TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4326
miRNA Sequence: UGUUCCUCUGUCUCCCAGAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000125chr693461 3229 2841 2799 2791 2777 1427 1067 783 52677 1154 980 596 191 ----
NM_000208chr1973875 3703 3604 3529 2948 1682 1129 24495 1483 --24058 864
NM_000259chr1576029 4534 4309 1640 571 287 275 --15412 --
NM_000332chr6146799 6784 6386 5409 5119 4514 2713 1205 839 532 264 255 227 212 25973 2674 25416 1079 12508
NM_000337chr5146561 5304 4391 4175 2360 1488 1394 994 740 648 582 551 431 237 35902 2502 2162 ----
NM_000351chrX103555 3263 2900 2860 2727 2683 1264 878 700 81 1525 --1989
NM_000362chr22133502 3349 2660 2649 2608 2325 1347 877 603 589 530 443 167 --22230 263 11386
NM_000368chr964137 3634 3614 3157 1387 814 23264 821 24234 865 14523
NM_000461chr383924 3377 2921 1836 1742 1497 113 99 2553 531 11170 --
NM_000555chrX87101 5472 2999 2810 2460 2253 2221 764 37153 2799 982 26090 1799 --
NM_000599chr2184033 4005 3778 3680 3416 3342 3228 3014 2978 1729 1719 1710 1650 1505 1479 289 277 134 --23782 1081 23790 1582
NM_000618chr1285682 5252 1705 1424 1160 1127 1005 976 --26079 1074 26478 4502
NM_000618chr1285682 5252 1705 1424 1160 1127 1005 976 --26079 1074 26478 4502
NM_000633chr18124875 4026 3519 1300 1292 1237 883 632 619 547 529 441 34669 4354 1244 22005 1605 --
NM_000719chr12246681 5816 5652 5629 5476 5286 5131 5077 4406 4379 4368 4356 4284 2584 2572 2298 2230 1783 806 643 486 235 208 172 45233 2698 2465 1791 24760 648 11146
NM_000721chr1112435 2055 1881 672 571 336 248 235 139 96 90 41850 1749 553 279 1929 --
NM_000809chr4118306 8035 6799 3365 2073 1313 1152 736 569 463 448 38948 8869 1592 12163 28897 8535
NM_000831chr1185689 4842 2398 2108 1855 1849 1575 1356 1248 1122 854 784 626 618 481 130 68 46 34976 1493 1208 --15826
NM_000926chr11128441 7586 6826 6554 6512 6488 6385 6374 6316 2344 937 475 36935 3579 2201 27288 7220 16408
NM_001001344chrX111644 992 809 701 540 294 270 252 246 234 216 21863 115 --11771
NM_001001481chr873441 2937 2414 2287 2277 2130 472 33105 2599 2361 ----
NM_001001669chr592437 2267 2228 2035 1988 792 556 412 68 1767 1885 11786
NM_001003407chr10114994 4686 4406 4219 1879 1545 1398 1388 778 533 276 33157 698 552 ----
NM_001003408chr10114994 4686 4406 4219 1879 1545 1398 1388 778 533 276 33157 698 552 ----
NM_001003652chr18108140 8000 7603 7323 2946 1778 1415 1303 579 218 22489 897 27224 2008 --
NM_001003674chr18124882 4659 4503 4321 2366 2076 1378 616 547 423 259 156 1680 12334 15546
NM_001003675chr18124882 4659 4503 4321 2366 2076 1378 616 547 423 259 156 1680 12334 15546
NM_001003794chr3163087 2864 2604 2563 2372 2183 2069 2014 1997 1240 1041 960 879 860 328 50 --12546 --
NM_001003800chr993568 3382 3270 2972 2863 1086 661 333 319 43728 3650 2406 206 ----
NM_001003940chr1593753 3672 3302 2880 2787 2658 2615 1524 1471 23238 37 53271 2747 1141 368 298 1918
NM_001003942chr1593753 3672 3302 2880 2787 2658 2615 1524 1471 23238 37 53271 2747 1141 368 298 1918
NM_001003943chr1593757 3676 3306 2884 2791 2662 2619 1528 1475 23242 41 53275 2751 1145 372 302 1922
NM_001004304chr12163132 2811 2763 2516 2449 1994 1083 1039 1002 779 577 561 467 356 207 115 32528 951 620 ----
NM_001004419chr1294085 3621 2977 1773 1420 1100 974 436 39 ----13570
NM_001005473chr5166334 5922 1928 1890 1367 1206 1077 1057 1037 1017 1001 976 964 952 705 138 21566 234 14667 --
NM_001008220chr572985 1136 1117 692 467 453 95 13056 33166 2483 679 33856 2750 835
NM_001009899chr3116098 5962 5792 5629 4791 4597 4111 4063 2600 2526 320 22443 1944 ----
NM_001010891chr5156453 5744 5619 5573 4730 4604 4547 2239 2111 1501 1280 534 475 235 122 25671 1046 2871 538 --
NM_001014380chr1375179 4346 3879 3713 1801 1246 466 24022 300 1376 1606
NM_001014797chr10138099 8012 7018 6938 6920 6665 6644 6440 6272 5826 5302 5240 525 47649 6847 6299 5700 15295 26536 2304
NM_001017440chr7227745 7242 6962 6855 6687 6583 6504 6199 5451 5099 3192 3041 3003 2994 2742 2682 2554 2433 1807 1286 1215 547 46144 5440 5268 192 27181 5556 15633
NM_001018065chr9125499 5231 5152 4869 4560 4166 2016 1121 1024 1001 75 42 1454 1277 14676
NM_001018066chr9125499 5231 5152 4869 4560 4166 2016 1121 1024 1001 75 42 1454 1277 14676
NM_001018111chr7103882 3078 1580 1358 937 800 266 240 94 75 33464 1152 863 13707 22593 1465
NM_001024647chr1256427 6222 5954 5703 1815 27149 5692 25959 5644 1700
NM_001025077chr10107204 6465 6210 5463 5457 2293 999 510 467 89 37392 5913 1789 1987 --
NM_001030007chr16103272 3193 2760 2610 1247 963 330 308 128 46 11275 1108 13939
NM_001031695chr22184951 3682 3666 3660 3548 3539 3410 2127 1985 1502 1209 1104 1008 901 557 364 347 102 43507 1654 1021 917 44369 4154 2121 80 15408
NM_001032999chr2085267 3845 3727 3396 3354 2005 1314 397 13674 33715 3533 61 13359
NM_001033087chr2092970 2575 2150 475 436 397 117 91 74 --1218 22223 1994
NM_001034841chr1695551 4943 4903 4883 4762 1724 1650 1298 1108 --11405 1533
NM_001037165chr7238913 8755 8675 8601 8195 8055 7860 7482 6760 6303 3419 3145 3057 2684 2670 2623 2614 1613 1342 1230 469 303 93 28681 2822 46285 3532 1586 328 11493
NM_001039577chr154369 4003 1619 1417 1411 144 34362 3224 1424 1899
NM_001039709chr2085267 3845 3727 3396 3354 2005 1314 397 13674 33715 3533 61 13359
NM_001039840chrX115938 5215 5198 4887 4649 4300 4089 3959 2054 1613 1200 15151 ----
NM_001042355chr16175002 4920 4616 4439 4431 4422 4383 4372 4106 4089 3781 3768 3562 3514 3420 1727 425 --11717 --
NM_001042412chr16175002 4920 4616 4439 4431 4422 4383 4372 4106 4089 3781 3768 3562 3514 3420 1727 425 --11717 --
NM_001042537chrX82500 1754 1673 1584 425 414 392 382 1986 11984 --
NM_001042599chr2137651 6968 5988 5775 5458 5421 3015 1351 1263 1242 1012 421 174 12864 1202 12001
NM_001042603chr12115010 4977 4474 4154 3985 1893 888 726 701 543 441 25255 383 ----
NM_001043318chr14112984 1603 1526 1497 1074 953 569 555 547 434 80 13821 1738 13568
NM_001044385chr243459 978 720 666 ----33969 3312 24
NM_001045556chr8121711 1555 1363 1170 703 678 533 500 419 413 343 178 138 --11374
NM_001045557chr8121711 1555 1363 1170 703 678 533 500 419 413 343 178 138 --11374
NM_001100108chr1128311 7333 6899 6876 6564 2052 1923 1644 1366 1055 913 49 37602 1623 261 27749 7531 --
NM_001106chr3199748 8497 8406 8400 7435 6748 6680 6669 6236 3746 3588 3518 3439 3278 3123 2919 752 743 472 58802 3061 2601 2311 945 23815 427 16368
NM_001128chr16103272 3193 2760 2610 1247 963 330 308 128 46 11275 1108 13939
NM_001271chr15112630 2552 2280 2151 2058 1987 1061 883 397 263 150 42960 1290 319 139 1267 --
NM_001420chr1972547 2283 2212 1986 877 585 479 32605 1936 1079 --1443
NM_001546chr661039 373 161 99 64 57 146 ----
NM_001759chr12114722 4245 4109 3921 3600 3305 760 488 461 405 343 1332 13367 22100 478
NM_001987chr1294217 3971 3678 3227 3214 813 374 94 43 23738 130 23082 154 13472
NM_002025chrX138571 8541 7646 6391 6291 6210 5618 2700 2489 1997 1354 898 403 28722 1002 22641 92 18707
NM_002270chr574324 4217 4126 719 335 163 105 21131 376 --2725 389
NM_002313chr10114994 4686 4406 4219 1879 1545 1398 1388 778 533 276 33157 698 552 ----
NM_002336chr1283928 3640 3602 3198 573 553 387 80 2350 325 ----
NM_002657chr20143491 3446 3265 3025 2807 2673 2546 1574 1501 1211 1120 997 811 184 1140 12837 12584
NM_002886chr3125129 5075 4614 4239 3973 3870 3799 1678 1162 521 374 354 34495 1775 514 ----
NM_003034chr1288014 7557 7300 6959 6155 712 488 69 25331 125 25424 328 --
NM_003043chr3164291 4111 3856 3453 3327 3109 3083 2766 1314 1063 955 817 692 645 597 577 1935 11089 14116
NM_003099chr15116012 5497 5280 5015 4976 4535 4389 4287 4055 1401 316 24622 1803 15327 1654
NM_003108chr2176999 6035 5296 4882 4690 2709 2682 2380 2363 2297 2234 2228 2222 1790 658 596 60 1994 --12416
NM_003112chr722259 1105 ----22222 672
NM_003199chr1854259 3536 3442 1474 516 34849 4030 938 1221 1602
NM_003320chr11103175 2846 1634 1141 1068 836 714 352 346 151 24318 2921 ----
NM_003392chr3114256 4249 4027 2684 1654 1380 1138 998 695 282 206 ----11203
NM_003412chr372523 2355 2164 1929 1028 261 163 --1481 12660
NM_003468chr293275 2882 1618 1194 917 661 233 152 132 ----23466 3384
NM_003759chr463549 3247 3163 2625 1148 497 22666 127 1340 1119
NM_003966chr5106445 5736 5729 5695 5443 5122 4806 2892 1916 569 46186 3083 2080 1609 --17738
NM_003983chr16104242 4136 3603 3497 1330 312 306 232 213 97 13534 21064 224 --
NM_004171chr11119172 9074 8870 7323 7259 6726 3673 3126 2381 1607 369 48803 6813 1342 1194 38644 255 143 18533
NM_004338chr18124882 4659 4503 4321 2366 2076 1378 616 547 423 259 156 1680 12334 15546
NM_004397chr11144150 4124 4094 3829 3375 3096 3047 2679 1615 1430 826 687 268 64 1179 1511 11377
NM_004412chr1065823 4623 1351 1243 1118 787 24290 298 1757 15954
NM_004437chr1143560 3538 3069 3000 2866 2848 2545 2539 1104 1090 1058 1006 951 884 ------
NM_004650chrX61528 592 426 411 265 224 ----2483 294
NM_004745chr8116327 5820 5373 5362 5293 5097 4788 4633 1268 1259 750 14968 --1254
NM_004992chrX167265 7141 6571 6563 6096 5816 5152 3224 2850 2390 2315 1618 1420 918 856 754 22925 963 11593 --
NM_004992chrX167265 7141 6571 6563 6096 5816 5152 3224 2850 2390 2315 1618 1420 918 856 754 22925 963 11593 --
NM_005056chr12115254 5221 4718 4398 4229 2137 1132 970 945 787 685 25499 627 ----
NM_005063chr1093568 3535 2442 1524 1461 1172 1143 804 582 12813 21176 599 11235
NM_005093chr2085267 3845 3727 3396 3354 2005 1314 397 13674 33715 3533 61 13359
NM_005121chr1753777 1489 1474 684 339 13721 --1351
NM_005188chr1187565 7391 6683 6337 6162 1991 760 473 27773 844 --36229 1194 283
NM_005197chr14116050 5671 4300 3976 2422 2347 2306 2252 1967 887 494 42318 1592 524 367 31910 1612 504 14124
NM_005207chr2243022 2275 979 930 13492 12280 23539 3239
NM_005235chr2137651 6968 5988 5775 5458 5421 3015 1351 1263 1242 1012 421 174 12864 1202 12001
NM_005339chr474152 4049 3907 3374 3270 679 205 23234 1094 12736 149
NM_005397chr7103882 3078 1580 1358 937 800 266 240 94 75 33464 1152 863 13707 22593 1465
NM_005759chr274672 4620 3770 2998 1526 897 469 44220 4034 334 34 24664 3702 14736
NM_005840chrX167504 7473 7186 6751 6335 6031 5941 5339 4946 4820 2017 1407 1235 1163 139 85 25759 3040 37445 6652 2680 17239
NM_005901chr18108140 8000 7603 7323 2946 1778 1415 1303 579 218 22489 897 27224 2008 --
NM_005909chr583937 3711 3556 3459 3107 3048 491 408 31578 1348 1047 ----
NM_005935chr4174826 4371 4273 3324 1702 1659 1600 1504 1262 1146 901 892 838 735 345 205 33 --35034 1266 739 --
NM_005955chr144625 4589 1773 172 45306 4024 1728 157 --23529 821
NM_006037chr2113843 3834 3742 3426 3191 1845 1783 762 614 311 293 2217 119 34066 1787 579 1732
NM_006141chr1672189 688 504 497 487 471 277 ----11907
NM_006203chr5115275 5200 5078 5054 4341 3778 3710 2127 1849 1720 460 21578 158 11696 --
NM_006306chrX115732 5628 5595 5577 5426 4717 3812 1299 1237 1175 414 34222 1839 1076 13579 25437 151
NM_006359chrX82500 1754 1673 1584 425 414 392 382 1986 11984 --
NM_006371chr3115094 4722 4703 4256 3256 2012 1626 1539 1515 1244 1091 11183 --11360
NM_006464chr2114148 3956 3914 3848 3598 3090 1462 1313 859 548 466 --11537 12897
NM_006544chr1495939 5182 5027 4997 4624 4493 4298 2216 1500 35659 4584 1278 147 --
NM_006546chr17186334 5635 5299 5205 5199 4965 4689 4253 4181 4071 4062 2238 1948 1931 1873 1508 687 636 16025 21211 161 15043
NM_006595chr1151524 824 592 44 29 11662 --11425
NM_006650chr572985 1136 1117 692 467 453 95 13056 33166 2483 679 33856 2750 835
NM_006720chr10114994 4686 4406 4219 1879 1545 1398 1388 778 533 276 33157 698 552 ----
NM_006748chr8121711 1555 1363 1170 703 678 533 500 419 413 343 178 138 --11374
NM_007030chr5104568 4428 3973 3796 1763 1336 584 402 384 48 53910 3805 3735 3700 3665 --43875 3840 3770 3630
NM_007050chr20166516 5446 5147 3020 2916 2838 2692 2558 1939 1555 1435 1292 773 739 400 88 37244 2615 1995 ----
NM_007078chr10122897 2790 2716 2016 1872 1098 1059 1053 336 190 108 92 21931 1198 12246 --
NM_007249chr13128828 7428 3525 3060 2750 2582 2497 1969 1498 999 884 876 37865 2589 1552 --12295
NM_007283chr3163087 2864 2604 2563 2372 2183 2069 2014 1997 1240 1041 960 879 860 328 50 --12546 --
NM_007347chr1552733 2692 2616 2116 1226 22589 1972 1282 12900
NM_012193chr1195226 4228 3895 1769 1223 845 800 61 42 23388 2055 14053 13792
NM_012199chr1154473 4242 4179 3548 1593 929 867 855 833 462 443 109 89 78 55 ----1159
NM_012214chr2115713 5229 5195 4893 4686 4499 4242 4219 4212 4162 2223 55525 5511 4710 4461 2045 36153 4181 1727 --
NM_012288chr695569 5292 5171 4072 3891 1876 1794 58 24 35214 4431 1713 ----
NM_012296chr11173480 3460 3011 1562 1511 1438 1179 1006 976 965 902 632 611 543 332 261 144 2945 742 11016 11263
NM_012306chr12113454 3227 3074 3027 2887 2793 2562 2483 1341 919 297 1289 22688 186 22735 2488
NM_012316chr1144571 3893 3857 3820 3451 2092 1815 1255 1215 1026 988 485 286 162 ----1797
NM_013374chr332336 1201 40 21074 1052 12319 23116 916
NM_013382chr14132302 2084 1989 1955 1929 1705 1537 1481 899 592 101 87 35 --1766 --
NM_013391chr5396 87 79 1318 ----
NM_013943chr172949 2535 2068 1317 977 690 296 ----11253
NM_014106chr1542666 2582 2529 325 32608 2000 1025 --11085
NM_014112chr864051 3959 3798 899 469 276 14650 14186 15208
NM_014155chr11127119 5616 2756 2581 2532 2421 982 945 902 594 378 179 125 15470 14622
NM_014309chr22184941 3672 3656 3650 3538 3529 3400 2117 1975 1492 1199 1094 998 891 547 354 337 92 43497 1644 1011 907 44359 4144 2111 70 15398
NM_014613chr592919 2862 2406 2002 794 550 456 448 52 --11880 12959
NM_014674chr363539 3520 3438 2550 1274 119 13975 33104 2829 867 13691
NM_014746chr221122 152 33884 3022 743 23513 3079 13427
NM_014747chr1165764 5593 5372 5365 4506 4187 4084 3623 3528 2008 1981 1850 1442 836 555 334 14792 15720 --
NM_014909chr14143000 2853 2634 2516 1309 1249 949 936 867 659 559 334 255 80 33541 2443 1455 --22910 1240
NM_014953chr1383808 3582 3138 1354 1182 1139 1025 381 54303 3127 917 815 409 1789 1310
NM_014982chr14105426 5128 5025 4435 4221 2117 1711 1314 973 692 24813 1429 1876 25143 69
NM_015035chr20145853 5450 4997 4833 4771 4387 2601 2498 1816 1789 1642 1617 1052 910 34318 2632 1014 35827 5080 1904 26652 2127
NM_015039chr1154189 4183 4093 3910 3455 3336 2984 2773 2718 2661 1477 1410 1033 246 225 23949 3447 ----
NM_015049chr293226 2916 2414 920 752 222 172 129 96 2845 404 1138 --
NM_015071chr5185412 5367 5301 5215 4849 2575 2480 2352 1799 1609 1548 1415 893 851 670 337 246 224 22493 634 ----
NM_015077chr17144367 4267 4259 4232 4055 3383 2967 2938 863 705 445 384 355 188 33591 1440 62 34374 4066 3467 --
NM_015085chr17164201 3826 3600 3363 3225 3065 2649 1088 1035 937 904 885 805 505 470 314 --11748 --
NM_015094chr22104446 4404 4073 3923 2944 2859 1446 1261 187 47 2880 458 24011 1437 24488 1574
NM_015111chr5153644 3429 3264 3200 3142 3081 1445 1254 1029 933 881 565 308 179 134 53374 3024 940 658 367 --1208
NM_015247chr16175002 4920 4616 4439 4431 4422 4383 4372 4106 4089 3781 3768 3562 3514 3420 1727 425 --11717 --
NM_015250chr971870 1684 1572 1274 276 177 83 32030 1952 708 1547 --
NM_015291chr141016 961 851 167 23406 618 13248 --
NM_015299chr1493881 3258 3226 3112 2955 657 642 623 518 34029 2845 1458 33824 2728 2693 12771
NM_015310chr8137589 7475 6850 6689 2785 2561 2313 2106 1372 817 720 688 233 68038 6903 6728 6138 1594 891 47148 3367 1144 783 17488
NM_015313chr1194829 4025 3954 3027 837 742 537 521 204 --14034 21926 547
NM_015332chr7113271 3112 2540 2349 2310 1374 1074 927 842 471 86 23521 3277 1931 23456 3207
NM_015375chr1104490 3941 3704 3233 1735 1634 1608 672 550 108 1407 1259 11642
NM_015568chr20113437 3169 1483 894 738 705 626 617 416 394 22 12887 2987 125 22719 1703
NM_015686chrX142155 2022 2015 1903 1705 1660 1011 842 829 818 684 284 123 114 1229 11015 --
NM_015879chr18137573 7436 7417 6316 6051 5292 3378 3368 2933 2397 2176 1085 555 26501 6310 38441 7280 5930 18046
NM_016206chr398120 6731 3479 3457 3253 2411 2246 862 450 36576 1064 369 22675 2394 --
NM_016257chr1113331 3314 2818 2738 2456 2235 913 810 739 324 87 32834 2769 1099 2665 167 192
NM_016260chr217063 47554 5043 2606 766 31595 842 533 22846 2569
NM_016272chr2262407 1125 1043 1026 936 75 32465 2076 29 12606 12652
NM_016531chr453188 1607 1450 948 715 1295 24204 2993 34212 3899 1684
NM_017415chr574547 4453 4129 3276 1620 1534 31 41144 655 280 37 11426 --
NM_017488chr281413 1213 1157 1059 428 134 112 26 --1464 1121
NM_017637chr9109005 8979 8781 7895 5869 2323 2251 1864 1640 451 36066 3209 1886 23739 2407 --
NM_017645chr952931 2833 1990 1177 856 42202 870 863 687 11057 --
NM_017754chr674939 4847 4407 4046 585 524 514 31631 1516 341 1114 --
NM_017813chr895495 5093 4782 3950 3941 3688 1938 1896 1368 --15283 --
NM_017817chr133220 160 94 3528 85 78 ----
NM_017902chr10165668 4986 4265 4149 4115 3744 3730 3654 3636 3608 2114 1928 1921 1591 1418 1405 15485 1190 11914
NM_017919chr964771 4162 4004 1475 1225 408 25507 252 21387 804 1469
NM_018036chr1483440 1275 1158 982 846 426 76 47 21099 111 13151 --
NM_018085chr1177969 7285 6751 5730 5149 5100 5074 3032 2867 2517 2151 988 722 585 435 357 182 --36973 6623 1860 37637 7006 500
NM_018181chr1891845 1331 790 714 678 666 534 490 21 --1708 --
NM_018299chr873441 2937 2414 2287 2277 2130 472 33105 2599 2361 ----
NM_018440chr897438 6742 6100 3278 2582 1767 1690 1214 306 17789 28505 640 --
NM_018566chr154477 3303 957 769 715 45155 3698 1680 1643 13212 --
NM_018638chr1295639 4965 4937 4790 4706 3780 1979 1495 1265 32185 2138 1121 ----
NM_018667chr1692857 2520 1059 872 206 187 137 115 97 1107 ----
NM_020133chr6116101 6084 6069 5681 4167 2470 1359 978 632 167 30 16147 22310 40 --
NM_020336chr2083432 2623 2577 2527 2432 460 291 41 2962 675 11313 12357
NM_020440chr183118 3109 2912 2609 2432 1138 902 350 33039 1269 42 130 1893
NM_020443chr1166245 6113 4886 2333 2057 1844 1737 1232 1091 407 259 210 189 142 123 112 14679 21101 629 1147
NM_020673chr20106568 5494 5467 5449 2711 2161 1487 850 424 222 47300 7032 6688 258 25893 1289 --
NM_020699chr1175441 5130 4535 4213 3932 3672 3536 3285 2061 2026 1661 1624 1598 1093 848 710 591 21924 880 44564 3962 1018 727 15166
NM_020717chrX153530 3442 3093 3042 1687 1318 1272 939 926 635 583 519 507 383 183 14299 1524 13602
NM_020718chr16125923 5609 5521 5411 5029 2309 2108 1040 627 493 453 386 --14956 --
NM_020772chr17148510 8320 8295 8255 7337 6628 6114 5828 5592 3155 2691 1039 631 209 15890 46320 6004 457 103 --
NM_020774chr18116092 5131 5048 4385 4377 4193 4146 4033 1912 595 259 23898 640 ----
NM_020809chr1191789 1527 858 728 386 377 356 298 36 2787 313 --1364
NM_021813chr6135712 5004 4192 4139 4062 3810 2014 1943 1893 1810 1641 1210 351 34212 3958 3761 11817 --
NM_021949chrX101939 1104 996 835 589 565 547 541 529 511 22158 410 1140 12066
NM_022048chr15126140 6012 5536 5451 5287 4723 4547 1503 1232 1189 458 84 --24141 1318 --
NM_022456chr1256427 6222 5954 5703 1815 27149 5692 25959 5644 1700
NM_022648chr2164431 4225 3948 3443 3218 3163 3090 3076 914 415 371 214 168 143 115 36 23287 338 11218 1738
NM_022716chr162980 2531 2371 853 481 90 12494 --22550 166
NM_022719chr22193506 3459 3008 2808 2735 2627 2505 2437 2370 1537 1308 1202 1192 1176 1170 1122 906 771 373 23573 3056 --1919
NM_024345chr963896 3879 1436 648 49 25 55694 5298 4327 4135 3866 1960 --
NM_024770chr2106574 6256 5725 5541 5426 5207 2490 1963 1014 584 16523 25551 4404 --
NM_024817chr15125715 5614 5176 4967 4521 4051 3900 3630 2269 2005 1387 1004 25709 2145 14344 11510
NM_024947chr399049 6974 6946 3244 3199 2918 1616 1388 533 43849 2788 1578 928 16858 --
NM_025179chr1124270 3405 3372 3049 1778 1729 1564 1024 805 690 602 342 24644 4159 34113 889 33 11743
NM_030674chr1295461 4336 4140 3961 3955 3933 2280 1258 816 35264 4438 2251 13807 --
NM_030761chr1122430 2362 2270 2204 1966 1675 1001 894 693 621 370 228 32236 2177 525 12471 --
NM_030806chr1159030 9008 7584 6934 6916 6793 6681 6653 6636 3286 3229 2667 2208 1187 28 58456 3357 3062 1446 175 18090 --
NM_031427chr14125699 5326 5282 5276 5231 4673 2010 1829 1482 1445 1370 1024 1323 14453 --
NM_031468chr7227745 7242 6962 6855 6687 6583 6504 6199 5451 5099 3192 3041 3003 2994 2742 2682 2554 2433 1807 1286 1215 547 46144 5440 5268 192 27181 5556 15633
NM_032017chr131976 645 306 3131 125 114 ----
NM_032105chr1117488 7438 6193 6170 5735 2753 2697 1531 1406 699 157 57299 6106 3027 2803 168 11184 --
NM_032116chr1375179 4346 3879 3713 1801 1246 466 24022 300 1376 1606
NM_032281chr1972547 2283 2212 1986 877 585 479 32605 1936 1079 --1443
NM_032329chr2194304 4155 4054 3705 3537 3512 3498 3442 2835 1372 1356 1214 1173 1145 1038 833 569 250 192 13202 24140 1165 130
NM_032373chr1065380 4507 4455 4323 4286 1146 24627 176 --194
NM_032446chr532678 1033 535 22598 461 --23028 1273
NM_032873chr11113786 3422 3135 2990 1244 1186 1085 730 360 327 184 24535 769 1466 --
NM_032932chr17145877 5706 5144 5024 4942 4746 4079 3919 2410 2095 1997 1758 1441 268 36405 2082 1812 14358 1865
NM_033224chr787212 6494 2248 319 228 205 118 97 23011 2777 --17871
NM_033290chrX63285 2933 1282 487 276 222 23057 1113 13006 135
NM_033503chr1593753 3672 3302 2880 2787 2658 2615 1524 1471 23238 37 53271 2747 1141 368 298 1918
NM_033505chr295913 5846 4974 4789 4732 2173 864 774 128 12490 25746 817 15446
NM_052885chr1263295 3250 3231 1720 1021 148 33748 1544 186 ----
NM_052896chr172246 1866 1812 1758 1672 808 246 12185 --22096 1681
NM_052906chr22214798 4646 4640 4347 4209 3971 3909 3712 3524 3273 3243 3109 2035 1903 1465 1152 850 520 322 279 58 --44163 1052 701 406 11324
NM_053016chr9117447 6468 4861 2685 2496 2366 2129 1939 1882 910 655 26064 5638 15961 --
NM_080491chr11173480 3460 3011 1562 1511 1438 1179 1006 976 965 902 632 611 543 332 261 144 2945 742 11016 11263
NM_080546chr952221 2066 2005 497 331 2881 167 --1870
NM_080669chr17244571 3798 3773 3542 3512 3304 3245 3200 3098 1914 1834 1703 1614 1452 1265 1138 958 813 723 545 517 482 339 309 --33437 3356 242 136
NM_080676chr2092970 2575 2150 475 436 397 117 91 74 --1218 22223 1994
NM_133170chr20166516 5446 5147 3020 2916 2838 2692 2558 1939 1555 1435 1292 773 739 400 88 37244 2615 1995 ----
NM_138459chr6143506 3295 3121 2720 2522 1155 996 554 499 489 395 292 48 42 ------
NM_138473chr12154714 4689 4513 4401 4275 3874 3865 3772 1673 1554 1097 874 478 151 138 11267 ----
NM_144578chr1465421 5202 1916 1043 844 791 24818 960 --11659
NM_144599chr1555302 4902 4504 3949 1747 44272 3332 1892 1418 --133
NM_144973chr12104949 4876 4420 4164 1592 1506 997 984 651 333 12020 ----
NM_145165chr1482948 2896 2801 2416 690 310 156 138 22809 586 11005 12933
NM_147223chr262294 2145 858 514 199 107 --1835 11750
NM_148955chr15116012 5497 5280 5015 4976 4535 4389 4287 4055 1401 316 24622 1803 15327 1654
NM_152253chr2294155 4002 2805 2777 2664 1535 1125 755 469 11030 54237 3436 2913 1165 108 21541 1280
NM_152261chr1242079 1767 507 381 1856 --1909
NM_152263chr1115968 5951 5046 4512 4353 4327 4309 3831 1252 271 249 15385 24331 53 --
NM_152280chr183382 3060 2890 1205 1111 569 59 47 23145 2571 33064 2867 944 --
NM_152388chr243459 978 720 666 ----33969 3312 24
NM_152424chrX154750 4510 4497 4490 4452 4440 4177 4103 4077 4058 3978 3365 1481 1092 548 63959 3948 3700 1737 1006 26 14147 14249
NM_152470chr18153217 2936 2906 2547 1206 842 795 779 598 382 236 165 159 136 104 ------
NM_152542chr451959 1865 1673 786 652 32171 1555 491 22085 794 --
NM_152624chr5106985 6689 4964 4917 2926 2396 1451 1245 1104 713 15495 ----
NM_152733chr6236289 5465 5410 5341 5253 5236 4587 4526 4497 4342 4233 3978 2506 2108 1874 1724 1709 1557 981 683 407 364 305 54826 2599 2593 2152 298 22034 117 14646
NM_152756chr594007 3380 2848 1221 951 912 840 505 437 13623 13420 --
NM_152826chr15116012 5497 5280 5015 4976 4535 4389 4287 4055 1401 316 24622 1803 15327 1654
NM_153035chr182707 2599 2526 2337 1083 834 177 39 --32291 942 612 --
NM_153188chr574324 4217 4126 719 335 163 105 21131 376 --2725 389
NM_153456chr13155875 5158 4791 4590 4519 4467 4333 3999 2532 1751 1641 1460 1027 678 334 3909 739 310 1816 25929 5371
NM_170706chr1154189 4183 4093 3910 3455 3336 2984 2773 2718 2661 1477 1410 1033 246 225 23949 3447 ----
NM_172071chr197507 6625 6177 5570 5430 4697 2964 2763 2215 25324 2654 ----
NM_173065chr1133430 2699 2400 2349 2269 1351 996 597 589 580 130 118 26 ------
NM_173468chr495821 5770 3849 1133 1052 936 892 258 178 25594 4293 --15689
NM_173642chr1179250 9003 8305 7857 7719 7016 6764 6418 6365 6222 3573 3488 3036 2540 1630 1094 1076 46582 5862 3092 2471 16438 --
NM_175623chr1256427 6222 5954 5703 1815 27149 5692 25959 5644 1700
NM_175736chr12257373 7030 5761 5755 5748 5736 3062 2903 2815 2732 2694 2672 2497 2440 2343 2287 2236 2220 1580 1219 1019 997 520 335 326 45075 1257 728 463 25703 1842 --
NM_176081chr1065823 4623 1351 1243 1118 787 24290 298 1757 15954
NM_176083chr1065823 4623 1351 1243 1118 787 24290 298 1757 15954
NM_176823chr143427 2891 463 398 63860 3518 2995 2749 1315 39 21174 752 --
NM_177972chr11103175 2846 1634 1141 1068 836 714 352 346 151 24318 2921 ----
NM_178151chrX87101 5472 2999 2810 2460 2253 2221 764 37153 2799 982 26090 1799 --
NM_178152chrX87101 5472 2999 2810 2460 2253 2221 764 37153 2799 982 26090 1799 --
NM_178153chrX87101 5472 2999 2810 2460 2253 2221 764 37153 2799 982 26090 1799 --
NM_181460chr22970 32 --2329 133 11045
NM_181481chr18124882 4659 4503 4321 2366 2076 1378 616 547 423 259 156 1680 12334 15546
NM_181482chr18124882 4659 4503 4321 2366 2076 1378 616 547 423 259 156 1680 12334 15546
NM_181483chr18124882 4659 4503 4321 2366 2076 1378 616 547 423 259 156 1680 12334 15546
NM_181521chr16177282 7224 5720 5677 5424 5281 5271 5250 2912 2884 2565 2413 1119 562 529 359 347 2670 368 16574 --
NM_182758chr1573695 1376 1322 1142 804 718 22 32711 1098 843 ----
NM_182970chr20164231 4138 3874 3748 3593 3375 3335 3038 2774 2673 733 664 648 631 560 117 --41615 1420 782 527 --
NM_194278chr14112984 1603 1526 1497 1074 953 569 555 547 434 80 13821 1738 13568
NM_194286chr12155713 3972 3950 3887 2453 1909 1531 1487 1479 1132 1093 474 183 138 132 ----11363
NM_198859chr374543 3820 3746 1783 893 706 473 21154 625 11121 11091
NM_198900chr12257373 7030 5761 5755 5748 5736 3062 2903 2815 2732 2694 2672 2497 2440 2343 2287 2236 2220 1580 1219 1019 997 520 335 326 45075 1257 728 463 25703 1842 --
NM_199000chr74904 791 524 486 192 --1305
NM_199262chr17152341 2292 2280 2012 2005 1960 790 660 507 417 325 213 120 96 88 21823 139 22117 1843 --
NM_199462chr1104490 3941 3704 3233 1735 1634 1608 672 550 108 1407 1259 11642
NM_203342chr1143560 3538 3069 3000 2866 2848 2545 2539 1104 1090 1058 1006 951 884 ------
NM_203343chr1143560 3538 3069 3000 2866 2848 2545 2539 1104 1090 1058 1006 951 884 ------
NM_203382chr561471 1388 1342 298 176 148 ----31020 482 204
NM_203458chr183319 3256 2585 2392 769 503 450 258 2533 460 --1410
NM_206909chr8137589 7475 6850 6689 2785 2561 2313 2106 1372 817 720 688 233 68038 6903 6728 6138 1594 891 47148 3367 1144 783 17488
NM_213589chr295193 5040 3872 3514 3426 2195 1673 1220 643 21495 444 ----