TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4259
miRNA Sequence: CAGUUGGGUCUAGGGGUCAGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr84770 555 433 57 ------
NM_000046chr573114 2617 2527 2304 677 638 86 --12119 --
NM_000061chrX1298 --151 --
NM_000084chrX96305 5190 4396 1409 1304 1097 822 406 347 16689 12650 24265 900
NM_000089chr7------1629
NM_000090chr24599 227 221 25 ------
NM_000091chr222705 2583 ------
NM_000092chr284168 3940 3537 3438 3257 2972 1265 205 ------
NM_000093chr982100 1839 1809 497 395 314 233 162 --1306 --
NM_000104chr23235 161 129 12109 ----
NM_000118chr96736 646 602 285 260 121 ----1700
NM_000125chr694275 3821 3686 3668 1485 1301 1232 1215 110 23381 2912 13601 --
NM_000138chr1531916 1854 71 ----11731
NM_000168chr763278 2921 2624 2069 605 429 --22810 121 --
NM_000176chr572798 2615 2538 1391 1183 1055 941 --1837 --
NM_000208chr1974644 3758 3422 1417 443 301 170 ------
NM_000210chr22566 235 12045 ----
NM_000212chr1741943 1549 621 356 ----1628
NM_000217chr1245232 1633 1220 536 14791 23675 740 --
NM_000222chr472111 1512 310 210 194 92 82 ------
NM_000232chr443180 1157 1094 819 13135 1731 --
NM_000237chr841845 1806 231 134 --11288 --
NM_000259chr1565746 5101 4489 2455 2233 1073 26144 228 12431 11210
NM_000264chr922560 1091 --22087 872 --
NM_000267chr1763380 2759 1387 1316 153 31 --12940 1905
NM_000280chr111654 ------
NM_000282chr13----132 --
NM_000291chrX4755 704 637 45 ------
NM_000304chr1741096 1013 310 296 1743 ----
NM_000307chrX1331 ------
NM_000314chr1033210 2120 364 1571 ----
NM_000321chr1311407 ------
NM_000332chr667214 6515 6023 5945 4599 613 --36530 4683 538 --
NM_000335chr372080 1817 1738 1613 1530 1486 633 --21965 268 --
NM_000337chr5105704 5468 5431 4866 2655 1691 1346 1242 529 325 171 25458 685 --
NM_000338chr1511142 ------
NM_000340chr321378 1118 ------
NM_000345chr4------1841
NM_000351chrX93917 3839 3769 3752 3361 2933 2879 1321 156 --1168 --
NM_000367chr61411 --22131 1508 21820 531
NM_000368chr971799 1667 1359 1303 1108 521 212 ----21692 1575
NM_000369chr1441402 1355 600 87 1447 ----
NM_000376chr1272948 2239 2009 1244 973 163 142 --22631 1250 12160
NM_000390chrX31272 996 377 --22130 29 --
NM_000424chr123302 123 43 1328 ----
NM_000439chr572408 2169 2090 2062 2020 975 182 ------
NM_000449chr1--21289 1087 ----
NM_000461chr373632 3197 1641 1316 1303 385 287 --11795 --
NM_000462chr151484 ------
NM_000484chr21------1358
NM_000489chrX32920 2367 1364 --186 --
NM_000493chr631093 714 51 1408 ----
NM_000518chr11123 ------
NM_000533chrX21889 99 --2638 260 --
NM_000555chrX187606 7497 7116 7049 6360 6208 5328 4902 2845 2612 2606 2597 2157 1493 1158 549 499 80 1205 27176 5216 --
NM_000575chr21396 --1977 --
NM_000599chr294569 4332 3550 3275 3094 1404 1370 809 44 --44046 404 170 51 --
NM_000600chr71337 ------
NM_000602chr711534 11306 1595 11185
NM_000609chr1073027 2753 2619 2388 1985 1122 599 --21219 43 12179
NM_000610chr1121858 175 1345 --1215
NM_000615chr1172984 2876 2606 2140 1849 709 69 ------
NM_000618chr12105990 5174 5072 2472 2084 1212 749 569 160 135 25656 1526 15752 --
NM_000618chr12105990 5174 5072 2472 2084 1212 749 569 160 135 25656 1526 15752 --
NM_000633chr1843691 3564 836 732 --2999 830 --
NM_000635chr1931174 1010 382 --2561 372 1428
NM_000671chr4178 --11274 --
NM_000684chr10--11291 ----
NM_000719chr12156336 6003 5960 5783 5767 4485 4462 2597 2330 2270 978 793 670 586 470 --24469 256 --
NM_000726chr24496 427 369 357 --11156 --
NM_000793chr1474490 4140 3972 3701 3335 1897 534 --14334 1836
NM_000800chr551269 616 259 222 104 ----11164
NM_000806chr5161 11379 ----
NM_000807chr42166 98 ------
NM_000813chr585184 4561 4176 3656 1909 1172 884 324 1616 ----
NM_000814chr1553890 3583 1294 891 789 11234 ----
NM_000818chr102404 163 1147 ----
NM_000826chr422522 495 22162 874 ----
NM_000827chr562404 1992 1705 1595 877 47 12172 1447 --
NM_000828chrX62034 1984 1750 1727 1571 421 ------
NM_000829chr1162303 2296 2083 1750 461 131 11957 ----
NM_000831chr1126049 5907 5886 5431 5408 4648 4255 3893 1418 1105 847 176 --35733 4287 291 14120
NM_000836chr198929 833 801 719 681 375 256 200 ----1191
NM_000844chr331019 220 59 ------
NM_000859chr511064 ------
NM_000868chrX42263 1635 844 212 ------
NM_000875chr15146812 6541 6422 6078 5369 2791 1949 1586 961 874 862 715 433 378 14566 26453 968 --
NM_000876chr621417 55 ------
NM_000891chr1723493 2371 1396 13294 --
NM_000899chr1264341 3656 3223 1532 1442 1316 23938 2862 ----
NM_000910chr461917 1292 678 651 635 619 21886 541 ----
NM_000926chr11118787 8525 8496 8435 8181 7938 7149 1918 1848 873 791 13242 37980 7298 775 12337
NM_000933chr2031801 1438 238 ------
NM_000935chr321097 456 ------
NM_000945chr251765 1736 1501 131 25 2517 153 ----
NM_000949chr52810 583 --2191 113 --
NM_000959chr143596 3201 3160 2846 13570 23240 90 --
NM_000961chr20103076 2504 1277 1196 1146 948 478 61 51 41 11185 63546 3373 846 339 254 70 11414
NM_000965chr31199 ------
NM_000990chr1183658 3333 3107 1559 978 655 649 557 22994 35 13935 21482 590
NM_001001323chr1263083 2582 2556 2395 2373 175 11170 ----
NM_001001342chr1031478 1064 136 --11290 1937
NM_001001344chrX22451 1976 --22573 1624 --
NM_001001389chr1121858 175 1345 --1215
NM_001001390chr1121858 175 1345 --1215
NM_001001391chr1121858 175 1345 --1215
NM_001001392chr1121904 221 1391 --1261
NM_001001395chr1232718 2580 2553 22259 438 ----
NM_001001396chr1124265 3884 3076 3037 2869 1721 1646 1577 1501 990 808 464 ------
NM_001001419chr563639 3559 1327 1058 443 293 1783 --11462
NM_001001420chr563639 3559 1327 1058 443 293 1783 --11462
NM_001001433chr2063155 3053 2411 2032 866 76 1901 --12238
NM_001001479chr223783 726 119 --2823 647 1256
NM_001001486chr3----1293 --
NM_001001487chr3----1293 --
NM_001001523chr13990 902 116 --51367 1208 984 542 264 --
NM_001001552chr12311 256 ------
NM_001001664chr233753 3426 638 1824 ----
NM_001001852chr221682 ------
NM_001001890chr2194196 3723 2805 1668 1456 1105 1086 273 137 ------
NM_001001924chr831381 785 607 ------
NM_001001925chr831381 785 607 ------
NM_001001931chr831381 785 607 ------
NM_001001938chr9114112 3523 3463 3374 3062 2747 1059 989 344 278 122 --13633 --
NM_001001971chr1021004 869 ------
NM_001001995chrX31767 729 376 ------
NM_001002026chr312370 12158 2461 375 --
NM_001002762chr1082835 2733 2662 2139 1875 1172 870 153 1536 ----
NM_001002838chrX21763 1172 11646 ----
NM_001003652chr18107973 7353 7158 6922 6644 6363 5887 5522 3359 2230 38211 7862 7821 26567 2660 --
NM_001003674chr18126214 5439 5084 5030 4419 2261 2217 2057 1440 1200 748 736 ------
NM_001003675chr18126214 5439 5084 5030 4419 2261 2217 2057 1440 1200 748 736 ------
NM_001003679chr15779 580 49 42 33 ------
NM_001003681chr2231921 642 577 --11353 --
NM_001003688chr41124 1240 ----
NM_001003712chr1244050 3988 3302 1535 ------
NM_001003800chr962747 1426 1198 970 841 57 1850 --150
NM_001003940chr15113540 3130 2695 2577 1217 1180 901 785 607 538 476 21188 1100 13100 13554
NM_001003942chr15113540 3130 2695 2577 1217 1180 901 785 607 538 476 21188 1100 13100 13554
NM_001003943chr15113544 3134 2699 2581 1221 1184 905 789 611 542 480 21192 1104 13104 13558
NM_001003945chr981924 1839 1685 1661 1640 1567 168 137 ------
NM_001004065chr933775 2555 1489 ----13649
NM_001004304chr1283053 2917 2866 2700 2693 1157 483 328 ------
NM_001004317chr654073 2889 1132 990 918 23098 533 ----
NM_001004360chr221879 1669 ------
NM_001004419chr1244043 3981 3718 3587 1798 12793 196
NM_001005366chr121381 ------
NM_001005386chr251781 633 478 197 76 ------
NM_001005404chr1774269 4044 3882 3841 3522 1813 961 ------
NM_001005473chr5136240 4989 4839 4337 4099 4068 2641 2441 1658 1417 1113 696 431 16665 15769 --
NM_001005609chrX73723 3673 3204 1425 872 809 612 --13468 --
NM_001005739chr21623 ------
NM_001005746chr24496 427 369 357 --11156 --
NM_001005747chr24496 427 369 357 --11156 --
NM_001005845chr8194 ----11720
NM_001006600chr51411 22171 2143 ----
NM_001006623chr232284 211 44 --11957 --
NM_001006636chr22854 823 1776 1200 --
NM_001006641chr971607 1572 1362 554 534 355 185 ----11109
NM_001006642chr971607 1572 1362 554 534 355 185 ----11109
NM_001006643chr971607 1572 1362 554 534 355 185 ----11109
NM_001006932chr6113393 2968 2847 2738 2578 2468 2103 1030 997 377 22 1346 1797 --
NM_001007023chr1474490 4140 3972 3701 3335 1897 534 --14334 1836
NM_001007024chr1774330 4206 2704 1545 1345 849 721 ----13888
NM_001007025chr1774330 4206 2704 1545 1345 849 721 ----13888
NM_001007097chr9114587 4486 3909 3605 3595 3516 3467 3099 1868 1553 1113 11988 11836 14706
NM_001007098chr12788 103 1163 ----
NM_001007102chr611514 --1551 --
NM_001007257chr131418 195 135 --2956 57 --
NM_001007271chr103943 880 126 --21081 840 --
NM_001007273chr10138 --1176 --
NM_001007277chr112891 845 ----1829
NM_001007466chr634287 3482 483 25198 3267 11837 --
NM_001007553chr11967 ------
NM_001007559chr1862069 2025 1936 1501 1443 257 ----11779
NM_001007794chr11682 ----1150
NM_001008215chr231316 1061 870 ----1330
NM_001008220chr583494 2714 976 596 573 376 340 237 --23511 757 --
NM_001008225chr71245 ------
NM_001008239chr1863286 3222 3107 2826 2558 2412 --12419 --
NM_001008388chr431096 212 96 ------
NM_001008392chr352858 1300 723 591 309 --42662 2276 372 353 --
NM_001008408chr7105758 5640 5269 3960 2342 2239 1959 1682 629 443 14840 24726 4558 14317
NM_001008541chr1032329 1755 49 --2697 632 --
NM_001008541chr1032329 1755 49 --2697 632 --
NM_001008660chr111269 ------
NM_001008701chr19132996 2955 2856 2669 2487 2472 2416 2399 2172 2143 734 677 221 --22913 2707 --
NM_001008738chr532968 2750 2096 1652 --11962
NM_001009183chr142426 104 --183 --
NM_001009552chr81396 ------
NM_001009899chr375590 5534 5314 5265 4191 1859 201 12425 ----
NM_001009909chr1163511 3048 1480 1465 429 340 1163 ----
NM_001009955chr12427 125 --1164 --
NM_001009955chr12427 125 --1164 --
NM_001009959chr221854 1682 ------
NM_001009993chr271136 1038 238 172 155 145 85 --23854 3196 --
NM_001009996chr3147 ------
NM_001010000chr1863188 2355 2204 747 294 176 23393 2774 1903 --
NM_001010853chr612963 13153 12565 1669
NM_001010861chr142673 2532 657 210 11021 ----
NM_001010862chrX72961 1139 1039 603 497 437 181 --1558 12868
NM_001010867chr1105975 5520 5473 5221 4395 2224 1602 1585 1490 271 ----14532
NM_001010891chr515751 11003 25205 1373 25242 2659
NM_001010908chr102769 548 ------
NM_001010922chr154027 3919 3713 3278 216 --34033 3872 1018 13289
NM_001010942chr1221115 74 --153 --
NM_001010986chrX1949 --12285 --
NM_001011513chr441169 555 250 134 --11508 1692
NM_001011515chr4164 ------
NM_001011516chr4164 ------
NM_001011666chr7115959 5643 5625 5592 4396 2321 1617 921 803 758 313 26505 1202 14462 --
NM_001011708chr232925 2592 2160 ----12308
NM_001011885chr1531790 1406 1110 ------
NM_001012393chr11114093 3775 1776 1752 1353 1074 755 672 311 167 81 21558 869 14155 --
NM_001012419chr911297 ------
NM_001012420chr1522839 2788 ------
NM_001012423chr1522839 2788 ------
NM_001012426chr6113348 2770 2468 2404 2398 2090 1259 1063 646 320 284 --3503 446 72 --
NM_001012427chr6113348 2770 2468 2404 2398 2090 1259 1063 646 320 284 --3503 446 72 --
NM_001012755chrX63785 1994 1881 1479 1408 396 14430 33443 1147 1105 1142
NM_001012989chrX1485 ------
NM_001013031chr1063138 3109 2724 2646 999 846 23160 2367 2713 397 --
NM_001013406chr711252 1475 21616 1567 --
NM_001013415chr4128 ------
NM_001013437chr181102 ------
NM_001013438chr3------141
NM_001013693chr182374 2304 2275 2197 896 840 651 116 --31984 932 779 --
NM_001013693chr182374 2304 2275 2197 896 840 651 116 --31984 932 779 --
NM_001013843chr151209 ----1830
NM_001014442chr131117 ------
NM_001014797chr1072357 2045 1941 1502 1485 1023 705 35884 1766 863 28145 6292 --
NM_001015887chr321640 499 --2447 328 --
NM_001017368chr1741895 415 348 72 12058 --1890
NM_001017395chr363364 2964 1373 1081 433 386 ------
NM_001017396chr222035 652 --1448 1771
NM_001017405chr41249 ------
NM_001017424chr111804 --1375 --
NM_001017425chr111804 --1375 --
NM_001017440chr7107840 7729 6487 5585 2840 2834 2497 2176 1881 980 15053 47527 3063 2973 740 22016 1099
NM_001017523chr1221863 1643 1578 1233 --
NM_001017535chr1272948 2239 2009 1244 973 163 142 --22631 1250 12160
NM_001017923chr14--1103 ----
NM_001017926chr8273 40 ------
NM_001017979chr42514 187 --1124 --
NM_001017999chr121736 244 --21504 935 --
NM_001017999chr121736 244 --21504 935 --
NM_001018000chr121736 244 --21504 935 --
NM_001018000chr121736 244 --21504 935 --
NM_001018001chr121736 244 --21504 935 --
NM_001018054chr11476 ------
NM_001018064chr921993 31 ------
NM_001018065chr9145887 5761 4760 4690 2381 2270 2221 2183 1736 1657 1527 1080 802 674 2990 869 35844 3890 3686 1317
NM_001018066chr9145887 5761 4760 4690 2381 2270 2221 2183 1736 1657 1527 1080 802 674 2990 869 35844 3890 3686 1317
NM_001018067chr154713 4282 3905 1849 465 1519 12103 1397
NM_001018068chr154713 4282 3905 1849 465 1519 12103 1397
NM_001018069chr154713 4282 3905 1849 465 1519 12103 1397
NM_001018072chr1221863 1643 1578 1233 --
NM_001018074chr572798 2615 2538 1391 1183 1055 941 --1837 --
NM_001018075chr572798 2615 2538 1391 1183 1055 941 --1837 --
NM_001018076chr572798 2615 2538 1391 1183 1055 941 --1837 --
NM_001018077chr572798 2615 2538 1391 1183 1055 941 --1837 --
NM_001018108chr153650 100 21 ----21834 1401
NM_001023567chr1522180 1897 ------
NM_001024024chr14197 --1666 --
NM_001024070chr14193 --1662 --
NM_001024094chr572798 2615 2538 1391 1183 1055 941 --1837 --
NM_001024226chr131114 799 260 ------
NM_001024227chr131114 799 260 ------
NM_001024228chr131114 799 260 ------
NM_001024372chr831451 602 62 1105 11926 --
NM_001024455chrX71846 811 592 437 416 339 187 ------
NM_001024660chr321155 1040 1420 ----
NM_001024680chr241586 1511 1474 591 ----11723
NM_001024912chr195427 348 93 73 56 11310 ----
NM_001024947chr53947 424 318 ----11123
NM_001024948chr123227 408 11006 12429 --
NM_001025076chr1095701 5160 4962 4440 4379 2194 2014 1775 1516 ------
NM_001025077chr10107059 6518 6320 5798 5737 2874 537 392 105 73 ------
NM_001025079chr344147 3484 3334 435 --1225 --
NM_001025100chr1853759 2585 1450 1385 1069 ----11410
NM_001025108chr263814 3275 2649 712 84 51 1667 --1522
NM_001025252chr852846 1200 1038 726 589 ------
NM_001025253chr852846 1200 1038 726 589 ------
NM_001025266chr374517 3792 2981 895 782 569 115 --14880 11495
NM_001025356chr1222175 982 1490 --1113
NM_001025580chrX54318 3445 3323 3210 758 1147 11366 --
NM_001025596chr111372 ------
NM_001025603chr1--21289 1087 ----
NM_001029858chr673103 2826 1032 334 160 32 22 12141 --23188 1353
NM_001029883chr211012 12834 43176 3007 2608 1991 --
NM_001030007chr1674049 3409 3144 3060 1117 764 549 --188 --
NM_001030055chr1474698 4645 3897 3024 1513 1170 701 --11484 --
NM_001030287chr131181 782 110 --2272 216 --
NM_001031680chr182077 1784 763 663 622 571 424 42 1313 3646 628 136 --
NM_001031684chr221506 944 1238 ----
NM_001031732chr433352 2999 807 22302 1194 ----
NM_001031804chr1644289 1208 584 561 24224 22 ----
NM_001031812chr5--12057 ----
NM_001032280chr641625 1550 624 205 ------
NM_001032282chr82348 31 ------
NM_001032288chr201310 --2315 41 --
NM_001032999chr20135094 4692 4626 4509 4169 3425 3337 1962 1777 1691 672 532 308 1819 15282 11523
NM_001033044chr161858 1505 1384 1189 443 54 ------
NM_001033045chr233427 3088 919 ----44024 3224 1382 516
NM_001033047chr42172 54 ------
NM_001033056chr161858 1505 1384 1189 443 54 ------
NM_001033059chr631800 500 403 ------
NM_001033081chr151619 1493 1322 623 246 --41676 1262 408 186 --
NM_001033082chr151619 1493 1322 623 246 --41676 1262 408 186 --
NM_001033087chr2052531 2369 683 449 141 12397 12241 --
NM_001033117chr374277 3142 1883 1666 835 262 246 --24063 3083 --
NM_001033503chr53139 63 30 ------
NM_001033506chr11182 1298 ----
NM_001033551chr1783425 3411 3268 1641 1606 1116 283 166 --21348 87 --
NM_001033557chr21576 1972 --11383
NM_001033561chr172301 217 1115 ----
NM_001033576chr1752565 2507 2490 1084 862 ------
NM_001033602chr1362552 2196 1069 1026 574 456 1614 ----
NM_001034837chr55728 527 192 162 95 ------
NM_001034838chr55728 527 192 162 95 ------
NM_001034954chr1092581 2489 2402 2325 1226 546 446 416 346 13112 ----
NM_001034955chr1092581 2489 2402 2325 1226 546 446 416 346 13112 ----
NM_001034956chr1092581 2489 2402 2325 1226 546 446 416 346 13112 ----
NM_001034957chr1092581 2489 2402 2325 1226 546 446 416 346 13112 ----
NM_001035003chr431106 221 26 ------
NM_001035004chr431106 221 26 ------
NM_001035260chr1021617 1425 ------
NM_001035511chr142029 1462 708 244 ----1433
NM_001035512chr142136 1569 815 351 ----1540
NM_001035513chr142136 1569 815 351 ----1540
NM_001037132chr7----12165 --
NM_001037133chr7----12165 --
NM_001037317chr142673 2532 657 210 11021 ----
NM_001037442chr41528 2491 101 ----
NM_001037631chr2198 2779 115 11011 --
NM_001037954chr1153176 3110 1338 453 419 11155 --12834
NM_001038493chr231461 466 335 --2171 68 1120
NM_001038702chr542286 2038 1954 935 ------
NM_001038707chr141874 638 631 130 --22057 2011 --
NM_001038707chr141874 638 631 130 --22057 2011 --
NM_001039348chr21877 --11008 --
NM_001039349chr21877 --11008 --
NM_001039395chr931892 1534 994 ------
NM_001039538chr283538 3473 2908 2806 2789 2285 1469 1209 22992 1273 ----
NM_001039547chr3137406 6947 6489 5644 5509 5367 3142 2135 2087 2020 1907 1218 265 11690 12773 37542 7281 2219
NM_001039577chr163706 1680 1449 1312 922 132 --13397 --
NM_001039585chr143853 3458 3417 3103 13827 23497 347 --
NM_001039590chrX63681 3442 3224 3132 2579 57 --12885 --
NM_001039591chrX63681 3442 3224 3132 2579 57 --12885 --
NM_001039618chr1154838 1391 582 171 43 --15009 --
NM_001039690chr1692236 2212 707 632 593 548 470 218 35 --11508 --
NM_001039709chr20135094 4692 4626 4509 4169 3425 3337 1962 1777 1691 672 532 308 1819 15282 11523
NM_001039762chr1031939 1568 200 ----11975
NM_001039802chr111284 ------
NM_001039840chrX65793 4443 4201 2332 1370 97 22314 1882 14920 --
NM_001039888chr14666 586 530 66 --2633 620 --
NM_001040002chr1761260 1253 412 144 91 63 ----150
NM_001040057chr7160 ------
NM_001040092chr8134 ------
NM_001040100chr331060 890 325 ------
NM_001040108chr1452984 1229 1081 1038 830 ------
NM_001040144chr1692236 2212 707 632 593 548 470 218 35 --11508 --
NM_001040146chr1692236 2212 707 632 593 548 470 218 35 --11508 --
NM_001040152chr775061 4817 3875 1918 961 742 386 11414 ----
NM_001040202chr452538 2012 886 840 310 ------
NM_001040214chr66736 356 341 320 215 191 ------
NM_001040284chr1635753 4878 4702 --34110 3618 135 --
NM_001040402chr432049 483 153 22964 382 23165 3136 --
NM_001040429chr1343460 3387 1325 785 ------
NM_001040439chr16101226 1207 1075 531 350 296 254 112 44 24 --31131 963 591 --
NM_001040458chr52117 92 ------
NM_001040619chr161631 1232 1142 560 421 345 ------
NM_001040665chr774232 4080 3468 1781 848 414 128 --11668 --
NM_001040712chr953051 2670 1210 1157 549 --13346 --
NM_001042357chr102536 302 --11007 --
NM_001042358chr102536 302 --11007 --
NM_001042360chr102536 302 --11007 --
NM_001042363chr102536 302 --11007 --
NM_001042389chr102536 302 --11007 --
NM_001042390chr102536 302 --11007 --
NM_001042392chr102536 302 --11007 --
NM_001042395chr102536 302 --11007 --
NM_001042406chr6178 ----1448
NM_001042413chr973970 3164 3142 2890 1647 996 102 --1498 1718
NM_001042424chr442565 2333 1039 896 --62717 2480 2441 1994 211 97 --
NM_001042425chr641625 1550 624 205 ------
NM_001042479chrX41533 671 545 23 ----21874 805
NM_001042480chrX41533 671 545 23 ----21874 805
NM_001042486chr2071469 1328 1169 975 300 120 80 --21522 176 21209 421
NM_001042492chr1763380 2759 1387 1316 153 31 --12940 1905
NM_001042494chr15123747 3655 2809 2741 1523 1388 1225 647 554 324 212 68 --13675 22667 93
NM_001042495chr15123747 3655 2809 2741 1523 1388 1225 647 554 324 212 68 --13675 22667 93
NM_001042496chr15123747 3655 2809 2741 1523 1388 1225 647 554 324 212 68 --13675 22667 93
NM_001042497chr15123747 3655 2809 2741 1523 1388 1225 647 554 324 212 68 --13675 22667 93
NM_001042510chr831554 637 353 ------
NM_001042511chr831554 637 353 ------
NM_001042533chr343109 1277 976 814 ----12304
NM_001042537chrX12536 11954 ----
NM_001042550chr911463 1198 ----
NM_001042555chr12104809 4182 3885 3213 3130 1661 1488 1216 1094 88 --13194 11241
NM_001042599chr2167595 7537 7526 7463 6699 6312 6270 3133 2304 2094 1966 1548 1006 575 542 45 16564 57796 5338 2030 580 159 --
NM_001042601chr32683 452 12058 23308 3250 11310
NM_001042603chr1295204 4803 4390 1931 1379 1001 985 392 351 24542 1019 14866 --
NM_001042604chr354431 4163 1553 1391 658 24704 3984 --14571
NM_001042784chr4------143
NM_001043318chr1463525 3284 3239 1450 1410 661 --23660 1511 12766
NM_001043351chr132222 1949 190 --11691 --
NM_001044305chr611087 11157 1264 --
NM_001044385chr263622 3600 3443 2467 1264 841 ------
NM_001044722chr5--12057 ----
NM_001044723chr5--12057 ----
NM_001046chr51408 12411 ----
NM_001048183chr1113645 3332 3225 2816 1334 1196 756 698 463 430 89 13818 --23093 2408
NM_001083620chr422520 494 22160 873 ----
NM_001092chr17122474 2313 2294 2181 1676 497 417 191 185 126 101 60 --1709 --
NM_001095chr1271702 1509 1228 771 745 470 288 --21306 66 --
NM_001099678chr395998 5887 5689 5434 2231 2181 2083 2036 575 12576 --14902
NM_001106chr3119737 8932 8576 8331 7307 7282 7026 3863 2638 1658 863 28872 6577 28999 6910 --
NM_001113490chrX33603 3340 3187 ----21167 585
NM_001116chr1673012 2169 1157 1114 1026 776 475 --22612 134 --
NM_001117chr1851673 1557 1000 582 71 1209 2593 588 --
NM_001121chr10--11575 ----
NM_001123chr101178 1235 1758 --
NM_001128chr1674049 3409 3144 3060 1117 764 549 --188 --
NM_001148chr42849 275 11682 1250 --
NM_001149chr102952 198 ------
NM_001153chr24893 728 621 35 1106 ----
NM_001167chrX36043 2648 404 24883 1178 11792 36178 4185 2013
NM_001173chr1474698 4645 3897 3024 1513 1170 701 --11484 --
NM_001174chrX2904 90 11911 ----
NM_001204chr287237 6017 5286 4854 2324 2247 2209 560 12693 22789 1801 26538 4989
NM_001206chr912179 ------
NM_001241chr211848 --1876 --
NM_001241chr211848 --1876 --
NM_001259chr755110 4678 1279 279 115 11031 35982 4546 2440 --
NM_001290chr4------1395
NM_001304chr1783796 3658 3305 2958 1157 915 695 26 23504 298 12499 --
NM_001315chr641835 1591 520 354 ------
NM_001329chr1041562 1279 1272 221 --11464 --
NM_001331chr113193 158 103 --22284 165 12556
NM_001346chr332864 2133 203 122 1865 --
NM_001364chr1164348 3626 3073 2940 1424 303 13142 --13685
NM_001369chr5125 1478 ----
NM_001380chr101966 ------
NM_001387chr552941 2574 2545 2293 664 --12894 --
NM_001396chr2131808 748 547 1339 ----
NM_001399chrX73723 3673 3204 1425 872 809 612 --13468 --
NM_001401chr941563 1517 1492 108 21479 296 167 --
NM_001408chr161589 1321 1233 396 192 47 --21118 1107 --
NM_001412chrX33687 3565 1212 ------
NM_001419chr1954789 3229 1275 436 92 ------
NM_001421chrX31421 1276 66 --1168 11607
NM_001429chr22----11004 --
NM_001430chr22596 50 21629 1557 ----
NM_001438chr142809 1063 647 559 12716 ----
NM_001448chrX21706 339 ----11575
NM_001465chr521803 1543 11624 --1134
NM_001483chr72936 322 ------
NM_001495chr831082 988 958 ------
NM_001497chr921879 1116 --1177 --
NM_001498chr621202 1126 ----11114
NM_001543chr5164853 4674 4413 4183 3425 3219 3130 3085 1925 1745 1584 1278 813 542 481 320 13539 23464 244 13064
NM_001584chr11--1963 1480 --
NM_001604chr111654 ------
NM_001616chr263296 2910 2665 2612 2263 582 ------
NM_001620chr114645 632 578 97 1782 ----
NM_001634chr631800 500 403 ------
NM_001650chr1884014 2687 2669 1539 1264 1066 592 277 ------
NM_001656chr51365 ----1665
NM_001658chr131114 799 260 ------
NM_001659chr1242550 879 221 129 --12109 --
NM_001660chr3--2581 141 ----
NM_001663chr1422225 565 ------
NM_001664chr32997 173 21037 152 ----
NM_001674chr131181 782 110 --2272 216 --
NM_001678chr1741397 208 199 151 11387 ----
NM_001682chr1252797 2296 2270 2109 2087 1884 ----
NM_001684chr1123982 3601 2793 2754 2586 1438 1363 1294 1218 707 525 181 ------
NM_001690chr3--22436 529 --1781
NM_001695chr843425 3261 3038 153 --12747 --
NM_001701chr931421 1139 442 --188 --
NM_001709chr1122480 2337 ------
NM_001726chr1128 ------
NM_001744chr51149 ------
NM_001753chr72700 63 1576 1364 --
NM_001754chr2194196 3723 2805 1668 1456 1105 1086 273 137 ------
NM_001755chr162329 168 ------
NM_001777chr344147 3484 3334 435 --1225 --
NM_001789chr361731 1709 1622 1286 478 443 --11479 --
NM_001791chr111284 ------
NM_001792chr1831156 142 47 ------
NM_001797chr161222 ------
NM_001806chr1942883 1800 1042 632 --1763 --
NM_001821chr154649 3790 1867 1401 1209 14171 ----
NM_001823chr14----142 --
NM_001830chrX62769 1463 1197 959 897 79 --12926 --
NM_001839chr11708 ------
NM_001854chr121395 1088 --2249 242 --
NM_001858chr674566 4474 4158 3779 1124 636 450 24386 647 ----
NM_001859chr983531 3318 2439 2417 1247 815 540 150 --11106 33730 678 465
NM_001896chr16--1354 ----
NM_001901chr61115 --1139 --
NM_001903chr51921 1909 2676 355 --
NM_001904chr3--1864 ----
NM_001918chr1159296 9285 9065 8468 7698 7569 7392 6259 6082 5975 3108 2561 1644 1306 325 36816 2920 893 17018 58602 6941 1959 1789 462
NM_001935chr21333 ------
NM_001938chr121434 756 ------
NM_001939chrX63359 2612 1492 1156 947 77 ----21016 113
NM_001945chr521266 1124 ------
NM_001951chr82257 38 ------
NM_001957chr422224 526 ------
NM_001968chr41216 ----1802
NM_001969chr142444 161 12829 13610 --
NM_001981chr132294 1873 1563 ----1622
NM_001987chr1251292 1198 1025 791 183 --44032 2940 1704 460 --
NM_001993chr11216 1942 ----
NM_001995chr4----11369 --
NM_002006chr475284 5191 4891 4042 2314 1424 942 15207 ----
NM_002015chr1382894 2865 2839 912 655 393 201 90 --12901 --
NM_002017chr11156 --1515 --
NM_002024chrX42080 2057 1973 1938 ------
NM_002025chrX169205 8984 8929 8901 8525 8002 7958 7302 7195 3539 2909 1876 1470 1279 891 739 18862 ----
NM_002031chr63665 329 82 ------
NM_002035chr1843157 2563 1263 930 23301 991 170 --
NM_002040chr2152929 2582 810 738 653 ------
NM_002048chr91142 --2259 236 --
NM_002063chrX21078 1015 --1882 --
NM_002065chr161858 1505 1384 1189 443 54 ------
NM_002069chr7--21764 645 ----
NM_002077chr951698 1450 443 405 297 --21500 260 --
NM_002092chr485040 4444 3331 3199 1500 1398 1104 853 11302 14218 --
NM_002107chr11433 ------
NM_002128chr1312324 --12438 --
NM_002130chr5--1359 ----
NM_002154chr52565 55 174 ----
NM_002156chr21286 1422 ----
NM_002158chr253528 3407 2567 2534 272 2822 399 1660 --
NM_002189chr103541 486 130 --2584 240 124
NM_002196chr2011106 ------
NM_002196chr2011106 ------
NM_002210chr213518 --11083 --
NM_002214chr795581 5346 5058 4864 4275 4157 2227 1899 1087 --24389 4288 11323
NM_002228chr121185 317 ----1954
NM_002241chr153079 2423 1896 213 156 11248 31911 980 202 --
NM_002247chr1042188 1568 1554 67 ------
NM_002264chr393927 3603 3584 3292 1932 1738 1163 897 88 14105 13374 --
NM_002265chr171874 ------
NM_002267chr1311811 ----1241
NM_002268chr311722 ------
NM_002270chr565497 4502 4331 1387 1000 140 --11709 --
NM_002271chr1352051 910 578 448 33 ------
NM_002285chr263814 3275 2649 712 84 51 1667 --1522
NM_002296chr12695 43 --1584 --
NM_002317chr5270 22 ------
NM_002336chr1264857 4449 4103 1403 558 32 ------
NM_002350chr83801 487 375 ----1311
NM_002356chr642854 1110 929 224 ------
NM_002373chr1551361 928 909 894 507 --31338 361 41 --
NM_002374chr283538 3473 2908 2806 2789 2285 1469 1209 22992 1273 ----
NM_002381chr21848 ------
NM_002387chr544158 3641 1618 1594 --33311 528 146 11823
NM_002390chr1751645 1598 1567 750 122 11329 31903 624 300 --
NM_002392chr121210 137 --1425
NM_002395chr62961 23 ------
NM_002397chr51253 --11375 --
NM_002398chr24473 284 200 118 ------
NM_002399chr1561078 942 322 288 200 164 ------
NM_002429chr1251547 1117 598 300 181 --41213 266 248 234 11293
NM_002430chr2252116 918 777 544 68 12143 ----
NM_002442chr1271608 1333 564 412 289 176 30 --1142 --
NM_002444chrX31337 1253 478 199 3749 74 65 --
NM_002480chr1221064 415 ------
NM_002481chr1116980 6422 6019 5900 5345 2439 2154 2078 1961 1375 80 --36501 2042 300 32365 2214 610
NM_002487chr151537 ------
NM_002500chr2--1368 ----
NM_002501chr19143748 3637 3613 3254 3145 2997 1399 1137 947 848 633 611 513 124 --31490 1209 624 --
NM_002505chr651531 450 356 284 65 ------
NM_002515chr1411285 11556 21533 1484 --
NM_002519chr1131349 1306 1192 --1500 --
NM_002522chr1763635 3035 1131 1077 966 437 13543 33651 1542 793 --
NM_002526chr611759 1229 --1544
NM_002538chr51179 1198 ----
NM_002541chr74937 833 806 374 ----167
NM_002544chr171130 ------
NM_002545chr11114093 3775 1776 1752 1353 1074 755 672 311 167 81 21558 869 14155 --
NM_002546chr82263 198 ------
NM_002547chrX64088 3947 2978 2720 504 334 ------
NM_002556chr1142025 1403 1331 824 ----11955
NM_002576chr1131008 830 70 --2427 231 --
NM_002581chr9104674 4641 4267 4124 1927 1519 1395 121 82 33 33875 1989 1431 2694 662 --
NM_002594chr2042485 786 713 207 --32348 793 41 --
NM_002605chr151752 ------
NM_002613chr1674771 4596 3978 3616 1821 169 49 --64051 4021 1505 1243 381 280 --
NM_002628chr361259 1176 874 829 774 133 ------
NM_002635chr12----1172 --
NM_002645chr1142704 2143 1231 454 ------
NM_002655chr81226 --14673 --
NM_002657chr2043072 483 409 197 ------
NM_002664chr221599 1010 21270 305 ----
NM_002687chr141859 ------
NM_002693chr151155 ------
NM_002698chr19122871 2754 2125 1201 1078 982 812 805 792 743 672 514 --11028 --
NM_002709chr213086 42685 2555 1089 497 --1800
NM_002711chr7--1780 ----
NM_002718chr342089 931 622 186 ------
NM_002721chr91331 --152 --
NM_002730chr1971136 1100 914 412 278 261 187 --2931 312 --
NM_002731chr13554 286 112 11098 22626 2160 --
NM_002734chr1751502 716 660 305 39 1794 ----
NM_002745chr2264540 4384 3055 1788 1205 707 --2656 393 --
NM_002747chr1821703 1514 --1371 1362
NM_002788chr14186 ------
NM_002816chr17--1303 ----
NM_002826chr1----1363 --
NM_002834chr1223322 189 1681 21267 864 1208
NM_002837chr1243342 3293 2791 1590 2764 90 1491 --
NM_002839chr953051 2670 1210 1157 549 --13346 --
NM_002855chr11103624 3559 2873 2532 2508 2359 1440 713 477 42 --33408 1458 111 --
NM_002868chr1252416 942 710 682 229 --22317 1897 --
NM_002873chr5--1344 ----
NM_002886chr374605 4429 1992 1390 1025 592 55 11397 11643 --
NM_002890chr54948 795 380 43 --1892 --
NM_002893chrX2343 261 ------
NM_002894chr181195 ------
NM_002941chr32451 190 ------
NM_002942chr321226 945 11343 ----
NM_002948chr331314 1157 888 --11107 --
NM_002959chr1103632 3474 3161 1437 1176 662 543 384 71 24 --1108 --
NM_002973chr122507 61 ------
NM_002977chr273235 2547 1195 1176 862 577 130 13176 12697 --
NM_002996chr1681951 1743 1494 477 317 291 285 228 --21593 219 --
NM_002998chr842259 2071 1975 1800 ------
NM_003001chr142136 1569 815 351 ----1540
NM_003003chr173240 78 61 1288 1193 --
NM_003010chr1721955 810 ------
NM_003016chr172709 262 1447 ----
NM_003030chr331934 1778 584 --11692 11448
NM_003036chr13375 360 237 ----1216
NM_003042chr351761 1621 92 41 25 --21874 870 --
NM_003045chr13114834 4335 4175 3496 3411 3294 1851 485 444 289 155 --23777 807 --
NM_003074chr32900 306 --176 1862
NM_003076chr1251231 1070 578 467 36 1348 1198 --
NM_003093chr61211 ------
NM_003095chr122126 66 ------
NM_003106chr311059 --1831 --
NM_003112chr71825 1642 ----
NM_003128chr222007 595 --11055 --
NM_003139chr114735 311 223 141 --2672 372 --
NM_003142chr2--1276 ----
NM_003144chr612026 12169 ----
NM_003155chr8102444 2189 1893 1104 1050 1040 727 594 254 169 ----12174
NM_003161chr1742808 1161 479 253 --1736 --
NM_003164chr111413 --1422 1552
NM_003178chr332189 1768 442 --1400 --
NM_003185chr202962 308 --1358 --
NM_003188chr62304 118 ------
NM_003189chr173208 2621 2233 827 679 514 458 ------
NM_003199chr1865179 3626 3491 1707 1608 840 15204 14490 1169
NM_003203chr22499 234 --1953 --
NM_003204chr1731260 1142 684 --31680 1468 530 --
NM_003211chr1231641 230 78 1644 ----
NM_003217chr1251945 1871 1294 1237 307 --1493 126
NM_003220chr641625 1550 624 205 ------
NM_003221chr682812 2568 1225 1216 824 614 496 354 --11642 13411
NM_003222chr201949 --1201 --
NM_003234chr32584 391 --11541 --
NM_003243chr131137 1033 26 --142 --
NM_003253chr21----2157 51 --
NM_003262chr354132 4110 3470 792 373 21248 540 --14569
NM_003269chr61136 ----175
NM_003270chrX1924 ------
NM_003274chr2132706 1073 151 11924 --135
NM_003281chr1125347 5125 4962 4535 4326 3604 3492 2120 1910 1730 1136 54 12177 54204 4191 4067 944 60 --
NM_003286chr2011151 ------
NM_003290chr1961087 812 757 412 211 26 --11199 1882
NM_003298chr385002 4798 4755 3824 2078 2011 1891 1474 25747 1751 --25465 4507
NM_003304chr3----11486 --
NM_003319chr24744 357 332 288 ------
NM_003325chr222485 451 --1147 --
NM_003336chrX11094 ------
NM_003338chr1031826 509 469 ------
NM_003341chr31600 ------
NM_003342chr1752064 810 190 179 47 ------
NM_003344chr751255 1166 392 183 43 ------
NM_003347chr2241598 626 279 132 ------
NM_003348chr121483 ----11238
NM_003349chr201310 --2315 41 --
NM_003369chr1112699 --1518 12653
NM_003392chr354132 3735 3420 1734 520 --1300 --
NM_003400chr2189 ------
NM_003404chr2041887 1374 732 48 ------
NM_003406chr811312 ------
NM_003411chrY31657 1612 706 1436 ----
NM_003412chr32621 533 12248 12568 --
NM_003413chrX21820 293 ------
NM_003423chr1952545 1828 1715 1047 241 ------
NM_003452chr92627 70 ------
NM_003458chr3103524 3496 3214 2735 1124 819 799 726 653 537 ------
NM_003462chr171755 1682 684 535 484 293 26 --11393 --
NM_003463chr652928 1221 988 947 362 --12781 --
NM_003468chr253325 2736 1047 708 492 --22645 187 14334
NM_003470chr1641563 1158 734 550 11403 11626 --
NM_003471chr342010 916 775 109 ------
NM_003477chr11--1205 ----
NM_003478chr1152780 2742 1342 621 256 12096 ----
NM_003482chr122992 747 --42000 622 400 238 --
NM_003483chr1282801 2408 2301 2198 2107 2018 696 476 ------
NM_003489chr2153055 1308 1176 586 480 --12418 --
NM_003575chr761597 1560 1373 1038 613 584 --31101 203 183 --
NM_003583chr1233505 3122 1064 1933 13619 --
NM_003590chr233793 3512 163 14032 ----
NM_003601chr4128 ------
NM_003607chr183926 3799 3659 3276 1414 1365 1351 175 13372 ----
NM_003613chr152629 262 ------
NM_003615chr353816 3471 3358 3220 520 ------
NM_003616chr142395 73 --152 --
NM_003617chr174596 4291 4283 4248 3975 3175 1903 1350 24393 4063 --
NM_003622chr122619 112 --12572 --
NM_003629chr173495 3311 3137 2851 568 372 290 ----12669
NM_003632chr174681 307 31 25 ------
NM_003633chr542141 956 441 162 --1466 --
NM_003644chr1785663 4515 4470 4447 1837 877 842 360 11831 36140 1336 743 --
NM_003645chr15270 24 ------
NM_003659chr251007 898 795 295 53 1939 ----
NM_003679chr173268 2464 2338 2305 2241 436 362 23470 238 ----
NM_003690chr21184 ------
NM_003701chr1321000 112 ------
NM_003713chr111378 11570 1110 --
NM_003716chr3--195 1750 --
NM_003759chr443795 3335 3150 848 ------
NM_003760chr1195 ------
NM_003763chr2063155 3053 2411 2032 866 76 1901 --12238
NM_003774chr1252958 2926 2753 2614 1236 ----1898
NM_003783chr11843 21127 796 ----
NM_003790chr1----1217 --
NM_003795chr6168 ------
NM_003818chr2021058 100 --2773 68 --
NM_003819chr13297 91 50 ------
NM_003828chrX1562 ------
NM_003831chr181690 11278 11256 --
NM_003861chr1442722 2348 1010 153 --22565 2540 --
NM_003884chr321611 1237 11195 21477 1179 --
NM_003895chr2131890 714 582 --1330 --
NM_003908chr2041372 1299 1270 856 --21317 1115 --
NM_003913chr673955 3625 3083 2899 2719 1667 790 --23041 2922 --
NM_003934chr9122 11200 ----
NM_003939chr1083972 3814 3717 3377 2698 1533 529 523 13852 22952 2556 --
NM_003941chr731972 1925 101 12320 ----
NM_003947chr351004 916 894 295 287 ------
NM_003955chr1751549 1538 372 239 221 --11035 --
NM_003958chr683860 3564 3172 2956 1241 1191 1014 103 12861 1221 11060
NM_003971chr171503 ------
NM_003983chr1653866 3783 1787 1091 110 --179 --
NM_003994chr1264341 3656 3223 1532 1442 1316 23938 2862 ----
NM_004004chr1341134 895 415 97 1868 ----
NM_004024chr161540 1141 1051 469 330 254 --1575 --
NM_004028chr1884014 2687 2669 1539 1264 1066 592 277 ------
NM_004035chr1765050 3794 3282 1599 1231 604 14936 --11880
NM_004050chr1421693 600 --12375 1957
NM_004075chr121424 ------
NM_004079chr152774 1939 1895 870 202 --12360 21806 310
NM_004090chr175922 836 405 136 102 22430 975 22641 374 --
NM_004093chr1343090 2637 2579 2370 --12718 --
NM_004094chr1462653 2572 1169 365 195 24 --1832 --
NM_004100chr631754 922 416 --11912 --
NM_004105chr21877 --11008 --
NM_004112chr1721760 1396 --21720 1311 --
NM_004124chr1432851 2397 935 1958 ----
NM_004133chr832534 269 242 ------
NM_004156chr81396 ------
NM_004161chr21188 11058 ----
NM_004170chr931487 1206 515 11316 --11765
NM_004171chr11129220 7370 7315 7169 6752 6207 6029 2840 2511 2410 287 40 59433 8701 7653 6116 3154 13822 --
NM_004172chr521883 363 1779 ----
NM_004183chr111540 --1714 --
NM_004205chr111490 --1553 --
NM_004227chr742065 929 42 36 --12562 --
NM_004229chrX--11419 31571 1473 709 --
NM_004232chr181739 23014 954 ----
NM_004236chr151143 ------
NM_004248chr102134 42 --1443 1668
NM_004268chr113920 887 266 2945 66 ----
NM_004272chr521512 181 3745 514 26 ----
NM_004274chr1453089 3036 2813 426 369 1308 13052 12788
NM_004293chr953678 3415 2882 1479 792 --1181 --
NM_004302chr1272934 2566 2324 2311 2174 842 98 ------
NM_004321chr2113594 3482 3184 2547 2304 446 356 179 168 81 35 13568 ----
NM_004323chr982397 2351 2215 1988 1664 968 119 49 --21680 271 --
NM_004327chr2242221 2060 2042 857 --1905 --
NM_004329chr1021300 1081 --11366 --
NM_004331chr862224 933 583 225 126 98 ------
NM_004338chr18126214 5439 5084 5030 4419 2261 2217 2057 1440 1200 748 736 ------
NM_004349chr841116 961 887 54 --1148 --
NM_004350chr182077 1784 763 663 622 571 424 42 1313 3646 628 136 --
NM_004369chr22458 58 --1480 --
NM_004370chr641805 688 264 175 ------
NM_004384chr5--12057 ----
NM_004385chr5----151 --
NM_004393chr362055 1842 912 654 387 225 --1888 --
NM_004397chr1173878 3137 2909 1509 395 371 238 ------
NM_004407chr42996 740 ----1729
NM_004423chr3152660 2563 2428 2335 2183 2164 2090 1731 867 852 719 334 192 133 41 12494 42416 2343 984 792 --
NM_004437chr1103416 2381 2289 1174 1150 1052 412 332 326 230 1747 22741 25 --
NM_004438chr252631 2572 2205 2107 1101 --1652 1735
NM_004441chr331250 874 327 --2512 297 --
NM_004446chr1128 ------
NM_004447chr122948 47 ------
NM_004450chr141282 ------
NM_004454chr332221 905 668 --21880 226 --
NM_004458chrX31923 1886 473 12189 21898 1694 --
NM_004459chr1751471 1447 170 161 21 2819 146 ----
NM_004466chr133217 172 126 ------
NM_004485chr194201 4023 3905 3018 2883 1258 969 416 108 11515 14114 1714
NM_004491chr1994196 3889 3723 3283 2722 1717 1393 1341 1181 ------
NM_004496chr142232 114 ------
NM_004501chr153785 3595 3513 1473 79 --11364 --
NM_004503chr125807 677 534 523 54 ------
NM_004514chr1731899 1180 34 --32999 2669 135 --
NM_004516chr194108 54 45 32 ------
NM_004527chr1761260 1253 412 144 91 63 ----150
NM_004537chr122278 200 11194 --1529
NM_004538chrX1584 ------
NM_004569chr141163 ------
NM_004586chrX64321 3925 3910 3547 1512 444 14081 1108 --
NM_004588chr11113190 2861 2814 2758 2567 2528 1600 1159 1090 739 471 11559 33182 3074 140 23890 1282
NM_004591chr2--1137 ----
NM_004593chr3--1722 1918 --
NM_004602chr203567 269 36 --21412 498 --
NM_004603chr771151 1120 430 392 369 356 86 ------
NM_004606chrX----169 --
NM_004615chrX1319 ----1757
NM_004621chr1141250 1169 318 267 --1423 --
NM_004631chr11476 ------
NM_004654chrY2401 393 ------
NM_004660chrY31981 375 109 1702 ----
NM_004663chr1511295 ------
NM_004681chrY1579 1672 ----
NM_004684chr4----124 --
NM_004687chr172219 25 ------
NM_004690chr61746 ------
NM_004697chr91171 1105 ----
NM_004713chr14138 1691 ----
NM_004717chr71409 11293 ----
NM_004723chr161039 862 711 411 124 73 ------
NM_004726chrX55728 5268 5221 4305 191 1463 --31143 932 75
NM_004734chr1353241 3120 2487 345 26 --32220 96 42 --
NM_004736chr12823 468 ----12137
NM_004742chr321358 273 --1468 --
NM_004745chr8136250 6031 5566 5225 5192 4285 1639 1587 1467 1204 834 685 612 16475 35960 5037 329 --
NM_004768chr13447 194 24 ------
NM_004781chr151561 1296 1215 412 378 ------
NM_004781chr151561 1296 1215 412 378 ------
NM_004788chr1152610 2603 1809 1703 683 2359 320 ----
NM_004789chr9--199 ----
NM_004798chr2042993 2859 631 143 --11437 --
NM_004801chr23469 436 224 ------
NM_004815chr184896 4554 4542 4458 4441 3387 3196 1261 13810 --1335
NM_004834chr223366 313 13254 ----
NM_004836chr22720 177 1730 ----
NM_004840chrX52410 1827 1628 571 562 --21692 452 11545
NM_004841chr1----1777 --
NM_004845chrX42564 1178 500 371 13455 34176 4108 425 13124
NM_004857chr1484397 4351 4019 3902 3882 1220 1035 664 --1547 1801
NM_004859chr1712303 1140 ----
NM_004863chr1454989 4687 4552 3381 341 --14629 34824 4299 3582
NM_004865chr6131 ------
NM_004871chr1774330 4206 2704 1545 1345 849 721 ----13888
NM_004879chr112769 723 ----1707
NM_004896chr1021532 1340 ------
NM_004902chr20----1341 --
NM_004904chr7115959 5643 5625 5592 4396 2321 1617 921 803 758 313 26505 1202 14462 --
NM_004912chr711252 1475 21616 1567 --
NM_004921chr151898 1875 1594 1016 764 ------
NM_004922chr105904 728 684 670 658 --1911 --
NM_004926chr144386 180 135 121 ------
NM_004929chr8--1450 1239 --
NM_004932chr53669 342 229 1543 21458 351 --
NM_004938chr9----1335 --
NM_004947chr342531 2305 1019 80 --21623 621 12101
NM_004956chr743803 3572 3045 484 23512 2909 --24230 1799
NM_004965chr211772 175 ----
NM_004967chr4167 ------
NM_004976chr11174854 4801 4556 4322 4052 3870 3850 3764 3754 3744 3295 2013 1752 1393 891 627 259 11938 43704 3424 1669 554 --
NM_004985chr1284216 4157 4124 3826 2759 1131 900 308 --13552 --
NM_004992chrX167762 6543 6491 3254 2996 2501 2091 1792 1663 1329 949 764 646 589 458 222 15453 22550 434 --
NM_004992chrX167762 6543 6491 3254 2996 2501 2091 1792 1663 1329 949 764 646 589 458 222 15453 22550 434 --
NM_004993chr142512 39 11526 ----
NM_004999chr664199 3860 1665 1264 915 839 22952 239 11337 --
NM_005006chr231016 956 165 1981 ----
NM_005010chr7----12165 --
NM_005020chr71560 ------
NM_005023chr511504 1538 ----
NM_005028chr1081653 1461 1439 703 645 623 322 185 1344 12261 --
NM_005032chrX11050 ------
NM_005054chr261557 1367 527 392 249 194 ----11464
NM_005056chr1295448 5047 4634 2175 1623 1245 1229 636 595 24786 1263 15110 --
NM_005060chr13990 902 116 --51367 1208 984 542 264 --
NM_005063chr1053831 3364 2762 1193 317 ------
NM_005065chr1464915 4769 4582 4542 2024 1962 1304 24878 4535 --
NM_005066chr11291 ------
NM_005068chr641320 1206 920 553 1899 ----
NM_005076chr1104234 4026 3639 3487 3049 3003 2874 981 953 325 --11252 13593
NM_005079chr852846 1200 1038 726 589 ------
NM_005093chr20135094 4692 4626 4509 4169 3425 3337 1962 1777 1691 672 532 308 1819 15282 11523
NM_005095chr141936 899 484 64 --1498 --
NM_005099chr1----11285 11078
NM_005109chr362519 2416 1677 1617 1030 96 12304 ----
NM_005121chr1713682 12930 11127 --
NM_005135chr15123747 3655 2809 2741 1523 1388 1225 647 554 324 212 68 --13675 22667 93
NM_005153chr162523 182 ------
NM_005156chr955357 5136 4442 3491 84 24187 710 11726 11793
NM_005160chr2266169 5433 2684 1968 1750 1120 --12144 26163 1539
NM_005171chr1211247 ------
NM_005180chr1021318 105 ----1343
NM_005184chr1971473 1432 1191 1034 610 499 109 --11395 --
NM_005187chr1611544 1140 51659 1391 1361 586 53 11975
NM_005188chr11107664 5183 3324 3100 2907 2361 2029 1791 1268 624 --18007 --
NM_005197chr1485903 5495 4586 3790 2427 1700 421 311 --14182 --
NM_005202chr182163 1874 1792 1733 742 426 259 137 11751 1315 --
NM_005204chr102973 941 ------
NM_005206chr1721215 187 1944 --21351 956
NM_005214chr2161 2742 78 1974 --
NM_005215chr18--157 ----
NM_005219chr551806 1327 1221 326 152 --31275 701 221 11406
NM_005221chr7----1236 --
NM_005235chr2167595 7537 7526 7463 6699 6312 6270 3133 2304 2094 1966 1548 1006 575 542 45 16564 57796 5338 2030 580 159 --
NM_005238chr1133294 3009 1219 ------
NM_005259chr231369 1273 54 ------
NM_005264chr102774 123 1868 ----
NM_005271chr102301 127 11201 11033 --
NM_005277chr431766 70 62 --1174 --
NM_005291chr27826 322 238 149 92 80 55 ------
NM_005316chr1121094 130 ------
NM_005324chr1721999 741 ------
NM_005338chr783473 2830 2515 1602 1508 677 300 69 --21135 725 23946 3610
NM_005339chr41803 --1873 --
NM_005342chrX42487 1794 977 386 --12183 --
NM_005359chr1886110 6075 5295 3971 2243 2177 1966 1307 16573 16349 --
NM_005375chr62314 69 ----1180
NM_005385chr332458 2125 1036 1219 1541 --
NM_005392chr941349 1337 170 133 --11822 --
NM_005400chr242901 933 583 555 ------
NM_005402chr751777 1710 1662 1540 205 ------
NM_005410chr5----129 --
NM_005414chr3--1254 ----
NM_005436chr1043883 3150 1430 59 ------
NM_005439chr12----2455 92 --
NM_005458chr96957 867 649 527 518 355 --1506 --
NM_005465chr131589 1549 284 2428 329 --11271
NM_005475chr1232659 2628 25 22817 648 ----
NM_005487chr2231921 642 577 --11353 --
NM_005499chr191566 ------
NM_005504chr1286150 6045 5546 5067 2035 1638 986 42 14615 ----
NM_005530chr151362 11014 ----
NM_005540chr11232 139 --2427 141
NM_005544chr2161 ------
NM_005561chr133957 213 192 ------
NM_005562chr151648 1319 1225 359 125 --124 --
NM_005566chr114550 360 220 135 2539 519 ----
NM_005596chr964765 4525 4043 2198 2175 671 11805 ----
NM_005610chr12907 49 ------
NM_005637chr1862069 2025 1936 1501 1443 257 ----11779
NM_005638chrX11240 --11713 --
NM_005639chr1241610 590 470 109 ------
NM_005648chr81231 ------
NM_005655chr82348 31 ------
NM_005665chr154550 4118 1070 790 722 ------
NM_005668chr52270 149 23642 1029 ----
NM_005670chr651917 1772 829 589 208 --11424 --
NM_005682chr1661334 1094 317 274 119 82 --1280 --
NM_005707chr153917 313 45 11290 --11057
NM_005715chr672514 2431 1040 1009 989 825 777 ------
NM_005722chr251781 633 478 197 76 ------
NM_005724chr152808 253 ------
NM_005725chr121876 622 --169 --
NM_005734chr11--1287 ----
NM_005736chr1031526 1396 222 ------
NM_005737chr242598 2483 1100 336 12528 22002 241 --
NM_005739chr155645 634 578 464 95 ------
NM_005746chr732735 2384 429 ------
NM_005749chr17--1484 ----
NM_005754chr531232 204 44 ------
NM_005756chrX31134 91 53 ------
NM_005786chr181958 ------
NM_005789chr1751448 1385 1347 1340 226 11499 ----
NM_005795chr252144 2138 2009 289 167 13058 144 --
NM_005808chr352858 1300 723 591 309 --42662 2276 372 353 --
NM_005826chr11620 ------
NM_005828chr1754681 4306 4095 1126 433 ------
NM_005839chr11807 ------
NM_005840chrX92608 1930 1903 1560 1091 933 330 225 47 46623 6213 5786 5557 12623 --
NM_005843chr231362 779 533 --197 --
NM_005857chr121242 64 --1415 --
NM_005859chr521524 171 ------
NM_005862chr34727 351 251 198 ------
NM_005863chr102531 319 --11066 --
NM_005869chr52395 73 ------
NM_005882chr41249 ------
NM_005888chr12----1172 --
NM_005900chr41124 1240 ----
NM_005901chr18107973 7353 7158 6922 6644 6363 5887 5522 3359 2230 38211 7862 7821 26567 2660 --
NM_005902chr15124513 3652 2970 2877 1436 1400 1362 1060 968 495 350 81 --32924 451 121 --
NM_005903chr563639 3559 1327 1058 443 293 1783 --11462
NM_005906chr641562 1438 1205 1187 ------
NM_005907chr611072 ------
NM_005909chr563737 3318 3241 3077 1097 817 --24067 285 1889
NM_005910chr1773579 2870 1373 1345 1234 1186 276 --22695 99 --
NM_005911chr251466 1365 1186 1027 312 ------
NM_005923chr61708 ----1174
NM_005933chr1142772 2324 2188 240 2668 598 ----
NM_005935chr451452 1022 645 359 151 24950 4228 1683 1240
NM_005937chr17153935 3864 3790 3707 3585 3500 3032 2718 1454 1209 933 617 608 524 275 11285 53869 3660 1631 903 468 --
NM_005943chr661597 506 437 306 232 169 --31238 470 31 1288
NM_005955chr155017 4336 2068 1811 1383 ------
NM_005957chr194737 4682 4506 3974 3704 3437 3264 1277 849 1316 21499 809 14819
NM_005962chr1032329 1755 49 --2697 632 --
NM_005962chr1032329 1755 49 --2697 632 --
NM_005990chr542670 1969 167 110 --31851 1021 144 11912
NM_006011chr1593547 3467 3208 3198 3064 3045 2755 2699 1505 146 23450 3095 --
NM_006022chr1311076 1949 ----
NM_006033chr1852333 2108 1725 218 90 --1554 --
NM_006036chr252177 1021 879 721 62 ------
NM_006038chr2081923 1776 1616 787 665 382 180 22 11468 1537 --
NM_006051chr51243 --148 --
NM_006079chr61255 --2312 40 --
NM_006080chr71204 1144 ----
NM_006085chr131137 513 50 11035 --1184
NM_006090chr11682 ----1150
NM_006094chr822111 616 11979 ----
NM_006095chr423383 79 11542 ----
NM_006106chr1122809 2785 --12518 --
NM_006108chr1182309 2279 2256 2245 1822 1671 857 634 ------
NM_006136chr71311 ------
NM_006141chr1622668 2150 ----1909
NM_006143chr12----190 --
NM_006166chr1211038 12396 ----
NM_006167chr862058 1852 635 422 385 366 --1846 --
NM_006180chr921993 31 ------
NM_006191chr126956 678 206 168 157 142 --2753 22 --
NM_006195chr921367 357 2313 221 ----
NM_006197chr841813 1669 1638 25 21704 461 ----
NM_006203chr534943 4742 4213 11474 ----
NM_006204chr101223 ------
NM_006206chr492859 2347 2093 1806 1145 1054 918 313 125 22173 2136 12081 --
NM_006209chr8134 ------
NM_006210chr1951237 1225 1191 864 307 ------
NM_006224chr17102275 2241 1954 1551 826 763 659 401 312 56 11813 11676 --
NM_006238chr661941 1750 1397 1329 835 190 --42028 1840 1437 710 --
NM_006241chr332231 478 412 ------
NM_006246chr14------11168
NM_006251chr522128 1022 12374 ----
NM_006257chr104957 342 109 85 ------
NM_006259chr4164 --1231 --
NM_006275chr2032155 2023 1690 --1423 --
NM_006282chr2054455 4439 4314 3439 321 --33927 765 28 --
NM_006283chr861521 1332 1132 651 462 23 11050 ----
NM_006289chr95292 175 98 92 83 ----1386
NM_006293chr158951 873 861 831 642 336 162 82 ----1418
NM_006306chrX65768 4738 1270 1222 76 54 14922 --11067
NM_006307chrX----1311 --
NM_006315chr494467 4227 3746 3592 3357 1665 762 684 153 13971 ----
NM_006317chr52272 138 ------
NM_006352chr132082 1438 342 --11318 --
NM_006359chrX12536 11954 ----
NM_006366chr621296 116 ------
NM_006372chr62397 161 ------
NM_006380chr1754296 3646 2679 1635 1219 124 1513 --
NM_006386chr2242247 2237 1783 133 --22189 292 --
NM_006390chr1221531 743 1470 ----
NM_006393chr1094446 3999 3992 3653 3030 1134 882 472 382 14567 ----
NM_006409chr71266 ------
NM_006420chr2043349 2613 1119 422 1165 ----
NM_006434chr1092581 2489 2402 2325 1226 546 446 416 346 13112 ----
NM_006449chr252102 2043 1582 1521 1386 11474 ----
NM_006454chr4112603 2548 2407 2137 2078 1239 990 612 376 192 124 --1227 --
NM_006457chr441169 555 250 134 --11508 1692
NM_006464chr284655 3513 3295 1797 1659 1045 726 353 11822 34303 3784 1738 13430
NM_006469chr151373 1330 1155 568 311 --11056 11510
NM_006472chr13928 426 83 ------
NM_006482chr1233505 3122 1064 1933 13619 --
NM_006489chr1411285 11556 21533 1484 --
NM_006504chr1052013 878 805 763 408 12810 ----
NM_006526chr20--11926 ----
NM_006537chr15--2596 161 ----
NM_006538chr2104049 3515 3157 2679 1334 1180 1099 1086 364 65 34211 1592 453 12770 --
NM_006540chr831514 1232 1082 --195 --
NM_006544chr1496009 5348 4865 4095 3949 1515 1422 1392 725 ----25818 5396
NM_006546chr17185967 5862 5506 5151 4991 4730 4623 4224 2179 2126 2114 1687 1124 1084 1027 954 602 202 --22029 194 --
NM_006547chr741874 648 488 398 --1204 1562
NM_006548chr331432 511 49 11786 --1502
NM_006549chr1272840 2760 2478 2367 2270 1908 95 1875 12087 --
NM_006555chr751870 1453 334 258 22 --11957 --
NM_006558chr8--1420 ----
NM_006560chr111372 ------
NM_006561chr1095701 5160 4962 4440 4379 2194 2014 1775 1516 ------
NM_006565chr161261 11013 ----
NM_006572chr1732269 1164 989 --43167 1264 445 263 --
NM_006574chr31278 ------
NM_006575chr1421401 512 ------
NM_006587chr421631 261 132 11647 --
NM_006599chr1675925 5646 5271 2959 2720 2583 252 26210 5277 15110 --
NM_006606chr2053026 2599 1233 716 32 ----12838
NM_006609chr23975 623 538 --1491 --
NM_006614chr373670 3315 2909 2853 1203 721 39 1561 32914 2750 2556 1269
NM_006618chr161472 1336 362 350 278 49 ------
NM_006620chr653286 3126 1383 797 189 21648 623 11734 --
NM_006621chr141625 1347 781 246 --11423 --
NM_006624chr101747 --1581 --
NM_006625chr11197 --11093 --
NM_006625chr11197 --11093 --
NM_006625chr11197 --11093 --
NM_006626chr961757 1745 1069 921 477 95 ------
NM_006628chr1544224 4197 3593 1660 24437 3270 24191 252 --
NM_006646chr1342296 2214 708 405 ------
NM_006650chr583494 2714 976 596 573 376 340 237 --23511 757 --
NM_006654chr12104809 4182 3885 3213 3130 1661 1488 1216 1094 88 --13194 11241
NM_006699chr12160 144 1383 1945 --
NM_006706chr5154 ------
NM_006713chr52332 184 1841 ----
NM_006721chr101178 1235 1758 --
NM_006726chr4122 2303 261 ----
NM_006731chr945379 3969 1971 1045 1543 32190 2088 922 25178 4835
NM_006738chr1554618 3794 1670 1423 498 --23519 1336 --
NM_006750chr1677913 7036 4972 2941 2737 2173 763 15361 26853 1810 25902 2108
NM_006751chr22915 216 ------
NM_006756chr841393 1310 487 137 ------
NM_006766chr852183 979 944 456 392 ------
NM_006772chr681709 1666 1440 1341 1228 1082 428 384 ------
NM_006775chr673092 2898 2481 2013 1987 179 36 12145 21979 265 12333
NM_006777chrX22783 2600 12814 11987 --
NM_006790chr51306 132 ----
NM_006793chr101613 1106 131 --
NM_006804chr17--1548 ----
NM_006806chr211267 ------
NM_006811chr201840 185 ----
NM_006825chr122675 39 --193 --
NM_006827chr1453060 2832 2778 800 170 --1634 --
NM_006828chr63410 114 102 ------
NM_006838chr1241613 741 209 23 21691 1540 ----
NM_006852chr1722868 1777 22602 837 12120 --
NM_006874chr4------11226
NM_006875chrX3773 194 29 1820 ----
NM_006884chr331934 1778 584 --11692 11448
NM_006885chr165959 702 237 79 62 --23307 2832 --
NM_006888chr1453472 3180 2967 1012 985 12588 ----
NM_006896chr771141 816 416 399 264 178 143 --21147 185 --
NM_006902chr152540 2373 2167 2098 154 ------
NM_006920chr241895 1746 367 228 ----1543
NM_006922chr272244 1838 1707 1031 246 222 69 11656 1399 --
NM_006924chr1773080 2810 1591 1557 1437 826 148 11214 14132 --
NM_006930chr521776 425 --21723 568 --
NM_006931chr1252047 1737 357 283 54 ----11863
NM_006940chr1231629 1551 296 --149 --
NM_006943chr2063225 3192 575 207 189 39 --32662 2368 853 13063
NM_006981chr942856 2685 2045 309 32038 825 364 22690 2175 --
NM_006990chr142044 1968 1672 69 1350 --11578
NM_007007chr1244140 3099 1304 1049 ------
NM_007010chr1751510 1439 1394 1200 50 1118 1315 --
NM_007011chr1575412 4747 4181 2470 2214 1307 1246 --22404 1836 25548 2010
NM_007017chr52188 181 1770 ----
NM_007030chr5144309 4261 4059 3198 2013 1786 1614 1566 990 967 630 412 179 86 13544 24484 1478 --
NM_007034chr11949 1315 ----
NM_007038chr2194932 4884 4259 2133 1946 1552 987 500 82 35913 4686 129 11285 --
NM_007039chr1411430 --21747 71 --
NM_007050chr20207863 7790 7266 6631 6133 5646 5404 5264 3146 3092 2827 2805 1803 1174 1122 661 622 577 341 228 15696 57695 5530 3119 2814 1678 --
NM_007052chrX1151 ------
NM_007064chr321155 1040 1420 ----
NM_007073chr653807 3632 3059 2940 1622 11115 33836 3831 1124 1727
NM_007084chr134619 439 432 245 11534 ----
NM_007106chr1342526 1785 491 69 ------
NM_007107chr342421 2186 703 126 1528 ----
NM_007114chr333189 2784 1228 --1635 --
NM_007124chr6165 1524 11741 --
NM_007145chr191193 11331 ----
NM_007146chr1751133 941 618 580 145 11043 1775 --
NM_007156chrX135 ------
NM_007158chr11967 ------
NM_007159chr31672 ------
NM_007166chr111269 ------
NM_007170chr1----1129 --
NM_007174chr1281655 1577 1497 877 810 796 705 22 1335 11708 --
NM_007189chr771287 1080 1025 527 399 142 123 --21434 958 --
NM_007198chr82606 71 21634 27 1504 --
NM_007200chr1554618 3794 1670 1423 498 --23519 1336 --
NM_007203chr933775 2555 1489 ----13649
NM_007207chr11752 1366 ----
NM_007214chr6--11013 ----
NM_007218chr8--2952 604 ----
NM_007222chr8273 40 ------
NM_007235chr121419 ------
NM_007236chr152447 70 --1814 --
NM_007238chr20114663 4585 4573 4415 4046 3817 1515 692 341 223 99 --14508 11652
NM_007249chr13139285 8974 8254 8217 7249 6218 6024 2085 1735 1646 1337 1101 1063 16279 49411 6963 597 56 --
NM_007269chr1--1461 ----
NM_007275chr32829 773 ------
NM_007276chr721076 952 --1986 --
NM_007292chr1765050 3794 3282 1599 1231 604 14936 --11880
NM_007294chr171274 ------
NM_007295chr171274 ------
NM_007296chr171274 ------
NM_007297chr171274 ------
NM_007298chr171274 ------
NM_007299chr171274 ------
NM_007300chr171274 ------
NM_007302chr171274 ------
NM_007303chr171274 ------
NM_007304chr171274 ------
NM_007305chr171274 ------
NM_007325chrX62034 1984 1750 1727 1571 421 ------
NM_007353chr76855 757 535 462 417 392 --21034 667 --
NM_007373chr101390 11666 ----
NM_007375chr111098 ------
NM_012081chr553744 3525 3017 2877 2294 ------
NM_012083chr1041229 144 68 47 --1952 --
NM_012090chr121007 857 11223 ----
NM_012095chr1053398 3027 2912 2199 905 --12833 13164
NM_012098chr9----1555 --
NM_012104chr1153526 2828 933 510 323 --13395 --
NM_012104chr1153526 2828 933 510 323 --13395 --
NM_012120chr652841 2785 1830 1090 676 ------
NM_012134chr151815 1435 1255 1233 364 11707 11273 11491
NM_012137chr141979 1945 1145 111 ------
NM_012156chr2043309 2406 2132 35 --43069 3013 683 104 11077
NM_012164chr9137324 6512 6086 5752 5539 5423 5401 5046 5015 1159 1134 564 78 12899 36011 1140 802 12367
NM_012193chr11104715 4620 3771 3326 1507 1106 1100 419 159 153 11244 11078 14087
NM_012199chr164588 4059 3478 2868 886 355 1911 23204 608 --
NM_012214chr295394 4313 2321 2178 2075 1745 1704 1575 1289 25492 2500 --11425
NM_012215chr1031486 561 109 ------
NM_012219chr322586 1155 --33126 587 67 --
NM_012224chr41250 ----129
NM_012238chr1061712 1233 540 261 198 191 ----11425
NM_012243chr11334 ------
NM_012244chr1461651 1371 717 685 588 544 --41513 1500 1178 244 --
NM_012249chr253465 3349 2882 2265 352 1228 --13339
NM_012252chr794753 4591 3733 3486 3478 2040 1039 404 27 ------
NM_012262chr174572 4417 4352 4234 3895 3601 1030 23833 354 ----
NM_012281chr732070 1728 57 ----11849
NM_012282chrX5643 615 324 315 237 --181 --
NM_012287chr364126 3785 3167 2795 1527 401 11667 ----
NM_012290chr221671 1320 ------
NM_012293chr272207 2199 1484 906 342 165 128 ------
NM_012294chr753410 3270 2640 1226 863 21128 631 13788 --
NM_012297chr422144 796 --1170 --
NM_012300chr542297 2202 693 602 12322 1146 --
NM_012309chr1174659 3827 3541 3374 1202 1092 276 --23501 684 --
NM_012316chr195328 5271 4862 4643 4558 3789 2201 2195 1832 15376 33664 877 641 14778
NM_012333chr121549 240 ------
NM_012334chr584105 3396 3056 618 552 429 194 82 11285 --14240
NM_012341chr10--1433 ----
NM_012343chr51750 ------
NM_012384chr2092280 2093 1988 1970 1776 1720 626 451 426 --12065 --
NM_012412chr71885 --1847 --
NM_012463chr123404 294 183 1654 ----
NM_012465chr1073432 2923 2889 2229 1110 944 896 23141 2461 ----
NM_012482chr11438 ------
NM_013233chr2--1942 ----
NM_013254chr121658 ------
NM_013255chr7118438 7653 6748 6583 6242 3516 2664 2594 2491 1667 171 13491 18755 --
NM_013261chr463685 2886 2758 2292 848 661 ------
NM_013269chr1243970 3908 3645 3514 1725 --123
NM_013277chr122772 27 --1793 1831
NM_013279chr1162248 1976 1529 172 102 58 --11542 --
NM_013281chr2031488 1328 985 1509 ----
NM_013286chr383421 3311 3255 2971 2714 2303 278 21 ----13379
NM_013316chr72390 138 ------
NM_013341chr232925 2592 2160 ----12308
NM_013357chr82231 197 ------
NM_013372chr1593365 3198 2410 2290 2283 1106 931 859 22 --22906 114 --
NM_013374chr31981 11085 12491 --
NM_013381chr1242241 820 614 31 --1856 1844
NM_013382chr1462339 2323 2002 1634 163 53 --1134 12032
NM_013390chr941295 162 90 48 21133 367 21157 531 --
NM_013402chr1162733 2705 2634 2613 2366 2086 ----1402
NM_013423chrX1305 1873 ----
NM_013427chrX1305 1873 ----
NM_013436chr23736 711 635 ------
NM_013438chr931156 644 120 11364 11324 --
NM_013444chrX1429 ------
NM_013448chr141644 ------
NM_013943chr183161 3012 2824 2337 1236 1099 649 59 ------
NM_013989chr1474490 4140 3972 3701 3335 1897 534 --14334 1836
NM_013995chrX92031 1032 884 801 743 187 101 74 56 1155 ----
NM_013999chr1761297 1290 449 181 128 100 ----187
NM_014011chr222296 1618 12580 ----
NM_014016chr31480 ------
NM_014021chr142139 2121 1279 1239 23105 958 ----
NM_014034chr631554 1044 523 2494 392 ----
NM_014041chr3--1341 ----
NM_014043chr331581 357 138 ------
NM_014048chr1634016 3426 928 24457 1297 14005 --
NM_014106chr1552874 2367 2153 2132 861 ----1943
NM_014112chr864767 4058 3546 1365 636 118 15035 13508 --
NM_014117chr1622274 54 --32735 2579 1031 --
NM_014154chr331582 472 273 ------
NM_014155chr1176924 6176 6075 5814 2678 2223 118 --32406 972 447 24852 1554
NM_014159chr32614 147 ------
NM_014171chr2175 ------
NM_014181chr252133 1992 1835 1793 1064 ------
NM_014212chr12177 ------
NM_014217chr111804 --1375 --
NM_014220chr31813 ------
NM_014231chr1262112 1807 1672 521 169 74 ------
NM_014232chr173658 149 46 --41653 1249 1219 1156 --
NM_014232chr173658 149 46 --41653 1249 1219 1156 --
NM_014233chr1742155 1364 1355 376 --22037 56 --
NM_014240chr343704 2833 1287 454 --21281 1061 13840
NM_014250chr2231921 642 577 --11353 --
NM_014253chrX41947 1581 881 124 --1529 --
NM_014267chr111657 --1235 --
NM_014268chr1861367 1115 313 237 105 85 ------
NM_014292chr2281724 1573 1284 1180 625 616 599 84 ------
NM_014294chr831253 929 344 ------
NM_014299chr1981983 1754 1700 1464 836 324 259 55 ----1426
NM_014319chr12----1448 --
NM_014323chr224332 165 138 127 ------
NM_014324chr531262 1236 805 --21056 931 --
NM_014333chr1131846 1007 32 --1372 --
NM_014335chr1521158 937 1419 148 --
NM_014345chr62304 264 --1422 1958
NM_014363chr13--186 ----
NM_014368chr941877 1722 440 294 --11767 --
NM_014372chr152055 1599 1437 732 219 ------
NM_014381chr1452984 1229 1081 1038 830 ------
NM_014388chr175670 2432 2314 1458 1448 1019 488 24920 2215 35583 4394 71 15820
NM_014390chr77513 409 360 340 111 74 26 --1398 --
NM_014415chr311176 ------
NM_014421chr421751 1384 ------
NM_014423chr531986 929 555 15405 11243 --
NM_014429chr3--1202 ----
NM_014445chr352462 2171 1503 960 326 11848 ----
NM_014454chr61979 ------
NM_014458chr141245 885 177 117 ----11286
NM_014494chr1642139 1652 1510 320 ------
NM_014498chr3----1258 --
NM_014548chr1521301 497 ------
NM_014574chr1411158 ------
NM_014577chr221660 ------
NM_014592chr55728 527 192 162 95 ------
NM_014606chr421446 1252 --1547 --
NM_014607chr2198 21385 57 ----
NM_014613chr541150 980 741 607 22507 404 23001 323 --
NM_014614chr221492 526 --1187 --
NM_014615chr1633411 1159 626 12515 13343 --
NM_014630chr15103858 3263 3135 2883 2639 1500 413 296 272 162 1313 ----
NM_014634chr22103230 3115 2643 2430 1173 495 413 301 123 74 --22737 258 --
NM_014635chr251529 1335 489 356 213 ----11436
NM_014637chr811501 ------
NM_014647chr1621995 1485 ----1331
NM_014665chr873637 3362 3096 3003 2473 613 481 12897 12697 --
NM_014666chr51272 183 ----
NM_014682chr811643 22169 1424 1146 --
NM_014686chr1951814 1719 771 668 216 1934 1698 11606
NM_014701chr1573258 3167 3013 1360 117 73 31 --11378 --
NM_014702chr623518 2280 11314 --1536
NM_014703chr31354 11172 21207 370 --
NM_014707chr711536 1274 ----
NM_014710chrX3167 130 121 ------
NM_014711chr1631665 1506 509 11544 ----
NM_014715chr111950 ------
NM_014730chr1295079 4883 4331 3354 1541 1271 966 821 230 ----11998
NM_014730chr1295079 4883 4331 3354 1541 1271 966 821 230 ----11998
NM_014732chr16105893 5026 4437 4171 4133 4127 1862 1784 1189 60 13951 25078 4404 --
NM_014735chrX3669 499 26 ------
NM_014739chr654059 3251 1690 1489 234 ------
NM_014742chr2071402 1216 1190 580 518 427 262 ------
NM_014746chr262905 1578 1255 505 419 57 --13052 13273
NM_014747chr195753 5498 5261 5106 4486 4330 4123 1635 1192 --35679 4882 139 --
NM_014752chr1121729 1204 1567 ----
NM_014755chr243570 3467 2799 1179 --23506 1540 --
NM_014765chr111076 --12691 --
NM_014767chr10103315 3117 2694 705 649 573 467 414 396 36 ------
NM_014771chr168930 856 843 766 693 331 303 114 1873 ----
NM_014772chr1873604 2929 2917 1281 1189 475 200 1868 21171 817 --
NM_014773chr51535 ------
NM_014774chr153103 1153 956 741 51 13012 ----
NM_014776chr1243036 1097 163 51 1171 ----
NM_014784chr12216 87 --1971 --
NM_014795chr2--11198 ----
NM_014797chr682601 2470 2429 2054 914 551 132 49 ----22736 1193
NM_014802chr121735 ----128
NM_014810chr173274 2517 2311 1330 876 786 493 ------
NM_014820chr3154 11310 ----
NM_014822chr41459 1175 ----
NM_014824chr112576 274 ------
NM_014826chr183926 3799 3659 3276 1414 1365 1351 175 13372 ----
NM_014828chr1421864 862 1868 ----
NM_014830chr1263747 2664 1532 424 356 307 12909 23002 82 --
NM_014835chr20194 --12235 --
NM_014838chr2262409 1921 1888 1780 132 44 21098 233 22683 682 --
NM_014839chr121760 329 ----1204
NM_014841chr641320 978 534 109 ------
NM_014850chr374277 3142 1883 1666 835 262 246 --24063 3083 --
NM_014860chr24903 490 377 44 11745 1265 --
NM_014873chr164852 4543 4207 1180 636 425 ------
NM_014876chr2262159 2065 1823 1665 795 521 ------
NM_014877chr17107678 7626 7312 5333 5290 2879 2583 2074 1913 1434 11597 16852 16064
NM_014893chrY42255 1578 317 150 11816 12087 --
NM_014897chr1722754 543 1459 1227 --
NM_014899chr532974 449 400 --21096 574 --
NM_014901chr5121909 1893 1856 1683 1598 1592 1577 1440 895 742 628 147 ------
NM_014902chr2071469 1328 1169 975 300 120 80 --21522 176 21209 421
NM_014903chr1262411 2330 630 600 589 425 1729 1250 --
NM_014906chr1732856 768 37 34118 2517 1284 ----
NM_014909chr1473651 3558 2662 2552 1107 415 135 --63967 2935 2648 744 720 182 --
NM_014912chr1032929 1217 766 ------
NM_014917chr12762 251 --1136 --
NM_014921chr19132996 2955 2856 2669 2487 2472 2416 2399 2172 2143 734 677 221 --22913 2707 --
NM_014926chr31707 ------
NM_014932chr331679 1588 177 ------
NM_014935chr193909 3600 3456 3001 2968 2934 1567 1188 214 ------
NM_014936chr612037 --1926 1263
NM_014937chr1021186 863 --11247 --
NM_014942chr622633 510 184 2988 966 21680 814
NM_014943chr831222 1213 81 --11070 --
NM_014945chr541913 711 487 289 --1269 1498
NM_014947chr162735 2139 1211 605 213 31 --1233 --
NM_014964chr1772173 1642 576 377 296 155 122 --12365 --
NM_014969chr1--1380 ----
NM_014988chr452736 2249 2224 2167 424 ------
NM_014989chr642050 1972 1516 104 --1146 --
NM_014991chr422314 501 23036 547 164 1923
NM_014994chr15101836 1612 806 699 648 571 520 480 437 138 --22035 1903 11747
NM_014996chr31368 ------
NM_015000chr1232462 269 182 ------
NM_015002chr1221433 1399 --21976 173 --
NM_015008chr363364 2964 1373 1081 433 386 ------
NM_015027chr1631668 1574 181 ----1537
NM_015032chr1312917 11831 1342 --
NM_015035chr2085858 5296 4744 2503 2453 2366 1783 1284 1798 24075 73 15433
NM_015039chr1134117 4020 3567 3390 3151 3034 1551 1162 441 402 363 324 285 11718 23690 3113 --
NM_015042chr15114219 4061 3784 3291 3276 1620 1363 1037 863 721 678 12798 54113 3648 1113 967 836 --
NM_015045chr1042100 1974 1521 1393 ------
NM_015052chr761404 1375 882 478 455 86 ----11385
NM_015055chr1141950 925 344 120 --12880 1260
NM_015063chr1951314 894 505 492 359 --21354 235 11248
NM_015064chr1263218 2603 2453 2220 323 161 --23511 480 13567
NM_015068chr753913 3669 2727 1034 770 1266 1961 --
NM_015071chr565141 2328 2247 1043 723 322 15192 ----
NM_015074chr154940 4192 3871 1237 226 13638 13340 24008 3391
NM_015075chrX82069 1843 1611 614 482 371 344 85 --22043 393 --
NM_015077chr17114739 4530 4356 4325 3970 3301 1580 973 823 678 161 --1811 --
NM_015082chr562492 2413 2072 1875 1845 375 21969 668 ----
NM_015090chr1146065 5914 5881 5812 4678 4367 4195 3866 2102 1477 1161 608 398 179 --35727 5682 1378 --
NM_015092chr1644580 1543 192 58 --13939 23627 1681
NM_015093chr61310 --21608 243 --
NM_015094chr2263598 3465 3268 1743 1404 206 23085 1887 34017 3009 241 --
NM_015097chr322007 406 ------
NM_015103chr33999 803 264 --161 --
NM_015107chrX61926 1802 624 244 158 58 --11678 --
NM_015115chr432049 483 153 22964 382 23165 3136 --
NM_015130chr41904 ------
NM_015133chr16101226 1207 1075 531 350 296 254 112 44 24 --31131 963 591 --
NM_015139chr1148 ------
NM_015144chr1643529 1085 981 825 --23164 1562 --
NM_015155chr1072776 2697 2417 2380 855 664 283 ------
NM_015156chr1433337 3294 728 --1367 --
NM_015184chr32251 48 ------
NM_015187chr41110 ------
NM_015192chr2032623 448 426 ----1460
NM_015194chr1781857 1823 1658 1442 507 495 75 62 11629 31874 501 455 --
NM_015199chr352854 2593 2155 725 697 --12565 --
NM_015205chr13114348 4269 4229 4042 3943 1985 1069 604 363 315 252 ------
NM_015209chr121736 244 --21504 935 --
NM_015221chr1041449 1192 417 23 ----11310
NM_015225chr942367 2287 2065 597 1203 1419 --
NM_015226chr16113025 2927 2908 2119 1255 1081 972 852 662 121 109 ------
NM_015233chr1362552 2196 1069 1026 574 456 1614 ----
NM_015245chr662722 2299 2274 2233 912 541 --1576 --
NM_015267chr1241663 753 98 68 --31651 1386 370 --
NM_015275chr1221599 657 --12147 --
NM_015277chr1851291 1235 337 209 67 --1174 11258
NM_015278chr623070 277 32892 804 626 ----
NM_015285chr1862310 1832 604 559 379 351 22184 997 12266 --
NM_015288chr5103785 3207 3153 2724 2591 999 847 749 671 488 --13161 --
NM_015292chr125768 723 694 523 129 --1278 --
NM_015299chr14103468 3449 3200 2751 2621 1476 1247 1070 190 52 11191 1225 --
NM_015310chr8128428 7550 7281 7037 6784 5702 3310 3105 1957 1427 991 332 17406 36929 2705 1227 --
NM_015313chr1184339 3562 1838 1771 1245 1053 749 456 11511 ----
NM_015317chr252521 2512 2079 614 494 1750 12599 184
NM_015321chr19164941 4766 4531 4280 3446 1263 1036 1013 474 456 423 411 289 171 52 38 ------
NM_015326chr152948 2317 2036 381 225 --22622 2276 --
NM_015335chr123799 472 261 --31927 906 686 --
NM_015336chr1212384 22325 2268 1262 --
NM_015344chr822026 481 11355 11695 --
NM_015345chr682713 2640 2502 2309 2177 2025 1745 469 --22671 2340 --
NM_015346chr1421828 1739 ------
NM_015347chr1262468 1869 857 373 307 59 ------
NM_015355chr171264 1440 ----
NM_015358chr2121338 220 ------
NM_015359chr862508 2031 1854 1832 453 349 --11991 --
NM_015361chr2----1259 --
NM_015365chrX54318 3445 3323 3210 758 1147 11366 --
NM_015385chr1092581 2489 2402 2325 1226 546 446 416 346 13112 ----
NM_015387chr221566 1305 --1465 --
NM_015393chr453658 2927 1261 1079 738 13834 ----
NM_015397chr92569 35 --11613 --
NM_015415chr1190 ------
NM_015429chr3--1963 ----
NM_015435chr821432 1029 ------
NM_015455chr583527 3496 1584 1475 896 577 272 186 ------
NM_015460chr341488 545 257 66 --21421 794 --
NM_015463chr22819 336 ------
NM_015477chr153733 645 639 --2998 334 --
NM_015483chr721109 439 ------
NM_015496chr8177 ------
NM_015526chr1971408 1202 1015 921 530 352 248 ------
NM_015535chr283601 3442 3178 3063 1548 1351 1175 835 --31682 1583 64 13017
NM_015550chr721302 970 2723 329 --12760
NM_015554chr153756 480 334 ----11109
NM_015557chr183531 3500 1187 939 749 589 73 43 --2473 175 13410
NM_015567chr1341299 964 441 267 --2918 473 --
NM_015568chr20114289 3986 3882 1462 1440 1325 1110 1068 710 137 63 --21244 285 --
NM_015569chr184506 3907 3431 1675 1431 1340 1321 880 1864 14361 --
NM_015570chr721172 293 1603 1644 --
NM_015571chr621834 192 ------
NM_015575chr25724 553 504 421 253 144 33682 3436 2570 12385
NM_015576chr322574 2124 --12166 --
NM_015577chr511201 1458 ----
NM_015609chr172754 2688 2673 1986 1847 862 283 12494 22453 1148 --
NM_015626chr171221 ------
NM_015640chr154713 4282 3905 1849 465 1519 12103 1397
NM_015646chr1221115 74 --153 --
NM_015651chr972169 2129 1934 1901 1499 1480 182 11831 170 --
NM_015660chr7--1132 ----
NM_015686chrX61994 1800 351 169 141 49 ----12395
NM_015691chrX62089 1943 1799 1129 1038 838 1245 ----
NM_015852chr793251 2950 2916 2816 2503 932 597 513 92 --1345 --
NM_015866chr131418 195 135 --2956 57 --
NM_015872chr131673 1505 151 --31786 1303 272 1691
NM_015878chr842131 1888 1652 839 --11370 --
NM_015888chr112696 178 ----
NM_015898chr1982525 2128 2099 1921 1730 1722 611 532 --12448 --
NM_015902chr83682 232 214 1749 ----
NM_015906chr131392 764 660 23265 934 13495 11366
NM_015912chr852559 2172 2002 935 341 ------
NM_015941chr82336 125 ------
NM_015967chr121060 829 ----1364
NM_016009chr1104921 4804 4452 4119 3605 3386 3224 1385 1124 530 13522 23998 271 --
NM_016018chr842780 1766 867 481 ------
NM_016019chr72422 135 1112 ----
NM_016021chr611859 --22630 34 --
NM_016025chr1651842 1696 1318 715 219 1262 1198 --
NM_016040chr122422 2030 --2482 265 --
NM_016072chr1221502 641 --1498 --
NM_016081chr43431 143 33 ------
NM_016083chr673262 3131 2865 2661 1557 1250 676 ------
NM_016096chr831554 637 353 ------
NM_016103chr53139 63 30 ------
NM_016125chr171139 ------
NM_016131chr22911 803 --1252 --
NM_016132chr152320 127 12549 22366 663 --
NM_016133chr211599 ------
NM_016141chr31781 ------
NM_016152chr31199 ------
NM_016156chr112962 517 --12060 1732
NM_016162chr12121 --1766 --
NM_016179chr13195 ------
NM_016206chr367463 5501 3258 2741 2237 230 ----12650
NM_016217chr643504 3421 2720 871 1943 ----
NM_016230chr6--131 ----
NM_016231chr1721398 1226 --11565 --
NM_016255chr623341 2066 --12732 --
NM_016257chr162896 2708 2690 682 475 53 --11408 --
NM_016260chr266542 5701 2175 1879 1854 466 11913 ----
NM_016269chr431129 977 31 11036 ----
NM_016271chr181404 1513 ----
NM_016275chr342567 2229 1983 635 ------
NM_016287chr141711 523 327 279 ----21705 1282
NM_016298chr363344 2038 995 754 556 153 --1317 --
NM_016308chr11396 --11992 --
NM_016315chr251874 1760 1743 1241 1190 ------
NM_016351chr72545 46 ------
NM_016357chr122466 94 11019 ----
NM_016364chr10138 --1176 --
NM_016374chr121376 209 ------
NM_016374chr121376 209 ------
NM_016376chr1794213 4015 3989 3345 3314 3199 2823 829 47 ----12817
NM_016382chr121053 201 ------
NM_016396chr1562966 2611 2484 2240 1080 135 ------
NM_016418chr22113574 3409 3054 1184 1078 1046 856 534 402 209 73 --23296 193 --
NM_016424chr17--11283 ----
NM_016436chr2052399 2178 1889 404 108 --12052 --
NM_016447chr71214 ------
NM_016448chr131829 632 458 ------
NM_016470chr201167 ------
NM_016472chr1431444 942 123 1473 --1370
NM_016485chr61170 --11742 --
NM_016499chr112539 465 ------
NM_016506chr111501 --176 --
NM_016507chr1732945 2827 230 ----12629
NM_016516chr21623 ------
NM_016529chr134989 957 436 261 --2231 208 --
NM_016530chr1564040 1329 881 615 132 74 12929 1234 --
NM_016531chr453916 1662 1644 1022 316 12936 ----
NM_016557chr33932 836 366 1675 ----
NM_016559chr341483 1400 604 516 ------
NM_016587chr721076 952 --1986 --
NM_016591chr541210 1055 772 78 ----1277
NM_016603chr53812 350 309 ------
NM_016604chr541159 1073 1022 159 ------
NM_016605chr5112247 2174 1976 1970 1909 1097 1062 1038 992 633 119 --1311 --
NM_016607chrX1276 ------
NM_016620chr1--11010 ----
NM_016621chr11134458 4427 4326 3651 3578 3325 3270 3200 3109 3013 2940 231 168 11106 13811 --
NM_016626chr1841172 609 363 274 ------
NM_016652chr2021172 214 --21791 386 --
NM_016734chr981887 581 427 343 310 288 105 62 --21993 1966 --
NM_016823chr1721085 57 1814 --21221 826
NM_016824chr10--11575 ----
NM_016834chr1773579 2870 1373 1345 1234 1186 276 --22695 99 --
NM_016835chr1773579 2870 1373 1345 1234 1186 276 --22695 99 --
NM_016841chr1773579 2870 1373 1345 1234 1186 276 --22695 99 --
NM_016929chr694570 4295 4102 1447 1395 1141 366 63 42 14564 34017 3694 1302 --
NM_016938chr11----1396 --
NM_016946chr143655 1271 889 427 --2853 340 13267
NM_016952chr1154107 2820 761 388 30 23266 598 ----
NM_017410chr1261055 899 455 344 335 191 --2380 173 --
NM_017413chrX42250 1872 1650 668 --21594 135 1706
NM_017420chr1483731 2882 2346 894 888 794 548 346 13581 ----
NM_017423chr411625 21744 836 ----
NM_017447chr2133563 3342 874 ----13988
NM_017452chr203567 269 36 --21412 498 --
NM_017453chr203567 269 36 --21412 498 --
NM_017454chr203567 269 36 --21412 498 --
NM_017519chr61139 ------
NM_017522chr11476 ------
NM_017551chr1022191 42 --22563 195 --
NM_017580chr101556 --11827 --
NM_017582chr111596 149 ----
NM_017592chr1972654 2125 2000 1949 847 616 330 --4898 792 513 506 11724
NM_017628chr4104295 3896 3698 3563 2094 2078 1837 1823 1669 1299 35004 4948 1034 ----
NM_017633chr653729 3132 649 494 430 --32946 2520 226 1756
NM_017637chr997102 6307 2680 1319 1056 1039 996 615 29 16379 28143 6030 --
NM_017641chr122740 131 ------
NM_017643chr1792570 2330 2177 1249 970 694 458 298 68 ------
NM_017658chr142932 242 13566 ----
NM_017660chr19103455 2684 2636 2133 2117 2104 1382 798 710 279 --22642 2111 --
NM_017672chr15--1388 --1488
NM_017709chr154031 3668 1528 466 38 14126 13373 --
NM_017719chr332463 2378 194 1475 1496 --
NM_017737chr131936 333 147 --1355 --
NM_017738chr91968 2341 98 1892 --
NM_017739chr13434 166 139 --1452 --
NM_017753chr92744 46 ------
NM_017768chr12649 295 ------
NM_017770chr632282 954 37 --12596 --
NM_017786chr81611 ------
NM_017790chr9----183 --
NM_017813chr855535 4481 2168 1577 594 --15382 12101
NM_017824chr1012667 --12200 --
NM_017848chrX44130 1461 714 508 ----11831
NM_017849chr283131 2732 2619 2503 1240 1180 719 84 --143 --
NM_017856chrX41533 671 545 23 ----21874 805
NM_017866chr82984 860 ------
NM_017893chr1041315 286 158 72 --31072 590 120 --
NM_017902chr1075593 1310 1139 774 662 317 218 --1275 15648
NM_017919chr985749 5543 4887 4855 3735 2112 1276 1246 1526 55187 5027 1368 1282 578 --
NM_017922chr141472 ------
NM_017938chrX41692 1381 371 243 11678 31669 1397 450 --
NM_017944chr1152863 2312 643 468 158 1784 ----
NM_017964chr2266 50 ------
NM_017988chr124585 250 240 214 ------
NM_017994chr782640 2355 2197 2174 2100 1953 392 65 ------
NM_018018chr12--11547 ----
NM_018027chr1093171 2934 2546 2503 1276 899 422 203 135 --12049 11311
NM_018036chr1463878 3830 3693 3678 3501 1731 --13159 --
NM_018045chr132730 2522 196 12528 22540 2417 1703
NM_018047chr51639 ----1316
NM_018061chr1--11647 21513 188 --
NM_018064chr6------165
NM_018070chr12427 125 --1164 --
NM_018084chr273219 2453 2400 2366 1305 1137 219 1585 ----
NM_018085chr187918 7131 6130 6089 4948 2097 1622 91 --27033 254 21759 756
NM_018086chr221276 745 ------
NM_018092chr16--1556 ----
NM_018095chr111501 --176 --
NM_018114chr3147 ------
NM_018121chr1053094 2497 1177 862 394 11113 ----
NM_018126chr441190 1137 1097 104 --1635 --
NM_018128chr1751415 1166 531 491 484 11252 --11303
NM_018171chr122876 862 1784 ----
NM_018172chr1151309 1292 1227 322 34 --21257 1050 --
NM_018176chr451506 1290 1045 664 183 ------
NM_018178chr131839 706 243 1334 11686 --
NM_018182chr1762090 1886 1832 804 283 210 --32010 1602 769 --
NM_018199chr1411180 --1482 --
NM_018230chr11475 --1524 --
NM_018241chr41726 --1753 1254
NM_018247chr611074 --42252 2183 826 709 --
NM_018293chr312289 22597 320 ----
NM_018302chr441689 961 441 352 1813 --1466
NM_018312chr111514 ------
NM_018313chr322407 988 ------
NM_018315chr4128 ------
NM_018325chr921547 435 ------
NM_018330chr1051618 1556 603 205 120 ------
NM_018339chr921641 432 21208 158 ----
NM_018348chr16124 1409 ----
NM_018362chr1133761 3462 393 ------
NM_018364chr132748 2657 723 --22766 1150 --
NM_018373chr1484546 2051 1927 1249 1111 755 150 29 52522 1444 921 435 352 14324 --
NM_018374chr741638 1473 1228 584 --23681 1432 --
NM_018383chr221277 706 1175 21810 219 11376
NM_018385chr32179 137 11258 --1326
NM_018388chrX11414 1546 ----
NM_018398chr32309 112 ------
NM_018403chr342832 1332 404 35 21338 1269 33333 3286 1324 12915
NM_018425chr1072472 1952 1704 1698 1692 887 790 --1930 --
NM_018433chr2--1487 1114 --
NM_018440chr868320 7027 6167 5364 5252 1889 18374 47680 5736 565 277 16307
NM_018444chr812191 ------
NM_018445chr151585 ----1125
NM_018452chr6_random43722 1535 859 831 --1896 --
NM_018486chrX----1196 --
NM_018489chr122311 545 --22394 2114 --
NM_018534chr22154 129 --1229 --
NM_018557chr231400 450 66 ------
NM_018566chr175035 4835 4673 4317 3194 416 309 --13271 --
NM_018569chr41217 2360 55 ----
NM_018590chr102527 143 ------
NM_018638chr1211694 25709 1780 ----
NM_018640chr1232718 2580 2553 22259 438 ----
NM_018644chr1181673 1557 1426 634 623 461 144 87 ------
NM_018650chr132031 1459 766 1689 ----
NM_018667chr1672080 2024 1127 1115 526 221 214 --21941 742 --
NM_018689chr1572042 1942 1727 1688 726 681 88 --11992 1364
NM_018695chr51411 22171 2143 ----
NM_018713chr12440 184 11020 ----
NM_018717chr462817 2741 2727 788 321 296 22880 2121 ----
NM_018844chr721774 197 11932 22013 1541 --
NM_018933chr51343 --174 --
NM_018945chr632643 1247 89 22756 1065 21031 1003 12940
NM_018970chr742729 2492 2214 713 1586 23194 2567 --
NM_018976chr121827 ----160
NM_018979chr1242555 1870 1004 942 190 11762 --
NM_018999chr1034126 3529 748 13243 13251 1574
NM_019001chr354431 4163 1553 1391 658 24704 3984 --14571
NM_019004chr732156 603 94 ------
NM_019008chr2253808 2902 1210 1081 611 --1181 --
NM_019009chr1172359 2236 887 803 767 478 78 ------
NM_019022chr1823165 126 ------
NM_019024chr2--138 ----
NM_019027chr431036 798 183 22333 392 ----
NM_019030chr5121 ------
NM_019036chr6178 ----1448
NM_019072chr553886 3050 2716 840 370 43712 3031 1228 1199 13316 21653 1486
NM_019084chr1021958 1942 --22150 2021 --
NM_019098chr82723 531 --21554 747 --
NM_019106chr2283338 3020 2348 2301 2135 2125 2104 733 --33375 692 86 12524
NM_019114chr952218 1018 976 864 139 ------
NM_019555chr32685 485 --1374 1519
NM_019596chr2162921 2669 1110 455 147 74 1183 21015 98 1591
NM_019610chr131655 813 459 1362 11660 --
NM_019843chr22------122
NM_019860chr1011448 ------
NM_019885chr282065 2050 2002 904 644 509 201 27 ----12446
NM_019891chr11914 2171 24 ----
NM_019903chr10--11575 ----
NM_020039chr1271702 1509 1228 771 745 470 288 --21306 66 --
NM_020066chr11299 1720 ----
NM_020116chr421220 614 ------
NM_020119chr733930 1188 1042 --33728 3120 2512 23994 413
NM_020122chr275248 4731 4221 3994 1875 1608 569 11993 25514 4389 23886 3657
NM_020123chr104631 542 294 195 ------
NM_020141chr12202 26 1776 ----
NM_020144chr741632 807 270 192 11597 ----
NM_020148chr1832372 522 199 12854 ----
NM_020150chr102138 100 --1381 --
NM_020152chr212634 151 ----1333
NM_020157chr202831 172 --2660 353 --
NM_020159chr441083 539 157 42 --11332 --
NM_020177chr563019 803 598 592 429 166 33324 2623 2605 ----
NM_020180chr181968 ------
NM_020193chr11----1335 --
NM_020225chr42325 97 ------
NM_020239chr141874 638 631 130 --22057 2011 --
NM_020240chr542286 2038 1954 935 ------
NM_020243chr222641 245 --3283 259 163 --
NM_020245chr634193 3388 389 25104 3173 11743 --
NM_020246chr71373 ------
NM_020309chr1911098 --2825 162 --
NM_020310chr17112525 2175 2049 1866 1823 1093 859 711 679 260 73 ------
NM_020318chr1--1347 2364 312 --
NM_020340chr672062 2031 1828 1401 620 263 152 ----12203
NM_020341chr203726 658 111 12027 ----
NM_020342chr242217 1825 472 136 1909 ----
NM_020346chr1111290 --11474 --
NM_020353chr31389 124 ----
NM_020374chr1212020 --21562 191 --
NM_020390chr384237 4103 1878 1225 1214 907 806 43 1862 23166 3132 11079
NM_020416chr442687 926 53 32 --42653 2001 1692 169 --
NM_020429chr783054 2865 2731 2352 531 499 347 58 1407 12384 --
NM_020440chr142817 2565 1284 415 --31345 602 240 --
NM_020443chr1166981 6944 6904 6523 5449 5011 4294 2763 2583 2509 2357 2229 2050 1891 1398 763 11743 1460 15895
NM_020463chr2124 1480 ----
NM_020478chr84770 555 433 57 ------
NM_020638chr1241699 295 240 227 ------
NM_020647chr832160 1756 512 ------
NM_020651chr221546 572 ------
NM_020654chr321663 77 --11431 --
NM_020666chr51644 168 ----
NM_020673chr2096781 6586 5612 5330 2248 1763 1469 1282 1216 14999 --15197
NM_020689chr2051647 1334 303 256 235 --31620 1195 1103 --
NM_020693chr114528 134 92 60 --1425 --
NM_020699chr1114393 3910 3885 3758 3732 1285 1251 1239 1129 739 419 --34977 528 67 --
NM_020711chr221854 1682 ------
NM_020713chr2052166 1928 476 224 67 12967 1706 1501
NM_020717chrX124713 4190 1641 1582 1551 1528 1382 1358 1146 619 162 36 24139 168 14264 14849
NM_020718chr1666152 4715 4150 2121 2005 242 12550 24814 117 --
NM_020727chr2153543 3293 3088 2961 1442 11498 1498 --
NM_020728chr743081 2635 2365 908 13158 1823 12777
NM_020732chr61139 ------
NM_020734chr1233014 600 70 22410 1149 ----
NM_020742chrX51881 816 481 335 210 --12090 --
NM_020749chr831381 785 607 ------
NM_020752chr1032643 666 455 1991 ----
NM_020753chr172658 54 --2712 586 1791
NM_020766chrX64013 3979 1462 1379 1099 524 24049 1258 ----
NM_020769chrX146 ------
NM_020771chr63391 237 122 ------
NM_020772chr1796910 6173 5295 3022 1755 1676 1361 904 364 15275 16567 --
NM_020774chr1856146 3944 2298 1972 1621 11500 14584 --
NM_020778chr15134810 4285 4184 3225 1846 1750 1187 1124 996 408 358 91 31 1516 43990 1152 849 713 --
NM_020782chr1234379 188 80 ------
NM_020783chr1832389 1845 1647 1837 ----
NM_020787chr17132 --1972 --
NM_020791chr1721462 1238 11179 ----
NM_020792chr341971 1856 354 183 1254 ----
NM_020794chr1185 ------
NM_020801chr532152 599 190 ------
NM_020805chr1821715 1592 --1253 --
NM_020808chr11732 ------
NM_020809chr1112232 --11931 --
NM_020810chr14--3367 306 142 11129 --
NM_020819chr62491 164 ------
NM_020824chr10------1768
NM_020825chr16103817 3742 3539 3150 2816 2504 1381 1171 418 61 ----13286
NM_020832chr13455 235 124 --1462 --
NM_020834chr1471594 1535 1261 599 417 218 48 ------
NM_020839chr341557 1101 380 86 ------
NM_020841chr1244050 3988 3302 1535 ------
NM_020845chr1261950 1900 1673 1653 896 405 12529 1446 --
NM_020858chr1552068 1755 870 799 135 ------
NM_020859chr443852 2636 888 44 ------
NM_020861chr63885 322 143 ------
NM_020868chr221879 1669 ------
NM_020872chr331343 1309 94 1566 ----
NM_020873chr3--1301 ----
NM_020888chr111751 --1671 --
NM_020897chr11865 1882 ----
NM_020909chr263574 3240 2864 512 164 131 14013 12556 --
NM_020918chr1053169 2882 2299 893 61 --2914 172 --
NM_020921chr14187 11309 171 --
NM_020922chrX21763 1172 11646 ----
NM_020935chr273786 3655 3093 1303 942 929 549 14242 14357 11840
NM_020949chr3----1199 --
NM_020951chr1942412 1619 1551 515 12256 --11794
NM_020956chr1994522 4258 4039 1201 1065 774 542 489 129 --13867 1251
NM_020977chr42849 275 11682 1250 --
NM_020987chr102952 198 ------
NM_020989chr2121 ------
NM_021003chr14----289 58 --
NM_021035chr2041115 854 135 54 11348 --1270
NM_021038chr343174 3096 2898 819 ------
NM_021061chr874176 4042 1783 1012 993 328 202 13598 13564 11597
NM_021072chr511634 --11897 --
NM_021079chr1762821 2211 1071 789 542 79 13140 22565 2075 12765
NM_021088chr222035 652 --1448 1771
NM_021116chr7158905 8380 8054 7330 7320 7199 6268 6065 5899 3335 2943 2450 1756 1455 804 15951 68104 6112 2639 2545 1485 219 16410
NM_021120chrX52990 2831 2306 1973 1073 12503 1688 --
NM_021135chr6113393 2968 2847 2738 2578 2468 2103 1030 997 377 22 1346 1797 --
NM_021140chrX2437 147 ------
NM_021143chr19--1587 1492 --
NM_021145chr71103 ------
NM_021159chr421443 123 ------
NM_021190chr11287 ------
NM_021191chr1242453 1621 777 687 21690 305 ----
NM_021202chr20102706 2649 2141 2001 1973 914 385 218 133 62 11907 23005 497 --
NM_021204chr4--1749 ----
NM_021215chr2041956 1753 116 108 11906 1466 --
NM_021224chr9----1438 --
NM_021239chr14--11110 --1324
NM_021245chr102181 48 ------
NM_021252chr101537 ------
NM_021253chr621358 1263 --1207 --
NM_021255chr1422843 61 12626 12931 --
NM_021260chr1411405 ------
NM_021574chr2242221 2060 2042 857 --1905 --
NM_021614chr51241 ------
NM_021627chr3--1256 ----
NM_021629chr384913 4618 3657 3431 3219 1808 1745 1559 ----11882
NM_021638chr474628 3407 3110 1844 1049 828 325 --34461 1138 221 --
NM_021639chr11740 ------
NM_021643chr22578 239 ------
NM_021705chr651531 450 356 284 65 ------
NM_021722chr72504 46 ------
NM_021723chr72545 46 ------
NM_021783chrX21686 437 --2824 268 --
NM_021809chr2072187 2172 1841 1629 464 150 38 1665 21933 841 --
NM_021813chr6105097 4771 4606 4493 3787 3591 1779 848 554 301 --1503 --
NM_021911chr585184 4561 4176 3656 1909 1172 884 324 1616 ----
NM_021912chr1553890 3583 1294 891 789 11234 ----
NM_021914chr1451858 575 376 121 51 1550 ----
NM_021935chr3----1113 --
NM_021940chr611087 11157 1264 --
NM_021948chr1----1248 --
NM_021949chrX32746 2271 172 --22868 1919 --
NM_021950chr1111604 --22222 649 --
NM_021954chr1311463 ----12522
NM_021956chr61356 --1325 1487
NM_021960chr1--22733 1800 22775 2351 --
NM_021961chr11146586 6115 6008 5288 5197 5024 4732 4703 1819 1761 1592 1473 1160 417 11733 36041 6014 139 11410
NM_021962chr17122474 2313 2294 2181 1676 497 417 191 185 126 101 60 --1709 --
NM_021964chr356509 5296 4466 4355 2510 14975 35326 4149 308 --
NM_021970chr42508 121 ------
NM_021977chr633445 3144 327 12371 13922 --
NM_021988chr201310 --2315 41 --
NM_022037chr22859 201 ------
NM_022041chr1632517 482 472 ------
NM_022048chr15106285 5614 5435 4244 4218 2433 2323 1446 1378 369 11198 34773 1743 559 --
NM_022051chr11191 ------
NM_022080chr2032061 230 32 --11027 --
NM_022085chr631483 1279 1147 --134 --
NM_022114chr1133734 3170 3163 3076 3069 2920 1910 1365 1293 1124 1079 1015 141 --23435 3379 14545
NM_022118chr13--1433 ----
NM_022130chr51411 ------
NM_022143chr731241 1143 183 ------
NM_022166chr16125567 5361 5049 5017 4955 3967 3917 2232 1819 1661 1176 38 ------
NM_022173chr22859 201 ------
NM_022351chr862839 1536 1495 1036 793 485 --33291 2786 491 --
NM_022442chr201310 --2315 41 --
NM_022459chr1375849 4210 2445 1618 1329 1066 166 26249 5466 1464 --
NM_022465chr1262459 2265 2047 1139 357 238 --22495 863 --
NM_022469chr163129 2897 2732 2154 388 285 --23061 2265 --
NM_022474chr1442387 1965 671 69 --1759 --
NM_022477chr2031388 260 217 11564 21585 312 21255 282
NM_022497chr353015 2830 2763 993 664 --12875 11129
NM_022648chr2124446 4048 4006 3758 3061 3053 3026 1752 1170 841 289 106 --34465 400 395 --
NM_022650chr54948 795 380 43 --1892 --
NM_022716chr142384 2217 2011 1942 ------
NM_022735chr131413 472 307 --11508 --
NM_022745chr122623 659 22815 2443 12080 --
NM_022763chr353201 3032 2857 2269 1214 --13164 --
NM_022781chr962959 2775 2596 2536 1219 848 1149 13303 --
NM_022782chr121251 ------
NM_022802chr1041562 1279 1272 221 --11464 --
NM_022821chr1----1483 --
NM_022824chr541657 1215 686 593 --21407 569 --
NM_022845chr162283 122 ------
NM_022897chr51890 --1135 --
NM_022898chr1474208 4053 1816 1794 1276 850 137 --14263 --
NM_022900chr711039 ------
NM_022917chr961112 956 463 251 152 142 --1159 --
NM_022918chr1122000 1453 22131 628 ----
NM_022977chrX31923 1886 473 12189 21898 1694 --
NM_023016chr221030 828 ----11841
NM_023923chr1113645 3332 3225 2816 1334 1196 756 698 463 430 89 13818 --23093 2408
NM_023929chr82651 385 --12550 --
NM_024007chr523154 591 ----13089
NM_024052chr1772373 1970 1012 751 493 450 283 ------
NM_024072chr1251341 1308 1290 1085 634 11540 11481 1453
NM_024076chr1962300 1683 907 827 256 173 1763 32048 2029 1589 --
NM_024090chr43547 432 260 1620 ----
NM_024099chr111283 --1106 --
NM_024103chr19141599 1513 1310 585 515 485 477 333 303 199 163 141 69 25 ------
NM_024312chr1241540 1411 346 321 1610 ----
NM_024332chrX21475 1288 --1638 --
NM_024511chr423326 2985 23460 1347 22934 1127 1476
NM_024524chr332545 537 179 --12656 --
NM_024525chr11112 ------
NM_024529chr11472 ------
NM_024539chrX----11230 --
NM_024551chr122492 398 ------
NM_024551chr122492 398 ------
NM_024563chr521553 428 11705 ----
NM_024582chr42850 366 ------
NM_024594chr531496 1352 1275 --11488 --
NM_024613chr8150 ------
NM_024624chr231498 509 130 21559 168 ----
NM_024639chr672580 1873 650 598 453 190 166 ------
NM_024659chr22854 823 1776 1200 --
NM_024686chr1--1371 ----
NM_024721chr832388 1005 734 ------
NM_024740chr1164098 3580 3555 1312 682 325 --23920 1362 --
NM_024749chr132107 1515 60 ------
NM_024755chr151209 ----1830
NM_024770chr2105871 4724 2645 2619 2584 2375 1944 1716 1494 673 26620 2500 1512 32081 1576 810
NM_024811chr1161630 1518 1404 669 655 184 1749 31673 1209 117 --
NM_024817chr15155243 4939 2399 2348 2261 2171 1795 1415 1214 1113 1100 965 886 428 117 --24309 682 11430
NM_024828chr911461 11523 ----
NM_024834chr1021367 677 ------
NM_024887chr142072 1970 849 615 1653 21415 402 --
NM_024889chr10131683 1201 1186 1164 1150 1135 719 704 660 646 634 619 232 ------
NM_024920chr421596 999 ----1246
NM_024930chr532744 2544 2253 ------
NM_024939chr1651412 441 235 82 29 --21022 147 --
NM_024947chr348942 8891 8623 7737 --26550 72 --
NM_024949chr4104915 4890 4830 4522 4436 4223 4172 1619 1239 117 14458 ----
NM_024989chr267687 7528 5984 3228 2470 295 15025 32969 2741 1531 11319
NM_024991chr1092581 2489 2402 2325 1226 546 446 416 346 13112 ----
NM_024993chr231484 1409 380 ----11427
NM_025040chr1951904 1838 1545 1526 97 --22151 1617 --
NM_025054chr843222 1470 675 304 ------
NM_025057chr142976 490 ------
NM_025073chr164659 3051 1789 1559 1113 1096 13251 24436 3599 --
NM_025074chr442365 2018 398 140 --1405 1764
NM_025106chr1111816 1759 1406 1347 1258 1216 571 472 201 174 45 --11742 --
NM_025115chr8----149 --
NM_025133chr24938 387 323 276 ------
NM_025134chr163568 559 518 22221 1976 ----
NM_025146chr331012 851 79 ----1771
NM_025160chr153647 3596 3179 1494 742 --23131 1019 --
NM_025179chr1144364 3978 3653 3528 3193 3075 1906 1869 1811 1655 1474 878 428 185 14300 13621 --
NM_025221chr431106 221 26 ------
NM_025222chr342283 990 377 234 --22129 984 --
NM_025235chr101322 1734 --11855
NM_025238chr1521587 1203 ------
NM_025257chr63356 136 55 ----1273
NM_030621chr1433863 3655 1605 ----12839
NM_030623chr241728 670 293 44 21217 369 --1645
NM_030625chr1022397 468 ------
NM_030627chr553675 1633 1591 1347 74 ------
NM_030634chr162256 2236 2110 954 936 630 --12063 12180
NM_030647chr756191 5668 5028 1314 849 ------
NM_030648chr434947 4759 1513 1150 14883 --
NM_030650chr284038 3937 3311 2993 2947 2859 628 25 ------
NM_030660chr142512 39 11526 ----
NM_030674chr1274377 1923 1306 945 804 568 282 1970 11338 11000
NM_030761chr192664 2058 2032 1932 1664 1050 674 664 406 --32618 2450 2079 --
NM_030762chr1242038 1999 1656 248 11473 ----
NM_030763chrX2352 232 1828 1855 --
NM_030786chr141323 424 199 88 --11405 --
NM_030791chr1421269 270 ------
NM_030799chr541979 1729 424 318 --1502 1562
NM_030806chr1118607 8015 8002 7171 6344 3460 2784 2426 1598 797 331 17822 39213 7178 3205 17407
NM_030810chr631483 1279 1147 --134 --
NM_030816chr113149 ------
NM_030881chr2242247 2237 1783 133 --22189 292 --
NM_030918chr1124881 4858 4695 4628 4540 4234 3644 3546 1729 1066 1035 744 --34224 4146 3930 --
NM_030939chr611173 ------
NM_030958chr81172 ----1453
NM_030964chr552719 1384 1271 702 348 1713 33553 2557 135 13174
NM_030966chr17124 ------
NM_031268chr1674771 4596 3978 3616 1821 169 49 --64051 4021 1505 1243 381 280 --
NM_031296chr442776 1898 1075 255 --1943 189
NM_031309chr8102290 1981 1948 1823 1765 1677 1615 1484 250 21 --1674 --
NM_031362chr222631 2509 ------
NM_031365chr222767 2645 ------
NM_031366chr222767 2645 ------
NM_031371chr121376 209 ------
NM_031371chr121376 209 ------
NM_031372chr42433 139 1158 ----
NM_031417chr19112816 2429 2207 1839 1801 934 905 863 602 257 169 12348 ----
NM_031418chr1122545 295 12181 ----
NM_031422chr181153 1458 ----
NM_031426chr942091 1061 902 23 --32495 2395 531 --
NM_031427chr14105823 5757 5238 4925 4162 3827 3721 1553 1502 623 --13748 24300 1690
NM_031442chrX5857 433 163 71 41 ------
NM_031444chr22102403 1821 1805 924 672 584 431 286 260 50 ------
NM_031445chr233361 3236 2338 --12847 --
NM_031463chr1642013 1472 530 33 ----12144
NM_031468chr7107840 7729 6487 5585 2840 2834 2497 2176 1881 980 15053 47527 3063 2973 740 22016 1099
NM_031469chr662917 2501 1553 1486 877 869 ------
NM_031483chr2022593 1007 ----13116
NM_031844chr153785 3595 3513 1473 79 --11364 --
NM_031845chr283538 3473 2908 2806 2789 2285 1469 1209 22992 1273 ----
NM_031847chr283538 3473 2908 2806 2789 2285 1469 1209 22992 1273 ----
NM_031890chr2292832 2504 2256 2096 1001 884 797 237 45 ------
NM_031922chr63552 98 61 ------
NM_031942chr261242 1100 422 265 219 62 1388 ----
NM_032012chr965226 4962 3202 1450 1133 85 24591 3688 ----
NM_032013chr2031388 260 217 11564 21585 312 21255 282
NM_032042chr552916 2335 1762 821 83 1705 1421 --
NM_032047chr322151 813 11748 ----
NM_032050chr224332 165 138 127 ------
NM_032102chr1152529 2520 2046 743 383 ----12183
NM_032105chr1137113 6555 6152 6033 5478 4927 2572 2287 2211 2094 1508 213 21 --36634 2175 433 32498 2347 743
NM_032124chr182445 69 ------
NM_032160chr1843593 2693 1506 316 24225 1441 11450 --
NM_032186chr1--11010 ----
NM_032199chr1073839 3694 3028 2607 2494 941 221 23758 3619 33395 1229 126 --
NM_032208chr273513 3407 3278 3010 2486 532 282 ------
NM_032217chr41143 ------
NM_032236chr121017 215 ------
NM_032239chr421322 26 ------
NM_032256chr123369 201 135 ------
NM_032268chr1672963 2442 2247 1211 502 388 210 --1482 --
NM_032325chr1131423 461 428 21909 562 ----
NM_032364chr12187 --2778 150 1273
NM_032373chr1094243 4183 3976 3921 2353 2034 1699 707 634 1567 --14057
NM_032438chr611514 --1551 --
NM_032439chr1031702 1186 466 ------
NM_032440chr1022343 931 2486 22 ----
NM_032445chr1531904 738 101 12017 ----
NM_032446chr543646 3143 731 496 --11113 --
NM_032449chr142177 2117 2085 1022 22823 677 42435 793 357 65 42645 1783 1048 54
NM_032452chr1421460 236 --2612 365 --
NM_032457chr451568 818 688 602 235 13843 12742 --
NM_032458chrX----1442 --
NM_032466chr82402 46 ------
NM_032468chr82402 46 ------
NM_032482chr19102594 2560 1738 1712 1705 1039 1011 999 477 49 ------
NM_032505chr34965 896 731 450 ------
NM_032518chr41182 ------
NM_032521chr2042934 2021 770 454 --12969 --
NM_032523chr22172 99 ------
NM_032538chr692800 2523 2503 2345 2022 1827 399 100 81 --52590 2352 2193 2115 123 --
NM_032539chrX--1798 ----
NM_032557chr41673 ----1970
NM_032560chr143757 220 153 ------
NM_032576chrY----1134 --
NM_032578chr1041134 985 400 208 ------
NM_032594chr142298 80 ------
NM_032595chr1761486 539 386 375 336 69 --31230 145 113 --
NM_032604chr2156 ------
NM_032632chr142580 38 ------
NM_032778chr343109 1277 976 814 ----12304
NM_032782chr521006 216 --1842 --
NM_032837chr172564 62 1330 11613 11904
NM_032839chr32447 417 ------
NM_032858chr1----145 --
NM_032881chr12287 125 --127 --
NM_032900chr1023797 255 2249 127 31558 351 143 13506
NM_032924chr761111 1078 879 451 97 72 ------
NM_032961chr43438 74 66 1148 ----
NM_032968chrX34141 3690 1451 13774 11106 --
NM_032969chrX34141 3690 1451 13774 11106 --
NM_032973chrY23682 1451 13766 11106 --
NM_033012chr1321000 112 ------
NM_033020chr131392 764 660 23265 934 13495 11366
NM_033030chr2272 26 187 2246 31 --
NM_033044chr121007 857 11223 ----
NM_033055chr12745 225 ------
NM_033081chr2021275 539 ------
NM_033102chr151094 978 955 943 839 --31081 1064 50 --
NM_033102chr151094 978 955 943 839 --31081 1064 50 --
NM_033129chr20131818 1670 1424 789 744 731 515 418 353 206 196 156 84 --41989 1266 738 274 --
NM_033132chr13161 --1918 --
NM_033133chr1793681 3622 3530 2686 1203 1160 935 327 199 --21287 338 --
NM_033143chr464497 4149 4033 4019 296 152 12817 ----
NM_033181chr673262 3131 2865 2661 1557 1250 676 ------
NM_033211chr52805 27 11806 ----
NM_033224chr7116253 5854 5826 5551 5118 3130 2387 2293 1653 1441 34 27958 5620 25702 282 36754 5241 3201
NM_033225chr823032 2096 1981 ----
NM_033255chr132112 34 ------
NM_033272chr21285 --1419 --
NM_033285chr833698 811 98 23688 3313 11041 12834
NM_033290chrX43520 3361 3213 2872 22513 559 ----
NM_033326chr113530 272 54 --1761 11833
NM_033360chr1284337 4278 4245 3947 2880 1252 1021 429 --13673 --
NM_033396chr111304 ------
NM_033425chr1153176 3110 1338 453 419 11155 --12834
NM_033429chr1542253 2040 1009 594 22868 141 --1123
NM_033495chrX21051 333 ------
NM_033503chr15113540 3130 2695 2577 1217 1180 901 785 607 538 476 21188 1100 13100 13554
NM_033505chr2106649 6444 5040 4102 2445 2432 1536 1012 263 171 22360 1706 ----
NM_033516chr941588 1499 996 226 ----11122
NM_033540chr32251 104 ------
NM_033542chr2061702 1635 793 711 676 670 --1776 --
NM_033624chr1221433 1399 --21976 173 --
NM_033631chr183333 896 868 686 443 306 219 209 --23533 693 --
NM_033632chr4128 ------
NM_033637chr1083972 3814 3717 3377 2698 1533 529 523 13852 22952 2556 --
NM_033644chr542297 2202 693 602 12322 1146 --
NM_033645chr542297 2202 693 602 12322 1146 --
NM_033656chr2175892 5479 4925 4687 4471 1693 967 23944 2136 24480 1276 --
NM_052832chr863016 2997 741 713 166 39 ------
NM_052834chr1862310 1832 604 559 379 351 22184 997 12266 --
NM_052860chr5194 --1143 164
NM_052875chr1151969 1840 1831 828 38 11775 11807 --
NM_052876chr1972530 2505 2032 1887 1789 259 42 ----11823
NM_052885chr1274062 4052 3929 3643 3626 3100 596 13147 ----
NM_052898chr821158 585 11289 11895 --
NM_052900chr821557 587 --1687 --
NM_052901chr971607 1572 1362 554 534 355 185 ----11109
NM_052918chr1073337 3308 2923 2845 1198 1045 87 23359 2566 2912 596 --
NM_052932chr1132476 2336 1816 --1954 --
NM_052950chr1371990 1742 1726 902 719 575 191 11899 ----
NM_052958chr8--1666 --1679
NM_052978chr1421754 1324 ------
NM_053016chr9127948 7580 7573 7320 6612 5604 4895 4887 1578 1118 965 76 --37341 7330 5867 26757 3157
NM_053023chr1152366 706 655 635 329 23000 2189 ----
NM_053024chr361581 1498 1196 1151 1096 455 ------
NM_053025chr331362 1091 265 --1574 --
NM_053026chr331362 1091 265 --1574 --
NM_053027chr331362 1091 265 --1574 --
NM_053028chr331362 1091 265 --1574 --
NM_053031chr331362 1091 265 --1574 --
NM_053032chr331362 1091 265 --1574 --
NM_053043chr7105758 5640 5269 3960 2342 2239 1959 1682 629 443 14840 24726 4558 14317
NM_053056chr1193111 2881 2702 2248 942 926 727 314 306 ------
NM_053281chrX1283 ------
NM_054016chr141712 1479 518 212 --12003 --
NM_054016chr141712 1479 518 212 --12003 --
NM_054016chr141712 1479 518 212 --12003 --
NM_054025chr1181673 1557 1426 634 623 461 144 87 ------
NM_054027chr532038 1405 776 --1904 12175
NM_054033chr2187 --1121 --
NM_054114chr6--1644 ----
NM_057159chr941563 1517 1492 108 21479 296 167 --
NM_057164chr22458 58 --1480 --
NM_057165chr22458 58 --1480 --
NM_057166chr22458 58 --1480 --
NM_057167chr22458 58 --1480 --
NM_057169chr1243036 1097 163 51 1171 ----
NM_057170chr1243036 1097 163 51 1171 ----
NM_057175chr452331 2171 1889 1726 86 1810 12177 --
NM_057178chr1741895 415 348 72 12058 --1890
NM_057749chr81113 ------
NM_058170chr141657 1569 1201 164 11330 ----
NM_058240chr1421433 205 --3387 139 84 --
NM_058241chr211748 --1776 --
NM_058241chr211748 --1776 --
NM_078471chr1731074 1016 494 1822 2895 98 --
NM_080546chr96810 654 627 569 520 267 ------
NM_080629chr121395 1088 --2249 242 --
NM_080630chr121395 1088 --2249 242 --
NM_080645chr641805 688 264 175 ------
NM_080669chr17114430 4132 3128 1802 1290 1085 1060 408 396 179 80 --13071 --
NM_080676chr2052531 2369 683 449 141 12397 12241 --
NM_080737chrX21325 499 ------
NM_080743chr62959 466 --1863 --
NM_080829chr204821 236 152 55 --2770 249 --
NM_080832chrX2385 178 ------
NM_080836chr2093918 3820 3473 3345 2975 1802 1324 300 130 --2948 684 --
NM_080867chr1444324 3866 3262 749 ----13722
NM_080872chr863727 3324 561 422 385 36 ------
NM_080874chr431868 1374 401 1359 ----
NM_080927chr343086 3071 3059 1142 --1852 --
NM_130386chr18--2435 117 ----
NM_130387chr32469 85 --1887 --
NM_130391chr953051 2670 1210 1157 549 --13346 --
NM_130392chr953051 2670 1210 1157 549 --13346 --
NM_130393chr953051 2670 1210 1157 549 --13346 --
NM_130435chr1052013 878 805 763 408 12810 ----
NM_130436chr2131808 748 547 1339 ----
NM_130438chr2182385 1325 1124 450 441 270 195 68 1916 ----
NM_130439chr1032329 1755 49 --2697 632 --
NM_130439chr1032329 1755 49 --2697 632 --
NM_130838chr151484 ------
NM_130839chr151484 ------
NM_133170chr20207863 7790 7266 6631 6133 5646 5404 5264 3146 3092 2827 2805 1803 1174 1122 661 622 577 341 228 15696 57695 5530 3119 2814 1678 --
NM_133172chr51243 --148 --
NM_133173chr51243 --148 --
NM_133174chr51243 --148 --
NM_133264chr1763950 3677 3665 3331 2555 98 13705 33410 2497 147 12996
NM_133265chrX33603 3340 3187 ----21167 585
NM_133329chr221548 135 1601 --11463
NM_133330chr442565 2333 1039 896 --62717 2480 2441 1994 211 97 --
NM_133331chr442565 2333 1039 896 --62717 2480 2441 1994 211 97 --
NM_133334chr466375 5056 4772 4440 4432 495 11502 16121 12513
NM_133335chr442565 2333 1039 896 --62717 2480 2441 1994 211 97 --
NM_133338chr5--1344 ----
NM_133339chr5--1344 ----
NM_133340chr5--1344 ----
NM_133341chr5--1344 ----
NM_133342chr5--1344 ----
NM_133343chr5--1344 ----
NM_133344chr5--1344 ----
NM_133367chr643132 2842 873 780 1309 12382 --
NM_133370chr433352 2999 807 22302 1194 ----
NM_133372chr532968 2750 2096 1652 --11962
NM_133378chr24744 357 332 288 ------
NM_133432chr24744 357 332 288 ------
NM_133437chr24744 357 332 288 ------
NM_133468chr732152 964 236 12549 ----
NM_133473chr1951830 1725 1327 724 70 ----11592
NM_133507chr121162 --1271 --
NM_133631chr32451 190 ------
NM_133647chr15123747 3655 2809 2741 1523 1388 1225 647 554 324 212 68 --13675 22667 93
NM_134265chr171221 ------
NM_138270chrX32920 2367 1364 --186 --
NM_138286chr1964236 4105 3845 1406 1333 216 --13835 --
NM_138300chr12373 360 --31531 1332 566 --
NM_138340chr182592 513 ------
NM_138423chr1532116 755 289 ----1570
NM_138434chr711403 --11277 1117
NM_138448chr2------1171
NM_138457chr6113348 2770 2468 2404 2398 2090 1259 1063 646 320 284 --3503 446 72 --
NM_138473chr1274423 4037 3893 3155 1610 602 284 25186 4930 34371 716 711 --
NM_138479chr171929 1804 1335 1294 466 263 59 --1135 --
NM_138576chr1474208 4053 1816 1794 1276 850 137 --14263 --
NM_138621chr2104049 3515 3157 2679 1334 1180 1099 1086 364 65 34211 1592 453 12770 --
NM_138638chr1451858 575 376 121 51 1550 ----
NM_138713chr1675925 5646 5271 2959 2720 2583 252 26210 5277 15110 --
NM_138714chr1675925 5646 5271 2959 2720 2583 252 26210 5277 15110 --
NM_138731chr1424181 122 ------
NM_138735chr23469 436 224 ------
NM_138768chr113572 125 36 1862 2291 159 1219
NM_138771chr7--1486 ----
NM_138782chr521903 1849 21879 208 1955 --
NM_138819chrX--1124 ----
NM_138923chrX----169 --
NM_138959chr1126339 6215 6101 5823 5361 4676 4300 2115 2046 822 789 679 11775 15309 16775
NM_138971chr1153526 2828 933 510 323 --13395 --
NM_138971chr1153526 2828 933 510 323 --13395 --
NM_138972chr1153526 2828 933 510 323 --13395 --
NM_138972chr1153526 2828 933 510 323 --13395 --
NM_138973chr1153526 2828 933 510 323 --13395 --
NM_138973chr1153526 2828 933 510 323 --13395 --
NM_139012chr641835 1591 520 354 ------
NM_139071chr1251231 1070 578 467 36 1348 1198 --
NM_139136chr1211091 ------
NM_139168chr521592 64 ------
NM_139207chr123874 522 150 21868 189 ----
NM_139239chr19----1313 --
NM_139242chr1521523 1064 11086 1596 --
NM_139321chr2013490 12684 1342 --
NM_139323chr2041887 1374 732 48 ------
NM_144498chr20194 --12235 --
NM_144567chr13972 487 35 ----21880 908
NM_144571chr4126654 6444 5690 5452 2723 2264 2021 1983 1002 838 301 290 26111 6093 11196 --
NM_144574chr141453 ------
NM_144578chr142668 453 14220 25368 4955 --
NM_144583chr231706 584 195 1339 ----
NM_144586chr221075 55 ------
NM_144599chr1575070 4078 3831 3400 3362 202 173 25380 1209 13536 11823
NM_144610chr17----1380 157
NM_144643chr41413 ------
NM_144664chr1131807 852 189 ------
NM_144718chr352240 2189 1826 756 187 ----1955
NM_144728chr11752 1366 ----
NM_144729chr11752 1366 ----
NM_144767chr1554618 3794 1670 1423 498 --23519 1336 --
NM_144778chr1362748 2533 1821 831 241 212 ----11880
NM_144949chr222296 1618 12580 ----
NM_144969chrX3276 245 213 ------
NM_144973chr1254725 3963 2109 1662 751 --23316 1532 149
NM_144977chr11240 ------
NM_145014chr11--1360 ----
NM_145055chr1863286 3222 3107 2826 2558 2412 --12419 --
NM_145113chr1451315 1243 613 509 213 2271 133 2538 121 --
NM_145175chr221030 90 11097 1368 --
NM_145203chr132932 323 195 1917 --
NM_145206chr1052765 2307 2296 2159 1026 1273 22246 2112 --
NM_145207chr465000 4818 2014 1939 811 475 14359 15032 14612
NM_145239chr163443 215 182 --3419 321 82 --
NM_145259chr275735 5558 5393 4829 4393 4304 2488 --56011 5707 4418 2569 233 --
NM_145274chr173731 691 664 1220 1779 --
NM_145284chrX12265 ------
NM_145307chr1023923 2943 11647 ----
NM_145313chr102344 44 --21579 1231 --
NM_145320chr721302 970 2723 329 --12760
NM_145321chr721302 970 2723 329 --12760
NM_145322chr721302 970 2723 329 --12760
NM_145331chr62304 118 ------
NM_145686chr223366 313 13254 ----
NM_145687chr223366 313 13254 ----
NM_145690chr811312 ------
NM_145716chr12427 125 --1164 --
NM_145733chr2241127 809 137 90 --11164 1313
NM_145739chr22172 99 ------
NM_145753chr341616 1051 402 90 ------
NM_145793chr102774 123 1868 ----
NM_145800chrX3713 197 147 ----1283
NM_145802chrX3662 146 96 ----1232
NM_145810chr261242 1100 422 265 219 62 1388 ----
NM_145913chr122763 739 11030 ----
NM_147147chr653807 3632 3059 2940 1622 11115 33836 3831 1124 1727
NM_147150chr933775 2555 1489 ----13649
NM_147175chrX22119 393 ------
NM_147181chr431106 221 26 ------
NM_147182chr431106 221 26 ------
NM_147183chr431106 221 26 ------
NM_147189chr821813 354 11571 ----
NM_147202chr9112620 2419 2167 1966 856 803 564 471 417 380 272 --179 --
NM_147223chr241988 668 574 148 22356 1699 12200 --
NM_148174chr842131 1888 1652 839 --11370 --
NM_148921chr1772173 1642 576 377 296 155 122 --12365 --
NM_152132chr14186 ------
NM_152133chr6--1644 ----
NM_152237chr2281751 1504 1249 1113 1104 601 212 156 --11092 --
NM_152261chr1232051 1961 84 11758 ----
NM_152271chr8--1167 ----
NM_152277chr531871 275 21 ------
NM_152280chr133177 3044 1163 --31026 648 293 --
NM_152283chr521129 447 ----1412
NM_152287chr1652146 1762 966 946 917 ----22279 1626
NM_152291chr4189 11095 ----
NM_152300chr1751510 1439 1394 1200 50 1118 1315 --
NM_152342chr16134 --2547 27 --
NM_152388chr263622 3600 3443 2467 1264 841 ------
NM_152390chr23616 155 97 ------
NM_152409chr521379 926 12605 --1229
NM_152420chr91126 174 ----
NM_152424chrX74222 3972 2956 1532 1209 494 188 11348 13621 1671
NM_152437chr1221582 1559 12310 ----
NM_152450chr1551790 1545 1423 608 466 ------
NM_152470chr1893840 3492 3353 2733 1670 1024 986 563 252 --43209 2880 911 666 22778 926
NM_152519chr222026 770 1857 ----
NM_152520chr21433 --1138 --
NM_152529chr233427 3088 919 ----44024 3224 1382 516
NM_152538chr321640 499 --2447 328 --
NM_152556chr742224 890 322 58 22179 474 ----
NM_152563chr1151309 1292 1227 322 34 --21257 1050 --
NM_152574chr91367 ------
NM_152586chr103425 309 90 --1702 1225
NM_152594chr152780 55 1278 1168 --
NM_152622chr543318 3094 363 271 32251 2195 598 1334 --
NM_152624chr5107301 5078 4766 4658 2681 2561 1748 931 785 746 --15778 1415
NM_152629chr973970 3164 3142 2890 1647 996 102 --1498 1718
NM_152643chr1061497 600 486 388 188 43 11159 21073 343 --
NM_152666chr12732 635 1649 ----
NM_152678chr352427 1717 1055 1026 355 22379 1801 --1942
NM_152686chr572420 2266 1906 1622 945 863 115 --1487 22114 1759
NM_152695chrX21803 43 11795 12022 11650
NM_152699chr353742 3191 3157 2806 511 1164 23344 892 12843
NM_152707chr10--1977 ----
NM_152721chr18188 ------
NM_152744chr793216 3059 3035 2803 1157 790 457 307 74 1337 32599 1036 533 --
NM_152748chr71404 --1218 --
NM_152749chr731043 810 287 --1754 --
NM_152756chr561336 813 651 588 421 168 1698 ----
NM_152787chrX73741 3190 2664 1567 983 568 89 --22554 303 --
NM_152789chr7160 ------
NM_152866chr1111604 --22222 649 --
NM_152896chr9----1174 --
NM_152903chr1332767 1814 1011 ----1691
NM_152914chr1784339 3944 3307 3119 1654 1038 591 442 --23950 2769 23412 3181
NM_152924chr1575412 4747 4181 2470 2214 1307 1246 --22404 1836 25548 2010
NM_152989chr1231629 1551 296 --149 --
NM_152996chr11815 --11747 --
NM_152999chr774232 4080 3468 1781 848 414 128 --11668 --
NM_153013chr521980 1631 1206 ----
NM_153020chr6156 11246 148 --
NM_153026chr122478 180 1534 1131 --
NM_153029chr1673920 3793 3630 2766 2689 784 169 --54175 3613 2636 1563 928 --
NM_153035chr153023 2929 2700 267 214 1509 --23160 2022
NM_153182chr343109 1277 976 814 ----12304
NM_153188chr565497 4502 4331 1387 1000 140 --11709 --
NM_153207chr12--1623 12653 --
NM_153223chr521284 428 1266 ----
NM_153321chr1741096 1013 310 296 1743 ----
NM_153322chr1741096 1013 310 296 1743 ----
NM_153332chr842377 2072 555 30 ------
NM_153341chr11359 ------
NM_153354chr5----1641 1738
NM_153365chr42913 278 12590 ----
NM_153367chr1053661 3635 1187 824 512 13836 13867 --
NM_153456chr13104559 4269 4228 2034 1987 1522 1157 867 795 157 14296 --11320
NM_153487chr6104752 4623 4512 4490 4408 1861 1279 716 84 27 --24438 824 --
NM_153499chr1272938 2858 2576 2465 2368 2006 193 1973 12185 --
NM_153500chr1272938 2858 2576 2465 2368 2006 193 1973 12185 --
NM_153607chr532992 719 461 11080 ----
NM_153616chr1552068 1755 870 799 135 ------
NM_153617chr1552068 1755 870 799 135 ------
NM_153618chr1552068 1755 870 799 135 ------
NM_153619chr15103306 2993 2412 2268 1373 880 841 821 788 269 ------
NM_153620chr771792 1226 1142 329 190 89 73 ------
NM_153649chr132222 1949 190 --11691 --
NM_153686chr4--1397 12301 --
NM_153693chr125807 677 534 523 54 ------
NM_153748chr1211091 ------
NM_153810chr1061496 1420 1125 861 807 545 ------
NM_153836chr221631 197 --11716 --
NM_170606chr71486 ------
NM_170665chr1283096 2915 2829 2807 1402 1307 911 466 11319 33965 3001 1279 --
NM_170672chr231549 688 596 ----1179
NM_170674chr1561078 942 322 288 200 164 ------
NM_170677chr1561078 942 322 288 200 164 ------
NM_170692chr1----1777 --
NM_170706chr1134117 4020 3567 3390 3151 3034 1551 1162 441 402 363 324 285 11718 23690 3113 --
NM_170731chr1122480 2337 ------
NM_170732chr1122480 2337 ------
NM_170733chr1122480 2337 ------
NM_170734chr1122480 2337 ------
NM_170735chr1122480 2337 ------
NM_170750chrX----1563 --
NM_170775chr51241 ------
NM_171998chrX42388 1993 662 92 1514 ----
NM_172016chr621358 1263 --1207 --
NM_172037chr831472 536 124 21157 157 ----
NM_172071chr186890 5734 5586 2177 712 691 558 430 36066 2355 952 ----
NM_172097chr151755 1153 --1268
NM_172103chr631754 922 416 --11912 --
NM_172105chr631754 922 416 --11912 --
NM_172127chr4--1230 ----
NM_172128chr4--1186 ----
NM_172159chr342010 916 775 109 ------
NM_172160chr342010 916 775 109 ------
NM_172200chr103541 486 130 --2584 240 124
NM_172216chr1272840 2760 2478 2367 2270 1908 95 1875 12087 --
NM_172226chr1272938 2858 2576 2465 2368 2006 193 1973 12185 --
NM_172315chr1561078 942 322 288 200 164 ------
NM_172316chr1561078 942 322 288 200 164 ------
NM_172344chr221548 135 1601 --11463
NM_172350chr11375 1400 1661 --
NM_172359chr11379 1404 1665 --
NM_172373chr1331168 1130 891 --1162 --
NM_172375chr1461078 735 369 328 168 141 ------
NM_173075chr41565 11461 --11177
NM_173083chr13852 74 22 --190 --
NM_173167chr1752565 2507 2490 1084 862 ------
NM_173172chr221211 499 ----1163
NM_173198chr942856 2685 2045 309 32038 825 364 22690 2175 --
NM_173200chr942856 2685 2045 309 32038 825 364 22690 2175 --
NM_173214chr1675925 5646 5271 2959 2720 2583 252 26210 5277 15110 --
NM_173359chr321903 1697 ------
NM_173454chr151752 ------
NM_173463chr483746 1650 1610 1443 405 358 311 76 --23581 1377 13073
NM_173468chr475847 5463 5009 4563 4504 3717 1057 --13793 --
NM_173473chr1042395 1787 454 321 ----32225 1924 1056
NM_173478chr173929 810 125 ------
NM_173495chrX62549 2480 1780 966 518 396 12387 --12107
NM_173508chr141131 229 186 140 ------
NM_173510chr2252407 2175 1948 1067 820 22137 1826 --1979
NM_173511chr263389 2880 2739 1222 579 105 13303 --11562
NM_173517chr7123 1472 ----
NM_173557chr183677 176 36 ------
NM_173576chr1042224 2105 281 268 ------
NM_173582chr1131267 997 147 12029 14164 25261 1402
NM_173595chr12145221 4490 4242 3935 3275 3223 3217 2073 1874 1758 1232 749 647 320 --1329 --
NM_173602chr1233409 3260 2459 1585 ----
NM_173642chr1127832 7765 7536 7292 6979 5875 5589 2371 2273 2210 1927 1437 33451 3169 691 58761 8174 7839 7434 215 12851
NM_173648chr22419 49 ------
NM_173654chr33846 777 46 ------
NM_173694chrX11015 --12351 --
NM_173794chrX--134 ----
NM_173808chr134327 1593 811 1650 ----
NM_173809chr1031478 1064 136 --11290 1937
NM_173812chr1241596 1432 1284 1007 1332 ----
NM_173825chr332615 2410 844 22709 2008 12115 11898
NM_173826chr331537 1178 113 ----1208
NM_173829chr545090 4807 4447 1503 12411 14574 13748
NM_173854chr162393 2268 2019 1897 1648 497 ------
NM_174916chr152909 384 --11716 --
NM_175056chr331507 1444 478 --1447 --
NM_175061chr731947 1420 406 ------
NM_175624chr1287694 7336 6998 6145 5260 2902 2400 2213 --26579 928 37375 5396 2987
NM_175625chr1287694 7336 6998 6145 5260 2902 2400 2213 --26579 928 37375 5396 2987
NM_175634chr841116 961 887 54 --1148 --
NM_175635chr841116 961 887 54 --1148 --
NM_175636chr841116 961 887 54 --1148 --
NM_175733chr1171878 1611 1442 750 711 373 137 --11494 --
NM_175736chr12247686 7447 7133 6482 5467 4969 4866 2482 2393 2322 2264 2157 2067 1919 1711 1675 1642 1313 1115 865 660 493 107 52 15015 46436 6248 2766 123 --
NM_175839chr20134 ------
NM_175840chr20134 ------
NM_175841chr20134 ------
NM_175842chr20134 ------
NM_175854chr13--1723 12736 --
NM_175863chr61139 ------
NM_175907chr1822536 1809 22088 515 1376 --
NM_175921chr553687 1531 1517 1244 126 --3841 804 273 13128
NM_175931chr1611544 1140 51659 1391 1361 586 53 11975
NM_176814chr7--1135 ----
NM_176863chr1751448 1385 1347 1340 226 11499 ----
NM_177414chr111378 11570 1110 --
NM_177424chr111639 2139 132 ----
NM_177438chr1433863 3655 1605 ----12839
NM_177947chrX1276 ------
NM_177948chrX1276 ------
NM_177952chr14----289 58 --
NM_177968chr261928 1685 1617 669 533 106 --12062 --
NM_177974chr1532116 755 289 ----1570
NM_177990chr203726 658 111 12027 ----
NM_177996chr2043309 2406 2132 35 --43069 3013 683 104 11077
NM_177999chr9113613 3249 2841 2649 2500 1323 506 322 306 70 59 --33311 2834 2451 --
NM_178010chr1231629 1551 296 --149 --
NM_178037chr1263218 2603 2453 2220 323 161 --23511 480 13567
NM_178038chr1263218 2603 2453 2220 323 161 --23511 480 13567
NM_178123chr21848 ------
NM_178151chrX187606 7497 7116 7049 6360 6208 5328 4902 2845 2612 2606 2597 2157 1493 1158 549 499 80 1205 27176 5216 --
NM_178152chrX187606 7497 7116 7049 6360 6208 5328 4902 2845 2612 2606 2597 2157 1493 1158 549 499 80 1205 27176 5216 --
NM_178153chrX187606 7497 7116 7049 6360 6208 5328 4902 2845 2612 2606 2597 2157 1493 1158 549 499 80 1205 27176 5216 --
NM_178161chr101112 ------
NM_178424chr5--1507 ----
NM_178441chr1411405 ------
NM_178445chr33932 836 366 1675 ----
NM_178450chr51709 ------
NM_178496chr311439 ------
NM_178505chr1073193 2566 2544 2392 324 159 79 --1518 --
NM_178539chr121228 12065 168 --
NM_178554chr3103176 3035 2262 2241 1448 1415 1088 802 652 617 13368 11251 --
NM_178568chr1761546 1424 602 323 221 24 31776 713 625 ----
NM_178585chr422314 501 23036 547 164 1923
NM_178812chr821513 112 ------
NM_178815chr102370 337 12116 1724 --
NM_178860chr172776 39 ------
NM_180989chr134833 801 579 330 1906 --11648
NM_181077chr1522173 1895 ------
NM_181291chr141663 ------
NM_181302chr141453 ------
NM_181308chr141453 ------
NM_181332chrX51881 816 481 335 210 --12090 --
NM_181349chr783054 2865 2731 2352 531 499 347 58 1407 12384 --
NM_181351chr1172984 2876 2606 2140 1849 709 69 ------
NM_181453chr251529 1335 489 356 213 ----11436
NM_181457chr211299 --1163 --
NM_181458chr221432 127 --1296 --
NM_181459chr211198 --162 --
NM_181460chr211245 --1109 --
NM_181481chr18126214 5439 5084 5030 4419 2261 2217 2057 1440 1200 748 736 ------
NM_181482chr18126214 5439 5084 5030 4419 2261 2217 2057 1440 1200 748 736 ------
NM_181483chr18126214 5439 5084 5030 4419 2261 2217 2057 1440 1200 748 736 ------
NM_181504chr573690 3373 2763 2670 1188 650 366 1733 ----
NM_181521chr1647239 7103 6455 1756 --35634 5547 2026 --
NM_181523chr573690 3373 2763 2670 1188 650 366 1733 ----
NM_181524chr573690 3373 2763 2670 1188 650 366 1733 ----
NM_181672chrX21318 44 ----1712
NM_181673chrX21318 44 ----1712
NM_181712chr141690 1416 1378 674 11554 ----
NM_181762chrX11094 ------
NM_181777chrX11094 ------
NM_181784chr272400 1934 1690 1050 771 506 298 --22062 123 --
NM_181787chr863708 3172 2699 2592 1443 715 --13654 12835
NM_181828chr22113574 3409 3054 1184 1078 1046 856 534 402 209 73 --23296 193 --
NM_181829chr22113574 3409 3054 1184 1078 1046 856 534 402 209 73 --23296 193 --
NM_181830chr22113574 3409 3054 1184 1078 1046 856 534 402 209 73 --23296 193 --
NM_181832chr22113589 3424 3069 1199 1093 1061 871 549 417 224 88 --33311 208 26 --
NM_181836chr512328 22137 593 32180 2058 886 --
NM_181846chr1963003 1810 868 608 375 205 --1502 --
NM_181876chr442687 926 53 32 --42653 2001 1692 169 --
NM_181897chr342089 931 622 186 ------
NM_182485chr412579 13702 --1117
NM_182507chr129890 875 849 757 722 711 367 238 186 11964 ----
NM_182509chr1461416 1105 416 324 308 246 --41583 1175 1134 60 --
NM_182526chr1482906 2516 2475 2125 2040 2016 813 142 --22983 762 --
NM_182641chr1751471 1447 170 161 21 2819 146 ----
NM_182643chr822111 616 11979 ----
NM_182646chr412579 13702 --1117
NM_182648chr141644 ------
NM_182666chr31600 ------
NM_182697chr751255 1166 392 183 43 ------
NM_182700chr751764 666 104 78 31 11315 ----
NM_182728chr1461651 1371 717 685 588 544 --41513 1500 1178 244 --
NM_182734chr2042870 695 673 21 ----1707
NM_182756chr2254 21 ------
NM_182757chr683146 2980 1006 744 298 216 207 98 ------
NM_182767chr1231686 152 133 ------
NM_182797chr2031821 1458 258 ------
NM_182830chr1421787 853 ------
NM_182854chr162428 310 ------
NM_182898chr7115959 5643 5625 5592 4396 2321 1617 921 803 758 313 26505 1202 14462 --
NM_182899chr7115959 5643 5625 5592 4396 2321 1617 921 803 758 313 26505 1202 14462 --
NM_182925chr561458 1210 1043 1023 216 24 1581 11197 1144
NM_182936chr1421433 205 --3387 139 84 --
NM_182943chr321097 456 ------
NM_182948chr13554 286 112 11098 22626 2160 --
NM_182970chr20154032 3989 3732 3655 3354 3328 2838 2818 1169 811 492 377 318 200 48 1401 23242 2766 --
NM_182977chr51750 ------
NM_183002chr1421433 205 --3387 139 84 --
NM_183004chr142444 161 12829 13610 --
NM_183006chr2071469 1328 1169 975 300 120 80 --21522 176 21209 421
NM_183050chr632239 1536 963 ----2707 366
NM_183078chr673766 3470 3078 2862 1147 1097 920 12767 1127 1966
NM_183393chr3--195 1750 --
NM_183394chr3--195 1750 --
NM_183397chr20114887 4809 4797 4639 4270 4041 1739 916 565 447 323 1223 14732 11876
NM_183419chr821432 1029 ------
NM_183422chr1311076 1949 ----
NM_184234chr20----1341 --
NM_194247chr244068 3168 2859 1383 11477 33811 1233 1144 13301
NM_194278chr1463525 3284 3239 1450 1410 661 --23660 1511 12766
NM_194286chr12176000 5789 5062 4533 4342 2435 2406 1741 1625 1404 1320 945 883 716 685 422 56 --66025 5867 4861 1506 727 212 --
NM_194301chr1411043 ------
NM_194313chr941765 1593 432 139 --31604 449 167 --
NM_194314chr174885 4410 4386 3493 3420 1477 240 14961 ----
NM_194328chr962959 2775 2596 2536 1219 848 1149 13303 --
NM_194329chr962959 2775 2596 2536 1219 848 1149 13303 --
NM_194330chr962959 2775 2596 2536 1219 848 1149 13303 --
NM_194332chr962959 2775 2596 2536 1219 848 1149 13303 --
NM_194442chr12695 43 --1584 --
NM_194454chr711252 1475 21616 1567 --
NM_194455chr711252 1475 21616 1567 --
NM_194456chr711252 1475 21616 1567 --
NM_194463chrX----11230 --
NM_197941chr582956 2346 2171 1896 1881 937 911 750 22222 415 ----
NM_197970chr2272 26 187 2246 31 --
NM_197977chr92627 70 ------
NM_198056chr372080 1817 1738 1613 1530 1486 633 --21965 268 --
NM_198066chr1433068 527 511 12803 --23086 2287
NM_198123chr821557 587 --1687 --
NM_198124chr821557 587 --1687 --
NM_198128chr181404 1513 ----
NM_198181chr1522557 2207 ------
NM_198196chr362403 2162 1829 803 338 146 ----22286 1965
NM_198215chr1011004 ------
NM_198236chr12216 87 --1971 --
NM_198270chrX2875 535 --192 --
NM_198279chrX2933 164 ----1991
NM_198281chr411224 13212 ----
NM_198334chr113252 235 214 --1938 --
NM_198335chr113252 235 214 --1938 --
NM_198353chr4176 1367 ----
NM_198391chr2031488 1328 985 1509 ----
NM_198392chr652000 1544 1528 605 424 1742 2325 122 --
NM_198395chr531232 204 44 ------
NM_198503chr132351 2198 1478 1338 ----
NM_198527chr151585 1434 ----
NM_198560chr373537 3473 3082 2712 2615 1116 339 1121 33143 3128 574 --
NM_198567chr52141 52 ------
NM_198581chr255796 5088 2328 1417 272 15626 12747 36569 5297 5000
NM_198595chr474628 3407 3110 1844 1049 828 325 --34461 1138 221 --
NM_198597chr105904 728 684 670 658 --1911 --
NM_198700chr111372 ------
NM_198715chr156204 5386 4712 623 557 24930 792 14836 15824
NM_198793chr344143 3480 3330 431 --1221 --
NM_198794chr1421401 512 ------
NM_198859chr354218 3778 3599 3299 1311 23892 800 ----
NM_198889chr41143 ------
NM_198900chr12247686 7447 7133 6482 5467 4969 4866 2482 2393 2322 2264 2157 2067 1919 1711 1675 1642 1313 1115 865 660 493 107 52 15015 46436 6248 2766 123 --
NM_198902chr152808 253 ------
NM_198904chr542119 1960 414 164 --1838 --
NM_198956chr751764 666 104 78 31 11315 ----
NM_198989chr132402 154 ------
NM_198990chr732566 2468 180 ------
NM_199000chr71232 --11692 --
NM_199144chr201310 --2315 41 --
NM_199160chr941818 1663 381 235 --11708 --
NM_199203chr201310 --2315 41 --
NM_199245chr1262518 2213 2078 927 575 480 ------
NM_199320chr442825 969 816 796 ------
NM_199320chr442825 969 816 796 ------
NM_199334chr171526 --1367 --
NM_199351chr1--1192 ----
NM_199355chr1631403 1179 65 11418 31360 1337 434 --
NM_199421chr1444324 3866 3262 749 ----13722
NM_199440chr21286 1422 ----
NM_199454chr1133734 3170 3163 3076 3069 2920 1910 1365 1293 1124 1079 1015 141 --23435 3379 14545
NM_199461chr1073649 2848 2576 2275 1273 1012 265 --22735 2404 --
NM_199478chrX21889 99 --2638 260 --
NM_199482chr221566 1305 --1465 --
NM_201263chr121608 188 --11720 2702 318
NM_201267chr22154 129 --1229 --
NM_201269chr1--11010 ----
NM_201278chr112962 517 --12060 1732
NM_201281chr112962 517 --12060 1732
NM_201413chr21------1358
NM_201414chr21------1358
NM_201432chr1785663 4515 4470 4447 1837 877 842 360 11831 36140 1336 743 --
NM_201433chr1785663 4515 4470 4447 1837 877 842 360 11831 36140 1336 743 --
NM_201436chr71885 --1847 --
NM_201437chr841393 1310 487 137 ------
NM_201516chr71941 --2903 580 --
NM_201517chr71885 --1847 --
NM_201524chr1661334 1094 317 274 119 82 --1280 --
NM_201525chr1661334 1094 317 274 119 82 --1280 --
NM_201567chr361731 1709 1622 1286 478 443 --11479 --
NM_201591chr431766 70 62 --1174 --
NM_201592chr431766 70 62 --1174 --
NM_201999chr4------11226
NM_203291chr181195 ------
NM_203292chr181188 ------
NM_203318chr1731074 1016 494 1822 2895 98 --
NM_203342chr1103416 2381 2289 1174 1150 1052 412 332 326 230 1747 22741 25 --
NM_203343chr1103416 2381 2289 1174 1150 1052 412 332 326 230 1747 22741 25 --
NM_203365chr22537 135 ------
NM_203382chr561653 1627 1196 1154 393 249 --21447 1322 --
NM_203390chr821301 531 ------
NM_203406chr552895 2791 2426 2399 1975 1730 12250 --
NM_203446chr2142700 633 231 225 --11140 --
NM_203454chr11995 2150 31 1915 --
NM_203459chr122016 776 ------
NM_203463chr264691 4412 3493 1651 1382 1023 13002 ----
NM_203504chr422144 796 --1170 --
NM_203505chr422144 796 --1170 --
NM_205768chr132082 1438 342 --11318 --
NM_205842chr23736 711 635 ------
NM_205861chr142072 1970 849 615 1653 21415 402 --
NM_206594chr142809 1063 647 559 12716 ----
NM_206595chr142809 1063 647 559 12716 ----
NM_206808chr13158 ------
NM_206853chr654004 3425 2870 1545 722 ------
NM_206854chr685265 4686 4131 1983 1251 943 655 198 --13352 13552
NM_206855chr676230 5651 5096 2216 1908 1620 1163 --14317 14517
NM_206876chr213086 42685 2555 1089 497 --1800
NM_206907chr522128 1022 12374 ----
NM_206909chr8128428 7550 7281 7037 6784 5702 3310 3105 1957 1427 991 332 17406 36929 2705 1227 --
NM_206914chr1272054 1442 870 293 284 191 55 ------
NM_207012chr1053398 3027 2912 2199 905 --12833 13164
NM_207015chr342404 2273 674 98 ------
NM_207043chr171960 1952 1658 1517 737 385 31 --11421 --
NM_207044chr171960 1952 1658 1517 737 385 31 --11421 --
NM_207047chr171960 1952 1658 1517 737 385 31 --11421 --
NM_207189chr1128 ------
NM_207292chr343174 3096 2898 819 ------
NM_207293chr343174 3096 2898 819 ------
NM_207294chr343174 3096 2898 819 ------
NM_207295chr343174 3096 2898 819 ------
NM_207296chr343174 3096 2898 819 ------
NM_207297chr343199 3121 2923 844 ------
NM_207299chr92744 46 ------
NM_207303chr1052912 1084 1016 609 316 1683 23031 690 1583
NM_207304chr1362635 2420 1708 718 128 99 ----11767
NM_207321chr1021082 988 1975 1256 --
NM_207337chr122986 953 11108 ----
NM_207366chr752299 2198 1470 315 180 ----1131
NM_207372chr1052294 2185 862 415 183 11928 ----
NM_207387chr1761536 1269 1199 707 83 31 --11323 --
NM_207406chr486120 6057 4873 4596 2450 1074 589 50 16472 ----
NM_207429chr1121817 43 22128 1624 1374 1547
NM_207518chr1971136 1100 914 412 278 261 187 --2931 312 --
NM_207577chr1142852 2231 1802 717 32918 1815 1043 151 --
NM_207578chr12783 286 ------
NM_207647chr912029 ------
NM_212464chr1592046 2010 1656 1528 1383 1375 772 752 347 ------
NM_212467chr1592623 2587 2233 2105 1960 1952 1814 278 259 ------
NM_212471chr1751502 716 660 305 39 1794 ----
NM_212472chr1751502 716 660 305 39 1794 ----
NM_213589chr2115115 4719 4434 4187 3960 3439 3391 1548 1469 1038 855 23729 122 ----
NM_213606chr1032645 1802 963 ----11938
NM_213609chr3--1261 ----
NM_213611chr12----1172 --
NM_213619chr82336 125 ------
NM_213620chr82336 125 ------
NM_213654chr331582 472 273 ------