TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-432-3p
miRNA Sequence: CUGGAUGGCUCCUCCAUGUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr51272 --12067 1441
NM_000052chrX92885 2357 2210 2154 1066 755 556 480 54 12933 ----
NM_000081chr11747 ----1114
NM_000084chrX127011 6731 6411 5720 4531 4348 2588 2521 1767 1462 1248 352 11302 26172 5975 --
NM_000092chr214380 11493 13751 12793
NM_000110chr1--1419 --1183
NM_000112chr5105025 4252 4234 4227 3854 1809 1207 1012 559 508 14175 11724 --
NM_000125chr633958 3632 3568 33819 3089 109 1141 --
NM_000127chr8------1111
NM_000161chr1451859 1769 1466 1390 1338 ------
NM_000176chr553253 2794 2534 1258 1173 12953 ----
NM_000189chr281937 1580 698 591 554 526 234 70 ------
NM_000202chrX52713 2683 2435 1064 834 --22730 782 --
NM_000208chr1973906 3730 1358 1172 746 684 520 11488 ----
NM_000217chr1295305 4419 3586 3523 1917 1772 1333 985 653 11538 24238 1864 14030
NM_000267chr1722817 395 2747 733 33296 2753 126 12672
NM_000314chr1073206 2746 2670 2447 918 564 160 ------
NM_000330chrX42240 2142 1869 722 21451 379 12244 --
NM_000332chr656652 6467 5179 2874 50 21581 1170 ----
NM_000337chr5146534 6242 4582 4305 2271 2180 2169 1911 1376 1068 383 318 276 260 25989 2516 1342 --
NM_000362chr2263414 2742 2306 384 217 172 --22814 923 --
NM_000408chr283470 2693 2605 2501 1200 998 922 523 --1196 --
NM_000428chr1462176 2132 570 558 382 299 12030 1833 --
NM_000461chr353797 2826 901 484 298 ----14535
NM_000489chrX22363 856 22539 1212 12991 12575
NM_000538chr1331414 342 22 21124 171 ----
NM_000539chr391275 1268 1247 1137 1066 428 197 73 44 --11486 --
NM_000544chr6_cox_hap163131 2882 1162 1137 1012 303 ----12801
NM_000555chrX87121 5597 3018 2744 2588 2409 833 229 27774 6532 1837 11980
NM_000595chr64200 109 67 56 1432 ----
NM_000599chr284642 4293 3479 3193 1618 1307 672 414 --23644 3132 --
NM_000612chr1193620 3570 3446 3341 3282 846 625 83 39 ----1665
NM_000618chr1276384 5170 2201 2194 2077 1309 590 --31443 1026 376 34684 2082 1511
NM_000618chr1276384 5170 2201 2194 2077 1309 590 --31443 1026 376 34684 2082 1511
NM_000633chr1843800 773 486 400 13463 ----
NM_000719chr12146427 6353 6166 5990 5957 5361 4579 4142 2441 2352 2319 2103 558 117 15406 12603 --
NM_000724chr1041449 744 709 430 1335 ----
NM_000806chr531931 557 77 ----11802
NM_000809chr4118547 7864 7441 6890 6257 3204 2552 1418 683 243 220 ------
NM_000813chr565445 3474 1815 1592 1345 131 11009 ----
NM_000814chr1553523 3247 1533 1185 392 31231 890 349 1942 11686
NM_000827chr542479 1822 393 54 1992 --11703
NM_000828chrX21482 330 ----1441
NM_000829chr1152069 1765 641 435 127 --22123 1953 11774
NM_000831chr1105638 5516 5494 4193 1304 991 969 521 490 191 --26082 5061 14868
NM_000834chr124904 445 233 184 ------
NM_000864chr141082 979 782 750 ------
NM_000875chr1596578 5337 4838 2718 2395 1857 1559 1477 1245 1556 35854 708 87 2713 432
NM_000899chr1243931 2892 1437 212 13222 13707 --
NM_000926chr1189285 8655 8311 3760 3630 2980 2013 274 37657 1682 321 28659 7642 12134
NM_000944chr452217 2164 1768 1551 897 ------
NM_000950chrX73151 3043 2596 2414 1460 511 174 ------
NM_001001331chr382737 2308 2123 2040 1857 1021 660 610 1454 32680 75 71 --
NM_001001344chrX51997 1873 1843 604 205 1286 --1173
NM_001001396chr1103814 2969 2730 1787 1433 1355 1089 338 307 21 21615 828 3511 344 48 --
NM_001001433chr203871 419 137 ----13123
NM_001001481chr822736 66 ----1402
NM_001001685chr1752897 909 801 793 786 --11092 --
NM_001001701chr432167 2157 190 21709 804 11599 --
NM_001001924chr831534 792 598 --11826 1194
NM_001001925chr831534 792 598 --11826 1194
NM_001001931chr831534 792 598 --11826 1194
NM_001001971chr1041313 921 874 67 1347 ----
NM_001002258chr241441 1296 205 29 11571 1225 --
NM_001002814chr863721 3609 3326 2936 1121 111 ------
NM_001002860chr1454337 3684 3430 3393 405 ------
NM_001002909chr1751713 898 643 506 419 --1587 --
NM_001003652chr1896839 6216 5718 5499 3321 2375 1608 1217 745 11743 17724 193
NM_001003674chr18116219 6092 5809 5462 4775 4692 2042 2019 1216 974 196 1708 15820 12670
NM_001003675chr18116219 6092 5809 5462 4775 4692 2042 2019 1216 974 196 1708 15820 12670
NM_001003712chr1222536 180 --13815 --
NM_001003945chr911221 ----11923
NM_001004065chr953761 3391 3150 2584 1584 23959 3059 ----
NM_001004304chr1253068 2619 2246 1229 1148 1395 12909 --
NM_001004317chr654112 3624 1446 1329 562 ------
NM_001004342chr1145973 5840 4876 2378 2018 1915 1338 1020 799 687 588 322 63 42 25647 4692 24710 1578 14767
NM_001005404chr1732841 1025 144 --31721 117 97 31344 812 46
NM_001005473chr586366 5894 5252 5199 2454 2044 1356 504 --35849 5405 4972 --
NM_001005502chr1295256 4229 3938 3690 1720 1392 1217 1135 1083 ----11916
NM_001005732chr211225 2438 190 --1214
NM_001005733chr21--1190 --1214
NM_001006636chr23902 779 148 ------
NM_001007024chr17114160 3295 2709 1329 1234 1184 1135 1094 857 817 516 24366 375 2863 823 --
NM_001007025chr17114160 3295 2709 1329 1234 1184 1135 1094 857 817 516 24366 375 2863 823 --
NM_001007094chr1083819 3788 3698 3551 3463 3432 3399 1048 1651 24082 3021 --
NM_001007466chr665014 3824 3650 3279 1139 920 15095 --11902
NM_001007559chr1821348 94 1815 1100 --
NM_001008220chr5113793 3760 3550 3346 1150 998 894 867 556 184 173 --41369 1006 1002 874 --
NM_001008239chr1853695 2978 1455 429 50 1967 ----
NM_001008405chr71238 1540 --1711
NM_001008491chr242043 1734 466 385 --1113 --
NM_001008492chr242043 1734 466 385 --1113 --
NM_001008541chr1072147 1733 1707 1678 762 712 317 ------
NM_001008541chr1072147 1733 1707 1678 762 712 317 ------
NM_001008726chr1441153 528 425 238 ------
NM_001008756chr342030 1950 1018 229 12014 ----
NM_001009554chr484733 4029 3292 3159 2959 1728 884 105 11216 ----
NM_001009554chr484733 4029 3292 3159 2959 1728 884 105 11216 ----
NM_001009555chr431442 677 234 21576 1199 ----
NM_001009571chr741650 1627 640 84 1616 ----
NM_001009899chr396433 5402 5390 4874 4438 2174 1256 915 445 15497 ----
NM_001010000chr1873534 3460 3089 2686 2560 2533 768 22413 929 1956 --
NM_001010861chr142700 499 293 40 --258 54 --
NM_001010862chrX72680 2596 1256 1124 243 174 89 12698 ----
NM_001010888chrX24349 1569 1764 --13934
NM_001010891chr535731 2277 1721 11325 24290 137 --
NM_001010895chr92801 470 --21629 1516 --
NM_001010924chr1011004 11234 --11178
NM_001010986chrX42473 2437 2233 2133 ------
NM_001011666chr754853 2400 1733 1564 1432 1801 12456 25385 4545
NM_001012393chr11104918 4652 3540 1837 981 633 594 558 547 228 1433 41533 1162 836 489 1866
NM_001012755chrX85023 4603 4472 3301 3182 887 110 99 ----1898
NM_001012968chrX32206 402 315 1631 --1786
NM_001012989chrX2274 212 ----1477
NM_001014380chr1365450 5308 5208 4743 2349 430 25420 1290 ----
NM_001014797chr10107708 7452 6948 6610 5780 2938 2911 2852 2406 2324 26041 31 12815 --
NM_001017368chr1752432 2073 938 803 354 12537 ----
NM_001017440chr7197994 7955 7917 6369 6185 6009 5641 5548 2461 2184 2099 2062 1685 1323 985 897 697 493 394 --26611 333 --
NM_001018064chr952088 1873 1402 224 171 ----22093 1601
NM_001018065chr966040 4833 1519 1219 1067 239 14034 25767 5577 --
NM_001018066chr966040 4833 1519 1219 1067 239 14034 25767 5577 --
NM_001018067chr131948 999 112 15372 1121 --
NM_001018068chr131948 999 112 15372 1121 --
NM_001018069chr131948 999 112 15372 1121 --
NM_001018074chr553253 2794 2534 1258 1173 12953 ----
NM_001018075chr553253 2794 2534 1258 1173 12953 ----
NM_001018076chr553253 2794 2534 1258 1173 12953 ----
NM_001018077chr553253 2794 2534 1258 1173 12953 ----
NM_001024094chr553253 2794 2534 1258 1173 12953 ----
NM_001024372chr832251 1610 1548 3849 601 61 ----
NM_001024455chrX62067 1063 1030 597 522 153 --11852 --
NM_001024596chr1953001 2936 1361 1135 233 12345 42441 2437 2433 2413 --
NM_001024649chr552210 1111 450 163 95 ------
NM_001024948chr1--2104 66 --12158
NM_001025076chr1075668 4725 2448 1538 1245 264 219 12050 14295 --
NM_001025077chr1077026 6083 2896 2603 1622 1577 1197 --15653 --
NM_001025079chr383685 3100 2987 2941 2597 1175 1096 620 ------
NM_001025108chr263311 2670 2642 1614 650 365 13475 ----
NM_001025233chr1231066 659 394 --11114 1547
NM_001025266chr383816 3487 1926 1489 1223 633 422 392 1780 31499 1406 1239 --
NM_001025580chrX23408 1341 1658 --11138
NM_001029858chr653003 2449 1295 1151 245 --12172 11156
NM_001029863chr622271 38 ----11121
NM_001029875chr532824 2795 556 ------
NM_001030007chr1632753 781 462 12786 13028 --
NM_001030055chr1424564 3902 34756 1022 110 ----
NM_001031684chr22425 336 ----1106
NM_001031690chr7102882 2861 2449 2178 2113 878 838 549 471 167 ------
NM_001031695chr2255090 4961 3376 1467 1272 --11249 13974
NM_001031804chr1643033 1076 590 424 --14107 --
NM_001032288chr2031136 561 214 1308 --1131
NM_001032363chr142088 1655 1446 89 ------
NM_001032363chr142088 1655 1446 89 ------
NM_001032394chr662529 2052 1807 584 73 23 1432 12542 --
NM_001033044chr141835 1345 315 45 --1739 --
NM_001033047chr47761 302 295 273 248 228 41 12565 1526 --
NM_001033056chr141835 1345 315 45 --1739 --
NM_001033087chr2042200 2067 1220 664 12760 12267 --
NM_001033117chr394897 4827 4076 3987 3935 3476 1922 436 172 14341 1792 --
NM_001033578chr832306 872 322 22152 1649 ----
NM_001033723chr862268 2261 1709 1092 838 732 11851 ----
NM_001033910chr131804 1453 430 22110 1992 ----
NM_001034841chr1655455 5247 4866 4255 854 1232 1858 --
NM_001034954chr1041287 601 364 52 ----12070
NM_001034955chr1041287 601 364 52 ----12070
NM_001034956chr1041287 601 364 52 ----12070
NM_001034957chr1041287 601 364 52 ----12070
NM_001035chr141118 982 378 254 --21122 841 --
NM_001037317chr142700 499 293 40 --258 54 --
NM_001037332chr572562 2095 740 620 570 312 304 ----12008
NM_001037333chr572562 2095 740 620 570 312 304 ----12008
NM_001037553chr21125125 4891 4730 3703 1926 1818 1806 1100 841 559 459 45 15097 11958 --
NM_001038707chr171863 1437 916 726 697 42 28 --11888 --
NM_001038707chr171863 1437 916 726 697 42 28 --11888 --
NM_001039459chr73813 298 92 1939 --1861
NM_001039538chr23752 646 116 --1319 --
NM_001039618chr1145961 5477 1689 301 --14298 --
NM_001039916chr125931 337 228 153 111 ------
NM_001039917chr125931 337 228 153 111 ------
NM_001039918chr125931 337 228 153 111 ------
NM_001039919chr125931 337 228 153 111 ------
NM_001039920chr125931 337 228 153 111 ------
NM_001039937chr1343434 3331 3130 81 12791 11215 --
NM_001040020chr721467 102 --11209 --
NM_001040152chr784771 4368 4295 3424 3163 1133 509 338 14488 1838 11491
NM_001040157chr43988 417 144 ------
NM_001040214chr652195 1975 1594 1484 247 1389 ----
NM_001040284chr1654148 3980 3850 1296 647 --13681 --
NM_001040441chr154539 3380 759 587 161 --12113 --
NM_001040458chr54730 470 333 133 --11565 --
NM_001040712chr9103341 3312 3074 2751 2450 1173 906 804 309 48 12379 23322 3318 12725
NM_001042355chr1695127 5104 4772 1831 1768 1555 1028 714 85 ------
NM_001042412chr1695127 5104 4772 1831 1768 1555 1028 714 85 ------
NM_001042492chr1722817 395 2747 733 33296 2753 126 12672
NM_001042494chr1561443 1192 1039 1022 677 172 21223 621 ----
NM_001042495chr1561443 1192 1039 1022 677 172 21223 621 ----
NM_001042496chr1561443 1192 1039 1022 677 172 21223 621 ----
NM_001042497chr1561443 1192 1039 1022 677 172 21223 621 ----
NM_001042510chr842128 2107 1864 222 --11695 --
NM_001042511chr842128 2107 1864 222 --11695 --
NM_001042555chr1274715 4653 4139 3543 3334 3304 2907 11660 ----
NM_001042599chr297791 7608 6915 6129 6057 2024 1601 1258 866 37145 1547 1469 52536 2532 1944 1940 1936 26066 1949
NM_001042601chr321994 405 1451 1412 --
NM_001042603chr1274043 3726 1375 1334 899 667 81 14334 ----
NM_001042604chr354455 4057 4050 1867 1663 34430 2962 656 143 --
NM_001042681chr182218 2167 2126 2069 1621 762 257 151 11064 22133 1674 12288
NM_001042682chr182218 2167 2126 2069 1621 762 257 151 11064 22133 1674 12288
NM_001042682chr182218 2167 2126 2069 1621 762 257 151 11064 22133 1674 12288
NM_001043318chr1483299 3289 3275 3264 3040 2544 1441 1183 ----13364
NM_001044305chr63493 61 23 ----11154
NM_001044385chr252953 2829 2524 1584 828 1930 ----
NM_001046chr551989 1131 970 742 359 11058 12324 --
NM_001099678chr386313 5820 5558 4503 1504 1059 868 151 --1159 14088
NM_001100108chr1107848 6779 6656 5495 3173 2219 1779 1568 854 296 --12650 --
NM_001106chr3139563 9503 8844 7390 7138 6497 3481 3461 3133 2552 2150 1359 383 13404 28110 7745 --
NM_001113490chrX53592 2383 1195 674 444 12530 13386 12240
NM_001116chr1683085 2790 2632 2349 1198 516 225 173 22706 865 ----
NM_001117chr181430 ----197
NM_001128chr1632753 781 462 12786 13028 --
NM_001167chrX76725 5001 4718 4495 1643 1196 198 ------
NM_001173chr1424564 3902 34756 1022 110 ----
NM_001186chr2142948 2762 352 79 ----130
NM_001198chr63892 473 388 --22235 866 11800
NM_001204chr2107175 6344 6249 5281 5101 4906 3080 1057 605 413 32690 2413 1221 ----
NM_001227chr1031040 870 539 ----11045
NM_001257chr163988 437 410 ----168
NM_001259chr775303 4987 4390 1646 1511 1112 1065 22522 2154 ----
NM_001310chr1252911 2698 1886 547 208 ------
NM_001331chr1151759 951 666 212 22 11991 11835 --
NM_001332chr541344 1224 576 413 --11169 --
NM_001346chr362610 2125 1954 1909 1887 618 ------
NM_001356chrX72277 1586 867 668 629 468 256 1710 ----
NM_001364chr1154604 3200 3151 1690 1251 14283 13764 --
NM_001387chr5112987 2855 2743 2613 2567 2522 2175 2141 2034 1218 1053 ------
NM_001412chrX43461 3344 2930 28 12559 ----
NM_001438chr162522 916 511 377 304 27 --1805 --
NM_001440chr862734 2723 2546 900 579 564 1321 12738 1373
NM_001455chr684713 3922 3699 3028 517 465 334 304 --1676 --
NM_001460chr162969 2696 2661 2213 280 49 1110 22711 612 --
NM_001560chrX42422 2293 1656 54 --11667 --
NM_001609chr1074044 3477 3233 3044 729 603 382 ------
NM_001616chr273516 3510 3205 1178 860 852 737 ------
NM_001659chr1252673 2115 1060 1010 897 --12448 11777
NM_001663chr1432599 480 449 22114 2012 151 --
NM_001678chr17121631 1465 1354 1272 1261 1198 1164 571 517 474 454 23 --1298 --
NM_001683chr382737 2308 2123 2040 1857 1021 660 610 1454 32680 75 71 --
NM_001684chr183531 2686 1504 1150 1072 806 55 24 21332 545 2228 61 --
NM_001689chr241441 1296 205 29 11571 1225 --
NM_001699chr193201 138 127 11357 ----
NM_001709chr1142447 2211 1872 1770 --12003 --
NM_001746chr552210 1111 450 163 95 ------
NM_001759chr12103830 3507 3208 2088 1716 1437 1250 1219 957 36 14761 14459 --
NM_001777chr383685 3100 2987 2941 2597 1175 1096 620 ------
NM_001830chrX63878 1542 1387 1120 610 568 23448 848 13072 --
NM_001854chr131201 452 339 --1344 --
NM_001874chr1295256 4229 3938 3690 1720 1392 1217 1135 1083 ----11916
NM_001918chr1149164 7726 7497 6865 6740 5681 5607 2712 2170 2036 1724 1591 1142 571 32698 1305 783 12857 --
NM_001939chrX43584 3284 1228 567 --2410 298 23357 946
NM_001951chr81212 1656 --1414
NM_001968chr42212 116 1720 2912 322 --
NM_001987chr1273626 2732 1137 1125 807 368 266 ----11489
NM_002006chr485572 5429 4842 4166 3917 1727 1408 130 24951 4912 1641 --
NM_002015chr1342998 2053 888 521 32919 1246 391 ----
NM_002025chrX168906 8827 7925 6553 6499 6472 6355 6304 6185 3653 2823 2524 2228 1419 408 252 11944 21508 1360 --
NM_002035chr1872851 2556 2442 916 900 886 779 22626 1261 ----
NM_002061chr141500 1335 1226 179 --2757 730 --
NM_002063chrX3475 307 285 1818 ----
NM_002065chr141835 1345 315 45 --1739 --
NM_002074chr141521 480 396 42 ----21625 81
NM_002092chr443997 3377 1288 460 ------
NM_002126chr1743296 3027 2955 317 11054 12804 23227 2521
NM_002137chr732312 1979 1634 12234 ----
NM_002163chr1651266 854 330 251 43 1929 ----
NM_002182chr372728 2665 2172 699 530 305 283 12410 ----
NM_002235chr121133 1185 21278 1274 1200
NM_002241chr173074 2959 2092 2057 720 106 24 --22036 408 --
NM_002253chr431144 317 236 ----1436
NM_002254chr242174 1777 562 403 11455 --128
NM_002264chr384814 4460 4177 3682 1845 1458 1156 583 25015 1781 21940 609 14694
NM_002267chr1331603 1496 613 32407 1865 34 ----
NM_002271chr134832 633 385 118 --1869 --
NM_002285chr263311 2670 2642 1614 650 365 13475 ----
NM_002293chr152089 1708 1107 1039 452 --3610 566 222 --
NM_002310chr585742 4603 4289 4224 2109 1791 520 32 24530 1779 1511 12202
NM_002374chr23752 646 116 --1319 --
NM_002387chr594615 4577 4507 4438 4055 3916 1960 1570 192 1779 14037 11338
NM_002398chr25564 410 400 311 137 ------
NM_002445chr8139 21293 1048 --1569
NM_002545chr11104918 4652 3540 1837 981 633 594 558 547 228 1433 41533 1162 836 489 1866
NM_002547chrX64094 3930 3902 3292 297 212 23497 3129 ----
NM_002556chr1171999 1922 1778 1722 1707 841 269 ------
NM_002577chr333392 3348 1619 --23719 326 --
NM_002581chr972179 1978 1968 860 456 328 212 35483 4265 1833 11169 --
NM_002586chr661429 1405 1159 1092 227 125 ------
NM_002588chr531157 588 319 --21429 342 1226
NM_002641chrX31328 798 627 2693 134 --1646
NM_002645chr1162963 2899 2058 1104 964 912 12344 ----
NM_002655chr875163 4517 4499 3541 1229 741 593 25170 852 ----
NM_002657chr20103236 1508 1278 1036 974 889 848 692 678 526 --12497 --
NM_002666chr154913 819 766 122 ------
NM_002698chr1961120 322 211 205 196 164 1949 ----
NM_002709chr252696 2456 490 338 237 --182 --
NM_002716chr1163070 2624 1359 1191 620 266 1109 13480 --
NM_002731chr172225 1164 732 268 163 142 77 ------
NM_002738chr16295 22 2416 40 --1350
NM_002745chr2254176 4168 3432 1667 106 --44381 3084 1489 1225 --
NM_002776chr19101989 1911 1778 1651 1514 1360 606 191 185 74 11712 21332 1247 --
NM_002827chr2051695 1176 430 182 153 ------
NM_002839chr9103341 3312 3074 2751 2450 1173 906 804 309 48 12379 23322 3318 12725
NM_002857chr17825 809 727 716 524 350 123 1559 --1130
NM_002858chr12317 300 11316 ----
NM_002874chr942420 867 543 89 ------
NM_002886chr344848 1824 1703 1232 2669 53 11789 1199
NM_002890chr51898 ----1774
NM_002895chr205926 902 800 767 350 1157 1817 --
NM_002959chr173954 3656 3486 3428 3126 506 420 --23312 3245 --
NM_002998chr822246 108 --1577 11763
NM_003026chr95911 517 361 325 116 --11118 --
NM_003042chr351718 1509 801 709 88 11395 --11887
NM_003051chr131770 1749 349 11424 ----
NM_003059chr5------1325
NM_003100chr5------185
NM_003108chr2106539 6472 5741 5363 4413 2904 2075 1886 1824 1458 34930 1142 685 ----
NM_003137chr641569 810 623 346 11828 11654 --
NM_003149chr361528 1415 1244 1144 1037 189 11234 ----
NM_003150chr1762205 1507 1479 934 847 673 22288 474 ----
NM_003155chr851999 894 312 216 119 21103 626 ----
NM_003161chr1753486 3467 3428 3245 1036 --12342 --
NM_003199chr1875109 4661 4519 1841 898 584 244 13490 ----
NM_003202chr561172 587 578 486 471 46 1433 1612 --
NM_003221chr673840 3466 3240 1661 878 476 239 12628 ----
NM_003246chr1582010 1416 1354 832 338 293 265 195 ------
NM_003262chr385070 3830 3317 1766 1583 1012 245 212 21355 131 --15044
NM_003291chr131100 1520 1108 --
NM_003320chr1163334 1380 1306 1227 949 80 --22960 1616 13043
NM_003340chr431336 426 328 --1143 --
NM_003347chr2221872 56 2937 287 --11819
NM_003349chr2031136 561 214 1308 --1131
NM_003369chr1181968 1913 1109 794 660 578 509 466 ------
NM_003387chr222503 318 22353 603 32256 1870 717 --
NM_003392chr344014 3394 1298 327 --2964 922 1146
NM_003410chrX52042 1968 1216 436 78 ------
NM_003411chrY21230 79 11610 --11784
NM_003421chr1083819 3788 3698 3551 3463 3432 3399 1048 1651 24082 3021 --
NM_003458chr393706 3547 2971 2704 2671 2463 774 763 110 --21267 1263 --
NM_003463chr622560 521 32295 1255 1042 ----
NM_003471chr33706 585 197 21968 1853 ----
NM_003478chr1173191 3130 2596 2569 2540 2050 236 ----11222
NM_003489chr2183051 2613 2465 1357 1055 964 892 866 2478 438 23276 314 --
NM_003498chr1662722 2555 1986 1066 515 395 22751 2524 ----
NM_003559chr1793782 3510 2740 2721 2520 1167 722 647 421 --13480 --
NM_003574chr1874861 4213 3916 917 903 548 414 --11619 --
NM_003575chr761518 1446 511 492 484 189 ------
NM_003590chr243412 3231 1570 92 --13344 --
NM_003593chr177670 659 561 555 486 477 286 ------
NM_003615chr333948 2636 637 33533 3405 2986 ----
NM_003617chr163873 3103 1743 1502 1208 27 13981 --13544
NM_003625chr12------179
NM_003659chr22223 164 21209 936 ----
NM_003663chr343232 2728 2145 1160 11175 ----
NM_003679chr193256 2874 2419 2267 2254 1199 607 588 558 12239 ----
NM_003681chr21126213 5942 5405 5111 4559 4528 4073 3958 1456 1142 838 273 --25211 3789 --
NM_003714chr552487 2314 841 736 273 22836 762 142 --
NM_003716chr35974 371 312 229 175 ------
NM_003735chr531157 588 319 --21429 342 1226
NM_003736chr531157 588 319 --21429 342 1226
NM_003759chr443888 1570 1206 1095 ------
NM_003762chr12958 432 --1916 --
NM_003763chr203871 419 137 ----13123
NM_003774chr1222203 817 12787 ----
NM_003800chr632125 709 697 21624 270 ----
NM_003838chr131601 1284 317 11547 ----
NM_003861chr1422329 416 1159 --1152
NM_003872chr262661 2450 794 647 524 482 --22930 511 --
NM_003873chr1032004 658 274 11708 11911 --
NM_003884chr341224 1173 642 535 ------
NM_003888chr1561556 1330 1318 1166 517 267 --21505 1242 --
NM_003958chr653794 3519 2952 1324 1002 23858 3714 13122 --
NM_003966chr557713 7658 4771 1813 249 17824 45457 2986 1391 1247 --
NM_003983chr1664024 4002 3332 1612 1514 556 14260 13476 --
NM_003994chr1243931 2892 1437 212 13222 13707 --
NM_004024chr14607 526 125 118 1329 ----
NM_004035chr1754881 4219 1792 1461 1316 --23958 217 --
NM_004094chr1462936 2592 2480 2293 2072 861 21857 349 ----
NM_004096chr1051756 1666 1601 1500 699 --1429 --
NM_004124chr1423406 2252 12378 22259 1373 --
NM_004136chr1552601 2127 2119 929 116 ------
NM_004171chr11109380 9339 8490 6540 6529 6259 3361 3112 2526 1445 38163 7296 1084 18494 --
NM_004172chr571958 1580 612 584 523 190 65 11398 1724 --
NM_004185chr13644 619 23 --1550 --
NM_004200chr1192898 2839 2590 2539 1168 1108 769 459 180 --22792 1134 --
NM_004232chr1843593 3034 2739 880 13784 1313 --
NM_004279chr73741 362 323 11492 ----
NM_004293chr963189 2446 1221 1105 905 114 ------
NM_004296chr1492933 2681 2590 1600 1380 780 501 432 297 --12535 12525
NM_004311chr1092914 2016 1217 908 673 566 413 154 94 ------
NM_004319chr1103123 2791 2234 1197 1180 1036 884 746 182 58 22651 803 21130 281 --
NM_004338chr18116219 6092 5809 5462 4775 4692 2042 2019 1216 974 196 1708 15820 12670
NM_004380chr1672406 2125 2092 1936 1802 583 68 --12117 --
NM_004386chr1951953 1845 1704 814 356 ------
NM_004397chr1141667 1258 711 414 12908 23860 479 --
NM_004404chr242043 1734 466 385 --1113 --
NM_004458chrX12089 ----12050
NM_004464chr494172 4008 3979 3761 2964 1406 1089 1011 30 33853 3580 2829 11683 --
NM_004499chr5------1510
NM_004500chr1451529 1381 1330 342 125 ------
NM_004504chr242436 2140 788 267 ------
NM_004580chr1561898 1873 1680 1650 145 118 1270 ----
NM_004586chrX55384 4908 3633 3382 894 23574 1317 --24862 443
NM_004612chr923317 1406 13674 ----
NM_004619chr131804 1453 430 22110 1992 ----
NM_004660chrY52070 1528 664 625 467 ------
NM_004709chrX31294 467 455 --2443 421 --
NM_004711chr22103589 3503 3113 3008 2399 2322 681 293 248 36 --23593 3049 --
NM_004726chrX55579 5318 5109 3629 1364 ----1937
NM_004736chr141861 1770 1685 526 11438 ----
NM_004745chr8146736 6461 6244 5583 5519 5169 4824 4640 4564 2825 2423 2027 695 484 35796 1215 704 ----
NM_004774chr1772883 2772 2163 1986 1937 1092 162 ------
NM_004815chr164914 4364 3906 3434 1375 883 34251 3336 972 ----
NM_004841chr141128 866 849 421 --21087 960 --
NM_004845chrX84170 4139 3842 3745 3255 998 613 389 --11665 --
NM_004859chr1752927 2388 2199 2125 709 --1715 --
NM_004862chr1651074 626 473 297 59 ----1277
NM_004863chr1485221 4636 4560 4032 1446 329 273 96 13570 1454 24379 504
NM_004866chr554615 4376 4205 4180 258 33389 1822 770 21583 1541 --
NM_004871chr17114160 3295 2709 1329 1234 1184 1135 1094 857 817 516 24366 375 2863 823 --
NM_004898chr442778 2552 2310 684 12815 12154 --
NM_004904chr754853 2400 1733 1564 1432 1801 12456 25385 4545
NM_004929chr821345 123 21163 1033 --1477
NM_004932chr551446 1331 1323 209 70 1626 --11400
NM_004937chr1762071 1941 1774 759 748 235 ----1159
NM_004947chr361859 1831 947 833 726 463 --1557 --
NM_004948chr1841207 1112 1061 235 ------
NM_004956chr753217 1659 1555 1422 410 1989 11646 --
NM_004976chr1195105 4817 4593 4561 4468 4419 3957 3290 1389 14101 13349 --
NM_004985chr1264096 1778 1721 1069 507 353 --11578 --
NM_004992chrX187891 7749 7487 6623 6482 6179 6003 5385 5339 5185 3409 2895 2689 1984 1299 1279 1253 745 12707 ----
NM_004992chrX187891 7749 7487 6623 6482 6179 6003 5385 5339 5185 3409 2895 2689 1984 1299 1279 1253 745 12707 ----
NM_004999chr6104411 4243 4106 4080 2824 1604 639 298 272 79 34325 3779 1427 ----
NM_005023chr511214 ----1986
NM_005032chrX----1403 1104
NM_005056chr1274287 3970 1619 1578 1143 911 325 14578 ----
NM_005063chr1031484 972 117 11033 11369 --
NM_005095chr132170 1666 61 12163 11767 --
NM_005121chr1753186 2933 2723 2634 2400 ----12405
NM_005135chr1561443 1192 1039 1022 677 172 21223 621 ----
NM_005147chr1631159 1021 888 --11000 --
NM_005188chr1187515 6841 3124 3107 2614 1807 1447 636 35479 2432 2251 55641 5563 2388 2149 496 --
NM_005197chr14106074 5682 5630 5585 5466 5158 4892 2374 1213 452 14033 13871 12243
NM_005222chr73869 828 198 ------
NM_005233chr332294 2128 60 --1793 --
NM_005235chr297791 7608 6915 6129 6057 2024 1601 1258 866 37145 1547 1469 52536 2532 1944 1940 1936 26066 1949
NM_005238chr1173593 3034 2874 2683 2443 838 319 12941 ----
NM_005249chr14--1270 --1612
NM_005259chr241197 623 522 430 11503 --1183
NM_005264chr10--1649 --2209 121
NM_005277chr4----1219 269 61
NM_005339chr413422 12822 --1374
NM_005342chrX62818 2701 2005 1051 603 546 ------
NM_005359chr1855950 4058 2586 1747 835 1550 24325 2321 --
NM_005373chr131518 1488 112 --11458 --
NM_005398chr1041443 1402 1127 518 ------
NM_005400chr231955 970 442 2892 807 13002 --
NM_005431chr742136 1980 1531 1358 ----11694
NM_005436chr1083748 3714 3655 2621 2552 1417 601 238 141 21126 132 --
NM_005440chr1792992 2768 2561 2151 1046 1021 875 749 372 1427 --12997
NM_005477chr1552082 2019 1898 917 803 --12023 --
NM_005477chr1552082 2019 1898 917 803 --12023 --
NM_005497chr1755426 2422 1249 1240 636 --21946 931 --
NM_005504chr1286497 6346 5720 5200 4344 2515 1233 436 26470 5352 ----
NM_005542chr751935 1899 1883 571 295 2765 441 ----
NM_005578chr394954 4836 4049 3973 3869 1839 454 412 256 1925 24522 262 --
NM_005599chr11344 ----11430
NM_005607chr82781 130 --1942 --
NM_005637chr1821348 94 1815 1100 --
NM_005638chrX2652 271 --1208 11411
NM_005665chr154825 4782 4767 3877 317 33667 1214 1131 ----
NM_005668chr553030 1060 760 396 96 13522 ----
NM_005730chr1273363 3320 2571 2370 1130 575 29 ------
NM_005737chr252891 2249 2179 2045 533 ------
NM_005748chr1253373 2317 904 651 96 ------
NM_005795chr262318 2149 1158 657 469 164 ------
NM_005813chr23857 829 386 22515 2415 ----
NM_005819chr132796 164 99 ----1423
NM_005840chrX77617 7596 6299 5492 1587 1384 193 17603 --11392
NM_005866chr96872 671 654 239 140 61 1155 ----
NM_005868chr71934 11663 12533 12197
NM_005880chr1621381 598 11578 11502 --
NM_005901chr1896839 6216 5718 5499 3321 2375 1608 1217 745 11743 17724 193
NM_005902chr1544176 3267 1521 957 --24325 4042 14330
NM_005907chr641645 1207 209 32 ------
NM_005909chr544168 3011 1019 91 --34174 2836 764 --
NM_005933chr1172231 2150 1924 1055 706 512 362 ----150
NM_005935chr464558 2115 2018 1543 519 405 11635 ----
NM_005941chr863569 3390 2996 2697 705 239 --11522 --
NM_005955chr154083 3979 1303 1042 161 ------
NM_005962chr1072147 1733 1707 1678 762 712 317 ------
NM_005962chr1072147 1733 1707 1678 762 712 317 ------
NM_005964chr1751347 1256 995 608 241 ------
NM_005966chr261995 940 611 289 229 97 ------
NM_006007chr943730 3451 1344 1002 22720 572 ----
NM_006011chr15124273 4024 4018 3922 3523 2898 2854 1588 1104 1023 274 202 --33799 2741 481 --
NM_006033chr1831939 926 537 11799 11481 152
NM_006036chr23783 484 380 1597 11018 1136
NM_006054chr1161457 1377 1371 1303 602 145 --1376 --
NM_006055chr242158 1131 322 148 1190 ----
NM_006080chr742785 2139 2065 565 11864 1559 1332
NM_006095chr464283 3357 2845 412 192 138 13104 13390 --
NM_006135chr13484 389 294 --21425 1421 --
NM_006139chr262321 1960 1094 362 84 44 ------
NM_006155chr242043 1734 466 385 --1113 --
NM_006158chr831822 1815 278 21440 150 ----
NM_006180chr952088 1873 1402 224 171 ----22093 1601
NM_006195chr931206 482 49 1218 194 --
NM_006197chr832071 1691 557 123 1441 11558
NM_006203chr585347 5326 4081 4075 3697 3547 1401 1314 1192 14025 --
NM_006226chr231145 1066 31 ------
NM_006237chr1342059 2028 1671 152 --1719 --
NM_006252chr157173 5542 1765 315 84 26690 5229 ----
NM_006282chr2084338 3863 3097 1515 1427 1394 747 173 13819 ----
NM_006283chr854862 4545 4074 3598 75 ------
NM_006290chr631820 413 68 11769 1599 --
NM_006306chrX124817 4500 4370 3709 2035 1719 1501 1432 1372 547 527 241 ------
NM_006313chr1211570 11161 --1678
NM_006315chr444487 2922 1573 919 33482 3355 1714 11438 --
NM_006386chr2232173 1694 811 22274 331 1832 --
NM_006393chr1064269 4179 3328 1804 1524 1424 --13664 --
NM_006411chr65736 384 317 38 28 --1192 --
NM_006420chr2043339 2903 2139 820 12910 22322 2248 --
NM_006434chr1041287 601 364 52 ----12070
NM_006464chr264651 4283 3348 1726 1706 1650 11851 31773 1671 287 --
NM_006465chr1572191 1765 1605 902 888 796 719 --1155 --
NM_006504chr1052916 2528 2163 903 818 ----1896
NM_006517chrX52095 1858 1615 928 48 11734 22118 427 --
NM_006544chr1455812 5795 5294 380 235 25521 4864 12061 --
NM_006548chr331782 308 108 --2274 262 --
NM_006561chr1075668 4725 2448 1538 1245 264 219 12050 14295 --
NM_006575chr1421313 437 ----11399
NM_006599chr16138174 7984 7909 6980 6714 6263 6059 5500 2520 2509 2222 1611 1298 --12370 --
NM_006602chr204640 228 190 40 ------
NM_006620chr633197 840 809 --11933 --
NM_006624chr1021449 804 ----11455
NM_006646chr13--33059 2462 137 12089 --
NM_006650chr5113793 3760 3550 3346 1150 998 894 867 556 184 173 --41369 1006 1002 874 --
NM_006654chr1274715 4653 4139 3543 3334 3304 2907 11660 ----
NM_006682chr732865 923 851 1202 12203 --
NM_006699chr13889 554 23 1419 ----
NM_006766chr832482 2341 1874 22182 238 ----
NM_006775chr652141 2127 2076 1180 270 22822 1896 --1144
NM_006826chr231244 521 58 --199 --
NM_006827chr1462786 2313 1184 912 830 376 23221 2436 11120 1938
NM_006873chr252896 2687 2429 1403 368 ------
NM_006885chr1673561 3516 3501 2932 2812 1116 449 ------
NM_006888chr1453172 2717 1269 1070 831 13079 ----
NM_006922chr241602 862 790 327 12324 ----
NM_006924chr1734411 3689 153 --11260 --
NM_006930chr561952 1926 1891 1510 649 551 ------
NM_006940chr1231398 568 58 1272 1645 --
NM_006947chr421772 242 11348 11776 --
NM_006981chr952182 947 828 788 305 ----1772
NM_007011chr1566251 5948 2690 2032 296 80 35982 1782 1464 12221 --
NM_007013chr82217 162 --1335 --
NM_007023chr231093 260 145 1919 ----
NM_007034chr1----1198 1312
NM_007038chr2145192 4744 4474 444 25060 995 --15216
NM_007114chr352999 2666 2258 1311 237 --1683 --
NM_007124chr632013 1622 1616 21986 1278 --1163
NM_007175chr853674 3300 3008 2704 1101 ----11184
NM_007195chr1823089 2754 13253 ----
NM_007198chr841624 1385 1061 136 ------
NM_007203chr953761 3391 3150 2584 1584 23959 3059 ----
NM_007236chr1562048 677 406 282 259 219 --2286 223 --
NM_007249chr13179449 8285 7991 6395 6200 6148 6034 5914 5877 5706 3669 3481 3251 2602 1478 402 108 26915 467 12223 --
NM_007271chr621646 222 1327 21508 579 1653
NM_007276chr76792 699 451 410 354 166 11075 ----
NM_007292chr1754881 4219 1792 1461 1316 --23958 217 --
NM_007325chrX21482 330 ----1441
NM_007332chr831580 1354 151 11485 11158 --
NM_007350chr1244544 3460 3083 774 11700 11625 --
NM_007365chr141979 887 793 186 --11603 11623
NM_007375chr142787 2439 2318 992 2982 637 ----
NM_012072chr20104571 4428 3553 3421 3243 2892 1431 933 67 44 1800 --1359
NM_012073chr541236 986 185 71 ------
NM_012081chr532592 1473 1148 12827 --12583
NM_012095chr10103432 3394 3107 2246 875 684 590 415 344 265 --12222 --
NM_012096chr353260 3020 2409 1045 366 1219 ----
NM_012102chr182218 2167 2126 2069 1621 762 257 151 11064 22133 1674 12288
NM_012104chr1163160 2995 2894 1433 705 307 11123 ----
NM_012104chr1163160 2995 2894 1433 705 307 11123 ----
NM_012129chr742397 1976 964 613 ----12225
NM_012137chr142830 2646 2034 1791 1154 ----
NM_012141chr1343434 3331 3130 81 12791 11215 --
NM_012156chr2093177 3042 3036 2996 2910 2831 2730 2546 2160 ------
NM_012193chr1184895 4835 3697 3420 2094 999 942 658 11459 ----
NM_012199chr173471 2875 1558 1434 944 687 231 14165 ----
NM_012214chr276246 5203 4938 4287 4267 1735 1342 35577 2034 821 16080 --
NM_012218chr19123102 3062 2945 2688 2492 2387 1081 1010 790 482 163 112 --2766 118 --
NM_012223chr21349 2949 481 1905 --
NM_012229chr1061450 1269 1159 1100 524 298 ------
NM_012234chr353117 2542 2431 1235 402 1826 21042 948 --
NM_012252chr744149 795 672 393 34752 3282 1282 --13412
NM_012287chr374037 3989 3153 1388 1191 1040 267 --1137 --
NM_012288chr685181 5042 2250 1909 1468 588 520 194 1912 24749 901 --
NM_012294chr743007 1499 571 125 --11392 --
NM_012296chr1193436 3408 3357 3325 3302 3237 1516 1480 58 11189 33155 2895 92 --
NM_012297chr452510 2472 2435 2381 1683 --22242 2166 --
NM_012300chr521950 698 --11885 1492
NM_012301chr742029 1506 1408 582 32236 2020 348 11700 --
NM_012306chr12103053 2667 2171 952 783 543 448 421 219 24 --11197 --
NM_012309chr1173972 3159 1570 976 623 603 391 --1885 14184
NM_012316chr175036 4887 4720 3746 3714 1938 189 15589 ----
NM_012334chr554614 3694 3680 3520 839 ------
NM_012382chr564406 4244 4164 3710 2900 480 --24391 3366 --
NM_012465chr1082287 1242 781 694 635 299 275 228 1894 12422 --
NM_012471chrX61728 1644 464 373 226 135 11226 1477 --
NM_013230chrY41717 1618 709 40 1260 ----
NM_013231chr1443696 3480 1639 1258 1837 23484 2969 --
NM_013233chr231402 953 925 --1381 --
NM_013243chr1541017 497 324 305 ------
NM_013255chr7158661 8506 8056 7893 6940 6430 6140 6050 3558 3543 2881 2335 880 801 187 38693 3488 2663 11700 --
NM_013257chr832306 872 322 22152 1649 ----
NM_013261chr463162 2944 2354 1361 873 226 13307 ----
NM_013411chr132238 783 486 31993 1870 765 12730 --
NM_013433chr1961495 754 549 212 146 72 --41424 171 167 163 11454
NM_013434chr261981 1624 1304 692 402 58 11261 1165 --
NM_013434chr261981 1624 1304 692 402 58 11261 1165 --
NM_013437chr851144 1136 326 260 47 ------
NM_013449chr1242896 2126 724 706 1596 11094 --
NM_013995chrX32263 997 300 --11759 --
NM_014011chr211899 12050 --11785
NM_014048chr16104837 4740 4428 4211 4109 3518 2034 1038 949 249 1845 15059 --
NM_014106chr1542337 1853 347 311 --1633 --
NM_014112chr834580 3399 255 25493 117 23972 1206 --
NM_014231chr1291945 1791 1578 693 593 129 102 95 44 --2788 38 --
NM_014253chrX52312 2180 509 359 311 1123 ----
NM_014299chr1972236 2163 1822 1461 829 396 335 ------
NM_014309chr2255080 4951 3366 1457 1262 --11239 13964
NM_014323chr224767 405 158 34 ----1677
NM_014333chr1162739 2726 2257 2089 1993 564 --1996 --
NM_014368chr97795 534 448 410 123 116 107 ------
NM_014372chr151753 1609 1411 1326 691 11597 ----
NM_014376chr572562 2095 740 620 570 312 304 ----12008
NM_014388chr1175997 5950 5875 5834 5758 5650 5386 5201 4872 4792 4382 1876 1409 1300 1024 685 204 --11171 --
NM_014408chr13216 191 132 ----1141
NM_014411chr772011 1812 1780 1749 1488 673 419 ------
NM_014415chr311628 ----11174
NM_014423chr554742 4564 3880 1663 1494 35225 4833 4083 11681 --
NM_014445chr331677 606 28 32236 2169 545 ----
NM_014491chr71423 ----11063
NM_014554chr1262245 2197 634 594 276 144 ------
NM_014572chr1341526 486 360 284 --1701 --
NM_014600chr241620 1585 1320 1164 11233 --1464
NM_014615chr1642764 2733 2339 201 13639 13353 12512
NM_014635chr231463 128 110 ------
NM_014636chr973906 3579 3335 1529 1225 848 150 24016 2761 13319 --
NM_014667chr352434 2381 2021 1915 1733 ------
NM_014670chr231388 636 415 --11233 --
NM_014690chr7102882 2861 2449 2178 2113 878 838 549 471 167 ------
NM_014701chr1523250 617 22915 928 --11359
NM_014702chr652273 1397 1144 482 202 1568 ----
NM_014707chr721859 396 ----11646
NM_014729chr82536 422 11437 1238 11487
NM_014730chr12115208 5054 4891 4676 4599 4546 2032 1504 826 380 173 21423 662 --11335
NM_014730chr12115208 5054 4891 4676 4599 4546 2032 1504 826 380 173 21423 662 --11335
NM_014739chr653450 3313 2976 2935 888 13851 ----
NM_014743chr452621 2478 2283 438 174 12932 1515 --
NM_014747chr185187 4762 3887 3729 1267 1046 521 134 --11711 --
NM_014755chr243235 2902 1440 1250 31166 1148 172 ----
NM_014765chr142544 2529 2113 2107 ------
NM_014766chr743318 3208 1309 1202 --13786 --
NM_014800chr73813 298 92 1939 --1861
NM_014810chr163557 2622 1091 883 828 818 --22770 192 1622
NM_014850chr394897 4827 4076 3987 3935 3476 1922 436 172 14341 1792 --
NM_014859chr1721005 73 ----21209 305
NM_014873chr144316 864 367 286 ----14114
NM_014877chr1776124 4760 2576 2493 2065 1205 79 17503 1606 37437 1454 1224
NM_014888chr721467 102 --11209 --
NM_014904chr1063718 3444 3196 3013 1179 635 --12902 --
NM_014906chr1764087 3296 2885 1311 302 264 --13086 --
NM_014924chr1463075 2508 1973 1947 971 663 --22244 772 --
NM_014932chr331336 682 234 21977 241 ----
NM_014935chr1113282 2876 2718 1248 1240 1066 928 490 484 283 69 ------
NM_014953chr132468 228 1698 13713 --
NM_014962chr2052288 2139 1806 1156 247 ------
NM_014982chr1455243 3667 1815 1436 188 24825 1081 ----
NM_014988chr452161 1985 1880 1140 1027 --12030 12685
NM_014991chr472669 2642 2566 2547 2008 1143 340 --22752 2650 --
NM_015000chr123697 457 300 13117 ----
NM_015020chr1643748 1295 957 208 --13453 13362
NM_015035chr2086366 5734 4735 4271 2170 1622 718 328 ------
NM_015039chr194006 3992 2878 1636 941 356 317 84 40 13801 ----
NM_015040chr231180 977 361 --23074 3024 --
NM_015042chr15104266 3539 3106 2834 2744 1725 1478 1070 1063 109 11267 13872 --
NM_015064chr1262490 1009 530 475 294 45 ------
NM_015068chr733623 3220 3147 13340 11057 1343
NM_015071chr5125834 5732 5359 5242 4653 4576 4494 1234 1092 1057 572 42 --21085 697 --
NM_015074chr184675 3634 3142 1950 1900 1683 1633 161 --1603 --
NM_015086chr1281321 1309 1207 1053 612 124 62 37 ------
NM_015090chr1135939 5924 5876 5596 5461 4914 4805 4754 4607 4403 1868 1554 1133 13897 14786 --
NM_015092chr1664039 1596 706 461 355 46 3982 901 75 ----
NM_015094chr2293833 3771 2986 1854 1522 1515 1501 1334 224 1560 24644 3837 --
NM_015097chr32666 165 12036 ----
NM_015100chr151705 1604 809 712 229 --1822 --
NM_015113chr1761912 1682 1607 771 524 72 163 ----
NM_015153chr63675 178 95 ------
NM_015155chr1033319 2288 2264 ----11274
NM_015156chr1473892 3565 2853 2796 767 151 82 13145 11399 --
NM_015192chr2062361 2124 1863 667 500 89 ------
NM_015199chr342737 2544 2440 2034 12370 12135 --
NM_015206chr1573124 2796 2702 2458 2384 1545 829 11282 12706 --
NM_015225chr952570 2493 2293 824 118 ------
NM_015231chr113792 655 289 1120 ----
NM_015247chr1695127 5104 4772 1831 1768 1555 1028 714 85 ------
NM_015251chr1632031 1838 36 11457 ----
NM_015271chr444035 2820 1288 1243 22852 168 12986 --
NM_015272chr1641624 1510 1452 535 21650 1329 ----
NM_015285chr1862306 2261 769 375 227 181 149 1117 --
NM_015305chr1451599 635 601 280 79 --11730 --
NM_015313chr1184796 4635 4213 3803 3414 1792 1554 211 24574 3883 ----
NM_015315chr5103410 2673 2330 2213 1329 1237 1217 1064 750 579 --12826 --
NM_015328chr753000 2707 1931 1130 1084 ------
NM_015336chr1262464 2286 2212 2136 2089 1070 1422 1780 --
NM_015339chr20154 11033 --1959
NM_015347chr1262662 2303 2290 1111 1032 568 12414 ----
NM_015361chr2151 1655 --1246
NM_015365chrX23408 1341 1658 --11138
NM_015385chr1041287 601 364 52 ----12070
NM_015387chr231422 317 85 ------
NM_015393chr473802 3542 3442 1418 933 191 58 11305 12820 --
NM_015458chr895161 4581 4214 4180 3988 3664 1711 1333 818 1302 24781 1892 --
NM_015475chr21727 1148 --1732
NM_015550chr743473 2974 1157 1053 --23556 2586 12464
NM_015553chr665003 4388 1923 1221 840 195 34440 1628 620 --1127
NM_015564chr543318 3278 1203 397 --12999 --
NM_015575chr252350 1109 1094 301 25 1503 ----
NM_015576chr342548 965 924 798 1786 ----
NM_015602chr131347 1180 496 1156 11414 --
NM_015640chr131948 999 112 15372 1121 --
NM_015686chrX62375 2080 1872 1794 1711 209 --22201 258 --
NM_015691chrX42531 1048 546 33 12795 32650 2630 1978 --
NM_015726chr14652 556 511 84 ----11345
NM_015879chr18157271 6254 5533 5308 3216 2346 2316 1954 1558 1392 1342 1063 881 491 479 --36240 2121 719 --
NM_015892chr1032107 519 208 --12132 12268
NM_015906chr134346 3372 1113 --23554 3382 13318
NM_015999chr14470 242 222 183 1740 ----
NM_016018chr842173 1808 111 61 ----1802
NM_016021chr642139 1999 477 158 ------
NM_016025chr1651934 1311 1250 723 108 ----1389
NM_016057chr126806 527 399 130 68 28 1481 ----
NM_016061chr251579 1539 585 549 22 --11589 1185
NM_016075chr1323000 2631 13107 --13192
NM_016076chr183128 2818 2779 1981 901 651 219 23 12246 1665 --
NM_016083chr631273 720 184 11364 --11257
NM_016089chr341692 642 138 54 --11842 --
NM_016096chr842128 2107 1864 222 --11695 --
NM_016107chr531164 553 64 ------
NM_016131chr212323 1586 130 2924 122
NM_016206chr3188579 8337 8258 8132 8037 7899 7215 7099 3593 2590 2221 2212 2153 2146 1781 1127 1000 395 --181 1888
NM_016235chr1621195 320 ----11251
NM_016248chr1333566 3322 630 1318 ----
NM_016257chr183083 2885 2752 2397 2156 493 443 402 ------
NM_016271chr1841920 1872 1824 44 31900 1852 1804 ----
NM_016272chr2262449 2438 1866 1807 711 490 --11961 1510
NM_016277chr631568 1553 1143 11006 159 --
NM_016320chr117811 325 315 235 222 110 88 --3847 445 38 --
NM_016322chr942931 937 568 387 13000 ----
NM_016376chr1751722 1333 358 347 284 --13122 --
NM_016401chr11------2224 68
NM_016418chr2253370 2398 1026 490 461 1350 33712 3278 143 --
NM_016436chr2032425 2046 1948 --12498 --
NM_016485chr641858 1576 1400 156 ------
NM_016507chr1762402 2345 2337 1091 643 564 --253 41 12640
NM_016531chr473299 3030 2809 1640 902 885 379 1141 ----
NM_016577chr3134439 4391 3998 3911 3473 3345 3334 2761 1540 1276 959 506 443 --1420 --
NM_016587chr76792 699 451 410 354 166 11075 ----
NM_016598chr361107 925 540 322 192 57 --163 --
NM_016929chr684292 3724 3689 1272 427 421 176 22 13950 33932 682 391 --
NM_016946chr132626 500 169 23653 2743 ----
NM_017415chr544567 4213 3494 3099 --12783 --
NM_017447chr2144049 3811 3708 450 ------
NM_017580chr101498 ----1462
NM_017594chr962778 2621 2397 2274 974 347 --12800 --
NM_017596chr1104324 4126 3458 3224 2876 951 748 441 344 185 ------
NM_017602chrX5925 354 250 235 27 ------
NM_017610chr1561833 1646 1400 544 392 42 ------
NM_017612chr121529 ----1118
NM_017628chr475236 4789 3279 1722 1188 1130 1110 13697 23942 922 --
NM_017633chr623521 237 23920 1212 ----
NM_017637chr978183 8000 6489 6211 3421 2063 612 13529 17861 --
NM_017644chr354401 3630 1859 1256 492 14247 ----
NM_017650chr744140 1598 1402 1129 35957 5428 1771 ----
NM_017651chr61591 --21489 648 11244
NM_017658chr1454183 3922 1474 838 57 11084 ----
NM_017672chr15--11107 --1385
NM_017680chr93927 265 209 11025 ----
NM_017709chr133524 654 578 23487 2975 23977 245 --
NM_017737chr12585 404 ----1867
NM_017758chr1761022 997 986 607 298 37 11046 21169 509 --
NM_017778chr821452 21 11392 11224 --
NM_017779chr142462 2210 875 601 22516 695 1240 --
NM_017813chr895454 5196 4867 3560 2244 1436 717 485 104 11649 ----
NM_017847chr14766 224 81 30 ------
NM_017848chrX73762 3349 2994 1881 1216 758 140 ------
NM_017893chr1061238 1090 559 477 315 280 --1329 --
NM_017902chr10114792 4614 2234 1781 1489 1483 1250 1068 884 257 41 --147 15132
NM_017919chr9155217 5161 5083 4966 4950 4898 4851 4483 4403 3785 2096 2082 1258 848 40 15579 23531 1957 --
NM_017944chr1163147 2831 2303 972 817 725 ----11246
NM_017952chr294298 3942 3692 3344 3201 1599 1162 1020 1009 12876 21377 195 --
NM_017954chr741650 1627 640 84 1616 ----
NM_017988chr123701 626 375 ------
NM_018003chr1562240 2127 2074 1807 1643 293 ------
NM_018027chr1022946 142 1420 52983 2256 1208 956 45 --
NM_018045chr152664 2276 2201 1964 592 1456 11239 --
NM_018084chr233305 711 386 23218 2554 ----
NM_018121chr1032750 1029 709 1607 ----
NM_018155chr322691 323 ----1355
NM_018157chr1293128 2140 1280 1189 898 796 725 505 185 ------
NM_018182chr1792210 2200 2178 2143 1921 1706 791 540 294 --22184 1426 --
NM_018184chr342198 1869 322 293 --11559 --
NM_018211chr141859 1789 873 585 2577 77 22044 1467 --
NM_018214chr651317 1028 958 165 113 ------
NM_018243chr453560 3163 2971 1091 32 ------
NM_018247chr64886 545 536 512 12365 13107 --
NM_018299chr822736 66 ----1402
NM_018351chr12114236 3951 3795 3594 3554 3526 1837 1593 1550 1383 1212 14105 14088 13691
NM_018364chr143595 1059 688 681 ------
NM_018371chr841384 1235 1192 978 11493 ----
NM_018373chr1476329 5660 5042 4359 2029 1775 1559 25333 973 ----
NM_018375chr1451882 675 603 465 415 --142 --
NM_018409chr462979 2943 1141 965 269 106 ------
NM_018424chr941648 1622 1519 454 21859 558 127 --
NM_018439chr182951 559 2594 245 12485 --
NM_018440chr8108562 7967 7886 7284 6416 2937 1910 1779 927 474 18483 37978 7971 376 --
NM_018469chr1741296 176 148 68 11117 ----
NM_018482chr851892 1011 1002 240 230 ------
NM_018557chr2----11206 11070
NM_018566chr13688 113 44 --14662 --
NM_018638chr1255496 3674 2216 561 194 --1963 --
NM_018644chr1131627 1562 52 --21506 211 --
NM_018667chr1672746 1110 846 803 343 232 51 22411 618 ----
NM_018704chr161997 1882 1574 1392 766 111 149 22001 1906 1747
NM_018717chr43821 806 78 22739 2368 1707 1960
NM_018834chr51786 ----1363
NM_018841chr123940 1184 ----11208
NM_018912chr531157 588 319 --21429 342 1226
NM_018913chr531157 588 319 --21429 342 1226
NM_018914chr531157 588 319 --21429 342 1226
NM_018915chr531157 588 319 --21429 342 1226
NM_018916chr531157 588 319 --21429 342 1226
NM_018917chr531157 588 319 --21429 342 1226
NM_018918chr531157 588 319 --21429 342 1226
NM_018919chr531157 588 319 --21429 342 1226
NM_018920chr531157 588 319 --21429 342 1226
NM_018921chr531157 588 319 --21429 342 1226
NM_018922chr531157 588 319 --21429 342 1226
NM_018923chr531157 588 319 --21429 342 1226
NM_018924chr531157 588 319 --21429 342 1226
NM_018925chr531157 588 319 --21429 342 1226
NM_018926chr531157 588 319 --21429 342 1226
NM_018927chr531157 588 319 --21429 342 1226
NM_018928chr531157 588 319 --21429 342 1226
NM_018929chr531157 588 319 --21429 342 1226
NM_018947chr794823 4718 4449 4240 4104 3771 1744 298 66 --21998 728 --
NM_018970chr743182 2924 1176 644 1913 ----
NM_018976chr1241883 802 258 33 --11810 --
NM_018979chr1222326 341 11062 --12636
NM_018999chr1054423 1861 992 476 40 1519 1359 13841
NM_019001chr354455 4057 4050 1867 1663 34430 2962 656 143 --
NM_019008chr2242660 2491 1097 601 --32849 1455 626 --
NM_019041chr672546 2533 1782 622 504 438 55 12381 ----
NM_019072chr533542 3417 1008 14109 --12709
NM_019080chr1321276 1254 11458 ----
NM_019084chr1042095 1933 1927 386 ------
NM_019098chr831858 1669 196 1490 ----
NM_019106chr2252537 2518 2467 2298 2244 12384 23253 2570 --
NM_019593chr2033183 535 480 ----12773
NM_019596chr2152849 1850 983 746 535 --32781 2021 159 11190
NM_020122chr255189 4806 2215 2152 1428 31535 273 129 12085 --
NM_020130chr841300 1213 353 264 245 31 ----
NM_020132chr21125125 4891 4730 3703 1926 1818 1806 1100 841 559 459 45 15097 11958 --
NM_020133chr6136141 5653 5631 5619 5233 5188 4903 4781 4578 2592 1967 506 350 34816 4763 2221 54772 4227 4173 4009 1895 36157 2162 23
NM_020148chr1883043 2632 2450 1934 1919 1913 935 434 ------
NM_020177chr543366 2384 1090 88 1228 ----
NM_020193chr1131343 917 882 ----1363
NM_020226chr42125 79 1186 --1560
NM_020228chr1172509 2475 2231 2082 905 783 136 1565 ----
NM_020239chr171863 1437 916 726 697 42 28 --11888 --
NM_020245chr664920 3730 3556 3185 1045 826 15001 --11808
NM_020338chr10103062 2851 2829 2732 2557 2364 1414 695 382 23 --12977 --
NM_020346chr112324 207 --1670 1200
NM_020384chrX91775 1712 1554 1300 597 586 523 338 281 11278 ----
NM_020416chr472131 2045 1074 905 820 300 48 ------
NM_020429chr762928 2785 2150 2034 415 55 11892 --1234
NM_020455chr662529 2052 1807 584 73 23 1432 12542 --
NM_020456chr132689 393 --12044 --
NM_020466chr654006 1723 1609 1414 613 --1916 --
NM_020473chrX31328 798 627 2693 134 --1646
NM_020647chr85788 683 517 430 334 --1304 --
NM_020673chr20127331 7238 6830 6269 5501 2260 1935 1916 1559 1134 620 538 35565 2873 1405 24769 2730 --
NM_020699chr1125309 4860 4748 4239 4206 3904 3765 3433 3420 982 484 28 --11004 --
NM_020708chr2042111 1553 734 355 1665 --12160
NM_020717chrX144933 4766 4163 4142 3913 3795 3631 3617 3559 3232 1874 1525 1233 464 11666 23553 3457 --
NM_020718chr1655591 5102 4789 2098 1238 16005 25976 527 --
NM_020734chr1263136 3031 2466 2271 2249 733 1369 ----
NM_020749chr831534 792 598 --11826 1194
NM_020774chr1856049 5690 5025 4742 1885 22464 1156 ----
NM_020792chr352815 2775 2127 1889 98 ------
NM_020796chr552919 2668 1154 754 318 ------
NM_020809chr1162328 2311 1977 1924 1677 683 11650 1406 --
NM_020810chr1483214 1317 1062 747 727 710 555 21 ------
NM_020830chr252917 2501 2423 1053 22 ------
NM_020834chr1431687 759 427 ----11460
NM_020841chr1222536 180 --13815 --
NM_020850chr1672842 2836 2614 2135 2044 1085 1025 ----1394
NM_020899chr1771604 1022 530 452 377 258 175 ------
NM_020909chr263897 1460 1219 1137 587 41 --1386 1163
NM_020921chr1443588 3514 2700 2252 --11461 --
NM_020935chr243989 3944 1648 197 --21869 425 --
NM_020948chr183488 3454 2732 2718 1365 899 882 275 11461 23492 3018 --
NM_020964chr1884300 3665 3054 3044 1122 1078 810 239 --23153 628 --
NM_021038chr373159 2685 2224 1348 773 339 135 21127 298 ----
NM_021097chr2103059 2577 2568 2498 993 863 832 803 217 171 ----2895 418
NM_021120chrX72982 2564 2232 683 238 218 212 ------
NM_021183chrX82340 1651 922 853 719 470 235 147 ------
NM_021255chr1473597 3591 3448 1450 1216 1015 650 ------
NM_021629chr384809 4743 4251 3457 3297 1991 1825 913 24816 3565 --14800
NM_021633chr151089 1032 881 506 383 --121 11230
NM_021647chr484733 4029 3292 3159 2959 1728 884 105 11216 ----
NM_021648chr63950 181 88 --21907 571 --
NM_021813chr674946 4481 3565 1508 1033 512 476 14499 34925 1295 42 15237
NM_021815chr262231 2086 1242 1080 654 201 ------
NM_021905chr672029 2017 1825 1815 1703 1464 294 --11966 --
NM_021911chr565445 3474 1815 1592 1345 131 11009 ----
NM_021912chr1553523 3247 1533 1185 392 31231 890 349 1942 11686
NM_021913chr193201 138 127 11357 ----
NM_021914chr1451542 976 435 358 21 ------
NM_021940chr63493 61 23 ----11154
NM_021949chrX72292 2168 2138 899 500 204 166 1581 148 1468
NM_021951chr92869 189 2328 291 ----
NM_021961chr1195933 5202 2917 2828 2787 2599 2138 1931 1347 35685 2664 1730 15610 15413
NM_021964chr356337 5051 2024 1685 1131 14757 26342 1760 --
NM_021967chr54987 250 83 51 ----1129
NM_021977chr653013 2594 1387 997 539 --73889 3235 2598 607 447 142 35 12368
NM_021988chr2031136 561 214 1308 --1131
NM_022048chr15125406 5130 4422 4349 4226 4057 1694 1131 1001 551 300 188 1112 25071 868 --
NM_022060chr1491314 1207 1167 1158 1062 872 447 430 317 --2464 255 --
NM_022130chr551379 364 243 230 22 ------
NM_022143chr7----1424 11441
NM_022166chr16225810 5175 5064 5033 5025 5006 4521 4511 4289 4265 2227 2176 2129 2078 1949 1772 1763 1700 1516 1404 1295 1011 25490 5348 25158 1119 12116
NM_022171chr361462 1439 1372 1160 486 337 --11043 --
NM_022336chr252257 1943 1465 672 660 ------
NM_022351chr863179 2852 2679 2604 1353 480 --23048 583 --
NM_022442chr2031136 561 214 1308 --1131
NM_022459chr1396292 5585 5074 3998 2119 2099 1766 1490 1209 11617 11087 --
NM_022495chr142155 52 1495 1106 --
NM_022650chr51898 ----1774
NM_022716chr172730 2590 1933 554 388 258 58 22662 686 12324 --
NM_022781chr932693 2130 672 --163 --
NM_022828chr531673 1113 140 ------
NM_022832chr442453 2411 2130 555 --1279 --
NM_022836chr121829 428 ----1549
NM_022894chr211282 --21530 239 --
NM_022898chr14104363 4080 3555 3548 3118 1833 1518 1113 888 324 ----11586
NM_022912chr232881 2819 40 22316 2291 12780 --
NM_022977chrX12089 ----12050
NM_022978chr54987 250 83 51 ----1129
NM_023016chr252449 2003 1164 668 326 ------
NM_023929chr851934 1715 983 665 322 --12592 --
NM_024052chr17112621 2547 2502 2419 2271 2068 2056 1945 968 319 307 ------
NM_024090chr461949 1356 749 584 242 213 ------
NM_024345chr995707 4838 4564 4498 2010 1650 1035 488 161 ----15582
NM_024494chr13644 619 23 --1550 --
NM_024511chr453378 2957 2785 830 164 ------
NM_024513chr343333 3277 1389 30 1808 ----
NM_024524chr353172 3158 2809 1202 223 12670 ----
NM_024529chr12339 144 21088 424 ----
NM_024659chr23902 779 148 ------
NM_024761chr974225 3450 3365 1301 1185 609 574 ----14101
NM_024770chr255270 4697 4168 1518 1395 34377 276 239 ----
NM_024812chr832145 1504 1442 2743 495 ----
NM_024817chr15125458 5376 4850 4158 4128 2353 1843 1406 761 751 365 316 15440 21434 718 --
NM_024854chr1251549 1437 1411 512 348 ------
NM_024939chr1661401 1215 1196 1160 417 153 ------
NM_024947chr3108750 8378 6785 6643 3741 3491 3257 2650 2358 2205 38449 7736 7019 ----
NM_024949chr454432 4043 3603 3082 527 13234 --11376
NM_024989chr257799 7251 5617 5484 561 --27804 5930 --
NM_024991chr1041287 601 364 52 ----12070
NM_025054chr853686 3368 1616 530 404 11272 --13501
NM_025057chr1441097 495 328 214 21268 974 ----
NM_025073chr163803 1564 1405 1124 496 209 ----21605 64
NM_025160chr184026 3787 3560 3511 3424 3314 331 263 ------
NM_025164chr1192051 1672 1630 838 823 522 476 244 144 ------
NM_025179chr1124656 3688 3646 3392 3217 1983 1301 1122 476 464 209 123 --23072 3027 1427
NM_025194chr1941293 1177 497 313 ----1908
NM_025235chr1042207 1386 512 224 ------
NM_025236chr64721 278 201 93 ----1271
NM_025250chr762832 2526 2434 2242 516 262 --1893 --
NM_030625chr1072528 2412 2082 2074 972 739 418 1809 ----
NM_030647chr766047 3837 2272 1747 682 23 21706 664 21448 1307 --
NM_030650chr264284 3559 2966 1490 326 266 33754 3132 3110 13654 --
NM_030674chr1294879 4577 1945 1936 1882 1648 1501 638 358 --21161 648 24559 280
NM_030780chr841452 1391 1323 596 --11415 --
NM_030791chr1451765 1477 581 220 164 ------
NM_030806chr1128652 7144 6542 6485 6406 6236 3467 3405 3263 2354 1011 441 23320 1597 33165 1590 790 15886
NM_030809chr1262232 2113 1745 829 712 32 ------
NM_030881chr2232173 1694 811 22274 331 1832 --
NM_030918chr1114985 4825 4571 4441 4293 4230 3822 1163 854 678 137 1596 11649 --
NM_031243chr732312 1979 1634 12234 ----
NM_031266chr5------1510
NM_031314chr1451529 1381 1330 342 125 ------
NM_031427chr1465850 5829 5525 4653 3912 1549 35517 2312 1924 21328 275 --
NM_031442chrX33202 2611 173 22453 501 --140
NM_031444chr2252541 2256 1667 127 40 ------
NM_031445chr273222 3156 2878 2631 2525 666 660 ------
NM_031468chr7197994 7955 7917 6369 6185 6009 5641 5548 2461 2184 2099 2062 1685 1323 985 897 697 493 394 --26611 333 --
NM_031845chr23752 646 116 --1319 --
NM_031847chr23752 646 116 --1319 --
NM_031892chrX2894 34 1740 --1166
NM_031954chr1252697 2607 1919 1009 856 --22472 812 --
NM_032012chr965126 4988 2037 1530 1372 904 --23484 1265 --
NM_032050chr224767 405 158 34 ----1677
NM_032052chr2241152 543 419 195 ----11062
NM_032088chr531157 588 319 --21429 342 1226
NM_032092chr531157 588 319 --21429 342 1226
NM_032116chr1365450 5308 5208 4743 2349 430 25420 1290 ----
NM_032189chr13104778 3987 3341 3304 1094 1065 970 954 461 219 1521 24164 289 --
NM_032208chr232499 1245 407 --42803 2360 2290 233 --
NM_032217chr42192 179 11355 11326 --
NM_032228chr1133474 105 29 ------
NM_032236chr1------21016 134
NM_032283chr131584 1353 130 --11448 179
NM_032289chr561596 1350 646 598 585 469 ------
NM_032291chr131899 1197 298 11788 ----
NM_032329chr243332 2911 1489 1018 14254 24178 3229 --
NM_032373chr1085228 5134 4166 4000 1235 207 191 156 35618 4991 4781 --1714
NM_032403chr531157 588 319 --21429 342 1226
NM_032434chr241018 478 393 377 ------
NM_032439chr102362 152 ----11281
NM_032449chr152459 1061 566 512 101 22781 2116 --12277
NM_032457chr431242 705 196 23840 838 --13418
NM_032482chr19------1256
NM_032491chr125528 453 442 276 72 ------
NM_032505chr322553 161 1894 2992 980 --
NM_032538chr682776 2377 2310 2104 1758 1035 664 254 1954 ----
NM_032741chr65736 384 317 38 28 --1192 --
NM_032804chr1042099 672 316 277 ----12482
NM_032826chr785276 4909 4141 3723 3691 3557 855 394 12101 3667 324 238 --
NM_032842chr731136 349 288 ------
NM_032866chr1573024 2665 2108 2033 2016 632 501 ------
NM_032871chr1141797 669 647 368 --1730 21878 1470
NM_032873chr1153814 3082 1509 1041 655 ------
NM_032876chr1411394 11459 --11575
NM_032900chr1063947 3782 3305 3083 2944 762 1833 --1254
NM_032932chr1795566 5276 5227 1519 1150 877 751 664 200 --25347 697 --
NM_032982chr762362 1667 955 831 423 403 1864 ----
NM_032983chr793176 2481 2340 2107 1237 1217 833 407 177 --1306 --
NM_033020chr134346 3372 1113 --23554 3382 13318
NM_033030chr241568 1147 1060 278 ------
NM_033129chr2072008 1979 565 527 399 230 217 --3647 620 473 --
NM_033133chr1763565 3185 1511 1189 941 497 22757 2685 1226 --
NM_033143chr494503 4339 4310 4092 3295 1737 1420 1342 361 34184 3911 3160 ----
NM_033181chr631273 720 184 11364 --11257
NM_033224chr7136628 6563 6281 6269 6082 2116 1997 1401 1337 452 338 75 42 --37766 7136 4926 1617
NM_033225chr833051 2864 970 22242 978 1729 --
NM_033274chr543561 2873 2210 1279 --33432 374 370 --
NM_033290chrX33304 3130 3043 22812 1059 ----
NM_033338chr1031040 870 539 ----11045
NM_033339chr1031040 870 539 ----11045
NM_033340chr1021156 986 ----11161
NM_033360chr1254217 1842 1190 628 474 --11699 --
NM_033429chr1562930 2525 1191 627 590 459 43269 2611 2582 2310 11006 --
NM_033505chr245834 5450 5288 2258 11507 14544 15650
NM_033551chr5103410 2673 2330 2213 1329 1237 1217 1064 750 579 --12826 --
NM_033631chr172508 1566 994 677 421 272 58 --11525 --
NM_033644chr521950 698 --11885 1492
NM_033645chr521950 698 --11885 1492
NM_033656chr2165774 2021 1270 1044 956 189 ----12133
NM_052834chr1862306 2261 769 375 227 181 149 1117 --
NM_052847chr1983657 3375 3353 2577 1190 1154 1127 87 ----13591
NM_052864chr431676 748 354 1615 --11364
NM_052879chr1243867 2882 469 119 ----12975
NM_052885chr1234813 4445 3978 24511 1584 13432 --
NM_052896chr162237 1773 611 490 350 107 --22215 171 --
NM_052898chr841822 1285 78 32 --11827 1584
NM_052900chr831652 582 301 --1480 --
NM_052910chr1341997 1821 370 364 --12107 --
NM_053023chr1162929 2717 2196 1296 559 168 ------
NM_053042chr462994 2959 2146 1244 519 417 1947 1337 --
NM_053056chr1182886 2824 2806 1106 1004 950 402 166 --2752 737 --
NM_053064chr1463062 1220 997 796 270 115 --1800 --
NM_053279chr882884 2608 2590 2533 2412 2068 927 289 --12594 --
NM_054025chr1131627 1562 52 --21506 211 --
NM_057178chr1752432 2073 938 803 354 12537 ----
NM_080491chr1193436 3408 3357 3325 3302 3237 1516 1480 58 11189 33155 2895 92 --
NM_080629chr131201 452 339 --1344 --
NM_080630chr131201 452 339 --1344 --
NM_080654chr114953 283 261 52 1856 ----
NM_080666chr1441153 528 425 238 ------
NM_080669chr1764302 3012 1979 1570 1489 432 --33793 281 166 --
NM_080676chr2042200 2067 1220 664 12760 12267 --
NM_080723chr641222 547 410 206 11166 11151 --
NM_080867chr1464585 3942 1924 1240 769 462 --23113 520 --
NM_080927chr382821 2165 1033 691 649 534 526 160 ------
NM_130391chr9103341 3312 3074 2751 2450 1173 906 804 309 48 12379 23322 3318 12725
NM_130392chr9103341 3312 3074 2751 2450 1173 906 804 309 48 12379 23322 3318 12725
NM_130393chr9103341 3312 3074 2751 2450 1173 906 804 309 48 12379 23322 3318 12725
NM_130435chr1052916 2528 2163 903 818 ----1896
NM_130438chr2141140 1001 780 33 22074 440 ----
NM_130439chr1072147 1733 1707 1678 762 712 317 ------
NM_130439chr1072147 1733 1707 1678 762 712 317 ------
NM_130442chr73813 298 92 1939 --1861
NM_133264chr1753959 3327 853 226 70 --1159 13948
NM_133265chrX53592 2383 1195 674 444 12530 13386 12240
NM_133334chr462169 2104 1852 1820 526 204 11057 14584 16297
NM_133445chr953778 1455 1295 1093 617 11164 43522 3433 2484 1037 13527
NM_133468chr752518 2367 1708 704 673 12106 1898 1963
NM_133476chr125931 337 228 153 111 ------
NM_133478chr252242 2031 1895 1031 619 21007 691 ----
NM_133496chr164477 3257 3139 1433 358 350 23610 613 1916 --
NM_133507chr121870 1705 1125 1160
NM_133647chr1561443 1192 1039 1022 677 172 21223 621 ----
NM_134268chr1761153 1131 1125 1113 1107 394 --1374 --
NM_138270chrX22363 856 22539 1212 12991 12575
NM_138328chr1793209 3084 2855 2568 1246 1083 1004 890 416 23144 1233 13000 --
NM_138426chr742347 1590 793 215 1680 ----
NM_138444chr1344987 4536 1090 108 ----24839 3141
NM_138468chr295865 5232 4483 4454 1441 1318 738 705 623 15428 36105 1818 1808 --
NM_138473chr1284777 4721 4627 1494 1299 489 458 172 ------
NM_138576chr14104363 4080 3555 3548 3118 1833 1518 1113 888 324 ----11586
NM_138638chr1451542 976 435 358 21 ------
NM_138713chr16138174 7984 7909 6980 6714 6263 6059 5500 2520 2509 2222 1611 1298 --12370 --
NM_138714chr16138174 7984 7909 6980 6714 6263 6059 5500 2520 2509 2222 1611 1298 --12370 --
NM_138731chr1472680 1714 1427 1319 1293 1272 610 2196 61 ----
NM_138959chr1156769 6635 6610 4916 2577 2207 2026 1506 1351 1238 712 425 330 242 146 --11396 --
NM_138971chr1163160 2995 2894 1433 705 307 11123 ----
NM_138971chr1163160 2995 2894 1433 705 307 11123 ----
NM_138972chr1163160 2995 2894 1433 705 307 11123 ----
NM_138972chr1163160 2995 2894 1433 705 307 11123 ----
NM_138973chr1163160 2995 2894 1433 705 307 11123 ----
NM_138973chr1163160 2995 2894 1433 705 307 11123 ----
NM_138995chr27848 517 443 284 228 167 44 --1390 --
NM_139057chr1562784 2241 1883 1106 1058 891 1719 1516 --
NM_139132chr117811 325 315 235 222 110 88 --3847 445 38 --
NM_139168chr541826 1317 329 150 ------
NM_139211chr42287 43 2591 441 ----
NM_139212chr42287 43 2591 441 ----
NM_139246chr942169 1987 769 512 12006 1429 --
NM_139276chr1762205 1507 1479 934 847 673 22288 474 ----
NM_139283chr1252108 1985 412 179 36 ------
NM_139319chr1221828 52 21374 515 1615 --
NM_139321chr20104019 3620 3575 3457 3115 2595 1114 738 557 58 1191 23462 176 23467 3270
NM_144567chr132486 560 475 1486 --12615
NM_144571chr446597 2026 1857 89 22020 271 25215 2508 --
NM_144578chr1495558 5059 3417 3357 1677 1663 1463 1234 103 13936 14293 --
NM_144582chr242347 802 717 138 22031 965 11782 --
NM_144590chr1062802 2463 2401 1939 828 680 12535 12566 --
NM_144599chr1584438 4317 3903 3396 1516 1316 1293 220 2487 474 21654 1326 --
NM_144778chr1342670 2198 827 73 22486 1920 1898 --
NM_144949chr211899 12050 --11785
NM_144973chr1254589 3395 2047 1895 962 --1455 1878
NM_145055chr1853695 2978 1455 429 50 1967 ----
NM_198560chr352719 2694 1489 1412 558 13825 --176
NM_198686chr1462638 1675 1009 884 591 427 --42530 2347 2232 340 1646
NM_198715chr155089 4081 1744 1197 232 25955 5273 ----
NM_198793chr383681 3096 2983 2937 2593 1171 1092 616 ------
NM_198794chr1421313 437 ----11399
NM_198859chr3124934 3798 1821 1766 1665 1558 884 845 711 698 515 283 13216 14061 --
NM_198889chr42192 179 11355 11326 --
NM_198900chr12126447 6423 6100 6024 5887 5491 4897 3002 2883 2454 1638 1399 26716 1312 --27062 6649
NM_198904chr531595 623 527 1251 11350 --
NM_199000chr731811 1616 146 12236 22012 556 --
NM_199144chr2031136 561 214 1308 --1131
NM_199160chr97736 475 389 351 64 57 48 ------
NM_199188chr1243867 2882 469 119 ----12975
NM_199189chr51786 ----1363
NM_199190chr1243867 2882 469 119 ----12975
NM_199203chr2031136 561 214 1308 --1131
NM_199245chr1282351 2197 1984 999 535 508 501 450 --1444 --
NM_199421chr1464585 3942 1924 1240 769 462 --23113 520 --
NM_199437chr1172509 2475 2231 2082 905 783 136 1565 ----
NM_199438chr1172509 2475 2231 2082 905 783 136 1565 ----
NM_199439chr1172509 2475 2231 2082 905 783 136 1565 ----
NM_199482chr231422 317 85 ------
NM_201266chr262661 2450 794 647 524 482 --22930 511 --
NM_201279chr262661 2450 794 647 524 482 --22930 511 --
NM_201428chr1161457 1377 1371 1303 602 145 --1376 --
NM_201429chr1161457 1377 1371 1303 602 145 --1376 --
NM_201430chr1171383 1303 1297 1229 614 528 71 --1302 --
NM_201439chr122420 327 1149 ----
NM_201440chr122420 327 1149 ----
NM_201515chr122420 327 1149 ----
NM_201559chr684713 3922 3699 3028 517 465 334 304 --1676 --
NM_201568chr172081 2015 1975 1900 1587 1494 206 --1866 --
NM_201569chr172081 2015 1975 1900 1587 1494 206 --1866 --
NM_201570chr1041449 744 709 430 1335 ----
NM_201571chr1041449 744 709 430 1335 ----
NM_201572chr1041449 744 709 430 1335 ----
NM_201590chr1041449 744 709 430 1335 ----
NM_201591chr4----1219 269 61
NM_201592chr4----1219 269 61
NM_201593chr1041449 744 709 430 1335 ----
NM_201596chr1041449 744 709 430 1335 ----
NM_201597chr1041449 744 709 430 1335 ----
NM_201632chr561172 587 578 486 471 46 1433 1612 --
NM_201634chr561271 686 677 585 570 145 1532 1711 --
NM_203301chr1441485 696 419 383 ------
NM_203365chr22519 182 ----1388
NM_203382chr541430 1169 1046 254 ----11603
NM_203394chr1242126 2080 113 77 11101 ----
NM_203453chr951798 1241 729 675 79 --1609 --
NM_203463chr244922 3178 349 181 --23295 1565 --
NM_203504chr452510 2472 2435 2381 1683 --22242 2166 --
NM_203505chr452510 2472 2435 2381 1683 --22242 2166 --
NM_206594chr162522 916 511 377 304 27 --1805 --
NM_206595chr162522 916 511 377 304 27 --1805 --
NM_206866chr2142948 2762 352 79 ----130
NM_206876chr252696 2456 490 338 237 --182 --
NM_206914chr1261584 825 728 649 336 39 12103 22182 219 --
NM_207012chr10103432 3394 3107 2246 875 684 590 415 344 265 --12222 --
NM_207043chr132094 1908 1895 11756 22352 1736 --
NM_207044chr132094 1908 1895 11756 22352 1736 --
NM_207047chr132094 1908 1895 11756 22352 1736 --
NM_207171chr151705 1604 809 712 229 --1822 --
NM_207292chr373159 2685 2224 1348 773 339 135 21127 298 ----
NM_207293chr373159 2685 2224 1348 773 339 135 21127 298 ----
NM_207294chr373159 2685 2224 1348 773 339 135 21127 298 ----
NM_207295chr373159 2685 2224 1348 773 339 135 21127 298 ----
NM_207296chr373159 2685 2224 1348 773 339 135 21127 298 ----
NM_207297chr373184 2710 2249 1373 798 364 160 21152 323 ----
NM_207303chr1073965 3260 3085 1097 881 673 104 11671 ----
NM_207304chr1332557 2085 714 22373 1807 1785 --
NM_207372chr1062289 707 617 369 179 154 ----1112
NM_207404chr381930 1883 1848 1578 1469 1443 573 332 --176 --
NM_207406chr4114269 4214 4125 4102 2321 1927 1548 1392 1335 1116 1050 46431 2086 1667 695 12359 --
NM_207411chr893502 2989 2966 2362 1171 965 785 358 352 13322 12978 1988
NM_207422chrX71306 1200 1027 1011 957 534 159 ------
NM_207467chr131697 532 147 --11755 11387
NM_212558chr973634 3421 3223 1688 1072 904 763 1864 1305 14310
NM_213594chr125528 453 442 276 72 ------
NM_213648chr561172 587 578 486 471 46 1433 1612 --
NM_213662chr1752299 1601 1573 941 767 22382 568 ----