TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-429
miRNA Sequence: UAAUACUGUCUGGUAAAACCGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX73125 3048 2982 2409 1380 1344 209 13429 ----
NM_000084chrX96501 5813 5638 4899 2765 2261 1835 1123 494 16751 26724 4657 12383
NM_000104chr242816 927 572 483 22756 937 22086 356 --
NM_000216chrX54034 2704 1141 1134 1047 ----12527
NM_000267chr1773198 3039 2221 1228 938 475 240 3650 463 412 ----
NM_000332chr6137184 6916 6249 6060 5811 5597 2812 2606 2192 1943 1346 1067 493 16304 66586 5424 5184 4905 1492 85 1876
NM_000337chr565187 4548 4036 2546 2067 1649 --15965 15386
NM_000813chr5104633 4615 3874 3542 3533 1992 1975 1812 1120 273 ------
NM_001003652chr18107789 7337 7187 6614 5935 5644 2643 1059 968 331 12092 1340 --
NM_001003674chr1856312 6057 1121 953 313 11357 32604 217 79 15403
NM_001003679chr121364 258 165 31808 1791 1437 --
NM_001003712chr12113879 3676 3546 3454 3006 2911 2696 924 695 333 136 --33159 966 60 --
NM_001005473chr564354 4163 2608 2230 624 299 1228 25282 634 --
NM_001009899chr386519 6231 4681 4603 4542 4234 948 865 15974 11020 --
NM_001009960chr742862 1046 386 282 2196 190 22181 2081 22476 1084
NM_001010986chrX62337 2269 2023 596 472 299 1583 22066 755 --
NM_001011666chr755455 4562 2280 1975 1586 26242 4138 34108 1905 1237 --
NM_001013620chr12147755 7739 7372 7327 7175 7017 6465 3142 2041 1976 1754 1650 1052 966 12221 25789 1428 --
NM_001014380chr13135902 5677 5329 4952 4143 3910 1019 664 626 454 285 214 30 --55756 5742 4180 2056 1583 --
NM_001025076chr10106164 5603 5587 5367 4595 2283 1160 1124 622 540 1372 26151 4927 --
NM_001029863chr643186 2606 518 231 --1188 22306 952
NM_001030055chr14114461 4292 4149 1710 1501 1084 855 476 270 142 77 14279 ----
NM_001031732chr4103552 3160 2898 2637 2532 2518 2338 1340 997 159 --1470 --
NM_001033047chr482261 2016 1803 1677 809 676 639 420 ----11958
NM_001037174chr251565 1551 580 568 442 22262 788 11646 --
NM_001039538chr232276 1314 854 2487 270 13154 1768
NM_001039577chr133645 1152 342 --33484 1171 959 11136
NM_001039577chr133645 1152 342 --33484 1171 959 11136
NM_001039618chr11144771 4612 4353 4012 3994 2218 1506 1429 1266 1124 807 722 551 136 15496 14790 --
NM_001039840chrX125648 5088 4357 3796 2404 2175 2155 1990 1339 1225 1211 997 --1279 --
NM_001040284chr1675457 3741 2347 2209 1214 374 337 14012 35556 1976 345 25614 2063
NM_001040665chr764404 4006 3793 3616 3249 3102 13305 --23812 1395
NM_001042555chr1273667 3482 3024 2902 1803 1275 429 14557 21046 421 1567
NM_001042599chr297565 7212 5352 5127 2959 2932 1828 1392 1255 --17662 --
NM_001042601chr343049 2972 2132 1114 --11037 12661
NM_001042604chr3104711 4620 4497 4447 3855 3700 1450 902 438 282 11365 ----
NM_001044387chr1964083 3303 2832 2540 1419 1287 --22984 1239 11378
NM_001100108chr168183 7402 6695 5205 3065 2102 11489 58173 7583 3178 1819 871 18275
NM_001106chr3139093 8092 8053 7382 7343 6358 6112 5975 3552 2388 2172 2121 715 --27595 1900 --
NM_001167chrX76592 5127 2217 1775 1129 909 284 35223 2345 185 21261 138 --
NM_001271chr1563211 2568 2475 2385 2345 434 13275 21073 364 12362
NM_001742chr761627 1588 1562 1252 1220 73 ----21580 1189
NM_001759chr1285126 5055 4757 3613 2112 1979 1609 392 ----15230
NM_001918chr188975 8826 8319 3180 2669 2044 970 631 38779 5753 3120 26667 6029 --
NM_001938chr161261 1252 593 471 208 118 21343 777 --1289
NM_001949chr633040 2906 2409 12777 32863 2442 75 12610
NM_002025chrX118251 7951 7162 6982 6722 6316 5609 3697 2682 2599 185 --38624 7218 731 17280
NM_002128chr1372122 2101 1705 466 226 193 130 --22509 561 --
NM_002210chr293410 3031 2740 2437 1290 1232 858 603 219 32648 965 928 23550 3019 --
NM_002310chr5126595 6517 5475 4507 4105 4028 1803 1725 565 147 101 56 25994 5344 ----
NM_002577chr393810 3532 3407 3222 3111 1291 1256 345 58 21263 1182 --12903
NM_002581chr955117 4754 2275 243 59 22239 748 --21143 1115
NM_002655chr8124868 4294 4008 3840 3778 3336 1844 1372 550 204 136 90 --23804 644 15267
NM_002716chr1152378 2331 982 949 769 --33466 3395 880 11106
NM_002731chr142875 2553 1032 384 1803 42746 2417 861 38 1349
NM_002745chr22113740 3640 3607 3166 3155 2922 2770 1250 1089 712 242 --11684 --
NM_002886chr3113938 3857 3654 1725 1536 1290 819 724 680 663 297 13158 13953 --
NM_003099chr15105157 2543 2514 2345 1948 1849 1561 1475 1421 264 12031 25151 2018 --
NM_003161chr1723300 200 33382 3057 2831 1927 1298
NM_003298chr366145 4083 2375 1447 347 75 24719 315 25741 1885 11862
NM_003474chr1042379 1673 1525 297 --12278 12257
NM_003478chr1173153 2911 993 985 570 544 535 1608 ----
NM_003574chr18134705 4546 3831 2192 2046 1477 1422 1183 792 571 462 433 86 15729 21291 726 14679
NM_003590chr263077 1230 832 722 715 381 12929 33282 2483 357 --
NM_003800chr651743 1656 701 655 646 --1384 12134
NM_003895chr2131766 390 70 ----22155 1685
NM_003913chr684260 3989 2909 1503 1254 1155 985 753 23326 1404 12955 --
NM_004124chr1443024 2526 194 27 --2846 458 22413 2334
NM_004171chr11119640 9394 8254 7854 7058 7034 6222 1077 738 414 353 17419 37092 6837 1471 11813
NM_004232chr1863897 3634 3443 2388 1417 1383 --1437 13126
NM_004392chr1352116 1784 856 811 144 1841 --1978
NM_004432chr972367 2319 2299 1948 475 283 164 --32263 516 100 --
NM_004586chrX94901 4784 4292 4120 3344 2101 1409 1198 1143 14344 43988 2187 1301 594 --
NM_004745chr854554 2147 2064 1953 721 --37063 1128 855 15589
NM_004852chr182013723 13547 13375 11720 11554 11333 10603 10226 10158 9818 8915 4956 4518 4232 4170 3616 3586 2800 2729 312 214038 10165 ----
NM_004866chr5134985 4884 4851 4842 3933 3888 3860 3800 3688 3397 1789 1251 630 34470 3784 952 34920 3164 993 --
NM_005063chr1083553 3259 3066 2610 1126 925 311 150 --32963 1431 129 --
NM_005065chr14115036 3926 3587 3554 2077 1421 1254 623 404 375 339 15210 ----
NM_005121chr1762963 1293 1013 854 415 408 1608 22665 275 --
NM_005188chr11138224 7348 6687 6066 5916 1912 1630 1608 1593 1478 732 309 182 23198 507 28112 6296 18022
NM_005277chr461712 1423 1383 1366 772 659 31809 1681 1570 --21659 1243
NM_005399chr1103983 3429 3109 2991 2752 1388 1256 1248 943 260 24448 4152 ----
NM_005436chr10101577 1496 1089 1074 834 494 432 290 277 270 --2213 170 --
NM_005513chr341486 1384 1321 74 --11303 1222
NM_005578chr374850 4447 4356 3937 3554 1488 342 ----13713
NM_005596chr9105400 4648 4401 4355 4293 2099 1995 807 683 467 --24656 1758 --
NM_005665chr154829 4267 1722 1695 1198 --14274 1258
NM_005759chr254157 1907 1842 1353 746 24635 3114 --21064 148
NM_005941chr863831 3032 1250 940 809 201 34111 4060 3735 32779 1596 748 13469
NM_006252chr167008 6828 5912 4747 4716 1333 17407 32412 2160 542 --
NM_006298chr631257 521 74 23376 2439 --22345 2082
NM_006364chr1421016 119 --1861 2954 218
NM_006375chrX81369 1331 1247 696 503 324 296 288 --1279 --
NM_006534chr2042662 2209 2100 132 22971 290 42923 947 666 422 --
NM_006544chr14106035 4860 4429 4172 3746 2277 1736 1294 1240 27 23929 1986 34052 884 332 22450 1482
NM_006575chr1461299 1089 1078 1013 915 308 21343 1181 21318 1103 --
NM_006599chr16176966 6740 6516 6220 6214 6165 5741 5367 3215 2738 2609 2566 2555 2178 1466 1098 839 12309 ----
NM_006646chr1352935 2316 794 281 77 22990 2376 2521 160 12954
NM_006750chr1657287 7213 6511 6504 3005 28064 1326 17933 17543
NM_006775chr641252 1129 796 512 21008 604 12311 22599 2531
NM_006948chr2162050 1806 647 560 459 148 --12012 22246 486
NM_007249chr13119049 9007 7655 7479 7367 7207 3125 2816 1994 1959 861 29226 2450 47306 3746 3549 824 186
NM_012081chr553172 2957 1077 343 248 23427 859 --23117 116
NM_012120chr652827 2328 2310 1146 1010 12616 --12358
NM_012164chr997202 6723 5452 4965 4778 2671 1809 1105 296 --14718 2482 256
NM_012214chr2105986 5379 5332 5185 4827 4725 4526 3878 1103 1075 1261 35868 5253 4479 --
NM_012262chr164590 4567 4435 2032 765 452 21409 591 54561 4169 1540 648 176 --
NM_012416chr94924 459 316 57 1793 --2773 151
NM_012465chr1083362 3202 2821 2178 1376 1291 1097 96 23342 246 1104 --
NM_012479chr752245 1070 898 473 204 --32552 1960 596 22497 571
NM_013381chr1232246 1804 714 --32147 477 404 1110
NM_014011chr262034 1675 361 351 269 105 42593 2317 676 120 --187
NM_014028chr663186 2703 2529 2088 2041 645 ----1451
NM_014048chr16124804 4662 4583 4435 4208 3983 3762 3631 1941 1769 1743 1229 14736 15254 --
NM_014117chr1642418 498 389 157 12641 1405 2860 679
NM_014155chr11137267 7108 7094 6190 6016 5934 5478 5136 4755 4741 2775 2661 741 15684 12917 --
NM_014331chr496534 6356 6272 5210 2910 2671 2581 1297 416 35597 3077 796 --11329
NM_014616chr373451 1172 998 901 599 355 55 23113 366 21351 955 --
NM_014701chr1563363 2837 2593 2172 562 173 23077 1176 42855 479 352 93 --
NM_014795chr22176 45 11369 1398 41036 905 462 215
NM_014839chr162414 2354 2281 1961 1636 272 ----1408
NM_014877chr1787702 6554 6165 5472 5237 5068 2812 2618 56356 4785 4740 2873 2716 ----
NM_014897chr1773161 2192 2066 654 640 489 126 12389 12788 12949
NM_014904chr1064073 3862 3587 2923 2519 1564 12986 --12768
NM_014906chr1764081 2727 1575 1059 564 184 11362 33335 359 163 13671
NM_014934chr1323185 47 1293 4192 168 56 40 --
NM_014982chr14105247 5222 3707 3327 2028 2009 1513 748 466 436 35310 4303 1526 15402 --
NM_014991chr462915 2575 2369 895 714 656 1126 21216 793 12116
NM_015026chr1294039 3927 3834 3497 3299 2940 559 251 201 12959 24151 1334 23424 1428
NM_015032chr1371797 1151 1061 1027 988 742 539 22874 2738 2675 410 --
NM_015040chr243123 2832 2444 343 13041 13063 22438 2318
NM_015051chr983212 2696 2311 1242 1067 531 402 394 1647 ----
NM_015310chr898067 5882 5627 3116 2897 2369 2238 1796 1493 26909 5091 12217 --
NM_015336chr1262633 2279 1081 1024 849 414 12583 21681 286 --
NM_015455chr573760 2613 1404 1326 1236 1182 146 --23369 2692 --
NM_015458chr894856 3866 3843 3579 3508 3307 1138 959 493 15301 23279 1218 11147
NM_015886chr8135669 5660 5133 4611 4038 3993 3980 3681 3630 1302 807 145 124 24822 4085 1875 --
NM_015888chr183319 2908 2867 2409 2248 2088 1016 123 1272 ----
NM_015986chr1751295 986 940 491 121 --2953 504 11000
NM_016083chr653872 2430 1515 953 377 43078 1388 1322 1300 1459 --
NM_016206chr398688 7789 7647 6748 5985 3584 3398 2102 1625 22512 2202 1652 18736
NM_016255chr6163278 3228 2944 2925 2872 2724 2711 2446 2041 931 884 876 797 141 114 62 42119 2084 908 201 33110 2172 923 --
NM_016530chr1562933 2616 1439 1378 443 139 23093 1386 --22583 305
NM_017594chr973193 3179 2961 2579 2343 680 644 12237 11169 1734
NM_017637chr9209355 9169 8650 8525 8444 8152 7653 7623 7406 7315 7205 3593 3280 2713 2539 2386 2337 946 328 71 48406 6477 979 973 32190 2146 1562 --
NM_017650chr795053 4981 2370 2269 1721 1617 1530 1031 382 46058 4224 2362 697 11462 --
NM_017658chr1483777 3698 1827 1698 1417 982 910 26 13007 1827 --
NM_017902chr10105528 5278 4052 2249 1802 1525 1037 560 261 90 ----14038
NM_017919chr965496 4343 2231 2202 1673 1644 34671 4444 3717 35460 2040 1758 --
NM_018017chr1042367 2135 971 276 22258 1875 --12197
NM_018133chr362159 2074 1774 1628 761 119 11767 1696 1560
NM_018374chr784603 4416 4384 3329 1700 1251 472 70 14969 ----
NM_018440chr8158546 8518 8009 7511 6900 6089 5959 3106 2752 2568 2560 1240 992 818 39 --2805 776 15260
NM_018566chr164707 4046 3624 1790 1071 499 2400 293 34955 3986 3772 --
NM_018638chr12115715 5204 5005 4799 4002 1954 877 799 671 610 433 1711 --11666
NM_020340chr631591 1481 612 --51963 1544 1457 301 127 --
NM_020390chr394759 4562 4360 3774 3737 3144 1504 364 240 14767 ----
NM_020432chr752075 2031 1552 771 117 ----2546 531
NM_020466chr643978 3673 3484 3441 24392 1917 33727 3207 108 --
NM_020673chr2075719 4873 4825 2914 1478 1046 839 11600 12599 16974
NM_020717chrX43951 3867 3700 3537 --23687 3205 14305
NM_020718chr1696568 4806 4760 4549 4463 4161 2407 2026 21 26300 1102 36080 1779 1561 --
NM_020772chr1798473 7077 6799 6542 3295 3206 1599 1535 1441 26813 3032 38564 2744 2544 --
NM_020774chr1875553 5261 5077 4233 2473 1079 947 24337 1133 25324 813 24104 1025
NM_021045chr1051902 1808 920 627 491 22131 231 --32619 2580 2377
NM_021255chr1483834 3762 2778 1345 1171 497 434 402 12904 23749 3336 --
NM_021813chr6105381 4648 4409 4325 3866 3780 2022 1587 1337 911 25812 2070 1672 --
NM_021914chr1422044 1715 2354 72 1595 1389
NM_021961chr11137481 7201 7173 6708 6349 6069 5951 5567 5534 4643 1557 1489 759 1715 17108 --
NM_021964chr342075 1227 1128 943 14935 --25461 5039
NM_022351chr853221 1357 1145 1015 537 2936 366 --13281
NM_024345chr9125978 5421 4776 4739 4723 4462 4036 3906 2229 1886 844 72 ----1945
NM_024749chr11610 11981 1529 31742 1608 388
NM_024947chr3148762 8518 7603 6489 6302 6266 5858 3052 3039 2685 2402 2145 546 480 47707 6322 3414 973 47264 6836 2847 1424 16110
NM_024989chr2117944 7863 7259 6921 6910 6219 5607 4977 3104 776 79 38144 6056 2565 11666 --
NM_025054chr8144228 3988 3871 3714 3553 3250 3102 2604 2593 1353 1127 1109 1022 878 --14079 --
NM_025134chr1642055 1902 1805 492 --21822 77 11624
NM_025160chr1104214 3835 3248 3045 2895 1093 779 692 546 286 --23724 3190 --
NM_030625chr10102392 2376 2235 1823 987 829 754 661 154 41 21956 815 --1384
NM_030627chr5104112 3922 3816 3436 3134 2707 1417 1212 332 126 --11334 --
NM_030647chr7116180 5780 5719 5533 4690 4139 4017 2269 2167 1999 1363 1951 26079 6039 --
NM_030751chr1021461 1413 --21779 469 41540 1320 1250 376
NM_031296chr451689 963 403 379 358 11942 11770 165
NM_032900chr1063823 2417 1316 655 445 437 11187 32434 700 669 --
NM_033224chr7137233 7067 6956 6174 6145 6121 5785 4930 2093 1690 1631 1557 1077 25459 1775 ----
NM_033285chr874148 3912 3764 3430 1542 1083 127 11657 31345 782 255 --
NM_033656chr2195831 5167 5120 4499 3869 2190 1596 1258 928 11571 1243 15473
NM_052885chr12104838 4742 4702 4167 4141 3706 3279 1914 1464 1395 ------
NM_133334chr445740 5148 4596 2152 1117 46314 2530 2405 471 1599
NM_133496chr164121 3795 3636 3307 1664 532 --13331 1457
NM_133646chr265511 5200 3754 3659 2011 1612 14948 43404 3382 1513 834 --
NM_138426chr762495 2120 972 879 300 249 --12428 11842
NM_138459chr682897 922 705 694 664 656 634 623 12815 ----
NM_138468chr286048 4750 4657 4246 4168 1875 893 825 11162 1833 --
NM_138731chr1464165 4034 3494 2818 828 531 12806 23622 709 --
NM_138959chr186753 5703 5587 4114 2239 1467 457 133 12608 21604 1489 14688
NM_139279chr243480 3278 3263 809 --22889 2674 13433
NM_144571chr476786 6539 6253 5585 5542 590 309 2712 195 1404 --
NM_144578chr1485510 4843 4428 4055 2205 1340 1313 374 --44127 2013 1668 572 --
NM_144973chr12125255 4623 4289 4267 4093 3908 3898 1441 1295 629 200 187 13739 --24516 815
NM_145257chr183470 3205 3123 2905 1514 1398 1197 976 33481 1670 1389 21067 342 --
NM_152409chr563604 3359 3270 3071 2881 369 22753 881 22630 632 --
NM_152622chr533387 157 123 22630 995 12739 11299
NM_152624chr577005 5582 5001 2385 1572 1216 375 --45535 2322 895 214 17106
NM_152754chr783806 3737 3649 3641 3478 3149 1392 1101 ------
NM_153207chr1263553 1043 728 678 671 578 --2442 133 --
NM_153332chr862651 2436 2261 2224 974 834 12667 1214 --
NM_153367chr1053194 3135 2834 2484 813 --11560 23109 175
NM_153810chr1074675 3632 1984 1903 1733 1324 871 21842 931 1460 --
NM_172071chr177357 6884 4542 2730 1095 402 222 35293 2499 390 44826 4754 2675 783 --
NM_173531chr19103626 2982 2644 1507 1355 1322 869 542 336 226 11442 ----
NM_175061chr721625 480 1675 --21977 1696
NM_178505chr1043167 1306 1211 882 12613 43606 1114 773 763 --
NM_181358chr183875 3383 3071 2593 1584 965 767 695 --24223 174 11389
NM_182767chr1261666 1624 791 400 339 138 21525 303 11470 --
NM_194247chr294411 4378 4283 4234 4203 2938 1794 1617 672 --13984 --
NM_198465chrX52819 881 794 289 84 12109 --1951
NM_198468chr654331 3609 332 277 39 1295 33790 1455 1127 --
NM_198581chr2106023 5101 2858 1691 1060 965 599 543 165 124 26192 1215 42077 1257 978 394 --
NM_203463chr264761 4406 3728 3644 3302 54 13625 23064 228 11324
NM_206853chr6114087 4014 3996 3976 3728 3288 3157 2700 2510 1186 214 13813 23949 3278 --