TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4436b-5p
miRNA Sequence: GUCCACUUCUGCCUGCCCUGCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001004419chr1241416 1024 920 877 --2683 44 24004 1340
NM_001025580chrX13160 ----23650 896
NM_001037165chr7148610 7491 7420 6439 6296 6236 6152 6142 5425 2535 2519 2121 1708 1618 2794 27 13416 28731 8533
NM_001039840chrX65774 5750 4941 4528 2110 528 14156 34898 4618 783 24518 4035
NM_001106chr3169574 8939 8479 8155 8115 7959 6818 6780 6090 3028 2996 2300 1212 1150 1086 35 --26545 3709 --
NM_001918chr133434 1664 345 --33688 1834 507 38876 7604 3343
NM_002336chr1214248 45093 4255 1834 1521 24261 3814 --
NM_002481chr187846 7526 6739 6244 1913 1595 1347 1060 25799 106 25731 2099 25240 1098
NM_003463chr613204 12465 --33262 3009 32
NM_005056chr1285321 5168 4385 4205 2112 2003 315 76 ----24019 3452
NM_006203chr545062 4446 4042 3522 --33583 2047 202 22063 1056
NM_007249chr1342839 2351 2152 925 27599 1309 15961 23500 2615
NM_013269chr1251786 1343 951 847 804 --1610 23931 1267
NM_015365chrX13160 ----23650 896
NM_020718chr1644770 2618 977 774 15322 --26595 4481
NM_020956chr19174693 4501 4297 4214 4085 3810 3608 3233 3035 1892 1265 1212 944 875 800 519 262 24478 3566 93672 3504 2889 1611 1239 1092 909 864 455 --
NM_021255chr1452756 1642 1117 530 507 23543 629 12506 11090
NM_025179chr184576 4072 4054 3588 1898 951 253 200 11550 34858 1408 942 11707
NM_032105chr187979 7659 6872 6377 2046 1728 1480 1193 25932 239 25864 2232 25373 1231
NM_033224chr776384 5138 2851 2622 881 727 91 11323 --25388 1945
NM_133334chr4125816 5730 5520 5022 3926 2141 1874 1812 1726 1138 1089 35 34813 4673 1880 16025 16364
NM_145259chr232083 550 519 34817 1617 534 --27069 2057
NM_173642chr1119062 9013 7502 7242 6744 6721 6355 2761 2425 961 862 16553 58625 8366 7412 2896 2333 1391
NM_181521chr16127061 6223 4605 4571 2817 2327 2075 2001 852 172 157 148 26429 2744 ----
NM_198715chr154757 2024 1709 992 750 ----22196 109