TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-421
miRNA Sequence: AUCAACAGACAUUAAUUGGGCGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000090chr22922 727 1890 ----
NM_000112chr555534 5109 4342 3586 2033 24844 4095 11480 11324
NM_000176chr52118 90 --1396 22811 1333
NM_000217chr1222133 149 13242 ----
NM_000259chr1586333 6013 5351 4751 854 576 482 380 11548 --13964
NM_000266chrX1157 ------
NM_000314chr102649 180 ------
NM_000332chr666327 4873 4613 4559 4352 1854 ----15206
NM_000408chr243411 3021 1363 148 --12410 13291
NM_000461chr344211 4076 3301 93 --13183 14504
NM_000719chr1246492 5063 2259 1448 --1127 11562
NM_000726chr211267 --132 1378
NM_000814chr1564203 4078 2895 2801 767 647 --11356 --
NM_000855chr111101 ------
NM_000875chr1566919 6436 5068 4769 1917 1119 16071 11031 24293 1449
NM_000891chr1733188 646 423 1466 149 12973
NM_000935chr341111 939 797 255 ------
NM_000944chr41790 ------
NM_001001396chr132788 2756 1054 14433 --23144 174
NM_001001481chr843090 1257 710 166 32562 1319 1265 ----
NM_001001664chr254087 3846 2799 2735 1443 13045 ----
NM_001001668chr1954299 2793 1576 491 114 34012 3798 1687 13417 12987
NM_001001787chr11476 ------
NM_001001875chr91283 ------
NM_001001890chr2143413 3259 1647 799 --13789 --
NM_001002838chrX1332 ------
NM_001003652chr1867977 5539 3349 2292 1475 1433 38477 6774 2874 22696 927 13061
NM_001003674chr1866626 6448 6350 5521 4923 777 1599 16500 11102
NM_001003712chr1213440 ----13528
NM_001003792chr331114 790 111 ------
NM_001003940chr151103 ----1226
NM_001004051chrX187 ------
NM_001004720chr21744 ------
NM_001005473chr556397 5998 5655 4589 452 16201 --14393
NM_001006636chr22969 296 ------
NM_001007226chr1751237 569 205 107 54 ------
NM_001007246chr2131856 1782 620 21960 1812 ----
NM_001007257chr151465 1402 1192 536 390 11080 ----
NM_001007794chr11528 ------
NM_001008225chr72505 300 1162 ----
NM_001008408chr776344 6123 5836 4865 1828 1590 521 ------
NM_001008539chr855169 4784 4504 4495 2077 ------
NM_001008660chr1121474 1269 --11160 --
NM_001008701chr1933088 2313 1928 ------
NM_001009899chr375412 5379 4818 1363 1127 486 345 25178 476 --15271
NM_001010891chr5106780 5597 5492 5283 4525 4360 2533 2384 1174 39 --14980 --
NM_001010942chr1221067 46 ------
NM_001010986chrX42445 2365 1677 757 ------
NM_001012755chrX44824 1384 1217 830 13651 1154 --
NM_001012968chrX62746 2739 2246 913 610 364 11992 ----
NM_001014797chr1048053 2789 2664 130 37901 6974 3291 17810 --
NM_001017523chr1221482 1405 ----1146
NM_001018090chr1532014 641 89 11103 ----
NM_001024948chr143447 2619 2604 876 21325 1027 23493 2193 --
NM_001025076chr10146113 5890 5871 5466 5321 4481 3996 3978 1466 1258 973 838 785 442 ------
NM_001025077chr10167471 7248 7229 6824 6679 5839 5354 5336 4733 2824 2616 2331 2196 2143 1800 1351 11147 ----
NM_001025079chr363997 3644 3219 1628 1070 244 13224 196 --
NM_001025108chr232711 2699 2653 1811 1488 13952
NM_001031623chr611513 ------
NM_001031712chr61300 ------
NM_001032283chr122696 76 ----154
NM_001032380chr1041996 693 498 363 1375 21453 1421 1568
NM_001033057chr321577 1446 --21554 354 11346
NM_001035chr111064 ------
NM_001037339chr12638 230 ----1444
NM_001039395chr951997 463 171 101 91 1572 ----
NM_001039590chrX33244 2778 260 ----11038
NM_001039618chr1144883 2052 1614 1002 34899 4134 985 11369 12213
NM_001039840chrX55194 1992 876 281 142 --15816 14494
NM_001039937chr1364070 3806 2987 720 101 67 --12846 --
NM_001040100chr311261 ------
NM_001040157chr44886 717 297 288 1658 12541 1361
NM_001040284chr1664228 2135 1924 1218 1019 347 12174 35490 3818 1442 --
NM_001040429chr1311063 --148 --
NM_001042537chrX52176 628 509 453 439 --11624 --
NM_001042555chr1274632 4108 2976 1352 957 884 792 --1608 --
NM_001042604chr34939 582 537 208 13858 --11120
NM_001044385chr222717 947 --22686 1017 --
NM_001071775chr1331923 613 390 ------
NM_001106chr369349 8954 8723 7202 3774 2213 17376 18122 16290
NM_001149chr1031318 940 539 ------
NM_001167chrX85806 5681 5113 2615 2056 1752 1345 488 --11800 --
NM_001200chr201789 ------
NM_001201chr433072 1324 977 13924 ----
NM_001204chr247419 6418 5042 450 1479 ----
NM_001241chr261905 1559 955 947 448 198 11598 ----
NM_001259chr762341 1100 952 945 933 755 ------
NM_001271chr1522602 980 --13129 --
NM_001310chr121692 ------
NM_001356chrX42500 2247 2158 990 21907 1661 1352 --
NM_001358chr41344 ------
NM_001363chrX2743 70 --1731 --
NM_001364chr1143211 863 649 92 ------
NM_001412chrX23270 713 22373 945 12473 --
NM_001426chr21660 ------
NM_001497chr942663 2175 779 694 ------
NM_001650chr1843291 1098 1018 110 12859 ----
NM_001690chr332185 1993 655 12469 ----
NM_001695chr832751 2665 932 13541 --1407
NM_001704chr61437 ------
NM_001792chr181861 ------
NM_001806chr1922556 1139 ------
NM_001834chr51272 ------
NM_001855chr92347 83 1769 ----
NM_001858chr624184 3612 11936 33369 1286 1256 1480
NM_001901chr611019 ------
NM_001949chr652830 2806 2216 694 651 12230 ----
NM_001981chr112069 ------
NM_002025chrX99196 9139 6930 5707 3308 2945 2567 2251 1791 18627 --17180
NM_002078chr31654 ----1486
NM_002114chr61143 ----1353
NM_002126chr1743165 3079 1124 981 14163 ----
NM_002128chr1372283 2014 959 471 421 357 270 ------
NM_002136chr122585 515 ------
NM_002395chr63458 361 254 ------
NM_002398chr241372 1351 1137 957 ------
NM_002401chr1712128 ------
NM_002407chr11----159 1125
NM_002516chr191315 ------
NM_002524chr1194 ----1424
NM_002569chr151318 ------
NM_002577chr383944 3093 1413 1325 845 563 511 310 ------
NM_002581chr934200 3785 1277 25138 1161 15650 --
NM_002607chr721295 1083 ------
NM_002628chr321121 988 ------
NM_002635chr122296 37 149 --1160
NM_002667chr611075 --1249 1177
NM_002731chr142981 2026 413 327 185 151 --
NM_002814chrX4278 218 134 40 1763 1202 --
NM_002834chr1243838 3311 3230 406 13402 1696 --
NM_002890chr52923 746 1657 ----
NM_002906chr1121866 888 ----1276
NM_002941chr331208 1048 174 ----1226
NM_003010chr172539 281 ------
NM_003081chr2011009 --1322 --
NM_003107chr652594 2293 708 302 287 ------
NM_003113chr21349 ------
NM_003144chr63741 472 317 1274 ----
NM_003221chr614213 ------
NM_003246chr1521889 1531 ------
NM_003342chr1743215 3187 1137 104 --22779 2288 --
NM_003412chr322908 2288 ----1397
NM_003430chr1911643 ------
NM_003468chr254200 3155 471 279 102 ------
NM_003474chr1032025 285 216 ------
NM_003478chr1151099 748 669 633 328 13156 ----
NM_003564chr11660 ------
NM_003574chr1864322 4194 4148 1347 532 363 --12032 22174 2064
NM_003590chr253032 2766 754 639 359 1331 22742 1389 11326
NM_003603chr421940 1558 ------
NM_003607chr144348 1429 1169 478 ------
NM_003615chr313664 ----13085
NM_003750chr104879 705 611 246 ------
NM_003873chr1052421 2058 1873 246 103 11811 2215 71 --
NM_003899chr1352587 2574 2559 2168 1843 12350 12506 127
NM_003924chr431700 1294 1245 ----21553 1145
NM_003941chr732134 1567 119 1483 12160 --
NM_004114chrX31227 1066 830 ----157
NM_004136chr1521105 381 1309 ----
NM_004171chr1199479 8181 7550 6763 6357 2758 2387 1971 1028 26225 1093 13689 --
NM_004232chr1853644 3445 1331 751 657 1440 --13044
NM_004261chr12893 224 ------
NM_004272chr531385 662 453 ----11996
NM_004293chr923730 3153 23296 527 ----
NM_004346chr421399 550 ----11187
NM_004392chr1332517 1849 607 --2910 796 --
NM_004457chr231395 1289 503 21220 489 ----
NM_004458chrX31008 558 154 2309 79 ----
NM_004529chr931306 983 87 ------
NM_004573chr151272 ------
NM_004586chrX25219 4988 1600 13407 1639
NM_004622chr242144 1893 1882 205 1517 1307 --
NM_004689chr141307 ----1319
NM_004762chr1711934 ------
NM_004774chr1723115 932 ------
NM_004788chr112874 268 --32569 706 622 --
NM_004795chr1341847 1819 1747 698 ------
NM_004852chr181213204 9756 5652 5456 5183 4902 3379 3283 3183 2269 1222 909 311881 5046 1227 513708 12706 10450 3026 2870 110091
NM_004973chr631496 1489 1325 --1327 1162
NM_005044chrX34480 4105 3786 1733 44560 4240 4118 1517 --
NM_005095chr11313 --12065 170
NM_005124chr61749 ------
NM_005126chr322007 1709 ----1389
NM_005156chr944690 4569 4451 1632 25189 556 ----
NM_005168chr231675 1347 1243 21406 1359 --11694
NM_005180chr103683 548 196 11291 ----
NM_005194chr201441 --1448 --
NM_005201chr32856 125 1214 ----
NM_005238chr1152828 2196 912 560 57 13094 13073 1994
NM_005318chr221291 ----1801
NM_005339chr454012 3193 2933 1057 381 24299 335 13049 --
NM_005358chr132181 28 ----1234
NM_005375chr641031 923 873 110 ------
NM_005493chr63672 649 554 ------
NM_005504chr1286527 5227 4433 4408 4051 2630 1309 66 --15123 --
NM_005596chr955280 5169 4283 1087 475 22420 2397 25709 5109 12489
NM_005599chr141470 1103 976 535 1370 ----
NM_005602chr31425 ----11216
NM_005668chr523015 692 --13337 13475
NM_005822chr631462 283 60 ----1641
NM_005828chr1754498 4356 1806 1028 304 ------
NM_005841chr42766 124 ----11094
NM_005920chr133873 1451 1348 --23747 126 --
NM_005922chr62417 381 ------
NM_005941chr833699 2980 1569 --23838 635 --
NM_005955chr174260 2044 1881 691 567 406 269 --44802 3943 2202 706 --
NM_005968chr192218 75 ------
NM_005996chr1221506 1385 ------
NM_006037chr234214 3495 1750 --11529 --
NM_006106chr1132911 2205 716 13099 ----
NM_006186chr25977 943 367 308 179 ------
NM_006194chr1431234 1121 395 ------
NM_006195chr921114 242 ------
NM_006206chr422757 2259 ----1478
NM_006212chr165431 4325 3676 3554 379 368 11672 --15282
NM_006216chr22617 530 ------
NM_006246chr141973 --1281 --
NM_006252chr166981 6885 6380 5956 2873 2351 37282 2724 489 --11120
NM_006300chr1921914 171 ------
NM_006320chr41191 --1827 --
NM_006380chr1753616 3474 1532 606 270 33913 3815 1503 23715 3069 --
NM_006420chr2052920 2824 2513 452 193 ------
NM_006496chr131992 1690 44 11345 ----
NM_006526chr2022107 587 1567 11541 --
NM_006559chr12260 76 --1969 --
NM_006572chr1742812 1147 940 438 22140 1155 1176 --
NM_006577chr211059 ------
NM_006595chr111345 ------
NM_006599chr1653126 2409 1649 1499 167 25370 1572 37366 6382 487 17704
NM_006620chr623392 3375 ------
NM_006624chr1052020 1608 1469 442 245 --21841 491 --
NM_006628chr1533636 1214 656 1661 --1698
NM_006675chr1233320 968 600 ------
NM_006777chrX2757 138 ------
NM_006805chr541688 1469 677 402 1698 ----
NM_006875chrX182 ------
NM_006885chr1664170 3802 2639 867 856 777 ------
NM_006920chr22804 680 --1471 --
NM_007011chr1566510 5818 4256 2352 2253 1494 --16192 11371
NM_007106chr1362845 1939 1907 1762 527 214 ------
NM_007190chr102766 445 ------
NM_007192chr1411183 ----1960
NM_007212chr111710 ------
NM_007249chr1388884 8111 7774 7212 7164 1690 1681 1158 28048 1952 29261 2244 15838
NM_007294chr1741165 1127 1027 329 1516 --11261
NM_007373chr1041581 1366 357 227 1617 ----
NM_007375chr152643 2228 2222 2154 1820 ----11003
NM_012081chr541498 1331 973 919 23220 2506 11247 1103
NM_012153chr1122587 453 ------
NM_012214chr255706 4643 4594 2570 2337 26423 6273 26343 939 --
NM_012248chr161742 ------
NM_012262chr145128 4081 3333 1338 24430 4172 --24380 4267
NM_012317chrX1639 ------
NM_012328chr721279 1061 ------
NM_012388chr151590 33050 2939 108 --1611
NM_012395chr743408 2609 2419 567 ------
NM_012471chrX2470 351 ------
NM_013231chr1414393 11096 --1349
NM_013238chr1311912 ------
NM_013261chr453700 2792 2628 2538 910 --23613 1324 --
NM_013283chr52862 375 --1361 --
NM_013316chr72311 201 ----1228
NM_013354chr81919 ------
NM_013433chr1922040 727 ------
NM_013436chr22599 39 --2716 653 --
NM_013437chr821057 1036 ------
NM_013446chr731394 1285 1049 11245 --1192
NM_014011chr252113 1994 901 781 541 1914 ----
NM_014071chr201439 --1176 --
NM_014112chr865341 5053 3865 3363 2142 430 13682 1862 --
NM_014264chr42607 48 --1615 --
NM_014319chr1221704 467 --21296 438 --
NM_014363chr132854 500 11170 ----
NM_014423chr565289 4760 4751 3646 868 136 21939 802 15137 1383
NM_014554chr1252119 794 367 101 52 ------
NM_014571chr122934 2316 13064 ----
NM_014635chr241368 640 598 190 ------
NM_014705chr752116 1940 1841 1527 1332 --11407 --
NM_014774chr123114 2067 --12948 12831
NM_014791chr91247 ------
NM_014820chr332003 394 301 2701 88 11551 21600 172
NM_014824chr1141812 1557 453 190 12026 11582 --
NM_014830chr1263737 2795 2565 541 173 69 13392 22586 852 --
NM_014841chr641084 1000 538 318 --11146 --
NM_014873chr164658 1564 1403 529 506 315 --14255 24443 1104
NM_014912chr1032944 2634 354 ------
NM_014917chr11969 --1222 --
NM_014939chr182361 141 ------
NM_014947chr153105 2051 947 734 237 ----12972
NM_014962chr2022099 532 12833 ----
NM_015042chr1534343 3177 103 ----23740 3414
NM_015045chr1041458 547 376 366 1493 ----
NM_015092chr1674171 3998 3776 3023 1509 1097 483 --13149 --
NM_015129chrX1399 ------
NM_015130chr431311 204 68 21205 1181 1312 1160
NM_015155chr101751 ------
NM_015156chr1463842 2918 2829 1586 1433 183 11603 1438 --
NM_015173chr42291 191 ----11744
NM_015185chrX3668 458 212 ----186
NM_015206chr1553550 3324 2738 2364 1269 33419 132 92 ----
NM_015215chr122284 1985 ----23095 262
NM_015236chr431482 1078 47 1301 ----
NM_015252chr23782 379 77 ------
NM_015272chr1631951 1755 1528 1146 ----
NM_015285chr1831752 430 298 ----1881
NM_015310chr898298 8160 6949 5758 5730 5169 2901 2698 563 22241 1556 ----
NM_015317chr252055 1835 871 860 711 22321 1805 12391 --
NM_015455chr544056 3831 2915 1258 13430 ----
NM_015542chr101860 ------
NM_015554chr153668 558 540 1402 11974 --
NM_015560chr342760 939 301 215 --1776 --
NM_015569chr143067 1577 763 433 ----13913
NM_015576chr362932 2641 2361 638 540 302 ----1436
NM_015626chr1731228 1161 987 1273 ----
NM_015670chr172478 172 ------
NM_015878chr821797 515 ------
NM_015885chr112832 197 ----149
NM_016009chr154154 4128 2983 1538 1098 14048 24636 1025 --
NM_016028chr111901 --21228 1221 --
NM_016083chr633704 1230 215 --13186 --
NM_016107chr521275 49 --11238 --
NM_016132chr1583048 2960 1350 1127 999 975 726 263 13284 ----
NM_016205chr41903 ------
NM_016206chr377649 7588 6723 3241 2641 2407 481 ----28641 3009
NM_016217chr663600 3566 3117 2675 2229 121 --23335 1129 1813
NM_016271chr1831472 606 258 ------
NM_016322chr951266 948 504 411 128 12653 --151
NM_016353chr811992 ----1851
NM_016441chr282268 2070 1809 1729 1610 883 859 326 1905 ----
NM_016530chr1553337 1423 1225 1048 262 ------
NM_016588chr62690 318 ------
NM_017420chr1433550 1352 1174 ----11299
NM_017508chr1162377 2181 998 332 200 185 --1776 --
NM_017633chr653766 3453 3330 986 828 23461 3421 ----
NM_017641chr1221003 730 ------
NM_017780chr81855 ------
NM_017799chr1421762 1498 ----11879
NM_018064chr6249 41 ------
NM_018110chr1621078 1012 ------
NM_018149chr171169 ------
NM_018159chrX31082 233 182 --1650 --
NM_018200chr1512391 --1811 12525
NM_018243chr41159 ------
NM_018247chr662938 2540 2040 518 332 139 ------
NM_018330chr1031092 686 506 ------
NM_018364chr133614 1500 758 ----1729
NM_018403chr342561 1535 984 841 ------
NM_018424chr911546 --1187 --
NM_018482chr812217 1995 --12392
NM_018557chr221729 1488 ------
NM_018977chrX1973 ------
NM_018999chr1064939 4715 4079 3268 3142 1545 14061 11326 --
NM_019004chr71748 ------
NM_019857chrX11549 ------
NM_020116chr431417 1263 546 ----11443
NM_020122chr245145 4375 1744 1580 --11837 25839 717
NM_020159chr421656 1647 1228 ----
NM_020182chr2053576 3385 3290 607 233 12624 1677 --
NM_020198chr1721219 373 ------
NM_020390chr344231 1428 574 446 1869 33171 3156 647 --
NM_020403chr1341139 1115 662 650 11096 ----
NM_020440chr112469 --12779 --
NM_020456chr133614 541 111 ------
NM_020466chr621929 48 21602 1314 --13759
NM_020640chr31558 ------
NM_020644chr113357 110 94 ------
NM_020651chr231510 367 69 --1338 --
NM_020673chr2067754 7607 6168 2830 1687 291 --12131 --
NM_020748chr1712023 ------
NM_020772chr17128032 7257 6648 6416 6046 5634 5328 2843 1984 1622 1292 627 18681 --11670
NM_020801chr542171 1627 887 775 12029 --1867
NM_020854chr1831551 1303 172 --11495 --
NM_020856chr1931525 182 81 ------
NM_020860chr421045 993 1307 ----
NM_021033chr1343376 3117 2532 2483 ------
NM_021038chr342329 2100 735 196 12420 ----
NM_021079chr1733325 1091 819 --23159 72 12515
NM_021097chr252511 2460 1173 1067 388 --12013 --
NM_021190chr111203 ------
NM_021238chr122808 567 ----12067
NM_021252chr1071886 1878 1653 1607 1364 827 307 ------
NM_021629chr344518 3145 990 253 ----11327
NM_021914chr14190 --12432 1186
NM_021964chr325139 1289 14678 --1692
NM_022041chr1642575 1919 1739 712 32690 2482 241 --1187
NM_022658chr1221067 1057 ------
NM_022776chr341621 1402 1369 1173 ----1612
NM_022781chr973324 2641 2414 1083 930 826 622 --23034 426 --
NM_022843chr1331066 1050 76 ------
NM_022898chr1494761 4656 4544 3970 3407 3044 2961 731 316 --33334 1372 894 --
NM_024295chr821619 712 ----192
NM_024665chr354645 4436 2876 1648 1000 14088 23704 748 --
NM_024674chr11856 ------
NM_024896chr922537 397 --1196 --
NM_024947chr3179508 9405 9361 9195 8895 8351 8253 7502 7335 7240 7197 6447 5888 2475 1758 1674 712 11258 28391 7950 13123
NM_025132chr41331 ------
NM_025160chr164216 3340 2999 2785 640 337 32871 224 212 --11500
NM_025191chr163399 2556 1368 1343 1284 307 23404 1373 --11122
NM_030625chr1032420 2355 571 22496 1785 ----
NM_030627chr5--34151 4054 1411 --23289 1225
NM_030647chr775870 5769 4822 4662 4505 1105 279 26296 1199 --24513 1036
NM_030806chr163661 2448 1193 494 241 221 --1311 --
NM_030953chr5163 ------
NM_031272chr171271 ------
NM_031291chr41694 ------
NM_031439chr841933 1793 1681 1595 ------
NM_032042chr532396 1988 941 --12382 --
NM_032102chr1133065 633 190 12676 --12373
NM_032124chr181128 ------
NM_032373chr1055386 5317 1689 857 722 --25850 5807 --
NM_032410chr81916 ----11192
NM_032420chr51699 ------
NM_032457chr443746 3018 2705 2682 ------
NM_032466chr821710 365 ----21088 408
NM_032560chr141705 ----134
NM_032569chr1611715 ------
NM_032632chr1451918 1358 768 483 48 ------
NM_032968chrX61367 983 613 507 489 292 ------
NM_032973chrY51367 983 613 507 292 ------
NM_033224chr776796 3150 2801 2417 1924 440 272 --17819 --
NM_033505chr286448 5788 5417 5334 4164 2291 1838 1351 14660 ----
NM_052936chrX1911 --1774 --
NM_052937chr842661 1777 475 463 ------
NM_053056chr1131058 347 128 ------
NM_133264chr1772940 2932 2663 2596 1476 1274 311 ------
NM_133265chrX33062 2932 987 --13074 --
NM_134428chr92327 91 --144 --
NM_138300chr141569 1544 1073 206 ----11728
NM_138333chr951979 1743 1707 927 351 31712 887 230 --11910
NM_138444chr1334313 3951 1301 14144 ----
NM_138459chr612291 ------
NM_138473chr1254873 4466 720 554 120 --1224 --
NM_138927chr211915 ------
NM_144571chr4106077 6041 5928 5821 4959 2548 2451 1200 632 34 11220 11022 12564
NM_144578chr1475004 4588 4542 4430 2115 1834 1203 --13570 11826
NM_144976chr191717 ------
NM_145025chr61179 --11141 --
NM_145117chr1152862 2837 2697 252 225 ------
NM_145257chr113539 ------
NM_145284chrX32201 774 747 --2620 422 --
NM_145753chr331680 1545 433 ------
NM_145808chr742014 1142 1090 931 1344 ----
NM_145858chr212338 76 ------
NM_152271chr811079 ------
NM_152556chr752539 2039 2007 708 334 --1978 1883
NM_152624chr557136 7070 5227 2079 2007 12864 12128 147
NM_152653chr31220 ----1610
NM_152835chr132725 2261 1043 11130 ----
NM_152902chr131788 1489 406 ------
NM_152903chr1332646 1101 27 ------
NM_153207chr1243712 3124 2834 2517 --13890 11429
NM_153634chr1231489 296 183 ------
NM_173078chrX160 ------
NM_173083chr111217 ------
NM_173172chr251285 1251 997 616 487 --1180 --
NM_173468chr444651 4618 1684 298 1713 11128 12429
NM_173495chrX22401 1993 ------
NM_173500chr152465 96 ----11367
NM_173511chr283938 2923 2479 1436 1191 1062 566 23 ------
NM_173808chr123906 2745 --14047 --
NM_173851chr831563 1514 784 22965 2761 ----
NM_174911chr843719 3672 1275 839 23785 3508 ----
NM_175607chr33628 516 89 11570 ----
NM_175856chr54165 118 59 52 ------
NM_175866chr11422 ------
NM_177424chr141999 1404 832 812 154 11791 --
NM_178505chr1032960 2598 1025 --12608 --
NM_181358chr143778 2915 187 176 22844 1450 13219 --
NM_181504chr553095 1670 1095 904 888 ------
NM_181672chrX2611 104 ------
NM_182485chr453741 3658 2842 1435 457 23334 2349 ----
NM_194291chr822502 2474 1213 --11101
NM_197941chr532865 1051 980 ------
NM_198074chr13272 237 211 ------
NM_198273chr552373 2352 2016 174 167 --11264 11045
NM_198279chrX21035 264 1336 ----
NM_198490chr313086 ------
NM_198503chr122064 792 ------
NM_199320chr431837 493 195 12899 ----
NM_203459chr12358 126 --12485 --
NM_206854chr645277 1159 506 456 1838 1158 14796
NM_207371chr1021070 49 ----11574
NM_207406chr4136499 6223 5870 5423 4661 4032 4018 2388 2376 1132 776 621 601 16214 26543 5905 --