TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4427
miRNA Sequence: UCUGAAUAGAGUCUGAAGAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX123294 3134 2834 2806 2688 2573 2374 2185 1368 532 384 192 12898 ----
NM_000084chrX96370 5976 5915 5685 5640 2263 1723 1173 515 25436 647 25764 551 --
NM_000091chr252791 2765 2663 2367 235 --22434 74 11859
NM_000092chr274417 4155 4067 3752 3385 832 780 --13308 --
NM_000104chr262910 2413 1167 575 65 36 11922 1947 --
NM_000108chr791872 1538 1343 706 629 509 277 184 131 1446 --11626
NM_000112chr585305 5266 4648 4313 2073 1378 1288 1043 55542 4674 4190 3537 1001 14141 --
NM_000115chr13102690 2650 2348 2088 2070 1933 1922 1784 758 285 ------
NM_000153chr1471608 1336 1301 1084 1055 670 383 163 11119 --
NM_000161chr1431977 1918 134 2738 699 1437 11581
NM_000163chr572342 2306 2128 1601 441 371 33 31455 819 558 ----
NM_000167chrX61826 1748 1353 550 110 91 1316 ----
NM_000176chr553728 1566 1450 1420 585 23095 1239 21532 542 --
NM_000214chr2071766 1499 1222 682 478 360 354 ------
NM_000217chr12105344 4781 4607 4447 4335 3324 3318 1044 274 131 --11109 --
NM_000232chr4103199 2033 2018 1966 1212 935 857 606 382 208 ------
NM_000259chr15105614 4819 2198 1782 1623 1434 1375 1367 867 824 --22180 872 --
NM_000264chr982930 2825 2624 2539 2303 2256 980 180 12469 11146 --
NM_000267chr1793088 3044 2989 2768 2712 2267 1406 1017 422 11391 --1244
NM_000321chr1351364 1305 1146 1101 194 ----11334
NM_000329chr15826 756 719 176 76 --1253 1198
NM_000332chr6116468 5764 5447 5180 4686 2551 2206 2195 1896 1135 87 25896 486 12380 12410
NM_000337chr596185 6175 6159 5984 1943 1448 1383 1121 391 22182 344 --26290 2600
NM_000390chrX63390 3319 3058 2874 2821 628 ----13356
NM_000393chr261981 1881 1314 816 345 171 --21915 636 --
NM_000439chr542309 2142 983 33 ----22188 582
NM_000448chr1153174 3142 2686 2056 1276 41065 851 836 722 ----
NM_000489chrX103257 3095 3058 2756 2749 2609 2116 1302 378 353 12993 13249 --
NM_000586chr46262 205 191 69 56 44 ------
NM_000618chr12106456 6146 6043 4998 4589 4455 2421 1799 843 381 22203 1356 36187 4102 2443 --
NM_000618chr12106456 6146 6043 4998 4589 4455 2421 1799 843 381 22203 1356 36187 4102 2443 --
NM_000619chr125166 111 67 57 47 ------
NM_000633chr1894327 4290 3953 3352 1767 803 482 260 203 --11853 13407
NM_000726chr251254 506 282 98 24 1262 11167 --
NM_000758chr54268 233 216 208 ------
NM_000759chr176216 68 55 45 38 28 ------
NM_000809chr4199292 8858 8732 7216 6109 5881 5820 5681 3682 3498 2872 2553 2219 1926 943 894 699 684 221 23588 2767 39127 6097 2781 46169 2053 877 716
NM_000813chr564914 4361 4140 3876 1865 1140 21000 642 1988 --
NM_000814chr1573510 3196 1162 1038 919 771 530 --13373 23099 1461
NM_000838chr642628 2479 1773 865 32437 446 212 32713 1986 722 12083
NM_000868chrX102295 1906 982 731 604 557 415 333 186 173 12057 ----
NM_000875chr1546316 5413 1845 1241 11235 11682 15054
NM_000899chr12114180 3919 3317 3116 2985 1598 1201 1141 1117 1078 984 54152 3709 2894 277 162 ----
NM_000912chr8113371 3259 2682 2265 1273 1084 944 615 603 574 303 11396 1690 --
NM_000944chr452039 833 707 487 143 12188 1778 12250
NM_000945chr25741 627 583 331 92 1398 --11672
NM_000963chr1132461 2347 2191 1967 1775 1641 1516 952 945 482 69 59 24 --12103 --
NM_001001323chr1272546 2201 2190 2062 1142 771 710 22500 90 --11136
NM_001001395chr1262589 2255 431 416 384 246 1180 --12156
NM_001001396chr164322 4291 4247 3860 976 512 2677 23 12854 11405
NM_001001419chr574829 4272 3778 2052 779 181 175 23643 242 23915 558 --
NM_001001420chr574829 4272 3778 2052 779 181 175 23643 242 23915 558 --
NM_001001433chr2082979 2970 1987 1276 984 933 917 560 1641 1331 --
NM_001001481chr8123482 3398 2946 2788 2710 2410 2120 1180 945 599 178 67 ------
NM_001001664chr2164148 3962 3893 3833 3687 3679 3530 3330 3250 3052 1621 1607 1368 1298 1034 238 ------
NM_001001668chr1973944 3911 3603 2754 1165 1018 256 13855 ----
NM_001001890chr21113902 3690 3511 3188 2722 1714 1315 817 767 645 342 --14228 1785
NM_001001928chr2287083 6458 6378 5874 5699 5186 1913 495 35843 5168 2380 ----
NM_001001974chr1092182 2147 2012 1963 1887 1772 1506 404 258 ------
NM_001002258chr261987 1927 1359 1333 338 206 1227 11458 --
NM_001002838chrX41660 1654 1639 1338 ----2429 272
NM_001003674chr18126733 6723 6011 4869 2707 2169 1598 1588 1163 1035 607 324 22628 1005 25580 85 --
NM_001003675chr18126733 6723 6011 4869 2707 2169 1598 1588 1163 1035 607 324 22628 1005 25580 85 --
NM_001003679chr172086 1861 1787 1624 587 261 114 1159 2540 464 --
NM_001003712chr12103459 2954 2916 2776 2545 2490 1284 1248 362 62 13630 21178 930 13573
NM_001003760chr673543 3402 456 441 390 92 41 --33548 2541 1446 --
NM_001004065chr993762 3342 3054 2702 1565 1549 1308 742 89 --1807 --
NM_001004317chr674035 2992 2886 1330 1173 1120 962 23405 196 33931 3578 2861 14275
NM_001005404chr1784455 4308 4116 3477 3155 1453 1058 102 11723 ----
NM_001005463chr1062618 2602 2584 2226 934 155 11618 --1979
NM_001005473chr555631 5308 2450 1132 642 --16633 25482 5225
NM_001005746chr251254 506 282 98 24 1262 11167 --
NM_001005747chr251254 506 282 98 24 1262 11167 --
NM_001007278chr1354434 1803 250 172 138 167 24746 2091 24666 4365
NM_001007466chr6114945 4866 4686 3708 3280 1977 1925 1514 1264 1205 921 ------
NM_001008239chr18103866 3726 3369 3072 2979 2964 1456 1148 771 360 ------
NM_001008405chr771860 1614 1371 718 247 180 147 21641 724 11314 11425
NM_001008541chr104427 221 158 38 12149 11641 1214
NM_001008541chr104427 221 158 38 12149 11641 1214
NM_001008564chr1382110 1928 1851 1607 868 818 505 293 ------
NM_001009554chr484651 4289 4053 3621 3062 1575 1365 945 --14456 13964
NM_001009554chr484651 4289 4053 3621 3062 1575 1365 945 --14456 13964
NM_001009894chr1261397 623 344 151 82 58 ----11507
NM_001009899chr376527 6125 3984 1993 884 862 672 25134 4658 1703 --
NM_001009909chr1193961 3887 3441 3144 2888 1589 1435 1405 1337 --12809 --
NM_001009960chr7112471 2427 2313 1113 1048 968 776 450 47 36 26 --12486 --
NM_001010000chr1853067 2884 2778 2181 521 ----12648
NM_001010846chr1124437 4084 3480 3376 3316 3265 3182 1519 1445 823 609 535 24353 1707 --23727 1737
NM_001010853chr662830 2750 2372 2343 2050 1998 --1887 1405
NM_001010861chr1102526 2366 2254 1890 1012 790 698 604 431 245 22310 1908 3766 480 415 --
NM_001011513chr4103638 3599 3384 3276 2952 2882 2680 1010 425 85 13148 ----
NM_001011537chr362354 2278 1918 869 667 99 22335 1783 22167 326 1882
NM_001011666chr7156501 5770 5504 4968 4670 4371 4357 4331 4067 2082 1883 1106 1085 649 642 34636 4050 1072 14487 15637
NM_001012393chr1185153 4951 4440 3714 3672 3383 1025 905 14840 1790 14177
NM_001012420chr15102358 2330 2242 2162 2123 2073 1114 496 383 197 2535 397 1996 --
NM_001012423chr15102358 2330 2242 2162 2123 2073 1114 496 383 197 2535 397 1996 --
NM_001012968chrX52370 2360 1839 718 103 12377 12656 12761
NM_001013620chr12228460 8415 7432 7418 7210 6870 6651 6576 6097 5852 5828 5630 5513 5347 5318 5195 5136 3297 2649 1466 1148 466 13189 28200 2699 --
NM_001013659chr1985395 5181 4559 2015 1547 1373 1262 411 11020 14232 13503
NM_001014380chr13125798 5616 5525 5197 4614 4524 2247 2221 1585 1239 1147 949 1313 14864 --
NM_001014797chr10108031 8004 7992 6479 6348 6227 2158 796 728 391 15379 22018 1225 --
NM_001015877chrX53105 2951 2305 956 917 ----12280
NM_001017434chr15260 232 214 204 198 --1484 --
NM_001017440chr7118248 8173 7995 6946 5814 5768 5077 5046 2848 1875 129 --15160 --
NM_001018054chr191423 1417 1310 1056 1005 559 499 350 37 2543 492 ----
NM_001018065chr965768 5581 5025 4865 4220 2077 16042 --25918 4979
NM_001018066chr965768 5581 5025 4865 4220 2077 16042 --25918 4979
NM_001018067chr1135204 4718 4669 4482 3763 3314 1789 1761 1729 918 731 452 48 1383 11514 24988 210
NM_001018068chr1135204 4718 4669 4482 3763 3314 1789 1761 1729 918 731 452 48 1383 11514 24988 210
NM_001018069chr1135204 4718 4669 4482 3763 3314 1789 1761 1729 918 731 452 48 1383 11514 24988 210
NM_001018074chr553728 1566 1450 1420 585 23095 1239 21532 542 --
NM_001018075chr553728 1566 1450 1420 585 23095 1239 21532 542 --
NM_001018076chr553728 1566 1450 1420 585 23095 1239 21532 542 --
NM_001018077chr553728 1566 1450 1420 585 23095 1239 21532 542 --
NM_001024094chr553728 1566 1450 1420 585 23095 1239 21532 542 --
NM_001024647chr1285944 5835 2585 1318 658 585 320 78 27030 2069 --21937 1380
NM_001024660chr361496 1368 582 495 395 84 --1152 1248
NM_001024948chr173502 3027 2523 791 579 488 117 --23047 784 --
NM_001024956chr11155369 5359 5128 4502 4293 4266 3822 2308 1550 1445 1403 1089 788 753 740 15669 --15303
NM_001025076chr1066241 5834 4526 1767 1194 636 --11034 11019
NM_001025077chr1077599 7192 5884 2552 1994 1112 906 25095 698 12392 12377
NM_001025079chr3113921 3628 3163 3033 1533 856 706 669 352 187 170 ----12780
NM_001025233chr1272462 2385 2295 2183 556 435 42 22477 2069 131 --
NM_001025252chr872928 2526 2215 2168 1261 935 926 22160 2142 5831 796 668 219 109 --
NM_001025253chr872928 2526 2215 2168 1261 935 926 22160 2142 5831 796 668 219 109 --
NM_001025366chr661841 1740 1458 1333 1319 1237 ------
NM_001025366chr661841 1740 1458 1333 1319 1237 ------
NM_001025367chr661841 1740 1458 1333 1319 1237 ------
NM_001025367chr661841 1740 1458 1333 1319 1237 ------
NM_001025368chr661841 1740 1458 1333 1319 1237 ------
NM_001025368chr661841 1740 1458 1333 1319 1237 ------
NM_001025369chr661857 1756 1474 1349 1335 1253 ------
NM_001025369chr661857 1756 1474 1349 1335 1253 ------
NM_001025370chr661841 1740 1458 1333 1319 1237 ------
NM_001025370chr661841 1740 1458 1333 1319 1237 ------
NM_001025580chrX42896 1160 866 520 31685 1343 927 --12846
NM_001029875chr5112385 2351 2304 2264 2179 1835 907 546 454 434 306 --22366 2124 --
NM_001029989chr153178 117 98 1111 ----
NM_001030055chr14134541 4457 4094 3985 3826 3657 3627 2959 1105 852 771 151 71 14360 24768 4372 --
NM_001031684chr251488 1447 1128 320 257 1338 21340 1048 --
NM_001031716chr23714 345 71 ----21038 388
NM_001031732chr493093 2668 2549 2542 1471 999 691 404 297 --31050 860 626 12649
NM_001032394chr672601 2402 2383 2352 2171 2021 809 32436 282 75 11861 --
NM_001032395chr672468 2269 2250 2219 2038 1888 676 22303 149 11728 --
NM_001033045chr264455 3378 2978 2937 824 50 12812 --12867
NM_001033047chr492595 2268 2090 1979 1851 1720 695 678 274 32149 1017 914 ----
NM_001033756chr661775 1674 1392 1267 1253 1171 ------
NM_001033756chr661775 1674 1392 1267 1253 1171 ------
NM_001033925chr1051782 1579 799 191 98 --1340 1495
NM_001034954chr1093259 3181 3017 2837 2734 2513 2386 602 229 --1930 23275 643
NM_001034955chr1093259 3181 3017 2837 2734 2513 2386 602 229 --1930 23275 643
NM_001034956chr1093259 3181 3017 2837 2734 2513 2386 602 229 --1930 23275 643
NM_001034957chr1093259 3181 3017 2837 2734 2513 2386 602 229 --1930 23275 643
NM_001037317chr1102526 2366 2254 1890 1012 790 698 604 431 245 22310 1908 3766 480 415 --
NM_001037535chrX41408 1339 1213 552 31158 564 23 --1558
NM_001037536chrX41408 1339 1213 552 31158 564 23 --1558
NM_001037540chrX41408 1339 1213 552 31158 564 23 --1558
NM_001039538chr272899 1198 931 848 580 150 82 --136 --
NM_001039577chr152805 1724 1674 1199 961 21526 744 21131 791 11735
NM_001039580chr4184024 3800 3533 3511 2025 1925 1817 1266 1133 1085 926 823 565 408 324 314 79 32 --1870 14926
NM_001039590chrX134022 4005 3827 3796 3417 2731 2668 1600 1398 1302 653 131 83 23924 3260 33714 3516 2872 23916 3395
NM_001039591chrX134022 4005 3827 3796 3417 2731 2668 1600 1398 1302 653 131 83 23924 3260 33714 3516 2872 23916 3395
NM_001039618chr11125001 4713 4558 4525 4299 4278 3848 3670 3611 2085 1491 469 --24325 1327 1518
NM_001039840chrX76033 5855 3788 1336 1242 539 94 --25375 4360 --
NM_001040020chr761468 1191 1104 974 640 147 --11292 11320
NM_001040152chr775147 4186 3892 3274 3169 2029 668 1874 11200 24825 4686
NM_001040284chr16115935 5166 5048 4774 4085 4045 2038 1978 1770 1468 484 --45210 3805 341 84 35535 3864 103
NM_001040429chr13103532 2875 2821 2798 2643 2508 2467 1293 1042 901 23029 870 22785 769 --
NM_001040441chr174870 4293 4175 3635 1532 1490 1135 ------
NM_001040450chr1592587 2462 1960 1787 917 865 779 536 367 22657 615 1563 --
NM_001040453chr1592587 2462 1960 1787 917 865 779 536 367 22657 615 1563 --
NM_001040665chr7204984 3889 3855 3654 3597 3586 3251 3241 3218 3170 3132 3116 3104 1585 1174 734 612 411 220 71 --34074 3659 1809 --
NM_001040876chr461597 771 748 631 308 47 --1708 --
NM_001042355chr16145326 5261 4633 4079 4051 3381 1941 1367 1268 970 896 177 79 61 --35217 3741 694 14085
NM_001042404chr141941 1763 1291 136 ----1186
NM_001042406chr641251 1068 909 281 ----11151
NM_001042412chr16145326 5261 4633 4079 4051 3381 1941 1367 1268 970 896 177 79 61 --35217 3741 694 14085
NM_001042413chr983961 3721 2958 2950 2922 2632 891 639 22526 254 13093 --
NM_001042473chr1071784 1709 1572 846 746 527 72 11838 21789 586 --
NM_001042492chr1793088 3044 2989 2768 2712 2267 1406 1017 422 11391 --1244
NM_001042533chr353163 2125 1204 603 240 22488 284 42833 2801 2041 962 --
NM_001042555chr12104544 4506 1628 1408 1048 951 647 423 417 242 --11669 --
NM_001042599chr297426 7130 5922 5715 5354 2496 2242 1403 973 22538 1771 67407 6019 3055 2791 1327 439 --
NM_001042646chr361996 1665 1441 1349 1342 700 11894 1721 11840
NM_001046chr5113050 2772 2592 2415 2325 942 923 814 710 700 479 32073 905 842 12204 --
NM_001071775chr1391877 1759 1735 1656 1462 272 257 251 210 --1594 1507
NM_001099678chr3206358 6124 5773 5729 5604 5587 5443 5385 5160 4622 4549 4460 2380 2005 1609 927 721 525 160 108 --26387 4114 --
NM_001106chr388111 7097 7040 6800 6421 2483 1747 1028 1698 36210 5941 2169 26537 1904
NM_001167chrX116767 6471 5139 4570 4529 1851 1822 938 585 278 217 ------
NM_001173chr14134541 4457 4094 3985 3826 3657 3627 2959 1105 852 771 151 71 14360 24768 4372 --
NM_001186chr21103203 2728 2684 2650 2586 2571 2240 1006 886 601 --11216 1291
NM_001198chr6112439 2399 1978 1962 1551 1522 1510 1482 614 518 241 2868 390 ----
NM_001200chr207895 846 435 360 311 170 125 --1245 --
NM_001201chr4113961 3733 3349 2558 1464 1283 1151 882 762 686 631 ------
NM_001204chr2127328 7093 6814 6565 6406 6258 5431 5399 1400 941 933 165 --22005 1903 --
NM_001241chr262442 2399 2211 1769 492 418 12047 11719 --
NM_001241chr262442 2399 2211 1769 492 418 12047 11719 --
NM_001256chr1752609 2134 1802 954 668 21867 780 22707 181 12470
NM_001259chr7135880 5570 5308 5131 4510 4378 4017 3965 3889 2305 2006 548 206 11840 1728 --
NM_001310chr1263105 2204 1124 894 714 494 22712 210 22923 1954 --
NM_001356chrX32278 1820 1797 11588 --2645 194
NM_001390chr1883605 3471 3149 2920 1424 823 786 288 13446 1439 --
NM_001396chr2142380 2254 2139 1719 --1295 22528 313
NM_001412chrX22862 491 23695 3289 32585 2460 1196 12963
NM_001419chr19134714 4689 4646 3898 3549 3483 1639 1631 1621 1609 1281 821 166 ------
NM_001432chr4143877 3796 3588 3489 3356 3260 2944 2464 1078 1013 724 381 196 79 ------
NM_001438chr1113553 3294 3184 3116 2835 2712 2645 1443 1221 912 127 33619 2566 2524 ----
NM_001482chr153793 735 214 ----1860
NM_001527chr694678 4149 3837 1132 866 811 491 227 117 14720 24230 1543 --
NM_001609chr10104466 4102 3538 3496 3441 3002 1270 1168 1034 563 23165 1150 --1791
NM_001616chr283429 3265 3201 2246 2188 1410 1018 689 11329 12394 --
NM_001656chr562000 1533 453 264 148 97 ----1535
NM_001682chr1272260 1915 1904 1776 856 485 424 12214 --1850
NM_001689chr261987 1927 1359 1333 338 206 1227 11458 --
NM_001695chr8103962 3827 3281 2590 968 740 380 343 264 244 --22819 390 --
NM_001709chr1182848 2770 2751 2725 2124 2004 1882 157 22188 1772 22175 82 --
NM_001717chr1551420 1180 1143 1081 48 ----21237 1092
NM_001754chr21113902 3690 3511 3188 2722 1714 1315 817 767 645 342 --14228 1785
NM_001759chr1284896 4499 4447 1901 1727 1438 857 131 --35225 1670 1394 --
NM_001777chr3113921 3628 3163 3033 1533 856 706 669 352 187 170 ----12780
NM_001858chr6135131 5082 4977 4959 4929 4382 4333 3926 3799 3341 1738 1716 582 ----34658 4552 3427
NM_001941chr1843759 3072 611 345 22882 1080 --13134
NM_001949chr672903 2865 2658 2257 2104 561 542 --12695 --
NM_001977chr421355 484 11297 --1455
NM_002006chr464839 4809 4393 3529 2271 273 24406 3942 11475 15111
NM_002009chr1572709 2215 1985 968 953 345 218 ------
NM_002015chr1342862 2244 1021 554 --22698 1088 12641
NM_002025chrX149298 8120 8100 7694 7041 6519 5711 5611 3718 3068 2590 2198 1587 1089 18829 --15845
NM_002033chr11104116 3572 3189 3145 3056 2939 2831 974 749 743 --24012 1381 14132
NM_002035chr1883681 3013 2852 2497 1400 1326 539 322 --23512 3105 --
NM_002040chr2192832 2768 2533 2459 2137 1959 1083 553 499 --11104 --
NM_002090chr46504 477 262 215 172 164 ------
NM_002158chr253546 3332 2695 1370 985 12801 13002 11298
NM_002182chr392578 2270 2218 1893 1068 791 494 252 131 32435 1714 762 ----
NM_002190chr671271 432 420 407 387 273 265 ----1448
NM_002203chr593619 3464 3144 3092 3048 3034 1390 1172 565 ------
NM_002210chr2103301 3231 2597 2439 2345 1397 852 826 254 221 1177 ----
NM_002214chr7125598 5557 5227 4992 4732 4028 3889 3868 2271 1912 1632 1590 --14764 1261
NM_002239chr261135 327 288 256 39 26 ------
NM_002243chr2191370 1322 1154 532 459 422 416 373 308 ------
NM_002270chr5125640 5309 4976 4737 4587 4167 3891 1874 1731 1420 959 870 --1295 13767
NM_002310chr5146577 6432 6277 5487 5015 4471 4230 4030 1654 1400 873 775 561 149 25682 4133 45513 2541 1760 1612 --
NM_002336chr1294955 4911 4872 4596 4086 3457 1875 1201 176 33774 3679 1847 --14430
NM_002374chr272899 1198 931 848 580 150 82 --136 --
NM_002481chr187976 7941 7053 6429 5023 4999 2505 1237 --11901 --
NM_002500chr241036 219 185 137 11283 --1283
NM_002515chr1452031 1947 1856 1648 543 11834 --11862
NM_002545chr1185153 4951 4440 3714 3672 3383 1025 905 14840 1790 14177
NM_002577chr384039 3995 3114 2919 2815 1578 1548 727 1587 ----
NM_002581chr9105532 5478 5466 5434 5069 5043 5003 4420 4121 3930 ------
NM_002594chr2052365 2042 2029 1940 514 ----11984
NM_002613chr1675133 5120 3555 3399 3300 211 141 --24197 1935 14878
NM_002623chr205511 497 188 158 121 ----1286
NM_002655chr8125186 5043 4616 4500 4011 3332 3263 2046 1825 1467 646 386 --1185 --
NM_002670chr381633 1567 1527 1077 446 221 145 121 11027 ----
NM_002709chr252959 2862 2826 2239 1054 12458 --12672
NM_002731chr172419 2365 2243 2088 1040 1034 733 11963 12219 --
NM_002734chr1772112 1755 1639 745 630 576 259 1867 11903 1393
NM_002736chr742105 1884 1796 651 12159 --1350
NM_002745chr2284311 3698 2767 1728 1680 1502 1357 992 24393 3086 24546 3637 --
NM_002869chr1172187 1393 1358 813 612 362 197 ----21808 1457
NM_002886chr334830 3980 1015 25045 4526 33611 1520 1293 15094
NM_002890chr55994 963 840 727 33 --1941 1679
NM_002892chr1421331 1132 11597 1514 1493
NM_002906chr1182390 2268 1981 1959 1622 1544 663 391 1846 ----
NM_002940chr461597 771 748 631 308 47 --1708 --
NM_002941chr371653 1571 1487 1468 1386 594 408 11493 192 --
NM_002956chr1241310 1159 487 322 --1194 1395
NM_002994chr451789 1774 1686 738 544 --11814 1611
NM_003034chr12128053 7401 7325 6973 6722 5846 3258 2055 1484 963 735 468 1680 35013 2106 1053 1873
NM_003099chr15116430 6368 5813 5089 5033 5025 4794 2411 2094 1073 169 14832 25154 2014 14912
NM_003108chr2117304 7114 6484 5507 5469 4732 4505 1737 1714 1655 1207 --15559 --
NM_003161chr1753085 2529 1292 781 553 --23566 3111 --
NM_003199chr18125584 5088 4530 4142 3572 2078 1771 1408 693 670 473 392 1246 25243 2188 --
NM_003222chr2061076 1008 879 454 245 124 ----11096
NM_003262chr375229 5208 5165 1981 1763 1553 983 11014 1145 1781
NM_003274chr2152783 2575 2435 2132 756 ----11938
NM_003298chr365743 5520 5492 5183 4451 2329 24558 697 25374 4512 1257
NM_003338chr102735 455 --11848 1386
NM_003369chr1142819 2795 2709 299 11111 --1426
NM_003376chr661841 1740 1458 1333 1319 1237 ------
NM_003376chr661841 1740 1458 1333 1319 1237 ------
NM_003392chr3144337 4327 4062 3903 3831 3662 3475 3407 3365 965 427 419 221 47 24016 1493 ----
NM_003407chr195538 513 498 257 195 --1637 --
NM_003410chrX82658 2174 2100 914 642 379 302 290 11989 1189 --
NM_003411chrY61364 302 292 280 153 73 --2563 178 --
NM_003478chr1172790 2224 1150 890 555 537 392 --12363 127
NM_003566chr1273246 3204 2830 2607 525 322 217 1784 11312 --
NM_003574chr1874267 2116 1873 1247 1081 573 415 --11920 34243 394 317
NM_003590chr2103236 3227 2861 2753 2508 1250 896 890 829 488 1300 11138 --
NM_003597chr262270 2083 1453 1413 832 389 --1182 11615
NM_003607chr174294 3262 3157 1623 594 574 136 23050 2918 ----
NM_003615chr3143766 3676 3423 3367 3292 2872 2584 2474 1209 1052 306 221 213 167 ------
NM_003622chr1292618 2055 2023 1937 609 434 366 252 223 --22555 1860 --
NM_003663chr343116 2600 911 83 --21130 946 13317
NM_003672chr161992 1479 1354 1299 1288 308 21625 415 1667 --
NM_003679chr182723 2110 1314 1175 1081 996 653 488 12149 22864 1369 23418 667
NM_003692chr93941 866 76 --2914 141 1133
NM_003743chr22829 643 ----21882 1668
NM_003749chr1382458 2069 2055 1961 1907 1573 889 424 --22395 1801 --
NM_003758chr1551201 1133 348 334 130 ----11160
NM_003758chr1551201 1133 348 334 130 ----11160
NM_003763chr2082979 2970 1987 1276 984 933 917 560 1641 1331 --
NM_003774chr12103101 2950 2937 2684 2653 2426 2067 2042 648 627 13280 32740 2224 1357 --
NM_003884chr331304 223 171 ----11451
NM_003895chr2142124 2000 1563 392 ----1283
NM_003913chr6184276 4219 4065 4010 3932 3909 3847 3668 3491 3044 2896 1718 1541 998 908 700 521 387 --13177 12984
NM_003930chr762244 856 535 503 430 259 154 --12115
NM_003932chr2241875 1271 258 192 1198 21635 1318 --
NM_003948chr452167 2123 1993 1788 308 12115 21968 448 --
NM_003955chr1721580 1574 ----11588
NM_003966chr5127860 7626 7251 7039 5126 4950 4768 2838 2310 1814 476 246 15516 12952 --
NM_003983chr1663297 3204 583 501 284 243 23160 1707 2961 512 13258
NM_003994chr12114180 3919 3317 3116 2985 1598 1201 1141 1117 1078 984 54152 3709 2894 277 162 ----
NM_004094chr14102715 2557 2397 2205 1127 1117 762 419 387 126 12695 22852 814 --
NM_004100chr642164 1038 637 207 1148 --22404 471
NM_004124chr14113407 3054 2591 2260 738 563 476 385 297 74 29 13384 12418 --
NM_004162chr371232 1157 945 852 482 460 426 --1449 --
NM_004171chr11129234 8158 6976 6941 6916 6047 3553 3015 2787 1079 826 816 38360 7159 3601 17055 --
NM_004229chrX92227 2077 1963 1890 889 730 508 311 62 --11585 --
NM_004232chr1863636 2590 1389 1350 1274 355 33700 2951 743 --1527
NM_004293chr993776 3528 3438 1488 1348 1326 1188 741 140 ------
NM_004338chr18126733 6723 6011 4869 2707 2169 1598 1588 1163 1035 607 324 22628 1005 25580 85 --
NM_004432chr952369 2301 1920 518 497 22072 805 12425 12027
NM_004438chr293244 3080 2949 2832 2378 2169 1141 1051 244 ------
NM_004458chrX62558 2296 2110 784 663 301 11825 11743 --
NM_004464chr454086 2940 2824 575 220 21408 828 12860 1263
NM_004501chr153049 2997 2973 1285 1184 11031 --13669
NM_004504chr262494 1214 915 789 520 482 12543 22702 2678 --
NM_004535chr2091544 1534 1360 1185 1168 1139 1133 1109 494 ------
NM_004540chr217904 842 720 583 328 312 255 ------
NM_004612chr964790 1877 1407 1347 1100 740 1451 --1605
NM_004631chr191423 1417 1310 1056 1005 559 499 350 37 2543 492 ----
NM_004657chr221175 634 --11512 11258
NM_004660chrY52270 2183 2139 1750 1727 11530 --1187
NM_004666chr621034 187 --1371 21440 124
NM_004685chr13112149 1953 1209 757 687 659 449 423 297 236 202 --11889 --
NM_004726chrX85348 4067 3749 2306 1611 1491 1439 325 21131 523 ----
NM_004738chr2062648 2249 2206 721 712 632 12352 12383 1693
NM_004744chr4113472 3255 3236 2741 1520 1491 1156 882 456 253 54 23379 201 --13900
NM_004745chr8116778 6574 4821 4722 4565 2793 2344 1955 1310 1233 219 11356 37066 6531 6441 15773
NM_004797chr373740 3644 3332 2555 423 138 114 --21321 90 --
NM_004815chr1164745 4421 4280 3435 3410 3165 1973 1943 1925 992 846 598 546 399 272 140 24936 3671 23946 689 --
NM_004857chr14134631 4292 3749 3475 3414 3299 3280 3122 1840 1305 1214 377 300 14129 --13640
NM_004866chr5134041 3572 3394 3189 3117 1861 1381 995 665 415 259 119 81 15028 14846 13701
NM_004904chr7156501 5770 5504 4968 4670 4371 4357 4331 4067 2082 1883 1106 1085 649 642 34636 4050 1072 14487 15637
NM_004926chr1461801 1444 1227 1221 1185 1166 ------
NM_004936chr952714 1975 1889 1099 964 --2949 251 --
NM_004956chr774489 3558 3444 3272 3181 1360 910 --1551 24221 3329
NM_004985chr1264055 3516 2929 1394 771 534 24046 3544 23855 3216 --
NM_004992chrX98526 8412 8268 6721 5441 2957 2896 1245 1057 17261 26506 2001 18362
NM_004992chrX98526 8412 8268 6721 5441 2957 2896 1245 1057 17261 26506 2001 18362
NM_004999chr6104127 3825 3178 3024 2928 1806 1698 1408 1115 896 21004 728 11019 --
NM_005036chr2287083 6458 6378 5874 5699 5186 1913 495 35843 5168 2380 ----
NM_005065chr1495391 4792 4348 3912 3556 2120 1928 1352 73 34432 4206 4139 21116 561 --
NM_005079chr872928 2526 2215 2168 1261 935 926 22160 2142 5831 796 668 219 109 --
NM_005121chr17123852 3491 3183 3127 3118 3010 2946 2661 1353 1120 446 418 --11062 11297
NM_005156chr995307 4945 4505 4259 4191 1285 1034 485 123 13875 1903 --
NM_005159chr1552085 1705 1572 265 144 ----11769
NM_005160chr2286475 5665 5587 1965 1653 1633 1406 88 25184 4335 1335 11954
NM_005188chr11148261 8114 7935 6585 5686 5564 3257 3202 2796 2075 1808 1586 1448 1095 --22814 1132 15600
NM_005197chr14145995 5604 5545 5527 5463 5311 5090 4893 4666 1316 1214 674 414 376 12115 11355 --
NM_005235chr297426 7130 5922 5715 5354 2496 2242 1403 973 22538 1771 67407 6019 3055 2791 1327 439 --
NM_005339chr443920 3500 3013 1442 --12713 2558 534
NM_005358chr1361810 1462 699 239 225 189 --21559 1316 --
NM_005359chr18106216 5399 5131 5091 4605 4122 4074 2561 1105 294 36370 5952 595 ----
NM_005433chr18112702 2426 2344 2271 2032 1981 1008 649 643 352 294 12821 12771 --
NM_005436chr1094080 3969 3062 1531 1482 1280 1131 1061 455 1469 ----
NM_005465chr131890 444 314 1458 11437 12024
NM_005509chr551862 1760 1317 1150 117 21226 176 ----
NM_005578chr374997 4917 4641 4523 4359 4192 1289 1618 --11646
NM_005584chr136825 713 696 686 139 70 1798 ----
NM_005587chr154900 866 388 94 ----1677
NM_005596chr9106184 5963 5715 5690 4846 4658 4428 4403 1349 1123 --24645 4290 --
NM_005665chr1154826 4741 4612 4446 3732 3689 3209 3116 3038 1692 1245 1051 523 407 33 11500 34492 4270 3796 --
NM_005668chr5124554 4312 3610 3531 3458 3255 3220 2956 2922 1586 1401 308 --43651 3378 2970 2877 --
NM_005711chr56970 927 804 757 750 271 1902 11033 --
NM_005739chr1572422 2228 1641 1515 246 231 139 11507 --1947
NM_005748chr1242818 1176 718 243 12519 1705 11199
NM_005779chr583512 3478 3238 2798 2545 1291 1245 898 --12971 --
NM_005795chr292908 2796 2699 2626 2615 2081 2067 2060 1174 ------
NM_005798chr1354434 1803 250 172 138 167 24746 2091 24666 4365
NM_005822chr62781 607 --1883 21801 209
NM_005840chrX116223 5830 5798 5076 4766 4710 2950 2909 1309 753 255 11866 25861 5791 13046
NM_005903chr574829 4272 3778 2052 779 181 175 23643 242 23915 558 --
NM_005935chr4115261 5097 4762 4633 4156 3795 2080 1905 1615 1104 261 --14569 --
NM_005962chr104427 221 158 38 12149 11641 1214
NM_005962chr104427 221 158 38 12149 11641 1214
NM_005977chr134875 779 299 49 1654 1791 1748
NM_005994chr173662 590 90 ----1694
NM_005999chr121335 188 --31098 115 69 11395
NM_006007chr973563 3281 2816 1613 1508 1415 1345 13552 21442 1311 --
NM_006016chr66609 460 369 355 197 184 11546 11440 12246
NM_006080chr793000 2837 2776 2441 2136 2066 917 232 127 --12639 --
NM_006095chr483821 3723 3448 3226 3088 939 562 542 2849 140 1390 --
NM_006106chr1193002 2362 1339 1279 896 398 390 329 259 23077 1043 13134 --
NM_006197chr862072 2024 1987 1873 695 588 21680 1673 --11657
NM_006203chr5124723 4630 4597 4029 3909 2017 1779 1293 1154 883 627 532 ----24884 645
NM_006251chr573328 2473 2193 2125 1114 367 199 23358 1247 1281 1902
NM_006252chr1247351 7257 7146 6931 6830 6586 6348 4930 4718 2927 2186 2162 2135 2080 1411 1372 1335 1191 1014 814 678 568 480 174 ----16868
NM_006256chr182761 2604 2430 2067 1013 859 589 424 12515 1811 --
NM_006283chr884858 4737 4498 3757 3308 1707 927 429 24393 1310 11472 --
NM_006287chr2102620 2607 2594 2276 1906 1765 831 768 475 104 --32578 2178 852 --
NM_006306chrX93918 2226 1973 1925 1502 559 543 246 122 13622 --15211
NM_006315chr473216 2923 1709 1439 568 464 120 1493 13957 --
NM_006345chr471229 1137 1052 900 863 272 263 --21209 298 --
NM_006379chr7102254 2133 1957 1584 1444 759 516 254 242 221 --1630 --
NM_006380chr1742702 1276 420 335 1820 2192 182 11045
NM_006434chr1093259 3181 3017 2837 2734 2513 2386 602 229 --1930 23275 643
NM_006457chr4103638 3599 3384 3276 2952 2882 2680 1010 425 85 13148 ----
NM_006489chr1452031 1947 1856 1648 543 11834 --11862
NM_006534chr20103296 3255 3110 2925 2842 2487 1070 725 668 227 ------
NM_006538chr2103746 2884 2869 2648 1634 1625 686 667 171 48 --13363 --
NM_006544chr14134835 4309 4291 4062 3813 3749 2287 2091 1296 1262 802 172 24 45606 4341 1169 367 24169 4110 14639
NM_006561chr1066241 5834 4526 1767 1194 636 --11034 11019
NM_006572chr1793252 3196 2436 2290 2266 1095 1067 751 240 53534 3359 3106 2707 2508 23027 385 --
NM_006575chr1491314 1167 1091 1049 1015 917 476 465 348 --11321 --
NM_006577chr251071 985 520 379 372 ----1994
NM_006599chr16198006 7154 7012 6841 6568 6559 6445 6060 3217 3108 3072 2823 2616 2456 2392 2371 2209 2180 1622 --25237 1975 15892
NM_006614chr3133567 3450 3091 2524 1436 1332 915 603 523 451 289 59 51 1256 2785 322 --
NM_006620chr684160 3169 3084 1331 989 971 715 606 24596 1467 13853 14623
NM_006624chr1072051 1784 1323 1304 711 521 474 1358 1458 11310
NM_006626chr9102596 2550 2543 2530 2504 2396 2387 1882 811 672 1544 12407 --
NM_006628chr15114668 4464 4123 3964 3105 3004 2961 1663 961 395 359 --24072 628 --
NM_006646chr1382747 2434 2156 2146 2110 1056 699 162 12300 1284 --
NM_006654chr12104544 4506 1628 1408 1048 951 647 423 417 242 --11669 --
NM_006682chr782645 2407 2387 2186 2004 840 309 29 1925 1631 --
NM_006699chr172560 959 907 775 723 431 141 ----12095
NM_006729chrX65657 5117 4366 3866 727 31 34398 3854 3641 --42101 1472 859 558
NM_006746chrX41408 1339 1213 552 31158 564 23 --1558
NM_006750chr16107840 6766 6683 6662 6330 6285 6144 5591 3225 2852 26478 3052 --22860 414
NM_006873chr292498 2449 2311 2271 2174 1417 1386 1319 543 --12193 --
NM_006885chr1693732 3591 3277 3142 1321 990 940 828 633 1451 ----
NM_006888chr14103521 3501 3104 2613 1287 1076 809 670 394 103 --21211 1155 --
NM_006918chr11155369 5359 5128 4502 4293 4266 3822 2308 1550 1445 1403 1089 788 753 740 15669 --15303
NM_006922chr281906 1720 1704 1684 751 745 670 412 ------
NM_006924chr1794291 3772 3655 3396 1743 1588 1074 1006 220 22783 1262 54072 3893 2921 603 57 198
NM_006948chr2182237 2142 2134 2110 1890 649 557 461 1124 2982 515 --
NM_006996chr1111868 1786 1762 1672 1445 714 688 646 461 205 91 ----1169
NM_007006chr16103406 3392 3261 3118 2631 2427 1063 820 468 202 21002 661 12838 13365
NM_007007chr12164815 4744 4229 4075 3747 3588 3493 3435 2961 1687 1168 1090 1079 666 592 451 13573 23723 493 13738
NM_007038chr21106102 5917 5362 4475 4389 3872 2436 1069 1060 44 24168 2421 15968 14459
NM_007039chr1441418 780 740 488 1689 21537 411 11976
NM_007054chr563934 3218 2992 1583 316 207 --1336 --
NM_007064chr361496 1368 582 495 395 84 --1152 1248
NM_007114chr3102620 2557 1158 1089 935 873 745 703 315 160 --12979 13068
NM_007137chrX45512 5015 1725 1641 21559 515 11355 1159
NM_007157chrX72761 2070 1153 988 634 228 78 ----12016
NM_007175chr8103581 3111 3057 2977 2734 2689 1241 1102 1037 752 --23193 2817 --
NM_007187chr1351010 796 329 315 276 1104 1221 --
NM_007195chr1883588 3181 2609 2286 518 480 394 98 13492 ----
NM_007203chr993762 3342 3054 2702 1565 1549 1308 742 89 --1807 --
NM_007212chr1112181 1612 1513 1484 1404 899 436 333 162 142 106 --1197 --
NM_007249chr13139282 9062 8177 8072 6548 6396 6149 5697 3632 2529 1961 691 59 57102 5916 3601 2225 1892 38916 3027 2386 --
NM_007347chr1573205 3150 3083 2575 1113 294 61 --11155 --
NM_012081chr573112 2979 2629 1184 1129 1058 45 23255 2486 --1478
NM_012089chr171542 1493 1307 1053 1035 964 514 ----1181
NM_012120chr682862 2305 2194 1986 1202 1176 354 21 141 11118 --
NM_012137chr152727 2506 2456 470 286 12878 32540 1115 317 --
NM_012214chr256294 5850 5255 4251 1143 46082 6017 5564 4777 ----
NM_012234chr363734 3047 1157 862 390 381 13233 12829 12324
NM_012249chr2123537 3231 3208 3187 3029 2942 2868 2846 2300 1358 821 730 12641 ----
NM_012252chr7105091 5084 4065 4048 3773 3277 1296 796 682 120 11195 1702 --
NM_012262chr195090 4966 4321 4021 3968 3898 1622 1150 552 --14564 11728
NM_012281chr751704 1599 701 695 598 ----1687
NM_012287chr383441 2999 657 562 260 249 220 145 23155 464 21825 1106 --
NM_012297chr472377 2313 2243 2147 732 294 42 --11762 --
NM_012334chr554615 4587 4533 890 608 24384 3177 --14429
NM_012338chr721166 769 21081 890 --1828
NM_012347chr652830 2235 581 281 216 11119 --12592
NM_012465chr1072823 2770 2423 2311 1293 1100 947 12595 12266 12815
NM_012471chrX41926 1823 680 478 11527 --1791
NM_013231chr1434210 1012 808 23486 2971 24403 1209 21037 967
NM_013233chr241329 561 354 282 ----1472
NM_013255chr7138872 8164 7957 7812 6626 6009 3200 3045 2804 2377 1655 489 377 57124 6947 2820 1119 782 46520 5782 2447 2132 --
NM_013261chr483712 2709 2689 2486 1212 1082 484 245 --1966 21259 1042
NM_013309chr1582579 2536 2460 1706 1012 704 676 33 ------
NM_013374chr353098 2194 2174 1105 781 21930 31 12975 --
NM_013386chr181791 1657 1650 1259 1227 587 378 181 ------
NM_013437chr861280 1212 1042 1029 223 214 11138 ----
NM_013943chr152835 1182 1140 513 432 12919 22591 461 --
NM_014005chr592206 1954 1180 1060 661 571 210 166 99 2754 718 1352 --
NM_014016chr371526 1189 1115 467 357 275 247 1665 ----
NM_014021chr1113162 3154 2665 2454 2280 1335 1008 890 421 167 36 ------
NM_014043chr341587 1443 1215 500 ----1153
NM_014048chr1674838 4688 4568 4110 1927 910 527 12036 23759 178 21773 565
NM_014089chr1382110 1928 1851 1607 868 818 505 293 ------
NM_014112chr8105415 5250 4964 3355 1821 1127 999 693 522 319 ------
NM_014155chr11126265 6085 5964 5700 5547 5330 4916 2919 1605 743 88 43 36369 5535 4810 12030 --
NM_014181chr2112863 2622 2318 2266 2062 1841 811 534 436 416 274 1507 22402 1852 1223
NM_014253chrX42026 1838 861 220 --22439 759 12032
NM_014331chr4167740 7399 6972 6913 6211 2833 2711 2404 2369 2159 1990 1803 925 170 148 130 25701 520 --26219 1307
NM_014333chr1162130 1979 1826 556 505 268 2685 550 --146
NM_014372chr131537 1331 597 ----1244
NM_014393chr852070 1474 738 711 462 11492 1124 --
NM_014394chr105859 778 341 314 127 ----11191
NM_014421chr472098 2002 1932 1766 545 395 49 183 ----
NM_014423chr5125028 4418 4308 3668 3617 1862 1682 1527 1251 419 306 202 --45234 4096 2057 390 --
NM_014456chr1031243 1237 508 11890 1378 11156
NM_014458chr151433 1190 343 320 196 1561 1980 --
NM_014548chr1561660 1045 631 500 341 159 --11442 --
NM_014616chr3103501 2333 2275 1347 957 857 590 460 391 52 23325 1400 ----
NM_014636chr953553 3331 2814 1226 737 --13931 11319
NM_014682chr892107 2021 1986 1784 760 723 564 315 222 --12316 11563
NM_014701chr15103225 3033 2695 2178 1198 1188 889 763 108 95 21154 210 ----
NM_014711chr1692065 2046 2005 1947 1756 1401 841 54 24 --1790 --
NM_014720chr1031214 316 246 11535 11811 11456
NM_014721chr6127317 6975 6564 6534 5866 5412 4972 2748 1663 1234 1090 510 27460 2332 27000 483 --
NM_014733chr582242 1985 1715 1506 829 694 281 170 ------
NM_014736chr153203 142 123 1136 ----
NM_014755chr274197 3798 3407 3088 3061 1044 469 ----1412
NM_014766chr793247 2918 2684 2575 1365 1310 1190 717 30 1732 13232 1964
NM_014774chr163272 3208 2858 2030 450 45 --32435 2372 1133 1196
NM_014781chr841195 1109 799 463 1819 --1455
NM_014812chr141941 1763 1291 136 ----1186
NM_014819chr552287 1833 384 158 93 12097 --11753
NM_014826chr174294 3262 3157 1623 594 574 136 23050 2918 ----
NM_014830chr1293787 3485 2935 2782 2743 2601 1499 1427 1198 1471 23899 632 13923
NM_014832chr1321391 812 --11891 21955 285
NM_014873chr174601 3455 364 340 243 133 93 34822 3220 41 23957 3355 --
NM_014877chr17147786 6876 6467 5460 5164 4812 2926 2254 2248 2115 1892 847 383 343 15270 37306 2261 1695 --
NM_014888chr761468 1191 1104 974 640 147 --11292 11320
NM_014899chr583153 3050 2821 2788 2331 2216 1191 1122 ----1282
NM_014900chr231088 955 431 2924 475 --186
NM_014904chr1093884 3651 3589 3369 3080 3041 2793 2691 488 1552 23854 401 --
NM_014906chr17134083 4040 3926 3765 3447 3331 3128 3017 2936 2683 2670 2550 1316 1931 21206 744 --
NM_014912chr1033207 495 155 --1734 12248
NM_014920chr693691 3672 3312 3271 2965 2864 2440 462 441 13712 ----
NM_014923chr1372340 2227 2217 1678 1595 611 94 2388 301 ----
NM_014934chr13123777 3489 2750 2673 2523 1548 1533 1521 942 899 717 533 --11538 --
NM_014936chr682852 2560 2497 2215 1152 1086 475 361 22511 691 ----
NM_014947chr183166 2874 2772 832 811 804 688 533 12880 12720 --
NM_014953chr13114390 4363 4251 4177 4000 3492 2677 1090 961 342 202 --11726 --
NM_014962chr2062792 2773 2651 2577 2423 1041 1480 --12338
NM_014982chr14155244 5224 4791 3962 3874 3821 1776 1424 1294 1206 1042 1030 1003 637 610 34106 1817 1325 11272 --
NM_014989chr661838 1828 1485 1270 690 154 ----11423
NM_014991chr4113312 3196 2886 2666 2658 2638 2537 2409 2037 1234 190 --11227 --
NM_015000chr1253053 1118 967 686 349 33109 2574 699 --11163
NM_015026chr12184624 4250 4160 3849 3241 3209 3091 1881 1847 1627 1573 1401 1312 1042 589 544 361 146 34051 3548 1165 ----
NM_015032chr1362902 2548 2508 2217 2196 1827 --11142 1915
NM_015040chr293364 3065 2793 2756 2617 2496 967 928 96 ------
NM_015049chr272584 1292 1241 1165 940 669 299 ----1218
NM_015068chr753999 3038 2744 1151 881 --152 23677 3538
NM_015071chr5106176 6105 6001 5995 5975 5828 5791 4256 1313 1240 15244 36390 2262 1929 16454
NM_015074chr194605 4431 4335 4213 3630 3605 1951 695 604 13093 ----
NM_015076chr664105 1143 1133 743 556 431 --14088 --
NM_015087chr13122477 1993 1073 1026 1014 925 872 533 384 289 158 111 ------
NM_015092chr1694699 4595 4556 4046 3760 3706 1384 1283 845 24201 463 11339 13673
NM_015093chr641862 1826 1252 439 --11276 11383
NM_015097chr382335 2223 2189 1571 822 673 473 403 ------
NM_015144chr1653874 3599 3045 2755 1424 ----11450
NM_015192chr20102927 2255 1936 1127 957 865 778 545 406 343 ------
NM_015199chr382941 2799 2738 2136 1164 1158 1075 76 ------
NM_015206chr1573621 3582 3575 3525 1210 1036 369 --1703 --
NM_015208chr1873499 2768 2611 1005 342 270 215 12458 23419 1391 1884
NM_015225chr972580 2210 2080 1230 1122 832 825 23175 2999 32927 2416 2174 --
NM_015230chr441663 1503 1369 715 --1670 11620
NM_015247chr16145326 5261 4633 4079 4051 3381 1941 1367 1268 970 896 177 79 61 --35217 3741 694 14085
NM_015265chr292419 1807 1026 919 852 706 618 432 206 ------
NM_015278chr683383 3235 2902 2487 986 883 760 480 ----11141
NM_015286chr1552347 2158 2089 629 377 1453 --12436
NM_015310chr898164 7733 6196 5583 2185 1695 1683 1340 83 36239 5672 2230 17518 --
NM_015317chr251985 1099 622 133 120 --31850 1766 204 1984
NM_015344chr83832 752 268 1362 31649 1532 416 11807
NM_015365chrX42896 1160 866 520 31685 1343 927 --12846
NM_015385chr1093259 3181 3017 2837 2734 2513 2386 602 229 --1930 23275 643
NM_015387chr272002 1801 1378 1297 795 181 166 ----11348
NM_015431chr173471 2829 1282 1229 1196 783 96 2572 382 12577 --
NM_015436chr4103228 3176 2920 2504 2423 1332 888 783 773 158 ------
NM_015455chr5154042 3850 3757 3695 3461 3381 3180 3151 3131 3010 2837 2663 1522 737 443 11461 24016 3651 --
NM_015458chr8125341 5118 4916 4497 3665 3334 3271 1214 1169 644 596 270 13743 ----
NM_015460chr351983 1312 715 430 350 --11758 11991
NM_015496chr81224 181 1323 1230
NM_015508chr351589 1382 1199 396 200 21128 603 --1615
NM_015554chr155575 550 477 395 389 1203 21160 624 21797 184
NM_015560chr3102920 2580 2017 1980 974 675 592 525 515 266 1844 22430 356 --
NM_015564chr543034 1222 654 469 52508 867 778 606 336 ----
NM_015626chr173834 164 108 ----1252
NM_015640chr1135204 4718 4669 4482 3763 3314 1789 1761 1729 918 731 452 48 1383 11514 24988 210
NM_015713chr8123378 3371 3359 2835 2475 2345 2336 2207 1372 971 786 664 12747 ----
NM_015879chr18106026 5438 5348 2277 1879 1609 1432 895 720 170 27795 5310 15404 27110 1010
NM_015886chr8145610 5540 4635 4080 4067 3761 3481 2080 2022 1092 951 877 692 433 14107 75333 4723 4198 3977 1966 1607 810 --
NM_015888chr153072 2864 2470 2411 2090 --53322 2632 1019 882 354 --
NM_015891chr66735 667 370 194 59 53 21846 1656 11946 1354
NM_015906chr174721 4626 3632 3253 1816 1796 1107 11631 --21529 713
NM_015962chr144397 280 125 114 --1133 --
NM_016018chr882837 2822 2545 1818 627 503 495 187 12348 1860 --
NM_016023chr832100 604 588 11791 --1594
NM_016072chr1252277 1872 1802 759 44 --168 12105
NM_016075chr1363152 3117 3056 701 542 315 1191 1169 22571 352
NM_016076chr152303 2063 2044 1124 902 22921 25 1920 --
NM_016081chr442145 1743 875 499 --12272 1641
NM_016087chr771667 1593 1482 1437 1423 1357 228 21573 679 ----
NM_016132chr15113138 3070 2673 2574 2422 2272 1171 1088 1075 1056 212 --22971 2933 --
NM_016156chr1182138 2089 1881 846 773 601 120 108 21997 84 ----
NM_016206chr3207735 7292 7100 6472 6368 6274 5906 5754 3568 3400 3129 2926 2222 2104 2045 1767 1268 996 355 82 22336 2214 21706 1631 16981
NM_016217chr673446 3074 2823 2562 2266 1205 294 12284 22745 1444 --
NM_016248chr1383858 3647 3541 3241 3067 2724 2538 563 23413 978 ----
NM_016255chr6113307 2516 2449 2443 2413 2168 2055 1328 958 943 863 191 1647 12034
NM_016260chr2117626 7539 6744 6445 2419 2300 2129 1895 1267 1241 584 22893 378 --1350
NM_016275chr352242 2109 2061 1712 801 12654 11736 22205 565
NM_016308chr172027 1702 1353 753 745 352 190 1641 12055 --
NM_016315chr27703 659 607 492 456 322 88 --21664 298 1600
NM_016396chr1562954 2569 2148 1929 1857 934 1679 1975 --
NM_016513chr693691 3672 3312 3271 2965 2864 2440 462 441 13712 ----
NM_016530chr1593786 3603 3301 3120 2922 2832 2592 859 492 22990 1406 11381 --
NM_016531chr484085 3660 2932 2596 1458 1161 727 109 ------
NM_016599chr471546 1456 1392 1116 621 609 114 1272 --1389
NM_016607chrX81530 1347 1329 1185 1136 1077 139 47 122 --11451
NM_016631chr2141023 795 328 125 1172 --1915
NM_016953chr265761 5732 3972 3870 1953 1295 25458 4702 14087 15808
NM_017415chr594202 3717 3219 1767 1756 1461 1001 904 153 11117 13963 13941
NM_017420chr1463862 3352 3066 2954 276 201 --22450 939 --
NM_017447chr21133883 3619 3266 3005 2852 2766 1726 1461 731 516 488 384 132 14092 24119 680 13442
NM_017522chr191423 1417 1310 1056 1005 559 499 350 37 2543 492 ----
NM_017563chr396067 5421 5023 4724 2520 2031 1848 1267 1112 35572 2308 341 11839 --
NM_017594chr9133292 3257 3246 3240 2987 2865 2711 2398 1171 1159 1048 646 595 --12346 --
NM_017599chr1271885 1765 1480 1451 737 578 365 11525 31681 1494 591 --
NM_017610chr1552133 1642 755 514 185 32049 735 692 ----
NM_017628chr485324 5047 4748 4490 4150 1127 651 485 --44717 3855 1689 211 --
NM_017637chr9139408 8481 7252 6094 3524 3041 2186 2148 2051 1775 1764 1412 659 --21558 534 --
NM_017644chr365073 4920 3160 1490 557 411 34967 1843 1689 11956 14724
NM_017645chr962535 2487 2354 2037 711 371 1747 1736 --
NM_017650chr7105908 5579 5521 5387 5277 4494 4314 2357 2113 723 11649 1820 24780 1541
NM_017658chr1494551 3843 3611 3235 3174 3050 1406 663 292 --23028 979 1914
NM_017672chr1541079 987 927 236 --31215 463 454 --
NM_017705chr1583811 3257 2846 2521 1315 899 296 103 13103 1151 --
NM_017719chr342352 1649 987 115 --12577 11949
NM_017736chr1632767 2340 832 --1925 22476 884
NM_017754chr694615 4486 3778 3567 3350 3344 1880 1703 1506 --14507 11534
NM_017768chr17861 666 354 343 251 196 165 ----1968
NM_017769chr14112853 2574 2511 2242 2142 2115 2107 1303 987 806 386 --22785 287 --
NM_017770chr672033 1926 1020 737 687 627 601 ----1366
NM_017813chr8115673 5183 4504 4254 3796 1679 1209 703 511 359 124 --24778 3620 --
NM_017831chr1894693 4283 3637 1583 1552 1507 1038 960 530 24008 3493 --1973
NM_017848chrX73665 2860 1882 1621 981 273 179 ----11286
NM_018018chr1281695 1630 1292 1271 1193 660 625 91 ------
NM_018036chr1494488 4440 4248 3021 2816 1058 1002 498 492 --11519 13776
NM_018046chr51357 21197 125 1611 1653
NM_018048chr1251866 1348 1331 519 31 21622 699 11829 --
NM_018060chr13366 95 67 --1297 1279
NM_018085chr185493 5176 2061 1987 913 802 762 406 38055 6016 152 --1428
NM_018105chr841078 990 394 288 21182 116 --11014
NM_018155chr373455 3422 3357 3032 2883 2112 624 --42545 2200 2160 2098 22889 2468
NM_018227chr493228 2962 2892 2774 2725 2596 788 362 245 23060 63 ----
NM_018247chr683108 2872 2654 2551 2266 879 779 54 2888 437 12504 1261
NM_018254chr162297 1745 1721 525 510 313 --21963 232 --
NM_018263chr262578 2466 2420 1638 524 490 1319 32045 1625 502 --
NM_018293chr392987 2833 2662 2576 2376 2218 2005 1137 848 1525 1270 --
NM_018299chr8123482 3398 2946 2788 2710 2410 2120 1180 945 599 178 67 ------
NM_018313chr352652 2114 1859 1841 847 --22168 586 --
NM_018351chr1294746 4053 3500 3117 1661 1222 992 312 191 11109 11445 --
NM_018361chr894087 3943 3490 3462 2718 969 620 524 501 22662 975 2483 414 --
NM_018362chr11104053 1524 1065 1033 843 833 761 755 627 363 1798 ----
NM_018364chr183858 3529 2796 1336 1100 1005 620 323 --23000 500 --
NM_018374chr7175199 5131 4752 4386 4120 3758 3539 3282 3224 2011 1964 1703 1495 1225 1190 1050 297 1844 --24133 1107
NM_018429chr5112551 2348 2104 1154 1051 1032 1003 989 382 374 199 12165 21064 660 179
NM_018440chr8128621 8102 8052 7274 7115 6878 5633 2917 2718 1919 1670 1088 37621 6977 378 1156 37761 3063 2790
NM_018444chr882207 2201 2188 1726 1504 464 425 379 --22140 909 --
NM_018569chr451565 1466 1399 572 468 2440 434 ----
NM_018590chr1041567 1538 1501 48 --2679 53 11190
NM_018638chr12145537 5395 4896 4617 4448 3941 3887 3675 1708 1450 1081 686 516 293 --35087 4961 430 --
NM_018640chr1262589 2255 431 416 384 246 1180 --12156
NM_018650chr1122205 2128 1841 1695 1663 1407 664 499 366 254 243 24 12159 ----
NM_018700chr531233 527 342 ----11267
NM_018710chr871402 1256 1038 860 512 384 80 --1493 --
NM_018718chr762297 2105 1714 1640 1483 255 ----11586
NM_018841chr173869 3580 3014 1553 1245 1196 645 --12620 12946
NM_018844chr772102 1856 1613 489 422 389 234 21883 80 11556 11667
NM_018947chr7154698 4682 4445 3708 1733 1427 705 594 527 430 424 361 269 209 22 31207 730 96 21586 178 23036 331
NM_018976chr1272661 2361 2315 2124 1125 762 557 22650 804 1925 1513
NM_018981chr271061 1054 1001 956 886 555 347 11307 --2857 69
NM_018999chr10134108 3914 3905 3307 3185 3037 1654 1648 1570 1528 1214 1081 455 13814 --23687 3005
NM_019022chr1872562 2238 2221 448 322 107 56 32759 2515 67 ----
NM_019027chr441840 1026 454 62 12021 --12561
NM_019035chr481932 1453 1418 1375 602 320 302 217 11783 ----
NM_019036chr641251 1068 909 281 ----11151
NM_019072chr594071 3932 3548 3152 3067 2975 1028 932 323 1774 12857 --
NM_019080chr1361425 1385 546 422 381 174 --21466 559 --
NM_019114chr921891 1553 1713 --21762 498
NM_019593chr2092938 2455 749 536 329 281 164 128 54 ----11063
NM_020122chr2155455 5242 4773 4327 3838 2283 1530 1304 1060 937 864 763 487 417 321 35890 2102 2087 1833 --
NM_020159chr471550 1278 1136 1086 1074 697 517 11111 --11403
NM_020177chr562834 2157 825 260 171 93 ----13315
NM_020245chr6124851 4772 4592 3614 3186 2030 1883 1831 1420 1170 1111 827 ------
NM_020297chr1283537 3385 3151 1453 1394 489 183 30 ------
NM_020336chr20113860 3806 3183 3163 3003 2469 1552 1297 957 840 400 1986 32656 2384 2364 --
NM_020347chr382266 2184 1953 868 827 796 758 645 11587 11446 2132 117
NM_020390chr3114645 4481 4329 4012 3938 1443 1387 1261 885 563 379 13862 13620 --
NM_020455chr672601 2402 2383 2352 2171 2021 809 32436 282 75 11861 --
NM_020456chr1362211 2045 287 226 215 49 1872 1139 --
NM_020466chr694651 4275 3655 3443 3328 1572 1075 95 55 14472 34873 3670 1235 --
NM_020640chr342189 908 857 482 1113 11712 1745
NM_020647chr8122270 2220 1951 1934 1799 1766 921 844 830 662 645 169 ------
NM_020673chr2097350 6831 6337 5813 5445 3051 1309 898 503 25616 1655 ----
NM_020718chr16106484 6464 5796 4775 4117 1999 1797 1781 174 44 11790 14526 21911 50
NM_020734chr1283344 3334 3137 2875 2452 2257 1259 84 11169 22631 1351 --
NM_020748chr1772121 2070 1960 1719 1691 772 745 11902 1303 --
NM_020766chrX124103 3645 3037 1650 1536 1493 1373 1088 469 460 259 222 34303 3109 3043 1189 --
NM_020772chr17117885 6959 6404 6144 5298 3228 2972 2242 1954 244 171 11840 38560 8234 7651 23211 2548
NM_020774chr1895856 5672 5152 4965 3803 2475 2203 1796 1137 11664 35258 926 805 --
NM_020782chr12114423 4317 4099 4055 1886 1826 1136 938 715 695 453 --2591 366 2779 517
NM_020810chr14165 ----23488 407
NM_020841chr12103459 2954 2916 2776 2545 2490 1284 1248 362 62 13630 21178 930 13573
NM_020859chr463519 2557 2461 478 288 52 13771 13349 --
NM_020921chr14113697 2797 2582 2528 2386 1465 1286 1111 1002 431 414 1622 12885 13531
NM_020922chrX41660 1654 1639 1338 ----2429 272
NM_020935chr264066 3518 3080 2960 1218 793 ----14509
NM_020948chr193274 3210 2636 2588 2574 2479 2411 2367 2280 1277 ----
NM_021033chr1383543 3266 3251 2822 2585 1349 1311 177 --12392 1128
NM_021061chr864128 3134 1385 1226 970 116 11250 23555 2984 24105 1407
NM_021083chrX73108 3087 2620 1389 897 497 60 22354 1286 ----
NM_021116chr7129088 8621 7717 6055 5728 3515 3491 3467 3444 3353 915 557 38826 7843 7744 1312 1856
NM_021127chr1871490 1472 1237 1224 464 393 169 --11416 1605
NM_021148chr782499 2434 1697 708 397 386 276 198 22285 716 12504 --
NM_021163chr7103689 3142 2450 1331 974 653 277 255 248 114 1963 --1693
NM_021183chrX92355 2131 1840 1629 808 720 700 348 151 --22345 823 --
NM_021190chr141344 933 488 40 --21119 1086 167
NM_021191chr1282418 2062 2048 1724 1023 365 334 131 ------
NM_021204chr45898 792 785 202 183 ----1360
NM_021215chr2042392 1933 409 210 31606 658 179 --22403 1594
NM_021222chr17539 425 413 405 397 225 79 2559 311 ----
NM_021255chr1483745 2980 2863 1606 1347 646 591 365 22752 2521 ----
NM_021622chr1092182 2147 2012 1963 1887 1772 1506 404 258 ------
NM_021629chr374663 4636 4367 4345 4160 1680 445 --34500 3956 3676 --
NM_021647chr484651 4289 4053 3621 3062 1575 1365 945 --14456 13964
NM_021813chr6105361 4947 4603 4411 3723 3574 668 654 367 74 21130 541 --11150
NM_021911chr564914 4361 4140 3876 1865 1140 21000 642 1988 --
NM_021912chr1573510 3196 1162 1038 919 771 530 --13373 23099 1461
NM_021961chr11107473 6830 6266 5137 4714 2958 1248 809 764 182 14629 25384 401 --
NM_021964chr394352 2549 2245 2144 2025 1949 1828 1710 627 12539 ----
NM_021977chr683890 3014 1398 1128 927 876 707 406 13237 12701 --
NM_021998chrX71309 1246 1239 1180 1013 553 512 1575 21057 31 --
NM_022133chr8101888 1835 1829 1773 1598 1190 736 477 174 36 246 29 ----
NM_022351chr883857 2797 2676 2468 1354 649 213 119 ------
NM_022444chr7101881 1865 1827 1709 1702 1673 1619 1605 1288 418 ------
NM_022456chr1285944 5835 2585 1318 658 585 320 78 27030 2069 --21937 1380
NM_022458chr752955 2628 1254 1066 744 ----2444 391
NM_022459chr13156386 6052 5756 5638 5348 5117 4877 4693 4651 4616 2411 2105 1319 1018 640 23888 27 35402 5186 4888 --
NM_022474chr1462718 2285 2091 1038 841 488 ----12580
NM_022650chr55994 963 840 727 33 --1941 1679
NM_022735chr171907 1807 1639 1520 725 621 281 31495 570 525 --11436
NM_022763chr3103193 2912 2906 2519 2166 1027 542 495 363 121 --1760 161
NM_022781chr972369 2199 1192 1143 1114 573 24 ----12876
NM_022842chr383168 3084 3052 2311 2223 2184 464 442 2833 318 ----
NM_022893chr263161 2982 2959 2290 2264 792 ----23044 2789
NM_022977chrX62558 2296 2110 784 663 301 11825 11743 --
NM_023000chr1421331 1132 11597 1514 1493
NM_023001chr1421331 1132 11597 1514 1493
NM_023037chr1341082 824 762 67 ----21139 1060
NM_024345chr986136 6085 4815 4523 4008 2314 1897 1417 35854 5405 63 13995 15095
NM_024524chr393218 3173 2889 2844 2700 2359 2138 224 97 12019 142 --
NM_024561chr13------31344 1311 1231
NM_024607chr8114045 3617 3556 3484 3083 2850 2745 1713 1420 420 411 22995 177 1615 --
NM_024636chr762948 2068 1146 580 48 30 --1877 --
NM_024639chr632712 103 40 11025 12888 12329
NM_024641chr662649 2423 920 606 344 114 ----1487
NM_024646chr163338 1542 1032 1004 740 691 23313 1405 1911 11389
NM_024692chr231665 1621 390 1139 181 21769 1300
NM_024744chr282666 1802 1783 1030 1020 1005 321 129 --11832 --
NM_024761chr985347 3742 3626 3567 3320 2029 1372 342 --15316 --
NM_024770chr2135874 5832 5759 5187 5146 4467 4208 2346 2314 2217 1899 170 46 1529 ----
NM_024854chr1281591 1428 1056 449 300 283 242 185 ----11568
NM_024899chr184637 501 449 217 1629 --175
NM_024921chrX71672 1509 1435 1332 1297 589 401 --1218 --
NM_024941chr541342 1035 220 32 ----11387
NM_024947chr3109568 7659 7111 6804 3495 2977 2534 1725 748 447 19346 49374 5855 3560 2405 36282 979 655
NM_024949chr494266 3559 1941 1925 1814 1029 813 355 36 13337 23630 1315 --
NM_024989chr2218206 7432 7387 6602 6461 6386 6317 5931 5687 5331 5268 3268 3101 3000 2950 2923 2569 2118 1668 788 324 ------
NM_024991chr1093259 3181 3017 2837 2734 2513 2386 602 229 --1930 23275 643
NM_024996chr37932 820 332 279 178 153 82 11016 1160 --
NM_025054chr893728 3615 3582 1198 1037 905 880 646 485 --1131 14190
NM_025134chr1672451 2382 2199 2192 1634 521 298 2868 722 11802 --
NM_025154chr731256 1121 1029 ----11038
NM_025191chr1113201 2693 2687 2499 2198 1398 1389 622 563 340 30 12526 --13292
NM_025214chr1882566 2513 2395 2029 1829 175 103 49 21784 27 12518 --
NM_030579chr1683620 3551 3228 3089 1300 593 441 286 23263 864 ----
NM_030621chr1474270 4102 2880 1236 1070 284 62 23194 1250 ----
NM_030627chr5114103 3925 3849 3672 3266 2829 2641 1314 1156 801 55 22716 754 ----
NM_030647chr7106081 5782 4446 3849 2462 1365 1221 1128 392 338 21803 430 46177 4848 1120 537 --
NM_030650chr2103417 3248 3191 3067 2655 1065 765 704 457 34 21031 124 1481 1991
NM_030674chr12135779 5231 4708 4616 4412 4380 2255 2099 957 884 446 347 202 35168 2180 1901 1390 25270 2276
NM_030751chr1051823 1402 1373 573 107 ----1603
NM_030751chr1051823 1402 1373 573 107 ----1603
NM_030755chr1492659 2419 2253 2244 2060 1977 600 334 108 23040 145 22781 2680 --
NM_030763chrX4760 673 666 654 ------
NM_030777chr2082485 2469 2456 2331 2315 2300 780 266 ------
NM_030791chr1481558 1209 1172 718 468 457 233 121 1226 ----
NM_030806chr1119395 9164 8725 8470 8296 8261 8210 6996 2922 2882 1960 27725 5965 48451 3057 1205 89 --
NM_030816chr1113493 2951 2852 2720 2685 2667 2459 1186 992 534 515 12353 ----
NM_030817chr1263574 3180 3152 3142 1505 1446 21520 515 --23293 756
NM_030911chr133284 70 61 21237 76 ----
NM_030920chr141554 1428 620 349 --31941 599 562 1243
NM_030945chr592630 2468 2341 2321 732 476 165 130 103 11974 22386 492 --
NM_031268chr1675133 5120 3555 3399 3300 211 141 --24197 1935 14878
NM_031362chr252717 2691 2589 2293 161 --12360 11785
NM_031365chr252853 2827 2725 2429 297 --22496 136 11921
NM_031366chr252853 2827 2725 2429 297 --22496 136 11921
NM_031427chr1474889 4836 2347 1802 632 345 33 2430 393 22302 160 15936
NM_031435chr12103486 3193 3080 2639 2564 2430 2290 718 683 88 21316 712 --13426
NM_031438chr551811 1673 1462 501 30 11591 179 --
NM_031442chrX53029 973 963 899 244 1369 12706 12877
NM_031468chr7118248 8173 7995 6946 5814 5768 5077 5046 2848 1875 129 --15160 --
NM_031483chr2093365 2943 2935 2562 2285 1349 1024 604 468 1141 23311 3048 --
NM_031844chr153049 2997 2973 1285 1184 11031 --13669
NM_031845chr272899 1198 931 848 580 150 82 --136 --
NM_031847chr272899 1198 931 848 580 150 82 --136 --
NM_031911chr4102123 1101 1074 811 642 517 493 356 240 230 ------
NM_032012chr9105275 5175 4800 3748 3472 3437 1773 886 329 56 44015 1882 1120 209 25031 583 --
NM_032116chr13125798 5616 5525 5197 4614 4524 2247 2221 1585 1239 1147 949 1313 14864 --
NM_032144chr261219 1208 665 464 212 47 ----21664 1314
NM_032160chr1864163 3965 3536 3330 3126 1634 --44170 3378 512 122 13051
NM_032175chr531866 1849 1513 11638 --2623 314
NM_032189chr1384762 4721 4355 4339 1938 1930 1508 159 22018 1300 11838 --
NM_032208chr242768 2361 1363 723 23537 2292 --12512
NM_032228chr1172859 2733 2419 2270 1118 909 659 --32365 1333 379 --
NM_032288chr362354 2278 1918 869 667 99 22335 1783 22167 326 1882
NM_032352chr1431456 1312 79 1976 11093 1507
NM_032373chr10135711 5602 5224 4810 4229 3836 3721 3706 2373 2186 1455 1319 867 13641 --1467
NM_032435chr162268 2245 1731 744 736 712 --11822 1858
NM_032440chr1082712 1819 1142 965 823 625 558 462 --32767 2226 61 12365
NM_032446chr583671 3483 3137 3043 2931 784 493 105 11060 1178 --
NM_032457chr463847 3686 2463 2446 1411 1136 12991 23632 1278 --
NM_032458chrX63435 3281 2635 1286 1247 253 ----12610
NM_032505chr362333 1906 889 707 473 324 12277 12684 22327 1976
NM_032778chr353163 2125 1204 603 240 22488 284 42833 2801 2041 962 --
NM_032859chr1393770 3520 3363 2931 1579 1227 1143 268 228 42706 2519 1263 743 23781 1462 11598
NM_032873chr11104378 4369 4167 3830 3375 3198 2847 1253 757 112 43046 3020 1240 180 13819 --
NM_032968chrX84061 3551 3305 3189 3032 1614 1341 199 23164 188 23362 1021 1425
NM_032969chrX84061 3551 3305 3189 3032 1614 1341 199 23164 188 23362 1021 1425
NM_032973chrY94053 3547 3300 3184 3027 2926 1613 1341 199 23159 188 23357 1021 1425
NM_032975chr1883605 3471 3149 2920 1424 823 786 288 13446 1439 --
NM_032980chr1883605 3471 3149 2920 1424 823 786 288 13446 1439 --
NM_033020chr174721 4626 3632 3253 1816 1796 1107 11631 --21529 713
NM_033030chr261543 1067 609 567 472 392 --2405 206 --
NM_033083chr3103433 3097 3049 1336 1237 1081 880 807 341 145 22803 2729 1258 --
NM_033132chr1362180 2124 2013 1702 775 131 --1136 --
NM_033143chr454417 3271 3155 906 551 21739 1159 13191 1594
NM_033211chr562026 2007 1888 1767 708 30 1447 --11456
NM_033224chr7168065 7948 7260 6274 5800 5534 5152 4927 2283 2179 1803 1779 1182 1007 546 390 27768 733 16171 16367
NM_033285chr863328 3087 2879 1510 784 604 --13108 33620 1247 134
NM_033290chrX83561 1449 1090 793 784 323 239 46 22597 1499 21278 58 1218
NM_033300chr191423 1417 1310 1056 1005 559 499 350 37 2543 492 ----
NM_033326chr1192447 2261 2175 2051 981 949 916 509 223 ------
NM_033360chr1264176 3637 3050 1515 892 655 24167 3665 23976 3337 --
NM_033427chr75844 618 347 159 133 1744 1285 --
NM_033480chr652830 2235 581 281 216 11119 --12592
NM_033481chr652830 2235 581 281 216 11119 --12592
NM_033505chr2106742 6091 6065 6046 5982 5451 1899 1377 906 568 ----14343
NM_033656chr21155959 5145 5122 4816 4770 4671 4621 3635 1909 1481 1366 930 190 105 93 35357 4776 887 11323 --
NM_052811chr1354434 1803 250 172 138 167 24746 2091 24666 4365
NM_052879chr12103897 3254 2640 2626 2498 2488 1029 746 636 444 21039 322 23380 2512 21470 1408
NM_052885chr12214859 4744 4705 4583 4303 4291 3979 3945 3659 3463 3217 3050 1773 1629 1397 1140 991 879 385 205 30 1600 123 34597 4151 763
NM_052904chr671418 1382 1015 980 969 514 403 ----1115
NM_052905chr271913 1764 1555 1494 1228 710 125 ----1205
NM_052937chr851049 986 738 545 449 --1158 21095 776
NM_053064chr14102962 2521 2491 2161 1975 1949 1904 1239 1174 436 1802 12364 12584
NM_057168chr771667 1593 1482 1437 1423 1357 228 21573 679 ----
NM_058241chr262342 2299 2111 1669 392 318 11947 11619 --
NM_058241chr262342 2299 2111 1669 392 318 11947 11619 --
NM_080818chr1351022 980 788 703 111 --168 1227
NM_080872chr863928 2783 2766 1458 1183 100 2533 526 11209 --
NM_080874chr471916 1518 1209 487 336 325 204 --1250 1679
NM_080927chr383316 2747 2698 1302 1253 964 939 306 23286 756 ----
NM_130436chr2142380 2254 2139 1719 --1295 22528 313
NM_130438chr2152957 2831 2716 2296 39 --22114 872 23105 890
NM_130439chr104427 221 158 38 12149 11641 1214
NM_130439chr104427 221 158 38 12149 11641 1214
NM_130809chr573077 2633 2627 2548 1019 759 251 --21034 785 --
NM_130831chr3102920 2580 2017 1980 974 675 592 525 515 266 1844 22430 356 --
NM_130832chr3102920 2580 2017 1980 974 675 592 525 515 266 1844 22430 356 --
NM_130833chr3102920 2580 2017 1980 974 675 592 525 515 266 1844 22430 356 --
NM_130834chr3102920 2580 2017 1980 974 675 592 525 515 266 1844 22430 356 --
NM_130835chr3102920 2580 2017 1980 974 675 592 525 515 266 1844 22430 356 --
NM_130836chr3102920 2580 2017 1980 974 675 592 525 515 266 1844 22430 356 --
NM_130837chr3102920 2580 2017 1980 974 675 592 525 515 266 1844 22430 356 --
NM_133329chr281779 1768 1761 1422 1394 696 605 62 1352 --1239
NM_133334chr4105591 5423 5385 5378 5074 4359 3864 3857 2407 832 --26310 467 13882
NM_133370chr493093 2668 2549 2542 1471 999 691 404 297 --31050 860 626 12649
NM_133474chr451612 1432 1267 639 380 --11097 11541
NM_133493chr6104636 4234 3846 3284 3269 2915 1551 1390 1274 1012 11243 13253 13167
NM_133631chr371653 1571 1487 1468 1386 594 408 11493 192 --
NM_133646chr265283 5139 3412 2228 351 213 13448 --15518
NM_134265chr173834 164 108 ----1252
NM_138270chrX103257 3095 3058 2756 2749 2609 2116 1302 378 353 12993 13249 --
NM_138286chr19134233 3943 3825 3805 3746 3495 1709 1594 924 849 576 309 203 22791 1046 12953 --
NM_138444chr1374960 4869 4514 3919 3786 3410 595 13202 --23173 373
NM_138468chr296302 5895 4347 4223 4086 1678 1179 1000 835 176 15649 21727 271
NM_138494chr7112471 2427 2313 1113 1048 968 776 450 47 36 26 --12486 --
NM_138621chr2103746 2884 2869 2648 1634 1625 686 667 171 48 --13363 --
NM_138694chr663457 3326 3040 2602 2284 254 --13154 12663
NM_138713chr16198006 7154 7012 6841 6568 6559 6445 6060 3217 3108 3072 2823 2616 2456 2392 2371 2209 2180 1622 --25237 1975 15892
NM_138714chr16198006 7154 7012 6841 6568 6559 6445 6060 3217 3108 3072 2823 2616 2456 2392 2371 2209 2180 1622 --25237 1975 15892
NM_138731chr14124251 4011 3629 3516 3497 3231 3204 3193 1273 1255 901 191 22994 935 ----
NM_138782chr542302 1744 811 363 21965 939 2422 218 2856 236
NM_138959chr195696 5096 4480 4199 2515 2017 1771 1469 489 46352 6343 5843 2209 14117 --
NM_139169chr1062264 2196 1886 1523 838 388 1265 22080 409 12005
NM_139182chr441663 1503 1369 715 --1670 11620
NM_139319chr1261409 1352 1183 616 457 302 --11211 1259
NM_139321chr2074096 4013 3962 3454 677 495 479 ----12666
NM_144571chr4116672 6505 6402 5600 5494 5460 5216 4565 1885 1575 741 25294 2727 25749 520 --
NM_144578chr1495512 5492 5290 4019 1664 1438 1189 656 574 23966 214 44182 4052 2016 1548 13510
NM_144599chr15115504 5156 4961 4035 4009 3469 1381 1256 1137 762 311 45217 5149 4260 1328 14408 14685
NM_144600chr1641234 1095 520 59 ----21544 1054
NM_144664chr11102505 2418 2257 2125 2087 1797 1729 706 489 129 2845 405 12175 --
NM_144721chr452708 2175 1877 1098 578 --12720 1995
NM_144778chr1332319 1703 394 1379 12734 12418
NM_144973chr12104817 4625 4503 4415 4340 4095 3630 1616 699 184 15087 ----
NM_145000chr54529 492 467 92 ----1258
NM_145055chr18103866 3726 3369 3072 2979 2964 1456 1148 771 360 ------
NM_145117chr1163337 3310 3204 2896 2611 682 12414 12141 13343
NM_145259chr2126946 6315 4660 2810 2357 2300 1745 1662 1295 999 247 120 36372 2130 1032 --26854 6784
NM_145307chr1074368 3222 3102 814 765 610 424 157 24207 3186 --
NM_145341chr1031243 1237 508 11890 1378 11156
NM_145698chr1071784 1709 1572 846 746 527 72 11838 21789 586 --
NM_145728chr1552347 2158 2089 629 377 1453 --12436
NM_147150chr993762 3342 3054 2702 1565 1549 1308 742 89 --1807 --
NM_147233chr22829 643 ----21882 1668
NM_148955chr15116430 6368 5813 5089 5033 5025 4794 2411 2094 1073 169 14832 25154 2014 14912
NM_152261chr1242042 485 314 269 --12394 12174
NM_152352chr1852658 2652 2646 1967 405 --22964 427 --
NM_152407chr563231 2731 2643 982 116 60 32482 2423 439 12450 13265
NM_152409chr593601 3441 3197 3113 2729 2620 2249 2209 713 12710 33382 3274 2272 --
NM_152414chr851519 1388 1280 1020 469 1475 ----
NM_152415chr83488 219 67 ----1383
NM_152417chr861331 1230 999 535 529 30 1214 --11023
NM_152422chr971881 1239 605 236 179 163 55 11383 ----
NM_152450chr155802 783 753 703 88 1560 --1646
NM_152470chr1843909 3865 3817 829 ----13915
NM_152487chr151293 1229 882 514 469 --21069 107 --
NM_152522chr26976 854 786 425 125 105 1119 ----
NM_152529chr264455 3378 2978 2937 824 50 12812 --12867
NM_152556chr762227 2166 796 736 535 240 --11717 --
NM_152608chr192592 2495 2135 951 938 335 265 234 215 --21027 864 11824
NM_152622chr573397 3061 2460 2136 1054 874 594 12795 --21161 1004
NM_152624chr5127007 6918 6628 5207 4826 2889 2249 2093 1734 1514 1445 1397 26311 5794 22325 217 27393 1594
NM_152629chr983961 3721 2958 2950 2922 2632 891 639 22526 254 13093 --
NM_152641chr1252325 2171 578 417 305 ----11812
NM_152699chr363669 2505 250 243 236 152 --1189 13710
NM_152745chr71342 ----21130 1075
NM_152754chr783651 3329 3257 2989 2458 1129 1080 582 23442 2532 --12858
NM_152756chr594175 3867 3802 3121 3101 2777 2771 1543 43 13144 24068 3077 --
NM_152774chr792397 2242 2103 1932 1793 1756 1050 973 687 ------
NM_152787chrX63730 3616 1297 1067 1044 79 23651 1273 22443 1153 13940
NM_152793chr764886 4636 4487 4455 1004 960 1259 ----
NM_152826chr15116430 6368 5813 5089 5033 5025 4794 2411 2094 1073 169 14832 25154 2014 14912
NM_152836chr8101888 1835 1829 1773 1598 1190 736 477 174 36 246 29 ----
NM_152837chr8101888 1835 1829 1773 1598 1190 736 477 174 36 246 29 ----
NM_152890chr171240 1062 1032 948 220 198 26 --1447 --
NM_152999chr7204984 3889 3855 3654 3597 3586 3251 3241 3218 3170 3132 3116 3104 1585 1174 734 612 411 220 71 --34074 3659 1809 --
NM_153020chr661677 1270 1242 1182 1111 1102 --11204 --
NM_153182chr353163 2125 1204 603 240 22488 284 42833 2801 2041 962 --
NM_153188chr5125640 5309 4976 4737 4587 4167 3891 1874 1731 1420 959 870 --1295 13767
NM_153207chr1274036 3295 1098 739 591 580 147 --22540 136 1476
NM_153223chr551230 625 559 159 145 ------
NM_153235chr642282 2244 1946 204 32325 1934 155 32042 712 48 1618
NM_153262chr183189 2559 2533 2467 610 395 293 110 --1962 --
NM_153367chr1083628 3168 3129 2871 2513 2486 1556 1020 12975 ----
NM_153371chr1362393 2254 1820 1463 854 154 31571 1558 240 ----
NM_153456chr1366269 5098 4573 4172 4012 1182 24895 2492 16153 --
NM_153689chr242182 2023 1977 911 169 130 22200 1577
NM_170665chr1284420 4300 4202 4052 3755 1701 738 456 ------
NM_170725chr15260 232 214 204 198 --1484 --
NM_170731chr1182848 2770 2751 2725 2124 2004 1882 157 22188 1772 22175 82 --
NM_170732chr1182848 2770 2751 2725 2124 2004 1882 157 22188 1772 22175 82 --
NM_170733chr1182848 2770 2751 2725 2124 2004 1882 157 22188 1772 22175 82 --
NM_170734chr1182848 2770 2751 2725 2124 2004 1882 157 22188 1772 22175 82 --
NM_170735chr1182848 2770 2751 2725 2124 2004 1882 157 22188 1772 22175 82 --
NM_170736chr2191370 1322 1154 532 459 422 416 373 308 ------
NM_170737chr2191370 1322 1154 532 459 422 416 373 308 ------
NM_172069chr282076 1583 1564 1543 1505 1452 402 161 1712 ----
NM_172070chr262113 1837 1644 1456 319 271 1285 --21817 1468
NM_172071chr1116591 6137 6062 6030 5233 5126 5026 1744 1615 866 779 22463 238 26803 4545 15617
NM_172103chr642164 1038 637 207 1148 --22404 471
NM_172105chr642164 1038 637 207 1148 --22404 471
NM_172219chr176216 68 55 45 38 28 ------
NM_172220chr176216 68 55 45 38 28 ------
NM_172240chr1241174 916 476 111 ----21188 380
NM_172344chr281779 1768 1761 1422 1394 696 605 62 1352 --1239
NM_173083chr14445 390 242 184 --11260 1204
NM_173214chr16198006 7154 7012 6841 6568 6559 6445 6060 3217 3108 3072 2823 2616 2456 2392 2371 2209 2180 1622 --25237 1975 15892
NM_173468chr4156027 5974 5471 5214 5100 4421 4374 4171 3992 1806 1728 1347 1320 1162 772 11889 25130 4656 24349 1856
NM_173510chr2252867 2752 2382 1787 533 --2696 52 1324
NM_173531chr19103163 2916 2850 2694 2646 1432 1396 1149 1075 654 23015 1263 22868 2754 --
NM_173552chr392303 2289 2269 1772 692 554 534 507 490 2837 105 ----
NM_173582chr11125690 5587 4990 4686 4657 4641 4492 4252 4171 2267 1186 627 14177 1532 --
NM_173595chr1243631 1654 75 51 --24712 547 157
NM_173602chr1273706 3649 3039 2311 1497 992 832 1972 --11503
NM_173607chr1462094 1889 1721 739 553 97 1185 21665 75 --
NM_173642chr1118506 8471 7751 7388 7038 6991 6290 6127 5744 1711 839 --28636 1490 26575 3112
NM_173808chr184311 3590 3507 3436 3268 602 394 304 --1536 24166 3991
NM_173829chr596109 5974 5833 5157 5050 2382 1654 958 713 14250 55777 5440 5221 889 844 --
NM_173851chr882921 1606 847 806 657 576 216 135 1800 22990 140 --
NM_174900chr4------2231 206
NM_174916chr1541951 1719 1559 661 21883 1486 22268 1566 --
NM_175061chr781963 1955 1627 1585 806 564 418 86 --21826 708 --
NM_175623chr1285944 5835 2585 1318 658 585 320 78 27030 2069 --21937 1380
NM_175854chr1382747 2612 2334 2322 1719 830 493 234 ----1987
NM_175861chr12115277 4697 3910 1383 1240 1217 1159 1153 1011 473 121 14558 --1898
NM_175876chr162126 1805 1759 853 62 56 1802 ----
NM_177438chr1474270 4102 2880 1236 1070 284 62 23194 1250 ----
NM_177947chrX81530 1347 1329 1185 1136 1077 139 47 122 --11451
NM_177948chrX81530 1347 1329 1185 1136 1077 139 47 122 --11451
NM_177968chr271867 1746 1467 718 519 502 155 ------
NM_177995chr971881 1239 605 236 179 163 55 11383 ----
NM_178011chr1043293 2164 117 73 ----31098 621 449
NM_178505chr10103614 3608 3169 3065 2632 1423 765 543 436 232 11173 12345 --
NM_178539chr1241591 507 419 225 ----22102 1411
NM_178566chr981845 1774 1740 1692 1421 1291 361 191 --1408 --
NM_178585chr4113312 3196 2886 2666 2658 2638 2537 2409 2037 1234 190 --11227 --
NM_178815chr1082761 2502 2143 779 709 684 640 31 ------
NM_181443chr2062792 2773 2651 2577 2423 1041 1480 --12338
NM_181481chr18126733 6723 6011 4869 2707 2169 1598 1588 1163 1035 607 324 22628 1005 25580 85 --
NM_181482chr18126733 6723 6011 4869 2707 2169 1598 1588 1163 1035 607 324 22628 1005 25580 85 --
NM_181483chr18126733 6723 6011 4869 2707 2169 1598 1588 1163 1035 607 324 22628 1005 25580 85 --
NM_181504chr563977 3913 1131 927 696 35 --12552 1589
NM_181521chr16137198 6097 5890 5746 5716 5051 4876 2300 2243 2225 1997 1193 93 14792 --14473
NM_181523chr563977 3913 1131 927 696 35 --12552 1589
NM_181524chr563977 3913 1131 927 696 35 --12552 1589
NM_181659chr20103296 3255 3110 2925 2842 2487 1070 725 668 227 ------
NM_181659chr20103296 3255 3110 2925 2842 2487 1070 725 668 227 ------
NM_181705chr5155815 5770 5748 5651 5323 5286 5139 4826 4378 3659 2241 1221 688 276 136 --24680 409 1720
NM_181706chr1181789 1582 1467 601 481 197 184 174 11894 ----
NM_181714chr651750 606 331 323 60 21244 75 ----
NM_181782chr682337 1777 926 880 835 800 500 360 22251 428 ----
NM_181787chr883766 3752 3559 2996 1151 983 826 388 --21227 784 1569
NM_181836chr542212 1715 228 215 22616 1055 1463 11814
NM_182503chr675625 5378 4424 3406 2191 1578 637 1558 25300 5128 14841
NM_182515chr1975662 2562 2210 2202 1229 1110 704 25440 4522 36105 5901 2407 12162
NM_182758chr15113952 3402 3325 3311 2581 2532 886 567 429 209 203 1500 ----
NM_182762chr7106260 5601 5008 4873 4500 4338 3934 2289 1316 1251 25356 1786 25744 4428 --
NM_182767chr1261864 1663 1568 796 785 764 1612 ----
NM_182898chr7156501 5770 5504 4968 4670 4371 4357 4331 4067 2082 1883 1106 1085 649 642 34636 4050 1072 14487 15637
NM_182899chr7156501 5770 5504 4968 4670 4371 4357 4331 4067 2082 1883 1106 1085 649 642 34636 4050 1072 14487 15637
NM_182907chr6112439 2399 1978 1962 1551 1522 1510 1482 614 518 241 2868 390 ----
NM_182948chr172419 2365 2243 2088 1040 1034 733 11963 12219 --
NM_182964chr1163337 3310 3204 2896 2611 682 12414 12141 13343
NM_183043chr134875 779 299 49 1654 1791 1748
NM_183044chr134875 779 299 49 1654 1791 1748
NM_183050chr642445 2121 507 190 12018 --12000
NM_194247chr2114494 4324 3948 3796 3658 3466 2940 1207 1041 674 402 24394 4372 1187 --
NM_194282chr472303 2290 2257 1945 1893 601 100 1898 12153 1472
NM_194285chr1153206 804 619 582 240 ----13237
NM_194286chr12115639 4786 4767 4397 4292 2154 2102 2090 2081 671 490 15019 15545 --
NM_194291chr8122829 2331 2154 2078 1215 1119 1083 1041 276 264 117 73 --11070 --
NM_194314chr185649 5326 4945 4463 2137 2037 971 813 --1232 25016 4991
NM_194328chr972369 2199 1192 1143 1114 573 24 ----12876
NM_194329chr972369 2199 1192 1143 1114 573 24 ----12876
NM_194330chr972369 2199 1192 1143 1114 573 24 ----12876
NM_194332chr972369 2199 1192 1143 1114 573 24 ----12876
NM_194434chr1874267 2116 1873 1247 1081 573 415 --11920 34243 394 317
NM_197970chr261543 1067 609 567 472 392 --2405 206 --
NM_198181chr15102441 2256 2173 2119 2091 1906 1867 1135 469 288 1483 11013 --
NM_198240chr1241310 1159 487 322 --1194 1395
NM_198267chr72632 37 ----2774 661
NM_198270chrX43411 2842 1260 611 2731 430 --1333
NM_198273chr583185 2893 2733 2714 2676 2107 493 443 21159 95 31113 813 412 --
NM_198401chr891771 1747 1208 706 621 594 442 359 159 ----11596
NM_198465chrX62982 2923 2807 2508 2190 1895 12172 21052 87 1300
NM_198485chr372333 2222 896 727 568 470 130 21991 123 --11659
NM_198503chr172238 1703 1646 892 606 585 110 ------
NM_198549chr192857 2829 2441 2362 2236 466 426 155 108 --12807 --
NM_198569chr672468 2269 2250 2219 2038 1888 676 22303 149 11728 --
NM_198578chr1271486 1290 1195 498 194 74 59 1917 ----
NM_198581chr2147205 5469 5459 5146 5014 2619 2510 2198 2064 1146 1132 1062 828 89 26986 2440 12073 --
NM_198715chr1195832 5314 5296 5172 4986 3911 1996 1982 1913 1785 1290 1009 934 828 524 508 499 392 70 --11790 --
NM_198793chr3113917 3624 3159 3029 1529 852 702 665 348 183 166 ----12776
NM_198794chr1491314 1167 1091 1049 1015 917 476 465 348 --11321 --
NM_198859chr384681 3985 3742 3465 3459 1823 631 400 13768 13113 --
NM_198896chr1172187 1393 1358 813 612 362 197 ----21808 1457
NM_198935chr2093128 2489 2463 2041 2035 1245 906 865 42 ------
NM_198968chr13123777 3489 2750 2673 2523 1548 1533 1521 942 899 717 533 --11538 --
NM_198990chr7113105 2936 2848 2747 2417 2260 2114 1268 1173 1150 174 11041 1256 --
NM_199003chr841362 1274 572 196 21466 400 --11298
NM_199072chr7123119 2528 2522 2417 2265 2102 1163 1130 944 852 394 360 --11065 11145
NM_199188chr12103897 3254 2640 2626 2498 2488 1029 746 636 444 21039 322 23380 2512 21470 1408
NM_199190chr12103897 3254 2640 2626 2498 2488 1029 746 636 444 21039 322 23380 2512 21470 1408
NM_199320chr472862 2835 2733 2173 1881 643 465 1128 12907 --
NM_199320chr472862 2835 2733 2173 1881 643 465 1128 12907 --
NM_199324chr483022 2997 2855 1248 1177 661 602 310 1210 ----
NM_199482chr272002 1801 1378 1297 795 181 166 ----11348
NM_201278chr1182138 2089 1881 846 773 601 120 108 21997 84 ----
NM_201281chr1182138 2089 1881 846 773 601 120 108 21997 84 ----
NM_203391chrX61826 1748 1353 550 110 91 1316 ----
NM_203394chr1262656 2502 2293 862 505 481 11898 32613 2120 871 --
NM_203403chr971272 1222 1023 999 922 209 45 ------
NM_203406chr582732 2380 2200 2178 2008 536 407 60 12714 31785 1114 1047 --
NM_203446chr2162934 2810 2373 1202 159 116 1342 --21093 593
NM_203458chr183172 2834 2705 2340 1393 960 938 820 12362 ----
NM_203459chr182460 2453 2383 1870 942 626 619 607 1790 --1968
NM_203463chr2103981 3379 3076 1695 1328 789 564 448 258 56 13297 14881 --
NM_203504chr472377 2313 2243 2147 732 294 42 --11762 --
NM_203505chr472377 2313 2243 2147 732 294 42 --11762 --
NM_206594chr1113553 3294 3184 3116 2835 2712 2645 1443 1221 912 127 33619 2566 2524 ----
NM_206595chr1113553 3294 3184 3116 2835 2712 2645 1443 1221 912 127 33619 2566 2524 ----
NM_206854chr6104992 4552 4507 4441 3760 3491 3310 1669 1088 279 --13331 --
NM_206855chr6105957 5517 5472 5406 4725 4456 4275 2053 1244 195 1816 14296 1171
NM_206866chr21103203 2728 2684 2650 2586 2571 2240 1006 886 601 --11216 1291
NM_206876chr252959 2862 2826 2239 1054 12458 --12672
NM_206907chr573328 2473 2193 2125 1114 367 199 23358 1247 1281 1902
NM_206909chr898164 7733 6196 5583 2185 1695 1683 1340 83 36239 5672 2230 17518 --
NM_207303chr1094103 3729 3585 3374 2985 2879 2752 517 164 23768 3762 12851 --
NM_207304chr1322206 281 1266 12621 12305
NM_207361chr1396230 6033 3949 2453 2299 1273 1239 958 659 34159 3935 1072 33919 1863 1738 --
NM_207517chr1541856 1747 1254 210 11997 22021 1375 1742
NM_207578chr12270 264 ----1589
NM_212471chr1772112 1755 1639 745 630 576 259 1867 11903 1393
NM_212472chr1772112 1755 1639 745 630 576 259 1867 11903 1393
NM_213589chr2145231 5056 4304 2114 1913 1890 1831 1292 753 650 413 384 241 75 14597 25416 108 2375 84
NM_213590chr1354434 1803 250 172 138 167 24746 2091 24666 4365
NM_213606chr1062712 2278 1720 1031 809 144 ----12682
NM_213651chr181791 1657 1650 1259 1227 587 378 181 ------