TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-423-5p
miRNA Sequence: UGAGGGGCAGAGAGCGAGACUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr882193 2066 1767 1667 922 589 238 183 22519 2230 42167 1659 610 31 --
NM_000051chr1122589 2215 22205 1228 1701 --
NM_000080chr174918 834 364 90 --1603 1249
NM_000088chr17131218 1187 1169 1154 1138 1125 508 395 382 365 356 317 28 190 ----
NM_000090chr21812 --1618 --
NM_000094chr3----2269 72 --
NM_000166chrX5580 248 232 138 86 --2597 58 --
NM_000183chr2----1100 --
NM_000188chr101490 1208 130 --
NM_000202chrX83936 2766 2716 2694 2500 2480 234 41 11565 22632 2412 --
NM_000304chr171413 --21037 383 --
NM_000334chr17142215 2177 2033 1996 1940 1869 1795 1782 1578 1467 713 514 272 233 1436 52102 2085 1958 411 290 2601 335
NM_000337chr585349 5115 4962 4708 4655 1050 704 537 34462 1689 1301 14919 25784 5455
NM_000346chr1711921 ------
NM_000449chr151013 979 943 167 116 11063 162 --
NM_000461chr3103626 2895 1717 1709 1156 1148 1116 886 850 300 34136 3586 2874 63337 3307 1229 1064 583 158 13208
NM_000478chr15293 226 214 160 102 3494 96 69 1647 --
NM_000484chr2121051 21 ----1319
NM_000525chr1161499 1232 563 429 233 196 21146 1057 21481 203 --
NM_000530chr13815 718 270 2776 409 1244 --
NM_000533chrX41829 758 178 21 ------
NM_000555chrX197662 7647 7290 6994 6986 6459 5809 5689 5629 5354 4936 3024 2889 2703 2012 1956 1830 998 177 25843 4995 22573 440 --
NM_000578chr241768 1632 1213 466 --11308 21548 1331
NM_000612chr11173677 3665 3629 3154 2898 2786 2633 2573 2416 2359 631 559 508 318 178 169 51 22745 247 23527 3314 22927 694
NM_000618chr12105599 5285 5183 4179 2613 2051 1478 1262 350 289 65645 5114 4661 4226 534 501 14784 1297
NM_000665chr71171 --1193 --
NM_000678chr202614 170 2635 622 2797 588 --
NM_000684chr10----1808 --
NM_000719chr12176461 6318 5671 5658 5198 4772 4559 4442 4427 4212 2356 2342 2139 1953 1277 560 250 86606 6324 5887 5204 4702 4232 1911 839 36306 4226 2656 12049
NM_000721chr192118 1893 1885 1834 1815 661 302 224 192 22686 441 1309 --
NM_000723chr1751292 1285 251 177 108 1281 31623 1097 489 1474
NM_000725chr1221000 262 3642 317 184 --1833
NM_000808chrX4703 685 110 78 --2668 186 --
NM_000813chr565274 1898 1167 1089 1074 591 2363 42 12177 --
NM_000831chr1196094 5985 5782 5649 5600 5573 5490 5239 5111 5105 4932 4070 3978 1624 581 571 524 297 141 34426 3843 197 74724 4154 4101 1765 1313 1066 263 1288
NM_000841chr66746 734 609 594 346 312 --2849 254 --
NM_000875chr15145170 4780 4745 4373 2799 2158 1720 1335 721 418 389 338 307 127 31938 613 297 44416 2110 1578 1496 --
NM_000883chr77623 535 481 449 226 117 70 1629 --2517 164
NM_000924chr1231345 970 262 31135 418 256 51143 1125 1019 461 165 --
NM_000944chr41101 --1673 --
NM_000966chr12141044 1022 927 917 880 837 738 431 192 171 157 126 113 103 --2672 336 --
NM_001001132chr2121367 1279 2546 26 ----
NM_001001331chr31357 22520 1876 31902 1842 266 --
NM_001001344chrX42622 2294 1650 880 --12411 2854 202
NM_001001433chr2073049 2818 2721 2697 2648 2426 147 12030 21143 474 --
NM_001001549chr72829 207 --32019 1014 601 --
NM_001001557chr841569 875 842 706 11591 1658 --
NM_001001586chr1127 1102 ----
NM_001002296chr8279 71 ----140
NM_001002860chr1433212 3127 1497 --1516 --
NM_001002909chr1772109 1628 1404 376 347 314 272 2640 209 21638 220 --
NM_001003398chr12--1109 184 --
NM_001003676chr116995 770 375 346 264 28 1800 2239 148 11043
NM_001003676chr116995 770 375 346 264 28 1800 2239 148 11043
NM_001003694chr34569 432 84 48 --1146 --
NM_001003799chr71242 --2642 580 1252
NM_001003810chr44693 252 128 80 --1155 --
NM_001004106chr55753 697 669 327 155 2806 213 3949 845 396 1149
NM_001004127chr133787 636 294 --1845 --
NM_001004720chr21297 --2677 76 --
NM_001005271chr1751122 991 167 128 101 2859 719 41076 1057 149 136 123
NM_001005336chr93493 87 66 1179 1570 --
NM_001005386chr231970 1880 108 --199 12165
NM_001005404chr17103750 2900 1566 1333 1230 898 756 456 341 162 1982 23360 968 --
NM_001005609chrX73477 3449 3185 2579 2354 1101 292 33391 3032 1033 43568 1542 413 33 --
NM_001005910chr3----1471 --
NM_001005920chr161822 ------
NM_001006115chr3122752 2350 2274 2237 2154 1113 943 772 719 297 265 28 1196 42035 874 683 391 31933 1793 209
NM_001007156chr1551762 1676 757 247 220 11688 1196 --
NM_001008220chr5123909 3782 3571 3315 3257 2627 1034 880 621 589 395 112 53864 639 170 158 147 32532 699 119 1258
NM_001008222chrX61105 1001 302 293 283 99 1929 ----
NM_001008239chr18122821 2643 2363 1378 1009 871 792 619 582 153 140 37 1219 13510 --
NM_001008566chr22--1443 1368 --
NM_001008701chr19142935 2842 2779 2763 2752 2741 875 686 657 632 619 611 331 320 21246 148 52960 2283 2018 1228 434 1124
NM_001008897chr6----1373 --
NM_001009955chr11131 1123 1527 --
NM_001009958chr7------170
NM_001010861chr112361 --22682 173 --
NM_001010922chr174237 3960 3907 3146 1637 1439 1414 ------
NM_001010924chr103808 334 210 --2992 775 --
NM_001010935chr11800 ------
NM_001010971chr11263 ------
NM_001011713chr14----11526 --
NM_001012267chr911685 11981 --21832 1567
NM_001012426chr6163074 2994 2909 2875 2383 1371 1252 1240 1185 1113 945 918 566 458 309 39 51306 909 899 379 249 83343 2480 2462 1328 960 886 707 84 1339
NM_001012755chrX84598 4552 3570 1725 1483 1055 482 358 24417 496 33143 1495 1178 --
NM_001012989chrX--1608 1248 --
NM_001013031chr1082417 966 935 818 686 483 400 230 --12403 --
NM_001013415chr41598 --155 --
NM_001013635chr1271219 1153 1050 1011 453 293 138 11125 21115 893 --
NM_001013693chr1102688 2243 1902 440 404 306 203 172 87 29 --32473 2154 1830 --
NM_001014442chr131132 --153 --
NM_001014839chr151038 905 425 408 92 1164 --1192
NM_001015053chr1771237 1211 1114 553 522 416 189 --41451 235 128 119 11481
NM_001017999chr15540 379 372 180 150 --1475 --
NM_001018065chr9105855 5719 4611 4014 3980 3962 3737 2429 243 26 42123 1677 1078 206 --24336 1262
NM_001018108chr1591823 1764 892 781 773 581 333 213 142 31509 1437 162 2173 34 --
NM_001020658chr11129 2451 25 21410 1382 --
NM_001023567chr151273 ----1187
NM_001024401chr16142561 2268 2080 2062 2013 1969 1805 968 619 589 531 472 445 392 12178 32810 1877 785 22794 2299
NM_001024649chr552772 2477 2471 915 39 12224 --1465
NM_001024808chr12112751 2414 1905 1029 823 800 735 588 538 477 432 --32381 2128 701 11837
NM_001024937chr177708 692 583 513 284 249 84 1719 4652 606 277 75 --
NM_001024959chr33845 819 778 134 2873 797 --
NM_001025077chr10146911 6595 6478 6388 6261 6200 6094 5698 5626 4881 1446 1052 440 224 37287 6575 5641 16404 11173
NM_001025079chr3103728 3095 1594 1133 1048 903 781 717 327 320 1636 13537 --
NM_001025205chr35391 179 91 66 42 ----1342
NM_001025366chr61604 128 2697 245 --
NM_001025579chr1771129 961 762 749 154 122 113 11178 4807 182 43 21 178
NM_001025579chr1771129 961 762 749 154 122 113 11178 4807 182 43 21 178
NM_001025580chrX44094 3604 3350 394 23261 3155 44026 3668 2965 33 --
NM_001029882chr16208 182 168 159 106 72 --1113 --
NM_001030007chr1693753 2716 1012 915 770 573 302 264 184 23634 2472 1391 --
NM_001031677chr5163 --1388 --
NM_001031702chr34755 747 594 91 ----1831
NM_001031732chr453190 661 504 482 140 ------
NM_001031738chr2------1448
NM_001031801chr221127 1157 1119 --
NM_001032288chr2041056 626 616 590 1385 3577 547 26 --
NM_001032296chr1382847 2605 2566 2520 2265 391 212 55 --32171 726 660 12498
NM_001033045chr243012 1411 326 99 --14368 --
NM_001033117chr3134600 4301 4163 3899 3480 1614 1568 1479 1425 1344 1321 319 197 34045 1333 769 54468 4436 1865 1444 812 1708
NM_001034837chr5173 1264 2742 290 --
NM_001035254chr9142455 2395 2161 2124 1945 1723 825 744 732 586 552 357 228 119 183 31821 392 166 21883 723
NM_001035521chr23587 206 54 ----1228
NM_001037131chr271165 501 407 271 217 124 99 1176 ----
NM_001037637chr5----1138 --
NM_001038707chr191764 1429 716 606 173 164 111 84 72 --31724 448 188 1562
NM_001039141chr2282421 2369 2295 2049 839 822 402 57 22382 2076 1247 --
NM_001039350chr7101482 1282 1260 1097 388 339 238 169 82 75 --1273 --
NM_001039468chr112243 187 ------
NM_001039550chr22702 203 193 1748 --
NM_001039574chr151063 952 904 882 311 2870 340 2914 889 --
NM_001039577chr1124175 3981 3868 3709 3340 3120 3099 1336 1287 1269 1213 237 24350 832 23926 3072 13516
NM_001039583chr222220 158 --2209 130 --
NM_001039618chr1155817 5078 4387 479 37 1512 --11780
NM_001039690chr1682218 2163 1789 1586 765 421 351 149 11570 12200 --
NM_001039711chr171050 899 830 822 196 167 85 ------
NM_001039802chr151425 508 427 180 173 21141 1041 ----
NM_001039840chrX55235 2343 1808 770 569 --16000 --
NM_001039916chr1251021 487 434 242 123 ------
NM_001040056chr163752 661 313 1567 1224 168
NM_001040056chr163752 661 313 1567 1224 168
NM_001040110chr7--11313 21453 697 1560
NM_001040152chr765052 5045 5021 3641 1706 1271 12049 --13133
NM_001040712chr912989 --1427 141
NM_001040715chr168953 826 815 457 401 376 169 55 21002 427 1392 --
NM_001042486chr2071551 1530 1173 1132 1107 574 528 1472 41558 1369 408 170 --
NM_001042539chr1681065 982 935 401 248 224 164 120 --3364 239 100 --
NM_001042539chr1681065 982 935 401 248 224 164 120 --3364 239 100 --
NM_001042681chr132155 2039 826 1345 12427 --
NM_001043351chr141896 418 173 135 2748 715 132 --
NM_001080418chr11612 1582 2538 212 1228
NM_001083621chr1164616 3509 3503 3371 2900 2891 1836 1314 855 804 638 561 443 258 232 66 --33270 520 498 --
NM_001095chr1281937 1707 1665 1515 1221 1203 171 162 3590 487 75 41281 704 366 256 --
NM_001100108chr1138302 7852 7472 6816 6752 6002 2887 2151 1400 1153 1100 893 591 17653 25850 1794 --
NM_001121chr1021810 1367 ----1655
NM_001148chr42640 126 ------
NM_001149chr101554 ----1926
NM_001163chr981017 1004 952 877 810 330 94 40 --2973 890 --
NM_001199chr83202 184 26 ------
NM_001204chr275217 2120 1993 1489 1461 1239 108 15373 16338 25319 2012
NM_001206chr942782 456 214 150 12202 --12812
NM_001222chr1071804 1654 1640 1258 467 299 151 31956 1696 1420 41612 1316 391 177 --
NM_001256chr1752593 2505 824 742 602 1836 163 --
NM_001273chr121416 --1180 --
NM_001300chr10----1128 --
NM_001356chrX21535 240 ------
NM_001364chr1193802 3607 3590 3314 3262 3172 3123 3009 935 33712 3320 296 13288 13043
NM_001406chr17131668 1645 1622 1381 1161 684 554 453 410 274 232 217 125 4583 565 538 308 4498 117 52 38 1374
NM_001407chr321655 625 11443 21640 590 --
NM_001408chr1101461 1435 1295 1050 652 427 360 353 67 36 41501 1309 521 213 31262 598 401 1462
NM_001417chr1221835 1776 --21464 519 --
NM_001419chr19144382 3652 3604 3565 3490 3301 3276 3052 3033 3006 1939 1740 1714 931 11455 23577 278 --
NM_001420chr19132938 2887 2810 2742 2584 2552 2520 2148 1172 1163 396 136 29 22944 1156 22930 2828 --
NM_001430chr231422 472 302 --1484 --
NM_001447chr571226 1197 1032 535 528 168 133 --11240 --
NM_001478chr128968 791 748 219 177 114 106 51 2820 344 ----
NM_001543chr5154619 4527 4406 4301 1869 1825 1604 1580 1519 1472 699 390 328 250 215 43580 1398 906 528 21804 1568 2368 304
NM_001584chr1111023 ------
NM_001616chr231370 827 269 23320 580 --12555
NM_001635chr71272 --1954 --
NM_001659chr12132629 2501 2416 2204 2137 2018 1682 1087 755 672 414 157 76 22284 1818 52076 589 446 380 270 --
NM_001662chr76251 137 131 125 88 37 176 ----
NM_001665chr114429 197 105 29 --1485 --
NM_001681chr12----1236 --
NM_001694chr161335 154 ----
NM_001701chr9--11297 ----
NM_001702chr83519 407 60 --1452 --
NM_001703chr12245 92 ----1205
NM_001709chr1141896 881 871 865 ------
NM_001731chr12----169 --
NM_001743chr21243 ------
NM_001753chr711507 --11210 11764
NM_001759chr12154938 4700 3871 3739 3702 3577 3377 3323 3285 1418 1155 1056 1034 677 385 24366 2134 24025 1870 --
NM_001806chr1932542 2402 1887 ----12867
NM_001810chr206805 767 594 561 523 201 --1690 --
NM_001834chr51117 1207 1232 1195
NM_001842chr96535 503 487 460 430 401 2249 203 ----
NM_001895chr2041172 1016 280 53 11022 --11053
NM_001927chr24695 458 144 119 2131 111 ----
NM_001946chr12------143
NM_001949chr642126 1153 977 81 --11129 --
NM_001962chr51227 1194 ----
NM_001964chr53326 188 134 1336 --1379
NM_001970chr178577 487 458 416 236 170 105 60 3537 247 152 --1178
NM_002025chrX168841 8737 8688 8353 8299 7704 7567 7547 7532 6817 6256 2738 1986 1431 350 280 37583 6645 1403 16242 --
NM_002045chr33350 90 39 ------
NM_002062chr63467 313 150 2565 552 --11600
NM_002070chr38904 649 385 341 243 208 125 116 1153 1699 1897
NM_002071chr183576 449 135 1154 ----
NM_002074chr131659 1607 583 1115 1552 --
NM_002076chr1263193 2171 1100 799 781 42 12540 --23236 2441
NM_002086chr1771943 1878 1849 1665 1421 252 77 22037 135 1243 --
NM_002128chr1312081 ------
NM_002139chrX3610 603 134 ------
NM_002140chr92775 413 ------
NM_002147chr173357 246 166 --159 --
NM_002193chr251656 1284 1176 710 619 11824 ----
NM_002205chr121179 1945 1116 1921
NM_002226chr141818 --2880 743 --
NM_002229chr193367 185 31 ------
NM_002230chr176989 957 281 104 47 27 1861 1214 --
NM_002247chr102664 106 11747 11960 --
NM_002254chr2142253 2244 1904 1562 1442 938 861 799 577 568 431 371 269 149 11823 21725 771 1622
NM_002264chr341643 1262 1022 196 34554 617 346 ----
NM_002270chr535058 1203 69 --24551 1982 --
NM_002359chr17213980 3849 3711 3679 3615 3323 3311 3155 3073 3048 2829 2821 1491 1417 1374 1120 717 385 249 115 100 13835 53821 3791 1128 169 72 --
NM_002361chr19175 137 ----
NM_002372chr51585 ----1288
NM_002373chr153332 268 44 1505 31309 977 162 --
NM_002375chr3101750 1707 1588 1549 654 536 294 222 65 45 32142 1579 344 31604 680 622 --
NM_002382chr1431312 1038 491 1218 1345 --
NM_002384chr181901 --1209 --
NM_002397chr541797 1788 783 274 ------
NM_002401chr1761895 1774 1756 1718 861 33 --42357 1835 644 141 --
NM_002442chr12151590 1569 1277 1183 1155 659 610 597 439 340 306 216 207 159 102 11576 21290 239 11168
NM_002466chr202355 341 --2391 122 --
NM_002481chr1197093 7082 6885 6682 6665 6559 6458 5522 5199 4967 4884 3161 2817 1991 1700 1444 999 715 57 107672 6848 5890 2728 1609 922 727 634 561 297 27630 6827 16609
NM_002501chr19224054 3923 3887 3685 3646 3260 3204 3095 3004 2901 1545 1496 1405 1335 992 872 865 797 554 452 241 187 33876 1413 542 113899 3726 3218 3126 3057 2984 1593 1573 1517 569 180 11000
NM_002506chr1----252 31 --
NM_002507chr1791909 1827 1532 1483 1281 791 283 250 227 2575 482 51815 489 313 185 119 11695
NM_002509chr20----2293 216 --
NM_002515chr1441738 1539 1272 36 11375 11604 --
NM_002516chr197264 237 226 204 56 46 36 --1106 --
NM_002522chr17112733 2582 2533 1236 1166 1126 973 709 187 171 116 22625 844 42758 2615 2591 872 --
NM_002537chr152998 762 --185 --
NM_002539chr2------1242
NM_002569chr1591402 1345 1327 1304 1279 435 310 219 36 21270 23 3986 362 352 --
NM_002578chrX1326 2157 33 1369 --
NM_002581chr995349 4504 4273 4196 3770 2267 1445 789 442 --3976 760 95 31239 1042 962
NM_002616chr175479 436 382 175 168 ----1493
NM_002634chr172721 607 1840 2857 742 --
NM_002657chr20133658 3608 3240 3209 2905 2882 2861 2648 1484 1288 1158 336 291 22522 971 13416 11134
NM_002660chr201478 --1312 --
NM_002662chr31504 --11979 --
NM_002698chr19242964 2901 2798 2674 2602 2454 2342 2322 2298 2279 2260 2114 1926 1905 1144 1134 1066 1010 995 345 333 316 216 99 22381 193 52713 2461 2035 1195 186 --
NM_002699chr1111369 1252 1080 947 587 532 493 424 301 285 157 --1580 --
NM_002707chr21156 ------
NM_002709chr233203 3140 1035 12714 ----
NM_002717chr83652 515 467 1495 1101 --
NM_002730chr1931162 238 222 41256 977 207 198 11128 1267
NM_002745chr2264227 4099 3916 1312 937 323 14173 --1471
NM_002755chr15------1574
NM_002779chr103541 415 357 --1198 --
NM_002791chr141111 --1102 --
NM_002824chr122458 393 1384 3310 159 35 --
NM_002829chr9169 --1852 --
NM_002840chr131374 373 367 --3595 225 61 1605
NM_002849chr122931 168 ------
NM_002855chr11183669 3596 3554 3430 3279 3197 2760 2702 2657 2340 1435 1360 901 771 723 701 326 194 22263 1447 63375 813 454 207 47 36 --
NM_002859chr12101502 1335 1184 601 577 549 464 199 189 28 --61639 1609 1442 1351 637 540 --
NM_002865chr82265 59 ------
NM_002868chr12152411 2236 2174 2109 1985 1929 1824 1494 915 758 415 406 392 366 313 2748 72 ----
NM_002880chr32693 225 1644 --1873
NM_002881chr261402 1083 912 242 234 33 21013 461 11076 --
NM_002896chr112301 66 ----1116
NM_002906chr113804 381 236 --1439 --
NM_002941chr31217 ----11587
NM_002956chr121157 21275 1022 ----
NM_002971chr31367 ----1419
NM_003036chr131080 995 87 1874 1813 --
NM_003047chr181345 1294 1253 1247 1081 1002 505 75 2328 33 5305 255 159 107 82 --
NM_003060chr551024 410 396 363 136 ----1893
NM_003075chr122319 124 128 2134 65 --
NM_003076chr12111535 1434 1418 1371 1342 1315 1074 1039 666 481 395 41605 1335 1098 509 11131 1365
NM_003091chr20--1193 ----
NM_003128chr242876 1967 1937 309 11052 22512 27 --
NM_003131chr6172110 1963 1436 1427 860 818 800 671 658 650 620 602 537 523 371 265 203 3531 193 146 11874 1473
NM_003132chr1----169 1248
NM_003139chr116816 762 717 236 218 135 2618 257 148 --
NM_003145chr12116 23 1375 145 --
NM_003170chr173546 532 68 --178 --
NM_003178chr362235 2171 1481 1396 450 404 11668 2270 155 --
NM_003179chrX151446 1417 1393 1365 1274 1221 1204 1195 1121 393 385 375 242 227 65 2193 97 31354 906 265 --
NM_003185chr203513 492 471 --1989 --
NM_003189chr152837 1258 831 638 251 42427 2157 1189 259 1400 --
NM_003214chr641389 1100 907 45 11088 21190 468 --
NM_003221chr6133377 3110 3086 2887 2843 2648 2600 1645 1486 596 575 523 307 12855 13033 --
NM_003223chr163549 543 22 --1284 --
NM_003250chr172146 59 ------
NM_003269chr631113 501 298 187 ----
NM_003320chr11104175 4153 3572 1581 985 969 793 508 167 159 --24182 1468 1531
NM_003339chr511502 1636 ----
NM_003348chr1261625 1425 1318 410 401 57 21401 598 1248 --
NM_003367chr196453 444 181 66 55 44 --192 --
NM_003369chr1132343 738 687 32621 2585 1950 1525 --
NM_003370chr1910778 742 691 592 585 572 245 233 210 70 --1259 --
NM_003378chr75409 161 124 81 61 1439 4385 376 356 112 --
NM_003403chr14121 --174 --
NM_003406chr811749 11624 --11889
NM_003410chrX1561 11942 12903 --
NM_003418chr31238 --122 --
NM_003458chr3203822 3815 3730 3534 3451 3240 3206 3059 3031 1619 1486 1132 1029 1017 980 941 551 448 331 310 32968 2542 2445 54000 3005 2555 974 832 --
NM_003459chr24677 659 119 107 ------
NM_003468chr2113491 2803 1129 1088 1082 1075 1068 995 957 887 109 12897 ----
NM_003470chr1651398 542 325 300 176 1506 41721 1500 611 528 150
NM_003471chr3----1123 --
NM_003482chr12162666 2650 2644 2514 2476 2112 1728 1024 979 902 753 726 531 505 390 131 12494 ----
NM_003546chr6----138 --
NM_003562chr173292 97 82 1397 1387 --
NM_003590chr221368 960 --1902 --
NM_003593chr172511 271 --1599 2218 185
NM_003629chr163066 2865 2183 1105 805 342 11095 1625 --
NM_003632chr175734 677 357 234 34 --3210 88 58 --
NM_003633chr521882 407 --32438 2380 1021 1301
NM_003635chr103376 358 103 --2389 97 --
NM_003651chr12--1595 ----
NM_003655chr175589 579 543 227 83 --2236 197 --
NM_003664chr51186 --190 1407
NM_003673chr17----150 --
NM_003684chr14430 410 404 96 ------
NM_003685chr194969 807 797 621 --1393 --
NM_003760chr1------1553
NM_003779chr13442 340 165 --3405 185 136 173
NM_003893chr104413 376 343 197 150 1458 --
NM_003936chr28484 423 409 392 378 314 293 40 1300 4999 986 772 751 1138
NM_003941chr71671 --1449 --
NM_003988chr10102301 2095 1866 1722 1689 1618 942 899 247 44 21969 234 51787 1697 1681 827 329 --
NM_004093chr13112985 2706 2643 2375 1296 775 672 594 302 268 129 --1948 --
NM_004102chr12451 48 ------
NM_004117chr651686 826 678 612 312 41583 1408 714 630 143 --
NM_004140chr171294 1316 --181
NM_004200chr11142817 2073 1235 1205 1103 1088 919 806 794 781 543 521 385 310 1836 42745 2063 1052 237 --
NM_004227chr743061 2513 2202 323 22029 837 22652 67 12477
NM_004228chr19------1122
NM_004272chr52345 120 ----1767
NM_004286chr22122839 2796 2681 2611 2394 1974 1949 808 643 394 384 265 --1492 --
NM_004295chr1781242 1224 543 423 404 247 182 130 ------
NM_004308chr11101698 1460 738 670 652 608 523 386 315 295 --2213 27 --
NM_004311chr10152853 2790 2737 2725 2483 2324 2316 2252 2147 2064 2050 1091 690 426 415 22556 343 32027 1198 1190 --
NM_004326chr131156 1009 836 1784 ----
NM_004349chr81287 1905 11020 --
NM_004370chr621775 1564 4814 806 594 521 ----
NM_004379chr22391 357 2264 203 ----
NM_004383chr154506 459 145 69 --1445 --
NM_004386chr1972037 917 809 697 620 103 44 --1154 12047
NM_004395chr55537 515 268 231 56 --3682 581 525 --
NM_004397chr1124081 1358 --23037 72 --
NM_004420chr11152371 2199 2131 2089 2021 1896 1884 1878 1870 1618 1587 1528 837 450 421 --82415 2381 2273 2220 2209 2110 2099 284 12362
NM_004423chr3132717 2700 2590 2455 1073 1010 510 420 381 303 258 200 57 3627 364 295 --1906
NM_004427chr161097 793 398 292 152 40 1466 ----
NM_004429chrX91076 1028 327 226 213 184 141 76 55 --41332 456 314 248 --
NM_004430chr8122606 2192 1106 965 957 812 792 404 393 210 139 33 --2129 110 1783
NM_004436chr13142 72 41 --3519 174 79 --
NM_004438chr262443 1114 1015 792 542 293 23207 902 1855 --
NM_004440chr621897 1784 ------
NM_004443chr34586 538 228 162 ----1241
NM_004444chr7--2300 233 ----
NM_004451chr117673 584 509 477 166 157 134 1561 1225 --
NM_004454chr352030 1727 656 534 107 11648 ----
NM_004463chrX1463 1412 2472 74 --
NM_004472chr5149 --3191 102 87 --
NM_004474chr11294 2397 39 2303 46 --
NM_004480chr14----1272 --
NM_004496chr145412 321 312 299 283 ------
NM_004501chr121253 489 22655 1554 1844 --
NM_004503chr125781 251 204 40 24 1172 ----
NM_004514chr17102539 2312 2024 1882 1197 1157 1041 968 853 513 32812 2324 111 22806 1023 22682 2288
NM_004519chr82158 23 ------
NM_004574chr17133 --161 --
NM_004575chr44573 243 68 56 --131 11164
NM_004615chrX2908 121 1130 3676 366 300 --
NM_004630chr1171057 940 901 863 397 370 307 1261 21022 281 --
NM_004637chr3101253 1238 1113 890 467 446 439 241 225 74 ------
NM_004643chr142634 308 ------
NM_004647chr193270 220 213 1252 151 162
NM_004656chr3101227 1219 1195 1101 1067 1017 963 850 824 78 1885 21141 284 1863
NM_004714chr19--1277 2332 25 --
NM_004716chr113806 327 254 ------
NM_004730chr562130 1926 1517 765 738 610 1592 ----
NM_004732chr172307 89 1313 273 60 --
NM_004734chr131103 --273 30 --
NM_004738chr2092619 2448 1743 1606 499 378 355 338 134 11028 1831 --
NM_004742chr31182 --171 --
NM_004758chr172865 384 ----1183
NM_004774chr1752855 2742 2374 2210 863 ----11929
NM_004783chr162244 84 2134 124 1628 --
NM_004801chr211426 --1588 --
NM_004822chr17213827 3748 3732 3711 3529 3269 3112 2876 2843 2701 1523 948 782 776 770 748 657 628 585 523 280 21575 1448 53656 2646 1431 538 167 11046
NM_004841chr1--21164 1156 174 --
NM_004852chr181714008 12472 12435 11745 11103 10281 9987 9693 9680 9525 9128 8884 3520 3512 3362 2437 2082 514108 9423 3399 3131 2934 210959 1042 1103
NM_004859chr1741906 765 669 257 ------
NM_004860chr173368 185 21 --1225 --
NM_004866chr513592 14968 1199 --
NM_004899chr22308 296 --1448 141
NM_004926chr1491463 572 549 490 450 230 157 126 39 2519 166 1613 --
NM_004952chr18841 719 665 323 292 159 151 100 1705 2766 70 --
NM_004953chr33368 290 177 ------
NM_004961chrX51349 567 517 240 32 --2166 59 --
NM_004964chr12556 386 160 --139
NM_004973chr621674 1602 --11331 --
NM_004977chr194536 479 453 157 --2382 74 --
NM_004992chrX398063 7884 7794 7463 6994 6974 6915 6781 6469 6414 6355 6163 6132 5922 5433 5380 5258 3331 3190 3089 3073 3047 3008 3000 2639 2521 2227 1818 1811 1566 1504 1370 1303 1284 1271 1225 674 325 264 12978 47972 6443 5276 1797 11064
NM_004995chr1491310 1071 1061 370 245 235 168 105 46 11281 --2472 253
NM_005027chr19101153 1113 959 910 388 286 216 185 163 34 --21028 354 --
NM_005045chr7----1127 --
NM_005053chr193466 213 170 ------
NM_005063chr1073088 2989 2591 1200 1133 604 211 1996 23360 1440 --
NM_005066chr1------1241
NM_005095chr141837 1426 821 639 12216 21582 803 1593
NM_005096chrX71112 883 799 437 374 281 116 11193 --161
NM_005099chr12243 22 1387 1129 --
NM_005121chr1733328 1526 1504 33609 3477 2392 ----
NM_005167chr1--150 133 --
NM_005186chr117573 563 499 191 140 35 21 ------
NM_005187chr16161645 1616 1568 1537 1495 1433 1401 1371 1341 1316 1308 528 381 363 345 335 31656 1553 1353 2595 162 --
NM_005220chr1761440 1252 458 224 196 118 --31094 488 129 --
NM_005229chrX61046 990 422 232 169 27 ------
NM_005233chr332552 1761 1002 12196 1884 --
NM_005270chr221109 174 ------
NM_005273chr73251 122 95 ------
NM_005276chr124636 629 576 493 --21521 233 --
NM_005277chr41214 1666 ----
NM_005312chr9152214 1925 1860 1696 1678 1087 1048 966 901 861 543 403 384 324 301 11833 31005 945 737 22035 709
NM_005337chr12130 --1337 --
NM_005370chr192326 320 ----167
NM_005407chr1491582 1246 636 408 296 287 264 145 124 21509 208 21392 1265 --
NM_005413chr2697 85 73 55 35 24 ------
NM_005430chr12101043 800 652 389 370 328 309 258 237 37 3855 669 168 3923 844 378 --
NM_005458chr931797 904 420 1449 1461 1121
NM_005465chr121911 137 1359 ----
NM_005569chr2241233 1135 563 502 1993 151 --
NM_005578chr334808 4784 4765 ----13863
NM_005596chr996190 5336 5025 2191 1406 933 791 663 340 1998 ----
NM_005604chr64130 81 60 40 1747 1703 --
NM_005626chr1--1154 1378 --
NM_005678chr151858 1999 1762 --
NM_005700chr111148 ----1359
NM_005716chr194531 470 453 176 ------
NM_005717chr11829 ------
NM_005724chr152208 79 ------
NM_005730chr1293404 3251 3097 2889 2721 2301 2279 1243 344 33464 3208 3137 43244 2785 2608 1044 22513 1269
NM_005736chr1081537 1449 1198 1109 1074 279 229 25 1269 11559 --
NM_005746chr742527 2402 223 125 --1606 --
NM_005778chr32480 145 1168 --1316
NM_005786chr18175 --1111 --
NM_005801chr17161 2758 320 --1198
NM_005822chr622055 35 --1135 --
NM_005828chr17164752 4570 4098 3758 3734 3510 1927 1787 1655 1518 1455 1313 778 612 562 51 44226 4160 586 205 64805 3906 3872 1853 1541 736 --
NM_005842chr13----1692 --
NM_005853chr161110 ------
NM_005866chr93852 566 350 1589 1767 --
NM_005870chr1311248 --1189 --
NM_005902chr15134639 4589 4092 3273 2902 2895 1712 1078 835 596 476 364 299 34582 604 118 44612 4252 3706 543 --
NM_005909chr594254 4088 3971 3529 3325 3251 2905 1597 690 12704 24030 3592 11154
NM_005910chr17153688 3573 3516 3280 3203 3074 1504 1423 1247 1031 909 871 862 630 319 53781 3719 3214 2952 1204 21528 106 11351
NM_005920chr1183590 3495 3273 3144 3086 3013 2989 2911 2803 2719 2520 1465 1269 1212 1183 1174 598 225 83517 3232 3058 2439 1502 1132 880 23 83506 2415 1487 1149 828 737 82 65 --
NM_005933chr11102418 2243 2077 1953 1084 710 698 376 272 118 11857 22704 235 --
NM_005935chr474386 3928 3564 3264 2119 1550 633 14611 1233 11813
NM_005937chr17214007 3959 3924 3846 3350 3275 3175 3121 2728 2580 1408 1193 1046 826 690 516 494 407 198 184 148 43343 1274 1078 615 23036 943 --
NM_005938chrX61314 1300 1257 1085 1070 1057 1255 21287 1077 1443
NM_005955chr1145201 5112 4973 4783 4618 3987 3950 2176 1485 1468 1336 1053 1037 417 23896 1381 ----
NM_005967chr122636 605 2594 280 1112 --
NM_005975chr20----2671 167 --
NM_006037chr264195 3217 1921 1276 886 523 13772 13333 --
NM_006054chr1131423 1321 392 ------
NM_006106chr11--12515 ----
NM_006128chr84289 271 113 28 ------
NM_006133chr11102159 2130 2115 1937 1698 977 895 869 702 492 42202 1733 1611 967 21543 671 1690
NM_006148chr17102869 2760 2434 2257 973 609 501 200 180 125 62656 2603 2127 892 557 321 52611 925 776 306 248 2936 343
NM_006156chr144236 218 175 92 161 ----
NM_006160chr1791428 1258 460 336 330 294 267 229 21 1401 11233 --
NM_006166chr1232592 2198 388 --1787 --
NM_006176chr117737 705 592 564 191 95 55 1149 2627 233 --
NM_006191chr124790 153 45 32 --1285 --
NM_006194chr143105 88 56 1300 ----
NM_006195chr911257 1994 ----
NM_006201chrX31094 1072 881 153 ----
NM_006224chr1792395 2293 2135 2066 1582 932 856 797 461 22144 1633 42231 1965 863 224 1162
NM_006245chr63869 811 377 1347 3333 171 109 1277
NM_006247chr194448 406 140 109 1309 2324 37 --
NM_006255chr14----1766 --
NM_006256chr132567 463 328 164 --1180
NM_006283chr894421 4161 4029 3557 1865 893 847 492 347 24017 759 2781 91 14797
NM_006301chr122601 451 --1234 --
NM_006306chrX144973 4934 4697 4575 4479 4055 3699 1531 991 728 304 262 209 99 34401 1019 273 2296 47 1972
NM_006328chr112531 235 --1471 --
NM_006340chr172349 332 183 1135 --
NM_006369chr12294 284 1316 ----
NM_006401chr9----1178 --
NM_006439chr4----1509 --
NM_006454chr4132884 2860 2794 2709 2531 2523 2112 1158 1008 813 805 783 479 --32333 186 86 12231
NM_006458chr111137 --1332 --
NM_006460chr1721176 298 ------
NM_006469chr12404 287 1336 ----
NM_006480chr5197 --2358 105 1198
NM_006494chr196781 760 688 636 124 113 1673 ----
NM_006517chrX122258 1956 1756 1499 1479 629 584 576 544 267 218 26 21469 45 11463 --
NM_006546chr17235998 5962 5955 5889 5360 5219 5212 5139 4560 4346 4334 4216 4124 4045 2345 2142 2133 1551 1374 960 867 465 21 45539 4360 4156 1924 75511 5159 4864 1516 1416 785 216 --
NM_006563chr193400 390 124 --1454 --
NM_006612chr173529 456 383 --138 --
NM_006621chr111631 11445 21826 598 --
NM_006624chr1021601 853 --1170 --
NM_006633chr5--1689 --1722
NM_006646chr1352018 1237 905 630 553 --22538 2051 1959
NM_006690chr2082081 2001 1983 1924 938 860 434 302 32287 2013 563 149 --
NM_006698chr2031263 371 268 1415 1422 --
NM_006742chr16141629 1565 1376 1248 781 745 663 541 418 326 257 156 133 78 11321 42009 1491 713 436 --
NM_006761chr173735 709 41 1729 ----
NM_006769chr1----1150 --
NM_006772chr6161694 1649 1579 1555 1531 1403 1285 1201 1073 671 588 511 467 434 224 196 41684 1313 1241 281 21569 1187 --
NM_006775chr611996 --21209 327 --
NM_006814chr2062134 1055 834 570 546 34 1150 2261 240 --
NM_006823chr831341 1282 530 11147 --1331
NM_006826chr21409 ------
NM_006856chr1261067 1027 873 735 363 76 ------
NM_006873chr232593 457 445 13002 23033 878 12219
NM_006885chr1692938 2868 2821 1516 1355 1078 1051 1045 328 12829 1343 1971
NM_006888chr1483456 3175 2577 2540 2386 2192 999 31 13011 --13375
NM_006943chr20192893 2838 2816 986 839 818 799 670 529 480 375 353 312 305 286 265 236 200 118 33043 1004 141 123126 2827 2621 1053 1033 758 510 451 327 220 159 73 --
NM_006946chr113489 227 30 2424 404 1177 --
NM_006950chrX7648 631 610 358 288 168 41 2904 127 1592 --
NM_006981chr952793 753 441 118 32 12051 12920 --
NM_006990chr1151878 1782 1765 1757 1665 1591 795 660 613 593 569 446 239 212 185 12493 ----
NM_007011chr15195621 5489 4626 4594 4540 4482 4228 2717 2558 2479 2314 2147 1872 1803 1162 1086 764 436 37 84411 4394 4179 2174 2002 1961 86 56 44239 1980 1241 643 45070 5033 4993 4876
NM_007014chr1661706 1531 1522 1474 261 84 1664 31754 1381 470 --
NM_007040chr198992 921 884 349 167 147 128 32 1892 168 1383
NM_007051chr11123 ------
NM_007067chr1781531 1438 1294 1278 1209 1118 1081 318 31572 309 128 11106 --
NM_007112chr1--1163 --193
NM_007122chr13591 235 227 --2244 74 --
NM_007144chr1741062 508 65 21 --3960 399 38 --
NM_007146chr1752805 2790 2670 2640 814 --21060 930 --
NM_007174chr1241843 1780 1711 696 127 ----
NM_007185chr16780 682 429 300 232 74 --2173 156 --
NM_007217chr3----197 --
NM_007245chr165722 362 167 132 110 1759 ----
NM_007260chr14505 132 104 91 1557 ----
NM_007327chr97889 843 757 476 296 30 21 1288 31148 914 796 --
NM_007371chr92583 63 --1640 --
NM_007375chr152591 2247 1717 1090 378 1496 ----
NM_012074chr1481112 968 957 729 170 158 110 41 1133 2767 150 --
NM_012154chr8----182 1590
NM_012193chr1195419 4635 4628 4470 4372 3576 1999 1285 686 13694 25081 1515 --
NM_012199chr1104302 4144 3610 3100 1795 1478 1046 693 672 638 24453 223 1600 --
NM_012215chr10185 ----1401
NM_012285chr172480 198 --172 --
NM_012297chr431840 1829 805 --1767 --
NM_012298chr32286 130 --2215 100 --
NM_012300chr532076 920 354 1250 11578 --
NM_012308chr11122286 2118 2012 1674 978 834 806 588 578 457 126 109 12088 5969 346 191 136 67 --
NM_012316chr1125488 5038 4420 3870 3803 2052 1762 1708 1679 1317 905 151 23640 748 43682 1991 1566 697 --
NM_012330chr1031662 1253 379 --1260 --
NM_012340chr201266 ------
NM_012423chr19----143 1453
NM_012428chr15191 --1144 --
NM_012446chr53437 429 148 ----147
NM_013236chr221470 1353 ----
NM_013247chr23554 460 27 --1113 --
NM_013261chr413658 --13014 --
NM_013346chrX----168 --
NM_013353chr1----188 --
NM_013392chr23167 69 43 --1103 --
NM_013416chr222156 142 ------
NM_013446chr721424 1319 1156 --1101
NM_013449chr12152845 2801 2720 2376 2365 2279 2114 689 630 528 339 326 315 179 134 2866 661 --2749 196
NM_013958chr8199 147 ----
NM_013960chr82254 101 --2303 165 --
NM_013999chr1761098 506 399 364 238 227 --2142 23 1554
NM_014042chr111240 ------
NM_014112chr82667 132 31107 906 516 --11224
NM_014182chr123473 243 169 1730 --1502
NM_014203chr192303 263 --2293 48 --
NM_014231chr1281950 1701 1682 1615 1597 1487 1471 234 --31894 1843 1711 1167
NM_014232chr1771629 1455 1212 1030 437 260 238 61379 416 363 314 254 70 41342 1253 341 39 --
NM_014253chrX2714 444 --1536 --
NM_014289chrX61243 1183 958 937 425 125 21123 1067 11212 --
NM_014299chr1972041 1760 1510 861 548 434 399 --1227 --
NM_014368chr941809 1615 212 165 --11898 151
NM_014368chr941809 1615 212 165 --11898 151
NM_014400chr192105 56 128 1477 --
NM_014415chr31558 11164 11383 --
NM_014417chr193383 297 208 --150 --
NM_014423chr594689 4526 4303 1971 1847 1403 174 117 24 11007 23756 1654 --
NM_014470chr122710 636 ------
NM_014554chr1252297 2144 579 547 310 11611 ----
NM_014613chr56640 442 263 252 37 23 12313 32643 2070 705 --
NM_014620chr122193 140 2130 49 --1611
NM_014636chr9113535 2871 2710 1367 1359 978 872 841 763 260 228 --53457 3134 884 779 667 --
NM_014646chr18122801 2493 2487 2123 1062 861 674 562 428 240 190 39 1650 42830 2575 2219 2116 --
NM_014647chr1622152 715 ------
NM_014663chr121059 728 ----1973
NM_014665chr873347 3294 2793 2310 1218 454 365 22374 2287 73527 2944 2679 2562 1161 660 350 --
NM_014686chr1922563 413 --22177 811 1100
NM_014701chr1523254 374 13247 11210 --
NM_014707chr722263 482 --1472 --
NM_014727chr192243 62 128 186 --
NM_014730chr12175221 5058 5028 4961 4910 4761 3739 3714 3679 3649 3436 3325 1710 1484 925 698 211 1819 43846 3444 1305 985 --
NM_014731chr20121513 1442 1429 1325 1116 635 499 482 476 290 147 66 21609 1238 31533 1501 573 --
NM_014755chr263450 3440 1528 1220 1003 496 --13492 --
NM_014761chr163434 235 137 --2305 158 --
NM_014762chr182305 2217 2043 2034 1802 270 261 106 21670 56 1664 --
NM_014770chr1291167 1039 962 496 411 305 222 180 91 11152 21098 990 --
NM_014774chr152881 2822 2546 2201 1033 42869 2800 729 594 13025 --
NM_014820chr331908 544 47 11579 1596 --
NM_014824chr1161961 1902 1396 1253 331 153 --1500 --
NM_014827chr151672 1559 1263 615 251 --11472 --
NM_014830chr1273666 2802 2578 2446 1415 1391 300 2737 500 33427 312 75 11003
NM_014846chr8----1249 --
NM_014891chr75529 490 462 282 137 --21555 537 21113 103
NM_014905chr231564 711 195 1672 1684 --
NM_014909chr14153970 3517 3226 3176 2974 2966 2768 2673 2607 2525 2466 940 623 365 359 23831 3198 23898 3357 13089
NM_014912chr1042851 2442 1246 424 1537 ----
NM_014926chr321138 745 2767 181 ----
NM_014945chr581287 1279 1239 642 617 606 168 80 --4720 689 596 348 --
NM_014949chr11136 --1671 --
NM_014967chr15--11208 11472 --
NM_014969chr11737 ----1122
NM_014978chr1021341 245 1342 21392 118 --
NM_014982chr1484074 3622 1447 1413 1138 1107 855 149 139 1661 1161
NM_014990chr142107 29 --195 --
NM_014994chr1582211 2149 2118 1962 1472 886 633 324 2672 472 61952 1527 774 224 146 59 22284 68
NM_014996chr3--1272 11003 --
NM_014999chr1211107 ----11578
NM_015025chr232047 1009 45 --1916 --
NM_015039chr193404 1679 1525 1386 1297 591 573 449 88 24115 3702 3394 71 35 --
NM_015042chr15184373 4073 3848 3633 3445 3241 3110 2838 1743 1493 1481 1024 909 868 854 846 349 269 43664 3100 2831 453 23281 3258 --
NM_015064chr1283143 3120 3101 2731 2700 2251 1431 1374 11408 23020 53 1701
NM_015075chrX152093 2084 1994 1593 1573 1446 877 841 805 792 728 594 353 180 172 31730 822 91 32047 1986 139 12074
NM_015080chr113171 96 70 1623 3402 223 36 --
NM_015090chr1185928 5754 5652 4720 4258 2467 2395 2289 2132 1357 1237 1127 767 653 434 388 309 174 46019 5178 964 191 75710 5664 4217 2084 1741 613 261 1751
NM_015094chr22164551 4332 4323 4150 4095 2884 1870 1633 1211 1119 823 779 676 551 481 306 --64469 4297 3476 2998 798 123 11641
NM_015099chr175463 276 167 135 85 --2291 179 --
NM_015107chrX142388 2172 1930 1885 1825 1806 1740 1658 1649 1509 529 174 150 29 123 ----
NM_015125chr1910519 511 459 415 225 213 168 152 106 81 2452 41 1136 --
NM_015138chr1592486 2427 2110 1007 479 389 356 200 81 22785 2585 22596 502 --
NM_015155chr102979 160 --13229 --
NM_015157chr1151127 936 773 338 322 --11002 11074
NM_015178chr892416 1891 977 949 837 723 690 409 57 1716 21868 608 1819
NM_015191chr1162532 2383 2356 1674 235 99 1669 22730 242 --
NM_015192chr20------1456
NM_015203chr11184 ------
NM_015206chr153548 487 381 23091 2655 23883 2776 1873
NM_015213chr111264 ------
NM_015215chr153140 2994 2932 782 139 ------
NM_015267chr1221342 239 166 2597 223 --
NM_015270chr1292240 1668 1642 1586 1481 396 348 306 244 --52219 1879 1867 533 387 --
NM_015272chr1641984 1725 1313 187 2210 34 11794 --
NM_015282chr242352 1962 690 138 2936 75 1453 152
NM_015284chr192092 2024 1671 1568 1309 773 509 389 252 --3337 261 88 --
NM_015299chr14143960 3783 3737 3715 3593 3289 2828 2785 1594 1520 649 426 372 60 33919 3402 3245 23270 76 --
NM_015310chr8137880 7153 7023 6755 6224 3345 3206 2728 1760 1718 1329 776 272 16259 15472 11946
NM_015315chr5123166 3140 2942 2877 2682 2664 2165 865 651 204 197 187 43174 1334 1234 405 42362 639 571 513 --
NM_015326chr172314 2203 2153 2093 2074 2066 164 42690 2537 1130 334 3781 540 177 --
NM_015327chr16931 865 517 478 245 182 21130 487 41252 1123 963 369 --
NM_015328chr762806 2696 2686 2287 2187 2168 --2814 418 --
NM_015336chr12----11633 --
NM_015338chr2071854 1545 1506 1448 1264 401 169 --11513 --
NM_015343chr172123 56 --1114 --
NM_015347chr1252138 2108 2065 932 525 --2762 550 --
NM_015375chr154847 3982 1801 1764 1491 148 --11515
NM_015388chr63260 246 233 ------
NM_015393chr483254 2884 2376 2344 678 663 169 143 13536 --13502
NM_015457chr1181089 985 828 798 231 208 88 31 21001 75 2974 839 --
NM_015477chr152987 701 --1113 --
NM_015481chr1281086 1077 1014 928 879 285 269 227 1970 3810 312 78 --
NM_015488chr291686 1569 1463 1388 1371 1363 1332 1153 292 31558 1350 685 41597 1515 1181 404 1440
NM_015497chr151238 ------
NM_015503chr162572 538 128 ----
NM_015509chr1221157 385 ------
NM_015526chr194908 520 311 239 4582 536 485 254 11436 1393
NM_015554chr1552623 2272 954 751 31 --12765 --
NM_015589chr14----1125 --
NM_015635chr931829 880 373 ------
NM_015638chr204641 622 581 155 --3667 510 486 --
NM_015652chr102593 486 1631 2625 457 --
NM_015655chr201606 --2680 647 --
NM_015680chr22575 564 --2617 271 --
NM_015686chrX92434 2421 2379 2242 2231 2084 1918 444 243 12094 22503 78 --
NM_015850chr8101689 1611 728 269 245 184 171 95 87 61 11961 1391 21822 877
NM_015872chr1191772 1761 1705 1548 1459 1415 1390 1354 1331 1255 1157 732 718 662 588 445 380 278 262 --41409 429 389 128 --
NM_015879chr18148372 8271 7427 6610 6458 5946 5219 3291 2722 1930 1216 694 504 369 26057 2494 21629 745 38549 6251 301
NM_015898chr19192510 2441 2310 2287 2252 2144 1863 1661 1596 1585 896 882 751 739 579 445 249 217 195 22270 806 21842 1743 --
NM_015904chr22249 233 --1282 --
NM_015906chr164507 4322 4162 3721 3661 3272 34513 3647 436 14199 14567
NM_015981chr5132502 2374 2364 2350 2086 1962 1192 619 582 462 420 277 223 42972 2202 610 210 32795 1037 407 --
NM_015999chr11296 1230 --1253
NM_016006chr3----1265 --
NM_016022chr15872 768 732 317 251 ----1745
NM_016081chr4----11756 --
NM_016129chr4----1323 --
NM_016131chr22797 412 1953 12255 --
NM_016132chr1523350 3245 11274 1517 1576
NM_016169chr10173266 3258 3094 3060 2958 2788 2672 2607 2598 2555 2540 2502 2479 1291 1172 1009 320 --32211 1196 453 11214
NM_016174chr93401 341 305 --1332 --
NM_016202chr193397 288 173 ------
NM_016257chr182887 2793 2501 447 147 106 66 24 --2465 139 12682
NM_016284chr163913 731 106 --1873 --
NM_016287chr131927 1608 191 --11860 --
NM_016289chr2----11561 --
NM_016338chr52852 29 --11169 1228
NM_016373chr161347 152 290 77 --
NM_016374chr1------1642
NM_016396chr1522528 2060 --12616 --
NM_016521chrX------1298
NM_016525chr93798 673 220 --1709 --
NM_016545chr11129 --167 --
NM_016577chr363075 2771 1496 697 567 395 24384 4373 34072 3741 2963 --
NM_016588chr61730 ------
NM_016604chr52984 838 --124 197
NM_016605chr5122715 2603 2537 2349 1880 1726 1682 911 834 720 487 231 2936 396 31744 949 333 12579
NM_016626chr18----1689 --
NM_016628chr10----1626 --
NM_017409chr126723 596 515 40 33 25 --150 --
NM_017420chr1423205 2789 --12440 --
NM_017488chr2101602 1492 1069 600 489 405 378 369 359 292 21307 263 --11433
NM_017519chr6--1450 1115 --
NM_017544chrX----1866 1230
NM_017553chr1551044 1010 997 361 302 1275 ----
NM_017559chr171239 126 --1273
NM_017575chr1761179 1049 651 628 567 305 --41522 1191 640 178 1167
NM_017590chr229974 959 634 601 542 419 409 318 281 1832 1228 --
NM_017596chr1274537 4422 4350 4219 4117 3477 3469 3145 1463 1395 1364 1150 1019 998 959 842 831 772 751 707 694 496 322 130 56 42 26 21301 745 63691 3213 1743 890 339 170 1763
NM_017668chr169807 777 702 550 255 216 210 101 50 ------
NM_017730chr32627 163 1198 ----
NM_017739chr1--1516 160 --
NM_017763chr173445 351 76 21147 378 1480 11072
NM_017772chr691796 1614 1496 1186 1141 1134 463 437 320 11669 41323 1085 430 264 --
NM_017778chr81504 ----1516
NM_017799chr1441723 1699 1375 734 --21533 1425 --
NM_017811chr9133082 2898 2711 2503 2451 2337 2300 2242 2147 629 232 161 128 1142 --22037 84
NM_017848chrX104399 4179 4015 3571 3539 3074 3034 1814 280 149 ----1712
NM_017849chr2112873 2795 2047 1256 933 876 614 607 465 217 75 3952 541 239 4944 898 55 35 21039 725
NM_017873chr972538 2119 1028 789 707 552 207 --42385 2077 933 442 12674
NM_017893chr1081320 1243 1186 1139 954 928 133 112 3241 174 90 21447 999 21309 223
NM_017902chr10155626 5389 5065 4601 4450 4358 3899 3791 3780 1556 1510 904 847 783 207 75114 4553 4215 3554 1982 1545 1426 34772 4719 1314 14181
NM_017907chr115363 333 322 60 31 ------
NM_017919chr995546 4419 4185 4115 2264 2049 1567 1356 852 --2741 624 --
NM_018013chr693021 3012 2941 2252 1879 993 178 168 100 ------
NM_018027chr10123121 2789 2248 2006 1318 848 836 383 367 251 245 39 ----1165
NM_018028chr1971215 1200 1116 909 888 510 316 21222 527 3998 340 267 --
NM_018030chr181431 --1949 --
NM_018064chr6192 ----1310
NM_018067chr15426 359 225 125 109 --142 1189
NM_018085chr1107763 2598 2274 2109 1495 833 816 624 120 28 46734 5937 823 630 46656 2377 773 574 --
NM_018086chr241816 1392 1320 1311 --179 --
NM_018116chr1----1465 --
NM_018121chr1062427 2239 2067 1142 450 301 22716 654 12033 --
NM_018133chr32677 92 1580 ----
NM_018137chr141411 488 133 117 2209 125 11274 --
NM_018193chr151200 --172 --
NM_018202chr11747 ------
NM_018222chr1181614 1327 529 447 271 246 194 62 ------
NM_018240chr14839 705 338 95 --1207 --
NM_018244chr203893 280 226 1964 41031 956 493 426 --
NM_018371chr8--21030 390 11118 --
NM_018401chr43640 204 84 1646 41746 1648 491 64 --
NM_018416chr1292508 2293 2226 1924 1660 574 284 171 81 42502 2300 2001 1036 12104 12516
NM_018426chr62451 111 --197 --
NM_018462chr3180 2616 314 --1594
NM_018489chr131558 1502 602 1702 ----
NM_018584chr141165 1149 1087 837 --1202 --
NM_018638chr1234754 2246 131 ------
NM_018650chr11119 --11647 --
NM_018653chr171136 --2356 83 --
NM_018686chr12----1327 --
NM_018896chr17----2119 57 --
NM_018952chr171446 --1226 --
NM_018977chrX4885 879 350 37 --1371 --
NM_018999chr1063547 1853 1107 998 878 685 1535 ----
NM_019106chr22153185 3026 2960 2506 2497 2394 2354 2278 1381 1303 1253 786 757 699 244 42250 766 622 83 22318 261 --
NM_019114chr92988 879 --21938 1653 --
NM_019116chr16103486 3376 3341 3334 3323 3056 2819 1285 788 646 62870 2724 2601 1449 1369 845 11233 12304
NM_019556chrX11021 ------
NM_019593chr2092865 2743 2730 2195 2183 2126 2092 2068 1990 ----23135 2925
NM_019610chr14619 612 282 136 ------
NM_019842chr6----176 --
NM_019884chr196534 462 129 99 82 21 1496 2442 149 --
NM_020066chr1--1870 1877 --
NM_020142chr127598 585 548 504 196 168 66 ------
NM_020144chr731615 769 474 --11624 1138
NM_020168chr1561145 289 234 216 191 86 3478 178 92 1521 1146
NM_020180chr1841357 1183 978 85 --11348 --
NM_020193chr11----1970 --
NM_020309chr194945 818 428 232 1935 2694 89 2895 170
NM_020310chr17102542 2473 2253 2039 1964 923 836 785 284 274 22332 1949 42264 2180 2030 1943 --
NM_020337chr4------11096
NM_020341chr201819 ----1253
NM_020344chr9166 --2120 43 --
NM_020354chr103866 641 116 ------
NM_020362chr12719 109 ------
NM_020382chr1231463 547 39 21299 994 --11269
NM_020403chr13----199 --
NM_020438chr951313 1163 897 322 254 1972 3886 507 477 1183
NM_020443chr1166976 6749 6732 5957 5459 5031 2570 2404 1685 1634 1479 1165 660 485 454 243 26848 6301 36361 5647 63 45569 4472 2120 434
NM_020452chr141481 1441 390 311 --21431 179 21469 457
NM_020526chr161488 1438 690 392 300 103 31214 1196 115 31792 1767 1188 11748
NM_020647chr821887 78 --11869 --
NM_020699chr1114770 4709 4285 3768 3390 3372 3275 1816 1644 986 186 24127 949 23840 1563 11515
NM_020708chr20101868 1767 785 768 755 747 721 363 238 221 --2476 398 3945 204 120
NM_020713chr20162577 2420 2390 2374 2315 2186 1271 1037 818 802 606 586 565 362 149 112 --41175 639 255 166 22172 768
NM_020718chr1655487 4989 4898 2610 276 22132 1020 15253 16162
NM_020734chr1223267 321 ------
NM_020750chr641342 1281 922 458 --2294 77 --
NM_020777chr4112384 2018 1840 1830 1771 1651 696 403 220 143 102 22224 2129 3670 567 472 180
NM_020795chr17121739 1728 1353 1337 1277 602 566 551 545 431 419 24 31321 1263 368 31944 1809 806 --
NM_020796chr552536 2306 2000 1853 138 --1654 --
NM_020801chr512326 12052 ----
NM_020810chr1433079 2777 2276 13238 12745 --
NM_020845chr1292464 2329 2062 1715 1686 970 944 732 384 12038 32388 1848 877 11879
NM_020859chr431396 725 216 21406 333 1169 --
NM_020899chr1792033 2011 1702 828 557 272 262 127 22 21616 208 6698 690 650 425 96 85 --
NM_020918chr103811 223 148 22944 843 12399 1861
NM_020920chr144387 317 267 60 ------
NM_020956chr19114728 4642 4618 4598 4455 1549 1429 1405 754 664 371 23733 982 64376 4364 1586 842 572 79 24030 903
NM_020963chr1----184 --
NM_020971chr197685 673 604 246 187 94 39 --1208 --
NM_021076chr222448 193 ------
NM_021109chrX----1129 --
NM_021144chr91120 --1432 --
NM_021155chr1992447 2237 2066 1974 1961 1208 946 488 370 22906 2379 32606 2396 1074 12473
NM_021189chr181003 982 949 881 802 784 701 222 11041 2829 100 21027 906
NM_021216chr1951153 888 483 393 168 --1197 11092
NM_021813chr694092 2221 1827 1656 1249 1084 206 157 35 35478 5088 4052 25403 4893 --
NM_021907chr21102 1273 ----
NM_021938chr19----1287 --
NM_021949chrX32917 2589 1945 --22706 292 21149 497
NM_021973chr44539 197 169 155 ------
NM_022006chr19------1338
NM_022048chr15146248 5827 5243 5181 4675 4063 2211 1607 1028 649 589 375 89 62 35041 1784 338 --12381
NM_022058chr221730 1535 11512 --1188
NM_022104chr202165 63 ----1213
NM_022117chrX4447 425 201 29 168 1558 --
NM_022130chr51535 1306 ----
NM_022343chr971330 1287 1184 1014 1006 939 89 ----1837
NM_022463chr1751288 1120 72 57 48 1154 1122 --
NM_022465chr12162923 2915 2893 2827 2818 2498 2253 2215 2070 1168 1134 1041 988 792 750 527 62886 1155 997 812 573 145 32141 775 403 11108
NM_022474chr1422762 2212 1788 12403 --
NM_022574chr7152183 2168 2152 2130 1972 1943 1927 1736 1654 1447 1427 756 594 286 22 --42058 1627 1368 643 --
NM_022719chr2283910 3734 3314 2770 1415 1103 703 514 11479 33700 277 229 --
NM_022737chr19121249 1120 1063 1034 910 279 256 250 211 100 94 88 41265 1203 952 919 4943 926 472 136 --
NM_022758chr682581 2386 2336 2131 925 700 618 399 32566 2490 123 43130 2588 2525 2203 --
NM_022778chr141338 1330 1291 1115 ----11324
NM_022821chr13392 138 76 ------
NM_022823chr23386 350 192 1485 1499 --
NM_022898chr1494735 4430 4191 3543 3412 3214 3206 3001 331 --21858 834 --
NM_023931chr1611482 --1194 21377 1291
NM_023940chr42943 404 1672 ----
NM_024015chr1731145 1072 989 --41110 955 907 326 --
NM_024046chr3101203 1152 1139 1027 973 914 457 329 314 221 --11233 --
NM_024328chr145607 179 135 104 87 179 2215 73 --
NM_024522chr181767 1331 1288 1205 774 507 499 308 11714 31794 1535 322 11734
NM_024524chr32715 108 22498 2469 --1696
NM_024541chr1061502 1203 1189 1166 35 25 11222 11181 1275
NM_024552chr19178 ------
NM_024676chr141112 983 547 320 --2215 188 --
NM_024705chr1341038 805 403 48 2877 820 1859 --
NM_024742chr1671682 1627 1360 1255 1197 694 212 1206 1134 1774
NM_024771chr1191844 1735 1715 1709 853 728 342 320 281 31909 1597 271 31613 645 170 2924 862
NM_024787chr82399 282 --3703 613 60 1870
NM_024811chr1161466 536 489 275 122 94 31889 603 53 1691 --
NM_024887chr1111588 1444 1437 1358 742 690 568 527 380 184 59 --1521 --
NM_024889chr1051224 1179 1110 326 280 --11242 171
NM_024915chr8182835 2721 2481 2467 2347 2332 2171 2157 2029 1897 1843 1112 1061 1013 888 754 402 389 1344 --1216
NM_024954chr104679 633 482 101 --1489 --
NM_024969chr2--1762 1887 --
NM_025054chr814031 --1913 --
NM_025129chr192159 82 ------
NM_025160chr194118 3307 3294 3256 1566 1457 1293 1180 883 ------
NM_025164chr1161825 1737 1616 789 444 90 --11783 --
NM_025182chr92413 208 4886 834 712 92 1741 --
NM_025187chr1641342 1154 855 66 1892 31255 523 23 --
NM_025248chr17133268 2743 2695 2181 2068 1195 1167 771 606 445 367 357 60 52890 2772 382 145 40 22940 285 --
NM_030576chr1792243 2185 2117 2041 670 535 489 250 25 3979 362 344 42532 2467 1669 910 22570 1753
NM_030629chr1671861 1724 1434 1402 1388 587 444 ------
NM_030661chr741625 1395 157 99 --21550 249 --
NM_030665chr1741099 928 498 362 ------
NM_030784chr6----174 --
NM_030813chr112284 149 4609 260 130 85 2197 50 --
NM_030913chr13270 90 47 1218 2297 139 --
NM_030918chr1195207 5045 4793 4711 4609 4494 4360 4193 4097 3898 3677 3400 1330 969 833 603 509 161 56 55077 3440 1727 1403 845 34058 1448 1122 13778
NM_030964chr5113393 3062 2847 2416 1379 1060 817 698 533 386 363 33567 3090 2578 1353 --
NM_030981chr1191138 1109 1096 808 398 247 186 78 53 --31038 935 316 --
NM_031216chr1881774 1683 1675 1626 1509 104 82 73 ------
NM_031433chr114577 408 192 182 --2548 490 --
NM_031445chr273386 1269 1022 853 609 576 75 12403 1252 12129
NM_031449chr7171846 1823 1771 1682 1464 1453 869 728 572 520 474 406 310 265 221 209 155 12186 --164
NM_031475chr12163 108 2616 525 ----
NM_031911chr432515 1947 600 ----11727
NM_032042chr532184 2134 388 157 1993 189
NM_032108chr195980 954 900 885 143 --1834 --
NM_032174chr141464 1189 299 203 1147 175 --
NM_032192chr173731 703 95 --2696 551 --
NM_032193chr11101778 617 479 462 371 363 335 154 146 128 21351 37 21957 1928 --
NM_032195chr211123 ------
NM_032199chr101217 13514 1415 --
NM_032211chr103783 771 200 1178 1255 171
NM_032236chr1----1111 --
NM_032256chr12--1944 --1731
NM_032268chr16123232 2681 2620 2071 654 572 535 491 355 154 121 47 41087 233 226 29 ----
NM_032289chr571377 550 473 417 231 220 210 21740 352 21604 346 --
NM_032294chr1721871 229 2523 67 21548 125 --
NM_032420chr58788 754 726 561 306 278 179 28 3367 185 88 3260 215 154 --
NM_032440chr1022948 389 22293 1803 --12970
NM_032452chr14111443 1308 1227 1077 1071 241 225 136 77 51 42 21458 1353 1513 --
NM_032458chrX32305 2134 988 43336 1146 291 262 ----
NM_032514chr205360 279 157 90 67 --2415 375 1303
NM_032552chr9111796 1480 1430 1335 691 442 435 342 325 168 107 1162 31855 1735 276 --
NM_032560chr143239 121 56 ------
NM_032575chr16181952 1742 1529 1414 1358 763 710 555 512 506 496 481 420 360 306 295 235 214 1328 51636 1543 1431 1347 458 --
NM_032595chr17111339 1221 1181 434 426 223 126 87 81 56 40 1181 1464 --
NM_032632chr1421279 813 11549 11654 --
NM_032689chr191519 --11407 --
NM_032827chr22739 164 --31089 804 383 1134
NM_032885chr191306 1241 --1115
NM_032905chr10----1214 --
NM_032982chr7112431 2380 2034 1938 1852 1777 937 803 437 197 181 52082 1908 1796 568 103 --22028 1685
NM_033027chr361040 976 778 746 727 213 --21115 296 --
NM_033058chr8----1136 --
NM_033089chr2041170 1131 315 46 1510 1234 --
NM_033129chr20172012 1705 1647 1627 1557 1449 1366 775 757 609 587 538 530 327 297 233 116 --11971 --
NM_033132chr1332027 1480 529 ----1458
NM_033133chr17133612 3520 2617 1362 1276 979 969 959 721 713 180 160 26 1728 13254 22808 1508
NM_033161chr951336 1262 1254 389 103 1211 --11347
NM_033224chr757546 2465 1968 1483 46 36226 457 243 12932 11718
NM_033259chr35940 801 731 345 316 1594 1882 --
NM_033312chr1----158 --
NM_033315chr17122207 2031 1980 1810 1785 1734 1457 883 728 492 452 120 --32072 1859 192 1743
NM_033397chr1051983 1864 1468 810 724 31913 1896 50 11810 --
NM_033542chr2021785 1669 ----142
NM_052840chr1541549 1460 593 567 --41605 1515 1111 86 --
NM_052897chr123291 259 67 --2677 651 --
NM_052907chr1253084 3024 2779 1707 190 --1399 --
NM_052925chr198985 974 883 858 767 714 708 665 ------
NM_052937chr8----1642 --
NM_053023chr11153162 2793 2597 2168 1305 1263 1007 952 650 622 563 434 399 323 181 22161 195 --1521
NM_053024chr31137 --1332 --
NM_054035chr174800 179 156 134 --1208 --
NM_057161chr68492 375 362 356 193 79 54 25 --1209 --
NM_058243chr191807 2856 220 1309 --
NM_079834chr19121642 1573 1427 1344 1227 687 583 455 227 220 146 38 21199 45 21663 1585 --
NM_080388chr110550 513 502 448 220 204 184 151 114 98 174 3612 467 230 --
NM_080546chr9--1632 12090 --
NM_080607chr209947 801 772 737 693 389 296 187 153 2877 405 ----
NM_080625chr2031045 361 32 ----151
NM_080652chr3------177
NM_080738chr121870 312 11579 21710 29 21843 1749
NM_080836chr20174411 4028 3989 3969 3852 3831 3569 3550 3517 3463 3266 3096 1420 600 532 404 76 21800 1165 33908 1875 1492 --
NM_101395chr2143260 1097 388 98 --2298 72 1157
NM_101395chr2143260 1097 388 98 --2298 72 1157
NM_130387chr33910 449 434 1502 --31068 884 41
NM_130459chr961538 1331 1246 1136 216 93 11489 31509 414 207 --
NM_130469chr141339 1934 2618 88 --
NM_133263chr5----151 --
NM_133264chr1753738 999 817 95 63 53392 2857 2544 803 754 33653 3144 3026 11045
NM_133265chrX41321 772 655 59 12459 --11347
NM_133369chr57726 687 385 304 175 134 116 --4733 717 316 80 1673
NM_133496chr1--23650 355 13789 --
NM_134268chr1761096 1083 967 309 137 22 --11038 --
NM_138360chr144297 246 210 96 123 1273 --
NM_138473chr12135052 5030 4761 4656 4297 4130 3715 3563 1312 998 338 293 189 44990 3738 939 43 13983 14368
NM_138689chr111241 ------
NM_138693chr72302 56 ------
NM_138795chr14639 289 258 219 1101 21505 1443 11604
NM_138967chr15162136 2035 1997 1949 1850 1727 1526 988 956 934 711 582 556 358 260 95 2590 390 71983 1906 979 965 428 366 350 --
NM_139057chr1532727 2168 460 22682 1795 22577 767 --
NM_139161chr195479 415 358 162 89 1379 ----
NM_139239chr19----1240 --
NM_144571chr456999 6991 1999 1607 544 25359 2673 ----
NM_144618chr1------1406
NM_144967chrX2417 373 --1168 --
NM_144973chr1284792 4041 2149 2071 1564 968 950 39 14825 14551 --
NM_145008chr113751 688 124 --240 25 --
NM_145113chr1431584 1310 156 3490 143 44 1617 --
NM_145185chr19102035 1872 1855 1658 1627 1442 464 426 286 57 31954 1789 1450 51979 1838 1576 1568 185 --
NM_145204chr15----248 36 --
NM_145239chr1610809 491 484 468 456 413 251 243 155 63 --1174 --
NM_145245chr1941026 983 480 238 1892 1974 1178
NM_145260chr25549 191 138 116 45 --1306 --
NM_145285chr102522 94 ----1124
NM_145296chr196837 811 694 607 584 307 ------
NM_145799chrX72589 1072 712 588 453 267 151 23009 112 1668 --
NM_145800chrX3868 215 154 1160 1954 --
NM_146388chr1951271 1147 1110 988 508 21174 998 1489 1476
NM_148894chr43787 311 119 --1902 --
NM_152237chr22151760 1616 1584 1577 1558 1530 1270 1242 1148 1116 1083 550 531 393 352 1523 31418 1253 632 11159
NM_152261chr12------1371
NM_152280chr1113456 3397 3249 3187 2978 2784 2733 2396 1230 846 523 22275 338 22945 2743 --
NM_152342chr161370 --2217 149 --
NM_152344chr1751451 1058 963 949 307 11164 --11003
NM_152345chr1761118 859 836 404 352 339 2912 730 ----
NM_152346chr174875 459 335 127 --2382 66 --
NM_152365chr11352 --1122 --
NM_152384chr291667 1653 1491 1477 1316 1302 781 602 282 --31689 1513 1338 --
NM_152399chr43431 279 212 1411 ----
NM_152424chrX184646 4579 4204 4184 4160 4005 3816 3683 3647 3638 3218 1855 1427 1401 1324 1195 803 162 34758 3282 1538 23058 485 --
NM_152437chr125856 835 559 488 368 1969 22041 386 --
NM_152450chr1511707 --11875 1412
NM_152470chr18124114 3671 3441 3423 3199 2874 2867 1377 819 368 189 63 --33473 3403 2972 31302 1251 333
NM_152570chr91106 ----1198
NM_152653chr32174 76 --1592 --
NM_152749chr7--31053 1003 801 1312 --
NM_152787chrX23334 329 11451 --12834
NM_152793chr755137 4156 3439 1719 1248 24098 4071 35079 4745 65 --
NM_153029chr16154063 3906 3869 3703 3566 3399 2981 2694 2639 2614 1390 1049 680 476 466 43095 3078 2906 1491 54082 3888 3625 3504 3383 --
NM_153035chr132924 2015 515 ----1446
NM_153334chr225790 716 566 239 159 133 1742 2599 542
NM_153340chr1145 ------
NM_153350chr1661436 1236 1109 1074 389 75 1625 51498 654 261 171 153 --
NM_153453chr63831 801 24 ----172
NM_153487chr6174756 4725 4392 4320 4020 3829 3717 3578 3442 3394 3314 3298 3262 3242 1897 1672 1063 64666 4592 3331 3166 1138 690 64774 4100 3791 3148 1284 471 13697
NM_153498chr101280 --1106 --
NM_153607chr5----12398 --
NM_153619chr1562966 2296 2284 1091 813 785 2597 436 ----
NM_153756chr181944 1378 1295 436 181 156 122 107 --21744 1496 --
NM_172212chr11568 --2652 55 --
NM_173156chr131999 1842 564 --11818 2704 282
NM_173491chr531425 912 102 ------
NM_173517chr7----138 --
NM_173595chr12355334 5202 5137 4769 4603 4482 4237 4205 4145 3927 3647 3445 3211 2046 2004 1836 1748 1630 1510 1447 1369 1221 1161 746 726 715 503 394 374 361 347 305 233 211 152 44221 3596 2106 512 64980 3784 3581 3234 1989 437 1671
NM_173596chr12----133 --
NM_173667chr521679 526 ------
NM_173814chr15----1401 --
NM_173828chr54362 288 271 73 ------
NM_173834chrX184 1164 1433 --
NM_175058chr11----11175 146
NM_175069chr92738 667 --2710 108 --
NM_175077chr2061354 1344 1246 1198 269 260 ----153
NM_175607chr311058 ------
NM_175736chr12287815 7652 7641 7396 7130 6439 6426 6059 5824 5479 5400 5382 5355 4943 4803 4783 3025 2781 2709 2536 1801 1342 901 775 768 542 367 179 87625 7156 5003 2369 1982 1928 863 34 57768 4837 2574 2196 1670 11809
NM_175852chr1132940 2732 2039 1941 1903 1880 1870 1114 928 643 517 486 374 --42911 2902 706 621 1385
NM_175856chr5------1652
NM_175898chr1531179 577 360 1516 3585 232 77 --
NM_176792chr1051260 1215 922 203 141 41412 480 461 307 ----
NM_176823chr1113471 1497 1478 1300 1105 577 515 420 316 254 53 22360 1146 1184 23851 231
NM_177424chr11743 ----1259
NM_177999chr983101 2682 1352 1270 1115 770 499 123 --52948 2640 2460 1496 1005 33237 423 84
NM_178026chr20----2481 58 --
NM_178123chr211071 --1362 --
NM_178126chr1771738 1663 1637 1540 296 170 94 22061 882 21419 388 --
NM_178553chr2136 --1151 --
NM_178568chr1711702 --1540 1561
NM_178830chr199662 594 321 308 281 216 117 94 66 ------
NM_178835chr42670 35 1801 1285 --
NM_178864chr11----1487 --
NM_181356chr63859 669 147 1788 --1165
NM_181358chr164015 3585 3317 3202 1008 673 --1381 13687
NM_181491chr9122665 2570 2458 2393 2382 2366 1195 1185 1125 339 308 132 11959 32520 2512 2253 --
NM_181504chr52223 51 --170 --
NM_181670chr123955 447 257 ------
NM_181671chr171150 1689 ----
NM_181712chr142070 102 64 54 ----12112
NM_181715chr14355 169 63 22 --1337 --
NM_181836chr521706 852 --11796 11896
NM_181844chr1781846 1839 1633 695 611 478 400 182 --32018 1699 1249 --
NM_182485chr443070 2552 2364 162 --22865 1137 --
NM_182488chr13----2255 164 --
NM_182509chr1451513 1204 1184 574 411 --11027 11668
NM_182526chr14102910 2770 2696 2232 2069 1198 926 825 685 380 12049 43097 2590 835 562 22786 2348
NM_182537chr3----1285 --
NM_182553chr113567 461 185 --3232 124 68 --
NM_182557chr11202074 2035 2026 1924 1848 1805 1752 1660 1436 1422 771 702 682 675 533 522 442 411 403 253 2321 70 3395 274 242 11874
NM_182687chr16340 33 24 163 1171 --
NM_182734chr203255 242 192 --2146 73 1703
NM_182970chr20254248 4194 4093 3796 3752 3524 3357 3316 3297 2897 2830 2704 1519 1453 1304 1200 916 599 540 340 329 304 193 163 144 34187 3739 3018 74164 3884 3505 1504 1233 612 153 --
NM_194282chr421239 1023 --1203 --
NM_194286chr12176046 5985 4508 4438 4377 4149 2063 1933 1899 1760 1558 1191 1080 993 360 187 101 34053 1398 1062 21690 34 11088
NM_198157chr2262481 2299 1828 1637 1021 794 22144 812 --22193 68
NM_198270chrX--13454 ----
NM_198273chr542658 2360 1248 743 1470 --13134
NM_198440chr22102286 1901 1651 1604 938 849 597 119 109 23 11557 3734 146 90 1413
NM_198458chr1961711 1695 1650 1643 1221 168 --11320 11547
NM_198573chr9----1373 --
NM_198993chr17121572 1480 1470 1449 1411 654 448 410 394 105 98 80 --21271 113 --
NM_199141chr1912957 923 896 871 699 673 667 398 335 253 81 48 ------
NM_199334chr173428 110 96 --3493 445 163 --
NM_201550chr1211303 --31125 184 60 1362
NM_203413chr1731015 995 778 --1121 --
NM_203434chr911181 11189 21114 474 --
NM_203446chr2171891 992 774 706 428 416 327 11169 1721 --
NM_206854chr694719 3995 3576 1966 1222 575 559 341 83 ----11134
NM_207043chr12446 24 21621 542 1777 --
NM_207303chr1024064 747 --1916 13815
NM_207387chr171662 21356 540 188 --
NM_213604chr192941 137 179 2631 243 --
NM_213662chr1742292 1817 1692 1674 1160 11772 147