TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4432
miRNA Sequence: AAAGACUCUGCAAGAUGCCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX22526 2367 21221 486 11029 12178
NM_000081chr121697 603 2240 70 ----
NM_000084chrX45337 5155 1992 876 25199 1434 ----
NM_000088chr1721284 172 ------
NM_000093chr932507 1956 837 12430 --1577
NM_000096chr3----1952 --
NM_000109chrX22331 161 12589 1666 --
NM_000112chr5135257 4962 4743 4415 4204 1960 1770 1648 922 884 540 516 502 11128 13834 --
NM_000141chr1011205 ------
NM_000142chr411448 --11306 11363
NM_000153chr1431500 1163 1135 --21640 1344 --
NM_000165chr641581 1352 1343 432 11715 ----
NM_000168chr742849 2537 681 212 12029 ----
NM_000176chr533721 3376 1300 ------
NM_000194chrX2457 22 ------
NM_000217chr1265299 5161 4798 4319 2119 764 ------
NM_000222chr421543 620 --11845 --
NM_000232chr443187 3100 540 80 1773 12307 --
NM_000242chr1032192 1967 1056 22631 2205 ----
NM_000248chr362209 1081 1005 735 708 525 11981 ----
NM_000251chr2--158 ----
NM_000259chr15106018 5994 2481 2254 1688 1594 1438 1380 340 242 1731 24989 4564 --
NM_000264chr962755 2669 2577 2549 2521 1022 22234 333 --13122
NM_000267chr1732892 2468 2320 ------
NM_000272chr211270 ------
NM_000280chr1111011 ----2906 405
NM_000297chr452008 1596 1312 348 109 --1288 --
NM_000302chr13707 489 444 ------
NM_000314chr1042783 2565 1223 1002 1298 ----
NM_000325chr4--1547 ----
NM_000327chr111268 ------
NM_000328chrX4373 302 150 94 ------
NM_000332chr6137024 6614 6405 6125 5987 5217 2803 1953 1708 1574 1546 972 424 35748 2034 1741 11793 --
NM_000333chr34914 790 286 96 ------
NM_000346chr1731669 1277 680 11738 ----
NM_000368chr964801 4332 1521 1008 353 93 14551 13033 12970
NM_000390chrX43418 2701 2245 57 42682 2299 1082 318 ----
NM_000393chr21495 2196 138 12007 --
NM_000439chr5102535 2520 2381 2211 2202 1708 1623 956 748 721 ------
NM_000441chr752162 2064 1963 916 381 1775 --22256 515
NM_000447chr1--166 ----
NM_000448chr1173226 2690 2521 840 678 369 41 22356 870 12758 12369
NM_000450chr131378 455 85 ----11762
NM_000459chr91869 1848 ----
NM_000489chrX42878 2238 1155 628 33460 1234 135 ----
NM_000492chr71128 11076 1182 --
NM_000503chr841709 1465 1203 134 1665 11555 --
NM_000509chr4--1148 ----
NM_000555chrX117247 5892 5136 4931 4786 1395 1388 1174 678 338 105 16158 ----
NM_000587chr521100 978 --11131 --
NM_000589chr5----121 --
NM_000618chr1265782 5317 4435 2325 1983 936 --15672 --
NM_000618chr1265782 5317 4435 2325 1983 936 --15672 --
NM_000633chr1874918 4820 4083 3250 1961 1375 176 24457 4311 ----
NM_000718chr9------162
NM_000719chr1275519 5440 4977 1990 1797 1161 1076 26486 5450 --1956
NM_000724chr104490 84 76 43 ----1652
NM_000739chr7--177 ----
NM_000788chr41103 1506 ----
NM_000807chr41681 ------
NM_000809chr468112 7446 7409 5715 3221 881 13401 49157 6811 1288 1232 --
NM_000813chr534498 4122 3632 24955 3405 ----
NM_000814chr1554116 3464 2795 313 70 ------
NM_000826chr42915 413 11895 11961 --
NM_000828chrX22001 1871 12172 ----
NM_000840chr73407 370 180 ------
NM_000859chr521351 319 ------
NM_000875chr1536658 5954 806 --36755 2447 2194 21157 75
NM_000876chr6----1128 --
NM_000880chr8174 ------
NM_000891chr1753629 3128 2857 885 435 ------
NM_000895chr121101 ------
NM_000899chr1284196 3785 3741 3102 2934 1496 592 269 13322 ----
NM_000901chr442207 1603 694 562 21588 316 12022 --
NM_000917chr103910 247 83 2316 69 ----
NM_000919chr51177 ------
NM_000945chr232024 1383 614 1469 11577 --
NM_000950chrX63269 3062 2998 2270 946 148 12654 23618 231 --
NM_000958chr521163 902 1992 11205 --
NM_000963chr13898 347 211 --1246 --
NM_000965chr341284 863 135 91 ------
NM_000975chr1137 ------
NM_001001132chr21--2954 330 ----
NM_001001323chr1252987 2447 2285 1257 73 12145 1347 12603
NM_001001330chr102526 504 ------
NM_001001395chr1222732 605 1335 11871 --
NM_001001396chr154085 3535 2942 2844 1168 13411 23287 3272 14414
NM_001001419chr551785 1370 870 579 383 21090 516 13994 --
NM_001001420chr551785 1370 870 579 383 21090 516 13994 --
NM_001001433chr201307 1672 ----
NM_001001481chr852892 1234 1048 382 71 13358 12203 --
NM_001001484chr10----11552 --
NM_001001521chr21131 ------
NM_001001549chr742466 2138 2112 1812 --1485 --
NM_001001550chr742466 2138 2112 1812 --1485 --
NM_001001555chr742466 2138 2112 1812 --1485 --
NM_001001557chr82685 518 11650 12082 --
NM_001001664chr223927 3855 13898 ----
NM_001001715chr133458 407 196 ------
NM_001001872chr14--1602 ----
NM_001001928chr2258335 7745 6679 1489 1015 11405 28204 1387 --
NM_001001933chr11605 ------
NM_001001937chr18137 ------
NM_001001971chr10182 ------
NM_001001974chr1042406 2136 1537 763 11511 ----
NM_001002257chr233528 1358 1215 33499 1385 1105 ----
NM_001002759chr10190 2525 494 ----
NM_001002838chrX31435 608 113 11503 --1482
NM_001002843chr1521284 207 ------
NM_001002860chr1433082 3056 128 --21575 1484 --
NM_001002901chr12450 324 ------
NM_001002926chr742046 705 533 25 ------
NM_001003396chr6129 ------
NM_001003397chr6129 ------
NM_001003407chr1083969 3792 3543 3480 3280 1780 1551 456 ----13824
NM_001003408chr1083969 3792 3543 3480 3280 1780 1551 456 ----13824
NM_001003652chr18108690 7563 6633 6305 6149 3431 3163 3132 1791 1326 16073 27429 6545 --
NM_001003681chr2212031 11654 ----
NM_001003688chr42969 959 --1435 --
NM_001003712chr1273845 3790 3506 3449 628 318 77 23092 434 ----
NM_001003792chr351131 980 957 186 164 ------
NM_001003793chr351131 980 957 186 164 ------
NM_001004051chrX2313 241 ------
NM_001004065chr953413 2735 2606 1557 1523 --24009 3047 --
NM_001004106chr52170 66 ------
NM_001004127chr1311015 ------
NM_001004317chr643361 3160 3009 254 43670 3535 2919 413 1434 --
NM_001004342chr196020 5157 5090 5052 4675 1902 1863 1274 959 16081 24123 526 16070
NM_001004346chr4--1156 --1187
NM_001004360chr231828 1767 250 --11924 --
NM_001004441chr51363 --1670 1641
NM_001005266chr151652 138 ----
NM_001005267chr151652 138 ----
NM_001005268chr151652 138 ----
NM_001005269chr151652 138 ----
NM_001005375chrY71597 1508 1463 1201 1174 418 150 2623 232 ----
NM_001005386chr241553 603 326 188 32345 1607 130 ----
NM_001005404chr1784529 3776 3652 3300 1408 1151 1130 238 ------
NM_001005473chr595953 4632 4222 1435 1351 1182 472 275 98 44446 4306 4058 2317 14041 --
NM_001005474chr321391 1025 11304 ----
NM_001005732chr21----1556 --
NM_001005733chr21----1513 --
NM_001005743chr141862 --21128 1084 --
NM_001005744chr141862 --21128 1084 --
NM_001005745chr141862 --21128 1084 --
NM_001005753chr232269 921 638 ------
NM_001005782chr21400 ------
NM_001005845chr841884 1860 1610 31 1627 1721 --
NM_001005849chr172558 115 ------
NM_001006600chr532387 2137 762 21790 960 ----
NM_001006612chrX--1453 ----
NM_001006613chrX--1453 ----
NM_001006614chrX--1453 ----
NM_001006618chr91198 ------
NM_001006626chr7--177 ----
NM_001006627chr7--177 ----
NM_001006628chr7--177 ----
NM_001006629chr7--177 ----
NM_001006630chr7--177 ----
NM_001006631chr7--177 ----
NM_001006632chr7--177 ----
NM_001006656chr1941713 1707 537 521 11266 ----
NM_001006946chr21733 ------
NM_001007024chr1774300 4065 3265 3038 2917 2896 642 1337 1290 --
NM_001007025chr1774300 4065 3265 3038 2917 2896 642 1337 1290 --
NM_001007075chr411025 ------
NM_001007099chr13807 703 263 ------
NM_001007100chr13807 703 263 ------
NM_001007214chr14713 620 404 277 1733 ----
NM_001007226chr1741185 1148 1115 241 ----1391
NM_001007227chr1741185 1148 1115 241 ----1391
NM_001007228chr1741185 1148 1115 241 ----1391
NM_001007229chr1741185 1148 1115 241 ----1391
NM_001007230chr1741185 1148 1115 241 ----1391
NM_001007245chr7179 ------
NM_001007267chr21842 1656 ----
NM_001007278chr1394907 4331 3908 3816 2076 2016 946 595 24 23336 1993 1389 --
NM_001007466chr674764 4246 4109 2012 1872 993 146 23257 1597 ----
NM_001007468chr221299 ------
NM_001007471chr9167 ------
NM_001007553chr121197 992 21235 135 ----
NM_001007559chr1841536 703 667 105 --11643 --
NM_001007794chr1--2723 696 ----
NM_001008239chr1873734 3667 1449 1106 576 556 345 33191 2692 1098 ----
NM_001008391chr113290 119 56 ------
NM_001008405chr771798 1746 1585 655 375 283 127 182 ----
NM_001008408chr7125804 5777 5168 4947 4857 2001 1500 1188 1044 736 377 248 --1437 --
NM_001008495chr851868 1617 1535 435 121 21445 394 ----
NM_001008540chr24484 444 136 96 ------
NM_001008541chr1011794 11584 ----
NM_001008541chr1011794 11584 ----
NM_001008564chr1352198 874 585 109 55 ------
NM_001008660chr1131367 1255 1130 ------
NM_001008738chr562695 2017 1827 448 391 303 --22498 2371 --
NM_001008801chr1941403 799 548 194 --11486 --
NM_001008925chr473222 901 741 729 567 427 344 12434 13122 --
NM_001008938chr111365 --1456 --
NM_001009881chr11237 ------
NM_001009882chr11237 ------
NM_001009894chr1221220 574 11568 11352 --
NM_001009899chr3155861 5255 4585 4077 2520 2190 2022 1544 1353 1165 893 855 685 490 119 --1813 --
NM_001009993chr264565 3684 2895 1423 668 552 2436 192 ----
NM_001010000chr1823263 3039 13338 ----
NM_001010853chr662990 2882 2649 2494 2235 938 12320 --1981
NM_001010854chr141657 --1277 --
NM_001010861chr1------12196
NM_001010867chr1166357 6271 6052 5468 5365 5165 4891 4721 2298 1687 1592 1256 1061 924 509 419 --35022 2007 72 --
NM_001010877chr61175 ------
NM_001010888chrX44500 4149 1369 1296 24441 1128 33885 719 377 --
NM_001010891chr5156669 6346 6063 5960 5924 5686 5112 2715 2522 2375 2364 1470 916 662 389 44474 2104 1445 729 25106 1410 16498
NM_001010895chr92279 43 ----1667
NM_001010908chr102663 33 ------
NM_001010984chr152456 1752 1683 759 86 12006 ----
NM_001010986chrX12428 ------
NM_001010989chr16--1576 1100 --
NM_001010990chr16--1576 1100 --
NM_001011513chr463842 3615 2528 1107 600 504 13907 196 --
NM_001011553chr7--197 ----
NM_001011663chr102434 314 1916 ----
NM_001011666chr785937 5861 4304 2015 1356 605 445 240 12051 15413 --
NM_001011708chr232581 2205 1849 --1576 --
NM_001011713chr1441066 614 412 372 1444 ----
NM_001011885chr1511346 --21812 496 --
NM_001012398chr16--1839 ----
NM_001012420chr1552817 2312 2290 267 175 ------
NM_001012423chr1562817 2312 2290 1026 267 175 ------
NM_001012456chr7----122 --
NM_001012614chr41269 ------
NM_001012751chr1041931 1650 634 566 ------
NM_001012754chr1311488 1179 --11970
NM_001012755chrX84697 4665 3361 1899 1817 1373 1206 769 14925 13726 13915
NM_001012761chr541065 816 741 726 --12612 --
NM_001012977chrX21365 1113 ------
NM_001012979chrX----1242 --
NM_001013031chr1063321 3177 2821 976 858 432 ------
NM_001013399chr61149 ------
NM_001013406chr711291 1481 150 --
NM_001013415chr411289 21249 1209 ----
NM_001013620chr1267237 6806 6431 2381 1608 129 17935 16396 12369
NM_001013703chr152451 183 ------
NM_001014286chr13165 ------
NM_001014380chr13105144 4028 3671 1822 1320 1008 788 519 341 181 25170 1796 35465 4199 2272 --
NM_001014434chr13248 173 24 --1269 --
NM_001014446chr4128 ------
NM_001014797chr10107279 7179 7152 7048 6828 6467 5079 1496 1035 768 11109 22873 1156 15407
NM_001014809chr42874 862 189 ----
NM_001014831chr191166 1801 ----
NM_001014832chr191166 1801 ----
NM_001014834chr191166 1801 ----
NM_001014835chr191166 1801 ----
NM_001015508chr83575 560 207 ------
NM_001015877chrX42933 2604 899 183 22728 2339 ----
NM_001017395chr373183 2664 2342 2292 994 194 86 --33073 1351 886 --
NM_001017523chr1231401 531 199 ------
NM_001017922chr1--11731 ----
NM_001017926chr8----11603 --
NM_001017930chrX41444 1329 1217 279 1977 ----
NM_001017961chr1187 ------
NM_001017962chr103910 247 83 2316 69 ----
NM_001017969chr92580 24 ------
NM_001017977chr1----1113 --
NM_001017999chr122166 734 ------
NM_001017999chr122166 734 ------
NM_001018000chr122166 734 ------
NM_001018000chr122166 734 ------
NM_001018001chr122166 734 ------
NM_001018004chr152510 236 ----2681 455
NM_001018006chr152510 236 ----2681 455
NM_001018007chr152510 236 ----2681 455
NM_001018020chr152510 236 ----2681 455
NM_001018053chr13602 443 266 --21628 518 --
NM_001018064chr921317 518 ------
NM_001018065chr975382 4656 4633 3912 3870 1792 306 --25349 5052 --
NM_001018066chr975382 4656 4633 3912 3870 1792 306 --25349 5052 --
NM_001018067chr155252 3973 1346 751 201 43246 1474 846 541 ----
NM_001018068chr155252 3973 1346 751 201 43246 1474 846 541 ----
NM_001018069chr155252 3973 1346 751 201 43246 1474 846 541 ----
NM_001018072chr1231401 531 199 ------
NM_001018074chr533721 3376 1300 ------
NM_001018075chr533721 3376 1300 ------
NM_001018076chr533721 3376 1300 ------
NM_001018077chr533721 3376 1300 ------
NM_001018111chr783917 3844 3661 3586 3108 3062 2573 550 --11173 --
NM_001018113chrX1128 ------
NM_001018115chr32602 66 --1446 --
NM_001023567chr1532209 267 175 --11735 --
NM_001024094chr533721 3376 1300 ------
NM_001024218chr14183 ------
NM_001024226chr121139 183 ------
NM_001024227chr121139 183 ------
NM_001024228chr121139 183 ------
NM_001024463chr15--1309 ----
NM_001024649chr552706 2456 2445 408 319 ------
NM_001024660chr331427 630 157 --1508 --
NM_001024688chr841542 1391 753 664 31824 705 546 ----
NM_001024847chr322124 1538 22338 1580 ----
NM_001024947chr51810 11057 ----
NM_001024948chr121246 599 23075 2413 ----
NM_001025076chr10146182 5577 5461 4290 4242 3910 3817 2209 1496 1424 1254 966 548 521 11722 --1825
NM_001025077chr10167540 6935 6819 5648 5600 5268 5175 4634 2854 2782 2612 2324 1906 1879 1321 667 ----12183
NM_001025079chr353435 2638 997 238 164 24186 3306 12816 14173
NM_001025108chr2104124 3935 3017 2915 2743 2695 1444 1330 945 834 --11265 --
NM_001025233chr122278 134 22033 836 --11793
NM_001025252chr833189 2401 601 ------
NM_001025253chr833189 2401 601 ------
NM_001025266chr384306 3929 3738 3493 3354 1604 520 199 34816 4298 1017 ----
NM_001025366chr621815 658 ----1315
NM_001025366chr621815 658 ----1315
NM_001025367chr621815 658 ----1315
NM_001025367chr621815 658 ----1315
NM_001025368chr621815 658 ----1315
NM_001025368chr621815 658 ----1315
NM_001025369chr621831 674 ----1331
NM_001025369chr621831 674 ----1331
NM_001025370chr621815 658 ----1315
NM_001025370chr621815 658 ----1315
NM_001025580chrX74280 4243 2995 1385 496 460 428 --1589 11227
NM_001025595chr421330 1092 ------
NM_001025616chr441446 640 290 233 1569 11325 --
NM_001025777chr23438 64 45 11517 21274 301 --
NM_001029835chr71327 ------
NM_001029863chr652835 2528 2056 385 141 12240 ----
NM_001029875chr552417 2342 933 550 414 ------
NM_001029882chr1--1278 ----
NM_001029882chr1--1278 ----
NM_001030007chr1643201 2928 2465 658 33922 2890 1253 ----
NM_001030055chr1464376 4125 3934 2989 1439 790 14576 24046 3976 11821
NM_001030272chr11------160
NM_001030273chr11------160
NM_001031623chr631214 428 65 ------
NM_001031679chr1282846 2824 2492 1375 552 333 296 109 12310 ----
NM_001031695chr22104869 4520 1598 1402 1256 1147 674 502 494 486 --11419 --
NM_001031700chr442106 2074 1785 296 ----1704
NM_001031710chr73932 83 69 ------
NM_001031716chr24335 317 178 28 1996 ----
NM_001031732chr463228 2681 2375 1075 1023 550 11381 11276 --
NM_001031748chr121556 --1233 --
NM_001031803chr172307 231 ------
NM_001031804chr1681718 1640 1490 1113 850 625 219 125 13580 1822 --
NM_001031812chr542369 2176 1811 212 11972 ----
NM_001032280chr631467 598 161 11725 ----
NM_001032282chr82504 444 11258 ----
NM_001032296chr1352137 2048 1935 559 158 12739 11907 --
NM_001032380chr10----21801 1243 --
NM_001032393chrX1202 ------
NM_001032394chr6--1132 11129 --
NM_001033057chr322121 452 2620 486 ----
NM_001033059chr631986 1687 543 ------
NM_001033112chr55784 750 650 131 121 ------
NM_001033503chr52463 378 ------
NM_001033507chr121787 1423 --1115 1215
NM_001033557chr21248 21251 113 1396 --
NM_001033578chr812233 11598 ----
NM_001033602chr135824 809 768 450 310 1698 11820 --
NM_001033659chr1731474 1031 530 1356 ----
NM_001033756chr631749 704 592 ----1249
NM_001033756chr631749 704 592 ----1249
NM_001033925chr1041803 1404 578 185 21847 1682 ----
NM_001034841chr16104982 4232 4208 4042 3832 3779 1961 1219 1144 417 11182 14397 --
NM_001034850chr531141 671 345 --11420 --
NM_001034915chr81352 1346 11532 --
NM_001034954chr1052963 2821 2253 2211 852 ------
NM_001034955chr1052963 2821 2253 2211 852 ------
NM_001034956chr1052963 2821 2253 2211 852 ------
NM_001034957chr1052963 2821 2253 2211 852 ------
NM_001035chr121060 1021 --1309 --
NM_001037131chr21483 ------
NM_001037164chr732014 1475 655 1687 ----
NM_001037165chr7128918 8776 8220 7863 7560 7308 7196 7004 6001 5698 1401 574 --48330 7646 7524 2742 --
NM_001037172chr3170 2996 884 ----
NM_001037317chr1------12196
NM_001037339chr161346 1250 1195 538 456 131 ------
NM_001037340chr161346 1250 1195 538 456 131 ------
NM_001037341chr161346 1250 1195 538 456 131 ------
NM_001037341chr161346 1250 1195 538 456 131 ------
NM_001037637chr5--1267 ----
NM_001037954chr1132877 2619 715 13471 ----
NM_001038493chr2--11496 ----
NM_001039199chr2074293 3539 3041 1652 678 457 90 13969 ----
NM_001039348chr21230 1850 1410 --
NM_001039349chr21230 1850 1410 --
NM_001039350chr71150 ----1562
NM_001039459chr731108 1037 999 --1988 --
NM_001039538chr283211 2879 2778 2300 1453 1084 475 437 12258 13357 --
NM_001039547chr367324 6595 5998 5870 5127 1828 27039 600 11805 --
NM_001039580chr413083 13250 --14194
NM_001039590chrX103718 3631 3566 3421 2939 2849 2810 1202 1002 126 ------
NM_001039591chrX103718 3631 3566 3421 2939 2849 2810 1202 1002 126 ------
NM_001039618chr1164917 4659 3663 2358 1648 801 ----25637 2157
NM_001039693chr2104013 3985 3683 3656 2774 1621 1469 942 697 606 ------
NM_001039762chr1042010 772 51 21 ------
NM_001039840chrX35337 4291 2263 ------
NM_001039937chr1333121 1108 715 ------
NM_001040001chr631918 255 70 ------
NM_001040059chr172593 208 ------
NM_001040101chr411224 ------
NM_001040102chr1022220 635 --11717 --
NM_001040103chr1022220 635 --11717 --
NM_001040110chr731383 496 110 ------
NM_001040135chr72706 538 ------
NM_001040142chr231921 1898 614 --11532 --
NM_001040143chr231921 1898 614 --11532 --
NM_001040147chr186701 619 589 471 105 73 ------
NM_001040153chr131245 --1320 --
NM_001040158chr51111 ------
NM_001040159chr42273 250 --1191 1406
NM_001040214chr642064 1533 835 97 ------
NM_001040260chr411023 ------
NM_001040261chr411023 ------
NM_001040284chr16125390 5382 5321 4923 4421 4309 2310 2127 1630 1446 1241 942 ------
NM_001040402chr4144 ------
NM_001040409chr22961 687 ------
NM_001040441chr164835 2161 1707 852 492 81 ------
NM_001040446chr562593 2574 1703 917 840 682 ------
NM_001040450chr151197 1608 1745 11783
NM_001040453chr151197 1608 1745 11783
NM_001040458chr531790 760 159 ----1656
NM_001040633chr71269 ------
NM_001040708chr81203 --1967 --
NM_001040712chr952331 1001 781 505 56 12731 ----
NM_001040876chr431238 495 267 ------
NM_001042355chr1664871 4256 4010 546 487 452 25083 3453 ----
NM_001042403chr121401 --1877 1200
NM_001042412chr1664871 4256 4010 546 487 452 25083 3453 ----
NM_001042413chr953668 3043 2708 2698 774 14109 12569 --
NM_001042414chr131117 ------
NM_001042425chr631467 598 161 11725 ----
NM_001042453chrX41342 1218 501 347 ------
NM_001042473chr101577 12023 1631 --
NM_001042481chr1422080 753 ------
NM_001042492chr1732892 2468 2320 ------
NM_001042494chr1553871 2466 2388 1330 234 12951 --13290
NM_001042495chr1553871 2466 2388 1330 234 12951 --13290
NM_001042496chr1553871 2466 2388 1330 234 12951 --13290
NM_001042497chr1553871 2466 2388 1330 234 12951 --13290
NM_001042510chr831753 1703 1639 ------
NM_001042511chr831753 1703 1639 ------
NM_001042517chr131904 1106 ----
NM_001042533chr333299 2103 644 12523 21143 637 --
NM_001042537chrX31757 942 189 1265 ----
NM_001042555chr1284340 1448 1380 931 919 851 775 41 11643 ----
NM_001042599chr264984 3094 2300 1685 103 77 ----15993
NM_001042601chr342892 2798 835 102 ------
NM_001042603chr1264021 2137 1733 1269 764 750 --15145 --
NM_001042604chr394841 4133 3739 3485 3328 3118 1407 1195 598 33964 2953 1340 1551 --
NM_001042632chr2022049 192 --22305 2208 --
NM_001042633chr2022049 192 --22305 2208 --
NM_001042669chr441446 640 290 233 1569 11325 --
NM_001042683chr62749 398 2359 76 --11175
NM_001042749chrX31469 215 158 ------
NM_001042750chrX31469 215 158 ------
NM_001042751chrX31469 215 158 ------
NM_001042762chr74685 245 171 41 ------
NM_001043351chr132244 1971 596 11731 ----
NM_001044305chr61279 ------
NM_001044722chr542369 2176 1811 212 11972 ----
NM_001044723chr542369 2176 1811 212 11972 ----
NM_001046chr532717 2315 250 11080 ----
NM_001048183chr173769 2960 2899 2583 2316 684 481 --1246 1168
NM_001083620chr42914 412 11893 11959 --
NM_001099678chr3106180 5698 4331 2126 2111 1846 1655 258 246 119 16158 ----
NM_001100108chr1107161 6554 6127 5191 5096 2908 1945 1512 1017 790 17923 21977 1666 --
NM_001106chr3179703 9157 8807 8719 8637 7638 7535 6784 3054 2710 2265 2107 2060 1701 1090 475 197 49773 8979 8865 6990 26731 6163 18294
NM_001113490chrX43414 2875 2605 938 11391 1535 --
NM_001117chr1822394 556 12153 12186 --
NM_001121chr10--2520 221 --11177
NM_001126chr13394 323 135 1358 ----
NM_001128chr1643201 2928 2465 658 33922 2890 1253 ----
NM_001144chr1611258 21108 132 ----
NM_001146chr862029 1824 1614 1572 704 184 ------
NM_001148chr431691 1652 317 1704 ----
NM_001149chr102484 32 ------
NM_001159chr24716 613 512 99 ------
NM_001167chrX86489 6398 5694 5378 2323 1435 1086 976 --21879 1388 12179
NM_001173chr1464376 4125 3934 2989 1439 790 14576 24046 3976 11821
NM_001178chr11------160
NM_001186chr2142750 2436 2374 47 21204 534 ----
NM_001191chr2031205 366 159 --1942 --
NM_001204chr287183 5298 5193 2450 2028 1361 442 205 36224 5685 2648 17635 --
NM_001206chr922154 692 33032 2764 2041 ----
NM_001207chr5--1267 ----
NM_001233chr731545 261 155 22155 345 ----
NM_001237chr43946 913 63 ------
NM_001237chr43946 913 63 ------
NM_001251chr172593 208 ------
NM_001253chr61253 ------
NM_001254chr1731009 838 59 11091 --1178
NM_001256chr1732944 1180 359 --32779 1995 78 11873
NM_001257chr16--11042 ----
NM_001263chr41111 ------
NM_001269chr11902 ----1975
NM_001270chr5--1886 ----
NM_001278chr1041200 388 297 177 ------
NM_001280chr191687 --1274 --
NM_001304chr1763761 3686 3600 2628 1079 161 12972 23251 490 --
NM_001310chr1222649 975 22928 2619 ----
NM_001313chr42874 862 189 ----
NM_001326chr11--1318 1306 --
NM_001328chr41269 ------
NM_001329chr1031161 244 93 ------
NM_001331chr1132151 2128 296 --12110 --
NM_001332chr51634 ------
NM_001351chr371857 1571 1437 1332 1170 1143 524 1144 11482 --
NM_001356chrX1658 22301 1786 ----
NM_001363chrX3714 518 223 ------
NM_001364chr1174546 4458 4384 1820 1079 763 541 --11241 --
NM_001379chr192277 215 ------
NM_001387chr583149 2716 2120 2076 1172 587 566 273 --11070 --
NM_001401chr9--11052 ----
NM_001406chr1711134 21731 1530 ----
NM_001412chrX23413 1200 12858 ----
NM_001419chr1964391 3200 2987 1532 770 686 34674 1065 386 14619 --
NM_001427chr7--11792 1206 --
NM_001430chr2--11861 1709 --
NM_001431chr6--2993 73 1494 --
NM_001438chr163039 2998 2862 850 180 84 13340 ----
NM_001448chrX51691 1518 1116 168 114 --11153 --
NM_001463chr22797 313 --1227 --
NM_001482chr151785 ------
NM_001494chr101292 ------
NM_001495chr81168 ------
NM_001498chr64896 880 301 168 --11023 --
NM_001514chr11394 ------
NM_001518chr731019 421 190 ----1938
NM_001530chr142299 217 ------
NM_001541chr111166 ------
NM_001546chr621062 933 ------
NM_001550chr7179 ------
NM_001604chr1111011 ----2906 405
NM_001609chr1031255 987 481 21798 1287 12872 --
NM_001616chr222758 2365 --11009 --
NM_001627chr31212 11721 1957 --
NM_001634chr631986 1687 543 ------
NM_001635chr73873 746 675 ------
NM_001650chr1833571 411 308 1856 --12792
NM_001655chr1142015 1550 724 378 --21355 74 --
NM_001656chr531857 270 29 11379 ----
NM_001658chr121139 183 ------
NM_001660chr3----1767 --
NM_001663chr1422678 2639 ------
NM_001668chr121652 1517 ------
NM_001682chr1242701 2161 1999 971 11859 161 12317
NM_001684chr153802 3252 2659 2561 885 13128 23004 2989 14131
NM_001690chr322312 1874 1161 ----
NM_001695chr873859 2895 1704 1628 1502 795 239 ------
NM_001699chr1941172 1159 437 288 --1328 --
NM_001704chr62527 414 ------
NM_001706chr32852 795 ------
NM_001714chr122529 40 ------
NM_001717chr1561476 982 475 369 221 133 ------
NM_001718chr621192 219 1313 ----
NM_001719chr202176 37 ------
NM_001726chr11139 ------
NM_001730chr1341371 1331 591 421 ----11256
NM_001730chr1341371 1331 591 421 ----11256
NM_001746chr552706 2456 2445 408 319 ------
NM_001755chr163892 717 273 21606 828 ----
NM_001777chr353435 2638 997 238 164 24186 3306 12816 14173
NM_001788chr7--197 ----
NM_001792chr181276 ------
NM_001797chr16--1120 ----
NM_001799chr5199 ------
NM_001801chr52235 213 1488 ----
NM_001826chr12463 296 ------
NM_001830chrX74060 2876 1354 1265 446 236 212 1989 ----
NM_001854chr131541 1487 80 ------
NM_001855chr9199 --129 --
NM_001856chr11327 ------
NM_001880chr2--127 ----
NM_001881chr101402 --1343 --
NM_001882chr51406 1389 144 --
NM_001884chr5--127 ----
NM_001893chr171373 ------
NM_001894chr221139 --1445 --
NM_001904chr31425 125 ----
NM_001924chr1145 1458 ----
NM_001936chr71150 ----1562
NM_001938chr1--31505 1465 664 ----
NM_001942chr181746 --21962 239 12074
NM_001968chr41203 ------
NM_001977chr4121 2536 332 ----
NM_001981chr1--22148 842 12308 --
NM_002006chr473711 3617 3595 1262 955 617 488 34348 2291 456 ----
NM_002009chr1582810 2690 2540 2481 1996 1945 1910 801 ------
NM_002014chr12169 ------
NM_002015chr1393374 3154 2475 2333 1175 827 668 330 103 ------
NM_002017chr111506 1937 ----
NM_002024chrX41499 1397 410 345 1256 ----
NM_002025chrX138867 8531 7746 6433 6360 6300 5749 3469 3313 3010 2921 1777 1045 33144 709 373 17608 --
NM_002039chr41600 ------
NM_002040chr2142569 2357 1024 31 1990 ----
NM_002054chr2--1178 ----
NM_002061chr131915 1577 1300 1147 ----
NM_002069chr721472 306 1423 176 --
NM_002076chr1262502 2020 1235 253 106 83 22961 2049 21132 1124 13125
NM_002082chr52133 29 ------
NM_002086chr1722164 1938 --1216 --
NM_002092chr454628 4588 3173 1387 266 2702 518 44700 4553 4459 1819 11712
NM_002107chr11175 ------
NM_002126chr1793981 3705 3457 2724 1616 1078 563 437 310 ------
NM_002128chr1362381 2030 1626 649 519 311 11740 ----
NM_002130chr521195 1077 11723 ----
NM_002140chr9152 1886 ----
NM_002154chr51110 ------
NM_002158chr233745 2749 1259 31375 766 81 ----
NM_002166chr2----1507 --
NM_002193chr2--11601 ----
NM_002196chr20--1930 ----
NM_002196chr20--1930 ----
NM_002203chr544053 3899 2789 273 ------
NM_002210chr223364 248 22350 1347 1953 --
NM_002211chr101349 21109 924 --11001
NM_002214chr764322 1989 1962 1747 1186 360 2784 583 33684 1562 863 --
NM_002222chr331134 907 507 1126 ----
NM_002229chr191417 ------
NM_002239chr211165 1261 ----
NM_002247chr1011761 11616 ----
NM_002267chr1322321 2257 --11654 --
NM_002268chr311526 ------
NM_002270chr574928 4910 4388 1749 489 475 48 45274 5201 4583 3778 15574 --
NM_002271chr1322468 170 --42181 2149 824 416 --
NM_002285chr2104124 3935 3017 2915 2743 2695 1444 1330 945 834 --11265 --
NM_002293chr172212 2110 1089 980 940 891 151 11970 ----
NM_002296chr141547 1486 625 103 21768 282 ----
NM_002310chr536016 4182 2392 --11060 --
NM_002313chr1083969 3792 3543 3480 3280 1780 1551 456 ----13824
NM_002314chr71931 ------
NM_002335chr11--148 ----
NM_002336chr1234363 3350 1905 1253 --14267
NM_002351chrX41729 1591 1226 325 158 1701 --
NM_002354chr21100 --1357 --
NM_002356chr622654 568 32880 1832 644 12355 --
NM_002358chr41504 1647 ----
NM_002359chr1763718 2962 2766 2712 979 973 --127 --
NM_002374chr283211 2879 2778 2300 1453 1084 475 437 12258 13357 --
NM_002397chr53725 646 23 ------
NM_002403chr11411 ------
NM_002408chr145841 788 742 78 28 ------
NM_002430chr2272559 1804 1781 1775 1600 928 208 12183 1125 --
NM_002442chr12--11769 ----
NM_002480chr1211046 --2526 445 --
NM_002481chr157901 7298 5828 5576 2852 52541 1615 616 218 207 21500 420 11833
NM_002485chr841542 1391 753 664 31824 705 546 ----
NM_002499chr154958 506 45 36 ------
NM_002505chr621300 129 ------
NM_002508chr161989 1754 1696 1677 1566 1323 1532 ----
NM_002515chr1451977 1807 1326 329 88 31394 488 434 ----
NM_002519chr1111054 1958 1544 --
NM_002538chr51121 ------
NM_002539chr2185 ------
NM_002543chr1241538 1201 307 34 11340 --143
NM_002544chr171229 1118 ----
NM_002547chrX54218 3441 3323 1283 329 23818 3306 160 1414
NM_002577chr393930 3710 3553 3359 2678 2511 1344 404 242 1660 1375 --
NM_002581chr944868 4693 3991 3467 15506 14039 --
NM_002588chr53667 568 84 11738 ----
NM_002591chr201511 1644 ----
NM_002600chr161346 1250 1195 538 456 131 ------
NM_002610chr263043 2181 1167 450 311 240 ------
NM_002611chr17--1841 ----
NM_002612chr761791 1683 742 278 245 41 ------
NM_002635chr121144 1346 ----
NM_002655chr864907 4157 3267 2030 1389 833 11307 1799 --
NM_002657chr2083480 1394 1195 1142 1093 1080 921 28 ------
NM_002667chr63433 307 114 1314 ----
NM_002687chr1441261 1160 826 521 ------
NM_002706chr2--2534 111 ----
NM_002707chr2----165 --
NM_002713chr11774 ------
NM_002716chr1163643 2924 2826 1053 943 814 1931 13000 1968
NM_002719chr1422058 576 ----1767
NM_002721chr91184 1399 ----
NM_002731chr132092 822 128 ------
NM_002734chr1721990 580 ----11933
NM_002736chr731971 804 484 21465 554 ----
NM_002737chr1766292 4893 4702 4408 2024 166 11402 36338 5672 5477 --
NM_002740chr362828 2522 2421 667 456 238 ------
NM_002742chr141528 1516 ----
NM_002748chr152406 173 1964 ----
NM_002755chr151699 ------
NM_002775chr101520 ------
NM_002814chrX1104 2649 122 1286 --
NM_002815chr171166 ------
NM_002821chr61233 --1598 --
NM_002822chr122539 33 11645 ----
NM_002828chr183968 749 707 ------
NM_002833chr1521612 1557 ------
NM_002835chr71287 1784 ----
NM_002839chr952331 1001 781 505 56 12731 ----
NM_002841chr32665 124 ------
NM_002843chr1133172 2776 755 13205 ----
NM_002844chr641431 1283 920 187 --21056 873 --
NM_002849chr12------1809
NM_002851chr73733 634 569 1621 ----
NM_002868chr1242341 2297 2070 561 --21768 803 --
NM_002874chr922156 251 1785 ----
NM_002886chr3104700 4467 4184 4172 3704 3619 3420 3187 1857 801 1473 13238 --
NM_002890chr51346 1959 ----
NM_002892chr1451384 1341 1187 690 604 ------
NM_002894chr18137 --1205 --
NM_002897chr21105 ------
NM_002906chr114823 786 611 529 ------
NM_002940chr431238 495 267 ------
NM_002941chr31504 ------
NM_002942chr32904 513 ------
NM_002956chr1211030 --1206 --
NM_002959chr1104281 4232 3175 3120 1758 1718 1509 1394 1249 952 33545 1402 1347 ----
NM_002970chrX1315 ------
NM_002971chr321095 449 1818 ----
NM_002973chr12--1590 ----
NM_002976chr21208 ------
NM_002977chr243397 1380 336 254 12333 23068 2802 --
NM_002979chr13807 703 263 ------
NM_002994chr441952 274 55 40 ------
NM_002997chr21733 ------
NM_003010chr1722130 743 ------
NM_003014chr721405 167 ------
NM_003022chrX31216 889 41 --1864 --
NM_003026chr9--1841 ----
NM_003034chr1257875 7329 6287 5964 93 11341 16379 --
NM_003035chr1----2939 330 --
NM_003036chr11154 ------
NM_003043chr374294 4156 3209 2867 1295 981 963 --23991 1455 --
NM_003045chr1374862 4784 4599 4275 3530 1425 915 ------
NM_003048chr252687 2388 1969 1075 658 ------
NM_003060chr521132 456 11315 ----
NM_003068chr831030 1011 392 ------
NM_003071chr311664 147 --2595 72
NM_003073chr221299 ------
NM_003074chr372239 1982 1880 1784 906 882 349 ------
NM_003082chr143930 473 22 --136 --
NM_003093chr61173 --185 --
NM_003096chr21180 ------
NM_003106chr331067 711 405 1734 ----
NM_003107chr64443 423 336 91 22252 2005 --11640
NM_003108chr296899 6752 5818 5789 5563 941 777 465 238 15762 27281 6601 --
NM_003112chr743230 2849 2627 1985 --32730 2100 1295 11281
NM_003113chr22804 303 ------
NM_003137chr62842 106 11965 --1429
NM_003144chr662133 1990 1394 292 136 28 2411 257 11548 11772
NM_003155chr842409 832 529 67 1947 ----
NM_003161chr1732587 2581 2359 32894 1168 1110 ----
NM_003174chr10----1116 --
NM_003185chr2011302 1112 ----
NM_003188chr6--1631 ----
NM_003189chr173113 2767 2759 2542 2126 317 246 13421 12519 --
NM_003194chr61387 ------
NM_003199chr1841999 1780 1007 929 1793 ----
NM_003201chr102356 290 ------
NM_003206chr61416 ------
NM_003211chr122472 458 140 ----
NM_003217chr1221249 186 12004 21780 439 --
NM_003220chr631467 598 161 11725 ----
NM_003222chr202899 104 1306 ----
NM_003234chr332419 2303 2046 32131 1806 1568 ----
NM_003242chr322124 1538 22338 1580 ----
NM_003246chr1531573 1395 174 ------
NM_003259chr191152 ------
NM_003262chr394432 4094 3307 1648 1331 1194 1152 898 450 55009 4329 4231 1804 314 ----
NM_003275chr91193 ------
NM_003285chr1----1450 --
NM_003291chr13--141 ----
NM_003292chr121894 1440 --11472 --
NM_003298chr356105 5797 3936 1431 1401 15753 24161 3921 --
NM_003302chr71143 ------
NM_003304chr32591 179 11272 ----
NM_003319chr23278 240 107 ------
NM_003320chr1154329 4237 3801 3665 3454 13918 ----
NM_003336chrX3267 242 140 --1741 1838
NM_003337chr531233 549 374 --1267 --
NM_003338chr1011974 21422 370 ----
NM_003340chr421144 1124 ------
NM_003341chr3--1130 1434 --
NM_003344chr721473 1430 ------
NM_003347chr222395 144 ------
NM_003350chr81958 1710 ----
NM_003352chr21400 ------
NM_003360chr4--1286 1218 --
NM_003369chr1162634 2502 2406 2215 2007 819 ------
NM_003370chr192800 638 ------
NM_003372chrX130 ------
NM_003376chr621815 658 ----1315
NM_003376chr621815 658 ----1315
NM_003379chr61732 1717 ----
NM_003380chr10198 ------
NM_003390chr111974 2836 110 ----
NM_003392chr383929 3309 3012 2990 1578 1415 1211 479 23586 3521 11587 --
NM_003404chr201218 ------
NM_003405chr221600 ------
NM_003406chr821371 83 --11979 --
NM_003409chr1811289 31228 1067 424 ----
NM_003410chrX23101 1929 32761 2184 269 ----
NM_003411chrY168 21261 649 ----
NM_003413chrX12007 1416 --188
NM_003418chr31788 ------
NM_003423chr1952321 2155 554 522 253 --12003 --
NM_003430chr192409 241 21613 1216 --11377
NM_003432chr5----1214 --
NM_003442chr112281 94 1305 138 1315
NM_003453chr13----1107 --
NM_003458chr343172 2942 466 427 --13391 --
NM_003463chr642969 2398 2178 2050 33073 580 127 ----
NM_003467chr24484 444 136 96 ------
NM_003468chr242774 1390 170 65 --14120 --
NM_003469chr22339 147 1428 ----
NM_003472chr631159 616 164 ------
NM_003478chr1142736 2630 2153 2062 22998 2192 1688 --
NM_003480chr1231979 549 521 ------
NM_003482chr1252742 2485 2470 2463 2297 ------
NM_003487chr17----160 --
NM_003489chr212858 22 ----13134
NM_003505chr731886 1764 345 ------
NM_003506chr81530 11056 11110 --
NM_003508chr71270 ------
NM_003558chr91698 --1143 --
NM_003563chr1741185 1148 1115 241 ----1391
NM_003564chr11656 ------
NM_003566chr1273250 2733 2711 2457 945 881 72 21223 1069 12855 --
NM_003567chr11349 1315 ----
NM_003574chr1825802 4388 45111 4809 1735 1003 35359 542 322 --
NM_003576chr1352137 2048 1935 559 158 12739 11907 --
NM_003580chr8--1107 ----
NM_003583chr1243051 2589 1318 196 ------
NM_003590chr233901 350 158 83895 3674 3616 2887 2795 1056 668 484 ----
NM_003592chr7--1482 ----
NM_003603chr422114 1589 --2656 642 --
NM_003607chr184101 3201 2971 2769 1642 1160 532 361 ------
NM_003615chr3103932 3645 3603 2887 2779 1281 937 581 432 137 ------
NM_003618chr211108 ------
NM_003620chr173874 801 267 2755 139 ----
NM_003629chr153453 2949 2535 2515 50 ----1769
NM_003630chr62198 128 1696 ----
NM_003644chr1786555 5162 4280 2348 1556 1400 1097 1027 --36610 4442 303 25055 2295
NM_003659chr221053 48 ------
NM_003663chr363417 3145 3043 2375 940 117 --1844 --
NM_003670chr34903 398 361 69 11065 ----
NM_003671chr963292 2251 1415 1100 173 153 23354 2823 ----
NM_003672chr141322 719 616 533 41988 1670 467 240 ----
NM_003676chr11645 ------
NM_003685chr193927 818 713 ------
NM_003692chr92172 154 ------
NM_003713chr121171 482 --1432 --
NM_003716chr31713 ------
NM_003722chr352415 2004 1942 1105 773 22592 1054 12457 --
NM_003735chr53667 568 84 11738 ----
NM_003736chr53667 568 84 11738 ----
NM_003741chr3----1378 --
NM_003743chr221768 157 ------
NM_003744chr141862 --21128 1084 --
NM_003749chr1341805 1794 1592 98 --12137 --
NM_003750chr10----1696 --
NM_003759chr454056 2638 1396 937 239 14219 23689 3377 --
NM_003763chr201307 1672 ----
NM_003768chr131732 1527 241 ------
NM_003772chr111904 11020 ----
NM_003774chr1243181 2921 1184 591 23166 2894 1233 --
NM_003777chr7--1558 ----
NM_003778chr31686 --1697 --
NM_003783chr131221 1089 277 190 ----
NM_003784chr186701 619 589 471 105 73 ------
NM_003787chr1851652 1409 1365 1352 101 189 ----
NM_003794chr3--1683 ----
NM_003795chr61135 ------
NM_003800chr642249 2009 1528 579 ----11508
NM_003816chr831498 1474 1224 1241 1335 --
NM_003822chr12913 894 --12413 12009
NM_003825chr1551095 573 485 82 75 --1611 11290
NM_003860chr112347 44 --2141 130 --
NM_003870chr1522058 1763 1296 ----
NM_003872chr21302 ------
NM_003873chr1021985 590 ------
NM_003884chr32404 67 21855 1292 ----
NM_003885chr1742369 1024 534 68 --1778 --
NM_003887chr211550 --11414 --
NM_003893chr101492 ------
NM_003895chr211301 --2428 202 11626
NM_003899chr1372337 1836 1826 761 668 595 289 --1954 11767
NM_003902chr12826 788 ------
NM_003909chr842332 2295 2137 627 ------
NM_003913chr6103722 3355 2842 1647 1389 1315 1277 857 457 350 12964 ----
NM_003921chr13378 369 237 11787 11799 --
NM_003922chr15--1373 ----
NM_003930chr731888 1678 253 --22283 447 --
NM_003941chr741802 812 790 276 ------
NM_003947chr32932 411 1874 ----
NM_003948chr411713 22594 2181 ----
NM_003953chr152795 986 868 571 560 1414 ----
NM_003971chr17----1415 --
NM_003980chr631493 1323 449 21127 344 ----
NM_003983chr1643792 3401 3050 397 1248 --1695
NM_003994chr1284196 3785 3741 3102 2934 1496 592 269 13322 ----
NM_004006chrX22331 161 12589 1666 --
NM_004007chrX22331 161 12589 1666 --
NM_004009chrX22331 161 12589 1666 --
NM_004010chrX22331 161 12589 1666 --
NM_004011chrX22331 161 12589 1666 --
NM_004012chrX22331 161 12589 1666 --
NM_004013chrX22331 161 12589 1666 --
NM_004014chrX22331 161 12589 1666 --
NM_004015chrX22331 161 12589 1666 --
NM_004016chrX22245 75 12503 1580 --
NM_004017chrX22331 161 12589 1666 --
NM_004018chrX22245 75 12503 1580 --
NM_004020chrX22331 161 12589 1666 --
NM_004021chrX22245 75 12503 1580 --
NM_004022chrX22245 75 12503 1580 --
NM_004023chrX22245 75 12503 1580 --
NM_004028chr1833571 411 308 1856 --12792
NM_004040chr221346 1085 ------
NM_004046chr18137 ------
NM_004061chr51195 ------
NM_004080chr751373 1283 545 181 127 ------
NM_004081chrY71597 1508 1463 1201 1174 418 150 2623 232 ----
NM_004093chr1332401 484 169 ------
NM_004094chr1452147 1215 753 501 77 ----1569
NM_004098chr1021133 1119 ------
NM_004100chr622257 1057 21012 201 ----
NM_004105chr21230 1850 1410 --
NM_004107chr191205 ------
NM_004117chr631527 741 529 --11659 --
NM_004124chr14113551 3436 3086 2967 2818 2339 2320 2220 1162 1025 711 1649 12499 --
NM_004126chr73288 183 53 ------
NM_004130chr31572 ------
NM_004136chr1532728 2344 349 13190 12261 --
NM_004170chr9--1557 ----
NM_004171chr11109509 7217 6798 5997 3700 3432 2600 1853 1177 1164 36874 1335 594 11962 --
NM_004172chr521632 640 32059 403 228 ----
NM_004183chr111319 ------
NM_004202chrY1108 ------
NM_004226chr21248 ------
NM_004227chr732692 1953 496 ------
NM_004232chr1833379 2999 205 53339 3236 1284 1009 114 1496 --
NM_004235chr92838 202 1873 ----
NM_004237chr52918 329 ------
NM_004238chr21264 ------
NM_004242chr61319 ------
NM_004255chr151168 ------
NM_004261chr13937 102 79 1303 --1678
NM_004272chr521950 1436 11911 11663 --
NM_004274chr1443186 2041 1160 729 --12458 1488
NM_004277chr61548 ------
NM_004291chr52100 76 ------
NM_004311chr1042926 2203 1959 636 ----12346
NM_004317chr19173 ------
NM_004330chr152812 276 11100 ----
NM_004331chr832553 1674 232 ------
NM_004342chr721446 376 12055 ----
NM_004346chr41384 ------
NM_004354chr42728 651 ------
NM_004359chr19127 ------
NM_004365chr5--1231 ----
NM_004370chr64847 329 290 95 ------
NM_004384chr542369 2176 1811 212 11972 ----
NM_004385chr51249 ------
NM_004392chr1352482 1908 1641 866 166 12077 ----
NM_004397chr1174268 4259 3723 2725 2655 2633 1005 11131 ----
NM_004412chr1053805 3744 2380 950 380 ----35677 4492 1893
NM_004415chr61609 ------
NM_004427chr12972 775 ------
NM_004428chr1----1742 --
NM_004429chrX41396 1093 914 112 ------
NM_004430chr841803 1720 929 694 --12230 --
NM_004432chr911669 --11999 11906
NM_004437chr183625 3185 2586 1324 1302 1229 925 152 1444 1260 --
NM_004449chr2141390 1105 391 334 3305 276 176 ----
NM_004454chr32814 270 11407 ----
NM_004457chr21297 ------
NM_004458chrX42422 1785 1651 178 ------
NM_004464chr454296 3631 3026 2866 47 22914 633 ----
NM_004482chr23655 363 75 ------
NM_004500chr1431857 1421 205 2558 216 ----
NM_004501chr153673 3617 3421 2649 1329 13698 ----
NM_004504chr221051 114 12558 12809 --
NM_004505chr1721324 322 1436 ----
NM_004506chr6--1668 ----
NM_004516chr191173 ------
NM_004520chr5--1270 ----
NM_004523chr1031370 527 185 ------
NM_004524chr172279 203 ------
NM_004526chr3--1634 ----
NM_004529chr921461 1023 ------
NM_004535chr203498 328 321 ------
NM_004571chr2153352 2722 2447 2417 35 32927 1055 62 12942 --
NM_004575chr441481 1254 1204 1196 11133 ----
NM_004576chr53373 284 56 --176 --
NM_004586chrX75338 5323 5085 4381 3324 1557 1265 --24943 4771 --
NM_004598chr533089 529 28 12746 ----
NM_004600chr11275 ----2551 530
NM_004612chr974457 4210 1601 1519 522 477 439 23949 292 24574 4447 --
NM_004622chr252345 1919 1823 1708 622 11785 ----
NM_004654chrY11114 147 1201 --
NM_004660chrY3850 771 576 12294 22090 528 --
NM_004663chr1551236 1162 1119 333 135 --1974 --
NM_004671chr182310 288 ------
NM_004685chr1322208 2085 22752 522 ----
NM_004687chr1741620 1381 548 234 ------
NM_004701chr151120 ------
NM_004707chr521387 70 ------
NM_004715chr18--1177 ----
NM_004719chr1242670 2218 1874 720 ------
NM_004725chr103575 269 256 --21385 1135 --
NM_004726chrX85573 5383 4968 3710 3584 1411 857 292 --33598 1397 650 --
NM_004730chr531937 1831 264 ------
NM_004731chr1251838 299 281 160 49 ------
NM_004733chr3--148 ----
NM_004740chr17136 ------
NM_004744chr433324 2938 2796 ----23906 1217
NM_004745chr854862 4361 2409 1477 1364 26361 1748 17040 26896 757
NM_004748chr1543870 884 118 41 13520 ----
NM_004760chr752258 1753 1741 1735 973 32351 2282 1880 11709 --
NM_004762chr1721893 1852 ------
NM_004766chr31166 ------
NM_004772chr521384 172 ------
NM_004774chr1762981 2896 1975 1962 309 212 --13016 --
NM_004775chr1852241 2040 1946 563 397 21769 1490 ----
NM_004788chr1142219 1848 1061 649 --11752 --
NM_004792chr2--1198 ----
NM_004794chrX----143 --
NM_004796chr1452182 2037 1897 1525 400 --22174 30 --
NM_004798chr2022835 561 23589 1255 ----
NM_004800chr13------185
NM_004801chr22489 40 11095 ----
NM_004817chr93566 540 209 1795 ----
NM_004821chr51672 ------
NM_004824chr621429 1261 ----1164
NM_004831chr191693 ------
NM_004836chr21669 --1187 --
NM_004841chr11812 --1739 --
NM_004842chr631765 600 61 11515 ----
NM_004845chrX63933 3857 3644 1489 649 145 --12988 --
NM_004850chr241479 1444 1407 608 ------
NM_004855chr151211 ------
NM_004857chr1431695 1504 410 1608 --13733
NM_004859chr1731937 971 860 32311 981 935 ----
NM_004863chr1455205 1957 1826 1188 522 22044 615 ----
NM_004867chrX2658 222 ------
NM_004871chr1774300 4065 3265 3038 2917 2896 642 1337 1290 --
NM_004874chr81189 ------
NM_004893chr51111 ------
NM_004904chr785937 5861 4304 2015 1356 605 445 240 12051 15413 --
NM_004906chr63606 533 469 ------
NM_004912chr711291 1481 150 --
NM_004921chr121757 270 12356 ----
NM_004926chr1411487 11333 11685 --
NM_004929chr821074 180 ------
NM_004946chr52416 46 ------
NM_004949chr1882177 1983 1901 1875 1856 1780 767 106 31755 853 774 ----
NM_004956chr763433 3061 1684 1493 458 300 --14438 --
NM_004965chr212301 94 ------
NM_004966chr102996 110 ------
NM_004967chr4------1498
NM_004972chr93820 374 166 152 ----
NM_004973chr611766 --11713 --
NM_004985chr1263398 2960 1735 1619 1038 167 33004 1313 922 2908 201 --
NM_004992chrX148541 8279 6237 5693 5424 5412 3271 2417 2394 2301 1967 1712 1483 143 12134 1992 --
NM_004992chrX148541 8279 6237 5693 5424 5412 3271 2417 2394 2301 1967 1712 1483 143 12134 1992 --
NM_004993chr1441501 1268 1230 231 1977 ----
NM_004996chr1651702 594 508 472 425 --21183 320 --
NM_004999chr674279 4146 3743 1745 1251 763 751 --11187 13212
NM_005011chr731383 496 110 ------
NM_005023chr541497 1286 614 146 11486 --1105
NM_005028chr1031935 1504 466 --11751 --
NM_005036chr2258335 7745 6679 1489 1015 11405 28204 1387 --
NM_005053chr19--2586 57 ----
NM_005054chr231521 1515 1404 ------
NM_005056chr1264265 3475 1977 1513 1008 994 --15389 --
NM_005063chr1073481 3429 3188 1471 869 362 301 ----11339
NM_005065chr1445021 2112 1275 749 23843 1142 1671 --
NM_005079chr833189 2401 601 ------
NM_005080chr221651 2774 38 ----
NM_005104chr61597 ------
NM_005113chr142373 187 ------
NM_005114chr4--1552 ----
NM_005116chr2054064 3386 3060 1506 1319 --24447 4323 --
NM_005119chr11340 ------
NM_005121chr1773558 3517 3150 2531 1399 457 108 43501 1046 967 795 13367 --
NM_005124chr62882 762 ------
NM_005125chr11--1151 ----
NM_005126chr332071 1947 1877 ------
NM_005135chr1553871 2466 2388 1330 234 12951 --13290
NM_005156chr9135177 4968 4855 4821 4645 4326 3953 3483 3318 1217 1090 955 115 34164 4086 889 ----
NM_005160chr2262261 1898 1449 766 756 45 46351 5455 1284 1232 24267 2605 26305 732
NM_005168chr21471 --1208 --
NM_005171chr122889 522 --11071 167
NM_005180chr10--1588 ----
NM_005188chr11187876 7830 7274 7253 6876 6091 5575 5470 5382 5064 2649 2533 2496 2079 1748 1136 582 108 --55892 2840 2704 999 204 --
NM_005190chr61149 ------
NM_005192chr14--1131 ----
NM_005197chr1445143 4867 1441 1162 --35751 4009 3965 --
NM_005201chr31339 ------
NM_005202chr11193 ------
NM_005203chr10166 ------
NM_005235chr264984 3094 2300 1685 103 77 ----15993
NM_005238chr1153078 2345 1303 932 515 --23523 3469 11320
NM_005239chr2111930 --21263 812 --
NM_005241chr311020 1468 ----
NM_005242chr511316 --11128 --
NM_005254chr151215 1346 ----
NM_005256chr111621 ------
NM_005257chr1811377 ----11127
NM_005259chr21353 21126 206 1222 --
NM_005264chr10--1373 ----
NM_005273chr71339 ------
NM_005277chr421815 397 ------
NM_005295chr7------144
NM_005296chrX1438 1409 1145 --
NM_005302chr7160 ------
NM_005308chr101335 ------
NM_005311chr742466 2138 2112 1812 --1485 --
NM_005313chr1511044 ------
NM_005316chr111869 ------
NM_005318chr221444 11051 1414 --
NM_005329chr1642345 1788 1510 850 --12175 --
NM_005339chr484121 3712 2841 1239 981 962 880 316 ------
NM_005342chrX1668 --1381 12425
NM_005359chr18115666 5588 5335 4890 4569 4269 2407 2293 1764 1732 1109 42255 1934 1922 617 12105 12009
NM_005376chr141136 1073 1028 221 ------
NM_005378chr21666 ------
NM_005385chr331913 1834 1081 1360 1443 11949
NM_005397chr783917 3844 3661 3586 3108 3062 2573 550 --11173 --
NM_005399chr154098 3129 864 656 469 21022 71 13546 --
NM_005400chr263108 2637 2601 1900 1210 83 ------
NM_005406chr182468 442 --21024 326 --
NM_005430chr121719 ------
NM_005433chr1841736 701 483 447 11041 12164 --
NM_005436chr1054102 4044 1561 901 178 ----12908
NM_005445chr101100 ------
NM_005450chr17--1228 ----
NM_005461chr2011707 31946 1771 591 ----
NM_005465chr12352 190 ----1763
NM_005471chr53877 166 48 ----1264
NM_005475chr1233310 2107 2099 ------
NM_005487chr2212031 11654 ----
NM_005497chr17116170 5201 4297 1636 1341 1272 1259 1105 566 559 292 --1470 --
NM_005499chr191526 1198 ----
NM_005502chr962518 1237 750 576 510 242 ------
NM_005504chr1246113 5896 5769 4125 55926 5015 4926 4666 4086 21833 670 --
NM_005509chr511569 ------
NM_005522chr731088 943 505 ----11098
NM_005540chr151548 1405 1266 636 596 --1292 --
NM_005542chr781910 1827 1705 1400 1227 691 362 192 ------
NM_005570chr1821126 425 1987 11117 --
NM_005573chr51162 ------
NM_005578chr3105108 4394 3790 3164 2022 1669 1657 1070 373 359 14473 15028 --
NM_005585chr15--1142 ----
NM_005587chr151308 1972 ----
NM_005595chr12643 632 ------
NM_005596chr9125516 5426 5201 4746 4378 3995 3944 2497 2442 2330 1859 1003 26309 455 ----
NM_005610chr11308 ------
NM_005611chr1621127 835 ------
NM_005614chr731099 852 163 --1873 --
NM_005634chrX1141 ------
NM_005637chr1841536 703 667 105 --11643 --
NM_005639chr1211905 11266 11365 11437
NM_005647chrX93265 3243 3120 3064 2527 2503 1198 177 145 12860 ----
NM_005650chr22--11324 --11212
NM_005655chr82504 444 11258 ----
NM_005657chr15--1117 ----
NM_005660chrX----1227 --
NM_005665chr194946 4754 4063 3602 1779 1713 1484 1441 951 24679 157 --24634 945
NM_005668chr594446 4324 4250 4105 4057 3846 3492 1686 489 1972 ----
NM_005685chr7199 ------
NM_005711chr52433 160 1778 ----
NM_005717chr111196 ------
NM_005722chr241553 603 326 188 32345 1607 130 ----
NM_005725chr121910 666 1575 ----
NM_005734chr111252 ------
NM_005738chr732014 1475 655 1687 ----
NM_005739chr1542406 2385 1918 839 11629 --11573
NM_005746chr752110 2014 1865 1011 423 12653 ----
NM_005748chr1223073 1244 1875 --21186 121
NM_005751chr71453 ------
NM_005759chr284517 3828 3757 3724 1718 1312 169 44 --13887 --
NM_005779chr563274 3109 3045 2777 2717 1047 12541 ----
NM_005780chr131373 ------
NM_005798chr1394907 4331 3908 3816 2076 2016 946 595 24 23336 1993 1389 --
NM_005802chr9--1745 ----
NM_005826chr12447 160 1418 ----
NM_005828chr1744530 1676 1037 930 --11098 1223
NM_005832chr311315 ------
NM_005842chr132274 119 1636 ----
NM_005843chr261447 1295 1232 509 380 244 11728 ----
NM_005845chr1341732 1349 1236 49 --11154 --
NM_005857chr141273 1112 946 599 2430 222 1974 --
NM_005859chr531473 1083 519 --11232 --
NM_005863chr1031150 996 60 1921 ----
NM_005868chr732290 1671 169 1698 ----
NM_005871chr1021067 988 --11018 --
NM_005875chr3139 ------
NM_005880chr1641570 1059 542 304 ------
NM_005884chr191166 1801 ----
NM_005888chr121144 1346 ----
NM_005895chr1293990 3753 3073 2884 1653 857 573 357 106 --12753 13552
NM_005896chr22593 126 ------
NM_005898chr1122678 2467 12636 ----
NM_005899chr1721083 226 ----11513
NM_005900chr42969 959 --1435 --
NM_005901chr18108690 7563 6633 6305 6149 3431 3163 3132 1791 1326 16073 27429 6545 --
NM_005903chr551785 1370 870 579 383 21090 516 13994 --
NM_005907chr62217 134 11588 ----
NM_005909chr564057 3290 2678 1462 563 167 ----1600
NM_005920chr152833 2543 1042 842 529 --23844 939 --
NM_005930chr141675 ----1252
NM_005933chr11------1944
NM_005935chr455152 4918 3495 1030 946 11949 1481 --
NM_005955chr114157 35268 4402 3666 45236 1871 395 374 13433
NM_005962chr1011794 11584 ----
NM_005962chr1011794 11584 ----
NM_005964chr1711202 ------
NM_005966chr262324 2123 2068 1815 949 441 ------
NM_005977chr131992 1880 ----
NM_005999chr121495 1253 ------
NM_006007chr944081 2838 1349 1321 --1653 1109
NM_006015chr11322 ------
NM_006016chr621785 1467 ------
NM_006035chr1421253 385 21327 160 ----
NM_006037chr274426 3978 3390 1797 669 641 554 --21729 1500 --
NM_006038chr2041886 1878 1436 861 ------
NM_006047chr2063535 3218 2466 2459 1145 293 13087 ----
NM_006060chr774050 3607 3542 3154 2689 1505 458 --13228 --
NM_006067chr162829 177 1300 1414 --
NM_006080chr722323 739 12534 ----
NM_006089chrX51898 1816 1281 662 83 ------
NM_006090chr1--2723 696 ----
NM_006094chr81180 1772 --11526
NM_006095chr474355 4238 1586 1425 1374 909 226 13234 ----
NM_006100chr32243 212 141 ----
NM_006106chr1162885 2643 2456 1367 1352 86 ----12141
NM_006107chr172337 156 1508 ----
NM_006108chr1152055 917 689 133 101 --11526 --
NM_006135chr111227 ------
NM_006136chr71282 ------
NM_006139chr212220 1215 12488 12794
NM_006141chr1632447 2264 98 --22203 1075 --
NM_006153chr31267 ------
NM_006154chr151358 2671 43 1103 --
NM_006164chr2135 ------
NM_006166chr1272541 2110 1945 1659 452 244 44 1678 --1861
NM_006180chr921317 518 ------
NM_006186chr21476 ------
NM_006190chr21945 ------
NM_006203chr5115470 3887 3449 1958 1483 1334 1093 874 695 502 172 24933 1864 15607 --
NM_006211chr81232 ------
NM_006251chr522985 2242 22796 927 --12996
NM_006252chr1127379 6590 6463 6066 5570 5340 5200 2688 1860 1596 1223 530 35224 4649 4628 --15525
NM_006256chr132646 2062 228 1983 199 --
NM_006265chr82409 115 1953 11385 --
NM_006282chr2074224 3663 3059 1720 1690 1288 668 2440 296 13250 1247
NM_006300chr1921932 1847 12358 ----
NM_006311chr17149 --1258 --
NM_006313chr1241686 400 213 105 ------
NM_006315chr454546 4341 3892 1745 331 ------
NM_006322chr132595 249 ------
NM_006323chr41506 ------
NM_006325chr121238 138 ----
NM_006330chr831172 1041 77 ------
NM_006350chr5151 ------
NM_006352chr162039 1800 1792 811 350 87 1396 1773 --
NM_006353chr6--175 21032 392 --
NM_006359chrX31757 942 189 1265 ----
NM_006364chr142280 245 11155 ----
NM_006369chr11435 ------
NM_006371chr364682 3963 1741 834 642 236 11277 13612 15138
NM_006375chrX41418 1280 1219 769 ------
NM_006379chr7--11937 1538 1132
NM_006380chr1773809 3463 3360 2764 1672 1513 342 11112 ----
NM_006386chr2232075 1592 890 --1697 --
NM_006390chr12----11462 --
NM_006393chr1054465 3218 1534 1431 945 --21600 1412 --
NM_006420chr2063412 2860 2543 2530 628 225 --23044 655 --
NM_006421chr821249 1163 1137 ----
NM_006425chr51246 1563 1283 --
NM_006434chr1052963 2821 2253 2211 852 ------
NM_006439chr4--1465 ----
NM_006451chr52799 341 126 ----
NM_006457chr463842 3615 2528 1107 600 504 13907 196 --
NM_006460chr171234 --11790 --
NM_006467chr542066 1912 1779 153 ------
NM_006482chr1243051 2589 1318 196 ------
NM_006489chr1451977 1807 1326 329 88 31394 488 434 ----
NM_006520chrX31503 1298 443 11045 ----
NM_006529chr431653 1321 609 11060 ----
NM_006534chr2063226 2528 2468 2116 1053 760 --13105 --
NM_006537chr152123 54 ------
NM_006544chr14115909 5860 5530 4125 3707 2440 2205 2131 1269 965 439 11708 15212 --
NM_006546chr1776614 6581 6396 6214 5437 5370 1785 ------
NM_006547chr721350 107 21708 476 22048 1503 --
NM_006559chr12821 405 ------
NM_006561chr10146182 5577 5461 4290 4242 3910 3817 2209 1496 1424 1254 966 548 521 11722 --1825
NM_006565chr161356 11080 1373 1412
NM_006572chr1722182 1033 ----12371
NM_006577chr211176 ------
NM_006591chr1151741 519 510 282 232 ------
NM_006593chr21574 ------
NM_006599chr1697903 6792 2375 2102 1917 1901 1357 1068 246 35290 829 517 16395 --
NM_006601chr122951 688 ------
NM_006603chrX31469 215 158 ------
NM_006609chr251926 1841 889 416 219 --1574 --
NM_006618chr131404 1150 471 --21531 487 --
NM_006621chr12818 661 1293 1635 --
NM_006622chr51215 ------
NM_006624chr1031433 340 179 21942 1703 ----
NM_006626chr93658 320 54 12292 ----
NM_006628chr1564394 4217 3461 2841 1107 735 33161 1668 294 1164 --
NM_006629chr1852337 2179 1089 268 144 1674 --1941
NM_006633chr51508 ------
NM_006636chr22961 687 ------
NM_006646chr1332777 2681 2006 22830 1959 1151 --
NM_006654chr1284340 1448 1380 931 919 851 775 41 11643 ----
NM_006660chr151247 ------
NM_006667chrX3999 121 101 ------
NM_006708chr641081 1006 916 852 --21111 989 --
NM_006711chr162656 54 ----1752
NM_006717chr963199 2214 1371 1036 534 495 11086 ----
NM_006720chr1083969 3792 3543 3480 3280 1780 1551 456 ----13824
NM_006722chr362209 1081 1005 735 708 525 11981 ----
NM_006729chrX44537 4079 2236 1847 13477 23609 2154 --
NM_006735chr7180 ------
NM_006738chr1564286 3847 3559 3459 3261 2821 14526 ----
NM_006750chr16107863 7630 6581 6440 5809 3229 2162 1985 945 740 26551 5506 12648 --
NM_006751chr2--1779 ----
NM_006756chr841531 1102 961 83 11004 ----
NM_006759chr21131 ------
NM_006763chr141760 1484 240 154 ------
NM_006772chr611117 ------
NM_006775chr632574 2372 2196 --1643 --
NM_006777chrX62267 1894 1015 222 172 26 21099 457 22260 2186 --
NM_006791chr151599 ------
NM_006803chr852114 1580 1545 713 28 21846 1556 ----
NM_006807chr1731349 1073 408 ------
NM_006808chr91156 ------
NM_006811chr202957 673 ------
NM_006813chr63649 226 120 ------
NM_006815chr1221306 280 --1966 11173
NM_006822chr172605 533 ------
NM_006823chr821321 389 ------
NM_006832chr141757 1850 ----
NM_006868chr1843225 2521 2003 466 1314 11949 --
NM_006874chr421013 334 --1952 --
NM_006885chr1664047 3847 3667 2755 1467 566 33617 807 425 ----
NM_006888chr1462706 2503 2410 2267 855 310 1220 ----
NM_006892chr2051420 1379 1243 420 313 ------
NM_006892chr2051420 1379 1243 420 313 ------
NM_006908chr741314 1154 1109 584 --1605 --
NM_006910chr162402 264 ------
NM_006915chrX51734 1648 779 688 242 1196 ----
NM_006924chr1723956 46 34053 3280 1079 ----
NM_006930chr541802 231 187 71 31288 611 524 ----
NM_006937chr172558 115 ------
NM_006938chr184789 300 219 75 2949 127 --2832 817
NM_006939chr144756 454 441 49 11204 ----
NM_006940chr1221833 437 2286 121 ----
NM_006947chr431693 1420 363 11630 11263 --
NM_006948chr2142198 2121 1795 986 ----1607
NM_006951chr102790 763 --1581 --
NM_006996chr141830 735 502 323 ------
NM_006999chr552064 1851 1446 1419 1413 --11337 1839
NM_007006chr1653482 2950 1305 1043 89 --1673 --
NM_007007chr122485 42 24520 1622 23992 3913 --
NM_007011chr1596638 6226 5857 4729 1608 1288 1225 671 552 ------
NM_007013chr8--1299 ----
NM_007027chr3----1146 --
NM_007038chr2185658 4667 3979 2349 2326 1662 973 819 14235 15865 --
NM_007042chr342502 2016 1975 1715 --1377 --
NM_007050chr2086561 6069 5999 2489 965 678 318 172 13179 11261 26303 2056
NM_007054chr543627 2540 892 587 ----12667
NM_007064chr331427 630 157 --1508 --
NM_007078chr1062601 2368 2338 2010 1168 793 ------
NM_007084chr1331567 1426 364 ------
NM_007106chr1322180 34 12748 12092 --
NM_007107chr332254 1798 768 ------
NM_007111chr132309 299 ------
NM_007112chr12240 179 ------
NM_007114chr312806 ----13027
NM_007125chrY31219 1003 452 1980 ----
NM_007137chrX105460 4949 4852 4195 4092 3763 3655 3480 1909 1265 11143 23789 1158 11922
NM_007146chr1732557 1025 996 ------
NM_007147chr19147 11245 ----
NM_007150chrX51892 563 551 324 67 ----11987
NM_007157chrX72984 2844 2547 2037 854 267 161 --12561 --
NM_007158chr121197 992 21235 135 ----
NM_007159chr311367 ------
NM_007166chr1131367 1255 1130 ------
NM_007175chr843530 2738 1010 458 33519 2328 980 13549 --
NM_007184chr31577 ------
NM_007191chr122719 167 ------
NM_007192chr142986 104 1458 ----
NM_007195chr1863551 2817 2436 1486 1190 455 ------
NM_007198chr841610 1589 1472 192 ------
NM_007200chr1564286 3847 3559 3459 3261 2821 14526 ----
NM_007202chr173631 539 264 ----1217
NM_007203chr953413 2735 2606 1557 1523 --24009 3047 --
NM_007204chr11200 --1127 --
NM_007207chr11306 ------
NM_007212chr131416 749 443 12157 1427 --
NM_007214chr61114 1379 ----
NM_007218chr82740 362 1903 ----
NM_007222chr8----11603 --
NM_007249chr1369477 9321 8795 7962 6330 2177 17186 12805 --
NM_007269chr11450 ------
NM_007274chr11126 ------
NM_007276chr711014 11133 --156
NM_007282chr31994 ------
NM_007285chr16----1194 1183
NM_007315chr231461 475 37 --11358 --
NM_007325chrX22001 1871 12172 ----
NM_007345chr182479 114 ----21746 305
NM_007347chr1532250 1959 368 --22637 2231 --
NM_007358chr131718 324 72 ------
NM_007361chr142677 31 ------
NM_007363chrX----11032 1372
NM_007373chr1041619 1396 554 195 --1718 --
NM_007374chr141383 ------
NM_007375chr11192 --11022 --
NM_012081chr573495 2807 2740 1238 1017 953 281 23230 3043 13152 --
NM_012082chr8--1788 ----
NM_012096chr342649 1471 945 866 --12943 --
NM_012104chr1153119 3095 2987 2972 2670 1676 12424 --
NM_012104chr1153119 3095 2987 2972 2670 1676 12424 --
NM_012115chr61621 ------
NM_012120chr652924 1993 1924 600 294 ------
NM_012129chr742248 2044 2025 155 --21986 1858 --
NM_012141chr1333121 1108 715 ------
NM_012155chr191224 ------
NM_012157chr32681 165 1942 161 --
NM_012158chr1321244 1141 21435 58 2391 164 11262
NM_012160chr61524 ------
NM_012164chr9127245 6477 6079 5688 4635 2939 2760 2687 2421 2230 1405 658 12636 22508 969 --
NM_012183chr1--1455 ----
NM_012193chr1145455 4919 4360 1959 31435 1213 79 23952 426 1492
NM_012199chr143874 3784 2889 1321 ------
NM_012207chr103841 825 27 1373 --1954
NM_012215chr1051841 1671 1408 1343 68 1407 31661 287 237 --
NM_012218chr191797 1412 2256 248 162
NM_012223chr2--3969 333 167 ----
NM_012224chr431045 865 329 --1402 --
NM_012234chr353754 3259 3076 2457 463 33588 1002 634 ----
NM_012238chr1051650 1537 1260 353 335 ------
NM_012242chr101547 ------
NM_012243chr12251 85 ------
NM_012255chr20186 146 ----
NM_012259chr641391 891 498 422 --21431 1247 --
NM_012262chr114119 1721 15014 --
NM_012281chr721593 1509 ------
NM_012290chr21383 --11154 --
NM_012294chr753814 3520 3485 3281 293 1406 53395 2788 1413 1194 389 22656 103
NM_012297chr472590 2253 1874 1853 923 712 23 11968 12021 12335
NM_012307chr181280 ------
NM_012327chr1831566 1500 996 ------
NM_012328chr721464 310 ------
NM_012334chr553209 3144 2999 1501 1237 24775 1268 1958 --
NM_012339chr102588 538 ------
NM_012388chr1522523 199 --13081 --
NM_012399chr2231791 1359 703 ------
NM_012412chr7--1790 ----
NM_012421chr11450 ------
NM_012426chr162477 360 ------
NM_012464chr442713 1129 649 104 11793 1494 --
NM_012486chr1--166 ----
NM_013230chrY51591 1526 374 228 98 1540 ----
NM_013231chr1473988 3791 3779 3678 1240 737 209 24413 3406 13935 --
NM_013233chr211204 2527 350 --11031
NM_013257chr812233 11598 ----
NM_013261chr432918 2599 275 11483 ----
NM_013283chr54799 743 236 82 ------
NM_013320chr121119 ------
NM_013322chr731614 1292 1264 ------
NM_013323chr173422 326 273 ------
NM_013341chr232581 2205 1849 --1576 --
NM_013354chr83961 425 304 ----1396
NM_013357chr8182 ----1671
NM_013372chr1552653 2524 2238 1168 765 --22870 1209 --
NM_013380chr19------1808
NM_013396chr212586 95 1422 ----
NM_013436chr2196 ------
NM_013437chr821332 179 184 ----
NM_013448chr141184 ------
NM_013449chr1242508 887 761 577 ------
NM_013450chr21916 11186 ----
NM_014011chr242601 2382 1852 739 12305 22119 396 --
NM_014023chr10102865 2731 2451 1959 1115 944 622 602 553 96 --1927 12849
NM_014028chr642669 2555 2047 352 11184 ----
NM_014038chr71405 ------
NM_014039chr1131261 881 179 ------
NM_014043chr311230 11090 ----
NM_014055chr121130 1443 ----
NM_014089chr1352198 874 585 109 55 ------
NM_014106chr1541046 867 595 576 ----11069
NM_014110chr11774 ------
NM_014117chr1622490 537 22104 730 ----
NM_014141chr763295 1487 1006 555 343 253 35370 5095 756 23844 206 --
NM_014154chr311116 1372 ----
NM_014155chr11117500 6648 5324 2443 1650 1465 1070 325 295 276 152 12830 ----
NM_014157chr1643743 3675 1026 862 22584 1012 23301 1431 --
NM_014178chr14260 47 1557 ----
NM_014203chr19164 ------
NM_014211chr531563 461 34 --2541 129 --
NM_014240chr323452 1155 --1971 --
NM_014241chr101281 162 ----
NM_014243chr421916 1616 ------
NM_014250chr2212031 11654 ----
NM_014278chr41131 ------
NM_014282chr91883 --1432 --
NM_014290chr91158 ------
NM_014300chr153378 156 40 1437 ----
NM_014302chr7----122 --
NM_014305chr132553 168 ------
NM_014309chr22104859 4510 1588 1392 1246 1137 664 492 484 476 --11409 --
NM_014319chr1252001 1639 611 240 206 1137 ----
NM_014331chr487241 6989 6117 2070 985 850 608 238 36181 5135 713 16603 --
NM_014333chr111458 ------
NM_014335chr1521215 83 ------
NM_014344chr111907 1769 ----
NM_014363chr132421 306 --1919 --
NM_014372chr141976 1957 1502 538 1480 ----
NM_014382chr321209 544 11357 ----
NM_014383chr191269 ------
NM_014392chr411224 ------
NM_014415chr3195 ------
NM_014423chr564756 4613 3856 2015 1509 111 34441 4293 1474 ----
NM_014445chr35524 401 343 285 172 1554 ----
NM_014447chr421329 1091 ------
NM_014452chr62453 278 ------
NM_014456chr1031742 293 74 2538 23 ----
NM_014462chr82298 284 --1103 --
NM_014469chr112254 190 ------
NM_014470chr12----1104 --
NM_014494chr162596 538 --12372 --
NM_014516chr19--1269 ----
NM_014517chr361880 1742 1711 1688 1447 79 --11612 --
NM_014554chr1212162 --11729 --
NM_014570chr222828 92 ------
NM_014574chr1471358 990 597 587 309 290 52 11187 21401 1391 --
NM_014575chr31456 2546 355 ----
NM_014583chr31512 --1326 --
NM_014607chr241712 824 538 482 --1550 --
NM_014612chr92492 342 1177 11434 --
NM_014615chr1632625 816 234 ------
NM_014620chr121824 ------
NM_014635chr231493 1487 1372 ------
NM_014636chr964280 4039 1500 1413 1135 1106 ------
NM_014646chr1812678 13148 42995 2195 2004 1053 1755
NM_014649chr19----121 --
NM_014653chr1232131 1595 143 --11763 --
NM_014655chr122351 824 12033 12170 --
NM_014659chr15--1309 ----
NM_014660chr7--11005 ----
NM_014666chr531170 474 412 ------
NM_014670chr231543 421 238 1344 ----
NM_014674chr331234 693 96 23723 756 2637 416 --
NM_014677chr811096 ------
NM_014679chr1131253 288 247 --1487 1205
NM_014682chr81514 11797 22200 334 --
NM_014685chr16--1576 1100 --
NM_014689chr2196 ------
NM_014702chr6103348 3332 3320 2944 2675 2405 905 432 213 128 ------
NM_014705chr711735 ------
NM_014707chr7102306 2089 2043 1887 1688 1512 444 377 311 130 ------
NM_014709chr2167 ------
NM_014711chr1642093 1847 1799 1771 ------
NM_014713chr22208 190 ------
NM_014723chr2042909 1068 992 103 ------
NM_014733chr52632 459 21641 468 ----
NM_014735chrX72088 1445 1300 860 537 169 145 ------
NM_014743chr422657 2170 --11053 --
NM_014747chr161688 1681 1096 745 337 78 24940 4832 25281 3997 11823
NM_014749chr141165 ------
NM_014751chr842103 1895 1445 294 ------
NM_014752chr1151979 1751 1397 713 258 1593 ----
NM_014755chr274000 3912 3350 3261 3209 1679 139 34278 4264 366 13040 --
NM_014756chr111365 --1456 --
NM_014765chr142330 2070 561 328 32671 2122 1693 ----
NM_014774chr132495 1245 761 ------
NM_014779chr32921 421 --2294 284 --
NM_014781chr81508 ------
NM_014793chr15147 1536 ----
NM_014800chr731108 1037 999 --1988 --
NM_014803chr1062802 2747 2495 2195 436 198 22631 2391 1583 11171
NM_014807chr111860 ------
NM_014810chr141116 509 334 307 12371 ----
NM_014819chr512407 1589 ----
NM_014822chr4189 ------
NM_014826chr184101 3201 2971 2769 1642 1160 532 361 ------
NM_014827chr161727 1365 1220 1135 400 335 --11054 --
NM_014828chr1452470 2229 1710 937 250 1882 ----
NM_014829chr5--42202 1532 908 489 1509 --
NM_014830chr1253817 3289 2398 1569 1298 1320 ----
NM_014832chr1331464 712 655 --1580 --
NM_014836chr10----21801 1243 --
NM_014838chr223493 286 276 ------
NM_014839chr132092 2029 738 --1226 --
NM_014840chr1252839 2435 2247 2219 2081 --12968 --
NM_014841chr6280 49 11076 ----
NM_014849chr131295 448 205 ------
NM_014860chr242656 432 191 182 22630 1635 11895 --
NM_014868chr124806 731 265 100 ------
NM_014874chr13465 450 21 --21850 1190 --
NM_014876chr225595 409 394 111 75 ----1872
NM_014877chr17217686 7673 7633 7527 7365 6546 6211 5928 5902 5660 5607 5435 5395 5257 3074 2973 2237 1947 1759 1578 1292 34866 571 512 37220 6758 4928 17351
NM_014897chr1743121 2629 871 805 12180 22488 582 --
NM_014903chr1242316 2308 1905 683 ----1720
NM_014904chr1063784 3512 2960 2605 859 743 1137 21132 1094 --
NM_014905chr22755 276 --21960 129 --
NM_014906chr1743500 3195 2895 700 ------
NM_014912chr1023437 992 --1132 --
NM_014914chr21483 ------
NM_014923chr1331788 1467 701 22379 1552 1225 --
NM_014924chr1452986 2078 1179 642 227 1394 2706 469 --
NM_014932chr321277 404 --1694 --
NM_014939chr1851363 1263 586 476 41 --2598 497 --
NM_014946chr263049 2567 2536 749 571 274 12457 12697 1116
NM_014947chr143002 2753 437 395 --1938 --
NM_014949chr1--1359 121 --
NM_014951chr1012617 ------
NM_014953chr1363736 3641 3615 3418 1201 427 24214 4132 ----
NM_014962chr2052565 2118 1003 455 301 ------
NM_014964chr175709 659 638 312 86 --12147 11948
NM_014974chr10----11799 --
NM_014982chr1443462 1010 833 285 14191 --14856
NM_014989chr631641 512 127 1698 1473 --
NM_014990chr1411061 1461 --1415
NM_014992chr141647 ------
NM_014999chr1241480 623 258 175 ------
NM_015000chr1232989 2210 435 12159 --12517
NM_015001chr11979 ------
NM_015008chr373183 2664 2342 2292 994 194 86 --33073 1351 886 --
NM_015017chr121126 217 21018 197 1248 --
NM_015018chr6180 ------
NM_015025chr262454 2270 1962 1099 906 179 ------
NM_015026chr1273991 3959 3684 3564 1606 1545 1450 --164 --
NM_015032chr1352364 2350 2231 1179 813 --2859 204 --
NM_015039chr1114165 4060 3219 3067 1664 1573 1544 1361 1174 837 562 ----14358
NM_015040chr233182 2960 816 13163 ----
NM_015042chr1594363 3982 3616 3429 2975 1287 985 903 589 ------
NM_015045chr1021871 277 12053 ----
NM_015046chr981994 1692 932 628 583 395 256 100 ------
NM_015051chr953369 2847 2296 2182 467 1263 22989 874 --
NM_015061chr95836 808 256 210 144 --187 --
NM_015071chr585270 4748 4503 4233 2207 1933 1276 618 21727 980 34696 2074 2003 --
NM_015076chr642951 1785 990 926 2506 411 ----
NM_015080chr111925 1298 1960 --
NM_015091chr142776 748 1614 ----
NM_015092chr1654292 3526 3316 2934 23 ----11089
NM_015093chr621766 655 ------
NM_015097chr321711 1657 21691 117 1440 --
NM_015115chr4144 ------
NM_015130chr4----173 --
NM_015132chr741235 576 425 101 21304 794 ----
NM_015137chr862619 2106 2020 872 669 157 ----12407
NM_015139chr1139 ------
NM_015143chr431398 468 166 ------
NM_015144chr1673863 3499 3315 2791 2429 1365 938 ----13676
NM_015153chr61502 2298 233 ----
NM_015155chr1022639 2521 --1346 --
NM_015163chr1421627 141 21489 569 ----
NM_015173chr441512 1428 1180 1116 ------
NM_015184chr32638 30 ------
NM_015185chrX1291 ------
NM_015192chr2032463 2446 615 ------
NM_015199chr343021 2554 2225 2169 1170 31032 934 573 1157
NM_015200chr452467 2264 1900 359 320 ------
NM_015203chr1157 ------
NM_015206chr1552849 2682 1537 1069 892 --22537 1101 --
NM_015208chr1853758 3464 3260 2912 477 1493 13542 --
NM_015209chr122166 734 ------
NM_015213chr111167 ------
NM_015215chr131133 717 148 13045 ----
NM_015229chr17--1762 11195 --
NM_015231chr112806 260 --1925 --
NM_015233chr135824 809 768 450 310 1698 11820 --
NM_015238chr5--1710 ----
NM_015239chr9185 ------
NM_015247chr1664871 4256 4010 546 487 452 25083 3453 ----
NM_015260chr1911577 ------
NM_015265chr242379 2302 953 70 --11946 --
NM_015267chr1212031 --11756 --
NM_015269chr11237 ------
NM_015272chr1632047 645 151 12165 --1451
NM_015277chr18----11298 --
NM_015282chr2123057 2677 2518 2162 2003 1948 1867 1223 821 529 304 204 ------
NM_015288chr553347 1193 1062 523 496 --1150 --
NM_015296chr132996 340 11024 ----
NM_015308chr112275 147 271 61 ----
NM_015310chr8128023 7914 7786 7012 6973 6026 5678 3276 2594 2546 981 841 25076 403 --15866
NM_015313chr1144563 3906 3339 1036 ----1423
NM_015314chr742421 2304 2168 449 22191 2098 1123 1698
NM_015315chr512304 1301 ----
NM_015326chr162640 2582 1890 833 604 438 1923 --2965 954
NM_015328chr752635 2174 969 680 594 1772 1374 --
NM_015331chr11656 ------
NM_015335chr1232037 2011 342 1941 12189 --
NM_015336chr1232066 1892 137 1355 12454 --
NM_015339chr20--1914 ----
NM_015344chr82813 452 ------
NM_015349chr62920 463 12590 1494 --
NM_015350chr11510 ------
NM_015354chr91368 ------
NM_015358chr212838 437 11074 ----
NM_015365chrX74280 4243 2995 1385 496 460 428 --1589 11227
NM_015382chr141151 1615 --1698
NM_015385chr1052963 2821 2253 2211 852 ------
NM_015387chr251989 1517 501 439 405 11592 ----
NM_015397chr911481 ------
NM_015428chr1941713 1707 537 521 11266 ----
NM_015436chr473041 720 560 548 386 246 163 12253 12941 --
NM_015455chr543455 3164 2851 1251 13158 13708 --
NM_015458chr8114561 4323 4279 3683 3263 1718 1560 1281 1275 969 533 15054 25214 1901 --
NM_015464chr72187 172 1250 ----
NM_015475chr23352 330 141 ------
NM_015508chr31588 1172 ----
NM_015520chr312819 ------
NM_015525chr6142 ----177
NM_015530chr2--1699 ----
NM_015534chr12401 387 1436 ----
NM_015542chr101406 ------
NM_015548chr61106 ------
NM_015550chr743334 3048 1189 520 23178 2310 11178 --
NM_015554chr1542949 2387 1834 1007 12834 1829 --
NM_015555chr631214 428 65 ------
NM_015564chr52559 130 ------
NM_015568chr2064123 3417 2866 1674 1521 477 --34326 1433 1081 --
NM_015569chr144000 1269 1256 312 2889 124 24089 3956 --
NM_015571chr6--12604 --12270
NM_015575chr233252 2578 52 --22467 2397 --
NM_015577chr511785 ------
NM_015578chr1941865 1756 779 70 --1765 --
NM_015584chr1751115 902 356 279 106 ------
NM_015601chr101280 2869 258 ----
NM_015602chr111108 --11640 --
NM_015622chr71282 ------
NM_015626chr17----11234 --
NM_015630chr2----1965 --
NM_015640chr155252 3973 1346 751 201 43246 1474 846 541 ----
NM_015641chr711021 ------
NM_015642chr31213 ------
NM_015652chr101253 ------
NM_015660chr7--1248 ----
NM_015678chr1311553 11441 ----
NM_015695chr651896 1511 596 523 157 --11398 --
NM_015702chr2179 1297 ----
NM_015713chr842667 1325 903 266 22249 1443 ----
NM_015723chr71573 ------
NM_015878chr852076 680 618 368 340 ------
NM_015879chr1877849 7843 6426 5360 2306 1475 538 37309 5981 5649 --22102 160
NM_015885chr111184 1644 ----
NM_015886chr895359 4867 3968 3943 3557 2055 1802 1443 1166 25606 1972 11294 --
NM_015906chr184863 4702 3692 3258 3106 896 880 832 24798 3473 --1564
NM_015955chr21366 ------
NM_015982chr17154 ------
NM_015990chr411025 ------
NM_015997chr1--1173 ----
NM_015999chr1182 ----1578
NM_016009chr173808 3276 1933 1704 1303 1285 727 21621 428 13853 --
NM_016019chr7--1229 ----
NM_016022chr11994 ------
NM_016023chr832168 1413 688 1116 1805 --
NM_016040chr152477 612 406 148 83 1414 ----
NM_016045chr2031508 628 101 1457 1738 --
NM_016048chr51329 ------
NM_016072chr1262069 2045 2028 712 669 118 22036 1556 ----
NM_016076chr142413 2088 470 125 ------
NM_016078chr1741049 435 163 150 11000 ----
NM_016079chr232269 921 638 ------
NM_016083chr643486 1013 865 67 12760 ----
NM_016087chr731640 1405 136 21293 1154 ----
NM_016096chr831753 1703 1639 ------
NM_016097chr182915 365 11009 ----
NM_016103chr52463 378 ------
NM_016107chr52504 128 ------
NM_016120chrX21037 157 --11162 --
NM_016121chr1178 ------
NM_016131chr242094 1671 1643 1521 --1692 12227
NM_016132chr1543417 3145 2349 312 53201 1064 1016 800 450 ----
NM_016133chr241214 1039 565 106 ----11381
NM_016142chr1111102 2923 329 11135 --
NM_016152chr341284 863 135 91 ------
NM_016156chr1152200 833 378 145 73 11673 ----
NM_016166chr15--1182 ----
NM_016192chr21242 ------
NM_016200chr71737 --176 --
NM_016203chr71269 ------
NM_016206chr3117116 6834 5643 5440 2699 2693 1560 851 735 707 283 --37413 6650 2088 --
NM_016213chr15----138 --
NM_016216chr3154 ------
NM_016217chr633228 1464 954 12763 --12838
NM_016231chr173637 300 53 21453 113 ----
NM_016239chr171774 --1755 --
NM_016248chr1343896 3156 2617 994 ------
NM_016260chr2127607 7235 7172 6124 5801 5274 5168 1379 1141 1062 784 708 57298 6266 4991 2781 1133 1383 26640 6055
NM_016271chr1852022 1992 1540 690 125 12308 --12327
NM_016272chr2232559 1076 280 ------
NM_016275chr342215 2131 1091 476 ------
NM_016287chr121837 77 --1745 --
NM_016289chr221493 499 --1871 --
NM_016290chr5--198 ----
NM_016300chr3----1440 --
NM_016303chrX--1453 ----
NM_016306chr31255 ------
NM_016308chr121928 1734 1386 21976 1893 --
NM_016319chr121716 ------
NM_016322chr943117 2825 2658 2177 ------
NM_016328chr7199 ------
NM_016356chr672846 2622 2166 2063 2030 924 871 12856 --12942
NM_016358chr5171 ------
NM_016377chr631765 600 61 11515 ----
NM_016383chrX--1745 ----
NM_016395chr15185 159 ----
NM_016396chr1541180 1070 576 551 --1216 --
NM_016418chr2233167 2387 1361 --22853 289 --
NM_016422chr1153222 2314 1020 785 470 --12377 --
NM_016423chr141314 ------
NM_016424chr1731842 1661 516 12013 ----
NM_016436chr2032478 731 363 --2518 265 11794
NM_016441chr242102 898 294 226 --11710 --
NM_016467chr211338 --1943 --
NM_016480chr55784 750 650 131 121 ------
NM_016485chr632257 873 177 188 ----
NM_016507chr1732817 2458 388 --12429 --
NM_016522chr1121447 1158 1182 1232 --
NM_016529chr13------1354
NM_016530chr1593919 3225 3203 2854 2662 2523 1212 1172 631 12547 11099 --
NM_016542chrX41342 1218 501 347 ------
NM_016544chr243822 3238 2948 541 23595 3022 23738 80 --
NM_016545chr13829 768 689 ------
NM_016559chr31576 ------
NM_016575chr1244984 3984 1120 73 --11276 --
NM_016578chr112653 145 ------
NM_016586chr141173 ------
NM_016587chr711014 11133 --156
NM_016603chr5--12131 ----
NM_016605chr532002 579 298 12744 1528 --
NM_016607chrX31631 153 98 ------
NM_016612chr81473 ------
NM_016613chr442106 2074 1785 296 ----1704
NM_016620chr121273 219 ------
NM_016621chr1174533 4495 4150 1708 1638 1290 161 11023 34518 3436 1170 --
NM_016623chr82256 67 1510 ----
NM_016626chr182446 377 ----11749
NM_016644chr51453 ------
NM_016654chr151215 1346 ----
NM_016824chr10--2520 221 --11177
NM_016836chr21105 ------
NM_016839chr21105 ------
NM_016936chr1652047 1921 858 670 33 11663 1865 --
NM_016950chr42273 250 --1191 1406
NM_016953chr266156 6099 5859 5850 1446 710 14046 24350 1572 1680
NM_017412chr8--21168 458 ----
NM_017415chr583345 3228 3045 1727 1539 755 734 102 --23870 228 --
NM_017420chr144529 523 319 104 21448 803 13665 --
NM_017423chr41335 --1829 11634
NM_017426chr41450 ------
NM_017440chr12187 ------
NM_017447chr2173614 3589 3102 2836 2722 1685 173 --11188 --
NM_017450chr17--11506 ----
NM_017456chr1721893 1852 ------
NM_017459chr11411 ------
NM_017510chr51674 ----1628
NM_017514chrX----1908 --
NM_017519chr6--1856 ----
NM_017548chr341637 1631 1452 1366 12093 ----
NM_017569chr131102 --142 --
NM_017594chr932683 2566 708 12117 12474 --
NM_017599chr1232066 1748 1594 32014 1676 461 ----
NM_017628chr474429 3371 1261 1157 1040 390 114 25031 1909 ----
NM_017629chr121532 105 3559 540 350 --21902 550
NM_017631chr4147 ------
NM_017632chr41113 ------
NM_017633chr643026 2821 2556 2452 ------
NM_017635chr111326 11150 1488 --
NM_017637chr989042 7556 3567 3013 710 367 346 221 22735 2457 13450 --
NM_017641chr12--1188 ----
NM_017644chr374668 1379 1270 1147 1062 939 756 1462 35046 4074 3691 --
NM_017658chr1483757 1012 883 773 749 165 135 71 21464 286 ----
NM_017661chr1521284 207 ------
NM_017666chrX12193 21992 358 ----
NM_017672chr15--11113 ----
NM_017679chr171581 ------
NM_017693chr1331653 498 457 1389 11343 --
NM_017694chr21798 ------
NM_017709chr134294 3151 163 --23909 963 --
NM_017724chr3----1102 --
NM_017736chr1662153 635 452 335 162 92 23016 2286 1355 --
NM_017737chr11636 11784 ----
NM_017745chrX2584 191 ------
NM_017753chr91754 1325 ----
NM_017769chr1433108 2968 2826 ------
NM_017778chr8--11138 ----
NM_017798chr2021002 794 ------
NM_017801chr342619 1888 1853 1732 1141 22581 947 --
NM_017811chr952703 2553 2484 1252 359 23004 2108 ----
NM_017813chr895716 5436 5122 4562 1964 1655 835 786 287 24190 4175 15148 --
NM_017830chr43722 93 30 ------
NM_017845chr42592 586 1296 ----
NM_017848chrX34576 3142 2959 --13722 --
NM_017880chr21465 ------
NM_017893chr1011124 ------
NM_017896chr2083547 2988 2752 2443 2397 689 533 421 ------
NM_017919chr984707 4635 4303 2309 1526 1028 983 920 ------
NM_017925chr931698 346 70 31873 1406 1320 ----
NM_017933chr231655 1503 304 ------
NM_017938chrX1818 1109 ----
NM_017944chr1163119 2966 1995 1183 1164 977 11029 135 --
NM_017948chr9--173 1477 --
NM_017958chr252857 2123 1893 710 90 1104 12690 --
NM_017988chr12----1180 --
NM_017994chr762771 2558 2494 1968 747 555 --11196 --
NM_018000chr22145 100 21926 415 ----
NM_018003chr1552398 1942 916 165 73 1971 ----
NM_018004chr3121 ------
NM_018008chr3--1277 ----
NM_018015chrX41151 1088 918 718 1133 ----
NM_018017chr1032341 1072 672 42757 1881 809 525 --1484
NM_018036chr1433890 3874 712 1817 --13544
NM_018046chr551794 703 562 235 32 ------
NM_018048chr1251788 1538 760 482 278 12005 1671 --
NM_018078chr421046 237 1930 1709 --
NM_018084chr222883 892 11153 ----
NM_018085chr1107314 7060 6484 6412 3171 2988 2589 2029 1244 794 36026 5259 3221 16941 --
NM_018086chr221414 92 ------
NM_018105chr82883 70 ------
NM_018112chr92984 676 1251 --1664
NM_018120chr83382 106 49 --11445 --
NM_018121chr1022093 493 12536 --1235
NM_018126chr43354 252 181 31532 1361 1260 ----
NM_018128chr172584 172 ------
NM_018133chr322221 1814 2727 51 ----
NM_018155chr373251 2796 2425 1074 971 307 131 --22251 909 --
NM_018169chr121109 1480 ----
NM_018177chr41348 1262 ----
NM_018178chr121275 386 11318 169 --
NM_018180chr102217 113 --1342 --
NM_018181chr1861518 1398 619 474 196 186 11834 ----
NM_018182chr174865 664 514 59 11489 ----
NM_018200chr1552537 1978 559 535 402 --21899 253 --
NM_018211chr11373 11384 ----
NM_018214chr621196 1119 21022 396 ----
NM_018223chr1241096 1018 301 119 ------
NM_018227chr441040 903 401 255 ----13224
NM_018237chr10--1261 ----
NM_018247chr622414 134 ----11966
NM_018254chr11291 11593 ----
NM_018299chr852892 1234 1048 382 71 13358 12203 --
NM_018302chr432102 570 185 2849 713 ----
NM_018312chr112708 568 1327 11794 --
NM_018313chr332687 2092 421 22621 2263 --1281
NM_018315chr411289 21249 1209 ----
NM_018317chr4135 ------
NM_018323chr441609 1363 156 114 ------
NM_018327chr2011496 1666 ----
NM_018334chr7----1384 --
NM_018351chr1284136 3920 3358 3343 3334 1776 1007 373 13029 13479 --
NM_018362chr1171482 1462 655 589 447 353 50 22883 1244 13189 --
NM_018364chr164096 3871 2816 1067 864 219 73982 3186 2948 2693 980 85 62 ----
NM_018369chr51142 2670 191 ----
NM_018374chr764493 3426 1618 1556 1171 679 24487 3971 13826 --
NM_018375chr14--1301 ----
NM_018388chrX31420 1271 1078 ------
NM_018398chr31224 ------
NM_018403chr363514 2703 1646 488 446 88 34142 1502 935 ----
NM_018429chr562834 2653 2369 2269 2012 1970 22415 1069 ----
NM_018439chr1832261 2106 467 --12126 --
NM_018440chr8108578 8431 7702 7188 7047 6882 6212 5990 2758 653 38728 5420 728 12463 --
NM_018442chr1----1113 --
NM_018444chr821840 181 1680 11470 --
NM_018448chr122870 516 ------
NM_018475chr43461 285 123 ----1180
NM_018482chr842546 2222 2115 1034 ------
NM_018490chr1121548 286 11677 --11248
NM_018502chr5--1294 ----
NM_018534chr21587 ------
NM_018557chr211335 --1140 --
NM_018566chr1114640 4561 4471 4146 3348 1797 1478 1383 925 846 683 11183 1517 --
NM_018571chr21675 ------
NM_018590chr1011635 11438 ----
NM_018638chr1254926 4342 4196 1498 379 35409 784 389 --15014
NM_018640chr1222732 605 1335 11871 --
NM_018650chr121819 56 --21595 640 --
NM_018657chr3----1804 1247
NM_018660chr862987 2830 2605 947 465 115 --12025 --
NM_018695chr532387 2137 762 21790 960 ----
NM_018703chr162402 264 ------
NM_018704chr11843 ------
NM_018712chr11----1261 --
NM_018717chr442432 2248 2221 690 --11060 --
NM_018724chr14647 521 109 52 ------
NM_018834chr51200 ------
NM_018840chr202454 389 --1362 --
NM_018844chr762040 1988 1827 617 525 369 1324 ----
NM_018846chr73932 83 69 ------
NM_018847chr931731 1626 411 11291 1310 --
NM_018890chr741314 1154 1109 584 --1605 --
NM_018898chr541994 395 372 36 ------
NM_018899chr541994 395 372 36 ------
NM_018900chr541994 395 372 36 ------
NM_018901chr541994 395 372 36 ------
NM_018902chr541994 395 372 36 ------
NM_018903chr541994 395 372 36 ------
NM_018904chr541994 395 372 36 ------
NM_018905chr541994 395 372 36 ------
NM_018906chr541994 395 372 36 ------
NM_018907chr541994 395 372 36 ------
NM_018908chr541994 395 372 36 ------
NM_018909chr541994 395 372 36 ------
NM_018910chr541994 395 372 36 ------
NM_018911chr541994 395 372 36 ------
NM_018912chr53667 568 84 11738 ----
NM_018913chr53667 568 84 11738 ----
NM_018914chr53667 568 84 11738 ----
NM_018915chr53667 568 84 11738 ----
NM_018916chr53667 568 84 11738 ----
NM_018917chr53667 568 84 11738 ----
NM_018918chr53667 568 84 11738 ----
NM_018919chr53667 568 84 11738 ----
NM_018920chr53667 568 84 11738 ----
NM_018921chr53667 568 84 11738 ----
NM_018922chr53667 568 84 11738 ----
NM_018923chr53667 568 84 11738 ----
NM_018924chr53667 568 84 11738 ----
NM_018925chr53667 568 84 11738 ----
NM_018926chr53667 568 84 11738 ----
NM_018927chr53667 568 84 11738 ----
NM_018928chr53667 568 84 11738 ----
NM_018929chr53667 568 84 11738 ----
NM_018932chr52665 249 ------
NM_018945chr643469 2514 1095 931 2893 439 13656 --
NM_018947chr774990 4752 3815 3253 1138 486 182 23724 3700 11946 11417
NM_018951chr72930 799 ------
NM_018970chr782414 1958 1270 1262 1154 706 592 137 21208 110 ----
NM_018979chr123667 296 171 1718 ----
NM_018999chr1064612 4437 4157 3860 3754 3378 11286 21929 1557 13275
NM_019000chr531141 671 345 --11420 --
NM_019001chr394841 4133 3739 3485 3328 3118 1407 1195 598 33964 2953 1340 1551 --
NM_019004chr741958 1793 1556 404 1553 11993 --
NM_019005chr72265 142 ------
NM_019027chr432089 165 155 12487 11821 --
NM_019045chrX1793 --1734 --
NM_019049chr1----1743 --
NM_019050chr491974 1833 1804 1755 1574 1544 893 690 303 12122 ----
NM_019063chr222001 526 31411 179 142 ----
NM_019072chr563169 2675 1518 1217 1194 388 21292 1069 --11355
NM_019080chr1351565 1198 1038 341 126 ------
NM_019084chr1042621 2376 1781 406 ------
NM_019087chr531508 1156 1143 11209 ----
NM_019116chr1632425 1013 704 --1575 --
NM_019117chrX31253 875 382 33337 1323 1086 ----
NM_019556chrX41270 1118 950 552 11049 ----
NM_019590chr1021428 956 ------
NM_019592chr92649 625 ------
NM_019597chrX1202 ------
NM_019600chr152540 126 --1724 --
NM_019605chr13517 250 85 1587 ----
NM_019610chr111946 11572 ----
NM_019862chr1651702 594 508 472 425 --21183 320 --
NM_019891chr111323 --11303 --
NM_019898chr1651702 594 508 472 425 --21183 320 --
NM_019899chr1651702 594 508 472 425 --21183 320 --
NM_019900chr1651702 594 508 472 425 --21183 320 --
NM_019903chr10--2520 221 --11177
NM_020120chr23438 64 45 11517 21274 301 --
NM_020122chr274410 4279 1780 1766 1288 1221 780 ----1401
NM_020141chr122011 1829 1845 21467 622 --
NM_020148chr1873083 2409 2044 1095 974 771 693 32359 2186 734 ----
NM_020150chr1031901 782 129 --1415 130
NM_020151chr251772 1144 609 585 423 11282 21329 1314 --
NM_020152chr211137 ------
NM_020156chr72506 450 ------
NM_020159chr421441 251 --11498 --
NM_020177chr542618 2329 447 363 ------
NM_020180chr1811162 ------
NM_020189chr81187 ------
NM_020193chr1161285 1191 1069 414 293 257 --11130 --
NM_020194chr22605 267 ------
NM_020204chr13248 173 24 --1269 --
NM_020205chr153478 3292 2581 743 358 ------
NM_020216chr12413 99 ------
NM_020225chr41106 ------
NM_020226chr42690 569 --1266 --
NM_020228chr1142533 470 277 125 21879 1733 ----
NM_020245chr674670 4152 4015 1918 1778 899 52 23163 1503 ----
NM_020337chr422586 2047 12955 ----
NM_020341chr2041983 1629 538 465 ------
NM_020342chr21818 42176 2050 1989 1711 1184 --
NM_020353chr341546 1327 563 458 11922 --11463
NM_020379chr13942 648 373 ------
NM_020381chr641355 595 556 199 ------
NM_020390chr374820 3833 3579 1135 943 728 143 11824 ----
NM_020420chrY71597 1508 1463 1201 1174 418 150 2623 232 ----
NM_020432chr72190 96 12314 11647 --
NM_020443chr146638 5759 1422 399 --35926 5601 277 16352
NM_020445chr72706 538 ------
NM_020449chrX1782 ----1301
NM_020455chr6--1132 11129 --
NM_020457chr161648 ------
NM_020463chr221403 146 21100 35 1595 --
NM_020466chr674561 4279 3919 3743 3275 1629 655 23990 88 ----
NM_020474chr1821691 751 31890 1328 733 1251 --
NM_020529chr14--156 ----
NM_020546chr533004 2816 585 32729 2155 651 ----
NM_020548chr21187 ------
NM_020645chr111456 ------
NM_020648chr1862792 2694 2583 2465 2296 1946 12165 1414 --
NM_020651chr231695 206 85 11428 1222 --
NM_020654chr3--1109 ----
NM_020666chr52734 175 ----1759
NM_020673chr20137364 7177 6341 5988 5848 5063 2173 1238 1010 990 300 99 84 57513 5769 5419 5374 3028 1106 --
NM_020715chr1441912 855 662 89 21716 645 --11441
NM_020717chrX53889 3876 3652 1160 1133 --11061 --
NM_020718chr1666229 2432 1665 1410 1321 535 35801 5335 4302 ----
NM_020724chr472564 2198 953 853 806 525 159 12137 11976 1799
NM_020727chr2153802 3770 3656 1154 261 33434 2491 1251 ----
NM_020732chr6--1856 ----
NM_020734chr1232892 2381 759 --11198 --
NM_020737chr6181 ------
NM_020739chr1543870 884 118 41 13520 ----
NM_020742chrX32668 1694 644 11836 ----
NM_020748chr1741808 1639 1524 353 1777 ----
NM_020750chr621196 425 --11268 --
NM_020752chr1022385 743 --12374 --
NM_020754chr31487 ------
NM_020755chr611502 1208 ----
NM_020760chr221748 1434 11474 ----
NM_020766chrX23193 1320 31612 1582 922 ----
NM_020771chr621516 1175 --11411 --
NM_020772chr1778416 7865 2602 1989 1584 1502 285 38239 7425 5303 ----
NM_020773chr422551 460 1353 ----
NM_020774chr1885371 4921 4814 3883 1941 1484 1441 1104 25958 5224 ----
NM_020782chr12104868 4730 4459 4297 4003 3966 3922 3866 3284 42 23491 2999 --1817
NM_020783chr1821996 944 ------
NM_020794chr121575 237 1202 ----
NM_020796chr572768 2740 2518 2329 2218 2175 831 ------
NM_020800chr321138 268 ------
NM_020801chr521962 247 12316 ----
NM_020802chr1143179 2657 2200 1064 ----11000
NM_020806chr14183 ------
NM_020808chr1------1332
NM_020809chr1122149 649 ------
NM_020810chr1443557 3086 754 601 22933 571 ----
NM_020824chr101539 --1547 1515
NM_020830chr232831 2225 1063 12550 --1295
NM_020841chr1273845 3790 3506 3449 628 318 77 23092 434 ----
NM_020844chr866756 2722 2029 1484 1161 524 47360 7304 2392 564 26145 1624 --
NM_020854chr1821480 293 197 --11104
NM_020859chr483375 3297 3250 3029 1473 1312 414 292 21435 1329 ----
NM_020861chr621365 363 ------
NM_020868chr231828 1767 250 --11924 --
NM_020872chr351289 1182 1101 677 263 --11268 --
NM_020873chr31811 ------
NM_020890chr3--1193 ----
NM_020897chr111111 11338 11087 --
NM_020899chr1782344 2320 2288 1728 1584 547 213 168 ------
NM_020918chr1043658 907 779 283 1480 12600 --
NM_020921chr1483350 1106 724 459 288 163 138 117 --1299 --
NM_020922chrX31435 608 113 11503 --1482
NM_020926chrX130 ------
NM_020940chr1032383 2185 987 ----11031
NM_020948chr143558 3325 799 440 22377 1433 13627 1122
NM_020951chr1951820 921 309 238 226 22132 435 ----
NM_020952chr9167 ------
NM_020975chr1021539 1271 11672 --1230
NM_020977chr431691 1652 317 1704 ----
NM_020981chr23822 561 115 ------
NM_020987chr102484 32 ------
NM_021003chr14125 ------
NM_021005chr1541030 475 367 276 --11128 --
NM_021007chr231921 1898 614 --11532 --
NM_021025chr52506 347 ------
NM_021033chr1353237 3171 2630 774 190 11358 11380 --
NM_021047chr192259 85 ------
NM_021069chr422114 1589 --2656 642 --
NM_021072chr532522 2248 1688 1792 --22486 820
NM_021100chr20----1370 2877 217
NM_021102chr191372 ------
NM_021106chr91493 ------
NM_021110chr82753 604 ------
NM_021120chrX32296 175 143 ----12660
NM_021136chr141527 ------
NM_021140chrX2893 424 --1846 1863
NM_021144chr91557 ------
NM_021148chr732020 857 691 --196 --
NM_021151chr721077 962 1305 ----
NM_021159chr431126 681 485 ------
NM_021163chr763556 2739 760 684 587 451 1238 ----
NM_021188chr14----2430 348 --
NM_021190chr141012 538 429 86 21091 1061 11318 --
NM_021194chr1--1233 ----
NM_021204chr41345 1802 ----
NM_021215chr2052317 2091 1963 1667 522 ------
NM_021227chr4--157 ----
NM_021229chr1221066 980 1177 --1135
NM_021238chr1281954 1791 1542 741 597 590 498 359 42115 1679 292 252 1102 --
NM_021239chr142554 468 11277 --11015
NM_021240chr93540 257 239 ------
NM_021255chr1443844 3788 1054 300 11619 13359 --
NM_021622chr1042406 2136 1537 763 11511 ----
NM_021627chr32991 801 --1958 --
NM_021633chr141425 1112 1094 438 ------
NM_021644chr103841 825 27 1373 --1954
NM_021705chr621300 129 ------
NM_021722chr71105 ------
NM_021728chr14--2224 64 ----
NM_021738chr10----1116 --
NM_021794chr13313 279 120 ------
NM_021813chr685788 5441 5046 4195 1853 1271 1172 266 2410 128 35373 1563 869 --
NM_021815chr252572 819 395 359 234 --1293 --
NM_021818chr1451467 1427 1228 612 26 ------
NM_021821chr121844 --1165 --
NM_021830chr10--2872 309 ----
NM_021911chr534498 4122 3632 24955 3405 ----
NM_021912chr1554116 3464 2795 313 70 ------
NM_021913chr1941172 1159 437 288 --1328 --
NM_021914chr1422395 556 ----1695
NM_021934chr121298 ------
NM_021935chr31806 155 ----
NM_021940chr61279 ------
NM_021943chr61839 22152 2146 1881 --
NM_021946chrX1919 11449 ----
NM_021951chr94697 267 220 136 1350 ----
NM_021956chr631182 1123 440 ------
NM_021957chr122507 113 ------
NM_021960chr142242 1959 1035 758 ----11062
NM_021961chr1186144 4620 2862 2849 2673 2158 1659 888 11085 12453 --
NM_021963chrX1248 ----1159
NM_021964chr3136563 5832 5782 4209 2516 2379 2217 1915 1881 1863 1659 1461 375 35975 4713 803 15358 --
NM_021998chrX31041 503 354 11217 ----
NM_022041chr1652200 1095 1054 988 774 22714 2028 ----
NM_022048chr1594809 4735 4524 1918 1835 1756 1710 911 760 25791 4755 ----
NM_022063chr102585 152 21689 1635 1562 --
NM_022066chr172991 139 ------
NM_022079chr101280 2869 258 ----
NM_022114chr174220 3979 1056 592 468 215 192 1762 ----
NM_022116chr74685 245 171 41 ------
NM_022121chr651233 1219 1082 1015 805 ------
NM_022130chr53973 341 51 1208 ----
NM_022136chr21------1499
NM_022166chr1696214 6100 5848 4762 4615 2069 2040 802 114 35948 4892 3866 ----
NM_022340chr3113298 3254 2420 1402 1216 1198 1112 664 601 388 37 ------
NM_022351chr853568 3244 2527 1170 769 22768 755 13159 --
NM_022373chr73744 237 33 1722 1184 --
NM_022443chr3129 ------
NM_022459chr1386304 6030 5710 5689 4697 4501 2481 552 45135 4612 4063 2223 35723 511 74 --
NM_022465chr1223052 473 --22937 87 12425
NM_022470chr32971 77 1374 ----
NM_022474chr1441875 929 893 634 22512 2443 11927 --
NM_022476chr16--1839 ----
NM_022496chr123498 351 334 ------
NM_022553chr6196 ------
NM_022566chr151588 ------
NM_022650chr51346 1959 ----
NM_022716chr142363 1247 1132 501 1332 ----
NM_022735chr1126 --11358 --
NM_022763chr321262 934 ------
NM_022768chr11127 ------
NM_022781chr932384 2347 170 23157 538 ----
NM_022782chr121379 1112 ----
NM_022783chr8----1115 1147
NM_022802chr1031161 244 93 ------
NM_022824chr531486 1460 239 ------
NM_022831chr141434 1339 561 372 ------
NM_022832chr42696 115 11874 21769 369 --
NM_022845chr163846 671 227 21560 782 ----
NM_022893chr243095 2751 2224 548 21008 518 ----
NM_022898chr1464017 3685 3063 1629 1571 567 --14293 --
NM_022909chr5--1528 ----
NM_022912chr232697 431 302 13088 ----
NM_022965chr411448 --11306 11363
NM_022970chr1011205 ------
NM_022977chrX42422 1785 1651 178 ------
NM_023000chr1451384 1341 1187 690 604 ------
NM_023001chr1451384 1341 1187 690 604 ------
NM_023010chrX1143 2589 577 ----
NM_023016chr242826 2802 790 361 1637 ----
NM_023037chr1331106 1064 844 ------
NM_023039chr5163 ------
NM_023923chr173769 2960 2899 2583 2316 684 481 --1246 1168
NM_023929chr8--22615 575 1433 --
NM_024007chr511192 12831 ----
NM_024017chr1731541 210 116 ------
NM_024019chr421059 314 ------
NM_024052chr1763077 983 954 561 231 198 --1785 --
NM_024082chrX------1139
NM_024086chr1743130 2686 563 335 1730 --22592 1393
NM_024090chr41658 11941 ----
NM_024094chr83566 344 104 1850 ----
NM_024295chr851759 1594 1542 1289 117 --11961 --
NM_024312chr1241144 1107 404 375 1598 --1570
NM_024334chr351864 1552 1278 746 693 ------
NM_024345chr9115807 5500 5360 5140 4630 4236 4212 4085 2051 1482 586 --1396 --
NM_024408chr152806 2595 852 817 610 21128 893 ----
NM_024415chr5153 --167 --
NM_024422chr18101969 1775 1693 1667 1648 1572 752 690 683 559 31547 645 566 ----
NM_024429chr71269 ------
NM_024519chr16------1292
NM_024524chr372689 2486 2279 1067 932 339 64 12626 12215 --
NM_024525chr11652 ------
NM_024529chr12883 232 ------
NM_024539chrX1891 ------
NM_024548chr3--1644 1169 --
NM_024556chr113450 381 343 ------
NM_024561chr131208 2927 376 ----
NM_024569chr162872 1063 945 648 637 47 1491 ----
NM_024582chr421017 881 ------
NM_024594chr541790 1515 1306 734 ----11596
NM_024595chr11304 ------
NM_024624chr251548 1444 597 388 244 11184 ----
NM_024638chr322294 2163 11003 12350 --
NM_024639chr642608 1959 888 707 ------
NM_024646chr133576 2557 202 23917 284 --12718
NM_024665chr384500 4355 3934 2860 1826 987 324 259 13565 1182 --
NM_024675chr16------166
NM_024700chr141008 790 129 50 ------
NM_024709chr11542 ----12334
NM_024721chr832512 1821 799 1606 ----
NM_024757chr931110 907 291 11099 ----
NM_024772chr11438 ------
NM_024811chr111321 11850 ----
NM_024824chr1431661 593 44 1126 ----
NM_024828chr91430 --11209 185
NM_024837chr1531654 517 74 ------
NM_024847chr1661274 977 934 323 121 75 ------
NM_024920chr431421 1289 1245 1294 ----
NM_024930chr562790 2267 2208 606 407 173 --1536 --
NM_024947chr3149530 9157 8702 8216 8077 7026 6666 6236 5925 2679 1635 683 639 407 59209 3646 3510 2745 35 22528 2029 --
NM_024949chr474359 3682 3634 3219 1460 1005 824 11937 ----
NM_024953chr1241953 622 611 315 11012 1402 --
NM_024971chr9167 ------
NM_024989chr287348 6192 3023 2843 2203 517 442 145 21432 1327 42721 2710 2648 1589 --
NM_024991chr1052963 2821 2253 2211 852 ------
NM_024993chr21403 21325 486 ----
NM_025027chr192486 372 21021 915 ----
NM_025047chr3--1327 ----
NM_025054chr853971 3275 1575 956 831 23931 293 --13342
NM_025073chr154587 3887 3499 1022 809 24684 4295 --12995
NM_025076chr21258 --1524 --
NM_025126chr12--1767 ----
NM_025133chr22895 804 ------
NM_025134chr1612131 32417 795 362 ----
NM_025138chr1321189 1179 11078 ----
NM_025146chr342645 2412 2115 253 ----1153
NM_025154chr731146 350 325 ----11558
NM_025160chr163972 2977 1550 1287 1234 618 ----12635
NM_025181chr2169 --1767 --
NM_025191chr152882 2752 2394 534 364 43571 2819 2709 1323 ----
NM_025208chr1122042 136 --12391 12171
NM_025211chr92240 99 ------
NM_025238chr1511143 1641 21609 293 --
NM_025248chr1753219 1123 981 703 667 ------
NM_025268chr141396 ------
NM_030594chr1531361 896 257 --1182 --
NM_030621chr1451504 691 641 623 332 23729 200 13559 --
NM_030625chr1012098 32056 228 220 ----
NM_030627chr553896 3788 3719 2629 433 1231 ----
NM_030636chr731553 903 490 12155 ----
NM_030637chr143213 164 105 ------
NM_030647chr796116 5790 5691 4420 4267 4233 1406 984 250 22364 549 ----
NM_030648chr444619 4190 3968 1865 --25477 1323 --
NM_030650chr253728 2675 1551 1440 874 142 23981 1509 12642
NM_030652chr61282 ------
NM_030660chr1441501 1268 1230 231 1977 ----
NM_030664chr10----11552 --
NM_030751chr1031893 1640 243 31703 1603 1356 ----
NM_030751chr1031893 1640 243 31703 1603 1356 ----
NM_030755chr1473001 2463 2439 608 564 480 136 22614 2168 1292 --
NM_030756chr101256 1319 ----
NM_030777chr2072498 2344 1777 484 291 190 98 ----1746
NM_030780chr831479 1202 260 --1519 --
NM_030784chr61369 ------
NM_030791chr1421392 638 --1253 --
NM_030806chr1129358 9182 6730 6529 5877 5854 5709 3247 2165 1915 1418 1213 ----13667
NM_030811chr201370 ------
NM_030816chr142741 1399 1341 775 1953 1176 --
NM_030820chr641055 947 353 51 1301 ----
NM_030877chr201101 ------
NM_030881chr2232075 1592 890 --1697 --
NM_030885chr331449 912 602 12031 ----
NM_030918chr185235 4724 4208 2019 1495 551 263 171 ----11851
NM_030920chr122003 1496 ------
NM_030937chr121157 973 ------
NM_030938chr1721062 439 ------
NM_030939chr63339 87 49 ------
NM_030940chr911390 11371 ----
NM_030949chr62355 148 ----1473
NM_030958chr82394 27 ------
NM_030963chr62661 231 1588 ----
NM_030965chr1----1538 --
NM_030978chr91379 ------
NM_031216chr1831915 1456 702 12121 11427 --
NM_031217chr111219 ------
NM_031244chr621126 864 ------
NM_031262chr9--1829 ----
NM_031263chr9152 1886 ----
NM_031284chr151860 ------
NM_031292chr1221725 1194 ------
NM_031296chr43809 767 584 22606 2318 1452 --
NM_031305chr441446 640 290 233 1569 11325 --
NM_031314chr1431857 1421 205 2558 216 ----
NM_031411chr541994 395 372 36 ------
NM_031419chr321391 1025 11304 ----
NM_031427chr1435948 3743 1856 --25889 2162 15127
NM_031431chr1331514 506 60 11770 11167 --
NM_031435chr1243276 2345 2314 491 199 ----
NM_031439chr81364 --1241 --
NM_031442chrX33144 2240 273 --11975 12231
NM_031443chr71327 ------
NM_031453chr1022301 755 ------
NM_031463chr1621570 26 1332 ----
NM_031476chr162444 239 22720 911 22590 1065 --
NM_031844chr153673 3617 3421 2649 1329 13698 ----
NM_031845chr283211 2879 2778 2300 1453 1084 475 437 12258 13357 --
NM_031847chr283211 2879 2778 2300 1453 1084 475 437 12258 13357 --
NM_031849chr541994 395 372 36 ------
NM_031857chr541994 395 372 36 ------
NM_031858chr1721083 226 ----11513
NM_031860chr541994 395 372 36 ------
NM_031862chr1721083 226 ----11513
NM_031866chr10----1934 --
NM_031922chr61421 ------
NM_031953chr4--1128 ----
NM_032042chr542787 1097 907 718 ------
NM_032088chr53667 568 84 11738 ----
NM_032092chr53667 568 84 11738 ----
NM_032116chr13105144 4028 3671 1822 1320 1008 788 519 341 181 25170 1796 35465 4199 2272 --
NM_032125chr1----1927 --
NM_032132chr11130 ------
NM_032145chr611646 ------
NM_032147chr121401 --1877 1200
NM_032153chr352320 1028 940 566 461 ------
NM_032154chr102434 314 1916 ----
NM_032160chr18104231 3635 3302 1285 1040 673 645 452 307 74 14327 ----
NM_032165chr12----1247 --
NM_032186chr121273 219 ------
NM_032189chr1334808 4748 557 --12034 --
NM_032199chr1053419 3035 1280 1088 680 13381 21435 207 --
NM_032221chr2042051 1809 1437 169 11639 ----
NM_032228chr1131154 768 482 12370 ----
NM_032229chr1311113 11104 ----
NM_032233chr141787 ------
NM_032236chr13962 359 52 --11109 --
NM_032239chr42284 169 21344 262 ----
NM_032246chr152362 311 11077 --11276
NM_032291chr121372 1327 21561 794 --1284
NM_032312chr21581 ------
NM_032321chr242462 1282 870 466 43222 3021 802 198 ----
NM_032373chr10135125 5119 4878 4818 4526 4192 4160 1459 1326 1270 1229 1219 372 25450 2167 14370 --
NM_032379chr112707 376 1809 ----
NM_032403chr53667 568 84 11738 ----
NM_032424chr111265 1533 1241 --
NM_032433chr1941554 1358 1274 263 ------
NM_032435chr111636 21924 531 ----
NM_032440chr1022355 1797 ------
NM_032446chr563871 3655 3100 2829 2540 1083 33514 3423 227 ----
NM_032449chr162239 2187 540 453 145 93 ------
NM_032457chr443263 1180 890 734 23889 2842 21500 1447 12997
NM_032458chrX43263 2934 1229 513 23058 2669 ----
NM_032466chr811536 2650 295 ----
NM_032468chr811536 2650 295 ----
NM_032485chr201662 ------
NM_032499chr151163 ------
NM_032505chr321858 639 31776 1053 626 --1103
NM_032507chr61228 ------
NM_032521chr2052272 1264 897 701 511 12607 --12465
NM_032539chrX1170 ------
NM_032547chr41955 ----11138
NM_032558chr921092 946 11230 ----
NM_032560chr142995 849 ----1830
NM_032582chr1731343 1299 334 1447 ----
NM_032598chr17141 ------
NM_032622chr43993 194 81 11045 ----
NM_032632chr1471957 1894 1840 1769 1539 466 436 ------
NM_032689chr192270 117 ------
NM_032711chr1763718 2962 2766 2712 979 973 --127 --
NM_032778chr333299 2103 644 12523 21143 637 --
NM_032784chr611028 ------
NM_032800chr172561 2332 2316 1832 1008 620 216 --32203 893 689 --
NM_032801chr1132362 1744 309 1980 1724 --
NM_032804chr1032166 1649 419 12159 ----
NM_032818chr942325 1922 573 534 --12301 --
NM_032826chr764739 1937 1449 1184 331 300 ------
NM_032859chr1352696 2434 905 839 154 43497 1161 1139 1129 ----
NM_032864chr151387 502 351 192 107 --1160 --
NM_032900chr1013837 --12446 --
NM_032905chr101350 ----11316
NM_032918chr121319 1154 ----
NM_032924chr731162 251 39 --11072 --
NM_032927chr41559 1665 121 --
NM_032932chr1786364 4653 1765 1704 1680 1670 1144 452 21317 731 46156 5395 1243 854 --
NM_032943chr112707 376 1809 ----
NM_032961chr411122 ------
NM_032967chrX1386 ------
NM_032971chrY1413 ------
NM_032972chrY1413 ------
NM_032973chrY43456 1358 521 500 --1852 --
NM_032991chr41384 ------
NM_032999chr731019 421 190 ----1938
NM_033000chr731019 421 190 ----1938
NM_033001chr731019 421 190 ----1938
NM_033020chr184863 4702 3692 3258 3106 896 880 832 24798 3473 --1564
NM_033030chr211505 11460 ----
NM_033083chr383333 3283 2735 2479 496 401 151 119 1346 13259 --
NM_033089chr2021487 149 ------
NM_033107chr72500 450 ----11653
NM_033135chr1122042 136 --12391 12171
NM_033138chr721446 376 12055 ----
NM_033139chr721446 376 12055 ----
NM_033140chr721446 376 12055 ----
NM_033143chr454627 3962 3357 3197 378 23245 964 ----
NM_033157chr721446 376 12055 ----
NM_033181chr643486 1013 865 67 12760 ----
NM_033196chr1921460 137 --1420 --
NM_033207chr1022220 635 --11717 --
NM_033211chr531339 1331 497 ------
NM_033222chr91389 31377 1298 78 ----
NM_033224chr787379 6613 6504 6208 6041 3078 1623 492 76319 5575 5562 2882 2238 1149 812 12560 18052
NM_033285chr864472 4345 3885 3379 3364 2739 23908 120 ----
NM_033326chr112854 152 5921 628 606 295 118 1179 --
NM_033331chr963292 2251 1415 1100 173 153 23354 2823 ----
NM_033360chr1273519 3081 2849 1856 1740 1159 288 33125 1434 1043 21029 322 --
NM_033389chr1741894 966 693 632 --1560 --
NM_033393chr452536 1087 680 352 337 ----12128
NM_033394chr221594 70 11578 11527 --
NM_033396chr111445 ------
NM_033407chr11530 ------
NM_033425chr1132877 2619 715 13471 ----
NM_033426chr1412913 ----12123
NM_033427chr71699 3562 271 246 ----
NM_033449chr511663 ------
NM_033450chr6--1279 ----
NM_033512chr842705 2135 753 508 12287 ----
NM_033515chr631141 294 254 ------
NM_033516chr941617 343 291 45 ----1448
NM_033540chr331026 956 374 1194 ----
NM_033551chr512304 1301 ----
NM_033632chr411289 21249 1209 ----
NM_033656chr2195971 5814 5695 5443 4727 4410 3677 265 175 24399 4051 35636 5283 982 14991
NM_044472chr11146 ------
NM_048368chr18--1296 ----
NM_052811chr1394907 4331 3908 3816 2076 2016 946 595 24 23336 1993 1389 --
NM_052832chr832850 2288 2212 22593 240 ----
NM_052840chr152456 340 ------
NM_052851chr1332026 1604 926 ------
NM_052865chr201342 --1767 1909
NM_052868chr11249 ------
NM_052879chr1223839 3281 ------
NM_052885chr1273677 3200 1280 873 740 452 110 34638 4424 4416 ----
NM_052900chr811412 11587 --1191
NM_052904chr631207 1090 905 1107 21295 263 --
NM_052905chr231880 1476 1356 ------
NM_052917chr283139 3037 2384 2126 1233 776 681 516 196 ----
NM_052918chr1073520 3376 3020 2272 1175 1057 631 ------
NM_052923chr61194 ------
NM_052927chr542255 1749 1569 1514 --180 22213 1457
NM_052937chr822137 45 --11980 --
NM_052966chr173141 3022 2734 1433 1138 323 24 ------
NM_053016chr987513 7498 5165 5151 1747 1615 1543 1327 ----12259
NM_053043chr7125804 5777 5168 4947 4857 2001 1500 1188 1044 736 377 248 --1437 --
NM_053053chr11684 ------
NM_053056chr1183077 3056 3028 2598 2443 2141 2056 1080 12095 ----
NM_053064chr1432377 2042 808 --22337 57 --
NM_053281chrX187 ------
NM_054016chr11116 11337 ----
NM_054016chr11116 11337 ----
NM_054016chr11116 11337 ----
NM_057159chr9--11052 ----
NM_057168chr731640 1405 136 21293 1154 ----
NM_057749chr821239 496 176 1348 --
NM_058170chr131354 273 251 ------
NM_058172chr41676 --1396 --
NM_080546chr931714 816 513 ------
NM_080594chr162656 54 ----1752
NM_080599chr101406 ------
NM_080607chr20----1719 --
NM_080617chr20--1330 ----
NM_080629chr131541 1487 80 ------
NM_080630chr131541 1487 80 ------
NM_080632chrX1143 2589 577 ----
NM_080645chr64847 329 290 95 ------
NM_080759chr1352482 1908 1641 866 166 12077 ----
NM_080760chr1352482 1908 1641 866 166 12077 ----
NM_080798chr10166 ------
NM_080799chr10166 ------
NM_080800chr10166 ------
NM_080801chr10166 ------
NM_080802chr10166 ------
NM_080803chr10166 ------
NM_080804chr10166 ------
NM_080805chr10166 ------
NM_080806chr10166 ------
NM_080807chr10166 ------
NM_080808chr10166 ------
NM_080809chr10166 ------
NM_080810chr10166 ------
NM_080811chr10166 ------
NM_080812chr10166 ------
NM_080813chr10166 ------
NM_080814chr10166 ------
NM_080815chr10166 ------
NM_080867chr1484939 4218 3585 3294 1974 1008 740 479 14130 ----
NM_080872chr853830 3095 1623 1105 981 --1413 --
NM_080927chr362683 2492 2202 2080 1110 1059 11324 ----
NM_130391chr952331 1001 781 505 56 12731 ----
NM_130392chr952331 1001 781 505 56 12731 ----
NM_130393chr952331 1001 781 505 56 12731 ----
NM_130434chr153799 369 152 11016 ----
NM_130438chr2163018 2943 900 597 545 182 13192 ----
NM_130439chr1011794 11584 ----
NM_130439chr1011794 11584 ----
NM_130442chr731108 1037 999 --1988 --
NM_130787chr19164 ------
NM_130795chr91493 ------
NM_130797chr71150 ----1562
NM_130798chr1551095 573 485 82 75 --1611 11290
NM_130809chr543122 978 427 107 12234 12083 --
NM_130846chr12------1809
NM_133170chr2086561 6069 5999 2489 965 678 318 172 13179 11261 26303 2056
NM_133171chr201163 ------
NM_133265chrX43414 2875 2605 938 11391 1535 --
NM_133326chr12240 31 ------
NM_133334chr455851 5232 4696 4089 3892 1546 34174 1837 516 --
NM_133367chr643382 2597 2504 602 --23153 161 12316
NM_133370chr463228 2681 2375 1075 1023 550 11381 11276 --
NM_133372chr562695 2017 1827 448 391 303 --22498 2371 --
NM_133378chr23278 240 107 ------
NM_133432chr23278 240 107 ------
NM_133433chr52683 339 193 ----
NM_133437chr23278 240 107 ------
NM_133443chr1611834 ------
NM_133493chr654150 3700 3586 1296 570 24582 2926 21819 104 --
NM_133496chr173518 3116 1508 890 701 395 211 14291 ----
NM_133625chr31281 1462 ----
NM_133631chr31504 ------
NM_133638chr51289 11006 ----
NM_133647chr1553871 2466 2388 1330 234 12951 --13290
NM_134265chr17----11234 --
NM_134424chr12----11036 --
NM_134427chr91493 ------
NM_134428chr92365 339 ------
NM_138270chrX42878 2238 1155 628 33460 1234 135 ----
NM_138288chr142439 212 22035 550 1764 --
NM_138346chr11158 ------
NM_138348chr5136299 5849 5837 5435 5414 4794 2460 2372 2289 802 301 182 82 11555 56621 6308 4888 4160 2469 --
NM_138350chr1--11051 ----
NM_138369chr51468 ----1677
NM_138370chr22732 185 ------
NM_138415chr2211884 ------
NM_138426chr722269 174 ------
NM_138437chrX2313 241 ------
NM_138443chr181184 ------
NM_138444chr1384797 4352 4170 4116 3923 1280 616 511 11947 --1539
NM_138459chr643248 2706 1421 315 1895 13636 --
NM_138468chr266157 2512 2022 1937 442 259 ------
NM_138473chr12105195 4667 4610 4323 4216 4190 3606 1197 1176 973 --13658 --
NM_138554chr92645 384 22214 892 2330 203 --
NM_138558chr11774 ------
NM_138569chr6140 ------
NM_138576chr1464017 3685 3063 1629 1571 567 --14293 --
NM_138578chr2031205 366 159 --1942 --
NM_138609chr51111 ------
NM_138610chr51111 ------
NM_138620chr91102 ------
NM_138633chr631765 600 61 11515 ----
NM_138638chr1422395 556 ----1695
NM_138694chr632311 674 262 13357 ----
NM_138713chr1697903 6792 2375 2102 1917 1901 1357 1068 246 35290 829 517 16395 --
NM_138714chr1697903 6792 2375 2102 1917 1901 1357 1068 246 35290 829 517 16395 --
NM_138730chr61344 ------
NM_138732chr111925 1298 1960 --
NM_138734chr111925 1298 1960 --
NM_138735chr22489 40 11095 ----
NM_138766chr51177 ------
NM_138771chr7----1272 --
NM_138775chr11148 ----1137
NM_138779chr131256 ------
NM_138782chr542113 2065 454 258 ----12287
NM_138821chr51177 ------
NM_138822chr51177 ------
NM_138931chr32852 795 ------
NM_138959chr1106474 5117 5089 4203 2716 2628 2182 1835 1211 898 16263 ----
NM_138970chr1452182 2037 1897 1525 400 --22174 30 --
NM_138971chr1153119 3095 2987 2972 2670 1676 12424 --
NM_138971chr1153119 3095 2987 2972 2670 1676 12424 --
NM_138972chr1153119 3095 2987 2972 2670 1676 12424 --
NM_138972chr1153119 3095 2987 2972 2670 1676 12424 --
NM_138973chr1153119 3095 2987 2972 2670 1676 12424 --
NM_138973chr1153119 3095 2987 2972 2670 1676 12424 --
NM_139072chr21576 --1108 --
NM_139135chr11322 ------
NM_139136chr123965 690 320 --1872 --
NM_139168chr521301 592 1497 11600 --
NM_139169chr1062223 1793 1711 699 495 302 32040 1896 1515 ----
NM_139201chr121634 ------
NM_139215chr17----160 --
NM_139241chr121195 ------
NM_139244chr62743 48 ------
NM_139283chr1282581 2332 1858 1847 685 574 473 122 ------
NM_139316chr73873 746 675 ------
NM_139321chr2072966 2899 2872 1652 843 654 411 1682 ----
NM_139323chr201218 ------
NM_144488chr91493 ------
NM_144489chr91493 ------
NM_144563chr23328 232 35 1156 ----
NM_144563chr23328 232 35 1156 ----
NM_144567chr121934 770 22621 1064 ----
NM_144571chr435593 5020 1371 34442 1645 1585 21406 655 --
NM_144578chr1485319 4584 3941 1602 1378 1158 1116 1014 14305 13778 --
NM_144586chr2178 ------
NM_144590chr104926 742 421 338 ------
NM_144595chr131245 --1320 --
NM_144632chr211786 1625 ----
NM_144642chr32467 130 1445 1353 --
NM_144643chr4----1340 --
NM_144657chrX2506 32 ------
NM_144664chr112920 396 12092 ----
NM_144690chr191361 ------
NM_144721chr41617 12725 ----
NM_144728chr11306 ------
NM_144729chr11306 ------
NM_144767chr1564286 3847 3559 3459 3261 2821 14526 ----
NM_144777chr13--161 ----
NM_144778chr1342696 1003 882 741 ------
NM_144949chr242601 2382 1852 739 12305 22119 396 --
NM_144963chr822532 158 1610 1731 --
NM_144965chr91139 ------
NM_144973chr1283770 3424 3360 3241 935 583 518 466 11400 14542 --
NM_144997chr1751347 1218 880 421 83 ------
NM_145005chr94821 408 393 215 ------
NM_145013chr1142605 2429 2003 625 11891 ----
NM_145037chr341617 1382 1140 511 --1572 --
NM_145049chr54849 729 132 124 ------
NM_145055chr1873734 3667 1449 1106 576 556 345 33191 2692 1098 ----
NM_145117chr1142292 1022 897 473 23301 3005 11001 --
NM_145175chr211090 11071 ----
NM_145247chr10190 2525 494 ----
NM_145251chr14197 1251 ----
NM_145259chr266033 5578 2180 1844 1252 314 25565 2580 ----
NM_145266chr5--1240 ----
NM_145274chr173951 677 130 ------
NM_145284chrX42503 2228 2196 303 1101 ----
NM_145307chr1024230 2919 23498 1139 32956 1553 1416 --
NM_145320chr743334 3048 1189 520 23178 2310 11178 --
NM_145321chr743334 3048 1189 520 23178 2310 11178 --
NM_145322chr743334 3048 1189 520 23178 2310 11178 --
NM_145331chr6--1631 ----
NM_145332chr6--1779 ----
NM_145333chr6--1779 ----
NM_145341chr1031742 293 74 2538 23 ----
NM_145690chr821371 83 --11979 --
NM_145698chr101577 12023 1631 --
NM_145719chr111378 ------
NM_145735chr1322477 2144 ------
NM_145753chr311665 --1497 --
NM_145756chr1821304 463 1605 1439 --
NM_145793chr10--1373 ----
NM_145808chr743125 2473 2414 700 1680 ----
NM_147150chr953413 2735 2606 1557 1523 --24009 3047 --
NM_147156chr1021278 328 11208 11066 --
NM_147171chr71453 ------
NM_147175chrX21748 1462 31891 580 113 ----
NM_147185chr71453 ------
NM_147223chr221951 340 ------
NM_147233chr221768 157 ------
NM_148174chr852076 680 618 368 340 ------
NM_148571chr172346 318 ------
NM_148894chr411034 ------
NM_148921chr175709 659 638 312 86 --12147 11948
NM_148957chr1312666 ------
NM_152221chr221139 --1445 --
NM_152240chr32971 77 1374 ----
NM_152244chr173422 326 273 ------
NM_152261chr124892 693 439 280 --12290 --
NM_152265chr1--167 ----
NM_152271chr81461 ------
NM_152275chr242266 1874 505 230 1677 ----
NM_152277chr541993 1956 1819 737 ------
NM_152282chr3170 2996 884 ----
NM_152284chr81618 --1645 1609
NM_152309chr1041996 745 363 50 11638 --184
NM_152312chr11--1244 ----
NM_152330chr1422080 753 ------
NM_152344chr1711018 1558 ----
NM_152380chr131344 555 50 21128 243 11278 --
NM_152384chr241931 661 168 86 12013 1126 --
NM_152409chr523535 1261 22867 873 23303 458 --
NM_152410chr61391 ------
NM_152424chrX84357 3935 3892 3097 1816 1447 1013 237 13561 1137 --
NM_152437chr1242303 2262 2256 1651 12180 ----
NM_152455chr1541130 741 417 57 22306 1813 1450 --
NM_152470chr1883801 3543 3113 3080 1144 769 524 395 ----1808
NM_152512chr221426 1463 ----
NM_152519chr231504 624 484 21389 889 --1850
NM_152542chr43134 38 23 11583 31937 464 214 --
NM_152556chr72870 129 ------
NM_152574chr91114 ------
NM_152594chr1541950 1823 943 892 31890 1883 486 ----
NM_152605chr1921407 463 ------
NM_152608chr121937 873 2506 460 ----
NM_152621chr4166 ------
NM_152622chr543151 2880 784 74 33264 1182 1141 ----
NM_152624chr5107187 5931 5553 5461 5098 4814 2530 1917 1718 163 46604 6577 5565 4697 1386 26055 539
NM_152629chr953668 3043 2708 2698 774 14109 12569 --
NM_152630chrX21308 1295 ------
NM_152633chrX1128 ------
NM_152636chr1132990 2477 875 ----13029
NM_152641chr122833 714 181 ----
NM_152665chr121186 1022 21148 73 ----
NM_152666chr13880 713 241 2569 293 ----
NM_152672chr31198 ------
NM_152678chr32737 507 ------
NM_152687chr511309 ------
NM_152695chrX21921 1777 2137 25 1643 --
NM_152704chr134273 151 97 76 1969 1678 --
NM_152705chr132988 305 --11414 --
NM_152707chr102735 330 1257 ----
NM_152739chr71389 ------
NM_152754chr723799 185 13099 2273 103 --
NM_152756chr554052 3990 3885 1404 242 23333 235 13046 --
NM_152758chr852836 2359 2209 2073 409 ------
NM_152774chr742326 2039 1723 82 12473 --11671
NM_152787chrX43221 2851 1257 174 22995 2448 11436 --
NM_152829chr711021 ------
NM_152835chr142952 2018 657 288 --12444 --
NM_152838chr2063535 3218 2466 2459 1145 293 13087 ----
NM_152896chr9--1218 1760 --
NM_152910chr131121 ------
NM_152924chr1596638 6226 5857 4729 1608 1288 1225 671 552 ------
NM_152989chr1221833 437 2286 121 ----
NM_152991chr11--1459 ----
NM_153013chr542320 922 831 622 --11683 1746
NM_153020chr621441 1330 11124 ----
NM_153035chr163068 2326 2142 1171 425 79 12312 12558 --
NM_153182chr333299 2103 644 12523 21143 637 --
NM_153184chr321860 562 11517 1338 126
NM_153188chr574928 4910 4388 1749 489 475 48 45274 5201 4583 3778 15574 --
NM_153207chr1263043 2922 2903 1531 1345 945 151 11496 --
NM_153252chrX------1418
NM_153256chr1041713 565 362 137 --21864 610 11293
NM_153262chr132920 2329 726 12115 ----
NM_153341chr1--1227 ----
NM_153362chr62732 235 --1905 --
NM_153371chr1331965 222 202 11751 1327 --
NM_153498chr101135 ------
NM_153607chr572533 2475 2338 2288 1243 961 784 ------
NM_153619chr1542509 441 344 158 ------
NM_153633chr121824 ------
NM_153634chr1241154 1136 642 98 ----1441
NM_153649chr132244 1971 596 11731 ----
NM_153682chr21149 ------
NM_153687chr1231454 1363 629 31578 1433 1351 ----
NM_153690chr3----1650 --
NM_153713chr1--1194 ----
NM_153715chr72930 799 ------
NM_153748chr123965 690 320 --1872 --
NM_170606chr731551 1196 627 ------
NM_170665chr1263690 3611 3372 1816 1244 726 2819 642 1488 --
NM_170675chr15--1324 ----
NM_170676chr15--1324 ----
NM_170679chr521107 375 ------
NM_170692chr11812 --1739 --
NM_170706chr1114165 4060 3219 3067 1664 1573 1544 1361 1174 837 562 ----14358
NM_170709chr812233 11598 ----
NM_170710chr452622 2268 772 607 528 22948 1181 ----
NM_170719chr1321189 1179 11078 ----
NM_170750chrX1250 2795 268 ----
NM_170751chr621429 1261 ----1164
NM_170752chr621429 1261 ----1164
NM_172037chr821108 363 ----11493
NM_172058chr841709 1465 1203 134 1665 11555 --
NM_172059chr841709 1465 1203 134 1665 11555 --
NM_172060chr841709 1465 1203 134 1665 11555 --
NM_172071chr1117459 7184 6732 6399 6319 5760 5639 4785 2219 1918 1421 26998 5700 --11049
NM_172103chr622257 1057 21012 201 ----
NM_172105chr622257 1057 21012 201 ----
NM_172128chr42648 501 ------
NM_172337chr14--2224 64 ----
NM_172348chr5----121 --
NM_173082chr63528 486 135 196 ----
NM_173083chr141252 1069 465 382 1505 ----
NM_173163chr161498 ------
NM_173165chr161379 ------
NM_173171chr21476 ------
NM_173173chr21476 ------
NM_173214chr1697903 6792 2375 2102 1917 1901 1357 1068 246 35290 829 517 16395 --
NM_173354chr2132107 1724 628 1505 ----
NM_173355chr21268 ------
NM_173468chr485447 5329 5074 2409 1958 1402 969 667 31471 1436 1033 34909 4614 262 14323
NM_173469chr1511197 ------
NM_173470chrX92424 2162 1992 1047 1039 525 475 419 55 --1198 --
NM_173475chr1621527 723 ------
NM_173478chr171966 ------
NM_173508chr121061 95 --11157 --
NM_173510chr2242614 873 619 212 22146 93 ----
NM_173511chr293756 3606 3367 3200 2874 2789 2516 1425 1300 12587 ----
NM_173519chr821888 371 ------
NM_173536chr4104655 4316 3603 3485 1963 1598 1523 1093 1077 497 35045 1269 1037 34629 3670 1179 11454
NM_173546chr31653 ------
NM_173552chr332129 1981 301 ------
NM_173570chr32551 333 --11939 --
NM_173582chr11105694 5485 5010 4765 2154 1663 1552 1310 835 718 12448 1304 --
NM_173602chr1263698 3205 3093 2491 2360 1311 ------
NM_173609chr151652 138 ----
NM_173642chr167994 3521 3378 3218 3179 55 --11218 --
NM_173644chr2021897 590 11275 21661 1516 --
NM_173647chr241083 871 857 830 ------
NM_173653chr351440 1193 386 270 209 11375 1305 --
NM_173654chr362323 2282 1820 772 636 306 ------
NM_173683chr831447 487 364 ------
NM_173698chrX31933 646 28 --11712 --
NM_173797chr541226 533 364 295 11171 11093 --
NM_173829chr585951 5462 4549 3759 1771 556 498 197 45685 2030 985 625 ----
NM_173834chrX1369 ------
NM_173851chr853921 3521 2936 2824 737 33362 1495 358 13639 --
NM_174890chr10--3281 202 190 ----
NM_174907chr3--194 ----
NM_174934chr11103593 2378 2200 1311 1184 658 552 297 216 122 --1622 --
NM_174937chr102697 194 --1136 --
NM_175056chr32700 297 12135 ----
NM_175061chr731675 1373 393 11487 ----
NM_175607chr31416 21195 462 ----
NM_175612chr31416 21195 462 ----
NM_175630chr22814 337 --1210 --
NM_175848chr2051420 1379 1243 420 313 ------
NM_175848chr2051420 1379 1243 420 313 ------
NM_175849chr2051420 1379 1243 420 313 ------
NM_175849chr2051420 1379 1243 420 313 ------
NM_175850chr2051420 1379 1243 420 313 ------
NM_175850chr2051420 1379 1243 420 313 ------
NM_175854chr1362442 2338 2013 2006 1807 921 ------
NM_175856chr52185 40 3632 579 129 1595 --
NM_175863chr6--1856 ----
NM_175874chr121152 ------
NM_175910chr1911726 12335 ----
NM_175924chr35848 785 159 110 101 ------
NM_176081chr1053805 3744 2380 950 380 ----35677 4492 1893
NM_176083chr1053805 3744 2380 950 380 ----35677 4492 1893
NM_176787chr1831566 1500 996 ------
NM_176812chr203674 595 586 ------
NM_177398chr121787 1423 --1115 1215
NM_177399chr121787 1423 --1115 1215
NM_177414chr121171 482 --1432 --
NM_177424chr151917 445 414 144 59 12096 ----
NM_177438chr1451504 691 641 623 332 23729 200 13559 --
NM_177553chr111621 ------
NM_177947chrX31631 153 98 ------
NM_177948chrX31631 153 98 ------
NM_177952chr14125 ------
NM_177968chr211750 1822 1851 --
NM_177969chr2--2534 111 ----
NM_177972chr1154329 4237 3801 3665 3454 13918 ----
NM_177983chr2----165 --
NM_177990chr2041983 1629 538 465 ------
NM_178006chr1332026 1604 926 ------
NM_178007chr1332026 1604 926 ------
NM_178009chr13184 ------
NM_178010chr1221833 437 2286 121 ----
NM_178011chr1053089 2705 2196 2139 462 --12558 12365
NM_178120chr2--11318 ----
NM_178151chrX117247 5892 5136 4931 4786 1395 1388 1174 678 338 105 16158 ----
NM_178152chrX117247 5892 5136 4931 4786 1395 1388 1174 678 338 105 16158 ----
NM_178153chrX117247 5892 5136 4931 4786 1395 1388 1174 678 338 105 16158 ----
NM_178424chr52177 102 ------
NM_178426chr121752 1617 ------
NM_178427chr121652 1517 ------
NM_178496chr311403 --21099 247 --
NM_178498chr1173801 3340 3324 1482 373 347 299 13754 13581 12747
NM_178509chr1753026 2686 1467 685 327 --11618 --
NM_178557chr4----11686 --
NM_178566chr941456 1385 1323 82 2198 113 ----
NM_178586chr1422058 576 ----1767
NM_178812chr831589 1475 226 1648 --194
NM_178835chr4125 ------
NM_178864chr111247 ------
NM_180989chr1332397 1848 482 1347 ----
NM_181054chr142445 363 ------
NM_181077chr1532202 267 175 --11733 --
NM_181265chr452622 2268 772 607 528 22948 1181 ----
NM_181332chrX32668 1694 644 11836 ----
NM_181354chr851630 1614 1294 532 153 ------
NM_181356chr62263 177 --2999 415 --
NM_181358chr193005 2780 2601 1660 1225 820 575 568 194 13104 23427 1577 --
NM_181361chr311315 ------
NM_181442chr20--1914 ----
NM_181443chr2052565 2118 1003 455 301 ------
NM_181453chr231493 1487 1372 ------
NM_181492chr22--11262 --11150
NM_181504chr574027 3530 2843 1398 1021 883 668 1846 ----
NM_181521chr16137162 5968 5067 4997 4759 4703 4668 2614 2019 1484 1218 442 57 1249 15581 --
NM_181523chr574027 3530 2843 1398 1021 883 668 1846 ----
NM_181524chr574027 3530 2843 1398 1021 883 668 1846 ----
NM_181552chr71679 ------
NM_181659chr2063226 2528 2468 2116 1053 760 --13105 --
NM_181659chr2063226 2528 2468 2116 1053 760 --13105 --
NM_181670chr12--1418 11427 --
NM_181674chr53373 284 56 --176 --
NM_181675chr53373 284 56 --176 --
NM_181676chr53373 284 56 --176 --
NM_181677chr53373 284 56 --176 --
NM_181678chr53373 284 56 --176 --
NM_181713chr22794 379 ------
NM_181714chr641769 1743 1532 368 ------
NM_181723chr82631 504 ------
NM_181762chrX3267 242 140 --1741 1838
NM_181777chrX3267 242 140 --1741 1838
NM_181782chr61539 3914 674 630 ----
NM_181787chr883938 3133 2645 1208 1003 684 250 51 23699 460 ----
NM_181828chr2233167 2387 1361 --22853 289 --
NM_181829chr2233167 2387 1361 --22853 289 --
NM_181830chr2233167 2387 1361 --22853 289 --
NM_181832chr2233182 2402 1376 --22868 304 --
NM_181836chr521859 660 1468 ----
NM_181839chr821321 389 ------
NM_181864chr11126 ------
NM_181865chr11126 ------
NM_181866chr11126 ------
NM_181886chr421144 1124 ------
NM_181887chr421144 1124 ------
NM_181888chr421144 1124 ------
NM_181889chr421144 1124 ------
NM_181890chr421144 1124 ------
NM_181891chr421144 1124 ------
NM_181892chr421191 1171 ------
NM_181893chr421144 1124 ------
NM_182314chrX41418 1280 1219 769 ------
NM_182485chr4--2944 719 11411 --
NM_182493chr1695305 4796 3980 2166 1919 1745 1546 1331 677 --14064 --
NM_182551chr233528 1358 1215 33499 1385 1105 ----
NM_182559chr121245 ------
NM_182565chr171207 --1194 --
NM_182569chr171111 1244 ----
NM_182643chr81180 1772 --11526
NM_182646chr4--2944 719 11411 --
NM_182648chr141184 ------
NM_182666chr3--1130 1434 --
NM_182685chr1----1742 --
NM_182697chr721473 1430 ------
NM_182700chr741555 734 654 645 ------
NM_182717chr1011032 --1959 --
NM_182720chr1011032 --1959 --
NM_182721chr1011032 --1959 --
NM_182722chr1011032 --1959 --
NM_182723chr1011032 --1959 --
NM_182757chr6103320 3030 2950 2788 2745 2603 2309 815 729 392 12886 12170 --
NM_182763chr142231 1948 1024 747 ----11051
NM_182764chr201163 ------
NM_182765chr1032294 1801 128 ------
NM_182789chr52799 341 126 ----
NM_182796chr54799 743 236 82 ------
NM_182802chr201662 ------
NM_182830chr1442228 2180 1481 727 --159 --
NM_182853chr1011032 --1959 --
NM_182898chr785937 5861 4304 2015 1356 605 445 240 12051 15413 --
NM_182899chr785937 5861 4304 2015 1356 605 445 240 12051 15413 --
NM_182918chr2141390 1105 391 334 3305 276 176 ----
NM_182948chr132092 822 128 ------
NM_182964chr1142292 1022 897 473 23301 3005 11001 --
NM_182976chr13808 737 195 ------
NM_183011chr1011032 --1959 --
NM_183012chr1011032 --1959 --
NM_183013chr1011032 --1959 --
NM_183043chr131992 1880 ----
NM_183044chr131992 1880 ----
NM_183075chr463010 2636 1843 1102 1069 633 ------
NM_183323chr52799 341 126 ----
NM_183353chrX21037 157 --11162 --
NM_183380chr61106 ------
NM_183381chr31994 ------
NM_183383chr31994 ------
NM_183384chr31994 ------
NM_183393chr31713 ------
NM_183394chr31713 ------
NM_194247chr283764 3429 1720 1702 1557 1101 406 271 12907 --11415
NM_194271chr12--1767 ----
NM_194285chr1153410 2479 2163 694 422 ------
NM_194301chr141889 1289 --1243
NM_194314chr174360 3888 3510 1858 1693 1413 1400 21519 1392 13799 25526 766
NM_194317chr232079 1738 185 ------
NM_194318chr1382130 1859 1621 1022 832 655 432 281 ------
NM_194328chr932384 2347 170 23157 538 ----
NM_194329chr932384 2347 170 23157 538 ----
NM_194330chr932384 2347 170 23157 538 ----
NM_194332chr932384 2347 170 23157 538 ----
NM_194434chr1825802 4388 45111 4809 1735 1003 35359 542 322 --
NM_194442chr141547 1486 625 103 21768 282 ----
NM_194454chr711291 1481 150 --
NM_194455chr711291 1481 150 --
NM_194456chr711291 1481 150 --
NM_194463chrX1891 ------
NM_197968chr13----1107 --
NM_197970chr211505 11460 ----
NM_198040chr12972 775 ------
NM_198066chr1452861 2314 1091 1057 822 ----12599
NM_198123chr811412 11587 --1191
NM_198124chr811412 11587 --1191
NM_198128chr1852022 1992 1540 690 125 12308 --12327
NM_198158chr362209 1081 1005 735 708 525 11981 ----
NM_198159chr362209 1081 1005 735 708 525 11981 ----
NM_198177chr362209 1081 1005 735 708 525 11981 ----
NM_198178chr362209 1081 1005 735 708 525 11981 ----
NM_198181chr1552586 2073 2051 1043 353 --1275 --
NM_198212chr731507 223 117 22117 307 ----
NM_198215chr10182 ------
NM_198225chr10----21801 1243 --
NM_198240chr1211030 --1206 --
NM_198268chr193005 2780 2601 1660 1225 820 575 568 194 13104 23427 1577 --
NM_198269chr193005 2780 2601 1660 1225 820 575 568 194 13104 23427 1577 --
NM_198270chrX43404 2674 2313 212 22637 2300 21325 1150 --
NM_198279chrX31249 486 342 ------
NM_198336chr781822 1739 1617 1312 1139 603 274 104 ------
NM_198400chr151358 2671 43 1103 --
NM_198465chrX21864 605 42741 1924 149 92 ----
NM_198468chr643029 1362 1022 1004 14574 --11688
NM_198489chr11--1133 ----
NM_198503chr132227 459 60 ------
NM_198504chr33647 321 48 ------
NM_198506chr421087 331 ------
NM_198513chr841781 1403 506 487 31959 1898 737 ----
NM_198566chr51206 ------
NM_198581chr286938 6073 5907 5767 5440 5385 2717 879 --46451 5895 5492 4863 12465
NM_198793chr353431 2634 993 234 160 24182 3302 12812 14169
NM_198829chr741314 1154 1109 584 --1605 --
NM_198892chr4--158 ----
NM_198904chr521302 43 11806 ----
NM_198956chr741555 734 654 645 ------
NM_198991chr181653 ------
NM_198995chr182554 478 ------
NM_199003chr831167 354 37 ------
NM_199039chr411025 ------
NM_199051chr1----141 --
NM_199072chr753078 2947 2390 765 415 1206 --13225
NM_199132chr1941403 799 548 194 --11486 --
NM_199138chr134273 151 97 76 1969 1678 --
NM_199188chr1223839 3281 ------
NM_199189chr51200 ------
NM_199190chr1223839 3281 ------
NM_199229chr241703 1462 1350 406 ------
NM_199282chr172349 313 ------
NM_199320chr412132 ------
NM_199320chr412132 ------
NM_199324chr443313 1166 848 199 23335 2303 ----
NM_199328chr21--11081 ----
NM_199342chr1--159 ----
NM_199355chr1621201 614 11798 ----
NM_199421chr1484939 4218 3585 3294 1974 1008 740 479 14130 ----
NM_199436chr263049 2567 2536 749 571 274 12457 12697 1116
NM_199437chr1142533 470 277 125 21879 1733 ----
NM_199438chr1142533 470 277 125 21879 1733 ----
NM_199439chr1142533 470 277 125 21879 1733 ----
NM_199454chr174220 3979 1056 592 468 215 192 1762 ----
NM_199482chr251989 1517 501 439 405 11592 ----
NM_201266chr21302 ------
NM_201267chr21587 ------
NM_201269chr121273 219 ------
NM_201278chr1152200 833 378 145 73 11673 ----
NM_201279chr21302 ------
NM_201281chr1152200 833 378 145 73 11673 ----
NM_201432chr1786555 5162 4280 2348 1556 1400 1097 1027 --36610 4442 303 25055 2295
NM_201433chr1786555 5162 4280 2348 1556 1400 1097 1027 --36610 4442 303 25055 2295
NM_201436chr7--1790 ----
NM_201437chr841531 1102 961 83 11004 ----
NM_201516chr7--1846 ----
NM_201517chr7--1790 ----
NM_201570chr104490 84 76 43 ----1652
NM_201571chr104490 84 76 43 ----1652
NM_201572chr104490 84 76 43 ----1652
NM_201590chr104490 84 76 43 ----1652
NM_201591chr421815 397 ------
NM_201592chr421815 397 ------
NM_201593chr104490 84 76 43 ----1652
NM_201596chr104490 84 76 43 ----1652
NM_201597chr104490 84 76 43 ----1652
NM_201624chr121126 217 21018 197 1248 --
NM_201629chr93566 540 209 1795 ----
NM_201999chr421013 334 --1952 --
NM_203291chr18137 --1205 --
NM_203292chr18130 --1198 --
NM_203301chr14--11285 ----
NM_203304chr191289 ----1843
NM_203327chr2054064 3386 3060 1506 1319 --24447 4323 --
NM_203341chr131010 175 152 1376 --1751
NM_203342chr183625 3185 2586 1324 1302 1229 925 152 1444 1260 --
NM_203343chr183625 3185 2586 1324 1302 1229 925 152 1444 1260 --
NM_203349chr1541831 1813 1624 176 11653 ----
NM_203354chr141675 ----1252
NM_203355chr141675 ----1252
NM_203356chr141675 ----1252
NM_203364chr1111036 ------
NM_203365chr21464 1585 ----
NM_203372chr21297 ------
NM_203394chr1242276 1695 1674 531 ------
NM_203406chr512261 22164 1126 ----
NM_203446chr2131934 1111 483 --11012 12436
NM_203459chr132611 929 881 22428 545 ----
NM_203494chr15----1180 --
NM_203504chr472590 2253 1874 1853 923 712 23 11968 12021 12335
NM_203505chr472590 2253 1874 1853 923 712 23 11968 12021 12335
NM_203506chr1722164 1938 --1216 --
NM_205768chr162039 1800 1792 811 350 87 1396 1773 --
NM_205833chrX1726 181 --1306
NM_205842chr2196 ------
NM_205860chr12913 894 --12413 12009
NM_206594chr163039 2998 2862 850 180 84 13340 ----
NM_206595chr163039 2998 2862 850 180 84 13340 ----
NM_206814chr621536 606 --11187 --
NM_206839chr151599 ------
NM_206852chr141527 ------
NM_206853chr663691 2902 2587 1591 933 294 33851 3089 366 13028 13544
NM_206854chr684952 4163 3848 3539 3427 1555 1194 516 45112 4350 1627 1280 14289 24805 3449
NM_206855chr695917 5128 4813 4504 4392 3945 2520 2159 1481 46077 5315 2245 61 15254 35770 4414 273
NM_206857chr141527 ------
NM_206866chr2142750 2436 2374 47 21204 534 ----
NM_206907chr522985 2242 22796 927 --12996
NM_206909chr8128023 7914 7786 7012 6973 6026 5678 3276 2594 2546 981 841 25076 403 --15866
NM_206927chr112707 376 1809 ----
NM_206928chr112707 376 1809 ----
NM_206929chr112707 376 1809 ----
NM_206930chr112707 376 1809 ----
NM_206944chr9167 ------
NM_206945chr9167 ------
NM_206946chr9167 ------
NM_206947chr9167 ------
NM_207113chr73451 175 63 ------
NM_207123chr41600 ------
NM_207189chr11139 ------
NM_207299chr91754 1325 ----
NM_207303chr1043659 3643 383 211 24024 3413 23423 1075 22677 173
NM_207304chr1342583 890 769 628 ------
NM_207317chr51405 ------
NM_207322chr1521867 1820 11779 ----
NM_207325chr1941937 1403 812 182 ----11820
NM_207352chr43892 165 40 --4703 677 505 172 --
NM_207361chr13126258 6135 5781 5639 5499 5165 2121 1857 1742 1167 487 143 26142 4089 ----
NM_207372chr1021907 410 --11989 12449
NM_207396chr161760 1500 1423 1333 1319 115 11810 ----
NM_207406chr4126419 5922 5817 5632 5365 4377 4180 2464 2118 1501 727 652 --36219 5715 978 15842
NM_207418chr1_random11010 --1306 1410
NM_207442chr1421047 31 ------
NM_207469chr201176 11281 ----
NM_207481chr21974 ------
NM_207660chr1431661 593 44 1126 ----
NM_207661chr1431661 593 44 1126 ----
NM_207662chr1431661 593 44 1126 ----
NM_212460chr732014 1475 655 1687 ----
NM_212467chr15----1408 --
NM_212471chr1721990 580 ----11933
NM_212472chr1721990 580 ----11933
NM_212543chr31686 --1697 --
NM_212554chr102397 330 --11516 --
NM_213589chr294570 4519 4084 3706 2182 2029 1899 1878 1736 23448 2044 --12135
NM_213590chr1394907 4331 3908 3816 2076 2016 946 595 24 23336 1993 1389 --
NM_213611chr121144 1346 ----
NM_213654chr311116 1372 ----