TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-432-5p
miRNA Sequence: UCUUGGAGUAGGUCAUUGGGUGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr142751 135 ------
NM_000037chr842257 1748 791 228 --32047 1003 222 --
NM_000045chr62258 118 1162 ----
NM_000046chr592629 2615 2525 2374 2316 2225 2008 1237 675 --1483 --
NM_000052chrX53180 2557 1100 600 164 --2848 795 --
NM_000053chr1362084 2038 1789 1743 638 96 --1722 11459
NM_000081chr171874 1354 453 338 300 42 26 ------
NM_000084chrX126425 6304 4632 4615 2473 1902 1408 1175 1164 854 750 346 15698 14959 --
NM_000089chr71829 ------
NM_000090chr23266 225 115 ------
NM_000092chr244608 4472 3664 3475 23764 2795 ----
NM_000093chr9112171 2143 2009 1899 1593 1536 995 496 436 424 296 ------
NM_000104chr232672 2162 1219 1391 22588 742 --
NM_000110chr141062 420 321 91 31128 871 471 ----
NM_000115chr1332206 2018 255 1279 ----
NM_000125chr683863 3763 3734 3684 3667 3378 1497 207 13790 --1402
NM_000129chr661304 1115 307 219 169 130 ------
NM_000138chr1542210 1892 503 379 ------
NM_000161chr1441840 1330 462 399 1635 ----
NM_000163chr522375 734 --2624 565 12114
NM_000167chrX11325 --1138 1299
NM_000168chr752650 2493 2068 2044 603 --32933 2631 1007 --
NM_000170chr92439 351 ------
NM_000176chr573550 3401 1452 1131 741 646 587 ------
NM_000217chr12105230 5042 4941 4920 4822 4303 3407 787 573 420 24191 190 --23793 681
NM_000220chr112110 37 ------
NM_000222chr451776 1683 308 297 193 ----299 32
NM_000237chr841661 1523 644 230 --1420 1429
NM_000259chr1576312 5441 5046 4914 4676 2486 1287 ------
NM_000266chrX2881 283 ------
NM_000267chr1762673 2394 1385 1134 769 722 21056 436 13521 --
NM_000284chrX51992 1758 1587 478 242 --11222 --
NM_000291chrX1792 1723 --1200
NM_000297chr471744 1684 1561 1531 721 662 536 1391 ----
NM_000315chr11190 ------
NM_000321chr1331241 456 262 ------
NM_000332chr6106644 6534 6290 5615 4992 4931 4638 4466 1420 612 16570 1242 16086
NM_000333chr331016 881 451 1874 21089 338 --
NM_000337chr5116423 6282 5875 5792 5598 5430 4865 4607 4308 2129 707 14142 31931 1330 543 11155
NM_000345chr43872 243 72 1397 ----
NM_000346chr1731788 531 210 1189 ----
NM_000351chrX42994 2878 1732 1111 23010 1445 13054 --
NM_000353chr161819 21207 128 1420 1400
NM_000382chr1731890 525 334 1394 --21793 552
NM_000390chrX43229 2815 1202 1001 1166 ----
NM_000393chr252108 2020 1611 1304 308 1474 ----
NM_000406chr483054 2343 1925 1230 778 592 540 408 --1721 --
NM_000408chr262353 2341 2223 1099 531 132 12465 ----
NM_000411chr2183309 3284 3197 2863 2474 2456 2245 91 1533 ----
NM_000412chr31285 ------
NM_000430chr1721349 821 11521 1745 --
NM_000437chr152136 2049 1858 1655 547 11763 ----
NM_000439chr572168 1906 1589 1003 974 521 440 ------
NM_000448chr1142671 2224 961 844 33107 828 111 12411 --
NM_000451chrX52036 1840 1620 1362 405 --1254 11708
NM_000452chr1351417 783 732 587 31 ------
NM_000461chr3103799 3631 3438 1737 1701 1192 903 748 619 586 2491 309 13373 14034
NM_000484chr2131070 773 755 ------
NM_000489chrX63358 3305 3018 2540 612 298 ------
NM_000492chr761475 956 541 526 318 230 ------
NM_000493chr641105 864 242 49 1440 1346 --
NM_000495chrX1879 ----2794 263
NM_000523chr231010 156 51 11019 1274 --
NM_000529chr1882344 2326 2266 1751 683 424 351 71 12149 1480 --
NM_000533chrX61708 798 301 288 42 28 11443 ----
NM_000550chr931020 888 826 ------
NM_000554chr1911100 --22030 277 1311
NM_000555chrX177887 6575 5902 5326 5256 4769 3152 3032 2595 2538 2503 2386 1715 1626 248 101 40 27535 418 17703 11129
NM_000560chr13704 567 511 ------
NM_000584chr421172 71 128 157 --
NM_000586chr41173 ------
NM_000599chr2104175 4028 3437 3299 3148 3141 3050 2799 1762 55 13746 23699 3077 1544
NM_000602chr741222 1113 256 65 11418 --1157
NM_000618chr12105964 5951 5693 5677 5653 4089 766 747 395 159 11069 ----
NM_000618chr12105964 5951 5693 5677 5653 4089 766 747 395 159 11069 ----
NM_000619chr121486 ------
NM_000620chr1222042 1294 ------
NM_000633chr18115155 4798 4266 3932 3804 3690 3680 3272 1926 1542 1079 --44830 4607 1170 1050 13589
NM_000639chr11731 ------
NM_000685chr31821 ------
NM_000685chr31821 ------
NM_000697chr171293 ------
NM_000719chr12136677 6334 6309 6294 5901 5282 4338 4330 4243 2540 2488 1921 1516 1460 46608 6465 1166 502 12038
NM_000783chr104536 527 447 171 ------
NM_000788chr411063 ------
NM_000793chr1444343 3989 3971 141 --24633 4451 14098
NM_000794chr52152 129 ------
NM_000801chr203784 311 66 ------
NM_000806chr551986 1264 1222 539 352 ------
NM_000807chr42287 259 ------
NM_000809chr4169275 8744 8688 8478 8253 8221 7946 7174 6933 6543 5897 3560 3538 3290 3249 1493 47219 3387 2071 734 12846 23337 455
NM_000813chr5105053 4753 4658 4565 3813 3734 2250 1188 1170 883 44467 1917 1126 92 11309 12118
NM_000817chr2155 1927 --2376 303
NM_000824chr41187 ------
NM_000826chr442611 2520 737 88 ----12473
NM_000827chr562169 2131 1872 1601 993 533 22255 489 ----
NM_000828chrX72032 1968 1612 1570 841 442 419 --21989 62 --
NM_000829chr1162082 2074 1982 1874 1490 427 11934 ----
NM_000831chr1126212 5812 5335 4869 4760 4037 2504 2476 2024 1771 1204 300 ----1729
NM_000833chr1651228 1188 969 407 345 --1589 --
NM_000837chr82553 135 ------
NM_000842chr113682 658 277 ------
NM_000859chr51489 21464 1128 21401 587 1469
NM_000868chrX22358 2171 ------
NM_000875chr15146623 6426 6420 6346 4864 4751 2522 2173 2023 1883 1111 1102 1012 557 15416 --25038 1356
NM_000877chr273089 2642 2300 1921 1237 891 863 11908 --1885
NM_000880chr83700 614 197 2575 326 --152
NM_000891chr1753198 2831 1084 495 264 12431 --13142
NM_000894chr19123 ------
NM_000899chr12134078 4051 3935 3401 3057 3002 2854 2689 1689 1622 992 721 344 23853 1564 --11728
NM_000902chr3122514 2464 2305 2161 2143 2008 1974 677 485 474 194 67 ------
NM_000921chr122221 28 --159 --
NM_000926chr11249449 9264 8855 8524 8494 8403 8179 8087 7512 7196 7162 6897 6560 6544 6151 5733 3526 3354 2629 1538 1139 727 570 419 --27794 6297 18098
NM_000933chr2031446 1437 490 ------
NM_000935chr311096 --11137 --
NM_000950chrX63352 1369 933 776 699 25 --11073 23465 2962
NM_000959chr173567 3349 3028 2844 2734 1167 543 13070 13292 --
NM_000963chr131666 367 173 ------
NM_000965chr32197 21 149 1835 --
NM_001001132chr2121047 459 ------
NM_001001323chr1262801 2586 2377 821 395 156 ------
NM_001001395chr1252717 2624 2610 1849 869 --11875 --
NM_001001419chr575122 4723 3575 3558 1727 1544 1057 ------
NM_001001420chr575122 4723 3575 3558 1727 1544 1057 ------
NM_001001433chr2033052 2811 2320 ------
NM_001001481chr843261 870 651 184 --1294 --
NM_001001484chr1022425 1712 ------
NM_001001520chr191157 ------
NM_001001664chr294150 4001 2547 1118 659 539 477 471 222 13995 3512 204 49 --
NM_001001890chr2163721 3596 2840 1695 411 239 12675 24090 1052 --
NM_001001924chr841784 1688 1414 207 --11392 --
NM_001001925chr841784 1688 1414 207 --11392 --
NM_001001931chr841784 1688 1414 207 --11392 --
NM_001001933chr11116 ------
NM_001001938chr954061 3079 2974 546 438 13122 ----
NM_001001971chr102868 427 ------
NM_001001977chr20137 ------
NM_001002243chr23880 106 78 ------
NM_001002257chr293283 3248 3177 3078 3026 2905 2450 2245 64 --1426 --
NM_001002258chr261997 600 455 268 115 73 1475 ----
NM_001002295chr101178 1947 ----
NM_001002811chr131181 272 166 ----21027 148
NM_001002812chr131181 272 166 ----21027 148
NM_001002812chr131181 272 166 ----21027 148
NM_001002860chr14114551 4496 4393 3032 1670 1588 1549 1196 787 622 491 24159 904 ----
NM_001003652chr1898463 6920 6643 5976 5949 5914 2850 1052 728 47111 5703 2993 103 11954 --
NM_001003674chr1886145 5959 5613 5586 4558 2296 1909 979 36222 2650 710 17001 --
NM_001003675chr1886145 5959 5613 5586 4558 2296 1909 979 36222 2650 710 17001 --
NM_001003681chr2241307 575 386 368 ------
NM_001003683chr2140 ------
NM_001003688chr431175 999 833 ------
NM_001003712chr1263825 3300 2844 975 921 64 ------
NM_001003760chr693450 3387 3312 3187 2729 2572 2517 2272 1222 ----12777
NM_001003800chr973613 3294 2593 2354 1360 777 299 ----11369
NM_001003810chr42821 52 ------
NM_001003954chr8159 ------
NM_001004023chr1----1161 --
NM_001004317chr664147 3499 2832 1282 988 705 1377 1152 13707
NM_001004360chr24755 586 167 84 11775 ----
NM_001004419chr1284629 3947 3635 1843 1560 1231 1146 54 11402 ----
NM_001004441chr581376 1248 1175 1139 544 428 367 29 1469 11640 --
NM_001005271chr171264 ----1158
NM_001005273chr171264 ----1158
NM_001005375chrY31648 1311 650 --21417 35 1482
NM_001005386chr252240 2089 824 307 255 ----182
NM_001005404chr1784493 4289 3880 3521 3098 1345 1147 164 --21570 397 --
NM_001005463chr1061974 1893 706 661 398 100 ------
NM_001005473chr586239 5666 4988 4893 4319 2439 1507 1364 21837 1169 --15520
NM_001005474chr321579 264 ------
NM_001005502chr12114910 4285 3839 3475 1534 1111 1018 956 918 652 144 35167 4299 3229 159 --
NM_001005526chr2188 ------
NM_001005527chr34364 287 257 22 1266 --1877
NM_001005609chrX143671 3293 2945 2677 2611 1462 1276 1181 1034 1022 610 369 335 279 --33368 151 71 13637
NM_001005782chr21329 ------
NM_001005785chrY31648 1311 650 --21417 35 1482
NM_001005786chrY31648 1311 650 --21417 35 1482
NM_001006600chr51543 11756 ----
NM_001006657chr242566 2476 1258 293 23226 2040 ----
NM_001007023chr1444343 3989 3971 141 --24633 4451 14098
NM_001007024chr1764282 4205 3616 3462 2770 2703 ------
NM_001007025chr1764282 4205 3616 3462 2770 2703 ------
NM_001007075chr411044 ------
NM_001007097chr954554 4145 3328 2029 497 11039 34618 4299 3649 --
NM_001007214chr151911 1531 1334 231 120 11826 ----
NM_001007237chr162517 1140 940 815 649 134 1465 21815 270 --
NM_001007257chr121154 960 ------
NM_001007267chr23815 600 135 ------
NM_001007466chr6145115 4969 4918 4479 4249 4041 3859 3605 3503 1845 1681 1516 1329 482 14598 ----
NM_001007559chr1842073 1875 1715 1580 ------
NM_001008220chr5103649 3487 3318 3260 3238 3094 2713 912 640 397 ----22642 2590
NM_001008388chr46963 879 412 211 191 94 ------
NM_001008391chr114512 470 203 114 ------
NM_001008393chr442675 2422 2283 2134 --12407 --
NM_001008401chr1951305 1285 1249 1185 920 ------
NM_001008405chr761741 1590 1350 430 316 68 ------
NM_001008408chr785638 4469 2237 1903 1747 1671 370 131 25570 5297 35800 244 56 --
NM_001008660chr113448 258 29 ----1971
NM_001008707chr1451214 651 621 532 309 ------
NM_001008711chr851637 1323 1094 629 563 --123 1211
NM_001008738chr562843 2748 1899 1059 712 409 11044 ----
NM_001008800chr13223 152 22 ------
NM_001008801chr1941928 1860 1557 569 ------
NM_001008883chr13223 152 22 ------
NM_001008925chr482637 2290 2279 1410 930 865 735 666 1646 12594 --
NM_001009184chr82553 135 ------
NM_001009554chr4104475 4263 3598 3271 1510 980 930 889 697 620 44427 1874 1664 335 13710 --
NM_001009554chr4104475 4263 3598 3271 1510 980 930 889 697 620 44427 1874 1664 335 13710 --
NM_001009894chr1261489 1267 642 636 458 141 --1578 --
NM_001009899chr3125864 4311 2511 2332 2071 1995 1969 1425 1150 630 245 227 25952 5832 ----
NM_001009958chr73639 209 107 --1398 --
NM_001009959chr261940 1853 1771 1699 1680 482 ------
NM_001010000chr1883321 2754 2414 2183 1363 958 817 274 1931 --12604
NM_001010861chr122206 2089 1621 ----
NM_001010862chrX62954 2941 744 477 427 38 12478 1665 --
NM_001010867chr1166470 5742 5668 5471 5059 5036 4749 4614 4293 2522 2435 1855 1600 415 253 67 24444 4354 25608 5103 1658
NM_001010888chrX134152 3800 3713 3569 3464 2992 2947 1679 1331 1255 509 274 267 13786 23327 502 --
NM_001010891chr5106466 5974 5775 5178 2595 1794 1577 1473 912 110 12348 12000 15026
NM_001010895chr942003 1384 762 168 21468 701 1243 --
NM_001010908chr10--1296 2706 553 --
NM_001010917chr1052219 2025 1855 1496 527 ----12105
NM_001010984chr13733 415 353 --190 1496
NM_001011513chr473739 3681 2706 2593 1385 805 774 ------
NM_001011537chr32799 91 178 ----
NM_001011553chr71330 --1214 --
NM_001011554chr20102090 2024 1819 1720 1643 1418 803 602 453 134 11554 ----
NM_001011666chr7156588 6006 5692 5591 5254 5054 4546 4394 4253 2320 1426 744 399 236 111 --24788 1420 128
NM_001011705chr132288 203 ------
NM_001011708chr282736 2429 2398 1022 857 385 236 37 11974 ----
NM_001011724chr131238 ------
NM_001011725chr131238 ------
NM_001012264chr146849 804 724 677 147 55 --1379 --
NM_001012270chr1771811 1689 1488 1377 1359 1311 572 --11751 --
NM_001012271chr1781914 1792 1591 1480 1462 1414 675 50 --11854 --
NM_001012393chr11135049 4935 4092 3828 3687 3630 1725 1645 1610 1503 1059 997 434 ----11362
NM_001012398chr1631102 230 57 --1173 --
NM_001012420chr1562639 2572 2297 1887 1874 1176 ------
NM_001012423chr1562639 2572 2297 1887 1874 1176 ------
NM_001012454chr72150 114 ------
NM_001012512chr182254 210 ------
NM_001012513chr182265 221 ------
NM_001012614chr42593 564 ------
NM_001012751chr1021717 1594 1499 1571 --
NM_001012755chrX105067 4686 4427 4357 4077 3836 1573 1280 394 372 12018 13406 --
NM_001013031chr1063315 3048 2916 844 821 487 13102 --12387
NM_001013406chr731647 1633 1296 1167 ----
NM_001013415chr431485 637 315 ----11361
NM_001014442chr131115 ------
NM_001014797chr10116891 5201 3143 3052 2927 2390 2232 2044 1763 1479 998 --27943 5555 --
NM_001015508chr82570 146 ------
NM_001015877chrX32158 2142 621 22715 526 1709 --
NM_001015880chr1051246 1236 689 465 380 ------
NM_001017368chr1721795 1112 12424 12739 --
NM_001017371chr23963 861 460 ------
NM_001017395chr383265 2962 2782 2728 2455 2298 1161 678 1188 --23402 149
NM_001017424chr111726 11454 ----
NM_001017425chr111726 11454 ----
NM_001017440chr7167705 7339 6572 6151 6079 5600 4986 2239 1667 1439 1378 1326 1302 335 272 259 47631 6981 6347 451 47649 7536 6836 5827 12375
NM_001017924chr1021422 116 21036 145 140 --
NM_001017995chr5174858 4570 4272 4251 3868 3463 3349 3213 3009 1700 1279 1169 1017 539 432 359 98 13239 1739 34601 330 321
NM_001018009chr32118 108 1769 ----
NM_001018054chr121026 474 ------
NM_001018065chr9125000 4385 3666 3656 2025 1899 1740 866 846 817 689 192 21222 174 25927 3715 --
NM_001018066chr9125000 4385 3666 3656 2025 1899 1740 866 846 817 689 192 21222 174 25927 3715 --
NM_001018067chr195373 5235 4215 4063 1858 1840 1494 305 75 23589 2003 ----
NM_001018068chr195373 5235 4215 4063 1858 1840 1494 305 75 23589 2003 ----
NM_001018069chr195373 5235 4215 4063 1858 1840 1494 305 75 23589 2003 ----
NM_001018074chr573550 3401 1452 1131 741 646 587 ------
NM_001018075chr573550 3401 1452 1131 741 646 587 ------
NM_001018076chr573550 3401 1452 1131 741 646 587 ------
NM_001018077chr573550 3401 1452 1131 741 646 587 ------
NM_001020658chr131659 1550 135 11264 --1119
NM_001020658chr131659 1550 135 11264 --1119
NM_001024071chr142862 352 ------
NM_001024094chr573550 3401 1452 1131 741 646 587 ------
NM_001024380chr831563 1529 969 --12036 --
NM_001024381chr831563 1529 969 --12036 --
NM_001024465chr61154 164 ----
NM_001024647chr12107598 7466 6243 5383 2335 2299 813 422 209 85 35838 2801 1675 --36656 4886 131
NM_001024847chr31430 32259 2165 2158 1713 11617
NM_001024947chr52819 726 ------
NM_001024948chr153239 2374 2343 1003 712 2462 106 ----
NM_001025076chr10146157 5495 5355 5164 4696 4600 4319 3926 2205 2051 1514 1096 463 427 24552 4166 34425 1547 1411 --
NM_001025077chr10167515 6853 6713 6522 6054 5958 5677 5284 4900 2872 2454 1821 1785 1214 536 227 25910 5524 35783 2905 2769 --
NM_001025079chr373704 3395 2903 2893 2532 637 24 1292 12934 --
NM_001025100chr1853215 2861 1402 1068 96 12624 32849 1532 257 --
NM_001025108chr294185 3354 3255 3025 2647 1564 941 680 634 --1724 --
NM_001025233chr1262687 2209 2145 2128 729 489 1412 22710 903 --
NM_001025252chr842845 2675 326 54 22071 278 1480 --
NM_001025253chr842845 2675 326 54 22071 278 1480 --
NM_001025266chr384327 4156 3586 3385 3363 1394 114 76 13414 1923 --
NM_001025366chr611405 ------
NM_001025366chr611405 ------
NM_001025367chr611405 ------
NM_001025367chr611405 ------
NM_001025368chr611405 ------
NM_001025368chr611405 ------
NM_001025369chr611421 ------
NM_001025369chr611421 ------
NM_001025370chr611405 ------
NM_001025370chr611405 ------
NM_001025580chrX53906 3543 3466 3364 2684 --12619 --
NM_001025595chr43522 359 317 ------
NM_001025596chr111370 ------
NM_001025616chr431651 1252 340 21503 270 147 --
NM_001025780chr911562 ------
NM_001029858chr642411 858 183 134 12637 22368 686 12665
NM_001029863chr663148 3118 3061 3026 2273 561 1390 ----
NM_001029875chr572629 2067 2045 989 578 261 65 1571 --12443
NM_001029955chr453460 2968 2650 726 305 12991 ----
NM_001029998chr441130 552 390 175 ------
NM_001030007chr16103861 3837 3464 3136 2787 2624 1600 1484 1053 751 23569 3503 --23589 2723
NM_001030055chr14104778 4731 3922 3896 3667 3252 1511 1425 971 580 43802 3432 1621 171 ----
NM_001031679chr1293482 3233 3166 2833 2639 2596 1101 923 336 22868 2371 --12245
NM_001031695chr2285191 5158 4987 4005 1297 1197 700 221 13976 15395 --
NM_001031700chr452363 2152 2143 1712 229 ------
NM_001031732chr4103587 3430 3069 2973 2803 2741 2678 664 553 148 1250 12842 --
NM_001031804chr1664221 4124 2925 1199 1171 560 1599 ----
NM_001031806chr1731946 581 390 1450 --21849 608
NM_001031812chr53772 183 95 --11456 --
NM_001032283chr12------185
NM_001032284chr12------185
NM_001032288chr2021528 551 ------
NM_001032293chr171436 ------
NM_001032380chr1031359 768 700 1715 --1602
NM_001032394chr682328 2182 2137 1919 1901 1736 1136 811 ------
NM_001032395chr672195 2049 2004 1786 1768 1003 678 ------
NM_001032999chr20145093 4773 4691 4482 4360 3405 3336 2046 1923 1775 1459 1453 671 134 23314 2011 13935 --
NM_001033045chr264097 3540 3306 1464 598 271 31271 426 287 ----
NM_001033047chr452632 1985 931 688 52 --12135 --
NM_001033059chr642065 1866 1504 1367 11408 1340 --
NM_001033081chr141504 1395 1181 350 --21361 1280 11224
NM_001033082chr141504 1395 1181 350 --21361 1280 11224
NM_001033087chr2082541 2530 2367 1273 1061 579 139 130 12203 ----
NM_001033518chr762630 2536 2529 2489 1144 572 ------
NM_001033519chr762630 2536 2529 2489 1144 572 ------
NM_001033520chr762630 2536 2529 2489 1144 572 ------
NM_001033576chr1742696 2506 649 600 12177 ----
NM_001033578chr81876 11828 1306 12017
NM_001033659chr1741673 1478 1415 293 11104 11332 --
NM_001033723chr872736 2380 2239 1979 997 955 248 22060 384 ----
NM_001033756chr611339 ------
NM_001033756chr611339 ------
NM_001033925chr1041452 830 720 663 ------
NM_001034841chr1665342 4927 4469 1517 1174 1148 32196 1194 923 21738 1004 14939
NM_001034954chr1072853 2487 2378 1230 1040 1016 162 22072 310 1390 --
NM_001034955chr1072853 2487 2378 1230 1040 1016 162 22072 310 1390 --
NM_001034956chr1072853 2487 2378 1230 1040 1016 162 22072 310 1390 --
NM_001034957chr1072853 2487 2378 1230 1040 1016 162 22072 310 1390 --
NM_001037165chr7138726 8038 7718 7602 7497 6695 6353 1844 1674 1199 967 909 694 18119 57727 7557 6964 1058 755 --
NM_001037172chr331356 1089 297 2987 277 ----
NM_001037174chr251624 1503 487 407 199 --12150 --
NM_001037317chr122206 2089 1621 ----
NM_001037332chr522581 1770 ------
NM_001037333chr522581 1770 ------
NM_001037494chr12165 ------
NM_001037495chr12165 ------
NM_001038707chr152245 2068 1728 608 103 11991 ----
NM_001038707chr152245 2068 1728 608 103 11991 ----
NM_001039091chrX31382 1247 318 ------
NM_001039199chr2064986 4885 3714 3117 1506 628 21013 368 ----
NM_001039348chr21859 ----1238
NM_001039349chr21859 ----1238
NM_001039465chr141414 ------
NM_001039538chr2113616 3537 3530 3471 3317 3226 2796 1468 1334 1307 350 11462 ----
NM_001039547chr396945 6651 5965 2925 1217 386 345 264 244 15558 11490 --
NM_001039570chr2274175 3696 3662 3063 1601 1009 577 13087 21828 1652 13939
NM_001039571chr2274175 3696 3662 3063 1601 1009 577 13087 21828 1652 13939
NM_001039577chr184394 4030 3832 2823 1559 1342 472 26 --44377 1357 869 781 1718
NM_001039585chr183824 3606 3285 3101 2991 1424 800 50 13327 13549 --
NM_001039590chrX63841 3119 3073 2852 2845 1176 1722 ----
NM_001039591chrX63841 3119 3073 2852 2845 1176 1722 ----
NM_001039618chr1165602 5030 2318 2092 656 581 ------
NM_001039690chr1652107 1807 688 240 195 2836 296 --11591
NM_001039693chr253900 3664 3192 3045 558 1833 24067 2699 12736
NM_001039697chr93626 462 446 172 ----
NM_001039709chr20145093 4773 4691 4482 4360 3405 3336 2046 1923 1775 1459 1453 671 134 23314 2011 13935 --
NM_001039711chr12792 88 ------
NM_001039712chr12792 88 ------
NM_001039762chr1092267 1938 1591 683 652 545 518 371 69 ----1937
NM_001039802chr111282 ------
NM_001039840chrX76003 5736 5260 4085 2311 1905 1720 15936 13984 14235
NM_001039937chr13103573 3497 3426 2864 2587 1405 848 248 208 42 23922 2742 ----
NM_001040033chr13704 567 511 ------
NM_001040092chr82289 160 ------
NM_001040097chr71164 ------
NM_001040098chr71164 ------
NM_001040099chr71164 ------
NM_001040102chr1082197 2029 1955 1722 1003 937 625 182 ------
NM_001040103chr1082197 2029 1955 1722 1003 937 625 182 ------
NM_001040142chr211927 21538 956 ----
NM_001040143chr211927 21538 956 ----
NM_001040144chr1652107 1807 688 240 195 2836 296 --11591
NM_001040146chr1652107 1807 688 240 195 2836 296 --11591
NM_001040152chr7143874 3444 3302 3176 2013 1737 1340 867 822 741 573 459 120 83 24407 4085 23486 774 1194
NM_001040157chr442341 782 533 371 ------
NM_001040159chr42447 365 ------
NM_001040272chr942347 2155 733 129 --2627 152 11688
NM_001040284chr16105848 5671 5386 5024 4142 2213 1803 1065 750 431 ----1857
NM_001040429chr1363475 3062 2975 2925 2298 512 --12837 --
NM_001040437chr6179 ------
NM_001040438chr6179 ------
NM_001040441chr1114702 4286 3915 3869 3488 1962 1880 1184 1026 765 390 13509 15258 --
NM_001040450chr1582486 2318 2062 1889 1819 1806 648 165 ------
NM_001040453chr1582486 2318 2062 1889 1819 1806 648 165 ------
NM_001040458chr561353 1245 455 115 91 35 --11381 21454 665
NM_001040624chr832540 688 558 1575 31866 1730 365 --
NM_001040625chr832540 688 558 1575 31866 1730 365 --
NM_001040626chr832540 688 558 1575 31866 1730 365 --
NM_001040627chr832540 688 558 1575 31866 1730 365 --
NM_001040628chr832540 688 558 1575 31866 1730 365 --
NM_001040629chr832540 688 558 1575 31866 1730 365 --
NM_001040630chr832540 688 558 1575 31866 1730 365 --
NM_001040665chr794900 4514 4222 3848 1099 1093 944 766 751 --1154 13456
NM_001040708chr81417 1233 ----
NM_001040709chr1112406 2351 2285 2238 1847 964 789 512 387 88 46 165 11888 1694
NM_001040712chr9113467 3284 2779 2726 2380 2290 1209 811 634 162 42 ------
NM_001042404chr11554 ----11444
NM_001042413chr973963 2668 1646 1518 1433 571 368 ------
NM_001042424chr462879 2521 2299 2236 272 29 12838 ----
NM_001042473chr1012016 ------
NM_001042492chr1762673 2394 1385 1134 769 722 21056 436 13521 --
NM_001042494chr1583351 3150 2603 2341 780 645 585 239 33236 2522 860 12349 --
NM_001042495chr1583351 3150 2603 2341 780 645 585 239 33236 2522 860 12349 --
NM_001042496chr1583351 3150 2603 2341 780 645 585 239 33236 2522 860 12349 --
NM_001042497chr1583351 3150 2603 2341 780 645 585 239 33236 2522 860 12349 --
NM_001042510chr832005 1429 635 ------
NM_001042511chr832005 1429 635 ------
NM_001042517chr134895 797 344 54 1191 ----
NM_001042533chr332709 271 88 12443 22858 2619 --
NM_001042543chr451533 1226 1150 1048 239 ------
NM_001042555chr1294512 3973 2986 1569 1486 1092 1072 440 321 ------
NM_001042599chr2127594 7079 6554 5194 5163 3097 2379 2198 2093 2034 1260 43 --25330 1690 16533
NM_001042603chr1231000 798 100 --14138 --
NM_001042604chr3144738 4208 4150 4092 3876 3836 3553 3175 1881 1765 1106 951 435 315 12964 ----
NM_001042632chr2042334 1716 888 779 12431 32132 1809 579 --
NM_001042633chr2042334 1716 888 779 12431 32132 1809 579 --
NM_001042669chr431651 1252 340 21503 270 147 --
NM_001042683chr631770 669 187 11267 ----
NM_001042749chrX31802 785 42 1618 1104 --
NM_001042750chrX31802 785 42 1618 1104 --
NM_001042751chrX31802 785 42 1618 1104 --
NM_001042762chr73897 117 104 1239 ----
NM_001043318chr1443365 3237 2947 760 --13784 2831 654
NM_001044305chr681399 1356 1327 1270 1085 572 350 304 ------
NM_001044722chr53772 183 95 --11456 --
NM_001044723chr53772 183 95 --11456 --
NM_001045556chr851634 1536 1205 577 48 11146 2372 339 11188
NM_001045557chr851634 1536 1205 577 48 11146 2372 339 11188
NM_001048183chr1103548 3330 3055 2490 1418 952 697 408 291 54 21245 805 1492 13709
NM_001083620chr442609 2518 736 88 ----12471
NM_001100108chr1117894 6795 6535 6295 5660 5385 5333 2894 2022 1126 403 --37080 7043 6760 --
NM_001106chr3139768 9131 8312 7657 7339 7174 7123 6725 6648 6499 3405 1391 1198 26485 6065 ----
NM_001112808chr1280 59 ------
NM_001113490chrX93616 3376 2622 2613 2493 1055 942 230 203 12532 42976 1288 1264 1094 --
NM_001117chr1841556 627 575 60 --1498 --
NM_001128chr16103861 3837 3464 3136 2787 2624 1600 1484 1053 751 23569 3503 --23589 2723
NM_001146chr862148 2052 1593 788 604 284 ------
NM_001148chr471724 1679 848 724 531 118 106 --21662 506 --
NM_001153chr23897 760 103 ------
NM_001167chrX146260 6053 5995 5918 4612 4499 4468 4267 2647 2385 1949 1645 1175 302 44585 2371 1764 988 ----
NM_001173chr14104778 4731 3922 3896 3667 3252 1511 1425 971 580 43802 3432 1621 171 ----
NM_001186chr2163298 2456 2307 2118 1143 21 12444 ----
NM_001198chr662012 1929 1602 811 557 153 22052 1802 ----
NM_001200chr2051115 1087 981 820 403 ------
NM_001204chr2126865 6859 5446 5152 5074 2414 2207 1671 1492 1222 780 728 11661 1801 --
NM_001235chr112695 605 1655 ----
NM_001237chr431071 457 359 2995 29 ----
NM_001237chr431071 457 359 2995 29 ----
NM_001241chr232372 1984 213 ------
NM_001241chr232372 1984 213 ------
NM_001256chr1742277 1886 978 679 22637 2557 --1446
NM_001259chr7106361 5686 5194 4826 4194 3948 2155 1300 1028 338 24782 238 1147 --
NM_001278chr103844 196 189 ------
NM_001280chr192452 31 ------
NM_001304chr1783714 3605 3596 3114 1024 590 188 101 ----12354
NM_001328chr42593 564 ------
NM_001332chr51597 ------
NM_001346chr352228 2018 909 880 122 22308 661 --1706
NM_001351chr361672 1621 1285 1239 442 381 1696 ----
NM_001356chrX22118 1632 ----189
NM_001358chr41430 ------
NM_001386chr842223 1663 844 323 11978 ----
NM_001387chr562939 2763 2712 2504 1221 143 --12300 --
NM_001389chr212589 80 ------
NM_001399chrX143671 3293 2945 2677 2611 1462 1276 1181 1034 1022 610 369 335 279 --33368 151 71 13637
NM_001401chr921534 639 1259 ----
NM_001408chr111074 --11352 1249
NM_001412chrX51414 1388 1216 1018 590 1133 --13230
NM_001419chr19114788 4721 3853 3826 3369 723 700 627 492 444 250 --23236 730 1318
NM_001424chr161503 --1735 --
NM_001430chr251885 600 564 449 263 --21412 1285 --
NM_001431chr6167 ------
NM_001438chr193609 3525 3011 2342 1205 855 846 749 557 23394 2222 ----
NM_001440chr842230 1765 470 374 12168 ----
NM_001465chr552184 1621 1608 480 312 ------
NM_001482chr153727 695 330 1831 1229 --
NM_001542chr162517 1140 940 815 649 134 1465 21815 270 --
NM_001543chr553718 1810 1787 1583 471 11898 21467 400 11288
NM_001546chr621329 1251 1149 11306 --
NM_001554chr11488 ------
NM_001555chrX2287 111 ------
NM_001608chr24926 313 279 196 1712 ----
NM_001609chr1063637 2920 2729 1738 991 240 14048 1753 --
NM_001616chr242610 2208 559 272 ------
NM_001620chr112200 80 ------
NM_001621chr782972 2801 2444 2250 2220 840 544 135 12683 ----
NM_001621chr782972 2801 2444 2250 2220 840 544 135 12683 ----
NM_001624chr641630 1498 577 333 1307 11404 --
NM_001634chr642065 1866 1504 1367 11408 1340 --
NM_001643chr1124 ------
NM_001650chr18104013 3654 3228 3145 2876 2523 1538 1360 865 194 2713 455 ----
NM_001663chr1412041 32559 2014 599 ----
NM_001668chr142027 1656 1536 686 --2204 168 --
NM_001682chr1252515 2300 2091 535 109 ------
NM_001689chr261997 600 455 268 115 73 1475 ----
NM_001690chr362035 1740 982 843 717 526 ------
NM_001695chr863816 3521 1160 1114 1081 845 32791 1378 620 ----
NM_001699chr19131825 1597 1545 1358 1310 1177 509 388 362 353 338 275 38 91554 1530 1483 1336 1243 1208 1193 1155 261 11695 21265 1220
NM_001701chr921420 1129 --11512 --
NM_001709chr11----11995 --
NM_001714chr122397 372 ------
NM_001723chr61197 --1297 --
NM_001726chr11122 ------
NM_001743chr24589 569 436 238 ------
NM_001744chr51153 ------
NM_001748chr11943 1463 1421 --
NM_001753chr751241 412 375 74 68 11731 ----
NM_001754chr2163721 3596 2840 1695 411 239 12675 24090 1052 --
NM_001759chr1284272 4028 3451 1967 1818 1637 715 401 34490 4200 3764 --14098
NM_001777chr373704 3395 2903 2893 2532 637 24 1292 12934 --
NM_001788chr71330 --1214 --
NM_001791chr111282 ------
NM_001792chr181373 ------
NM_001797chr161781 ------
NM_001812chr41327 ------
NM_001830chrX63361 3054 2545 1046 925 216 12515 --11510
NM_001843chr123230 78 51 ------
NM_001844chr12161 1163 ----
NM_001845chr1341208 975 520 486 11221 ----
NM_001854chr141045 945 460 424 21113 347 1542 --
NM_001858chr661724 1707 1575 1189 1097 292 14625 11418 --
NM_001859chr993812 3541 3529 2704 1186 1170 760 506 77 ----13220
NM_001874chr12114910 4285 3839 3475 1534 1111 1018 956 918 652 144 35167 4299 3229 159 --
NM_001875chr241086 709 423 175 ------
NM_001880chr2148 ------
NM_001881chr101495 ------
NM_001884chr53527 520 67 ------
NM_001904chr31786 ----11052
NM_001918chr1229272 8681 8326 8276 7697 6763 6746 6487 6033 5974 3729 3360 3107 2734 2634 2604 2072 2041 1871 544 127 38 27874 785 37784 7386 5989 --
NM_001938chr131432 754 340 11276 21926 303 1557
NM_001939chrX93339 3221 3090 3066 3036 2679 2538 2530 958 --23083 235 23144 550
NM_001942chr1841538 1339 569 273 32068 2015 1560 ----
NM_001945chr531402 1122 477 --1176 1342
NM_001949chr643220 2181 963 415 --2688 233 2241 102
NM_001951chr82159 36 ------
NM_001969chr1432529 1147 914 --23354 1376 --
NM_001980chr1272169 2093 1971 1580 689 458 402 --11918 --
NM_001992chr542023 1942 617 207 --1805 --
NM_001993chr13695 309 220 ------
NM_001995chr451485 583 407 332 224 --11169 --
NM_002006chr494890 3908 1757 1558 1437 1422 1230 1207 805 31996 1267 1025 --1741
NM_002009chr1541862 808 685 530 ------
NM_002013chr14----123 --
NM_002015chr1352920 2838 2421 401 326 12074 12108 --
NM_002025chrX119204 8982 8900 7379 6996 5745 3317 2908 1818 1266 1257 38537 8382 1248 18643 --
NM_002031chr62112 60 ------
NM_002032chr112389 142 ------
NM_002035chr1873893 3383 3015 1308 928 856 33 1542 ----
NM_002040chr2162973 2770 2271 960 622 25 12282 ----
NM_002048chr941243 247 240 135 11202 ----
NM_002051chr101178 1947 ----
NM_002061chr151948 1473 530 361 38 ------
NM_002074chr131423 124 45 ------
NM_002076chr1283237 2224 2213 1990 1307 879 690 510 ----188
NM_002077chr972152 1972 1796 1534 1336 295 264 11707 --11721
NM_002091chr182254 210 ------
NM_002092chr494621 4382 4247 4085 3629 3198 1473 1080 642 2244 145 ----
NM_002103chr197213 180 165 158 152 88 45 --1779 --
NM_002106chr4245 36 ------
NM_002126chr1773432 3269 2806 1175 899 581 259 1382 13749 --
NM_002136chr121238 ------
NM_002137chr72918 733 ----11957
NM_002138chr42821 52 ------
NM_002139chrX2449 259 ------
NM_002140chr911205 159 ----
NM_002157chr22172 138 ------
NM_002158chr272794 2566 2472 2353 1201 1004 371 43196 648 609 240 22865 2547 --
NM_002176chr9154 --144 --
NM_002196chr2021090 742 ------
NM_002196chr2021090 742 ------
NM_002199chr46814 760 248 183 151 104 ------
NM_002210chr262262 1249 1007 816 238 93 --1701 --
NM_002214chr765758 1848 1259 1086 458 441 44047 3721 2049 524 34698 3584 1050 15425
NM_002222chr31154 ------
NM_002223chr1263988 3849 3498 1354 725 519 11017 --1149
NM_002232chr111282 --11079 11273
NM_002235chr1241547 280 201 186 2593 136 --11133
NM_002242chr221840 676 21508 469 --1335
NM_002247chr1062246 1690 1622 720 261 66 ------
NM_002264chr374947 4913 4331 4232 3615 3523 895 ------
NM_002265chr171976 ------
NM_002270chr585439 4603 4554 4269 4006 2004 1402 244 14979 ----
NM_002284chr121556 --1123 --
NM_002285chr294185 3354 3255 3025 2647 1564 941 680 634 --1724 --
NM_002290chr651079 976 935 364 303 ------
NM_002293chr162643 2531 2338 1713 1085 504 --1646 --
NM_002298chr1361651 1222 274 118 85 76 1382 21078 65 11590
NM_002310chr576536 5501 5433 2118 2019 417 282 55031 2419 2204 793 494 --21979 271
NM_002349chr241250 613 211 90 11493 --11603
NM_002350chr851131 1105 928 296 158 ------
NM_002356chr621985 223 --12613 --
NM_002373chr1541366 1360 980 416 --1366 --
NM_002374chr2113616 3537 3530 3471 3317 3226 2796 1468 1334 1307 350 11462 ----
NM_002384chr185838 713 396 166 32 --1960 --
NM_002398chr211103 ------
NM_002402chr71984 --11172 --
NM_002451chr952992 2889 2759 2675 187 23581 3535 ----
NM_002457chr111131 ------
NM_002500chr2----2122 115 --
NM_002508chr141479 756 181 28 1568 ----
NM_002522chr1743279 1379 1180 1071 13164 11170 11554
NM_002545chr11135049 4935 4092 3828 3687 3630 1725 1645 1610 1503 1059 997 434 ----11362
NM_002547chrX64213 4086 3683 2873 70 45 13569 13813 --
NM_002556chr1162139 1894 1710 1440 1401 132 ------
NM_002563chr3--1846 21122 1015 1346
NM_002576chr112947 69 ------
NM_002577chr383951 3193 2705 2583 1580 912 854 350 13817 ----
NM_002581chr995386 5309 4697 4673 4485 2272 1834 1495 1106 34423 3750 881 34228 3501 699 --
NM_002588chr551746 1240 1094 375 324 ------
NM_002590chr132499 131 ----143
NM_002594chr2032505 1623 235 21732 608 --1374
NM_002605chr152949 778 ------
NM_002612chr731897 576 92 ------
NM_002623chr20173 ------
NM_002628chr311258 ------
NM_002634chr172765 157 ------
NM_002646chr171967 1866 1725 1488 681 124 113 12005 1600 --
NM_002655chr8134944 4884 4422 3708 3345 3279 2091 1891 1546 1197 998 853 481 ------
NM_002687chr142857 211 1886 ----
NM_002693chr151382 --1402 --
NM_002703chr41185 131 ----
NM_002707chr21141 ------
NM_002709chr263522 3160 2864 2271 2241 726 ------
NM_002710chr122910 188 ------
NM_002716chr1183686 3526 3462 3093 3064 2444 416 110 23590 818 --199
NM_002718chr362436 2169 621 449 240 184 --1107 --
NM_002719chr1472316 2281 834 645 570 376 253 1671 11534 2871 663
NM_002720chr162215 26 ------
NM_002731chr163181 909 818 303 284 111 ------
NM_002734chr1762114 2064 1691 903 658 451 ------
NM_002737chr17106623 5716 5513 5355 5082 4775 2457 1912 825 725 25118 431 22368 1813 --
NM_002740chr341978 1852 1821 926 12630 ----
NM_002745chr2244559 1416 949 88 --34112 3485 3030 11115
NM_002761chr16------158
NM_002763chr13562 535 59 ------
NM_002765chrX31382 1247 318 ------
NM_002822chr1241583 1212 413 261 --1462 --
NM_002828chr1811002 ------
NM_002834chr1223436 2652 23874 1278 --11469
NM_002835chr7----1201 --
NM_002836chr201186 ------
NM_002837chr1293828 3143 1653 1606 1242 1203 723 630 622 13647 13920 --
NM_002839chr9113467 3284 2779 2726 2380 2290 1209 811 634 162 42 ------
NM_002843chr1193311 2989 2910 2696 2510 2223 2135 761 307 ------
NM_002851chr72782 308 1236 ----
NM_002857chr162657 2021 1776 634 536 352 22044 132 --11912
NM_002868chr1252064 1939 807 730 251 ------
NM_002874chr942467 1923 506 182 ------
NM_002886chr3145024 4805 4673 4640 4392 4276 4236 4211 4153 3326 1351 1052 467 61 1553 ----
NM_002893chrX2342 143 ------
NM_002894chr181193 ------
NM_002897chr21603 ------
NM_002924chr14565 251 182 150 ------
NM_002930chr182258 76 ------
NM_002942chr341340 1064 944 72 ------
NM_002959chr183301 3159 2833 2819 1268 807 388 70 13432 --1527
NM_002970chrX1109 ------
NM_002977chr221240 773 13465 12842 --
NM_002996chr1641950 1785 1767 783 --31880 144 129 11231
NM_002998chr872257 2069 1799 1764 1511 1468 1431 ------
NM_003011chr951705 1554 1250 48 22 --11168 --
NM_003012chr872741 2641 2162 1057 990 293 177 ----12468
NM_003026chr911360 ------
NM_003029chr121102 37 ------
NM_003034chr12127279 7088 6453 5685 5400 5318 5273 3148 3141 2756 2350 138 15667 --165
NM_003042chr361845 1778 849 805 420 237 12243 --11807
NM_003043chr3104044 3886 3360 3214 3181 3014 1641 1383 922 513 33250 835 720 43853 3564 2805 2696 --
NM_003045chr13124672 4592 4068 3855 3781 3490 3246 1792 1785 1307 403 202 --1767 11970
NM_003048chr232522 2361 352 11816 21007 993 --
NM_003059chr51306 ------
NM_003068chr841007 842 281 48 ------
NM_003069chrX2769 203 ----1244
NM_003074chr362016 1902 1823 1808 1677 1448 11931 1118 --
NM_003076chr1251699 1291 1186 120 102 11163 1337 1404
NM_003079chr171733 ------
NM_003081chr203230 197 26 ------
NM_003087chr101252 ------
NM_003099chr1556108 5537 4681 1245 153 21983 968 15438 --
NM_003101chr131492 1098 525 --1112 --
NM_003107chr632511 1877 374 ------
NM_003108chr287315 7260 6787 6375 6126 5265 2441 1828 --16822 --
NM_003110chr1721133 293 ------
NM_003111chr23963 861 460 ------
NM_003112chr762834 2064 996 558 535 133 ------
NM_003113chr23691 607 87 ------
NM_003136chr141399 ------
NM_003137chr612088 --159 2367 102
NM_003139chr111140 ------
NM_003142chr2195 ------
NM_003144chr642068 1692 1670 1399 --21603 600 --
NM_003150chr1732295 1926 496 ----11855
NM_003155chr882461 2442 2302 2063 1803 539 507 325 22812 1118 11946 --
NM_003161chr1722545 1038 33152 2593 937 --12915
NM_003184chr841099 825 426 141 ------
NM_003188chr62766 245 ------
NM_003189chr153047 2652 2583 2298 825 12876 13290 --
NM_003199chr18105603 5433 4676 3769 3625 1773 1705 1099 925 475 15018 --14473
NM_003202chr551644 1317 1258 1192 702 --1397 1248
NM_003205chr1562241 2193 1689 1610 892 697 ------
NM_003206chr61165 ------
NM_003221chr693893 3885 3233 3223 2785 2629 1223 1030 997 1218 ----
NM_003234chr351503 736 451 439 390 --21689 183 --
NM_003236chr2113046 2991 2564 2498 2346 1387 1266 781 518 346 150 1228 12915 1752
NM_003242chr31430 32259 2165 2158 1713 11617
NM_003246chr1561475 1434 1398 1334 222 203 ------
NM_003257chr1521422 352 ------
NM_003262chr3155045 4505 4301 4177 3890 3680 3468 3211 1983 1356 1134 643 586 372 132 ------
NM_003269chr63999 423 51 --1936 --
NM_003270chrX3998 758 246 ------
NM_003298chr3145342 4925 4796 4319 4200 2484 2166 1890 1478 1390 1063 975 872 426 144 ----
NM_003320chr1174204 3892 3649 3577 888 532 422 34415 3045 1447 42787 2758 1237 684 --
NM_003325chr222573 450 --1220 --
NM_003337chr551584 1134 584 552 242 ------
NM_003338chr101163 1359 ----
NM_003342chr1743089 2801 1102 45 1373 ----
NM_003347chr2272151 1783 624 592 538 250 240 12316 1297 --
NM_003349chr2021528 551 ------
NM_003352chr21329 ------
NM_003376chr611405 ------
NM_003376chr611405 ------
NM_003385chr24939 926 747 277 ------
NM_003387chr242660 977 676 498 2862 56 1200 --
NM_003390chr114969 892 409 245 ------
NM_003392chr353664 2651 1733 1571 1081 34006 3410 148 --13741
NM_003400chr21575 ------
NM_003403chr141713 ------
NM_003406chr861759 1580 1433 1381 325 292 ------
NM_003411chrY31351 1214 705 1318 ----
NM_003412chr373026 2619 2538 1099 1086 921 687 ----11177
NM_003418chr31854 ------
NM_003427chr61730 ------
NM_003430chr192650 244 ------
NM_003439chr773495 3158 2491 2158 1094 710 634 12978 12571 --
NM_003445chr193847 595 327 ----1706
NM_003454chr1641221 1068 1028 191 ----1493
NM_003457chr171436 ------
NM_003458chr373495 3396 3157 2893 2871 1351 334 1867 33740 2447 299 1453
NM_003463chr633304 2761 447 ------
NM_003466chr232491 2321 442 11686 32134 1982 1725 21938 201
NM_003474chr1051989 1745 1735 503 59 12269 ----
NM_003477chr112202 160 ------
NM_003478chr1183178 3082 2833 2740 2698 2454 2378 754 ------
NM_003480chr1242112 1410 302 67 21985 1481 ----
NM_003482chr1232760 2008 1019 22131 1824 1730 22503 244
NM_003483chr1211862 --11138 --
NM_003487chr171192 ------
NM_003498chr1692752 2730 2654 2525 2119 2009 1913 1127 1108 --1189 --
NM_003507chr261848 1814 1807 1656 1489 547 --1336 --
NM_003566chr1222422 996 ------
NM_003574chr1865512 5000 4771 4401 4395 3872 2823 307 --15245
NM_003582chr1----1161 --
NM_003583chr1252404 1419 984 930 674 1519 1415 --
NM_003590chr273904 3289 1241 1152 1069 853 162 24007 2476 ----
NM_003603chr452159 2023 1931 1373 105 --1233 1334
NM_003613chr151260 ------
NM_003618chr211140 ------
NM_003629chr183503 3160 3026 2728 1386 1209 566 541 23262 2336 12871 --
NM_003644chr17136071 5450 4914 4594 4506 4445 4161 2067 1929 1597 1272 812 358 --2417 378 --
NM_003663chr342502 1291 1176 450 22328 803 22919 629 --
NM_003672chr141925 1603 623 485 ----1151
NM_003688chrX1304 ------
NM_003713chr13563 157 67 ------
NM_003714chr552706 1968 707 666 66 21071 450 23097 1206 --
NM_003735chr551746 1240 1094 375 324 ------
NM_003736chr551746 1240 1094 375 324 ------
NM_003743chr21855 1354 22047 1584 2619 546
NM_003746chr12165 ------
NM_003750chr104885 753 77 55 ------
NM_003754chr111121 ------
NM_003757chr11326 ----1369
NM_003759chr474176 3512 3373 1521 1089 567 53 11442 --23241 602
NM_003760chr11191 ----1647
NM_003763chr2033052 2811 2320 ------
NM_003764chr61653 2871 145 ----
NM_003787chr1841414 628 286 168 1329 ----
NM_003794chr32225 25 1327 ----
NM_003799chr1894392 3475 3463 3079 2864 1614 963 805 133 1243 34367 3783 2875 11057
NM_003800chr642403 2223 1787 436 --22005 1851 --
NM_003818chr203749 694 98 --156 --
NM_003822chr182998 2844 2115 2027 1985 1270 996 927 --1103 --
NM_003825chr1531511 1146 589 1298 ----
NM_003862chr51272 ------
NM_003864chr41132 ------
NM_003872chr262981 2831 2436 2368 2073 649 --32406 2322 943 --
NM_003873chr1052545 2524 1716 1709 138 21952 353 ----
NM_003888chr1561641 1361 526 483 424 389 ------
NM_003895chr2141704 753 722 581 ----1778
NM_003913chr624269 98 --21641 21 --
NM_003916chrX41419 1284 1098 508 ------
NM_003919chr7177 ------
NM_003922chr151144 ------
NM_003934chr91883 ------
NM_003939chr1083954 3716 3356 2747 2697 2625 1188 679 --1459 --
NM_003947chr35893 886 244 153 76 --1419 --
NM_003951chrX1287 ------
NM_003955chr1781554 1476 636 371 362 308 282 219 ------
NM_003956chr101399 ------
NM_003958chr6103915 3726 3563 3235 3171 3124 3082 2765 1154 769 13378 22515 604 --
NM_003966chr5127208 6952 6789 6339 5889 5815 3146 2398 1938 499 120 109 42120 1287 767 373 37501 3079 1168 --
NM_003994chr12134078 4051 3935 3401 3057 3002 2854 2689 1689 1622 992 721 344 23853 1564 --11728
NM_004024chr131146 1111 303 1955 --1581
NM_004027chr2------176
NM_004028chr18104013 3654 3228 3145 2876 2523 1538 1360 865 194 2713 455 ----
NM_004036chr21251 ------
NM_004050chr1452471 1981 941 906 243 ----11102
NM_004056chr841119 1072 407 215 ------
NM_004080chr73552 376 85 ------
NM_004081chrY31648 1311 650 --21417 35 1482
NM_004094chr14102990 2744 1961 884 389 350 296 194 120 96 11189 ----
NM_004096chr1012053 11625 12157 1836
NM_004099chr962090 1948 1707 1602 428 26 1537 22074 407 --
NM_004105chr21859 ----1238
NM_004109chr1152304 2194 1546 710 558 22137 1881 ----
NM_004113chr361747 1704 1622 1311 1269 537 ------
NM_004124chr1473020 2485 2325 2201 1278 1085 955 13394 1236 --
NM_004126chr71278 ------
NM_004161chr211141 ----11266
NM_004162chr321131 94 ------
NM_004171chr11149534 9430 9218 7980 6864 6028 3638 3379 3287 2885 2873 2509 2038 1252 --26036 366 27399 1546
NM_004215chr84504 371 227 217 1132 ----
NM_004229chrX22174 1437 11685 --11387
NM_004232chr1843393 3058 2910 612 ------
NM_004235chr91227 ------
NM_004241chr101551 ------
NM_004274chr1453088 2471 1091 305 164 33206 2324 620 ----
NM_004279chr772238 1990 1461 809 783 522 456 11494 ----
NM_004293chr953677 2900 2769 2359 685 23581 908 13327 --
NM_004301chr32269 239 ------
NM_004304chr21321 ------
NM_004306chr8159 ------
NM_004331chr862030 1809 1026 931 606 318 ----1908
NM_004337chr821876 315 1768 --11785
NM_004338chr1886145 5959 5613 5586 4558 2296 1909 979 36222 2650 710 17001 --
NM_004342chr752242 2033 1638 1481 322 --11442 --
NM_004352chr162223 120 ------
NM_004364chr192925 314 1189 ----
NM_004370chr62823 263 11477 11530 --
NM_004379chr261761 1283 599 524 340 179 11590 ----
NM_004384chr53772 183 95 --11456 --
NM_004389chr21334 ------
NM_004392chr1351820 738 585 541 427 ------
NM_004393chr352303 2087 2063 1803 1707 --21956 901 1862
NM_004396chr171281 ------
NM_004397chr11124341 4280 4074 3901 3877 3707 3115 2812 1384 1302 887 370 ------
NM_004430chr882372 2145 1979 1030 1017 968 293 36 ----1910
NM_004434chr1451214 651 621 532 309 ------
NM_004437chr1103590 3368 2563 2523 2401 2337 1397 855 744 325 2105 46 22667 376 --
NM_004438chr263131 2960 2623 2199 1065 933 --13018 --
NM_004440chr631433 274 111 ------
NM_004447chr123954 367 46 ------
NM_004450chr141280 ----1328
NM_004458chrX62462 2232 2104 1800 472 364 ------
NM_004464chr464291 3167 2896 977 870 369 33855 3022 2737 13891 --
NM_004482chr22271 115 ------
NM_004485chr1154397 3971 3712 3613 3000 2944 2728 1738 1512 1391 1257 1038 650 304 40 --171 --
NM_004500chr1431977 719 300 161 ----
NM_004516chr195914 849 59 53 43 ------
NM_004529chr931455 566 432 --1240 --
NM_004537chr1231503 1306 98 ------
NM_004540chr213914 790 572 ------
NM_004571chr2172844 2640 2623 2158 1062 984 160 --13255 12891
NM_004575chr441475 1080 484 383 ------
NM_004583chr172752 66 ------
NM_004586chrX75367 4278 4165 4151 3351 1732 653 13576 24896 4688 13501
NM_004595chrX2466 328 ------
NM_004598chr552976 2582 1079 413 285 33059 2355 74 181 --
NM_004612chr984772 4246 3837 3426 3410 1567 947 622 --13937 --
NM_004615chrX2895 77 ------
NM_004621chr1121249 1167 ------
NM_004625chr3164 ------
NM_004631chr121026 474 ------
NM_004637chr361294 1018 908 220 85 61 --1867 --
NM_004660chrY21576 131 ----188
NM_004661chr521220 83 --1810 --
NM_004667chr151213 ------
NM_004670chr1051246 1236 689 465 380 ------
NM_004684chr4------1357
NM_004685chr1342786 2323 2094 901 1481 --1340
NM_004690chr61744 ------
NM_004717chr721290 970 1536 11202 --
NM_004719chr1272663 1971 1866 1019 426 338 218 ------
NM_004726chrX85727 5350 4321 3716 1926 1150 460 189 12188 ----
NM_004734chr1353176 2993 2739 2224 2186 ----178
NM_004737chr2251218 1144 840 832 75 ----1247
NM_004742chr321534 1487 11417 ----
NM_004745chr8176323 5892 5797 5606 5436 5429 5064 4945 4459 4390 2518 1957 1650 1367 1276 642 611 15212 --24911 2809
NM_004748chr1574134 3979 3395 3058 1096 763 590 33739 1170 65 13135 --
NM_004760chr741670 630 324 270 ----127
NM_004772chr511048 1632 ----
NM_004775chr1831926 866 263 22144 304 ----
NM_004781chr13377 168 98 133 --146
NM_004781chr13377 168 98 133 --146
NM_004784chr42100 53 ------
NM_004788chr1162601 2183 1844 1696 1064 356 22695 1034 ----
NM_004789chr9163 ------
NM_004795chr1311723 --177 --
NM_004797chr352757 1158 852 666 364 --2692 28 --
NM_004798chr2063303 2911 2554 629 534 252 22813 2449 23584 1152 --
NM_004804chr282777 2658 2441 2409 2283 1878 1754 927 12112 ----
NM_004808chr1063154 2825 2114 961 662 75 ----12735
NM_004815chr154325 4138 2992 1980 1619 24253 3393 14018 --
NM_004822chr1733833 1392 966 --33348 2901 1256 --
NM_004834chr252989 317 311 204 33 --12593 144
NM_004835chr31821 ------
NM_004835chr31821 ------
NM_004844chr32118 108 1769 ----
NM_004845chrX73963 3279 3060 988 499 449 250 --21352 810 --
NM_004849chr63648 603 73 1418 ----
NM_004850chr241757 493 344 31 11588 ----
NM_004857chr1454771 3035 1229 956 883 24390 1134 23907 3668 --
NM_004859chr1752465 1157 740 593 344 ------
NM_004863chr14125125 4907 4209 4018 3745 3380 3269 2037 725 505 456 146 34381 1594 75 13358 --
NM_004866chr574349 4009 3924 1990 1026 587 50 1350 ----
NM_004871chr1764282 4205 3616 3462 2770 2703 ------
NM_004887chr54949 870 245 30 11138 ----
NM_004902chr201602 ------
NM_004904chr7156588 6006 5692 5591 5254 5054 4546 4394 4253 2320 1426 744 399 236 111 --24788 1420 128
NM_004912chr731647 1633 1296 1167 ----
NM_004921chr142312 1818 1578 367 1907 --21684 869
NM_004932chr541416 179 107 24 ----1523
NM_004939chr22157 58 ------
NM_004956chr754457 3370 3097 1811 1619 13203 23029 1842 --
NM_004960chr16178 ------
NM_004961chrX41030 344 53 35 11235 1249 --
NM_004965chr211650 ------
NM_004976chr1135135 3943 3891 --54426 4197 1829 1572 1555 --
NM_004979chrX31075 788 55 ------
NM_004985chr1244155 3705 1379 898 --1180 --
NM_004992chrX238249 8166 7407 7061 6848 6829 6314 6153 6122 5991 5711 5678 2937 2610 2333 1347 1312 1165 1008 947 763 644 268 15140 67755 7694 7369 5744 2625 1174 16137
NM_004992chrX238249 8166 7407 7061 6848 6829 6314 6153 6122 5991 5711 5678 2937 2610 2333 1347 1312 1165 1008 947 763 644 268 15140 67755 7694 7369 5744 2625 1174 16137
NM_004993chr145960 530 510 182 38 11415 ----
NM_004999chr664473 4283 1180 914 879 236 13749 ----
NM_005028chr1052278 2187 1477 1438 565 21684 809 ----
NM_005032chrX41048 1030 825 66 ------
NM_005045chr7131 ------
NM_005054chr261365 1133 556 525 423 247 ------
NM_005063chr1073363 2844 2544 1136 1025 370 322 22825 1258 1648 13635
NM_005066chr12314 279 ------
NM_005067chr321009 22 ------
NM_005077chr92393 115 ------
NM_005079chr842845 2675 326 54 22071 278 1480 --
NM_005088chrX3916 629 582 --1815 --
NM_005093chr20145093 4773 4691 4482 4360 3405 3336 2046 1923 1775 1459 1453 671 134 23314 2011 13935 --
NM_005105chr142228 2126 1825 345 ----134
NM_005109chr351875 710 634 583 321 --2894 278 --
NM_005114chr4----1577 --
NM_005121chr1753835 3331 1510 1155 125 ------
NM_005128chr211662 ------
NM_005135chr1583351 3150 2603 2341 780 645 585 239 33236 2522 860 12349 --
NM_005141chr42399 93 ------
NM_005153chr163753 187 180 ------
NM_005156chr985343 5271 4197 1902 1855 1626 1007 125 24884 4285 ----
NM_005168chr221763 613 ----1293
NM_005171chr1231245 227 113 1896 ----
NM_005184chr1951608 1575 313 247 71 ------
NM_005187chr1691627 1441 1395 1365 1335 813 414 167 86 11677 2261 58 --
NM_005188chr11128314 7990 7518 7429 7198 2857 2433 2359 2141 823 538 440 47938 5481 1037 145 ----
NM_005189chr1752343 2304 2177 988 878 12226 22200 291 12427
NM_005201chr331108 361 88 ------
NM_005214chr23958 457 401 143 --1925
NM_005220chr1731317 919 227 --2990 137 21396 281
NM_005235chr2127594 7079 6554 5194 5163 3097 2379 2198 2093 2034 1260 43 --25330 1690 16533
NM_005238chr1153293 3124 3112 1142 42 22599 1185 22583 628 --
NM_005243chr221347 ------
NM_005245chr4187 ------
NM_005254chr1521215 234 ------
NM_005264chr101806 ------
NM_005271chr1041263 1178 902 140 ------
NM_005273chr71361 ------
NM_005284chr62400 334 ------
NM_005339chr483944 3386 3370 2844 2823 1596 1212 756 --11010 --
NM_005342chrX52685 2357 2161 1107 230 1750 ----
NM_005359chr1856008 5308 1802 1161 454 --16200 --
NM_005373chr171670 1491 1449 1407 1311 610 314 1386 --11426
NM_005375chr621010 375 --2444 42 --
NM_005378chr23829 303 295 ------
NM_005399chr1104347 3838 3567 3500 3096 2783 1742 1640 1069 619 13048 2408 23 --
NM_005409chr411079 ------
NM_005415chr21288 ------
NM_005433chr1842494 2263 490 176 ------
NM_005436chr1053798 3336 1421 746 26 ------
NM_005445chr101308 ------
NM_005455chr12410 89 ------
NM_005465chr181872 1692 1588 1547 283 222 186 36 ------
NM_005487chr2241307 575 386 368 ------
NM_005497chr17106160 5716 5375 4951 4164 3775 2119 2017 1851 128 25805 2157 13847 14192
NM_005499chr19179 ------
NM_005502chr973170 3078 2944 2836 2259 2111 2069 --1696 --
NM_005509chr511744 ------
NM_005511chr92299 120 --1905 --
NM_005512chr1151514 671 534 433 109 --1789 --
NM_005520chr5----1239 --
NM_005530chr1541531 1057 197 36 1601 ----
NM_005537chr131689 ------
NM_005542chr731714 1607 1223 1767 1526 --
NM_005544chr23957 276 81 1363 ----
NM_005562chr131712 1647 562 --21536 650 --
NM_005566chr113525 435 218 ------
NM_005582chr5----154 --
NM_005595chr11892 ------
NM_005596chr995184 4848 4140 2581 2196 2173 1802 1628 942 --195 --
NM_005602chr341277 1120 1044 103 1931 ----
NM_005604chr621576 86 ------
NM_005605chr8197 ------
NM_005613chr182088 1899 1669 1454 831 776 396 87 ------
NM_005618chr62647 54 ------
NM_005627chr62385 218 ------
NM_005637chr1842073 1875 1715 1580 ------
NM_005638chrX31613 444 111 2513 382 1152 --
NM_005662chr81118 ------
NM_005665chr194798 4750 4371 4117 3979 3319 3111 3089 592 23692 1382 ----
NM_005668chr564541 2867 2848 1235 988 175 11507 24341 4297 11613
NM_005669chr542248 2005 1590 926 ----12206
NM_005685chr71104 ------
NM_005688chr33912 890 233 ----1898
NM_005711chr52812 163 ------
NM_005720chr71261 ------
NM_005722chr252240 2089 824 307 255 ----182
NM_005725chr142067 1875 886 505 ------
NM_005731chr21287 ------
NM_005734chr11------1781
NM_005739chr1541839 1773 1652 439 ------
NM_005746chr72776 428 1463 ----
NM_005752chr1611129 --125 164
NM_005754chr52202 43 ------
NM_005759chr294721 4659 4206 3249 2952 1839 1298 994 81 11378 ----
NM_005779chr5103541 3425 1359 985 856 802 630 455 445 368 11137 1872 --
NM_005780chr132703 79 ------
NM_005795chr242603 2221 2007 85 12799 ----
NM_005797chr1151594 1369 587 241 107 2623 34 ----
NM_005813chr251942 1839 1686 760 610 1711 --11899
NM_005826chr12618 63 ------
NM_005828chr1734679 3204 1125 13283 1901 13988
NM_005832chr311460 ------
NM_005839chr11805 ------
NM_005840chrX197575 7034 6810 6279 5844 5700 5361 2973 2796 2487 2324 1928 1921 1902 1754 1439 891 683 445 1402 ----
NM_005852chr171264 ----1158
NM_005857chr121229 960 ------
NM_005862chr32917 726 ------
NM_005863chr1021334 901 --11005 --
NM_005868chr742320 2040 948 33 11665 21619 1600 --
NM_005885chr531551 1135 1106 ------
NM_005896chr23701 682 559 ------
NM_005900chr431175 999 833 ------
NM_005901chr1898463 6920 6643 5976 5949 5914 2850 1052 728 47111 5703 2993 103 11954 --
NM_005903chr575122 4723 3575 3558 1727 1544 1057 ------
NM_005909chr563466 3438 1719 804 781 55 21712 1204 ----
NM_005910chr1773731 2759 1325 1055 374 211 172 --33796 3692 3285 --
NM_005911chr231465 593 319 --157 --
NM_005923chr63688 432 269 ------
NM_005927chr531292 816 795 11173 1457 --
NM_005935chr465187 4074 1771 1228 845 100 11637 ----
NM_005937chr1773862 3718 3705 2638 1321 987 131 --24072 3059 13506
NM_005941chr842948 1453 651 540 31115 507 60 ----
NM_005955chr185372 5356 5073 4373 4284 1943 1537 1009 24669 1824 11325 --
NM_005966chr242303 2073 1985 1978 --12369 --
NM_005977chr133953 241 51 --1354 --
NM_005998chr13223 152 22 ------
NM_006009chr121135 ------
NM_006010chr31208 ------
NM_006011chr1574053 2998 1691 1414 1282 1246 509 ------
NM_006033chr1861624 363 242 222 216 53 22339 1707 ----
NM_006036chr272587 2275 1822 979 598 385 60 --1285 --
NM_006037chr264477 3018 1363 1167 1157 929 --11469 --
NM_006038chr2051644 1615 1347 865 664 --2573 27 --
NM_006040chr1631306 1069 142 --1515 1486
NM_006054chr1141426 1066 1029 112 1593 ----
NM_006055chr2113090 3007 2737 2523 1961 1258 1246 756 427 191 83 2527 513 ----
NM_006060chr754040 3523 3086 599 305 12994 --11514
NM_006064chrX2404 281 ------
NM_006078chr22199 ------
NM_006080chr782319 2259 2012 857 756 696 439 421 ------
NM_006094chr852110 2031 1793 726 501 12275 --1539
NM_006095chr494503 4175 3735 3587 2869 953 672 637 379 --140 13927
NM_006106chr1142897 664 206 43 ------
NM_006122chr1542519 2111 1073 319 ----1896
NM_006134chr2151581 1439 1379 1258 1238 ------
NM_006141chr1672803 2790 2712 2223 800 572 156 1428 11049 --
NM_006143chr12196 ------
NM_006158chr82575 520 ------
NM_006166chr1272367 2281 1998 1968 1906 1645 354 --1827 --
NM_006186chr22470 22 ------
NM_006191chr122172 156 --1279 --
NM_006194chr1451195 1011 861 455 99 ------
NM_006197chr881954 1701 1693 1636 1559 1467 810 458 1560 ----
NM_006203chr584817 3549 1202 677 498 275 193 54 33394 2020 288 --14088
NM_006209chr82289 160 ------
NM_006224chr1742524 2261 2155 324 --12201 1229
NM_006246chr142270 179 --1150 --
NM_006252chr197363 5970 5813 4623 2463 1871 1068 778 121 17314 27000 695 1512
NM_006256chr141714 1068 650 167 12284 ----
NM_006275chr2012021 --1164 --
NM_006277chr21607 ------
NM_006281chr82285 277 ----1196
NM_006281chr82285 277 ----1196
NM_006282chr2074271 4220 3770 3131 1860 1304 650 33821 3601 1063 --12973
NM_006283chr884629 3924 3862 3728 3333 1709 1185 460 23847 78 24062 851 --
NM_006290chr621736 1238 --11930 --
NM_006298chr642926 2791 2213 623 23332 433 ----
NM_006306chrX105868 5071 4979 4555 4534 3845 1952 1398 1189 1090 1437 ----
NM_006310chr1731089 500 158 ------
NM_006330chr83575 417 80 ------
NM_006334chr91114 ------
NM_006371chr3105178 3796 3616 1659 1350 937 819 308 139 111 --24656 994 13808
NM_006379chr782196 1691 1517 726 549 405 266 51 ------
NM_006380chr1774225 3650 3644 3563 2789 1555 43 23834 1328 ----
NM_006386chr2252334 2206 2026 1799 26 ------
NM_006390chr121261 11204 ----
NM_006391chr111274 ------
NM_006393chr10104403 4274 3625 3336 3301 3204 1631 1441 786 451 ----11336
NM_006416chr61674 ------
NM_006434chr1072853 2487 2378 1230 1040 1016 162 22072 310 1390 --
NM_006439chr41218 ------
NM_006457chr473739 3681 2706 2593 1385 805 774 ------
NM_006460chr1721724 602 11507 --11635
NM_006482chr1252404 1419 984 930 674 1519 1415 --
NM_006516chr141456 1094 129 83 ----1176
NM_006517chrX82077 1735 1721 1653 894 282 206 161 --1153 --
NM_006520chrX161 ------
NM_006526chr2041952 728 467 421 ----1749
NM_006532chr1962070 1710 1590 1406 653 610 --21494 772 11581
NM_006538chr243835 3176 755 323 11299 23218 3009 13147
NM_006544chr1496013 5689 5064 4529 3726 1824 1806 1409 263 15443 25573 5283 --
NM_006546chr17146610 5861 5687 5653 5527 5373 5321 5149 4563 2462 814 725 590 412 131 24086 280 16229
NM_006548chr331460 509 48 ------
NM_006552chr11193 ------
NM_006560chr111370 ------
NM_006561chr10146157 5495 5355 5164 4696 4600 4319 3926 2205 2051 1514 1096 463 427 24552 4166 34425 1547 1411 --
NM_006565chr1631310 982 321 --1139 --
NM_006572chr1782494 1411 1205 1113 615 391 311 242 21070 494 ----
NM_006595chr1161740 1613 1604 1439 310 232 1822 ----
NM_006599chr16116928 5830 5568 5074 2980 2825 1913 1323 1085 1071 316 22788 39 27868 6328 --
NM_006601chr12191 ------
NM_006603chrX31802 785 42 1618 1104 --
NM_006614chr393676 3292 2754 2651 2392 2376 1362 1053 163 ------
NM_006618chr161608 1231 1134 613 66 48 1150 11063 --
NM_006620chr664644 3236 3161 2941 1935 180 160 11388 --
NM_006624chr1041860 1698 1410 173 167 11391 --
NM_006628chr1584651 4195 3958 3863 3531 3046 1850 1133 24304 3219 ----
NM_006629chr1872584 2265 2059 2046 586 326 183 ------
NM_006633chr51710 ------
NM_006646chr1332483 791 404 --12808 --
NM_006650chr5103649 3487 3318 3260 3238 3094 2713 912 640 397 ----22642 2590
NM_006654chr1294512 3973 2986 1569 1486 1092 1072 440 321 ------
NM_006667chrX2472 451 ------
NM_006699chr152621 2172 1671 995 571 22487 364 --12451
NM_006703chr61414 ------
NM_006717chr963243 3067 2961 2656 2469 792 12450 11235 --
NM_006726chr421138 431 --11098 --
NM_006731chr9124306 4193 4031 3759 3611 1969 1102 1024 967 771 487 314 12073 ----
NM_006748chr851634 1536 1205 577 48 11146 2372 339 11188
NM_006750chr16167538 7170 6015 5984 5571 5257 5193 2887 2821 2773 2747 2057 1833 761 212 202 36933 1898 926 16418 --
NM_006754chr71281 ------
NM_006756chr811308 ------
NM_006774chr72171 164 ------
NM_006811chr202839 209 ------
NM_006828chr61153 1123 1653 1507
NM_006836chr12178 ------
NM_006873chr272749 2613 1330 1241 1186 1025 817 --1833 --
NM_006875chrX2863 772 ------
NM_006885chr1653522 1385 1201 707 89 1636 ----
NM_006886chr20137 ------
NM_006888chr1453300 3178 872 837 567 --12390 --
NM_006922chr272541 2243 1605 1030 767 726 664 12484 --180
NM_006924chr1742809 1607 1211 938 23273 3194 1496 --
NM_006925chr141414 ------
NM_006930chr51737 ------
NM_006939chr14------1900
NM_006948chr2142088 1810 222 89 21893 835 --1601
NM_006990chr14967 595 487 153 1579 2250 166 --
NM_007006chr1673408 3101 2734 2321 883 562 484 ----1414
NM_007008chr23806 732 649 ------
NM_007011chr15205763 5662 5630 4745 4373 2487 1910 1735 1701 1441 1425 1384 1306 1244 1120 990 975 840 440 26 15460 32660 1090 176 11582
NM_007013chr81962 --1311 --
NM_007015chr132288 203 ------
NM_007017chr51780 ------
NM_007030chr584678 4615 4163 3411 3261 3160 965 257 34858 1104 382 11604 --
NM_007039chr1421596 225 ------
NM_007050chr20197432 7402 7357 7210 7101 6198 6163 6094 5963 5942 5898 5650 3156 2799 2611 1475 1428 884 200 36222 2218 1896 47700 2531 1531 117 1983
NM_007078chr1032774 2056 1977 2270 230 11964 1649
NM_007106chr1322411 349 --1260 22658 1880
NM_007107chr342185 525 517 378 --1878 --
NM_007114chr342782 2528 1074 72 22701 1277 ----
NM_007124chr621885 69 --11746 --
NM_007137chrX65543 4566 4327 4088 1955 1626 35018 1044 84 11942 --
NM_007145chr1911328 --21166 541 --
NM_007146chr1742201 622 306 143 ------
NM_007166chr113448 258 29 ----1971
NM_007172chr2243069 2942 1126 332 2834 98 1287 --
NM_007175chr863650 2753 1109 1065 341 220 --1401 --
NM_007184chr33564 457 75 ------
NM_007195chr1873742 3341 3273 3027 2760 2703 1262 13519 12740 12998
NM_007238chr2074662 3941 3788 1734 763 339 98 14435 14676 24780 4602
NM_007246chr421017 48 ------
NM_007249chr13158948 8074 7903 7836 7733 6905 6735 6023 3568 3141 2709 2084 1734 1386 813 12698 ----
NM_007275chr33827 772 331 ------
NM_007287chr3122514 2464 2305 2161 2143 2008 1974 677 485 474 194 67 ------
NM_007288chr3122514 2464 2305 2161 2143 2008 1974 677 485 474 194 67 ------
NM_007289chr3122514 2464 2305 2161 2143 2008 1974 677 485 474 194 67 ------
NM_007308chr42243 72 ------
NM_007325chrX72032 1968 1612 1570 841 442 419 --21989 62 --
NM_007345chr1831927 1578 737 --190 --
NM_007349chr72341 299 ------
NM_007350chr1294448 4398 4108 3776 3508 3441 1639 944 377 34003 3821 350 ----
NM_007363chrX2237 98 ------
NM_007375chr122520 2425 1639 12544 12043
NM_009585chr31821 ------
NM_009585chr31821 ------
NM_012064chr122791 174 ------
NM_012069chrX52578 2223 1929 1918 84 1113 ----
NM_012074chr1421067 844 1244 ----
NM_012081chr542584 1467 1337 58 --12882 --
NM_012082chr81377 ------
NM_012095chr1032842 2355 39 23373 2722 23439 485 --
NM_012096chr331116 718 607 21402 660 ----
NM_012097chr251624 1503 487 407 199 --12150 --
NM_012104chr11103407 3207 2787 2491 2419 2384 1321 1232 322 175 --1948 1692
NM_012104chr11103407 3207 2787 2491 2419 2384 1321 1232 322 175 --1948 1692
NM_012110chr43256 46 29 ------
NM_012115chr62151 55 ------
NM_012120chr663000 2993 2792 2516 1828 33 ------
NM_012129chr722226 1705 ------
NM_012141chr13103573 3497 3426 2864 2587 1405 848 248 208 42 23922 2742 ----
NM_012156chr2042875 2405 465 83 43238 1262 563 311 23105 475 --
NM_012160chr6------1203
NM_012193chr1194023 3606 3291 1781 1766 1421 1348 1104 316 1308 24905 4424 25224 2052
NM_012197chr931177 1007 475 ------
NM_012199chr154057 4014 1426 896 44 24167 3933 23518 2845 14261
NM_012207chr1021031 693 ------
NM_012214chr275237 5015 4301 4294 1507 1167 1084 76430 6007 5579 4809 3905 2402 1132 15540 --
NM_012238chr1031710 523 238 11266 ----
NM_012242chr103833 134 121 ------
NM_012247chr10162 ------
NM_012249chr283464 3347 2700 2629 2264 1115 963 394 --22385 487 --
NM_012250chr1141180 384 308 207 ------
NM_012255chr201170 1317 ----
NM_012257chr72873 232 ------
NM_012262chr164547 4351 3210 1685 694 181 --12086 --
NM_012281chr721605 140 123 ----
NM_012287chr394144 3979 3815 3594 3588 2941 1392 1331 1136 ------
NM_012288chr6114049 3953 3883 3870 3854 3599 1665 1604 970 867 815 25211 1437 44800 2265 1831 1287 --
NM_012294chr774078 3347 2740 2479 1400 1266 785 --1484 --
NM_012297chr422142 699 1749 ----
NM_012300chr561961 1592 1022 493 449 356 --2222 153 --
NM_012301chr742255 2032 1684 810 ------
NM_012302chr121276 22 ------
NM_012306chr12143212 3104 3071 2677 2671 2397 1313 1274 1230 1182 451 284 237 29 --23451 1398 --
NM_012307chr1811004 ------
NM_012308chr1142495 2152 1767 1648 --21846 973 --
NM_012309chr11104816 4684 4478 4228 3553 1985 1950 1574 1439 730 2888 308 1843 1852
NM_012316chr164860 4724 3936 3817 2075 861 --11904 --
NM_012325chr202165 42 ------
NM_012327chr182494 71 1487 ----
NM_012329chr172666 22 ------
NM_012334chr594666 4353 3588 1426 1109 918 905 217 67 44393 4154 4006 3895 22906 146 11885
NM_012382chr564525 4202 3665 3615 3013 1516 ------
NM_012383chr92366 52 ------
NM_012417chr172531 398 --1572 --
NM_012420chr1042329 2135 777 561 1375 128 --
NM_012428chr153808 349 96 ------
NM_012463chr1221703 403 ------
NM_012464chr422716 821 1782 22869 249 --
NM_012465chr1073037 2873 2748 2458 2206 829 358 --12802 --
NM_012482chr11646 ------
NM_013231chr1443625 1218 1145 191 --1476 --
NM_013233chr251291 1215 272 146 61 11120 1193 --
NM_013235chr53884 629 578 1274 2818 706 --
NM_013236chr2241189 1119 1058 481 ------
NM_013246chr112621 33 --1865 --
NM_013257chr81876 11828 1306 12017
NM_013261chr473450 2934 2711 2440 1386 1380 465 13466 --13281
NM_013262chr64941 450 197 94 11387 ----
NM_013269chr1274556 3874 3562 1770 1487 1158 1073 11329 ----
NM_013272chr15277 39 ------
NM_013281chr201506 ------
NM_013302chr1684094 4045 3241 3083 2857 1805 1073 386 11380 44622 3795 3421 1163 11624
NM_013309chr1532590 2035 1651 1272 1967 11823
NM_013336chr341940 580 157 36 ----1523
NM_013341chr282736 2429 2398 1022 857 385 236 37 11974 ----
NM_013352chr6----1901 --
NM_013354chr841476 1328 1304 453 ------
NM_013357chr85748 686 238 229 196 ------
NM_013372chr1552788 2763 2656 2409 602 11157 13325 --
NM_013374chr352520 1047 1000 805 752 12383 ----
NM_013381chr121218 --1806 --
NM_013386chr121718 144 ------
NM_013434chr21725 1230 31793 1680 1673 31706 1468 79
NM_013434chr21725 1230 31793 1680 1673 31706 1468 79
NM_013444chrX----1846 --
NM_013450chr21331 ------
NM_013951chr232491 2321 442 11686 32134 1982 1725 21938 201
NM_013952chr232568 2398 519 11763 32211 2059 1802 22015 278
NM_013953chr232568 2398 519 11763 32211 2059 1802 22015 278
NM_013986chr221347 ------
NM_013989chr1444343 3989 3971 141 --24633 4451 14098
NM_013992chr232568 2398 519 11763 32211 2059 1802 22015 278
NM_013995chrX72547 2298 1790 883 742 186 55 ------
NM_014005chr532724 2514 2466 1522 11936 1624
NM_014011chr221622 411 1391 --12249
NM_014016chr321478 1248 ------
NM_014021chr183465 3436 3033 2866 2126 2120 91 54 --13192 12786
NM_014028chr632893 2323 204 12573 ----
NM_014034chr651553 1043 529 389 199 ------
NM_014048chr16104213 4094 3956 3442 1720 1315 846 704 634 258 --11914 --
NM_014112chr8104164 3759 3632 3466 1827 1056 1031 851 488 414 14543 13440 --
NM_014117chr1672719 2355 1776 1047 666 398 273 ------
NM_014141chr765236 4990 3669 3573 1753 1451 21648 1188 ----
NM_014154chr331360 1112 312 ------
NM_014155chr1197050 6951 6067 5825 5747 5475 1877 1032 891 25703 2555 --26363 2727
NM_014157chr1642693 1361 1153 219 23679 3501 33237 2597 1007 --
NM_014191chr122955 105 ------
NM_014211chr561474 1279 592 166 153 37 1675 ----
NM_014217chr111726 11454 ----
NM_014234chr61161 ------
NM_014240chr373922 3092 1285 670 557 247 194 11426 1992 --
NM_014243chr411830 --11544 --
NM_014250chr2241307 575 386 368 ------
NM_014253chrX1305 11763 ----
NM_014268chr1811276 --1973 --
NM_014283chr111547 ------
NM_014294chr831099 465 216 1375 ----
NM_014309chr2285181 5148 4977 3995 1287 1187 690 211 13966 15385 --
NM_014319chr121146 124 ----
NM_014323chr223703 425 137 --1260 --
NM_014331chr4157776 7376 6332 6063 5973 5865 5432 4939 4758 1985 1815 1624 1593 879 332 32034 641 163 ----
NM_014333chr1142073 983 499 387 ------
NM_014335chr1541387 1005 109 75 ------
NM_014368chr931623 292 74 ----11389
NM_014372chr121495 261 --126 --
NM_014376chr522581 1770 ------
NM_014386chr5168 --134 1123
NM_014393chr831797 1643 1548 ------
NM_014400chr191115 --1401 --
NM_014405chr1782328 2010 1910 1746 1699 905 128 27 ----1548
NM_014418chr1481873 1602 1376 553 403 341 211 70 --11311 --
NM_014423chr5115343 4436 4420 4350 4084 3670 1769 1666 1187 553 186 33633 1364 472 ----
NM_014445chr352387 2309 2175 167 144 ------
NM_014447chr43522 359 317 ------
NM_014452chr611114 1325 11197 --
NM_014454chr62686 293 --1193 --
NM_014458chr121343 287 --1964 --
NM_014491chr72901 838 ------
NM_014494chr1632235 2138 1761 ------
NM_014571chr162808 2717 2290 2112 150 124 12825 21082 853 --
NM_014573chr1741624 1569 1474 496 11507 11279 --
NM_014577chr222910 144 ------
NM_014584chr1431112 1106 295 ------
NM_014585chr2175 1394 1448 --
NM_014606chr431444 551 102 ------
NM_014612chr921284 966 ------
NM_014613chr542790 2524 2489 1020 12187 ----
NM_014615chr1673543 3294 2791 1315 543 145 139 ------
NM_014616chr372576 2215 1310 722 628 580 100 ------
NM_014620chr121152 ------
NM_014621chr2----2218 95 --
NM_014630chr1583857 3633 3464 3134 1561 1473 1029 271 33103 2945 1313 21162 933 22536 1154
NM_014635chr261333 1096 518 487 387 211 ------
NM_014636chr984393 4181 4143 3643 1153 1146 925 758 12763 --1528
NM_014666chr521022 344 1502 ----
NM_014667chr311720 ----22291 966
NM_014676chr131659 1550 135 11264 --1119
NM_014682chr852273 825 493 401 50 ------
NM_014689chr2------131
NM_014701chr1593438 3257 2630 2233 588 382 330 178 29 1191 1703 --
NM_014702chr643194 3129 217 146 23359 1390 ----
NM_014705chr751444 734 707 683 486 ------
NM_014707chr741986 1881 1475 1465 ------
NM_014717chr191847 ------
NM_014721chr677041 6430 5700 4701 2734 2346 182 21551 1535 14514 12840
NM_014730chr1294914 4787 4548 4130 3880 3849 3777 1424 1336 1664 21777 1240 14102
NM_014730chr1294914 4787 4548 4130 3880 3849 3777 1424 1336 1664 21777 1240 14102
NM_014732chr1685783 5338 5025 4991 3719 2195 1967 1072 14037 31906 1158 1024 14712
NM_014735chrX31555 710 160 12094 ----
NM_014741chr1172165 2155 2143 2108 2099 1826 604 --12073 --
NM_014743chr422454 105 32934 2881 568 11988 1425
NM_014747chr1115557 5423 5388 5205 4746 4613 4006 1201 1152 1092 754 --53569 1598 1275 808 342 --
NM_014751chr811485 ------
NM_014755chr2103552 3306 3252 3192 2904 2611 1693 905 293 173 13904 12833 --
NM_014758chr1161941 1639 1619 871 672 566 22444 2252 187 --
NM_014766chr763812 3566 2920 1367 1044 580 22687 726 ----
NM_014771chr161861 ------
NM_014776chr1243035 2938 2372 1976 11104 32719 487 470 --
NM_014787chr162791 2725 2267 792 177 93 ----1461
NM_014795chr231211 1195 1047 1108 ----
NM_014803chr1062578 2564 2422 905 668 384 ----1708
NM_014810chr173272 2772 2310 1328 874 830 435 --11421 12654
NM_014812chr11554 ----11444
NM_014820chr341979 1322 606 52 11728 11301 --
NM_014830chr1283457 3103 3013 2956 2662 1276 744 423 161 23337 1170 --
NM_014832chr1341678 1455 1381 451 ------
NM_014835chr2042276 2016 1495 568 --1829 11878
NM_014836chr1031359 768 700 1715 --1602
NM_014839chr152459 1603 673 656 295 --11697 --
NM_014841chr65976 532 517 133 60 ------
NM_014844chr1464193 4026 3256 3124 307 262 --11282 --
NM_014864chr1114095 3606 3264 3120 3019 2715 1440 1297 1273 825 65 23436 2976 ----
NM_014873chr184115 3933 3184 1611 1501 856 522 499 ------
NM_014877chr17107513 7413 5344 5332 2910 2582 2370 1749 960 911 27505 5369 26000 722 11668
NM_014893chrY82253 2234 1946 1577 343 316 299 84 ------
NM_014904chr1043159 2501 674 571 11030 23676 2837 --
NM_014906chr1773802 3361 3158 2514 1259 1005 329 ----11341
NM_014912chr1022792 2234 --11127 --
NM_014920chr653439 1511 957 812 482 21374 1116 1658 --
NM_014923chr1352320 2279 2034 2025 1627 1287 ----
NM_014932chr311378 31979 1630 243 ----
NM_014934chr13103684 3189 3125 2469 1444 1404 1323 1309 1035 519 1596 ----
NM_014939chr1841337 1168 392 291 ------
NM_014946chr262854 2447 1980 1907 1027 61 22798 342 ----
NM_014947chr163087 2517 1009 725 604 513 12527 ----
NM_014950chr1461789 1469 1142 704 222 44 1158 1324 --
NM_014953chr13124179 3694 3679 3565 3449 3207 1210 678 667 423 71 23 24141 2705 11021 --
NM_014964chr1761876 1539 959 218 176 120 182 11720 2800 318
NM_014969chr13916 740 377 194 1276 --
NM_014974chr1051820 1478 538 524 368 ----11623
NM_014982chr1484925 3742 3344 1560 1393 1319 1082 46 24719 971 ----
NM_014988chr492508 2330 2223 2166 1746 1117 885 817 778 21756 446 ----
NM_014989chr652048 1583 735 575 25 ------
NM_014990chr1471104 1064 863 835 453 384 98 ------
NM_014991chr493269 2706 2437 2012 1274 643 609 486 248 ----1279
NM_014992chr142243 47 ------
NM_014996chr34884 813 366 33 ------
NM_014999chr12178 ------
NM_015000chr1242914 2548 1084 340 1151 ----
NM_015002chr1252248 2151 2118 1666 609 148 --12040
NM_015008chr383265 2962 2782 2728 2455 2298 1161 678 1188 --23402 149
NM_015017chr131194 961 319 ------
NM_015025chr252754 2711 2486 809 652 ------
NM_015026chr1284786 4604 4386 4144 3020 1487 401 271 13569 1867 --
NM_015027chr161278 --1382 11300
NM_015064chr1263643 3276 2734 1151 774 586 --12615 11336
NM_015068chr762726 1281 945 865 589 192 23259 2937 ----
NM_015069chr161117 ------
NM_015071chr5126117 5233 5140 4567 4006 2326 1281 1186 1118 732 576 420 --11992 12362
NM_015074chr1144659 4634 4392 4190 4090 3741 3679 3554 1852 1635 1594 1320 1103 329 41826 1774 1151 431 ----
NM_015076chr693871 3644 3346 3263 2833 2827 2812 960 48 1805 13086 --
NM_015080chr1111015 ------
NM_015090chr1125879 4654 3898 3865 3843 2101 1729 1406 875 852 568 391 34789 1635 786 --11424
NM_015092chr1654094 3947 2898 1763 794 24442 383 ----
NM_015107chrX62167 2088 2039 2001 1701 491 --1779 --
NM_015138chr1542786 2464 542 120 12677 ----
NM_015144chr16113428 2983 2548 2460 1368 1252 980 774 766 580 335 --43319 1311 667 383 12693
NM_015147chr282899 2545 2148 1190 1158 772 200 121 12391 --172
NM_015149chr152047 1672 1472 1350 632 11693 ----
NM_015155chr1053051 2912 1159 682 675 1261 --22635 1023
NM_015156chr1464038 4007 3402 3341 918 726 23727 3396 13443 1801
NM_015170chr852357 2254 2034 879 331 ------
NM_015172chr111657 ------
NM_015185chrX62662 2197 1213 1188 920 265 11151 --12354
NM_015192chr2031965 248 41 --1474 --
NM_015198chr711074 ------
NM_015199chr392381 2153 2105 2043 937 695 619 298 39 --12958 12236
NM_015206chr1563886 2715 1361 1095 791 288 12404 ----
NM_015208chr1854054 3264 3070 2754 2507 --1318 --
NM_015216chr531278 444 104 ------
NM_015230chr431832 1786 68 ------
NM_015231chr112324 121 ------
NM_015251chr1652025 1543 1513 356 332 ------
NM_015265chr262348 2265 2142 1043 898 39 --12129 --
NM_015271chr493965 3815 3344 3141 3070 2900 788 372 123 11336 13459 --
NM_015272chr1631728 1470 1461 ----11630
NM_015275chr1241597 656 365 168 12153 ----
NM_015278chr673139 2889 2857 2340 1353 300 171 ------
NM_015282chr222972 2359 --32562 2491 724 --
NM_015285chr1862496 2181 1695 979 50 40 ------
NM_015296chr133186 75 55 ------
NM_015299chr1494056 3467 3108 2896 1574 836 712 50 40 22699 1491 33064 1346 312 33535 1455 757
NM_015310chr8128166 7780 7241 6933 6782 6643 6589 6443 3309 1649 527 492 35893 888 55 35713 2691 2310 17287
NM_015313chr1194575 4003 3582 3554 1443 1249 1148 573 76 ------
NM_015317chr232742 747 95 ------
NM_015326chr172986 2812 2516 2459 2081 1819 108 ----12098
NM_015328chr7123080 2783 2403 2326 2125 2095 931 817 803 344 326 95 --145 --
NM_015346chr1471827 1737 1277 594 538 193 83 ------
NM_015347chr1282855 2644 2467 1992 1826 1115 745 475 ------
NM_015355chr1721534 97 ----165
NM_015358chr2111067 --1376 --
NM_015361chr25721 710 678 337 232 1956 ----
NM_015365chrX53906 3543 3466 3364 2684 --12619 --
NM_015375chr184516 4365 4133 3689 1983 1206 1175 940 3856 769 332 23637 1682 --
NM_015382chr143772 671 275 ------
NM_015385chr1072853 2487 2378 1230 1040 1016 162 22072 310 1390 --
NM_015435chr821430 1028 ------
NM_015439chr61442 ------
NM_015458chr8124844 4605 4153 3849 3834 3755 2072 2040 1199 638 598 329 1965 13393 --
NM_015464chr741021 961 382 183 1193 ----
NM_015483chr7------1813
NM_015506chr181847 1553 1450 1324 572 523 300 196 ------
NM_015520chr332450 1792 718 1744 ----
NM_015534chr12305 35 ------
NM_015535chr293061 3025 2940 2842 1132 1083 999 974 786 ------
NM_015550chr763194 2608 1415 720 326 307 --12959 --
NM_015564chr583324 1158 1061 931 669 482 244 109 ------
NM_015565chr2132059 1919 388 ------
NM_015569chr1103905 3608 3435 1943 1154 1145 884 728 628 608 13538 ----
NM_015571chr642505 2399 2015 143 1466 ----
NM_015575chr263717 2810 2701 2574 2372 723 33113 2856 158 11221 --
NM_015576chr342244 1080 476 455 1975 12758 --
NM_015577chr561579 1372 534 436 193 131 ------
NM_015610chr762630 2536 2529 2489 1144 572 ------
NM_015640chr195373 5235 4215 4063 1858 1840 1494 305 75 23589 2003 ----
NM_015642chr31297 ----1261
NM_015677chr22638 476 ------
NM_015713chr853208 2313 827 287 269 1841 12321 --
NM_015726chr121460 1160 ------
NM_015844chr185838 713 396 166 32 --1960 --
NM_015845chr183616 491 174 --1738 --
NM_015846chr185838 713 396 166 32 --1960 --
NM_015847chr185838 713 396 166 32 --1960 --
NM_015866chr121154 960 ------
NM_015878chr831718 1686 1544 ------
NM_015879chr18158599 6678 6472 6377 6112 5857 5836 5448 5387 5354 3082 3022 2193 1490 1427 47506 5815 5456 1304 --16127
NM_015892chr1072168 2058 948 675 635 621 211 --12153 --
NM_015895chr61239 ------
NM_015904chr21211 ------
NM_015906chr184613 4568 4276 4095 3592 3262 1718 664 11673 ----
NM_015912chr862125 2099 2000 873 339 101 2499 242 --11011
NM_015941chr82293 137 ------
NM_015948chr62185 64 ------
NM_015975chrX31840 534 185 11437 ----
NM_015981chr562973 2884 2798 2449 1941 658 --12605 --
NM_015986chr173368 164 100 ------
NM_015990chr411044 ------
NM_016002chr11732 ------
NM_016003chr762630 2536 2529 2489 1144 572 ------
NM_016009chr1114920 4693 4577 3789 3604 3242 1962 1383 1281 529 61 13750 14163 --
NM_016018chr852864 2709 2022 1765 278 ----1454
NM_016025chr1691722 1702 1665 1501 1317 1253 395 259 242 21494 464 ----
NM_016026chr1421160 312 1499 178 1399
NM_016037chr1279 64 ------
NM_016038chr7125 ----1229
NM_016045chr204576 309 170 45 11340 136 --
NM_016072chr1232279 2184 1693 ------
NM_016076chr142247 1222 880 353 1745 --11168
NM_016083chr6103619 3610 3260 3040 1365 1249 972 698 614 240 32534 2459 293 1190 12945
NM_016096chr832005 1429 635 ------
NM_016100chr201301 1415 --1122
NM_016131chr241486 186 123 88 ------
NM_016152chr32197 21 149 1835 --
NM_016169chr1053277 2813 973 836 184 --22828 2602 12182
NM_016205chr42408 226 --1108 --
NM_016206chr3158700 7462 7219 6852 6678 6360 6282 3529 3439 3300 3131 2950 2739 1486 42 57161 6806 5467 3604 2559 28154 6841 1549
NM_016221chr531574 1467 630 ------
NM_016227chr111547 ------
NM_016231chr1721460 1225 ------
NM_016235chr1631371 1166 552 ------
NM_016255chr683165 2884 2451 1111 327 270 196 111 1291 11049 --
NM_016257chr1103126 3013 2482 2443 1392 1370 908 414 200 98 --23364 2642 12304
NM_016258chr1------171
NM_016260chr2126549 6110 5976 5294 4715 3041 2711 2036 1925 1752 1614 1431 47574 5174 1070 806 16129 --
NM_016261chr174639 592 581 260 --1778 --
NM_016269chr41233 ------
NM_016281chr1211135 ------
NM_016287chr15812 522 325 136 53 ------
NM_016315chr251823 761 729 652 578 --11351 --
NM_016328chr71104 ------
NM_016338chr511254 ------
NM_016351chr7144 ------
NM_016353chr862245 913 565 416 294 273 --1150 11594
NM_016373chr16293 81 ------
NM_016374chr151448 1186 1108 643 208 11385 ----
NM_016374chr151448 1186 1108 643 208 11385 ----
NM_016395chr1531537 1212 760 1536 ----
NM_016396chr1532225 1198 236 --21184 381 1962
NM_016410chr9171 ------
NM_016422chr1172852 2433 2390 2168 1190 486 441 --12805 22505 2277
NM_016433chr1221341 223 11413 ----
NM_016441chr282367 2003 1801 837 746 694 637 56 ------
NM_016472chr1421138 122 ------
NM_016484chrX1557 ------
NM_016507chr1742825 981 628 228 ------
NM_016513chr653439 1511 957 812 482 21374 1116 1658 --
NM_016531chr454106 3141 676 499 175 12967 13215 --
NM_016559chr321135 514 ------
NM_016592chr2031265 546 406 ----11093
NM_016598chr311514 --11254 --
NM_016603chr552266 1996 1784 822 521 ----1315
NM_016604chr571157 1072 1021 997 897 134 125 --1216 1944
NM_016605chr592246 1975 1818 1695 953 815 341 148 117 22208 2180 12418 --
NM_016620chr131472 1219 975 ------
NM_016621chr11104527 4256 4236 4198 3980 3965 3749 3576 3335 2972 1838 11749 24123 774
NM_016654chr1521215 234 ------
NM_016656chrX2404 281 ------
NM_016834chr1773731 2759 1325 1055 374 211 172 --33796 3692 3285 --
NM_016835chr1773731 2759 1325 1055 374 211 172 --33796 3692 3285 --
NM_016836chr21603 ------
NM_016839chr21603 ------
NM_016841chr1773731 2759 1325 1055 374 211 172 --33796 3692 3285 --
NM_016929chr6104493 4427 3359 1847 1505 1117 991 684 144 61 --21671 1076 --
NM_016950chr42447 365 ------
NM_016954chrX3638 553 230 ------
NM_017409chr121145 ----1544
NM_017410chr125874 856 831 343 228 11007 ----
NM_017415chr593590 3534 3221 1838 1668 1238 1137 1066 774 13041 43699 3179 1413 351 --
NM_017420chr1442832 793 558 295 ------
NM_017423chr441581 879 833 109 1572 ----
NM_017440chr122124 26 ------
NM_017447chr21104077 3803 3214 2751 1659 1279 1180 896 872 586 1979 ----
NM_017455chr153808 349 96 ------
NM_017488chr231385 1095 253 --1197 --
NM_017519chr621186 954 11226 ----
NM_017522chr121026 474 ------
NM_017545chr203524 130 105 ------
NM_017551chr1022529 1999 ----12393
NM_017580chr1042100 1640 463 254 --2927 73 --
NM_017581chr42134 62 175 ----
NM_017596chr183613 3321 3299 2942 2839 1785 963 193 14675 11353 --
NM_017599chr121471 11899 21692 719 163
NM_017628chr484740 4294 3516 2093 1821 506 330 119 --14425 13324
NM_017633chr653728 3232 573 493 429 ------
NM_017634chr821895 685 ------
NM_017637chr9199138 8924 8904 8684 8363 7687 7519 7101 6952 6722 6611 6376 5752 3274 3181 1656 1310 1109 500 18434 ----
NM_017643chr1752395 2175 1951 456 254 ------
NM_017644chr385040 4426 3762 3636 3266 1756 1314 774 140 --24952 784
NM_017650chr795958 5570 5488 1410 1387 1144 485 264 73 25430 2116 --137
NM_017657chr23880 106 78 ------
NM_017658chr1434288 3622 1332 --13227 --
NM_017660chr1993370 3306 2683 2447 2115 2083 1380 1038 708 --12155 --
NM_017666chrX6833 771 763 467 236 222 1529 --11800
NM_017680chr92890 800 --1807 --
NM_017684chr155499 254 172 95 22 --11951 --
NM_017704chr112854 131 1913 ----
NM_017709chr1114095 4077 3836 3666 3599 3019 1715 1253 1077 1003 525 1258 23777 1100 --
NM_017719chr342484 2233 2201 1850 ------
NM_017739chr12541 165 --1144 --
NM_017744chr132212 780 333 --12056 --
NM_017752chrX51565 1476 677 511 471 11467 ----
NM_017753chr95712 386 244 57 44 ------
NM_017754chr684813 4516 4428 4058 3176 1766 1166 631 ------
NM_017769chr1433112 2979 2532 12577 13008 --
NM_017787chr1052893 2135 834 728 601 1427 21034 161 --
NM_017799chr1431927 1377 42 --1512 21362 74
NM_017813chr875774 4479 4394 2037 1333 452 68 ------
NM_017822chr122832 51 ------
NM_017831chr18124642 4602 4489 4220 3819 3788 3487 3118 1758 788 460 439 13601 14513 --
NM_017845chr42568 44 ------
NM_017848chrX64469 3950 1247 672 635 507 13914 11489 1110
NM_017864chr81198 ------
NM_017887chr11524 --2467 55 --
NM_017893chr10131 ------
NM_017896chr2093015 2936 2756 2401 2323 2240 1260 977 742 1722 ----
NM_017902chr1094920 4505 4455 4429 4324 4216 4104 661 583 --34028 1155 81 15394
NM_017919chr995519 5445 4730 4722 3765 1933 651 588 120 21987 1338 --13946
NM_017925chr951809 782 659 79 66 ------
NM_017934chr6125 ------
NM_017938chrX32017 1345 474 --1220 --
NM_017944chr1122530 950 --1993 --
NM_017964chr23853 97 48 1364 ----
NM_017969chr2------136
NM_017982chr151195 990 953 428 410 11043 ----
NM_017994chr772487 1883 847 710 446 230 134 ------
NM_018003chr1542109 2044 1782 853 12307 1269 --
NM_018015chrX2383 115 ------
NM_018018chr1231187 115 55 11698 ----
NM_018036chr14144090 4062 3972 3324 3028 2933 2860 1363 1353 1291 906 734 637 534 14021 ----
NM_018050chr124732 616 502 227 ------
NM_018084chr263282 3007 2511 2287 2030 1135 12242 22086 1235 1345
NM_018085chr1127961 7318 6349 6087 5947 5883 5760 5337 2880 1420 835 523 27145 6177 28001 6720 15573
NM_018086chr241533 710 430 240 ------
NM_018105chr821195 238 1256 1851 --
NM_018121chr1092966 2753 2674 2192 2036 1968 1242 987 861 --12104 --
NM_018155chr342936 1154 916 121 --22130 213 --
NM_018157chr1273294 2968 2706 2417 577 385 77 --161 --
NM_018167chr144842 619 342 49 --1940 --
NM_018171chr121860 ------
NM_018178chr151837 1804 1767 1353 331 ------
NM_018182chr1772108 1794 1688 700 181 145 97 1122 1527 1432
NM_018184chr321415 808 22102 1863 ----
NM_018195chr1142155 1955 1570 737 ----11746
NM_018200chr153748 588 398 22117 2035 --123
NM_018211chr151869 1747 1479 578 266 ------
NM_018214chr6--11005 --21304 1151
NM_018237chr102268 188 ------
NM_018246chr842664 2631 2386 140 ------
NM_018257chr2072459 2350 2265 887 693 471 164 1684 ----
NM_018265chr142080 1464 1446 348 21593 371 21870 1856 --
NM_018275chr73552 539 34 ------
NM_018286chr172800 358 ------
NM_018293chr362429 2288 1180 1050 958 185 22957 799 ----
NM_018299chr843261 870 651 184 --1294 --
NM_018302chr452399 2302 2187 1896 810 ----1345
NM_018315chr431485 637 315 ----11361
NM_018317chr4------1343
NM_018323chr441438 1247 304 89 11558 ----
NM_018326chr71192 --1282 --
NM_018327chr2051667 491 327 216 162 1699 11519 11343
NM_018334chr7125 --1205 --
NM_018340chr1694481 3711 3281 3093 1778 1182 1118 711 358 11896 11912 1691
NM_018351chr12134358 4156 3938 3924 3877 3833 3752 3739 3535 1640 1522 903 32 14107 ----
NM_018362chr1153850 3837 3265 2507 391 23892 453 --1967
NM_018364chr184039 3743 2955 2941 1445 968 530 271 23865 1034 ----
NM_018368chr61259 ------
NM_018373chr14126331 6208 5851 5811 5513 4816 4396 3987 2050 1532 1124 148 21356 795 36140 5117 1154 --
NM_018374chr7104733 4399 3271 3243 1916 1885 1571 703 313 239 21053 121 --13469
NM_018383chr2------1154
NM_018387chr91168 ------
NM_018388chrX11144 ------
NM_018403chr383770 3649 3575 2775 2708 2699 336 146 ------
NM_018424chr951911 1480 1217 504 498 --1487 --
NM_018427chr1641297 1041 527 137 --1615 1431
NM_018444chr84796 534 143 103 11507 1512 --
NM_018448chr121100 ------
NM_018452chr6_random103466 3174 2929 2794 2648 2415 1534 1156 1088 791 42776 1297 996 404 --13290
NM_018460chr21154 ------
NM_018489chr121715 863 1191 --1455
NM_018490chr1121763 208 ------
NM_018509chr1711527 --11521 11696
NM_018527chr132179 173 ------
NM_018534chr22233 213 ------
NM_018557chr251228 1092 1082 635 65 ------
NM_018566chr194671 4286 3843 1344 1228 1012 997 505 64 ------
NM_018638chr1253635 2020 1510 133 24 --14338 --
NM_018640chr1252717 2624 2610 1849 869 --11875 --
NM_018689chr1532159 2127 1961 12016 --12696
NM_018695chr51543 11756 ----
NM_018698chrX31890 1720 775 --1696 1174
NM_018700chr521216 214 ------
NM_018710chr821321 523 31080 1041 123 ----
NM_018717chr482877 2612 2098 1850 1070 895 808 147 1962 1761 --
NM_018723chr16126 ------
NM_018834chr52970 328 1802 ----
NM_018841chr173072 2751 2536 1346 785 364 153 11210 1833 --
NM_018844chr761983 1832 1592 672 558 310 ------
NM_018847chr951326 664 349 325 299 ------
NM_018898chr532289 1661 836 ------
NM_018899chr532289 1661 836 ------
NM_018900chr532289 1661 836 ------
NM_018901chr532289 1661 836 ------
NM_018902chr532289 1661 836 ------
NM_018903chr532289 1661 836 ------
NM_018904chr532289 1661 836 ------
NM_018905chr532289 1661 836 ------
NM_018906chr532289 1661 836 ------
NM_018907chr532289 1661 836 ------
NM_018908chr532289 1661 836 ------
NM_018909chr532289 1661 836 ------
NM_018910chr532289 1661 836 ------
NM_018911chr532289 1661 836 ------
NM_018912chr551746 1240 1094 375 324 ------
NM_018913chr551746 1240 1094 375 324 ------
NM_018914chr551746 1240 1094 375 324 ------
NM_018915chr551746 1240 1094 375 324 ------
NM_018916chr551746 1240 1094 375 324 ------
NM_018917chr551746 1240 1094 375 324 ------
NM_018918chr551746 1240 1094 375 324 ------
NM_018919chr551746 1240 1094 375 324 ------
NM_018920chr551746 1240 1094 375 324 ------
NM_018921chr551746 1240 1094 375 324 ------
NM_018922chr551746 1240 1094 375 324 ------
NM_018923chr551746 1240 1094 375 324 ------
NM_018924chr551746 1240 1094 375 324 ------
NM_018925chr551746 1240 1094 375 324 ------
NM_018926chr551746 1240 1094 375 324 ------
NM_018927chr551746 1240 1094 375 324 ------
NM_018928chr551746 1240 1094 375 324 ------
NM_018929chr551746 1240 1094 375 324 ------
NM_018958chr1584067 3745 3560 3323 3262 2861 759 124 21169 331 13057 --
NM_018959chr192187 45 ------
NM_018963chr212466 82 ------
NM_018970chr742653 711 583 564 21039 92 ----
NM_018976chr1252446 2158 2109 941 825 11970 ----
NM_018979chr1231869 751 183 ------
NM_018992chr1681597 1330 1260 645 591 562 260 180 171 11159 --
NM_018999chr1084246 3614 3148 1865 687 593 520 386 --24792 405 --
NM_019001chr3144738 4208 4150 4092 3876 3836 3553 3175 1881 1765 1106 951 435 315 12964 ----
NM_019004chr751982 1804 1651 93 22 --1672 1290
NM_019005chr72339 261 --130 --
NM_019022chr1832284 1166 36 13097 ----
NM_019027chr43378 352 211 ------
NM_019040chr11145 ------
NM_019049chr12735 633 1567 ----
NM_019063chr292235 1772 1755 1538 1446 814 742 633 134 --1769 --
NM_019072chr5104176 4102 4018 3550 2710 1589 1422 1225 368 88 23920 3287 13568 --
NM_019080chr1321486 1158 ------
NM_019083chr131358 1190 551 1390 ----
NM_019088chr192358 323 ------
NM_019091chr21880 --129 --
NM_019095chr201192 ------
NM_019098chr851698 1172 1164 702 390 21730 1720 ----
NM_019102chr71330 --1417 --
NM_019102chr71330 --1417 --
NM_019116chr1643410 1414 1093 1037 33554 1018 941 1806 --
NM_019117chrX73358 3305 3030 2975 2763 1203 346 146 ----
NM_019593chr2023116 457 11216 22781 2332 --
NM_019595chr21607 ------
NM_019596chr2182920 2735 2668 1191 1161 718 678 161 1504 ----
NM_019860chr102587 479 ------
NM_020122chr2144944 4406 4219 4164 4151 3742 2285 1902 1770 1617 1607 1600 1464 300 21830 1511 25066 1250 15962
NM_020123chr1041417 1096 341 194 ------
NM_020130chr851048 520 355 191 126 133 ----
NM_020144chr762094 1696 1630 1594 1368 287 ----11320
NM_020152chr211241 ------
NM_020159chr441686 1081 339 168 ------
NM_020177chr54962 899 753 596 --11168 --
NM_020192chr71143 ------
NM_020198chr171422 1200 11328 --
NM_020205chr163388 3266 2895 739 669 295 11210 1811 --
NM_020228chr1162088 1996 1934 836 395 188 ------
NM_020239chr152245 2068 1728 608 103 11991 ----
NM_020243chr223765 640 50 ------
NM_020245chr6145021 4875 4824 4385 4155 3947 3765 3511 3409 1751 1587 1422 1235 388 14504 ----
NM_020338chr1033592 2408 433 --41432 1198 907 769 11048
NM_020340chr662285 1827 1685 578 325 151 ------
NM_020341chr2011906 --11526 --
NM_020342chr232634 2216 2171 --21830 1780 --
NM_020357chr351367 1110 664 522 233 1194 ----
NM_020363chrY31648 1311 650 --21417 35 1482
NM_020364chrY31648 1311 650 --21417 35 1482
NM_020390chr393837 3122 1716 1235 1224 1015 906 859 65 24389 252 --11677
NM_020420chrY31648 1311 650 --21417 35 1482
NM_020428chr1931143 978 216 ------
NM_020443chr1196522 6145 5831 5549 5368 5301 4943 2775 2761 2592 2582 2428 2283 1450 973 953 782 246 100 11714 11211 --
NM_020455chr682328 2182 2137 1919 1901 1736 1136 811 ------
NM_020466chr684808 4492 3515 3334 3213 3093 1456 576 21667 376 11531 14086
NM_020474chr1861875 1795 1649 1584 630 258 1395 ----
NM_020475chr842194 1685 728 165 --31984 940 159 --
NM_020476chr842194 1685 728 165 --31984 940 159 --
NM_020477chr842194 1685 728 165 --31984 940 159 --
NM_020478chr842257 1748 791 228 --32047 1003 222 --
NM_020480chr842194 1685 728 165 --31984 940 159 --
NM_020525chr122207 133 ------
NM_020532chr23806 732 649 ------
NM_020640chr361809 1651 1481 1422 230 214 11670 11492 --
NM_020647chr822326 511 ------
NM_020651chr231544 1200 1194 ------
NM_020654chr311661 ----137
NM_020666chr51676 ------
NM_020673chr20116584 6060 5133 4976 4717 2896 1468 1215 952 542 153 12425 ----
NM_020676chr31761 --1265 1188
NM_020682chr103879 461 358 1942 ----
NM_020689chr201331 ------
NM_020697chr811115 1917 ----
NM_020698chr1273110 2805 2239 2032 1142 1134 33 12337 3897 500 23 --
NM_020699chr1104673 3757 3375 1572 1128 1029 989 897 316 308 14313 --1700
NM_020704chr7102409 2244 2151 2087 1924 1629 771 764 300 45 --1733 1506
NM_020711chr261940 1853 1771 1699 1680 482 ------
NM_020715chr1461668 1420 890 700 414 249 --21877 1456 --
NM_020717chrX84136 3931 3259 1884 1346 1280 1121 370 44437 4364 4076 3625 24040 1238 --
NM_020718chr1665262 2547 1336 473 458 313 15027 24605 1507 --
NM_020727chr2143798 3787 3541 3264 11082 1676 --
NM_020732chr621186 954 11226 ----
NM_020734chr1232945 1020 370 ----12562
NM_020739chr1574134 3979 3395 3058 1096 763 590 33739 1170 65 13135 --
NM_020748chr1732123 645 75 ------
NM_020749chr841784 1688 1414 207 --11392 --
NM_020750chr651491 1345 950 442 128 1270 ----
NM_020752chr1041040 988 547 400 ------
NM_020760chr241450 1382 392 361 3274 131 86 ----
NM_020766chrX84589 3977 3367 3078 2848 1460 1010 988 13996 ----
NM_020771chr621309 120 1283 ----
NM_020772chr17117759 7167 6909 6892 6171 5293 3020 2205 1834 917 89 1225 16743 --
NM_020774chr18106181 6145 6056 5667 4756 4710 4596 2297 1970 673 55915 4518 1158 982 255 ----
NM_020779chr242566 2476 1258 293 23226 2040 ----
NM_020782chr12104855 4740 4733 3651 3223 3076 1719 242 68 38 14152 ----
NM_020783chr1851850 1511 834 462 160 ------
NM_020794chr141456 1174 1161 1071 11361 ----
NM_020796chr532314 745 448 --11878 --
NM_020801chr52207 189 12422 1633 --
NM_020805chr1851732 1360 1281 1273 414 1404 ----
NM_020808chr11730 ------
NM_020809chr1142255 1742 1438 515 1574 --11545
NM_020821chr155499 254 172 95 22 --11951 --
NM_020841chr1263825 3300 2844 975 921 64 ------
NM_020844chr8167620 7574 6313 5818 5658 5006 4998 4827 4802 1840 1221 1041 874 825 601 27 31137 1068 749 ----
NM_020859chr453422 2830 2815 1477 608 12850 --1143
NM_020866chr13--1391 --1100
NM_020868chr24755 586 167 84 11775 ----
NM_020872chr321580 1342 11668 ----
NM_020899chr1762113 1776 789 779 730 267 --2419 221 --
NM_020918chr1032298 1017 892 13335 --11347
NM_020925chr14527 503 334 285 ------
NM_020935chr2104258 4200 3809 3785 3686 3667 3186 1793 1744 927 --23602 768 --
NM_020940chr1042307 2069 2010 306 1241 ----
NM_020948chr133329 1307 884 ------
NM_020960chr9124735 4657 4294 4179 3905 3570 3155 1820 1346 960 649 32 34020 3129 1049 33696 1415 320 --
NM_020977chr471724 1679 848 724 531 118 106 --21662 506 --
NM_021005chr1531145 442 379 1803 ----
NM_021007chr211927 21538 956 ----
NM_021032chr361747 1704 1622 1311 1269 537 ------
NM_021033chr1333384 3047 619 13295 ----
NM_021038chr363172 2931 2836 2612 1141 437 ------
NM_021061chr8114540 4472 3866 3731 3700 3595 1812 1533 735 345 135 44341 1333 973 365 13931 --
NM_021069chr452159 2023 1931 1373 105 --1233 1334
NM_021072chr532091 1804 806 ------
NM_021083chrX103409 3000 2857 2811 2327 1084 931 602 592 499 ------
NM_021097chr222647 1869 --1254 2605 124
NM_021101chr322276 383 ------
NM_021111chr92289 204 11103 ----
NM_021116chr7217850 7518 7198 7011 6869 6812 6492 6074 6063 5932 3507 3327 2773 2705 2652 1909 663 481 234 142 76 38940 8666 1197 43046 2343 2238 1560 21025 502
NM_021120chrX53215 3150 2323 2059 663 ------
NM_021145chr74416 344 63 28 1926 --1456
NM_021155chr1982970 2162 2123 2052 1980 666 543 139 1236 11934 --
NM_021156chr2051117 1066 889 875 178 122 1905 --
NM_021165chr14870 853 712 67 ------
NM_021167chr782664 2635 2227 2063 873 568 148 27 --182 --
NM_021183chrX42510 2220 1565 267 --1601 1178
NM_021202chr2071972 1232 546 383 309 164 60 22245 1194 12611 11955
NM_021205chr152846 2798 2666 2532 301 ------
NM_021215chr2032320 839 411 --1712 --
NM_021222chr12419 49 --1928 1104
NM_021255chr1444111 3710 3276 2647 --12538 --
NM_021614chr51260 ------
NM_021627chr32804 421 ------
NM_021629chr3134985 4817 4617 4434 3992 3894 3566 3430 3121 1964 1515 1162 1148 23266 493 ----
NM_021638chr4124817 3863 3742 3067 1933 1863 1298 1047 1021 324 111 21 --24158 4027 --
NM_021643chr241911 1234 576 307 21177 35 1146 --
NM_021644chr1021031 693 ------
NM_021647chr4104475 4263 3598 3271 1510 980 930 889 697 620 44427 1874 1664 335 13710 --
NM_021722chr7144 ------
NM_021723chr7144 ------
NM_021803chr4173 ------
NM_021809chr2082146 692 468 408 364 277 134 32 --1208 --
NM_021813chr6125619 5349 5328 5238 4159 3803 3750 1880 1834 1549 553 44 14292 1739 --
NM_021911chr5105053 4753 4658 4565 3813 3734 2250 1188 1170 883 44467 1917 1126 92 11309 12118
NM_021913chr19131825 1597 1545 1358 1310 1177 509 388 362 353 338 275 38 91554 1530 1483 1336 1243 1208 1193 1155 261 11695 21265 1220
NM_021935chr31119 ------
NM_021940chr681399 1356 1327 1270 1085 572 350 304 ------
NM_021942chr43946 191 156 ------
NM_021945chr651173 880 812 157 148 1205 21035 28 --
NM_021954chr1363284 1462 1212 626 395 21 --22668 1169 --
NM_021956chr631346 150 46 ------
NM_021960chr162535 2499 1887 1052 529 494 --22216 78 --
NM_021961chr11137354 7169 5842 5597 4795 2777 2509 2292 2003 1590 1485 1479 416 --25940 5563 12560
NM_021964chr3106626 5572 5294 5241 4392 4359 4318 4197 2460 371 21920 615 14787 --
NM_021970chr42708 120 ------
NM_021973chr43589 556 200 ------
NM_021979chr141170 ------
NM_021984chrX41030 344 53 35 11235 1249 --
NM_021987chrX41030 344 53 35 11235 1249 --
NM_021988chr2021528 551 ------
NM_021990chrX41030 344 53 35 11235 1249 --
NM_022037chr21863 --1952 --
NM_022048chr15126380 5944 5665 5221 4926 4258 3892 1532 1195 1080 721 378 16301 34483 1610 694 15969
NM_022051chr11195 ------
NM_022058chr241635 1330 731 105 ------
NM_022080chr2032060 1722 913 12350 --12374
NM_022085chr621145 152 11559 21019 197 11217
NM_022114chr184761 4753 3983 3480 3285 3037 2918 148 --1205 --
NM_022116chr73897 117 104 1239 ----
NM_022118chr131430 --1444 --
NM_022133chr82512 311 --11785 --
NM_022154chr441241 495 184 58 1436 ----
NM_022166chr16156062 5642 5491 5073 5048 4954 4486 3965 2244 2201 1818 1444 797 563 397 21922 1122 15798 12513
NM_022170chr741694 1610 653 470 --1399 --
NM_022173chr21863 --1952 --
NM_022343chr931332 349 289 ------
NM_022351chr863737 3019 2868 750 463 31 12507 11500 --
NM_022365chr10136 ------
NM_022442chr2021528 551 ------
NM_022444chr741281 608 294 75 ------
NM_022456chr12107598 7466 6243 5383 2335 2299 813 422 209 85 35838 2801 1675 --36656 4886 131
NM_022459chr1366177 6076 5625 5429 2537 1112 ------
NM_022470chr331250 943 805 ------
NM_022473chr1584290 4188 4181 4110 3456 1667 1520 279 12890 24123 3359 11770
NM_022475chr43622 493 31 ------
NM_022476chr1631102 230 57 --1173 --
NM_022482chr2072414 2378 2367 2232 2096 452 437 --22603 2226 --
NM_022484chr731443 1141 438 1458 ----
NM_022491chr1283160 2592 2456 2408 969 923 400 174 12900 ----
NM_022574chr721676 277 ------
NM_022745chr142875 2706 1000 773 --11048 --
NM_022753chr132310 319 39 22169 533 32519 1984 782 --
NM_022763chr333021 2352 2148 ------
NM_022768chr1187 ------
NM_022776chr321345 559 ------
NM_022781chr961217 1145 861 847 283 215 11050 12800 --
NM_022782chr123249 151 100 ------
NM_022784chr153945 879 126 158 ----
NM_022810chrX1287 ------
NM_022818chr162273 158 --2297 178 --
NM_022823chr22537 450 ------
NM_022829chr20102090 2024 1819 1720 1643 1418 803 602 453 134 11554 ----
NM_022831chr141617 1463 397 86 --11574 11328
NM_022898chr1454826 3959 3315 652 136 --24327 4009 23124 3110
NM_022900chr71832 ------
NM_022912chr253030 2886 876 661 649 12293 12355 --
NM_022918chr1132128 1590 356 ------
NM_022977chrX62462 2232 2104 1800 472 364 ------
NM_023037chr134839 157 85 30 ------
NM_023074chr194953 535 332 34 --11341 --
NM_023076chr1641200 617 222 44 11031 32323 2027 428 --
NM_023112chr1462916 2407 2331 1951 296 74 --1853 11130
NM_023923chr1103548 3330 3055 2490 1418 952 697 408 291 54 21245 805 1492 13709
NM_023929chr81796 ------
NM_023948chr71164 ------
NM_024007chr563135 3008 1181 1004 916 889 12180 ----
NM_024017chr1771682 1480 1214 471 388 125 97 ------
NM_024061chr73639 209 107 --1398 --
NM_024090chr411700 --31365 1242 218 1375
NM_024297chr17129 --1107 --
NM_024345chr955918 5553 1789 254 57 --33702 1064 184 14441
NM_024348chr91262 --2234 55 --
NM_024408chr163532 3277 2270 1380 748 654 ----1779
NM_024422chr1861576 1462 748 391 319 223 ------
NM_024423chr1882867 1627 1548 451 430 383 264 104 23366 1088 11574 13966
NM_024492chr691494 1145 1139 1127 511 492 198 190 169 1152 11394 --
NM_024509chr191165 --121 --
NM_024520chr22257 95 ------
NM_024523chr751177 954 872 359 131 ------
NM_024524chr352828 839 510 498 460 ------
NM_024539chrX31275 1010 865 --1416 1265
NM_024541chr1041711 652 284 142 ----1234
NM_024554chr161710 1692 1573 1362 408 63 2415 191 11273 1359
NM_024557chr113601 528 105 11605 --1420
NM_024582chr41849 1752 1870 --
NM_024586chr13665 262 94 ------
NM_024617chr93602 102 24 ------
NM_024626chr151395 1300 571 206 180 11655 ----
NM_024631chr113572 142 120 ------
NM_024639chr621871 189 12857 12177 --
NM_024646chr163357 3302 2981 2479 342 162 12811 ----
NM_024674chr172868 2679 2291 2184 1179 759 183 --1828 1654
NM_024702chr175644 262 256 157 53 ----1238
NM_024713chr1541194 1095 1070 212 --11330 --
NM_024721chr862303 1761 323 273 91 80 11705 ----
NM_024740chr1183664 3579 3506 3311 3023 1426 658 540 ------
NM_024744chr232528 1657 607 12098 ----
NM_024749chr131561 796 380 11954 ----
NM_024770chr2156698 6673 6606 6376 5749 5316 4723 4605 2583 2231 2163 923 892 442 48 54262 2463 1990 1785 722 15448 --
NM_024780chr163432 229 109 2896 207 --1310
NM_024813chr131131 412 207 2308 106 ----
NM_024814chr71312 ------
NM_024834chr1031921 1657 648 ------
NM_024850chr52351 97 ------
NM_024866chr22103463 3447 3387 3275 3128 2365 2237 1341 570 541 --11221 13015
NM_024911chr13787 776 51 ------
NM_024915chr882613 2442 2166 2105 1886 1020 317 282 1768 31950 1792 545 1347
NM_024947chr3168824 8741 8690 8548 8514 8450 7422 7020 6554 6118 6034 3279 3131 2520 2247 591 12581 18926 --
NM_024948chr101674 ----1555
NM_024949chr494455 4379 4187 4170 3859 3531 1216 858 499 ------
NM_024989chr277922 7590 7101 6442 6163 6140 2137 15690 --17329
NM_024991chr1072853 2487 2378 1230 1040 1016 162 22072 310 1390 --
NM_024993chr251517 1482 1407 215 75 ------
NM_025054chr883767 3502 3475 3220 3152 2586 1468 303 11332 ----
NM_025074chr463092 3055 2116 1216 1198 549 --22737 2196 --
NM_025076chr22529 254 ------
NM_025133chr22857 341 ------
NM_025134chr1652412 2331 1936 861 516 22180 1753 ----
NM_025138chr1321128 1015 ------
NM_025146chr352586 1751 632 398 164 ------
NM_025160chr183595 3515 2841 2736 1615 1492 1006 472 1934 ----
NM_025179chr1134849 3191 3062 1911 1904 1867 1659 1646 1621 1494 1116 505 42 --33884 1895 262 23956 1820
NM_025181chr22788 132 ------
NM_025191chr173443 2915 2704 2415 2334 442 229 --1486 --
NM_025235chr1071793 1785 1703 1433 731 721 228 ------
NM_030621chr1464251 3654 3332 3205 1000 380 12932 ----
NM_030623chr251214 353 216 77 43 ----1301
NM_030625chr10112127 1936 1705 1631 1009 870 810 477 467 109 52 ------
NM_030627chr533027 2878 1613 --13390 --
NM_030631chr141735 1117 ----
NM_030634chr142170 1793 478 186 ----2960 799
NM_030647chr7126189 5851 5446 5027 4860 4646 4258 4047 1750 989 684 665 --14924 15081
NM_030648chr4115189 4781 4758 4018 2206 1511 1487 1137 609 455 268 23663 1834 1863 13576
NM_030650chr2114256 3936 3706 3193 3093 2991 1351 1265 880 368 23 13070 23154 95 --
NM_030660chr145960 530 510 182 38 11415 ----
NM_030664chr1022425 1712 ------
NM_030670chr1261798 1687 1670 1584 1553 570 ------
NM_030671chr1261798 1687 1670 1584 1553 570 ------
NM_030674chr12105588 4853 4588 4560 4375 4253 2344 1693 1613 891 --13685 1186
NM_030751chr1031306 1188 544 ------
NM_030751chr1031306 1188 544 ------
NM_030758chr2231210 454 199 ----11271
NM_030786chr13578 515 87 ------
NM_030799chr542044 1728 819 726 ------
NM_030806chr1189254 9186 9013 8634 8472 7707 7212 7060 6872 6452 5935 5869 5764 3365 2194 1035 330 268 53701 2369 930 743 405 36632 6582 5813 26100 6065
NM_030809chr1242378 1607 555 451 ----1525
NM_030810chr621145 152 11559 21019 197 11217
NM_030816chr172778 2341 1211 1192 1134 837 156 13377 --13715
NM_030817chr1293544 2975 2827 2453 2439 2312 676 467 58 --2640 383 --
NM_030881chr2252334 2206 2026 1799 26 ------
NM_030885chr332300 1764 643 1719 ----
NM_030915chr282355 2212 1753 1538 1528 934 542 342 1898 ----
NM_030918chr1105404 5277 4991 4621 4539 3450 719 681 614 597 11530 ----
NM_030920chr161919 1430 1301 263 154 25 1440 ----
NM_030938chr17194 --168 --
NM_030939chr611171 ------
NM_030953chr571191 614 473 371 280 233 224 1204 1362 --
NM_030965chr12794 219 ------
NM_031157chr121238 ------
NM_031208chr163986 817 790 ------
NM_031216chr1862075 2035 1839 1736 1384 792 ------
NM_031243chr72918 733 ----11957
NM_031244chr631194 1105 339 ------
NM_031262chr911148 ------
NM_031263chr911205 159 ----
NM_031305chr431651 1252 340 21503 270 147 --
NM_031314chr1431977 719 300 161 ----
NM_031369chr42821 52 ------
NM_031370chr42821 52 ------
NM_031371chr151448 1186 1108 643 208 11385 ----
NM_031371chr151448 1186 1108 643 208 11385 ----
NM_031411chr532289 1661 836 ------
NM_031418chr1152765 2608 2557 2052 643 1637 1693 --
NM_031419chr321579 264 ------
NM_031427chr14115005 4953 4382 3854 3760 1772 1506 1462 980 603 515 25519 1602 ----
NM_031435chr1272228 1396 1190 1158 857 785 779 --13300 --
NM_031439chr861491 1271 1209 510 248 166 11706 1233 1700
NM_031442chrX33131 2908 236 ------
NM_031445chr262834 2667 2175 1243 1169 960 ------
NM_031468chr7167705 7339 6572 6151 6079 5600 4986 2239 1667 1439 1378 1326 1302 335 272 259 47631 6981 6347 451 47649 7536 6836 5827 12375
NM_031845chr2113616 3537 3530 3471 3317 3226 2796 1468 1334 1307 350 11462 ----
NM_031847chr2113616 3537 3530 3471 3317 3226 2796 1468 1334 1307 350 11462 ----
NM_031849chr532289 1661 836 ------
NM_031850chr31821 ------
NM_031850chr31821 ------
NM_031857chr532289 1661 836 ------
NM_031860chr532289 1661 836 ------
NM_031911chr452449 1909 1773 450 331 ------
NM_031935chr1----1910 --
NM_031940chr831563 1529 969 --12036 --
NM_031992chr741694 1610 653 470 --1399 --
NM_032041chr832540 688 558 1575 31866 1730 365 --
NM_032042chr552186 1945 820 537 294 22643 1916 ----
NM_032047chr372432 2189 2150 2041 902 374 259 12073 ----
NM_032049chr31821 ------
NM_032049chr31821 ------
NM_032050chr223703 425 137 --1260 --
NM_032052chr2231088 952 522 --1172 1915
NM_032088chr551746 1240 1094 375 324 ------
NM_032092chr551746 1240 1094 375 324 ------
NM_032105chr1207228 6716 6695 6031 5717 5202 5174 5006 4926 3139 2571 2429 1868 1618 1056 649 321 212 145 130 46168 5702 2584 2167 2787 47 1571
NM_032119chr51235 --169 --
NM_032144chr22516 157 ------
NM_032153chr382734 2325 1937 930 907 723 631 197 ----1875
NM_032160chr1874235 4176 4097 3707 3576 1406 1326 23924 414 ----
NM_032182chr1041332 1326 570 431 1496 ----
NM_032186chr131472 1219 975 ------
NM_032199chr1063786 3296 2748 469 243 220 22887 294 1436 --
NM_032226chr92711 233 1289 ----
NM_032228chr1113273 --13001 11062
NM_032231chr151132 ------
NM_032236chr13944 213 115 ------
NM_032239chr421075 396 11333 ----
NM_032287chr2253912 2580 1122 1061 123 --1383 13897
NM_032288chr32799 91 178 ----
NM_032291chr13595 547 500 ------
NM_032321chr233277 2450 331 --12620 --
NM_032352chr1441244 1023 919 137 ------
NM_032373chr10145034 4840 4696 4512 4170 4139 2351 2125 1698 1047 662 609 564 139 1313 ----
NM_032403chr551746 1240 1094 375 324 ------
NM_032427chr111414 --133 1232
NM_032434chr221365 396 ------
NM_032439chr1051081 1058 465 398 142 ------
NM_032440chr1032815 2666 755 22787 968 ----
NM_032445chr1581902 1722 947 749 671 171 148 99 ----1834
NM_032446chr553812 3485 2407 1383 582 --12354 --
NM_032457chr493219 3187 1217 1082 692 601 531 265 139 12373 ----
NM_032458chrX32488 2472 951 23045 856 11039 --
NM_032466chr821611 58 ------
NM_032468chr821611 58 ------
NM_032471chr63947 209 179 ------
NM_032486chr1632177 293 209 --3759 160 152 140
NM_032521chr2042899 2777 2308 1981 11178 ----
NM_032547chr4171 --1965 --
NM_032557chr41697 ----1116
NM_032560chr1431028 988 218 ------
NM_032562chr10197 ----156
NM_032564chr112857 172 ------
NM_032574chr21259 ------
NM_032578chr103617 207 78 --11519 --
NM_032596chr91156 ----123
NM_032622chr42304 172 ------
NM_032631chr191157 ------
NM_032632chr145775 761 469 165 55 11998 ----
NM_032646chr1711367 --11172 --
NM_032727chr1041566 1557 509 153 1221 1111 --
NM_032728chr91919 --1228 --
NM_032737chr1962728 2676 2540 432 169 107 ------
NM_032778chr332709 271 88 12443 22858 2619 --
NM_032784chr64800 714 399 340 ------
NM_032801chr1152562 2236 2105 876 160 ----11840
NM_032804chr104971 910 743 471 ------
NM_032812chr10----1108 --
NM_032813chr1351101 772 717 362 240 ------
NM_032826chr765198 4540 4326 3383 2102 538 25005 824 ----
NM_032837chr1741953 445 378 318 12012 ----
NM_032859chr1353772 3752 3114 678 146 ------
NM_032870chr61408 --1420 --
NM_032873chr1133979 3931 705 --33584 346 90 --
NM_032892chr151262 1229 ----
NM_032906chr41701 1616 2730 656 --
NM_032918chr122220 137 1385 ----
NM_032949chr132499 131 ----143
NM_032961chr441355 1229 437 284 ------
NM_032968chrX94140 3884 3689 2650 1321 600 529 392 67 11160 12900 --
NM_032969chrX94140 3884 3689 2650 1321 600 529 392 67 11160 12900 --
NM_032983chr762703 2353 2126 2087 410 331 --2986 157 1339
NM_032998chr12792 88 ------
NM_033020chr184613 4568 4276 4095 3592 3262 1718 664 11673 ----
NM_033030chr231106 635 76 11546 ----
NM_033055chr12947 177 ------
NM_033081chr2031274 362 279 ------
NM_033083chr383015 2682 2093 1187 985 770 302 147 12475 ----
NM_033122chr43246 172 77 166 ----
NM_033133chr17103621 3492 3342 2941 2892 2454 982 917 305 183 12759 22930 2709 1822
NM_033136chr541622 1495 438 212 159 ----
NM_033137chr541622 1495 438 212 159 ----
NM_033138chr752242 2033 1638 1481 322 --11442 --
NM_033139chr752242 2033 1638 1481 322 --11442 --
NM_033140chr752242 2033 1638 1481 322 --11442 --
NM_033143chr474622 3498 3227 1308 1201 700 184 44186 3353 3068 27 14222 --
NM_033150chr12161 1163 ----
NM_033157chr752242 2033 1638 1481 322 --11442 --
NM_033181chr6103619 3610 3260 3040 1365 1249 972 698 614 240 32534 2459 293 1190 12945
NM_033207chr1082197 2029 1955 1722 1003 937 625 182 ------
NM_033211chr51753 11891 ----
NM_033224chr7217883 7424 7266 6630 6261 6244 5852 5725 5454 5375 5323 5079 2999 2766 1617 1473 1306 921 358 340 200 57151 1452 717 619 607 12895 17513
NM_033225chr853072 2228 874 208 117 1543 --1263
NM_033238chr1572023 1777 630 615 475 188 165 32065 801 247 22665 984 --
NM_033259chr31757 ------
NM_033274chr5113462 3399 3386 3258 3160 2877 2714 2435 827 288 137 --22667 1056 1121
NM_033281chr52604 61 ------
NM_033285chr884017 3310 3012 1624 1271 1100 863 645 ------
NM_033290chrX73603 3575 3534 3024 2892 2824 2813 ----23054 1021
NM_033300chr121026 474 ------
NM_033326chr111528 ------
NM_033360chr1244276 3826 1500 1019 --1301 --
NM_033380chrX1879 ----2794 263
NM_033381chrX1879 ----2794 263
NM_033389chr1744018 1367 1161 686 --13348 --
NM_033407chr12485 424 ------
NM_033427chr73758 238 210 ------
NM_033429chr1562894 2633 2232 813 795 238 42743 2160 484 474 11173 --
NM_033430chr444083 3073 1474 1414 1375 22861 2642 1833
NM_033437chr444083 3073 1474 1414 1375 22861 2642 1833
NM_033453chr201372 ------
NM_033495chrX2910 773 --1390 --
NM_033505chr2116442 5930 5532 5261 4562 2375 2015 1815 1508 1493 1010 --1176 --
NM_033624chr1252248 2151 2118 1666 609 148 --12040
NM_033631chr162675 1503 793 712 563 78 --43753 2795 1480 810 --
NM_033632chr431485 637 315 ----11361
NM_033637chr1083954 3716 3356 2747 2697 2625 1188 679 --1459 --
NM_033644chr561961 1592 1022 493 449 356 --2222 153 --
NM_033645chr561961 1592 1022 493 449 356 --2222 153 --
NM_033656chr2145890 4623 1255 965 1792 14872 --
NM_044472chr11739 ------
NM_052832chr852740 2579 1176 1008 721 ------
NM_052834chr1862496 2181 1695 979 50 40 ------
NM_052869chr1711367 --11172 --
NM_052879chr1243679 2593 202 173 1749 ----
NM_052885chr12104805 4605 3223 1900 1576 1389 796 594 528 411 23447 1507 11734 11653
NM_052886chr822166 100 --1132 --
NM_052918chr1063514 3247 3115 1043 1020 686 13301 --12586
NM_052927chr5----2516 417 21798 798
NM_052932chr11----21939 161 1567
NM_052950chr1351896 1492 762 403 190 11403 ----
NM_052978chr1421753 164 ----11341
NM_053002chr331150 401 338 ------
NM_053016chr9197578 7572 7428 7372 7334 7319 6256 5562 5161 2861 2240 1950 1915 1722 1140 1116 797 749 221 47256 6661 3064 2345 --2243 204
NM_053025chr361275 678 502 463 55 29 ------
NM_053026chr361275 678 502 463 55 29 ------
NM_053027chr361275 678 502 463 55 29 ------
NM_053028chr361275 678 502 463 55 29 ------
NM_053031chr361275 678 502 463 55 29 ------
NM_053032chr361275 678 502 463 55 29 ------
NM_053043chr785638 4469 2237 1903 1747 1671 370 131 25570 5297 35800 244 56 --
NM_053279chr852871 1781 729 246 85 12751 1461 --
NM_057157chr104536 527 447 171 ------
NM_057159chr921534 639 1259 ----
NM_057169chr1243035 2938 2372 1976 11104 32719 487 470 --
NM_057170chr1243035 2938 2372 1976 11104 32719 487 470 --
NM_057175chr462170 1808 1673 619 123 84 11046 ----
NM_057178chr1721795 1112 12424 12739 --
NM_058191chr214768 697 665 29 --1684 --
NM_058237chr142766 241 ------
NM_058241chr232272 1884 113 ------
NM_058241chr232272 1884 113 ------
NM_078473chr831563 1529 969 --12036 --
NM_080552chr203682 514 277 ------
NM_080617chr207926 732 383 369 353 127 30 1678 2773 211 --
NM_080629chr141045 945 460 424 21113 347 1542 --
NM_080630chr141045 945 460 424 21113 347 1542 --
NM_080645chr62823 263 11477 11530 --
NM_080676chr2082541 2530 2367 1273 1061 579 139 130 12203 ----
NM_080743chr652537 1582 1043 509 264 ------
NM_080759chr1351820 738 585 541 427 ------
NM_080760chr1351820 738 585 541 427 ------
NM_080840chr201186 ------
NM_080841chr201186 ------
NM_080867chr1474812 3653 1498 1154 773 619 308 ------
NM_080872chr863633 3323 2852 1113 800 503 ------
NM_130385chr1183236 2757 2692 2656 2407 1087 876 720 --12512 --
NM_130391chr9113467 3284 2779 2726 2380 2290 1209 811 634 162 42 ------
NM_130392chr9113467 3284 2779 2726 2380 2290 1209 811 634 162 42 ------
NM_130393chr9113467 3284 2779 2726 2380 2290 1209 811 634 162 42 ------
NM_130438chr2173310 2105 1122 1073 638 405 194 32451 2081 42 ----
NM_130466chr1251836 1507 1279 601 231 1365 2191 25 --
NM_130798chr1531511 1146 589 1298 ----
NM_130808chr31342 ------
NM_130811chr203230 197 26 ------
NM_130830chr3103851 3544 3212 2847 2782 2620 2478 758 562 285 --13073 1309
NM_133170chr20197432 7402 7357 7210 7101 6198 6163 6094 5963 5942 5898 5650 3156 2799 2611 1475 1428 884 200 36222 2218 1896 47700 2531 1531 117 1983
NM_133263chr5154 ------
NM_133264chr1743195 238 133 110 --33569 3433 3119 23830 1015
NM_133265chrX93616 3376 2622 2613 2493 1055 942 230 203 12532 42976 1288 1264 1094 --
NM_133330chr462879 2521 2299 2236 272 29 12838 ----
NM_133331chr462879 2521 2299 2236 272 29 12838 ----
NM_133334chr4135885 5686 5425 5387 4586 4431 2526 2149 1287 1273 629 494 254 34604 2308 1843 36359 5994 2448 --
NM_133335chr462879 2521 2299 2236 272 29 12838 ----
NM_133367chr643307 2841 962 113 2992 678 1320 1498
NM_133370chr4103587 3430 3069 2973 2803 2741 2678 664 553 148 1250 12842 --
NM_133372chr562843 2748 1899 1059 712 409 11044 ----
NM_133379chr2289 63 ------
NM_133445chr963721 3036 1339 1154 1143 1007 13534 1193 13668
NM_133468chr762546 2495 2107 1690 595 476 1361 ----
NM_133478chr282171 2135 2035 1845 1817 1576 976 51 22358 2128 ----
NM_133493chr653780 2941 1361 444 277 11282 14394 --
NM_133496chr1104414 3792 3611 3562 2998 1419 1273 772 391 234 ------
NM_133642chr2251218 1144 840 832 75 ----1247
NM_133646chr285526 5159 5145 4160 4035 3418 1098 1005 35584 1091 740 ----
NM_133647chr1583351 3150 2603 2341 780 645 585 239 33236 2522 860 12349 --
NM_134442chr261761 1283 599 524 340 179 11590 ----
NM_138270chrX63358 3305 3018 2540 612 298 ------
NM_138316chr1011100 --11349 --
NM_138328chr1783430 3341 2969 2591 2254 695 495 418 1759 23289 1166 --
NM_138444chr13104831 4689 4589 4343 4224 3679 3128 1970 119 27 --33759 1399 864 --
NM_138455chr81386 ------
NM_138473chr1294922 4803 4565 4163 4136 3892 3154 1315 1160 24020 75 11172 --
NM_138479chr181952 1927 837 818 785 628 576 261 --2370 208 --
NM_138576chr1454826 3959 3315 652 136 --24327 4009 23124 3110
NM_138621chr243835 3176 755 323 11299 23218 3009 13147
NM_138635chr763108 2980 2057 946 787 779 1998 1344 --
NM_138694chr673363 3238 2652 2263 1206 1153 516 --23183 1113 --
NM_138713chr16116928 5830 5568 5074 2980 2825 1913 1323 1085 1071 316 22788 39 27868 6328 --
NM_138714chr16116928 5830 5568 5074 2980 2825 1913 1323 1085 1071 316 22788 39 27868 6328 --
NM_138727chr132212 780 333 --12056 --
NM_138728chr132212 780 333 --12056 --
NM_138731chr1483609 2609 1196 505 426 394 132 121 --12965 --
NM_138732chr1111015 ------
NM_138734chr1111015 ------
NM_138771chr741426 483 150 123 ------
NM_138775chr114791 535 517 122 ----1268
NM_138782chr542272 525 450 69 12347 ----
NM_138811chr751272 1241 1023 285 21 1910 --1825
NM_138957chr221111 ------
NM_138959chr1116750 6326 6100 5360 4389 2057 2045 1973 1854 1684 379 14326 ----
NM_138971chr11103407 3207 2787 2491 2419 2384 1321 1232 322 175 --1948 1692
NM_138971chr11103407 3207 2787 2491 2419 2384 1321 1232 322 175 --1948 1692
NM_138972chr11103407 3207 2787 2491 2419 2384 1321 1232 322 175 --1948 1692
NM_138972chr11103407 3207 2787 2491 2419 2384 1321 1232 322 175 --1948 1692
NM_138973chr11103407 3207 2787 2491 2419 2384 1321 1232 322 175 --1948 1692
NM_138973chr11103407 3207 2787 2491 2419 2384 1321 1232 322 175 --1948 1692
NM_138980chr43717 241 131 ------
NM_138982chr43717 241 131 ------
NM_139014chr651981 1886 1463 161 149 --22197 324 --
NM_139035chrX2769 203 ----1244
NM_139048chr32379 79 ------
NM_139071chr1251699 1291 1186 120 102 11163 1337 1404
NM_139072chr22880 221 ----1822
NM_139076chr41201 ------
NM_139168chr531436 773 317 ------
NM_139182chr431832 1786 68 ------
NM_139207chr1232177 1980 772 11466 ----
NM_139211chr42685 568 1593 ----
NM_139212chr42685 568 1593 ----
NM_139215chr171192 ------
NM_139244chr61809 ------
NM_139276chr1732295 1926 496 ----11855
NM_139279chr2102978 2942 2424 1326 1074 950 830 614 557 90 22816 2474 2937 238 --
NM_139321chr2083986 3716 3555 2938 2597 1591 515 238 13272 ----
NM_144498chr2042276 2016 1495 568 --1829 11878
NM_144567chr152784 2616 1816 210 33 ------
NM_144571chr4126370 5697 5427 5403 5332 2486 1001 836 720 477 433 323 36481 6421 4753 ----
NM_144578chr1494448 4206 3937 3392 1705 1567 1260 687 370 34418 1630 322 21794 1009 --
NM_144582chr261828 1798 966 902 441 275 11021 22453 568 2957 186
NM_144583chr251404 1176 709 531 194 11384 11599 1700
NM_144590chr1062119 2074 1033 985 411 207 ----12227
NM_144594chr121196 ------
NM_144658chrX1132 ------
NM_144664chr1142140 1711 625 187 1226 ----
NM_144710chr261483 1059 450 239 210 155 ------
NM_144721chr472462 2352 1810 1084 471 354 340 12116 ----
NM_144778chr134596 460 436 211 22488 872 --1153
NM_144949chr221622 411 1391 --12249
NM_144967chrX3796 420 150 ------
NM_144973chr12134924 4797 4780 4735 4582 4330 4016 3349 2016 1868 1344 991 258 14242 33449 954 410 --
NM_144974chr131814 ------
NM_144979chr41124 ------
NM_144982chr12124 ----167
NM_145056chr194838 742 110 85 ------
NM_145117chr1172923 2881 2408 2296 1196 664 464 --12465 --
NM_145175chr221094 1044 1508 ----
NM_145206chr1063130 2931 2811 2591 2069 1063 ------
NM_145259chr2106762 5551 5523 5059 4302 1320 1142 975 492 155 11433 ----
NM_145284chrX32130 1810 155 --1513 --
NM_145320chr763194 2608 1415 720 326 307 --12959 --
NM_145321chr763194 2608 1415 720 326 307 --12959 --
NM_145322chr763194 2608 1415 720 326 307 --12959 --
NM_145331chr62766 245 ------
NM_145332chr62914 393 ------
NM_145333chr62914 393 ------
NM_145686chr252989 317 311 204 33 --12593 144
NM_145687chr252989 317 311 204 33 --12593 144
NM_145690chr861759 1580 1433 1381 325 292 ------
NM_145698chr1012016 ------
NM_145715chr4186 ------
NM_145793chr101806 ------
NM_145808chr732975 1183 1055 ------
NM_145891chr165574 554 101 52 26 --11255 --
NM_145892chr165574 554 101 52 26 --11255 --
NM_145893chr165696 676 223 174 148 --11377 --
NM_145913chr122960 761 2944 58 ----
NM_147156chr103617 450 166 --11203 --
NM_147168chr91156 ----123
NM_147189chr841875 1577 1568 125 ------
NM_147223chr2--1537 22230 1767 2802 729
NM_147233chr21855 1354 22047 1584 2619 546
NM_148174chr831718 1686 1544 ------
NM_148898chr72901 838 ------
NM_148899chr72901 838 ------
NM_148904chr13665 262 94 ------
NM_148905chr13665 262 94 ------
NM_148906chr13665 262 94 ------
NM_148907chr13665 262 94 ------
NM_148908chr13665 262 94 ------
NM_148909chr13665 262 94 ------
NM_148921chr1761876 1539 959 218 176 120 182 11720 2800 318
NM_148955chr1556108 5537 4681 1245 153 21983 968 15438 --
NM_148977chr1011100 --11349 --
NM_148978chr1011100 --11349 --
NM_152240chr331250 943 805 ------
NM_152253chr2253933 3848 3210 423 388 2936 804 64062 3630 2675 1518 1369 433 13030
NM_152263chr185810 4594 2232 1663 1316 1263 661 461 15334 ----
NM_152265chr121468 60 ------
NM_152271chr82261 164 ------
NM_152275chr231867 1787 501 --1556 --
NM_152280chr183461 3176 2141 1125 1104 322 85 21 11063 1316 --
NM_152282chr331356 1089 297 2987 277 ----
NM_152283chr561158 446 317 267 173 27 ------
NM_152292chr442044 1891 1626 674 ----1867
NM_152335chr151612 --1135 1520
NM_152344chr1751509 1497 611 413 133 ------
NM_152409chr5103481 3146 2845 2502 2301 1145 1060 523 214 105 21102 975 ----
NM_152410chr61171 ------
NM_152422chr951815 1585 1402 686 337 ------
NM_152424chrX94313 4296 4220 3941 3421 3130 1345 974 233 14746 23394 3102 --
NM_152440chr122356 182 129 ----
NM_152450chr1551710 852 451 307 222 ------
NM_152470chr1864181 1669 1233 1023 858 192 --12750 13173
NM_152529chr264097 3540 3306 1464 598 271 31271 426 287 ----
NM_152542chr452185 2008 1805 852 367 1658 1415 --
NM_152608chr121952 1894 1284 --11743
NM_152622chr523316 1194 13400 ----
NM_152624chr5127299 7216 6512 4526 2575 2560 1998 929 891 784 606 521 12019 16906 --
NM_152629chr973963 2668 1646 1518 1433 571 368 ------
NM_152636chr1182889 2540 2160 861 676 520 496 108 12388 ----
NM_152673chr353576 1226 1055 604 141 --13713 13646
NM_152680chr431555 453 140 32181 1810 28 ----
NM_152687chr541124 1074 906 877 ------
NM_152688chr61655 ----1783
NM_152695chrX41842 913 263 152 ------
NM_152723chr1141154 858 350 102 ------
NM_152733chr6156349 6328 5922 5834 4971 4850 3933 2427 2063 1758 1599 927 276 238 110 24007 1053 45958 4641 4084 2588 --
NM_152737chr632141 1574 1451 11365 ----
NM_152739chr72154 131 ------
NM_152754chr722900 2726 23238 191 ----
NM_152756chr574040 3654 3646 3454 3037 2795 650 12712 1450 --
NM_152758chr892771 2447 2215 2177 1038 963 606 483 388 ------
NM_152787chrX53924 3295 981 903 567 12561 ----
NM_152793chr7115093 4823 4638 4182 3427 1657 1637 1533 1438 850 682 --24110 3999 --
NM_152826chr1556108 5537 4681 1245 153 21983 968 15438 --
NM_152835chr151974 1860 968 725 159 --1107 --
NM_152836chr82512 311 --11785 --
NM_152837chr82512 311 --11785 --
NM_152862chr21287 ------
NM_152890chr11428 ------
NM_152903chr1372505 2005 1934 1921 1812 773 426 1603 12666 --
NM_152914chr1774337 3357 1482 1103 898 787 405 1920 43150 2803 1762 852 11703
NM_152924chr15205763 5662 5630 4745 4373 2487 1910 1735 1701 1441 1425 1384 1306 1244 1120 990 975 840 440 26 15460 32660 1090 176 11582
NM_152999chr794900 4514 4222 3848 1099 1093 944 766 751 --1154 13456
NM_153020chr641140 1052 508 54 --1157 --
NM_153042chr661591 1234 614 531 160 124 ------
NM_153182chr332709 271 88 12443 22858 2619 --
NM_153183chrX11124 --3468 168 104 --
NM_153184chr351595 1417 778 731 492 ------
NM_153188chr585439 4603 4554 4269 4006 2004 1402 244 14979 ----
NM_153207chr1252708 2488 1592 914 829 ----11311
NM_153223chr511084 1593 133 --
NM_153260chr1531166 475 255 --11265 11252
NM_153262chr1112978 1176 1038 1019 856 795 594 465 249 53 47 ------
NM_153332chr863286 3110 2893 2070 1216 28 2447 272 ----
NM_153341chr1176 ------
NM_153346chrX31930 1916 75 11402 ----
NM_153362chr62292 197 1896 --1354
NM_153374chr15123 ------
NM_153442chr10165875 5004 4778 4762 4727 4317 2450 2412 2042 1697 1193 1187 1051 755 506 146 1242 55548 3965 1398 1385 408 --
NM_153605chr361556 1294 1163 649 251 135 ------
NM_153607chr563175 3066 2067 952 718 624 ------
NM_153619chr1571096 819 578 550 510 315 148 --1421 --
NM_153633chr121152 ------
NM_153634chr1231245 286 242 ------
NM_153645chr2243069 2942 1126 332 2834 98 1287 --
NM_153689chr272184 1674 1568 762 731 563 420 ------
NM_153694chr121246 ------
NM_153702chr41208 ------
NM_153704chr82463 384 ------
NM_153706chr52216 50 ------
NM_153764chr112110 37 ------
NM_153765chr112110 37 ------
NM_153766chr112110 37 ------
NM_153767chr112110 37 ------
NM_153810chr1085102 4253 3991 3679 3534 3364 325 289 14980 ----
NM_153828chr23806 732 649 ------
NM_153836chr241902 1467 419 196 11321 ----
NM_170606chr731567 490 484 ------
NM_170607chr1731122 996 321 --11539 --
NM_170665chr1294353 4248 4074 3575 3223 1306 1296 922 155 14129 13382 --
NM_170696chr1561641 1361 526 483 424 389 ------
NM_170697chr1561641 1361 526 483 424 389 ------
NM_170709chr81876 11828 1306 12017
NM_170711chr192363 221 ------
NM_170719chr1321128 1015 ------
NM_170731chr11----11995 --
NM_170732chr11----11995 --
NM_170733chr11----11995 --
NM_170734chr11----11995 --
NM_170735chr11----11995 --
NM_170775chr51260 ------
NM_171825chr562973 2884 2798 2449 1941 658 --12605 --
NM_172069chr242109 1978 361 110 ------
NM_172070chr242087 1605 1541 137 ------
NM_172071chr186889 6879 4788 2796 2291 2176 1489 302 1115 15739 15147
NM_172127chr42315 227 --11367 --
NM_172128chr42271 183 --11323 --
NM_172373chr1321342 88 177 ----
NM_173054chr7131 ------
NM_173078chrX2115 75 ------
NM_173083chr14468 121 73 21 ------
NM_173167chr1742696 2506 649 600 12177 ----
NM_173171chr22470 22 ------
NM_173173chr22470 22 ------
NM_173214chr16116928 5830 5568 5074 2980 2825 1913 1323 1085 1071 316 22788 39 27868 6328 --
NM_173359chr321813 1676 --1710 --
NM_173454chr152949 778 ------
NM_173470chrX52902 2760 2441 2417 422 --11043 --
NM_173471chr321049 1027 --1824 --
NM_173473chr1052675 2307 1741 992 712 11836 ----
NM_173478chr173747 690 93 ------
NM_173495chrX62479 1926 1830 851 753 470 --12197 --
NM_173496chr1082885 2484 2457 849 416 250 220 119 ----32390 971 269
NM_173505chr183871 394 69 11037 1318 --
NM_173510chr2262570 2134 2075 1795 915 255 ------
NM_173511chr263881 2996 2878 2737 1498 103 13499 ----
NM_173552chr331931 1570 169 21952 882 ----
NM_173560chr62521 457 ------
NM_173562chr653333 2563 2411 754 434 32192 879 848 22974 682 --
NM_173563chr61233 178 --145
NM_173576chr1052103 687 586 578 280 1376 1635 --
NM_173582chr1165931 5898 5343 4479 1484 800 24689 3851 ----
NM_173595chr12144488 4240 3808 3793 3567 3555 3290 3216 2107 1906 1898 1814 1340 1164 11062 55197 4957 4495 4030 3449 --
NM_173602chr1293408 2852 2511 2423 2356 1010 918 325 78 13357 ----
NM_173611chr15163 ------
NM_173642chr1159105 8659 7633 7535 7498 7181 5873 5833 2933 1691 1068 1008 755 688 516 48085 6762 2377 1037 11170 17405
NM_173645chr21215 ------
NM_173648chr23919 418 209 ------
NM_173654chr362285 1469 845 542 376 45 1677 ----
NM_173797chr531236 442 309 133 ----
NM_173808chr1104198 3835 3678 1497 1273 1256 1205 986 647 493 --21761 733 --
NM_173824chr32111 58 ------
NM_173825chr352190 2005 1980 992 387 22166 776 12081 --
NM_173851chr843677 3600 309 45 --13293 33690 1300 742
NM_174890chr102297 91 --1531 --
NM_174911chr853993 3868 3275 1517 1240 1506 --12815
NM_174937chr102631 551 ------
NM_175038chr123230 78 51 ------
NM_175056chr341519 1442 1375 638 1826 ----
NM_175061chr721945 1646 1372 ----
NM_175610chr1521422 352 ------
NM_175623chr12107598 7466 6243 5383 2335 2299 813 422 209 85 35838 2801 1675 --36656 4886 131
NM_175624chr12107693 7561 6338 5478 2430 2394 908 517 304 180 35933 2896 1770 --36751 4981 226
NM_175625chr12107693 7561 6338 5478 2430 2394 908 517 304 180 35933 2896 1770 --36751 4981 226
NM_175733chr1181854 1636 1610 1585 523 493 430 372 11539 ----
NM_175736chr12267685 7544 7294 7120 7063 6907 6746 6717 6429 6252 6198 5633 5627 5372 5313 5237 4851 3145 3103 2642 2391 2262 2243 1830 1673 1438 --45388 4922 2713 2460 26567 2428
NM_175767chr571566 1374 1270 1253 489 422 194 --1267 --
NM_175854chr1321961 714 22474 2157 ----
NM_175861chr12105957 5468 4877 4632 3884 3650 1929 1108 276 116 11794 11511 1754
NM_175863chr621186 954 11226 ----
NM_175876chr132355 2208 866 1828 --12482
NM_175921chr564283 3393 2721 1314 659 67 14100 ----
NM_175931chr1691627 1441 1395 1365 1335 813 414 167 86 11677 2261 58 --
NM_176787chr182494 71 1487 ----
NM_177414chr13563 157 67 ------
NM_177438chr1464251 3654 3332 3205 1000 380 12932 ----
NM_177454chr23699 343 222 ----1249
NM_177524chr71984 --11172 --
NM_177525chr71984 --11172 --
NM_177531chr85910 458 441 432 167 1847 1267 --
NM_177538chr2178394 7999 7820 7391 7275 6940 6758 6667 6194 5886 5391 2937 2098 1764 1453 1048 298 47113 2768 2398 1832 ----
NM_177966chr32724 261 --21880 91 11670
NM_177968chr262145 1806 667 563 531 73 ----1598
NM_177972chr1174204 3892 3649 3577 888 532 422 34415 3045 1447 42787 2758 1237 684 --
NM_177983chr21141 ------
NM_177985chr251624 1503 487 407 199 --12150 --
NM_177989chr32269 239 ------
NM_177990chr2011906 --11526 --
NM_177995chr951815 1585 1402 686 337 ------
NM_177996chr2042875 2405 465 83 43238 1262 563 311 23105 475 --
NM_178011chr1082691 2628 2356 1322 741 640 511 86 1137 ----
NM_178037chr1263643 3276 2734 1151 774 586 --12615 11336
NM_178038chr1263643 3276 2734 1151 774 586 --12615 11336
NM_178042chr32269 239 ------
NM_178123chr21202 ------
NM_178140chr552337 1988 996 951 185 2886 871 1123 --
NM_178151chrX177887 6575 5902 5326 5256 4769 3152 3032 2595 2538 2503 2386 1715 1626 248 101 40 27535 418 17703 11129
NM_178152chrX177887 6575 5902 5326 5256 4769 3152 3032 2595 2538 2503 2386 1715 1626 248 101 40 27535 418 17703 11129
NM_178153chrX177887 6575 5902 5326 5256 4769 3152 3032 2595 2538 2503 2386 1715 1626 248 101 40 27535 418 17703 11129
NM_178313chr231734 1582 36 --11602 --
NM_178424chr51517 ------
NM_178426chr142127 1756 1636 786 --2304 268 --
NM_178427chr142027 1656 1536 686 --2204 168 --
NM_178450chr51188 1113 1145 --
NM_178470chrX2425 124 11156 31569 58 23 --
NM_178505chr1063466 3258 3080 2285 1262 78 ------
NM_178509chr1733962 3894 1358 23362 1165 ----
NM_178554chr393360 1413 1176 918 844 800 651 459 252 --2863 490 1583
NM_178558chr721046 75 ------
NM_178584chr261483 1059 450 239 210 155 ------
NM_178585chr493269 2706 2437 2012 1274 643 609 486 248 ----1279
NM_178586chr1472316 2281 834 645 570 376 253 1671 11534 2871 663
NM_180989chr1322090 577 --12376 --
NM_181077chr1552178 1906 1893 1670 832 ------
NM_181291chr142652 260 --169 --
NM_181361chr311460 ------
NM_181453chr261333 1096 518 487 387 211 ------
NM_181481chr1886145 5959 5613 5586 4558 2296 1909 979 36222 2650 710 17001 --
NM_181482chr1886145 5959 5613 5586 4558 2296 1909 979 36222 2650 710 17001 --
NM_181483chr1886145 5959 5613 5586 4558 2296 1909 979 36222 2650 710 17001 --
NM_181493chr201372 ------
NM_181504chr584192 4128 3591 3493 3103 1461 1117 75 ------
NM_181523chr584192 4128 3591 3493 3103 1461 1117 75 ------
NM_181524chr584192 4128 3591 3493 3103 1461 1117 75 ------
NM_181527chr201301 1415 --1122
NM_181528chr201356 1470 --1177
NM_181571chr1031017 245 173 ------
NM_181643chr111573 --11460 150
NM_181645chr113482 267 244 ------
NM_181670chr1231072 457 380 ------
NM_181671chr173842 709 91 --2883 615 --
NM_181672chrX31928 1793 1451 ------
NM_181673chrX31928 1793 1451 ------
NM_181698chr101541 ------
NM_181723chr822266 1532 11429 ----
NM_181747chr7275 28 ------
NM_181784chr242246 2022 1906 769 1412 21611 94 --
NM_181787chr842916 2439 1291 1006 --22842 415 --
NM_181794chr63947 209 179 ------
NM_181795chr63947 209 179 ------
NM_181807chr111363 ------
NM_181897chr362436 2169 621 449 240 184 --1107 --
NM_182485chr423647 3632 --2899 252 1375
NM_182487chr9124296 4145 3801 3669 3513 3277 3162 3150 3107 1160 726 658 13328 11362 --
NM_182503chr674712 4440 2150 1440 480 453 304 15502 24391 1101 1399
NM_182511chr1841122 206 150 100 ----1372
NM_182515chr19116570 6415 4793 4568 4345 1968 1811 1797 1755 290 91 1887 15747 --
NM_182522chr34364 287 257 22 1266 --1877
NM_182543chr10134 ------
NM_182546chr72134 24 --1107 --
NM_182551chr293283 3248 3177 3078 3026 2905 2450 2245 64 --1426 --
NM_182580chr162372 1816 1743 524 341 120 --1508 31917 1659 757
NM_182620chr1762192 2166 2029 1572 322 123 11455 ----
NM_182643chr852110 2031 1793 726 501 12275 --1539
NM_182646chr423647 3632 --2899 252 1375
NM_182701chr62332 304 ------
NM_182715chr71281 ------
NM_182717chr1031422 578 31 1154 ----
NM_182718chr1031017 245 173 ------
NM_182719chr1031017 245 173 ------
NM_182720chr1031422 578 31 1154 ----
NM_182721chr1031422 578 31 1154 ----
NM_182722chr1031422 578 31 1154 ----
NM_182723chr1031422 578 31 1154 ----
NM_182724chr1031017 245 173 ------
NM_182725chr1031017 245 173 ------
NM_182757chr663406 2654 2191 1321 734 314 --1620 --
NM_182762chr7105980 5499 5421 5276 5224 3838 2344 2227 1723 887 ------
NM_182763chr162524 2488 1876 1041 518 483 --22205 67 --
NM_182769chr1031017 245 173 ------
NM_182770chr1031017 245 173 ------
NM_182771chr1031017 245 173 ------
NM_182772chr1031017 245 173 ------
NM_182797chr2031466 1457 510 ------
NM_182830chr1452269 1832 1485 826 770 21590 684 ----
NM_182850chr1031017 245 173 ------
NM_182853chr1031422 578 31 1154 ----
NM_182854chr162426 308 ------
NM_182898chr7156588 6006 5692 5591 5254 5054 4546 4394 4253 2320 1426 744 399 236 111 --24788 1420 128
NM_182899chr7156588 6006 5692 5591 5254 5054 4546 4394 4253 2320 1426 744 399 236 111 --24788 1420 128
NM_182907chr662012 1929 1602 811 557 153 22052 1802 ----
NM_182920chr361359 1353 1313 1203 919 906 --11243 11382
NM_182943chr311096 --11137 --
NM_182948chr163181 909 818 303 284 111 ------
NM_182964chr1172923 2881 2408 2296 1196 664 464 --12465 --
NM_183004chr1432529 1147 914 --23354 1376 --
NM_183011chr1031422 578 31 1154 ----
NM_183012chr1031422 578 31 1154 ----
NM_183013chr1031422 578 31 1154 ----
NM_183043chr133953 241 51 --1354 --
NM_183044chr133953 241 51 --1354 --
NM_183050chr652237 2094 967 643 302 11734 ----
NM_183060chr1031017 245 173 ------
NM_183078chr6103821 3632 3469 3141 3077 3030 2988 2671 1060 675 13284 22421 510 --
NM_183397chr2084886 4165 4012 1958 987 563 322 220 14659 14900 25004 4826
NM_183415chr1251836 1507 1279 601 231 1365 2191 25 --
NM_183416chr171709 1695 1581 1502 1360 1317 555 11802 --11467
NM_183419chr821430 1028 ------
NM_184234chr201602 ------
NM_194247chr273112 2857 1642 1553 1474 716 583 13207 13433 --
NM_194250chr21297 ------
NM_194278chr1443365 3237 2947 760 --13784 2831 654
NM_194285chr1182452 2186 1204 1195 690 650 279 179 --22955 1189 13048
NM_194286chr1276160 6093 4496 4336 1440 1301 838 22414 498 45563 4866 2339 283 15005
NM_194314chr164712 4647 3693 1269 783 679 14458 ----
NM_194324chrX1375 ------
NM_194328chr961217 1145 861 847 283 215 11050 12800 --
NM_194329chr961217 1145 861 847 283 215 11050 12800 --
NM_194330chr961217 1145 861 847 283 215 11050 12800 --
NM_194332chr961217 1145 861 847 283 215 11050 12800 --
NM_194356chr1272292 2216 2094 1703 812 581 525 --12041 --
NM_194434chr1865512 5000 4771 4401 4395 3872 2823 307 --15245
NM_194454chr731647 1633 1296 1167 ----
NM_194455chr731647 1633 1296 1167 ----
NM_194456chr731647 1633 1296 1167 ----
NM_194463chrX31275 1010 865 --1416 1265
NM_197941chr552762 2608 2442 2170 910 11959 ----
NM_197970chr231106 635 76 11546 ----
NM_198066chr1473073 3067 2661 2512 2498 2208 730 --1818 --
NM_198087chr1641221 1068 1028 191 ----1493
NM_198088chr1641221 1068 1028 191 ----1493
NM_198089chr193847 595 327 ----1706
NM_198120chr84504 371 227 217 1132 ----
NM_198181chr1542723 2405 2205 2058 ------
NM_198204chr1731122 996 321 --11539 --
NM_198205chr1731122 996 321 --11539 --
NM_198217chr131689 ------
NM_198218chr131689 ------
NM_198219chr131689 ------
NM_198225chr1031359 768 700 1715 --1602
NM_198256chr231298 619 556 --1339 --
NM_198273chr583160 2661 2219 1967 914 471 214 81 1590 ----
NM_198281chr452702 2164 1307 1217 883 12621 11346 --
NM_198320chr12114910 4285 3839 3475 1534 1111 1018 956 918 652 144 35167 4299 3229 159 --
NM_198336chr731626 1519 1135 1679 1438 --
NM_198391chr201506 ------
NM_198392chr6102354 2283 2100 1998 1792 1542 551 534 498 349 32117 337 282 1222 12305
NM_198395chr52202 43 ------
NM_198396chr171161 ------
NM_198465chrX3426 356 205 22888 919 --12938
NM_198468chr684265 3447 3010 1797 1298 1264 994 64 2861 652 13432 11389
NM_198489chr111142 ------
NM_198513chr82216 26 --2633 147 --
NM_198560chr353471 3081 2904 191 77 --43654 520 438 137 1413
NM_198569chr672195 2049 2004 1786 1768 1003 678 ------
NM_198581chr2197486 7192 7133 7008 6862 6508 5884 5562 5233 5094 4936 4707 1561 1473 1275 1210 670 359 152 12012 17016 --
NM_198595chr4124817 3863 3742 3067 1933 1863 1298 1047 1021 324 111 21 --24158 4027 --
NM_198700chr111370 ------
NM_198793chr363700 3391 2899 2889 2528 633 1288 12930 --
NM_198859chr385164 4951 4304 3993 3776 3598 3217 1967 ------
NM_198900chr12267685 7544 7294 7120 7063 6907 6746 6717 6429 6252 6198 5633 5627 5372 5313 5237 4851 3145 3103 2642 2391 2262 2243 1830 1673 1438 --45388 4922 2713 2460 26567 2428
NM_198904chr562007 1833 1551 1320 826 66 --1570 --
NM_198935chr2063271 3060 2341 882 706 48 31303 1105 962 1984 --
NM_198965chr12123 ------
NM_198966chr12123 ------
NM_198968chr13103684 3189 3125 2469 1444 1404 1323 1309 1035 519 1596 ----
NM_199000chr721930 615 22267 1855 ----
NM_199003chr821479 522 1540 11135 --
NM_199039chr411044 ------
NM_199050chr21103814 3217 2711 1311 784 755 670 322 165 123 --123 --
NM_199053chr43968 213 178 131 ----
NM_199132chr1941928 1860 1557 569 ------
NM_199144chr2021528 551 ------
NM_199160chr921564 233 ----11330
NM_199168chr1021116 302 1271 --1377
NM_199188chr1243679 2593 202 173 1749 ----
NM_199189chr52970 328 1802 ----
NM_199190chr1243679 2593 202 173 1749 ----
NM_199203chr2021528 551 ------
NM_199244chr92940 299 --1280 --
NM_199320chr452198 1870 968 888 862 ------
NM_199320chr452198 1870 968 888 862 ------
NM_199324chr463225 2688 2375 541 428 167 ------
NM_199328chr2141120 268 240 230 1766 ----
NM_199355chr1641388 650 339 329 --11707 --
NM_199421chr1474812 3653 1498 1154 773 619 308 ------
NM_199423chr1641391 992 383 377 1359 --1485
NM_199436chr262854 2447 1980 1907 1027 61 22798 342 ----
NM_199437chr1162088 1996 1934 836 395 188 ------
NM_199438chr1162088 1996 1934 836 395 188 ------
NM_199439chr1162088 1996 1934 836 395 188 ------
NM_199454chr184761 4753 3983 3480 3285 3037 2918 148 --1205 --
NM_199461chr1063653 2847 2516 2487 529 522 11082 ----
NM_199462chr184516 4365 4133 3689 1983 1206 1175 940 3856 769 332 23637 1682 --
NM_199478chrX61708 798 301 288 42 28 11443 ----
NM_201266chr262981 2831 2436 2368 2073 649 --32406 2322 943 --
NM_201267chr22233 213 ------
NM_201269chr131472 1219 975 ------
NM_201279chr262981 2831 2436 2368 2073 649 --32406 2322 943 --
NM_201413chr2131070 773 755 ------
NM_201414chr2131070 773 755 ------
NM_201428chr1141426 1066 1029 112 1593 ----
NM_201429chr1141426 1066 1029 112 1593 ----
NM_201430chr1131352 992 38 1519 ----
NM_201432chr17136071 5450 4914 4594 4506 4445 4161 2067 1929 1597 1272 812 358 --2417 378 --
NM_201433chr17136071 5450 4914 4594 4506 4445 4161 2067 1929 1597 1272 812 358 --2417 378 --
NM_201434chr172752 66 ------
NM_201437chr811308 ------
NM_201613chr124883 669 356 328 ------
NM_201624chr131194 961 319 ------
NM_201632chr551644 1317 1258 1192 702 --1397 1248
NM_201634chr551743 1416 1357 1291 801 --1496 1347
NM_202002chr123616 368 356 --153 --
NM_203291chr181193 ------
NM_203292chr181186 ------
NM_203304chr193857 557 220 --1318 --
NM_203309chr14------125
NM_203342chr1103590 3368 2563 2523 2401 2337 1397 855 744 325 2105 46 22667 376 --
NM_203343chr1103590 3368 2563 2523 2401 2337 1397 855 744 325 2105 46 22667 376 --
NM_203349chr1531707 1423 401 31532 124 35 ----
NM_203350chr11305 ------
NM_203364chr111238 ------
NM_203390chr841545 1427 1401 1328 1471 --1296
NM_203391chrX11325 --1138 1299
NM_203406chr532309 1955 1880 22540 182 ----
NM_203437chr23880 106 78 ------
NM_203446chr2162514 748 632 383 268 223 --1777 --
NM_203454chr111077 --11117 --
NM_203458chr153788 3099 2877 2851 2693 21466 1280 --13339
NM_203488chr141156 --185 --
NM_203504chr422142 699 1749 ----
NM_203505chr422142 699 1749 ----
NM_205860chr182998 2844 2115 2027 1985 1270 996 927 --1103 --
NM_205864chr61134 ----148
NM_206594chr193609 3525 3011 2342 1205 855 846 749 557 23394 2222 ----
NM_206595chr193609 3525 3011 2342 1205 855 846 749 557 23394 2222 ----
NM_206832chr171258 ------
NM_206854chr653851 3637 1135 1048 281 11271 ----
NM_206855chr684816 4602 4089 3941 2100 2013 1246 386 22236 510 ----
NM_206866chr2163298 2456 2307 2118 1143 21 12444 ----
NM_206876chr263522 3160 2864 2271 2241 726 ------
NM_206909chr8128166 7780 7241 6933 6782 6643 6589 6443 3309 1649 527 492 35893 888 55 35713 2691 2310 17287
NM_206914chr1291780 1607 1426 828 407 292 190 41 29 1652 --1233
NM_207012chr1032842 2355 39 23373 2722 23439 485 --
NM_207015chr362364 2167 1653 827 461 56 3731 620 303 ----
NM_207036chr1562241 2193 1689 1610 892 697 ------
NM_207037chr1562241 2193 1689 1610 892 697 ------
NM_207038chr1562241 2193 1689 1610 892 697 ------
NM_207040chr1562241 2193 1689 1610 892 697 ------
NM_207043chr162302 2036 1950 1500 434 216 --22213 166 --
NM_207044chr162302 2036 1950 1500 434 216 --22213 166 --
NM_207047chr162302 2036 1950 1500 434 216 --22213 166 --
NM_207113chr731581 647 94 ------
NM_207189chr11122 ------
NM_207292chr363172 2931 2836 2612 1141 437 ------
NM_207293chr363172 2931 2836 2612 1141 437 ------
NM_207294chr363172 2931 2836 2612 1141 437 ------
NM_207295chr363172 2931 2836 2612 1141 437 ------
NM_207296chr363172 2931 2836 2612 1141 437 ------
NM_207297chr363197 2956 2861 2637 1166 462 ------
NM_207299chr95712 386 244 57 44 ------
NM_207303chr10104125 3949 3922 3901 2865 1354 826 767 754 130 13339 ----
NM_207304chr134483 347 323 98 22375 759 --140
NM_207317chr53325 187 96 --1119 --
NM_207325chr1921798 1681 22005 246 1104 --
NM_207343chr113498 464 156 162 1343 --
NM_207348chr151954 1694 1595 1385 1252 --1188 168
NM_207361chr1376299 5712 4776 4592 2099 1990 1429 11211 15705 1872
NM_207371chr1011365 ----1571
NM_207406chr496038 4460 4231 4130 2325 2285 449 304 48 25959 1838 21797 919 --
NM_207445chr1541516 1476 821 368 --1180 1405
NM_207506chr831000 935 536 --1100 --
NM_207517chr154780 212 189 170 ------
NM_207520chr23806 732 649 ------
NM_207521chr23806 732 649 ------
NM_207577chr1142915 2511 1801 841 1135 ----
NM_207647chr952365 2316 1711 591 450 21799 945 11994 --
NM_212471chr1762114 2064 1691 903 658 451 ------
NM_212472chr1762114 2064 1691 903 658 451 ------
NM_212554chr1031645 261 85 ------
NM_212558chr9133888 3465 3292 3167 3025 2917 2665 1531 1453 1349 865 624 242 11543 --24007 2860
NM_213619chr82293 137 ------
NM_213620chr82293 137 ------
NM_213648chr551644 1317 1258 1192 702 --1397 1248
NM_213651chr121718 144 ------
NM_213654chr331360 1112 312 ------
NM_213662chr1732389 2020 590 ----11949