TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4301
miRNA Sequence: UCCCACUACUUCACUUGUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000555chrX76848 6404 6136 1809 1757 1659 464 --11813 35788 2122 1667
NM_001100108chr1117963 5556 5188 3217 2573 2524 2158 799 761 226 210 15874 --1426
NM_007238chr20114226 3343 3254 2995 1630 1035 976 382 323 176 160 34000 3069 701 23763 375 --
NM_175063chr196834 104 92 84 78 72 --196 --
NM_178151chrX76848 6404 6136 1809 1757 1659 464 --11813 35788 2122 1667
NM_178152chrX76848 6404 6136 1809 1757 1659 464 --11813 35788 2122 1667
NM_178153chrX76848 6404 6136 1809 1757 1659 464 --11813 35788 2122 1667
NM_182515chr1985710 5394 4555 4145 2033 1143 941 805 --12539 25517 5294