TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4431
miRNA Sequence: GCGACUCUGAAAACUAGAAGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000618chr1276237 5781 1982 1408 935 759 208 ------
NM_000618chr1276237 5781 1982 1408 935 759 208 ------
NM_000809chr479071 6809 2991 1230 1105 880 148 ----17332
NM_001010891chr5116455 6345 6190 6062 5685 5104 2521 2374 1518 1408 695 14708 ----
NM_001017395chr373405 3261 3071 1349 1274 884 57 ----1107
NM_001037165chr7148775 8219 7644 7522 7003 6430 5697 2740 2639 1861 1738 1717 1344 993 15488 ----
NM_001204chr247633 5484 2270 259 ----16579
NM_001699chr1951478 1158 436 287 271 ----11121
NM_001939chrX73579 3316 3061 2741 2534 789 782 ----12455
NM_002481chr167726 7297 5827 5634 1498 1330 --27124 6156 17118
NM_003108chr297279 6898 6599 5183 2444 2373 776 528 321 16112 ----
NM_003679chr132955 1272 928 --1902 12387
NM_003774chr1243323 3180 2920 231 ----12857
NM_004171chr1198765 6797 6506 6146 3699 1960 1884 1248 807 ----12750
NM_005160chr22115554 5215 5187 4265 1897 1490 1472 1448 122 44 21 1789 ----
NM_005188chr11108001 7358 7252 6568 6107 6057 5890 1526 952 42 11971 ----
NM_005665chr123601 942 ----23786 2992
NM_005668chr554445 4249 4237 4104 202 --23807 3748 13121
NM_005759chr244012 3925 1717 1311 14643 24626 4079 13329
NM_006420chr2062676 884 653 627 224 97 11148 1547 --
NM_012382chr544308 4124 3965 2970 12978 ----
NM_014877chr17127526 7238 7020 5927 5829 5728 5434 4926 3073 2279 2270 621 ------
NM_014946chr232695 570 113 ----11949
NM_015008chr373405 3261 3071 1349 1274 884 57 ----1107
NM_015436chr453224 2083 1294 755 162 ----1101
NM_015458chr885212 4643 4560 1899 968 828 658 400 ------
NM_020810chr1443556 1372 608 600 ----1815
NM_020909chr2114148 4003 3554 3511 3468 3262 3154 3130 3115 2937 569 12596 ----
NM_021913chr1951478 1158 436 287 271 ----11121
NM_030806chr199357 6470 5708 3714 2863 1849 1528 1472 1212 --29464 2871 15719
NM_138468chr256115 5826 4517 2511 258 22413 327 --15413
NM_172071chr1117375 7024 6085 5850 5792 5085 4784 2218 2121 1581 1420 ------
NM_174902chr1151220 1155 1149 1143 537 ------
NM_181521chr16106753 5167 5066 1835 1639 1596 1590 1109 962 176 ------
NM_182757chr683319 2949 2602 2308 2168 814 649 391 12284 1671 --
NM_194314chr11763 14404 11313 13942
NM_198581chr297127 6449 6072 5490 4861 4701 2026 1574 878 ----12892
NM_199436chr232695 570 113 ----11949
NM_207406chr4126266 6217 6135 5981 5839 5713 2064 1205 976 388 81 44 ----15452