM_016316chr24648 265 213 196 1523 ----
NM_016322chr942720 2282 2220 67 --11168 11087
NM_016337chr14----1491 --
NM_016338chr511042 1133 ----
NM_016339chr1731855 1553 1153 --1597 --
NM_016340chr53907 402 132 --11238 --
NM_016351chr72582 91 --140 --
NM_016352chr7122 --11283 --
NM_016357chr1241215 298 205 111 ------
NM_016374chr121243 592 ------
NM_016374chr121243 592 ------
NM_016377chr631443 1295 55 --11704 --
NM_016395chr1541383 1352 1282 155 21952 593 ----
NM_016396chr154718 663 653 616 ------
NM_016401chr111266 ------
NM_016410chr91417 ------
NM_016422chr1172634 2587 2521 654 544 476 354 22892 1061 12848 --
NM_016433chr1221601 137 --1189 --
NM_016436chr2022628 792 12264 ----
NM_016441chr232255 152 52 12245 ----
NM_016447chr72236 68 1103 ----
NM_016451chr111268 ------
NM_016462chr6------1454
NM_016472chr141520 --11523 --
NM_016475chr1421025 491 21083 220 ----
NM_016485chr642259 2180 2008 786 1193 ----
NM_016499chr111521 ------
NM_016505chr13690 654 579 2666 535 ----
NM_016507chr1743135 1128 922 224 22920 1992 1655 12693
NM_016513chr692693 2401 1364 1168 808 630 586 542 443 ------
NM_016516chr22716 226 1607 ----
NM_016522chr11--1609 11161 --
NM_016530chr1583686 3205 2888 2761 984 807 541 289 --12901 --
NM_016531chr433638 3403 1027 22577 1187 11349 --
NM_016545chr11770 ------
NM_016547chr11730 ------
NM_016559chr33989 952 528 11251 ----
NM_016569chr1221144 559 11379 ----
NM_016578chr11------1572
NM_016587chr711022 171 11091 --
NM_016589chr31192 ------
NM_016603chr512133 --1247 --
NM_016607chrX31320 1312 681 ------
NM_016613chr492762 1975 1796 1747 1725 715 706 589 581 ------
NM_016620chr131038 455 171 ------
NM_016621chr1173710 2986 1042 1030 868 669 277 44625 1652 1384 287 ----
NM_016623chr81261 ------
NM_016625chr3182 ------
NM_016626chr1811291 21591 1143 --2567 194
NM_016631chr213741 206 190 --1227 --
NM_016644chr5175 1390 ----
NM_016651chr1421178 1137 ------
NM_016654chr1541349 1079 168 29 ------
NM_016824chr1021813 1631 ------
NM_016836chr2------1697
NM_016839chr2------1697
NM_016936chr1641651 1540 304 91 ------
NM_016940chr211442 ------
NM_016950chr441513 1496 1128 546 ------
NM_017410chr123971 284 29 ------
NM_017412chr821079 999 --1426 --
NM_017415chr553981 3694 1758 1018 595 22829 395 33348 3231 381 --
NM_017416chrX1149 ------
NM_017420chr1463669 3602 2633 1276 805 410 21061 850 22987 404 --
NM_017423chr442013 870 227 191 1638 ----
NM_017426chr42557 227 --1135 --
NM_017437chr1451602 1549 562 291 27 --12446 --
NM_017440chr122576 104 --1138 --
NM_017447chr21104376 4231 3907 3370 3335 3180 3127 3067 1344 890 24448 2999 --14404
NM_017455chr153898 318 66 ------
NM_017456chr174448 324 286 26 --11819 --
NM_017516chr1121105 781 ------
NM_017519chr61445 ------
NM_017522chr1----11442 11138
NM_017544chrX1382 ------
NM_017545chr201378 ------
NM_017548chr34493 438 244 82 ------
NM_017549chr731311 1067 176 11294 11132 --
NM_017569chr131107 ------
NM_017580chr1071930 1881 922 439 271 170 117 11976 ----
NM_017594chr933294 2284 2092 13281 13273 --
NM_017596chr12447 109 --11691 --
NM_017599chr1241803 1763 1499 382 11389 11470 194
NM_017610chr1562025 1828 1569 1528 1301 232 2517 126 ----
NM_017617chr931525 1497 240 ------
NM_017626chr101493 --1540 --
NM_017628chr444551 3763 1200 1081 45014 3889 2085 267 14905 14190
NM_017629chr121835 431 1562 11535 --
NM_017633chr683963 3911 3523 3195 2802 2775 2506 332 --13111 12543
NM_017634chr821611 267 1298 1585 --
NM_017635chr1121527 99 ------
NM_017637chr987487 7276 6019 5783 1780 1766 1690 657 1720 ----
NM_017641chr121761 1784 21043 315 --
NM_017643chr1741256 975 746 88 ------
NM_017644chr395227 4990 4120 3632 3418 3162 1152 294 270 ------
NM_017646chr11639 1273 ----
NM_017650chr7145688 5279 4536 4492 4163 3884 2154 1493 1476 1467 1001 606 562 414 44988 4152 2237 1893 ----
NM_017657chr23729 705 26 ------
NM_017658chr1484558 4154 4105 3930 2921 2868 1344 665 14212 11315 --
NM_017666chrX31820 1680 414 1261 21750 335 --
NM_017672chr1511382 ------
NM_017673chr14955 901 647 242 1841 1784 --
NM_017676chr521888 1408 ------
NM_017680chr92211 111 174 ----
NM_017684chr1562057 1515 509 168 68 55 11594 ----
NM_017686chr11977 ----1849
NM_017694chr221954 1775 ----1802
NM_017700chr42569 122 ------
NM_017709chr173854 3257 2807 1688 640 165 121 23980 3005 13400 --
NM_017714chr201339 ------
NM_017719chr331594 764 536 184 ----
NM_017721chr191329 ------
NM_017724chr31733 1823 1267 --
NM_017734chr11253 ------
NM_017737chr152137 1468 701 416 261 1144 ----
NM_017739chr11201 --1193 --
NM_017742chr1831882 754 94 --1313 --
NM_017745chrX2259 219 ------
NM_017747chr51318 ------
NM_017752chrX22145 1990 22174 1694 --136
NM_017754chr674932 3776 3620 3607 1419 1251 915 24774 1556 ----
NM_017768chr12787 691 1847 ----
NM_017769chr1442725 2482 1181 327 12570 ----
NM_017770chr62566 379 22581 2498 22764 825 --
NM_017780chr83818 267 61 ------
NM_017784chr321106 349 1170 11186 --
NM_017786chr83599 479 92 1526 ----
NM_017787chr1052029 1935 1833 1827 506 ------
NM_017791chr1451653 1608 1546 1410 1073 --11572 --
NM_017799chr1441857 695 662 558 ----1177
NM_017811chr962926 2804 2685 2209 2089 1973 12748 --13122
NM_017812chr73730 630 293 ------
NM_017813chr855124 4891 2024 1528 289 21060 901 15328 --
NM_017819chr3----1223 --
NM_017824chr1032590 2475 872 21826 1793 ----
NM_017831chr1834252 3635 435 1655 ----
NM_017845chr41647 ------
NM_017847chr13473 261 111 ------
NM_017848chrX104682 4261 4251 4191 3794 3244 3153 1122 979 49 23641 1709 13827 --
NM_017893chr1011301 ------
NM_017902chr1085617 5464 4777 4010 3643 1553 1491 521 --34702 1993 1645 --
NM_017905chr13--1577 1526 --
NM_017919chr9105850 5299 5097 2274 2221 2156 2010 1683 1292 38 --25657 1529 --
NM_017922chr141206 ------
NM_017926chr143667 594 238 2877 277 ----
NM_017934chr6276 21 ------
NM_017938chrX52070 2050 1973 1640 51 1750 ----
NM_017943chr14----11024 --
NM_017944chr1142280 2081 1930 988 1273 ----
NM_017946chr771151 1095 1046 476 366 356 265 21306 534 ----
NM_017958chr252582 2504 2103 1155 1125 1862 11896 --
NM_017964chr2193 ------
NM_017966chr1131481 1012 317 ------
NM_017972chr143667 594 238 2877 277 ----
NM_017988chr123957 928 671 1378 ----
NM_017994chr762780 1905 892 774 419 173 ------
NM_018003chr1552164 2004 702 488 125 11649 ----
NM_018010chr311563 ------
NM_018014chr221177 1069 ------
NM_018017chr1052826 2362 2218 811 64 22281 1964 1731 --
NM_018018chr123762 125 29 ----1476
NM_018023chr332019 1770 1707 11489 ----
NM_018025chr192249 178 ------
NM_018027chr1053233 3156 2601 2199 575 ------
NM_018030chr183694 296 84 ------
NM_018043chr1111059 ------
NM_018046chr531912 1604 109 11661 11797 --
NM_018048chr1221911 580 21850 1259 ----
NM_018061chr131449 348 53 --1520 1455
NM_018062chr2----1363 --
NM_018063chr101452 --1435 --
NM_018067chr11432 ------
NM_018070chr11608 ------
NM_018071chr142533 113 ------
NM_018072chr1128 ------
NM_018084chr243069 2279 355 276 23045 408 ----
NM_018090chr121181 381 --21025 852 --
NM_018092chr163225 199 166 ------
NM_018094chrX176 ------
NM_018098chr32351 165 1867 ----
NM_018103chr11305 ------
NM_018105chr811043 ------
NM_018120chr82984 423 11362 ----
NM_018121chr1052668 2207 1987 826 193 12530 ----
NM_018126chr431303 985 195 162 ----
NM_018128chr1741498 595 434 397 1948 ----
NM_018133chr31817 ------
NM_018142chr81182 ------
NM_018151chr2--1594 ----
NM_018155chr353444 3413 2967 2151 921 22826 1203 11039 --
NM_018156chr152532 2517 2021 452 414 12912 ----
NM_018157chr1232206 1053 851 13203 1124 --
NM_018168chr142274 51 ------
NM_018177chr41172 2993 841 ----
NM_018178chr131662 1366 1281 2439 371 ----
NM_018181chr1811232 ------
NM_018184chr342113 1840 573 370 --11991 --
NM_018195chr1121759 150 --1517 --
NM_018199chr1441192 274 260 149 --11224 --
NM_018202chr1193 ------
NM_018211chr161368 762 720 615 403 50 ------
NM_018221chr23313 305 42 --1132 --
NM_018227chr442784 2164 1252 561 22574 2025 1544 --
NM_018243chr433860 3375 705 22978 1373 13751 --
NM_018247chr622014 627 23134 1208 23046 308 --
NM_018254chr142264 2254 860 306 ------
NM_018263chr252238 2152 689 646 533 21729 333 12576 --
NM_018270chr20--1674 ----
NM_018286chr173874 790 231 1776 --1940
NM_018293chr372881 2453 2155 2068 2000 1896 388 11034 ----
NM_018299chr841069 619 141 130 12759 ----
NM_018307chr171387 172 ----
NM_018312chr1132159 2107 351 --1623 --
NM_018313chr372605 845 677 470 423 291 116 1626 ----
NM_018314chr11----1765 --
NM_018315chr421555 609 1363 1212 --
NM_018323chr441391 180 150 75 ------
NM_018325chr941088 332 233 103 ------
NM_018339chr921768 598 1103 ----
NM_018348chr161314 173 ----
NM_018361chr873640 3557 3117 2838 1452 1394 585 1924 145 --
NM_018362chr1143956 3566 601 415 11205 ----
NM_018364chr12780 772 21008 954 1222 13153
NM_018371chr831288 574 285 ------
NM_018373chr1446204 5228 833 483 21196 244 24658 1392 --
NM_018374chr7105042 4166 2092 1923 1834 1176 220 204 111 38 32060 1986 1738 11953 1403
NM_018375chr1421717 1531 21794 406 ----
NM_018383chr222024 1428 ------
NM_018388chrX1409 --1422 --
NM_018393chr113591 213 181 --1102 --
NM_018403chr341599 1590 1568 1124 12864 ----
NM_018416chr1232660 808 382 ------
NM_018419chr202369 82 ------
NM_018424chr951927 1366 1289 266 182 1282 ----
NM_018427chr162497 444 --11186 --
NM_018429chr532777 2180 262 1905 ----
NM_018433chr21154 ------
NM_018439chr1862296 1857 1809 1057 412 185 11707 1680 --
NM_018440chr8108602 7888 7315 7190 6858 5628 2927 2781 2720 2707 28174 6253 13188 1421
NM_018444chr862388 1947 694 686 641 454 --11967 --
NM_018445chr152549 205 ------
NM_018448chr122954 304 1834 ----
NM_018462chr32586 252 1850 ----
NM_018469chr1731045 355 293 ------
NM_018482chr852573 2386 1861 1617 493 --12056 --
NM_018489chr132188 614 438 --1796 --
NM_018490chr1121202 373 ------
NM_018509chr1731477 1465 66 1330 --11202
NM_018534chr2----1594 --
NM_018557chr22489 313 ------
NM_018566chr1114679 3638 3529 1947 1802 1280 1165 1027 227 193 179 --14564 --
NM_018569chr43323 251 203 ----1283
NM_018571chr21664 1127 ----
NM_018584chr11449 ------
NM_018590chr10166 --11638 --
NM_018593chr63707 671 495 ------
NM_018602chr1531528 247 223 ------
NM_018638chr1294928 3877 3608 2206 1368 832 478 391 148 15420 24803 1335 --
NM_018640chr1252787 1038 786 607 520 12345 ----
NM_018650chr131724 619 88 ------
NM_018652chr151162 ------
NM_018657chr31185 2529 312 ----
NM_018685chr72756 75 ------
NM_018686chr121138 1332 ----
NM_018689chr1572671 2344 2105 775 653 472 192 ------
NM_018691chr521230 790 ------
NM_018693chr2190 ------
NM_018695chr532240 2095 797 11550 ----
NM_018703chr16----1267 --
NM_018704chr161805 1723 1577 768 298 200 11398 12036 --
NM_018710chr81279 1994 ----
NM_018712chr1131574 266 64 1602 ----
NM_018715chr12675 412 11641 ----
NM_018717chr462771 2443 872 823 734 665 12169 --12252
NM_018834chr5----1927 --
NM_018841chr173510 3417 2942 2480 865 183 147 12965 ----
NM_018844chr761788 1750 1579 1534 664 272 --1554 --
NM_018846chr71350 ------
NM_018890chr7--1227 ----
NM_018896chr171297 ------
NM_018898chr531964 1712 925 1185 12042 --
NM_018899chr531964 1712 925 1185 12042 --
NM_018900chr531964 1712 925 1185 12042 --
NM_018901chr531964 1712 925 1185 12042 --
NM_018902chr531964 1712 925 1185 12042 --
NM_018903chr531964 1712 925 1185 12042 --
NM_018904chr531964 1712 925 1185 12042 --
NM_018905chr531964 1712 925 1185 12042 --
NM_018906chr531964 1712 925 1185 12042 --
NM_018907chr531964 1712 925 1185 12042 --
NM_018908chr531964 1712 925 1185 12042 --
NM_018909chr531964 1712 925 1185 12042 --
NM_018910chr531964 1712 925 1185 12042 --
NM_018911chr531964 1712 925 1185 12042 --
NM_018945chr643506 3284 2498 484 12889 12305 11395
NM_018948chr141279 1101 510 212 ------
NM_018951chr721194 458 ----11120
NM_018962chr2141433 389 245 165 1896 ----
NM_018963chr2121284 71 ------
NM_018970chr773131 3074 2637 2219 2016 1140 48 1647 1595 --
NM_018976chr1242189 1137 480 342 ------
NM_018979chr1252313 2109 2007 920 775 ------
NM_018999chr10104578 4415 4193 3461 3202 3187 3167 1276 1224 1028 43935 3516 1668 867 24756 3413 --
NM_019004chr732316 1529 307 --1591 --
NM_019022chr18113155 3121 2807 2203 2099 919 853 803 770 678 260 22059 975 21005 54 --
NM_019027chr42557 363 ------
NM_019036chr6----1993 --
NM_019044chr254240 3860 3330 3161 37 44750 3830 3525 3003 ----
NM_019045chrX1769 ------
NM_019048chr2168 177 ----
NM_019049chr13719 533 188 ------
NM_019050chr421844 120 11579 1912 --
NM_019053chr103333 313 90 ------
NM_019058chr102821 747 ------
NM_019063chr231721 1428 395 1782 --1611
NM_019072chr554035 3941 3546 3471 711 ------
NM_019074chr152626 65 ------
NM_019087chr531640 228 106 21212 142 ----
NM_019096chr64802 278 123 26 ------
NM_019098chr8--21359 686 ----
NM_019106chr2262625 1365 1312 833 726 702 --22097 874 --
NM_019114chr962355 2258 2056 2046 1008 964 31723 333 202 ----
NM_019116chr1683583 3535 3309 2878 2314 1345 1076 837 ----13699
NM_019555chr311349 11553 ----
NM_019556chrX31375 1245 73 ------
NM_019590chr104482 213 206 58 ------
NM_019593chr2022627 1276 --1791 12467
NM_019600chr153697 264 28 ------
NM_019610chr1----12025 --
NM_019613chr1741199 1114 868 397 --1144 --
NM_019843chr22191 ------
NM_019845chr21803 ------
NM_019857chrX41743 1677 1439 1179 ------
NM_019895chr321040 125 --1187 --
NM_019903chr1021813 1631 ------
NM_020066chr15963 844 372 163 93 ------
NM_020116chr461679 1666 1503 1459 672 115 ------
NM_020120chr241073 483 393 79 ------
NM_020122chr295158 4631 4069 784 724 525 358 226 182 25079 4812 ----
NM_020123chr103610 467 156 ------
NM_020130chr831302 1203 917 --2538 485 --
NM_020144chr751909 1447 1435 368 129 ------
NM_020147chr153840 204 50 --11081 --
NM_020148chr1843088 2361 1025 297 13001 ----
NM_020150chr104420 401 337 32 ------
NM_020152chr213956 128 94 --1140 --
NM_020157chr2051038 825 819 648 202 ------
NM_020159chr421180 601 --11127 --
NM_020177chr562767 1123 797 412 332 246 1440 12783 12955
NM_020184chr21249 ------
NM_020186chr7--1513 ----
NM_020191chr3129 ------
NM_020193chr111345 ------
NM_020194chr21637 ------
NM_020198chr172491 139 11611 ----
NM_020204chr13676 211 175 1621 ----
NM_020205chr121111 836 ------
NM_020207chr941363 868 432 49 3524 469 77 ----
NM_020225chr4271 50 --1116 --
NM_020235chr32309 258 ------
NM_020239chr142015 1559 626 168 1576 11646 --
NM_020245chr6114869 4470 4448 3640 1572 974 956 763 751 328 301 ----11274
NM_020310chr1732642 2548 940 12701 ----
NM_020315chr221949 ------
NM_020337chr442412 1943 987 882 22054 2002 12567 --
NM_020341chr2021985 1611 11405 --1529
NM_020342chr231938 1025 749 ------
NM_020346chr1121746 1222 1306 11508 --
NM_020357chr31648 11657 1340 --
NM_020381chr621357 144 11855 ----
NM_020390chr343936 3670 1530 827 44500 3946 3853 3710 ----
NM_020403chr13------1200
NM_020420chrY11465 11196 ----
NM_020423chr11478 1387 ----
NM_020425chr62732 692 21678 1473 1372 --
NM_020432chr731737 158 120 --1865 --
NM_020438chr921334 423 ----11400
NM_020440chr122726 175 12091 12713 --
NM_020443chr185363 4927 2726 2492 2318 1642 1142 234 --24562 1857 --
NM_020449chrX1303 ------
NM_020452chr161980 1883 1608 1435 360 307 --1765 --
NM_020453chr421455 1283 2333 114 ----
NM_020455chr672826 2163 947 933 807 798 489 12685 1664 --
NM_020457chr162619 226 ------
NM_020458chr222109 1413 ------
NM_020466chr664923 4895 4580 4056 3853 3330 21864 413 ----
NM_020473chrX31607 639 385 ------
NM_020474chr1831693 362 234 ------
NM_020482chr61239 --2789 609 --
NM_020532chr21290 ------
NM_020640chr361709 1464 782 755 691 75 12227 ----
NM_020642chr111546 ------
NM_020644chr11--1242 1704 --
NM_020648chr1832774 2547 1823 12260 ----
NM_020651chr241540 413 358 91 ------
NM_020654chr331502 632 433 ------
NM_020673chr2087797 5771 5421 5277 4882 2234 893 865 27334 193 ----
NM_020680chr111133 ------
NM_020686chr1622861 2449 ------
NM_020689chr2021465 520 ------
NM_020693chr111450 ------
NM_020696chr3----127 --
NM_020697chr81343 --11002 --
NM_020699chr164820 3329 1819 1533 1298 1230 --1892 --
NM_020708chr2042510 2483 1747 87 ------
NM_020711chr232504 1046 54 2856 503 12353 --
NM_020717chrX104526 4152 4033 3708 3619 3422 3101 1898 403 307 24797 789 ----
NM_020718chr1675109 4614 4429 4334 2411 1950 1904 14083 16144 --
NM_020726chr51110 ------
NM_020727chr2154000 3904 3678 1372 1027 ------
NM_020732chr61445 ------
NM_020734chr1242932 2873 533 57 1161 ----
NM_020737chr6197 ------
NM_020739chr1544005 2747 653 360 --23081 2894 13450
NM_020747chr52816 253 1775 1293 --
NM_020748chr173728 220 201 ------
NM_020749chr872093 1773 767 674 612 468 51 11523 ----
NM_020750chr621455 248 ------
NM_020752chr1032248 2046 277 1785 ----
NM_020755chr641435 1253 261 135 ------
NM_020760chr221639 1482 ----11803
NM_020761chr1711938 ------
NM_020766chrX84585 4277 4084 3585 2910 1753 1041 831 --14460 11486
NM_020769chrX3928 838 385 ------
NM_020771chr621462 466 1325 ----
NM_020772chr17168611 7792 6966 6638 6559 6430 6193 6073 5544 5305 2838 2233 1959 1935 896 512 37395 5975 5939 27619 5446 15559
NM_020774chr18105943 5715 4651 4560 4543 4221 2413 1977 1376 923 56245 4180 2313 751 116 33959 3801 1225 11389
NM_020776chr1872849 2640 2371 2361 1030 1004 879 1336 11145 12970
NM_020779chr252653 2112 1213 669 583 ------
NM_020782chr1233527 1884 1105 23900 1612 11695 --
NM_020783chr18--138 ----
NM_020786chr1671816 1631 1365 784 735 491 242 21917 1505 ----
NM_020791chr1751293 1161 1094 1008 40 ----1163
NM_020792chr352781 2643 2431 129 107 1412 --1964
NM_020794chr141436 1243 1098 343 1544 --11579
NM_020796chr522368 650 --22141 2045 1558
NM_020801chr51396 1786 --1561
NM_020810chr1463587 2958 1455 1443 648 359 3970 558 93 --12733
NM_020815chr42356 35 ------
NM_020818chr141266 ------
NM_020819chr641077 435 218 169 21029 227 ----
NM_020821chr1562057 1515 509 168 68 55 11594 ----
NM_020841chr1273466 3343 2967 971 619 405 250 13980 12952 --
NM_020844chr8146851 6076 6047 4728 3024 2727 2564 2518 1995 1630 1398 1163 515 118 36811 5554 578 26309 5128 15096
NM_020845chr1242135 1009 787 659 --12023 --
NM_020850chr1632358 945 260 1371 12441 --
NM_020853chr1251958 967 331 178 55 11000 --1673
NM_020854chr181238 11558 ----
NM_020856chr1921275 526 --11082 --
NM_020858chr153971 784 669 ------
NM_020859chr433429 1180 416 1223 13875 --
NM_020860chr461105 887 731 377 271 244 --2170 163 --
NM_020866chr132377 32 ------
NM_020868chr232012 1261 425 --21979 173 1464
NM_020870chr432106 1793 296 1239 ----
NM_020871chrX52325 2209 2067 2004 573 1237 ----
NM_020872chr331809 1681 114 ------
NM_020890chr33464 195 57 ------
NM_020897chr121075 893 2862 370 ----
NM_020899chr172909 310 ------
NM_020909chr254187 4025 3212 632 317 13097 ----
NM_020917chr1953363 2838 2457 770 451 13806 11522 1706
NM_020918chr101226 --22363 1330 --
NM_020919chr211206 2270 35 ----
NM_020920chr14151 ------
NM_020921chr1452719 1463 879 633 38 11321 ----
NM_020922chrX31485 1223 518 --21877 116 11737
NM_020929chr111151 ------
NM_020935chr2103830 3428 3294 3137 1224 1122 680 645 94 71 13033 24254 3064 --
NM_020940chr1062946 2419 1183 975 962 653 ------
NM_020948chr173400 3036 2895 2727 948 418 172 1284 ----
NM_020951chr1952290 2265 2248 540 262 11954 ----
NM_020964chr1873878 3179 3172 1420 1405 1023 44 14142 ----
NM_020975chr1041989 1891 166 64 1699 11853 --
NM_020977chr421654 706 ------
NM_020987chr10136 ------
NM_020988chr1631267 1071 1027 --11314 --
NM_021003chr14127 ------
NM_021005chr1521032 402 ------
NM_021007chr261938 1725 525 216 93 41 --1617 1447
NM_021012chr17113088 3002 2711 2245 2030 1168 1139 721 522 436 335 --12830 --
NM_021033chr1332715 2325 786 13273 ----
NM_021035chr20--21322 219 ----
NM_021038chr373276 3221 2518 2353 2217 1038 443 23249 376 ----
NM_021045chr1082503 2021 2001 1873 1054 923 810 177 12639 ----
NM_021069chr431974 1740 499 ------
NM_021072chr552528 2136 2006 332 302 ------
NM_021083chrX13141 ------
NM_021097chr223061 1939 ------
NM_021109chrX160 ------
NM_021109chrX160 ------
NM_021111chr941383 883 421 118 ------
NM_021115chr22----1139 --
NM_021116chr789053 7632 7616 7563 6865 5552 2444 1844 57943 7317 6695 6354 5912 28893 3566 --
NM_021120chrX53187 2044 1209 1040 945 11047 ----
NM_021132chr1041305 1239 532 300 ------
NM_021140chrX3851 308 115 138 11050 --
NM_021148chr742315 2239 2055 168 12472 --12483
NM_021151chr711081 1912 ----
NM_021155chr1932359 2257 2074 21057 934 ----
NM_021167chr722280 1039 32497 1881 740 12555 --
NM_021177chr6--1108 ----
NM_021183chrX42342 528 215 149 1126 ----
NM_021190chr11486 31308 543 343 ----
NM_021194chr11127 ------
NM_021220chr203422 369 47 ------
NM_021224chr91134 ------
NM_021239chr1441056 1037 897 285 ------
NM_021252chr1061435 1413 1355 619 555 197 21498 1480 1320 --
NM_021253chr61244 11277 11326 --
NM_021255chr1463604 3364 3231 902 635 272 --1217 12734
NM_021614chr5--1273 ----
NM_021620chr62685 510 --1299 --
NM_021622chr1032337 2170 863 ------
NM_021626chr171185 1463 ----
NM_021627chr331093 996 396 ------
NM_021629chr335061 4789 3592 44326 3303 1703 110 ----
NM_021643chr241700 1399 1333 1188 ------
NM_021644chr10--2790 300 --149
NM_021705chr621445 1084 1106 ----
NM_021722chr72541 52 --140 --
NM_021723chr72582 91 --140 --
NM_021728chr142849 203 ------
NM_021813chr655754 3648 1788 1058 80 ------
NM_021814chr631524 1425 1163 11478 ----
NM_021911chr555447 4341 1749 1540 833 34357 4150 168 ----
NM_021912chr1563991 3846 3428 3232 2668 1157 ------
NM_021913chr19--1370 ----
NM_021914chr1432369 1571 702 --12444 --
NM_021947chr171919 11283 ----
NM_021951chr92907 210 1717 ----
NM_021956chr621568 126 ------
NM_021958chr1------1344
NM_021960chr132289 1992 382 --1719 --
NM_021961chr1166639 6439 5440 5179 5104 1096 11788 32527 2485 2372 14909
NM_021962chr1772460 2385 2343 857 826 795 775 --11722 --
NM_021964chr375883 5408 5097 4782 936 893 356 ----26539 1232
NM_021970chr43632 294 241 ------
NM_021998chrX41270 1233 1062 1028 11403 ----
NM_021999chr131540 1122 ----
NM_022041chr1622213 1924 22508 2454 1892 1996
NM_022048chr1566206 5836 5036 827 411 283 --2643 345 15282
NM_022049chr111499 ----11491
NM_022051chr12545 454 1696 ----
NM_022058chr221958 91 ------
NM_022062chr1121679 346 ------
NM_022066chr172984 184 ------
NM_022073chr1431447 1161 261 --11376 --
NM_022079chr10--2944 261 ----
NM_022085chr621589 390 --11014 --
NM_022091chr642070 1738 990 899 --12055 12114
NM_022103chr19168 1346 ----
NM_022114chr163872 3526 1707 1639 594 313 --1471 --
NM_022118chr132258 191 1488 ----
NM_022129chr1031429 1423 51 21114 251 1102 --
NM_022130chr561027 1006 937 563 210 165 21223 439 1276 --
NM_022143chr72196 112 ------
NM_022145chr51611 2624 151 ----
NM_022154chr41866 --11107 --
NM_022156chr17173 ------
NM_022166chr16125620 5027 4863 4793 4689 4655 4617 4116 2546 1754 590 351 --14644 --
NM_022168chr21116 ------
NM_022351chr853617 2770 2529 1032 95 53573 2885 2793 1392 122 1474 --
NM_022458chr773114 3098 2889 2843 2594 2284 364 12624 --11240
NM_022459chr1375102 4934 4262 1872 1453 1108 183 35997 4660 1482 ----
NM_022469chr143276 2881 2343 1032 12948 ----
NM_022473chr1543414 757 744 616 34476 2957 1393 ----
NM_022474chr1462196 1909 1884 767 686 308 ------
NM_022475chr4127 --1681 --
NM_022482chr2042038 1838 1604 33 22132 140 31801 1000 416 --
NM_022483chr551576 696 262 249 184 31768 1370 277 11403 --
NM_022484chr72943 298 --2416 391 --
NM_022497chr3103898 3704 2885 2545 2449 776 763 388 350 207 ----13857
NM_022550chr5146 ------
NM_022552chr22785 302 1518 ----
NM_022572chr271670 1663 1528 1303 1185 1174 1157 ------
NM_022650chr54965 931 706 152 ------
NM_022658chr12180 ------
NM_022716chr152520 680 617 405 82 ------
NM_022726chr631784 565 407 11380 ----
NM_022728chr71228 ----1109
NM_022731chr1----1233 --
NM_022735chr14546 418 100 72 ------
NM_022739chr173829 342 31 ------
NM_022757chr34881 846 407 293 ------
NM_022763chr311955 12651 ----
NM_022768chr11129 ------
NM_022771chr12--1840 ----
NM_022776chr32552 46 ------
NM_022780chr261718 1575 1519 557 352 288 ------
NM_022781chr911184 13261 11019 --
NM_022826chr22363 188 ------
NM_022828chr521808 1388 ------
NM_022831chr141343 485 374 236 21810 245 1267 11376
NM_022832chr442399 2048 1610 323 12287 11013 --
NM_022838chrX1237 ------
NM_022841chr1542387 2367 1833 915 22602 2162 --12379
NM_022843chr1341360 1312 1163 138 11499 ----
NM_022844chr162945 713 ------
NM_022845chr1692252 1899 1847 1747 880 590 567 496 389 12091 1115 --
NM_022893chr253148 3109 2895 1163 766 22943 740 ----
NM_022894chr241676 527 469 272 11748 ----
NM_022898chr1484778 3633 1906 1731 1577 1237 1227 152 24571 4522 24550 515 --
NM_022900chr72411 257 11124 ----
NM_022901chr91218 21396 1302 ----
NM_022902chr5----1305 --
NM_022912chr263046 2583 2441 2258 1105 696 ------
NM_022918chr1121407 435 --11661 --
NM_022977chrX--12213 1165 --
NM_023000chr143668 240 143 11575 ----
NM_023001chr143668 240 143 11575 ----
NM_023009chr11722 ------
NM_023010chrX--1668 1780 --
NM_023034chr82519 26 ------
NM_023037chr13--1736 ----
NM_023039chr53423 102 24 --270 37 --
NM_023074chr1941274 1103 125 103 1181 ----
NM_023914chr341603 1167 164 27 ------
NM_023929chr892646 2534 2112 2043 1987 1968 789 516 442 22162 695 ----
NM_024007chr552773 2767 1938 791 719 33016 1944 48 22048 970 --
NM_024016chr172842 806 --1706 --
NM_024019chr421001 206 ------
NM_024045chr101166 ------
NM_024060chr111228 ------
NM_024061chr72557 182 ------
NM_024069chr192694 210 ------
NM_024089chr131138 ------
NM_024090chr431869 1210 390 1355 ----
NM_024095chr1231477 1344 1189 1523 ----
NM_024293chr21297 ------
NM_024311chr171164 1739 ----
NM_024312chr122222 39 ------
NM_024345chr9115362 5103 4070 3980 2080 1536 1197 810 701 314 226 24979 1656 24204 986 --
NM_024411chr2021488 370 ------
NM_024416chr941572 643 376 186 ------
NM_024424chr112960 280 1449 11273 1418
NM_024425chr112960 280 1449 11273 1418
NM_024426chr112960 280 1449 11273 1418
NM_024429chr7----1831 --
NM_024491chr3123 ------
NM_024494chr11113 1506 ----
NM_024511chr442977 2343 723 230 23409 2480 --12777
NM_024524chr332693 2190 353 --11111 --
NM_024525chr11150 197 ----
NM_024529chr141171 1066 866 373 11056 ----
NM_024539chrX1818 170 1489 --
NM_024548chr331113 299 195 11286 1690 --
NM_024561chr1321340 525 ------
NM_024563chr521835 571 ------
NM_024569chr152041 906 582 500 248 --11885 --
NM_024582chr421123 865 ------
NM_024605chr41694 ------
NM_024607chr893632 3580 3133 3050 1285 810 493 335 54 23150 1064 ----
NM_024612chr17158 --1996 --
NM_024613chr831550 1288 1148 ------
NM_024617chr91721 ------
NM_024632chr51281 160 ----
NM_024639chr621009 1003 1317 ----
NM_024645chr851495 1408 1346 1146 554 ------
NM_024646chr153675 3582 1117 891 810 12848 ----
NM_024662chr111691 ------
NM_024665chr334397 1426 230 23568 1836 ----
NM_024666chr1551539 678 653 298 61 ------
NM_024670chr1051630 1461 509 433 276 ------
NM_024674chr121035 833 12545 12965 --
NM_024676chr11502 ----11308
NM_024692chr241805 1619 754 597 1720 173 --
NM_024700chr11909 ------
NM_024702chr172558 205 ------
NM_024704chr202830 95 2945 759 ----
NM_024713chr1531038 658 171 ------
NM_024731chr161115 ------
NM_024738chr1231746 1728 1644 ------
NM_024740chr11104146 3762 3639 3372 2846 1641 1431 1381 1288 1081 23389 301 1152 --
NM_024744chr252659 1867 833 697 187 --1298 --
NM_024749chr13760 509 299 1616 ----
NM_024753chr21492 --1205 --
NM_024755chr15159 ------
NM_024761chr944495 3267 1202 333 15145 --15216
NM_024770chr2105595 5326 4856 4561 4068 2219 1728 1408 1284 1243 24448 2027 2501 66 --
NM_024772chr12545 496 --1441 --
NM_024785chr241332 1096 1049 489 ------
NM_024786chr52255 85 ------
NM_024811chr1131827 1788 761 ------
NM_024817chr1575906 5630 5362 4667 3759 1767 659 25149 254 ----
NM_024824chr141506 2699 215 21536 1334 --
NM_024831chr81716 ------
NM_024852chr11619 --1167 --
NM_024881chr1952754 2617 2539 821 349 11165 ----
NM_024899chr182264 241 ------
NM_024900chr441855 864 338 226 --11619 --
NM_024900chr441855 864 338 226 --11619 --
NM_024913chr711348 ------
NM_024920chr411146 ------
NM_024944chr21------1161
NM_024947chr3159448 7962 7185 6344 6030 5809 3493 3325 2432 1950 1414 1252 997 587 37 18021 11873 --
NM_024948chr103647 517 278 1218 ----
NM_024949chr433675 3355 1876 11738 13222 --
NM_024953chr1252793 2408 1994 1869 317 --21765 1099 --
NM_024979chr1331193 565 504 ------
NM_024989chr2108135 7376 6391 5713 2482 2057 1505 919 423 366 13225 2729 114 --
NM_024993chr23405 253 29 ------
NM_025004chr112272 40 ------
NM_025027chr192992 252 1123 ----
NM_025040chr1961538 826 551 491 457 297 ------
NM_025054chr843198 1500 995 224 23136 690 14128 --
NM_025069chr8--1155 ----
NM_025073chr1104473 4273 3858 2931 1177 947 841 559 402 33 --11133 --
NM_025074chr432884 2829 2667 22714 486 --12949
NM_025076chr2----1537 --
NM_025083chr1571578 1329 1319 386 315 277 28 ------
NM_025090chr1711206 11324 ----
NM_025107chr632001 435 358 ------
NM_025134chr1642190 1890 967 614 ------
NM_025135chr181436 ------
NM_025138chr1341124 1080 1049 917 11232 ----
NM_025146chr322416 1946 --22690 2564 --
NM_025147chr221086 1018 ------
NM_025151chr83695 674 185 1647 ----
NM_025160chr143935 3797 3545 1585 ------
NM_025181chr22604 232 ------
NM_025184chrX3848 58 35 ------
NM_025191chr142726 2628 2540 2365 12844 ----
NM_025201chr1552066 1371 373 173 85 --11322 --
NM_025208chr1152236 1828 1795 1743 274 ------
NM_025211chr91266 ----1214
NM_025221chr411303 ----1998
NM_025222chr352970 1982 914 255 151 12369 1848 --
NM_025235chr1061932 1924 1454 769 483 71 1338 ----
NM_025238chr15------11584
NM_025246chr3164 ------
NM_025250chr743022 2780 2107 125 ------
NM_025263chr621483 599 ------
NM_030579chr1633682 3638 2399 --11485 --
NM_030594chr151530 ------
NM_030621chr1454185 4029 3080 872 245 1923 ----
NM_030623chr241293 1159 568 427 1130 11664 --
NM_030625chr1062363 2100 2084 1778 791 632 11950 1680 2310 87
NM_030627chr584005 3900 3483 3005 2857 2831 2611 422 63793 3550 2909 2822 954 779 12726 --
NM_030639chrX1219 11392 ----
NM_030647chr7136099 5881 5653 5557 4932 4871 2174 1902 1876 1610 1430 1223 886 35785 1643 1394 14641 --
NM_030648chr445437 5067 3858 789 --14193 --
NM_030650chr263958 3848 3012 1407 962 489 14124 22604 478 --
NM_030664chr1071821 1719 1538 927 635 597 267 ------
NM_030670chr1211549 11664 ----
NM_030671chr1211549 11664 ----
NM_030674chr1274565 4311 3874 2129 1137 640 90 14480 24323 37 --
NM_030755chr1443003 1231 1000 138 --1777 --
NM_030758chr2211265 ------
NM_030759chr101641 ------
NM_030761chr132643 1945 303 ----12120
NM_030762chr1221984 557 11739 ----
NM_030771chr11168 ------
NM_030775chr123274 77 51 ------
NM_030780chr841550 1417 1299 446 ------
NM_030786chr181823 1800 1650 1416 692 442 225 216 --2540 504 --
NM_030790chr161211 ------
NM_030791chr1451698 1627 1503 1331 543 21277 471 ----
NM_030799chr511967 1508 ----
NM_030806chr1129340 8744 8317 7474 6263 6043 5971 2067 759 540 398 86 39446 3628 2627 13054 16212
NM_030808chr174916 910 335 103 ------
NM_030809chr123691 505 38 ------
NM_030810chr621589 390 --11014 --
NM_030881chr2232313 2120 1670 1881 ----
NM_030885chr331734 925 160 11935 ----
NM_030915chr252009 1716 703 687 589 11940 ----
NM_030918chr154420 4400 1651 1424 317 ------
NM_030920chr131744 596 559 1134 ----
NM_030923chr22563 137 1519 ----
NM_030926chr251144 1122 984 804 198 ------
NM_030938chr1721172 718 ------
NM_030949chr621514 1487 ----1152
NM_030954chr81606 1767 --126
NM_030958chr81498 1425 ----
NM_030959chr62305 72 129 1728 --
NM_030962chr112462 155 ------
NM_030963chr61612 --1248 --
NM_030964chr593643 3441 3397 2468 2297 1168 806 733 116 --11250 13673
NM_030969chr6------1454
NM_030979chr131357 ------
NM_031157chr121433 ------
NM_031216chr1811976 21532 841 1493 --
NM_031217chr112119 42 1411 ----
NM_031231chr201167 ------
NM_031232chr201167 ------
NM_031243chr762254 2193 1610 1569 955 642 ------
NM_031266chr52417 98 ------
NM_031268chr1615278 14826 ----
NM_031296chr422019 151 11886 ----
NM_031314chr14----21899 715 --
NM_031362chr272693 2381 2204 2198 1812 904 646 ------
NM_031365chr282829 2517 2340 2334 1948 1843 1040 782 ------
NM_031366chr282829 2517 2340 2334 1948 1843 1040 782 ------
NM_031371chr121243 592 ------
NM_031371chr121243 592 ------
NM_031372chr441416 1272 635 176 ------
NM_031411chr531964 1712 925 1185 12042 --
NM_031412chr122394 265 11156 ----
NM_031418chr1132788 2590 504 ------
NM_031419chr3--11325 ----
NM_031422chr181507 ------
NM_031427chr1475167 5067 4246 1903 1344 1330 580 34804 1639 278 24046 76 --
NM_031435chr1243188 3098 2270 101 --12447 12318
NM_031442chrX52470 1021 901 275 58 --12315 13058
NM_031443chr71150 --1378 --
NM_031445chr243255 2774 857 140 199 ----
NM_031453chr1012437 ------
NM_031461chr831984 1768 153 ------
NM_031469chr673709 3087 1608 1238 897 411 218 12816 ----
NM_031483chr20103367 3308 3240 3177 2933 2736 2679 2564 189 164 ------
NM_031492chr112533 390 ------
NM_031844chr143506 1167 1064 344 ------
NM_031845chr253467 3219 1120 250 148 12702 ----
NM_031847chr253467 3219 1120 250 148 12702 ----
NM_031849chr531964 1712 925 1185 12042 --
NM_031857chr531964 1712 925 1185 12042 --
NM_031860chr531964 1712 925 1185 12042 --
NM_031890chr2252601 2359 2047 917 267 12275 192 --
NM_031891chr182391 152 ------
NM_031892chrX3852 358 253 ------
NM_031904chr1132103 2074 1340 ------
NM_031911chr411951 31066 276 188 11904 1701
NM_031922chr63503 487 396 ------
NM_031935chr12933 292 ------
NM_031942chr271104 429 396 323 246 213 31 --11250 --
NM_031966chr57479 409 392 379 220 111 83 ------
NM_031990chr191130 ------
NM_031991chr191130 ------
NM_032012chr964385 4058 3817 1378 1346 1198 34839 4436 1948 --13880
NM_032025chr31444 21447 139 --1168
NM_032042chr572275 2150 1102 966 846 720 437 ------
NM_032047chr361936 1621 1599 1576 175 76 ------
NM_032102chr1153144 3136 2423 1241 67 23108 2132 ----
NM_032105chr1128014 7795 7371 6728 6642 5755 5556 5170 3133 1656 1384 679 43212 2295 1688 1516 17063 --
NM_032116chr1395600 5452 5146 5071 4542 2219 598 542 257 32092 570 481 14608 --
NM_032120chr7187 ------
NM_032121chrX52720 2320 980 943 629 22639 1061 ----
NM_032127chr111163 ------
NM_032138chr13132 ------
NM_032144chr221310 667 11393 ----
NM_032146chr31111 1449 ----
NM_032147chr124981 788 383 216 ------
NM_032153chr342107 1795 1785 417 21951 663 ----
NM_032160chr1873093 3022 2751 1059 1042 650 497 1248 11755 1234
NM_032177chr5165 ------
NM_032182chr1041313 537 395 339 1583 ----
NM_032186chr131038 455 171 ------
NM_032189chr1395051 4697 4633 4586 4535 3269 1234 402 184 --15075 --
NM_032195chr21----1527 --
NM_032199chr1033383 2866 789 13109 ----
NM_032208chr222611 395 --1651 --
NM_032217chr44555 455 397 93 ------
NM_032221chr2061786 1744 1420 1408 823 198 ------
NM_032231chr151305 ------
NM_032233chr141665 --1647 --
NM_032239chr421182 1069 1188 ----
NM_032242chr373305 2720 2472 2286 1052 1042 666 --12510 --
NM_032246chr1551158 1105 1088 930 909 ------
NM_032256chr122166 90 ------
NM_032268chr1663247 2160 539 510 366 304 12686 ----
NM_032271chr162289 173 ------
NM_032281chr1951926 719 638 598 178 ------
NM_032287chr2253214 1182 998 808 28 23946 284 ----
NM_032288chr322341 87 ------
NM_032291chr131563 518 189 11417 ----
NM_032312chr2--1798 ----
NM_032320chr112661 224 2759 697 ----
NM_032329chr254007 3799 3117 826 756 --12973 --
NM_032352chr1431206 1178 914 ------
NM_032353chr17122 ------
NM_032373chr1065407 2188 1253 740 629 133 54430 4006 1833 196 170 24895 50 35666 4636 1676
NM_032379chr112255 101 1758 ----
NM_032408chr731043 984 265 ------
NM_032410chr81939 21077 483 ----
NM_032435chr142384 2194 1926 685 --32428 2398 178 --
NM_032439chr101374 ------
NM_032440chr1052392 1067 825 357 92 22620 2461 ----
NM_032445chr1581716 1637 1030 786 698 612 592 35 12174 ----
NM_032446chr543806 2741 418 405 --23755 3658 --
NM_032451chr162651 125 ------
NM_032452chr1431480 1467 260 ------
NM_032456chr41531 ------
NM_032457chr433200 1271 176 13734 13648 --
NM_032458chrX62994 2637 1255 650 434 209 13134 ----
NM_032466chr8--11702 ----
NM_032468chr8--11702 ----
NM_032487chr3----1179 --
NM_032499chr15159 ------
NM_032503chr64881 700 677 42 --11030 --
NM_032505chr331075 858 485 1532 ----
NM_032509chr842122 1853 1693 385 12209 ----
NM_032510chr1821954 418 22217 602 ----
NM_032521chr20--13140 1649 --
NM_032523chr21125 ------
NM_032532chr63622 516 228 ------
NM_032536chr91481 ------
NM_032538chr652710 2158 1852 886 223 --22494 617 --
NM_032557chr43714 325 312 ------
NM_032558chr94572 565 517 147 21448 1420 ----
NM_032594chr141827 --192 --
NM_032599chr71463 ------
NM_032622chr431421 343 250 ----11602
NM_032632chr1431783 1617 1243 ------
NM_032642chr123274 77 51 ------
NM_032664chr831347 697 542 11552 ----
NM_032679chr1911089 ------
NM_032682chr343321 2435 477 197 1625 ----
NM_032717chr42731 238 --1218 --
NM_032727chr1041615 1528 659 622 ------
NM_032765chr52851 74 ------
NM_032777chr831437 1122 421 ------
NM_032778chr343144 905 752 611 22577 111 1987 --
NM_032800chr142252 1911 875 98 ------
NM_032801chr1131012 798 518 153 22134 951 --
NM_032804chr103980 966 94 1675 1659 --
NM_032810chr1011288 21536 1170 ----
NM_032812chr10136 ------
NM_032813chr132422 109 ------
NM_032826chr753734 3702 1939 1582 258 33410 861 376 ----
NM_032837chr1762135 697 606 519 341 122 12055 1157 --
NM_032846chr1441514 1235 499 354 1529 1456 --
NM_032857chr151209 ------
NM_032859chr1373966 3563 2436 1325 751 563 546 ------
NM_032883chr201718 --1748 --
NM_032892chr15--1350 ----
NM_032905chr102834 808 ------
NM_032936chr7128 ------
NM_032943chr112255 101 1758 ----
NM_032947chr511245 ------
NM_032960chr11943 11547 ----
NM_032961chr431376 937 258 --1562 --
NM_032968chrX134229 3920 3533 3434 3203 3191 2951 856 771 691 576 408 397 ------
NM_032969chrX134229 3920 3533 3434 3203 3191 2951 856 771 691 576 408 397 ------
NM_032973chrY134221 3912 3529 3430 3198 3186 2946 856 771 691 576 408 397 ------
NM_032975chr1883618 3329 2907 2689 2415 1380 979 444 13022 13163 --
NM_032978chr181432 21209 1036 ----
NM_032979chr181432 21209 1036 ----
NM_032980chr1883618 3329 2907 2689 2415 1380 979 444 13022 13163 --
NM_032981chr181432 21209 1036 ----
NM_032983chr722934 2595 12603 12860 --
NM_032999chr731101 427 125 --1145 --
NM_033000chr731101 427 125 --1145 --
NM_033001chr731101 427 125 --1145 --
NM_033014chr941572 643 376 186 ------
NM_033020chr183989 3937 3770 3569 1941 1851 611 493 24840 4349 34319 1096 673 --
NM_033030chr23580 492 333 11025 ----
NM_033055chr111029 2816 314 ----
NM_033056chr101601 192 ----
NM_033058chr82356 143 --1806 --
NM_033081chr20----11376 --
NM_033083chr343367 3170 1079 255 --12784 --
NM_033087chr931189 971 300 ------
NM_033088chr12708 231 ------
NM_033089chr2031197 485 265 --1152 --
NM_033119chr161686 175 ----
NM_033121chr1241735 1379 601 449 1287 21622 1370 --
NM_033135chr1152236 1828 1795 1743 274 ------
NM_033138chr731817 1695 257 193 12113 12353
NM_033139chr731817 1695 257 193 12113 12353
NM_033140chr731817 1695 257 193 12113 12353
NM_033157chr731817 1695 257 193 12113 12353
NM_033181chr643395 3069 625 197 --33936 943 70 --
NM_033211chr521967 1452 1410 ----
NM_033224chr778060 7622 7507 5798 2539 1987 450 25190 1525 12202 --
NM_033225chr831157 155 103 --1128 --
NM_033227chr51523 ----1139
NM_033228chr51563 ----1179
NM_033254chr3--199 ----
NM_033272chr23312 81 66 1322 ----
NM_033281chr54826 739 346 257 ------
NM_033285chr883578 3121 3038 1610 1530 1413 1284 198 ------
NM_033290chrX63137 2926 2627 1225 847 163 ------
NM_033300chr1----11442 11138
NM_033305chr91250 11389 ----
NM_033340chr1031193 525 105 ------
NM_033360chr1244373 3635 1051 550 ------
NM_033364chr321956 61 1370 1558 11916
NM_033380chrX3967 851 234 3210 199 92 ----
NM_033381chrX3967 851 234 3210 199 92 ----
NM_033389chr1754567 4539 3658 3393 114 ------
NM_033407chr12599 69 ------
NM_033425chr1173357 3274 3098 1255 1001 969 250 12289 ----
NM_033429chr1552932 2713 2281 716 293 --1863 12689
NM_033430chr483866 3681 3320 3160 2739 1280 794 31 13687 ----
NM_033437chr483866 3681 3320 3160 2739 1280 794 31 13687 ----
NM_033495chrX2925 256 ------
NM_033505chr2126670 6363 4304 4282 2562 2253 2011 1965 1235 1196 275 85 16728 36110 1437 1114 --
NM_033512chr842993 1083 696 366 --22629 2338 --
NM_033535chr42923 64 --31151 764 26 --
NM_033551chr553386 2507 2246 1189 668 13294 12307 --
NM_033631chr173853 2915 2445 1386 702 32 24 --13581 --
NM_033632chr421555 609 1363 1212 --
NM_033637chr1052984 2691 1388 662 172 --33193 698 194 --
NM_033656chr21125749 5587 5124 4768 3788 1966 1859 1654 1617 1315 424 232 --35949 4196 1061 --
NM_048368chr181780 1299 1313 --
NM_052832chr822635 308 1111 ----
NM_052834chr1862488 2099 1890 863 513 493 --21843 713 --
NM_052840chr151309 ------
NM_052849chr151658 ----1324
NM_052851chr1341979 966 885 376 1629 ----
NM_052864chr451902 670 602 482 309 11857 1575 --
NM_052875chr1112081 ------
NM_052876chr1931893 1701 495 --11013 --
NM_052879chr1253336 1393 1204 442 262 ------
NM_052885chr1274593 4267 3960 1970 1662 1347 1162 11449 ----
NM_052886chr821444 1428 21831 522 21825 46 --
NM_052900chr841570 1332 601 177 ------
NM_052903chr151238 --1531 --
NM_052905chr251609 1168 489 441 371 1577 --11814
NM_052906chr223285 264 234 11627 13411 --
NM_052907chr1273763 3475 1523 881 810 769 359 1984 ----
NM_052911chr186943 923 852 394 257 37 ------
NM_052913chr631045 912 290 ------
NM_052917chr263057 2461 2261 926 452 33 ------
NM_052918chr101408 13665 ----
NM_052923chr61206 ------
NM_052937chr82692 190 22201 1964 12267 --
NM_052944chr16188 ------
NM_052953chr3----170 --
NM_052954chr2152249 654 231 161 63 12079 --1481
NM_052958chr82766 555 182 ----
NM_053016chr9177619 7244 6540 5714 5701 5419 5143 4928 2224 2177 1893 1835 1751 1718 1680 898 829 47196 6706 5098 3102 17424 --
NM_053024chr331554 1396 1101 ------
NM_053043chr7125946 5739 5670 4889 4645 3990 3935 2545 2245 1667 1175 601 21634 1302 ----
NM_053044chr42955 935 ------
NM_053046chr191556 ------
NM_053056chr1122190 867 ------
NM_053064chr1442597 819 553 305 1267 ----
NM_053281chrX--1368 1112 --
NM_054016chr142014 1854 1726 45 21754 602 21832 61 --
NM_054016chr142014 1854 1726 45 21754 602 21832 61 --
NM_054016chr142014 1854 1726 45 21754 602 21832 61 --
NM_054027chr531624 535 205 12124 ----
NM_057175chr432182 2022 1699 1373 22612 2223 --
NM_057178chr1772821 2187 2167 2108 2043 742 533 --12292 --
NM_057749chr851042 992 482 270 219 ------
NM_058237chr1451066 915 702 388 315 ------
NM_058241chr23811 459 30 ------
NM_058241chr23811 459 30 ------
NM_078471chr1721215 474 ------
NM_078483chr583901 3367 3171 2745 1228 1125 825 303 ------
NM_078487chr922043 232 13329 1744 --
NM_080422chr181133 ------
NM_080546chr962343 2136 1623 648 543 440 ------
NM_080597chr183694 296 84 ------
NM_080599chr101876 ------
NM_080604chr61695 ------
NM_080607chr201931 ------
NM_080629chr131299 1239 1080 ------
NM_080630chr131299 1239 1080 ------
NM_080632chrX--1668 1780 --
NM_080645chr61331 1172 ----
NM_080650chr153934 810 436 ------
NM_080654chr112213 99 --2947 414 --
NM_080661chr11--1332 ----
NM_080672chr201469 ------
NM_080676chr2043078 2863 786 126 --1339 --
NM_080678chr21622 --2252 234 --
NM_080683chr4----1445 1468
NM_080684chr4----1445 1468
NM_080685chr4----1445 1468
NM_080717chr1211196 --11120 --
NM_080732chr191556 ------
NM_080737chrX31374 1240 965 ------
NM_080742chr61102 ------
NM_080759chr1312032 --22627 2459 --
NM_080760chr1312032 --22627 2459 --
NM_080764chr2263159 3113 2920 2897 795 305 --13223 --
NM_080798chr101174 ------
NM_080799chr101174 ------
NM_080800chr101174 ------
NM_080801chr101174 ------
NM_080802chr101174 ------
NM_080803chr101174 ------
NM_080804chr101174 ------
NM_080805chr101174 ------
NM_080806chr101174 ------
NM_080807chr101174 ------
NM_080808chr101174 ------
NM_080809chr101174 ------
NM_080810chr101174 ------
NM_080811chr101174 ------
NM_080812chr101174 ------
NM_080813chr101174 ------
NM_080814chr101174 ------
NM_080815chr101174 ------
NM_080821chr2052364 2327 1851 1534 842 ------
NM_080840chr20--1129 ----
NM_080841chr20--1129 ----
NM_080867chr1465096 4982 4370 4220 4107 905 31649 1237 133 14358 --
NM_080872chr884026 3540 3128 2840 2565 1350 790 650 1212 1984 --
NM_080874chr43347 215 45 ------
NM_080923chr12266 149 168 ----
NM_130387chr341214 1205 873 141 11015 164 --
NM_130391chr943151 1377 926 412 130 ----
NM_130392chr943151 1377 926 412 130 ----
NM_130393chr943151 1377 926 412 130 ----
NM_130435chr1032939 644 624 1229 ----
NM_130436chr2142203 1963 1113 292 22659 2454 ----
NM_130438chr2152780 2540 869 301 184 33236 3031 458 1401 --
NM_130469chr141645 ------
NM_130808chr31362 2401 71 ----
NM_130809chr562938 1217 1051 982 827 249 --11040 --
NM_130838chr1511255 ------
NM_130839chr1511255 ------
NM_130846chr1241037 759 714 682 1690 ----
NM_133171chr20------1184
NM_133264chr1763648 3315 2884 2690 2451 940 12748 22788 542 --
NM_133265chrX22848 1341 --1177 --
NM_133330chr451140 704 509 298 187 --2975 912 --
NM_133331chr451140 704 509 298 187 --2975 912 --
NM_133334chr496219 5256 5194 4744 2352 1223 1214 1048 110 1536 ----
NM_133335chr451140 704 509 298 187 --2975 912 --
NM_133367chr6103463 3452 3376 3158 3063 2863 2851 1085 823 589 --11148 13368
NM_133370chr483210 2352 1427 1109 1060 950 98 69 --11026 --
NM_133372chr522834 663 12402 ----
NM_133433chr52601 211 1782 ----
NM_133443chr1632257 1826 296 ------
NM_133474chr4--11055 1432 --
NM_133477chr463172 3134 2761 2147 340 325 ------
NM_133486chrX1438 --1451 --
NM_133493chr6104682 3588 3267 1763 1607 767 659 578 222 88 ------
NM_133496chr153971 2831 1656 1264 759 24048 3778 ----
NM_133503chr12--2775 486 ----
NM_133504chr12--2775 486 ----
NM_133505chr12--2775 486 ----
NM_133506chr12--2775 486 ----
NM_133507chr121142 2953 664 ----
NM_133631chr31596 ------
NM_133638chr51561 21320 903 11183 --
NM_133642chr2231273 1236 906 ------
NM_133646chr265437 5366 5141 4974 4453 158 24483 511 12226 --
NM_133647chr1563814 3396 2703 1470 802 578 11123 ----
NM_134265chr1741147 957 903 66 --11010 --
NM_134442chr221271 243 11627 1285 --
NM_138270chrX23363 137 33260 1237 1225 ----
NM_138286chr1953810 3660 2658 543 358 23913 1100 13936 --
NM_138288chr1451923 1495 424 376 343 21802 1775 22136 220 --
NM_138292chr1173542 3503 3268 2954 2556 679 195 2961 359 ----
NM_138316chr103997 479 160 --1350 --
NM_138319chr1521102 460 --1309 --
NM_138333chr942602 2516 1013 308 --12451 --
NM_138335chr42576 271 149 ----
NM_138340chr181566 1222 ----
NM_138344chr141335 ------
NM_138357chr103649 529 369 ------
NM_138370chr21187 ------
NM_138375chr184940 823 459 397 ------
NM_138396chr12----1774 --
NM_138423chr1552322 2303 2230 732 56 ----11770
NM_138426chr722094 396 --11883 --
NM_138437chrX1306 ------
NM_138444chr1394212 3911 3752 3503 3417 1665 1329 329 278 14611 11193 --
NM_138448chr22363 165 ------
NM_138453chr5------171
NM_138455chr81120 ------
NM_138457chr643116 3080 1145 570 ------
NM_138459chr663579 3267 1463 1176 1088 68 ------
NM_138468chr231708 1110 1072 22301 1472 ----
NM_138473chr1284553 4477 4220 4066 3994 2030 1865 623 34337 3331 1759 ----
NM_138494chr752579 2247 2154 1124 810 11791 ----
NM_138559chr221167 1059 ------
NM_138569chr61248 ------
NM_138572chr623251 2789 11245 ----
NM_138576chr1484778 3633 1906 1731 1577 1237 1227 152 24571 4522 24550 515 --
NM_138609chr51405 ------
NM_138610chr51405 ------
NM_138615chr3161 ------
NM_138621chr274132 3802 3281 3141 2878 2611 294 --13831 --
NM_138633chr631443 1295 55 --11704 --
NM_138635chr752988 2142 252 171 66 ------
NM_138638chr1432369 1571 702 --12444 --
NM_138711chr32169 130 ------
NM_138712chr32169 130 ------
NM_138713chr16158231 7920 7660 7469 7193 6603 6106 5995 5640 5498 5116 1659 888 239 132 27015 683 27835 368 --
NM_138714chr16158231 7920 7660 7469 7193 6603 6106 5995 5640 5498 5116 1659 888 239 132 27015 683 27835 368 --
NM_138730chr62464 315 1130 1457 --
NM_138731chr14114253 3514 3465 3362 2650 1609 1403 1337 1201 747 296 13875 ----
NM_138735chr22246 75 ------
NM_138766chr52521 135 ------
NM_138782chr531701 665 294 32305 1820 1650 ----
NM_138798chr2--1111 132 --
NM_138799chr241944 1714 1471 396 ------
NM_138811chr741073 895 319 126 ------
NM_138821chr52521 135 ------
NM_138822chr52521 135 ------
NM_138927chr214807 757 345 188 ------
NM_138961chr112416 134 ------
NM_138970chr1432267 1885 1581 31981 1592 350 ----
NM_138971chr1153123 2478 2428 270 222 ------
NM_138971chr1153123 2478 2428 270 222 ------
NM_138972chr1153123 2478 2428 270 222 ------
NM_138972chr1153123 2478 2428 270 222 ------
NM_138973chr1153123 2478 2428 270 222 ------
NM_138973chr1153123 2478 2428 270 222 ------
NM_138980chr4--1566 ----
NM_138981chr4--1697 ----
NM_138982chr4--1566 ----
NM_139015chr1241373 1244 1106 1099 --11414 --
NM_139035chrX3797 765 586 ------
NM_139045chr91117 --1598 --
NM_139048chr32860 227 --1851 --
NM_139057chr1542829 2776 2102 735 12318 ----
NM_139062chr172439 131 1152 ----
NM_139067chr12--1293 ----
NM_139068chr51707 ------
NM_139069chr51707 ------
NM_139076chr441127 1008 159 63 2111 73 --1395
NM_139126chr62875 39 ------
NM_139131chr112264 161 ------
NM_139135chr12313 106 ------
NM_139136chr122254 127 ----1969
NM_139164chr5