TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4438
miRNA Sequence: CACAGGCUUAGAAAAGACAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5----1911 --
NM_000016chr11611 ------
NM_000020chr12102330 2240 2217 1971 1761 814 602 568 352 196 ------
NM_000038chr531501 512 296 11959 ----
NM_000044chrX2329 62 --1125 --
NM_000084chrX96559 6543 5748 5395 4675 1727 1318 1276 668 11297 --12557
NM_000088chr171279 --11227 --
NM_000090chr2--1606 --1911
NM_000093chr941943 1785 1664 978 ------
NM_000109chrX----22333 234 --
NM_000112chr545287 3544 3401 631 11679 --1175
NM_000125chr653033 3007 1681 1364 353 11651 ----
NM_000129chr611011 ------
NM_000138chr1532432 2370 2214 12641 ----
NM_000141chr1011145 --185 11087
NM_000142chr471449 1392 1370 1003 430 176 124 ------
NM_000161chr1441815 1568 280 57 ------
NM_000163chr522359 2215 ------
NM_000168chr753230 2750 2127 2094 405 2734 705 ----
NM_000176chr5--1935 1328 --
NM_000189chr262062 616 460 361 174 161 ------
NM_000192chr121172 --1384 --
NM_000212chr1772326 720 600 475 301 177 155 12280 136 --
NM_000214chr203275 79 36 146 11600 --
NM_000216chrX23975 242 23889 3435 146 --
NM_000217chr1221890 779 --11203 11585
NM_000244chr113747 564 26 ----1146
NM_000248chr332544 347 302 ------
NM_000251chr2--149 ----
NM_000259chr1584606 4596 4411 4096 2020 1844 1291 1130 21200 1065 ----
NM_000264chr912244 1694 --11025
NM_000271chr182527 145 ------
NM_000272chr221282 495 21341 1217 ----
NM_000286chr172712 177 ------
NM_000292chrX----1465 --
NM_000304chr171948 ------
NM_000314chr1022535 647 --13075 --
NM_000318chr852917 2243 1110 866 853 ------
NM_000321chr132600 331 ------
NM_000330chrX2743 408 ------
NM_000332chr666518 5328 4611 2804 674 192 17156 27026 6206 --
NM_000333chr3----198 --
NM_000337chr586576 5019 5012 4242 1888 1660 965 805 ------
NM_000349chr831537 359 78 11479 ----
NM_000362chr2283435 1412 1334 1124 686 662 563 97 ------
NM_000367chr631906 668 68 21810 1517 ----
NM_000368chr9114846 4333 4166 4054 4046 3867 3619 3093 890 472 442 13974 21671 648 --
NM_000378chr11165 ------
NM_000379chr241145 427 347 253 ----1321
NM_000388chr331258 957 391 ------
NM_000391chr1131467 149 28 ------
NM_000429chr1081660 1475 1396 1380 639 403 351 21 --2715 138 --
NM_000430chr1732906 2855 2307 13463 --11143
NM_000434chr6--164 ----
NM_000439chr532224 661 64 --21710 412 --
NM_000449chr12492 182 ------
NM_000456chr12----1486 --
NM_000459chr93770 602 230 ------
NM_000461chr333252 1608 1181 --11338 --
NM_000462chr152341 159 --11424 --
NM_000484chr211967 ------
NM_000494chr102618 148 --192 --
NM_000517chr16199 ------
NM_000522chr71408 ------
NM_000523chr211120 ------
NM_000527chr1992463 1921 1856 1759 1684 1555 766 734 659 11622 ----
NM_000555chrX66873 6604 5940 2753 2128 1640 47638 2561 1852 971 15700 --
NM_000558chr161100 ------
NM_000572chr14983 864 698 368 1633 ----
NM_000578chr251493 1466 720 389 50 ------
NM_000609chr1032539 357 70 --12455 --
NM_000615chr1152833 2412 2114 2026 1871 ------
NM_000618chr1246124 2569 981 937 ------
NM_000618chr1246124 2569 981 937 ------
NM_000627chr2----1222 --
NM_000633chr1865234 1150 1009 1001 990 567 1358 ----
NM_000675chr222345 326 --1860 --
NM_000678chr204679 545 351 156 --1847 --
NM_000719chr1236379 1202 145 1365 16121 --
NM_000723chr1761411 1325 1193 1154 208 135 11340 1559 --
NM_000724chr1041946 1801 1485 207 21881 453 11344 --
NM_000725chr122891 147 ------
NM_000726chr211227 11021 ----
NM_000756chr81115 ------
NM_000757chr13838 595 544 ------
NM_000800chr531536 236 116 11234 ----
NM_000806chr52188 164 --11565 --
NM_000807chr42493 70 ------
NM_000808chrX2984 254 ------
NM_000813chr553713 1872 266 247 60 ------
NM_000817chr2--1913 2361 152 --
NM_000824chr41583 ------
NM_000826chr422266 2066 ------
NM_000827chr532084 1678 886 ------
NM_000829chr1142214 2139 1557 845 12227 ----
NM_000831chr1115725 5621 5013 4699 1951 1446 1420 1319 401 118 29 --14874 --
NM_000838chr632744 2428 87 12116 ----
NM_000841chr65823 761 353 329 168 ------
NM_000845chr7----1397 --
NM_000859chr521091 451 ------
NM_000868chrX51812 1803 1663 1626 617 ------
NM_000870chr551269 1182 647 340 70 ------
NM_000872chr10143 --1998 11458
NM_000875chr1564715 4424 2819 1914 1589 913 11255 11611 --
NM_000876chr611353 ----11335
NM_000891chr172537 46 12524 23398 1289 --
NM_000899chr122771 439 --13062 1405
NM_000901chr452531 2386 2367 351 197 ------
NM_000919chr5----2412 109 --
NM_000924chr121964 1845 ----
NM_000933chr2041202 1150 298 160 11361 ----
NM_000937chr173388 279 44 ------
NM_000942chr15135 ------
NM_000944chr422151 2079 1970 11748 --
NM_000945chr231869 1530 207 ----1617
NM_000961chr2083845 1578 1500 1334 1204 865 54 44 21404 1269 ----
NM_000963chr152498 2483 2035 1003 686 12333 1587 --
NM_000965chr3----11190 --
NM_000966chr123780 250 210 ------
NM_000984chr172428 66 ------
NM_000989chr8172 ------
NM_001001323chr121233 ------
NM_001001331chr332599 2426 467 ------
NM_001001344chrX42493 1823 519 188 ----12557
NM_001001395chr12----12594 --
NM_001001436chr162747 127 --1139 --
NM_001001481chr81843 12524 ----
NM_001001502chr53601 164 152 --1140 --
NM_001001521chr21306 ------
NM_001001522chr113361 294 69 ------
NM_001001549chr742686 2381 2094 63 --32360 946 698 12037
NM_001001550chr742686 2381 2094 63 --32360 946 698 12037
NM_001001555chr742686 2381 2094 63 --32360 946 698 12037
NM_001001557chr861699 1528 1391 870 130 68 --12067 --
NM_001001665chr283254 2651 2408 2359 2244 1314 831 661 32586 2313 597 ----
NM_001001669chr532580 819 339 12422 12180 --
NM_001001787chr1--150 ----
NM_001001852chr225800 762 653 638 193 ------
NM_001001890chr2124199 585 ------
NM_001001924chr821376 396 ------
NM_001001925chr821376 396 ------
NM_001001931chr821376 396 ------
NM_001001933chr11156 ----1444
NM_001001974chr103897 475 21 ------
NM_001001995chrX1123 ------
NM_001002032chr17183 ------
NM_001002033chr174183 70 49 34 ------
NM_001002243chr22643 347 ------
NM_001002264chr13196 ------
NM_001002295chr101171 --21126 987 --
NM_001002814chr883381 3169 2511 1427 1302 1264 1147 1098 33441 1168 1033 13001 --
NM_001002838chrX1294 --11606 --
NM_001002860chr1454567 3256 1037 912 22 24718 991 ----
NM_001002862chr2232246 1976 937 11785 21521 838 --
NM_001002876chr221423 --1362 --
NM_001002914chr174963 843 800 443 11042 1236 --
NM_001003406chr22143151 3091 2838 2735 2691 2500 2161 882 741 607 472 355 167 152 ------
NM_001003407chr1055030 4983 4111 458 134 --11782 --
NM_001003408chr1055030 4983 4111 458 134 --11782 --
NM_001003674chr1867040 6624 5606 5560 4960 1843 16966 11938 --
NM_001003675chr1867040 6624 5606 5560 4960 1843 16966 11938 --
NM_001003676chr114907 636 291 137 190 2724 660 --
NM_001003681chr2241618 597 424 314 ------
NM_001003698chr621584 186 --2679 373 --
NM_001003699chr621584 186 --2679 373 --
NM_001003712chr1232860 1521 49 ------
NM_001003722chr921105 1045 ------
NM_001003789chr2211138 --1448 --
NM_001003792chr32997 21 ------
NM_001003793chr32997 21 ------
NM_001003800chr963737 1495 916 909 712 448 1702 ----
NM_001003940chr15133474 3369 3075 3050 2961 2949 2933 2797 2669 2618 1235 776 246 --1843 --
NM_001003942chr15133474 3369 3075 3050 2961 2949 2933 2797 2669 2618 1235 776 246 --1843 --
NM_001003943chr15133478 3373 3079 3054 2965 2953 2937 2801 2673 2622 1239 780 250 --1847 --
NM_001004023chr1------1185
NM_001004051chrX----2315 77 --
NM_001004065chr913415 --13253 --
NM_001004105chr5199 ------
NM_001004127chr132862 418 ------
NM_001004196chr321104 211 ------
NM_001004298chr103797 753 332 ------
NM_001004317chr6114075 3211 3162 3042 1748 1649 1560 1200 822 249 216 --1256 --
NM_001004419chr1234633 1596 1011 1830 ----
NM_001004720chr21684 ------
NM_001004722chr21853 ------
NM_001005158chr32117 103 ------
NM_001005159chr32117 103 ------
NM_001005209chr27645 543 268 163 122 107 57 ------
NM_001005404chr1734315 1250 636 13129 11438 --
NM_001005417chr13665 613 61 ------
NM_001005463chr1042639 2327 2284 697 ------
NM_001005476chr21235 ------
NM_001005505chr341458 1384 1267 139 --1450 --
NM_001005609chrX113855 3710 3399 2411 1536 1481 898 812 635 579 164 ------
NM_001005611chrX2476 28 ------
NM_001005732chr21174 ------
NM_001005733chr21174 ------
NM_001005746chr211227 11021 ----
NM_001005747chr211227 11021 ----
NM_001005782chr22702 281 1733 ----
NM_001005845chr821314 62 ------
NM_001006115chr382785 2672 2399 2364 2000 1716 970 149 --12653 --
NM_001006612chrX2391 44 ------
NM_001006613chrX2391 44 ------
NM_001006614chrX2391 44 ------
NM_001006617chr931360 203 42 ------
NM_001006619chr931360 203 42 ------
NM_001006620chr931360 203 42 ------
NM_001006621chr931360 203 42 ------
NM_001006634chr161511 ------
NM_001006636chr23293 126 117 ------
NM_001006641chr97671 524 421 314 307 170 51 --11140 --
NM_001006642chr97671 524 421 314 307 170 51 --11140 --
NM_001006643chr97671 524 421 314 307 170 51 --11140 --
NM_001006939chr101509 ----1717
NM_001007075chr41433 ----1888
NM_001007097chr9104048 3422 1387 1304 1220 1012 992 918 168 43 14359 34920 1286 1101 --
NM_001007098chr12708 38 ------
NM_001007102chr62557 263 ------
NM_001007156chr1541790 1364 1213 365 ------
NM_001007226chr1721192 232 ------
NM_001007227chr1721192 232 ------
NM_001007228chr1721192 232 ------
NM_001007229chr1721192 232 ------
NM_001007230chr1721192 232 ------
NM_001007243chr831537 359 78 11479 ----
NM_001007246chr213536 421 220 ------
NM_001007257chr131439 372 101 ------
NM_001007271chr103955 289 148 ------
NM_001007277chr112706 342 ------
NM_001007466chr6124900 3846 3754 3733 3163 2022 1638 974 433 421 376 296 14326 12071 --
NM_001007553chr12306 212 ------
NM_001007559chr18--12010 ----
NM_001008220chr563614 3600 2606 759 442 210 --32818 1402 473 --
NM_001008239chr1833341 2381 1385 ----13818
NM_001008392chr353361 2910 284 65 28 --21391 583 13120
NM_001008541chr101495 --1518 --
NM_001008541chr101495 --1518 --
NM_001008701chr1972380 2338 2048 1907 1045 993 171 --12403 --
NM_001009567chr103165 154 115 ------
NM_001009571chr731659 277 137 1116 ----
NM_001009881chr1--1610 ----
NM_001009882chr1--1610 ----
NM_001009899chr364859 4794 2119 1354 1250 397 1108 --15481
NM_001009955chr11510 1571 ----
NM_001009955chr11510 1571 ----
NM_001009959chr22421 172 ----11837
NM_001009960chr722102 1928 11832 ----
NM_001009993chr274065 4042 3708 2999 1559 1286 321 --13964 --
NM_001010853chr632161 805 79 12660 12718 --
NM_001010854chr143598 560 65 ------
NM_001010862chrX2358 236 ------
NM_001010867chr1176359 6036 5959 5650 4618 4452 2656 2573 2333 1689 1629 1623 1113 1062 715 597 45 25572 4387 31794 1185 741 --
NM_001010888chrX13452 13212 13446 --
NM_001010891chr546177 6015 1628 176 --15642 1166
NM_001010908chr101482 ------
NM_001010924chr1011103 ------
NM_001010927chr6------1536
NM_001010934chr71478 ------
NM_001010971chr11911 ------
NM_001011513chr463232 1389 1160 778 612 150 51294 823 682 547 520 ----
NM_001011537chr331776 1460 204 11746 ----
NM_001011545chr211209 ------
NM_001011553chr7150 ------
NM_001011645chrX2329 62 --1125 --
NM_001011658chrX21889 88 --12022 --
NM_001011666chr746082 1532 1031 210 15433 ----
NM_001011705chr13--1280 ----
NM_001011708chr272721 2469 2457 2402 2352 1093 309 1446 12218 12940
NM_001011713chr142580 272 ------
NM_001011724chr131304 ------
NM_001011725chr131304 ------
NM_001012267chr931727 1221 1213 ----11592
NM_001012393chr1134830 169 83 --23293 1238 --
NM_001012426chr6153275 3220 3210 3177 3125 2904 2415 1262 1154 876 817 759 733 590 522 ------
NM_001012427chr6153275 3220 3210 3177 3125 2904 2415 1262 1154 876 817 759 733 590 522 ------
NM_001012514chr23838 282 272 ----191
NM_001012516chr23838 282 272 ----191
NM_001012614chr45644 606 486 259 162 ------
NM_001012755chrX44774 3656 3350 701 --34346 3384 881 --
NM_001012968chrX32744 960 872 ------
NM_001012977chrX11074 11354 ----
NM_001012989chrX2640 515 --1620 --
NM_001013031chr1023530 920 --1152 --
NM_001013399chr61984 --1100 --
NM_001013415chr421463 1086 --1369 --
NM_001013437chr181112 142 ----
NM_001013438chr32629 219 1211 ----
NM_001013439chr3165 157 ----
NM_001013620chr1297810 7350 2981 2741 895 814 592 280 208 --16389 --
NM_001013635chr121975 ------
NM_001013674chr12314 153 ------
NM_001013699chr121379 ------
NM_001013839chr17112429 2353 2172 1932 880 727 497 296 219 91 70 ------
NM_001014431chr142381 32 ------
NM_001014432chr142381 32 ------
NM_001014434chr11137 ------
NM_001014764chr17------1155
NM_001014797chr1057757 2777 1080 165 94 --12835 --
NM_001014809chr43810 690 27 --1946 --
NM_001014987chr164205 168 125 114 --123 --
NM_001014988chr164205 168 125 114 --123 --
NM_001014989chr164205 168 125 114 --123 --
NM_001015045chr451658 946 915 811 772 --11912 --
NM_001015508chr81683 ------
NM_001015880chr1021706 1063 ------
NM_001015881chrX41259 1136 357 275 --11159 --
NM_001015887chr32675 313 ------
NM_001017368chr173157 74 44 --1992 --
NM_001017371chr211048 ------
NM_001017392chr1941349 1181 480 79 --1311 11116
NM_001017395chr333107 2888 2860 13421 ----
NM_001017926chr811749 --1334 --
NM_001017969chr91165 ------
NM_001017977chr11284 ------
NM_001017999chr141519 910 523 40 1465 ----
NM_001017999chr141519 910 523 40 1465 ----
NM_001018000chr141519 910 523 40 1465 ----
NM_001018000chr141519 910 523 40 1465 ----
NM_001018001chr141519 910 523 40 1465 ----
NM_001018009chr31343 ----11105
NM_001018050chr2232164 143 33 --21304 939 --
NM_001018052chr2232164 143 33 --21304 939 --
NM_001018053chr12133 57 ------
NM_001018056chr9----1140 --
NM_001018057chr111192 ------
NM_001018064chr921945 1389 --1586 --
NM_001018065chr975966 5772 2273 2036 1492 996 295 --15030 --
NM_001018066chr975966 5772 2273 2036 1492 996 295 --15030 --
NM_001018067chr154403 4219 3992 3255 2010 13857 13768 --
NM_001018068chr154403 4219 3992 3255 2010 13857 13768 --
NM_001018069chr154403 4219 3992 3255 2010 13857 13768 --
NM_001018074chr5--1935 1328 --
NM_001018075chr5--1935 1328 --
NM_001018076chr5--1935 1328 --
NM_001018077chr5--1935 1328 --
NM_001018108chr152130 40 ------
NM_001018115chr3--1636 145 --
NM_001020658chr121206 94 ------
NM_001020658chr121206 94 ------
NM_001020818chr1941740 1327 515 495 11230 1445 --
NM_001020819chr1941740 1327 515 495 11230 1445 --
NM_001020820chr1941740 1327 515 495 11230 1445 --
NM_001020821chr1941740 1327 515 495 11230 1445 --
NM_001023560chr62917 878 ------
NM_001023587chr32941 442 ------
NM_001024094chr5--1935 1328 --
NM_001024226chr12947 150 ------
NM_001024227chr12947 150 ------
NM_001024228chr12947 150 ------
NM_001024455chrX62326 2113 1708 1052 578 285 ------
NM_001024460chr641272 1231 1118 1048 ------
NM_001024649chr52945 796 --1146 --
NM_001024660chr321645 1103 --11393 --
NM_001024680chr231809 1643 694 21713 1578 21449 543 --
NM_001024847chr312229 1287 ----
NM_001024855chr32217 130 ------
NM_001024934chr62675 58 ----1459
NM_001024935chr62675 58 ----1459
NM_001024936chr62675 58 ----1459
NM_001024948chr123532 3158 --1249 --
NM_001024959chr32786 727 1280 ----
NM_001024960chr32786 727 1280 ----
NM_001025068chr311322 --11666 --
NM_001025069chr311322 --11666 --
NM_001025076chr1045168 5093 5073 978 1513 ----
NM_001025077chr1056526 6451 6431 2336 565 21871 832 167 --
NM_001025079chr312808 ------
NM_001025108chr273008 2658 1663 1026 803 451 187 ------
NM_001025233chr1222133 1842 --1443 --
NM_001025580chrX43473 1511 1248 678 14246 ----
NM_001025595chr411497 --1538 --
NM_001025603chr12492 182 ------
NM_001025616chr421582 332 11519 ----
NM_001029858chr611126 13381 1142 --
NM_001029875chr512395 --1952 --
NM_001029989chr151924 2864 730 ----
NM_001030006chr1762675 2557 2544 2532 2517 2367 --21783 734 --
NM_001030007chr1653543 3324 1291 1079 934 13437 ----
NM_001030055chr1453624 3607 1909 653 380 ------
NM_001030272chr111189 --168 --
NM_001030273chr111189 --168 --
NM_001031681chr1762240 2033 1552 567 476 468 1774 2728 453 --
NM_001031684chr221264 476 171 ----
NM_001031690chr793076 2440 2386 1256 854 674 279 234 196 ------
NM_001031695chr2255052 4762 4660 655 51 1295 11264 --
NM_001031702chr32741 124 ------
NM_001031717chr32275 241 ------
NM_001031740chr141665 1629 496 51 31569 354 247 --1280
NM_001031801chr222405 98 ------
NM_001031804chr16103818 3606 2800 1568 985 856 790 664 536 415 --1310 --
NM_001032221chr941580 1402 445 89 --31711 703 681 --
NM_001032280chr611319 11596 ----
NM_001032282chr81126 --185 --
NM_001032288chr2041472 440 430 363 --1475 --
NM_001032293chr171458 ------
NM_001032296chr1342548 2541 2379 1151 12450 22864 1937 --
NM_001032363chr141752 1549 644 444 --21648 158 --
NM_001032363chr141752 1549 644 444 --21648 158 --
NM_001032380chr102361 189 11717 1276 --
NM_001032386chr12----1486 --
NM_001032387chr12----1486 --
NM_001032393chrX1217 ------
NM_001032394chr642646 2571 1834 970 ------
NM_001032395chr642513 2438 1701 837 ------
NM_001032999chr20134975 4830 4249 4035 3795 3475 1680 1655 1051 727 421 221 138 14707 1794 --
NM_001033026chr193689 492 43 1192 1109 --
NM_001033030chr3193 ------
NM_001033031chr3193 ------
NM_001033032chr3193 ------
NM_001033044chr131178 531 519 ------
NM_001033045chr273310 3274 1418 851 602 434 165 51372 1305 1214 506 369 14212 1816
NM_001033047chr43497 456 154 --1728 --
NM_001033056chr131178 531 519 ------
NM_001033081chr161307 654 509 444 354 107 --21687 1366 --
NM_001033082chr161307 654 509 444 354 107 --21687 1366 --
NM_001033085chr2129 ------
NM_001033087chr2022772 1024 --13101 --
NM_001033112chr51751 1642 ----
NM_001033117chr364758 3631 1723 1657 701 132 1402 ----
NM_001033507chr171854 1425 1355 1346 1340 1248 578 ------
NM_001033551chr17173801 3664 3527 3230 3129 3099 2958 2568 2502 1363 1079 1005 916 828 652 488 99 ------
NM_001033557chr22125 24 11182 ----
NM_001033667chr11218 ------
NM_001034845chr41886 ------
NM_001034852chr1411923 11961 12077 --
NM_001034954chr1061152 866 712 606 476 379 --1157 --
NM_001034955chr1061152 866 712 606 476 379 --1157 --
NM_001034956chr1061152 866 712 606 476 379 --1157 --
NM_001034957chr1061152 866 712 606 476 379 --1157 --
NM_001035chr121290 396 ------
NM_001035003chr4196 ------
NM_001035004chr4196 ------
NM_001035005chr18----1508 --
NM_001035511chr12315 135 --1425 --
NM_001035512chr13422 242 82 --1532 --
NM_001035513chr13422 242 82 --1532 --
NM_001037163chr72766 73 ----1257
NM_001037164chr731855 1520 89 11903 11960 --
NM_001037172chr331402 316 76 ------
NM_001037331chr181964 ----1324
NM_001037332chr552452 669 442 157 70 ------
NM_001037333chr552452 669 442 157 70 ------
NM_001037339chr131315 440 208 ------
NM_001037340chr131315 440 208 ------
NM_001037341chr131315 440 208 ------
NM_001037341chr131315 440 208 ------
NM_001037558chr111220 ------
NM_001037582chr421162 348 ------
NM_001037631chr221103 784 ------
NM_001037954chr1133303 2748 1263 12683 22495 673 --
NM_001038707chr122085 1644 --12060 --
NM_001038707chr122085 1644 --12060 --
NM_001039091chrX--11348 ----
NM_001039199chr20115035 4846 4587 4305 3718 3551 1684 1510 798 239 129 44376 3622 3446 1281 ----
NM_001039350chr731775 1679 1311 --11393 --
NM_001039395chr93902 579 96 ------
NM_001039465chr14--1425 ----
NM_001039538chr233708 3381 438 --13592 --
NM_001039547chr367592 5732 5635 5566 2909 2305 57532 5501 4957 2079 855 --12209
NM_001039550chr23903 327 121 1684 1168 --
NM_001039569chr242976 2133 1219 203 33046 2912 178 --11127
NM_001039585chr131452 607 132 13588 11316 --
NM_001039590chrX32629 981 213 --13384 --
NM_001039591chrX32629 981 213 --13384 --
NM_001039618chr1114332 ----15789
NM_001039690chr16102339 2152 2031 1914 1822 1682 1668 725 611 342 ------
NM_001039709chr20134975 4830 4249 4035 3795 3475 1680 1655 1051 727 421 221 138 14707 1794 --
NM_001039770chr342261 643 161 133 12355 ----
NM_001039802chr121062 322 ------
NM_001039840chrX54330 4317 4009 1386 190 --15901 --
NM_001039845chr22696 538 1628 ----
NM_001039877chr194195 128 113 101 ------
NM_001039888chr11733 ------
NM_001039937chr1332762 1199 261 11652 ----
NM_001040057chr721402 1130 ------
NM_001040110chr731581 1305 1144 ------
NM_001040142chr21962 1711 ----
NM_001040143chr21962 1711 ----
NM_001040144chr16102339 2152 2031 1914 1822 1682 1668 725 611 342 ------
NM_001040146chr16102339 2152 2031 1914 1822 1682 1668 725 611 342 ------
NM_001040151chr11104480 4317 4090 3572 3425 3265 2976 1541 547 30 14555 ----
NM_001040152chr764563 4309 4235 3570 1837 1457 13520 23672 3320 --
NM_001040172chr551269 1182 647 340 70 ------
NM_001040173chr551269 1182 647 340 70 ------
NM_001040179chr641004 778 665 226 1941 ----
NM_001040214chr6--21642 719 1664 --
NM_001040272chr931578 1465 865 11755 21722 693 --
NM_001040284chr1664748 4715 4447 1363 1088 281 24870 4434 15360 --
NM_001040402chr41678 12982 ----
NM_001040409chr21857 ------
NM_001040429chr1312471 ------
NM_001040436chr123624 458 213 ------
NM_001040439chr1651358 1007 932 578 134 ------
NM_001040441chr1105094 4706 2078 1884 1828 1719 1218 1030 864 218 44611 4476 1788 1655 ----
NM_001040446chr541889 1740 1690 627 1541 ----
NM_001040450chr1552899 2733 1120 371 89 22668 1055 ----
NM_001040453chr1552899 2733 1120 371 89 22668 1055 ----
NM_001040633chr71426 ------
NM_001040661chr751071 812 767 57 37 ------
NM_001040694chr118969 898 428 355 244 184 80 56 ------
NM_001040709chr152542 2322 1909 1776 714 11951 1959 --
NM_001040712chr943445 3348 3150 2333 ----13554
NM_001042353chr202578 531 ------
NM_001042361chr101301 ----1508
NM_001042364chr101301 ----1508
NM_001042365chr101301 ----1508
NM_001042371chr1672102 1870 1575 1465 1288 626 304 1191 ----
NM_001042387chr101301 ----1508
NM_001042388chr182654 395 ------
NM_001042393chr101301 ----1508
NM_001042396chr101301 ----1508
NM_001042397chr101301 ----1508
NM_001042403chr122974 747 ------
NM_001042404chr1193 ------
NM_001042413chr974009 2848 2792 1539 1262 1083 677 --13832 --
NM_001042425chr611319 11596 ----
NM_001042459chr31228 ------
NM_001042473chr1021973 1736 11513 --1722
NM_001042478chr12351 53 ------
NM_001042479chrX31916 1329 137 32138 795 663 ----
NM_001042480chrX31916 1329 137 32138 795 663 ----
NM_001042481chr1452471 2016 1729 770 625 ------
NM_001042486chr2031483 1471 1283 --1356 --
NM_001042494chr1543144 3102 2853 1514 --2814 102 13679
NM_001042495chr1543144 3102 2853 1514 --2814 102 13679
NM_001042496chr1543144 3102 2853 1514 --2814 102 13679
NM_001042497chr1543144 3102 2853 1514 --2814 102 13679
NM_001042533chr343232 2085 834 572 ------
NM_001042537chrX42126 1992 1945 506 ------
NM_001042548chr24786 684 587 579 ------
NM_001042555chr1234744 1108 582 ----11022
NM_001042573chr1752061 1700 889 761 71 --22199 1983 --
NM_001042599chr227346 6711 --17225 --
NM_001042601chr322934 384 ------
NM_001042603chr1264032 3617 3270 1458 1382 581 --11486 --
NM_001042604chr313523 14425 11281 --
NM_001042632chr2032501 873 548 ------
NM_001042633chr2032501 873 548 ------
NM_001042669chr421582 332 11519 ----
NM_001042681chr162203 2014 1834 1825 968 742 1535 1833 --
NM_001042682chr162203 2014 1834 1825 968 742 1535 1833 --
NM_001042682chr162203 2014 1834 1825 968 742 1535 1833 --
NM_001042728chr123780 250 210 ------
NM_001042749chrX1720 ------
NM_001042750chrX1720 ------
NM_001042751chrX1720 ------
NM_001043318chr14103936 3330 3176 1461 1354 1256 1020 987 958 680 --13594 13837
NM_001044305chr611438 1149 ----
NM_001044385chr233849 1043 505 --22805 744 --
NM_001046chr552913 2653 2442 1190 458 ------
NM_001048183chr1123691 3455 2494 2377 2328 1422 1318 1253 956 813 587 335 21188 748 ----
NM_001049chr1431979 1948 1750 12046 ----
NM_001050chr1731467 1301 243 11371 1162 --
NM_001068chr3--1217 ----
NM_001069chr61159 ------
NM_001071775chr1311921 11965 1307 --
NM_001079874chr151910 1758 1438 220 61 12078 1229 --
NM_001083620chr422264 2064 ------
NM_001092chr1782347 2270 1811 1635 666 587 500 51 --11717 --
NM_001094chr173690 632 322 ----1683
NM_001096chr174859 537 106 86 1756 1581 --
NM_001099678chr366113 4988 4822 2085 120 70 24892 502 ----
NM_001100108chr1108246 7885 6458 6139 5742 5664 5628 5292 755 713 56206 6074 5568 5434 1040 15941 15244
NM_001106chr3116246 3623 3289 3177 3094 2790 1685 1101 1091 806 21 17774 29347 3819 19271
NM_001113490chrX43348 2898 1105 869 ----12762
NM_001116chr1642752 2422 2228 1176 ------
NM_001117chr1842140 1612 917 441 11581 --11822
NM_001122631chr111544 1639 1614 --
NM_001122679chr5----1911 --
NM_001123chr10--1159 ----
NM_001128chr1653543 3324 1291 1079 934 13437 ----
NM_001130chr193264 219 156 1797 1717 --
NM_001146chr83826 403 273 21845 1583 ----
NM_001148chr422011 407 ------
NM_001157chr103283 128 74 1672 1483 --
NM_001167chrX126100 5429 5379 5355 5264 4472 4271 4106 2688 1885 1220 683 76168 6126 6035 5333 4175 2296 1319 ----
NM_001172chr14----1550 --
NM_001173chr1453624 3607 1909 653 380 ------
NM_001177chr1242153 1982 1825 786 --2646 344 21843 741
NM_001178chr111189 --168 --
NM_001189chr44387 365 172 78 ------
NM_001191chr2071325 1143 1093 1061 1053 979 358 11251 11443 --
NM_001198chr6--276 62 ----
NM_001199chr81221 ------
NM_001200chr2011074 ------
NM_001204chr236785 5078 244 24979 4846 15179 --
NM_001206chr91693 ------
NM_001219chr742146 613 492 401 ------
NM_001222chr1071671 740 596 478 384 185 73 ------
NM_001241chr222219 953 1638 ----
NM_001241chr222219 953 1638 ----
NM_001253chr61294 ------
NM_001256chr1732091 1911 1134 ------
NM_001257chr1641168 580 340 23 --11258 1161
NM_001259chr766182 5704 2013 1572 382 227 ----1819
NM_001260chr13------1299
NM_001277chr11------1953
NM_001282chr1762675 2557 2544 2532 2517 2367 --21783 734 --
NM_001293chr113484 407 356 ------
NM_001294chr191406 ------
NM_001304chr1722551 1315 ------
NM_001310chr1252990 2842 1198 619 376 ------
NM_001313chr43810 690 27 --1946 --
NM_001316chr201388 ------
NM_001319chr193992 918 361 --1409 --
NM_001328chr45644 606 486 259 162 ------
NM_001329chr1021619 492 ------
NM_001331chr1172153 2044 1086 962 910 773 411 ------
NM_001332chr52996 988 --1107 --
NM_001356chrX1504 --11671 --
NM_001364chr1154674 3528 3500 1110 904 --12981 14163
NM_001385chr8--1285 ----
NM_001386chr852143 1566 817 608 338 --1112 --
NM_001387chr562943 2840 2536 2077 401 274 ------
NM_001391chr18--11117 ----
NM_001396chr2111767 --12164 --
NM_001399chrX113855 3710 3399 2411 1536 1481 898 812 635 579 164 ------
NM_001406chr173672 588 430 ------
NM_001412chrX23202 453 11160 31308 501 479 12424
NM_001418chr111529 1475 ----
NM_001418chr111529 1475 ----
NM_001420chr1933120 2628 429 --12466 --
NM_001430chr23454 355 67 ------
NM_001438chr121394 1171 ------
NM_001452chr6--1643 ----
NM_001453chr621726 1125 ------
NM_001457chr341377 1041 337 53 --2204 88 --
NM_001482chr152341 136 ------
NM_001483chr7----1122 --
NM_001491chr662587 2390 1753 796 789 630 12294 157 --
NM_001495chr831187 337 202 ------
NM_001498chr621330 851 1254 ----
NM_001514chr13551 529 46 ------
NM_001546chr6--11154 ----
NM_001552chr173209 89 83 ------
NM_001553chr4123 ------
NM_001554chr11464 --1261 --
NM_001560chrX52648 2262 767 601 509 32404 671 536 ----
NM_001584chr111900 ------
NM_001610chr112651 167 1610 ----
NM_001614chr171441 1559 --1139
NM_001614chr171441 1559 --1139
NM_001616chr221203 339 1775 1489 --
NM_001621chr722224 2170 22723 1997 --12130
NM_001621chr722224 2170 22723 1997 --12130
NM_001650chr1823358 1580 --24135 3700 --
NM_001654chrX1461 ------
NM_001655chr1111925 --21973 1508 --
NM_001656chr521588 672 ------
NM_001658chr12947 150 ------
NM_001659chr1242598 1889 997 921 1474 1577 --
NM_001660chr32694 54 ------
NM_001661chr171761 1572 174 --
NM_001663chr1412540 --1472 12681
NM_001668chr141540 814 488 362 ------
NM_001670chr224679 206 141 92 ------
NM_001678chr1741797 1425 713 159 ------
NM_001679chr32183 43 ------
NM_001683chr332599 2426 467 ------
NM_001695chr843171 1487 1453 914 34271 213 146 --1851
NM_001699chr1911299 --11700 --
NM_001706chr33974 325 157 ------
NM_001709chr1152691 2644 1944 1879 215 ------
NM_001731chr12----1210 1684
NM_001742chr721776 658 --1675 --
NM_001746chr52945 796 --1146 --
NM_001753chr741866 1740 1187 196 ------
NM_001754chr2124199 585 ------
NM_001755chr1622067 1525 ------
NM_001759chr1275081 4782 4691 4250 3675 3555 1075 ----11198
NM_001760chr63781 107 94 ------
NM_001773chr1126 ------
NM_001777chr312808 ------
NM_001788chr7150 ------
NM_001789chr321192 116 ------
NM_001791chr121062 322 ------
NM_001800chr19----1477 --
NM_001829chr42835 353 ------
NM_001854chr111252 ------
NM_001855chr91619 ------
NM_001859chr983868 3816 3650 2496 2472 1221 764 598 43720 2431 668 532 13300 11541
NM_001895chr202124 67 1928 ----
NM_001896chr162330 23 ------
NM_001901chr6--1391 1753 --
NM_001907chr16172 --1296 --
NM_001918chr1188685 8591 8576 8175 7394 7198 5838 3653 3635 3518 2608 2444 1875 1763 1620 1568 548 382 52514 2381 1779 1636 317 --17860
NM_001931chr11----1121 --
NM_001935chr22805 778 ------
NM_001936chr731775 1679 1311 --11393 --
NM_001938chr111215 --1729 --
NM_001942chr181659 1261 --11915
NM_001945chr521181 518 11041 ----
NM_001946chr121833 1123 ----
NM_001954chr61803 ------
NM_001955chr621083 699 ------
NM_001956chr12503 72 1523 ----
NM_001964chr51412 ------
NM_001967chr31406 1236 ----
NM_001968chr41818 ------
NM_001969chr1473805 2851 2804 2625 1225 402 148 ------
NM_001975chr123887 709 572 1596 ----
NM_001981chr142088 2024 1486 273 ----12237
NM_001991chr1752230 2172 1520 696 504 ----1366
NM_001995chr411286 ------
NM_001999chr521500 48 ----1340
NM_002015chr1333079 2439 2334 --1592 1851
NM_002017chr11--11015 ----
NM_002025chrX59096 8727 8322 7317 2405 16181 17176 27975 3096
NM_002032chr111373 ------
NM_002033chr1133844 1604 1422 --1921 --
NM_002035chr1843282 3212 570 50 ------
NM_002040chr213468 361 113 ------
NM_002045chr31111 --2119 51 --
NM_002048chr91206 ------
NM_002051chr101171 --21126 987 --
NM_002061chr151952 1787 1477 1312 138 41723 1381 1179 83 ----
NM_002063chrX1961 149 ----
NM_002065chr131178 531 519 ------
NM_002076chr1262893 2364 2056 968 953 403 174 1671 --
NM_002077chr9173 11880 ----
NM_002086chr1751974 1655 879 806 391 21824 655 32022 1385 90 --
NM_002090chr4--1552 --1188
NM_002092chr484583 4044 3826 3633 3599 3585 3491 393 --21389 1047 --
NM_002107chr11475 ------
NM_002111chr4103735 3525 3431 1152 642 488 426 220 92 58 ------
NM_002112chr153300 212 25 --1264 --
NM_002114chr61451 ------
NM_002126chr1744147 3655 3459 169 1717 --12727
NM_002130chr541651 1088 447 141 ------
NM_002136chr12----1656 --
NM_002141chr7----1169 1437
NM_002146chr1751426 1005 909 158 132 --11080 --
NM_002147chr176882 782 666 290 253 111 ----1765
NM_002149chr25733 651 613 113 41 ------
NM_002181chr22541 283 ------
NM_002192chr71483 ------
NM_002193chr261667 595 571 534 332 143 --1605 --
NM_002199chr42401 214 ------
NM_002202chr51757 --1142 --
NM_002204chr1731277 1188 900 ------
NM_002241chr152906 2812 550 457 137 --12336 --
NM_002247chr101597 ------
NM_002253chr43542 197 178 --11310 --
NM_002254chr242319 1685 1479 314 ------
NM_002264chr344975 4061 1893 1863 13919 --11852
NM_002265chr1731074 454 422 ------
NM_002268chr32618 115 --1741 11865
NM_002270chr545151 3895 2213 566 ----12206
NM_002271chr131671 ----11512
NM_002285chr273008 2658 1663 1026 803 451 187 ------
NM_002290chr621443 980 ------
NM_002293chr11752 ----11017
NM_002309chr22102630 2511 2453 2269 2120 1202 736 683 651 66 1865 ----
NM_002310chr576555 6281 5705 2324 2078 1897 997 26067 3989 ----
NM_002313chr1055030 4983 4111 458 134 --11782 --
NM_002315chr11131 1209 1217 --
NM_002334chr11299 30 ------
NM_002336chr1224665 210 --13069 14239
NM_002356chr6--12867 ----
NM_002359chr17104242 4149 3719 3621 3606 3382 3277 1247 592 536 ------
NM_002361chr191254 1318 ----
NM_002374chr233708 3381 438 --13592 --
NM_002376chr143546 475 122 ------
NM_002382chr14136 ------
NM_002390chr1771526 690 651 626 351 192 26 11910 ----
NM_002398chr211370 ------
NM_002399chr1521142 982 ------
NM_002401chr1772382 1791 1670 928 625 467 134 --2616 207 --
NM_002406chr53822 264 81 ------
NM_002409chr22123243 3030 2925 2684 2494 2013 1990 1289 1068 700 435 336 --21160 656 --
NM_002430chr2241782 921 649 52 ------
NM_002438chr103165 154 115 ------
NM_002449chr5138 11222 ----
NM_002451chr973696 2919 2801 2669 1548 1532 1263 --23825 1565 --
NM_002480chr12179 ------
NM_002481chr197220 7188 6894 5229 2300 2264 1946 1739 1522 47960 4931 2204 2070 17512 --
NM_002499chr1582356 2341 880 683 539 483 187 37 12394 1199 --
NM_002500chr2------1828
NM_002501chr1994048 3989 3912 3703 1525 1433 851 502 433 ----1517
NM_002507chr1751726 1492 1439 1236 533 ------
NM_002509chr202640 602 ------
NM_002515chr1431893 266 224 ------
NM_002516chr193286 257 89 ------
NM_002519chr1121503 1028 ------
NM_002538chr51458 --1488 --
NM_002539chr2138 ----1270
NM_002545chr1134830 169 83 --23293 1238 --
NM_002547chrX33722 3095 227 11604 11590 --
NM_002576chr1131159 989 467 ------
NM_002581chr944472 3720 926 221 --24105 590 15698
NM_002586chr61208 11276 ----
NM_002589chr42111 75 ------
NM_002590chr13--1370 ----
NM_002595chr121338 ------
NM_002599chr112920 313 1164 ----
NM_002600chr131315 440 208 ------
NM_002607chr731276 1076 437 ------
NM_002608chr223414 353 106 --11163 --
NM_002613chr1694562 4266 1838 1696 1661 1395 1245 934 568 14983 25125 1749 --
NM_002628chr31889 ------
NM_002635chr12135 ------
NM_002651chr13844 229 162 ------
NM_002655chr823592 3374 --14121 --
NM_002657chr2052698 1125 1094 709 66 1130 ----
NM_002669chr4160 ------
NM_002673chr33212 37 21 190 ----
NM_002687chr14----1327 --
NM_002709chr213164 --23513 388 --
NM_002710chr122885 88 ------
NM_002714chr63805 739 199 ------
NM_002716chr11103578 3429 3264 3059 3041 2340 1478 1336 1168 337 1607 13106 --
NM_002717chr8--1455 ----
NM_002729chr101600 ------
NM_002731chr152979 2943 2922 2786 201 12581 22263 706 --
NM_002734chr1732226 1799 120 1508 ----
NM_002736chr741957 1815 1685 492 ------
NM_002737chr1776005 5544 4488 2627 1700 1147 119 --21794 389 15529
NM_002740chr372710 2685 1866 830 679 613 70 ------
NM_002748chr15--11209 ----
NM_002750chr10137 ------
NM_002751chr2271185 1044 460 330 205 68 47 --130 --
NM_002753chr43290 95 34 1591 ----
NM_002755chr15179 1352 1606 --
NM_002756chr173687 365 284 ------
NM_002760chrY85597 5392 4425 3943 1184 1010 938 286 24014 1036 ----
NM_002761chr162131 110 ------
NM_002765chrX--11348 ----
NM_002776chr1911337 1201 ----
NM_002786chr11--1203 ----
NM_002790chr1--1125 ----
NM_002792chr20--123 ----
NM_002809chr17--1324 ----
NM_002810chr12108 28 ------
NM_002814chrX----2697 177 --
NM_002819chr1941357 429 294 276 ----11455
NM_002833chr1541558 1216 1172 425 ------
NM_002835chr7--1246 1680 --
NM_002839chr943445 3348 3150 2333 ----13554
NM_002840chr151350 1187 1172 1009 544 --11582 --
NM_002843chr1143424 3124 2128 1029 21036 925 ----
NM_002844chr611326 --11065 --
NM_002845chr181562 ------
NM_002849chr12--1280 ----
NM_002855chr1163258 2812 2391 1242 989 25 --13411 --
NM_002857chr172377 1013 989 491 471 185 103 ------
NM_002869chr1121631 137 ------
NM_002871chr141757 1587 1381 101 ------
NM_002874chr921725 1656 --12091 --
NM_002883chr226779 735 725 184 122 29 ------
NM_002886chr374777 3896 1179 802 594 335 307 ------
NM_002892chr1421274 210 ------
NM_002912chr63740 697 109 1371 ----
NM_002918chr19----2918 402 --
NM_002924chr11488 1496 ----
NM_002926chr471106 1054 922 888 729 295 178 1957 11167 --
NM_002938chr441981 1239 704 282 ------
NM_002942chr32357 343 ------
NM_002948chr33453 92 79 ------
NM_002955chr621584 186 --2679 373 --
NM_002968chr16------1424
NM_002977chr233203 2427 501 --133 --
NM_002994chr411291 11554 11356 --
NM_002998chr8----12209 --
NM_003001chr13422 242 82 --1532 --
NM_003010chr1741628 950 744 440 22300 142 ----
NM_003011chr921543 1339 ------
NM_003012chr882895 2484 2451 2255 1279 779 133 101 --1738 --
NM_003017chr6197 ------
NM_003028chr963428 3244 1007 508 179 36 ----12668
NM_003030chr33279 48 30 ----11684
NM_003034chr1297498 7478 7181 7083 4978 4961 3202 2354 700 16686 21518 775 --
NM_003037chr12404 200 1111 ----
NM_003042chr3----22106 629 --
NM_003045chr13144757 4269 3825 3632 3531 1708 1581 1548 1343 985 942 771 703 543 --1883 --
NM_003051chr11171 171 --11929
NM_003055chr103374 294 283 ------
NM_003062chr5141 ------
NM_003068chr8------1395
NM_003069chrX2600 593 ------
NM_003070chr92880 807 ------
NM_003071chr321750 217 --1713 --
NM_003074chr331440 867 741 ------
NM_003077chr173776 695 36 --1561 --
NM_003085chr53601 164 152 --1140 --
NM_003088chr761173 911 804 728 280 224 --1451 --
NM_003106chr31999 ------
NM_003107chr612584 ----12344
NM_003108chr2117179 7173 6866 6339 2258 1991 1947 1519 711 474 315 --25333 458 11553
NM_003111chr211048 ------
NM_003112chr71473 --12606 --
NM_003127chr92111 102 ------
NM_003128chr262797 2361 2345 2256 1023 997 ------
NM_003130chr731199 1033 59 --1204 --
NM_003131chr651844 552 435 274 169 11859 ----
NM_003139chr112886 128 ------
NM_003145chr11180 ------
NM_003155chr82609 584 1978 ----
NM_003161chr1733324 881 427 1752 ----
NM_003162chr24359 289 225 217 --1311 --
NM_003174chr101148 ------
NM_003178chr342096 1578 1437 895 2653 191 ----
NM_003179chrX61317 1299 1261 1177 1046 57 11072 ----
NM_003186chr113361 294 69 ------
NM_003189chr192740 2269 2189 963 593 564 516 422 311 --1702 --
NM_003199chr1844492 3576 377 123 ------
NM_003204chr1721235 1201 ------
NM_003211chr1221742 314 ------
NM_003220chr611319 11596 ----
NM_003222chr202811 92 21201 902 ----
NM_003234chr341659 1509 525 42 ------
NM_003236chr252905 2581 2233 2195 1360 23339 119 ----
NM_003242chr312229 1287 ----
NM_003246chr15--11834 1796 --
NM_003250chr172445 315 1420 1385 --
NM_003253chr2161925 1781 1567 444 269 210 ------
NM_003255chr1762558 925 871 766 571 362 ------
NM_003257chr151343 1948 ----
NM_003274chr211181 ----11161
NM_003292chr122192 1621 ------
NM_003295chr13157 ------
NM_003298chr3115037 4995 4581 4567 4264 2120 1743 1171 1141 994 464 --25275 1275 --
NM_003300chr14163 ------
NM_003304chr3--11304 ----
NM_003315chr17----1225 --
NM_003319chr21668 ------
NM_003336chrX1343 11034 ----
NM_003337chr511588 11492 1151 --
NM_003339chr511429 1452 ----
NM_003340chr4----1991 --
NM_003341chr32662 35 ------
NM_003342chr1723064 2228 12840 12833 --
NM_003344chr731135 1119 460 --1276 --
NM_003345chr161522 ------
NM_003347chr2282077 1926 1559 1548 756 732 697 118 ------
NM_003348chr122630 513 --21248 610 --
NM_003349chr2041472 440 430 363 --1475 --
NM_003352chr22702 281 1733 ----
NM_003371chr952006 1941 1662 451 178 --164 --
NM_003373chr103719 590 113 ----1209
NM_003379chr65985 316 292 208 66 1285 11046 --
NM_003383chr9----1140 --
NM_003385chr22283 53 ------
NM_003387chr252131 1942 789 502 226 --11059 --
NM_003388chr751324 1305 584 252 232 --22074 2053 --
NM_003389chr91550 2487 396 ----
NM_003390chr1111051 --2860 198 --
NM_003392chr331659 1594 535 ------
NM_003400chr21645 ------
NM_003404chr2021483 1314 --11829 --
NM_003406chr821709 1426 ------
NM_003410chrX32387 1250 727 12700 ----
NM_003412chr321959 748 --12734 --
NM_003413chrX21222 342 ------
NM_003430chr192138 102 142 ----
NM_003439chr743162 2495 2330 1018 23565 2264 23014 987 --
NM_003457chr171458 ------
NM_003458chr352763 2452 1586 391 76 1839 11533 13382
NM_003459chr25634 616 570 514 279 ------
NM_003462chr121761 1241 ------
NM_003463chr632498 752 235 ----11225
NM_003468chr244111 3699 3661 813 1690 --11414
NM_003469chr21148 1373 ----
NM_003471chr332035 100 46 1923 ----
NM_003474chr102824 283 1730 ----
NM_003478chr1112976 --1718 --
NM_003482chr1231894 1878 430 12380 11008 --
NM_003483chr1222897 2862 --12574 --
NM_003487chr171280 ------
NM_003489chr2133089 2925 594 ------
NM_003498chr1632165 2123 223 1469 2885 284 --
NM_003505chr721930 1739 --1275 --
NM_003507chr25652 590 477 385 87 --1280 --
NM_003558chr9--1646 ----
NM_003559chr1773890 3146 3123 3013 1564 1384 853 --23612 144 --
NM_003562chr174366 160 139 59 ------
NM_003563chr1721192 232 ------
NM_003574chr1874579 4105 2309 2029 1577 1438 631 --21114 621 --
NM_003576chr1342548 2541 2379 1151 12450 22864 1937 --
NM_003581chr21684 ------
NM_003582chr1------1185
NM_003583chr1231476 1050 826 13564 ----
NM_003592chr72357 90 ----1192
NM_003603chr421945 171 ------
NM_003607chr164111 1716 1702 1201 1126 93 1661 22836 1162 --
NM_003615chr323127 1606 --11024 22613 1374
NM_003620chr17--1162 ----
NM_003624chr1971300 1127 1104 1089 478 460 133 ------
NM_003626chr11--1342 11218 --
NM_003628chr21235 ------
NM_003629chr1103488 3115 2796 2688 2452 2254 1372 822 174 94 1898 22412 249 --
NM_003637chr141460 996 424 128 ------
NM_003642chr2129 ------
NM_003644chr17106256 5897 5479 5244 4659 4472 4281 1288 906 328 15251 12363 --
NM_003648chr272013 963 797 776 670 473 294 --22625 70 --
NM_003653chr17----2204 89 --
NM_003654chr112617 544 --1602 --
NM_003663chr332855 2650 2260 12951 12589 --
NM_003664chr51412 ------
NM_003670chr32400 368 ------
NM_003671chr9102976 2901 2891 2884 2722 2656 1250 983 550 298 --22737 1102 --
NM_003677chr1272304 2254 2138 1848 728 319 31 11857 11828 --
NM_003679chr133345 2964 2410 ------
NM_003685chr194861 786 636 184 ------
NM_003704chr41620 --3585 518 189 --
NM_003713chr11339 --1265 --
NM_003716chr3121 --162 --
NM_003722chr342659 1106 468 210 ------
NM_003725chr12--1407 ----
NM_003741chr32283 41 ------
NM_003743chr241807 1480 1412 428 --2781 499 --
NM_003759chr423721 535 23272 642 11449 --
NM_003760chr11558 1730 ----
NM_003774chr1233221 1069 540 ------
NM_003780chr13665 613 61 ------
NM_003787chr18----1307 --
NM_003795chr6--1498 ----
NM_003796chr19----1194 --
NM_003797chr11143 ------
NM_003799chr18104081 3850 3790 3774 3135 3119 2754 1565 160 90 1452 22821 1260 --
NM_003822chr153201 2812 1226 662 611 ------
NM_003861chr1442838 466 195 117 ------
NM_003862chr51246 ------
NM_003872chr232559 2290 353 ------
NM_003873chr1021686 630 ------
NM_003877chr122953 148 ------
NM_003885chr1731896 1658 275 --22006 1718 --
NM_003888chr1531202 41 32 ------
NM_003901chr1041965 821 528 134 ------
NM_003907chr3--1338 ----
NM_003908chr202960 529 --130 --
NM_003913chr632651 474 459 12641 ----
NM_003914chr131198 ------
NM_003924chr441527 379 359 309 ------
NM_003930chr742364 958 696 32 ------
NM_003931chr62675 58 ----1459
NM_003932chr221278 --11770 --
NM_003936chr241195 1183 1127 252 ------
NM_003939chr1043003 1548 1206 415 11226 13039 13362
NM_003941chr72623 63 ------
NM_003958chr653494 3449 2758 2559 49 --13701 --
NM_003966chr586979 5521 5187 2573 1113 792 536 50 17320 --1841
NM_003968chr3--1182 ----
NM_003969chr193302 258 234 ------
NM_003975chr13215 61 33 ------
NM_003980chr6--11338 1457 1541
NM_003981chr151261 --2760 309 --
NM_003983chr16104161 3954 3560 3051 1540 1427 1274 632 434 27 --1836 13483
NM_003994chr122771 439 --13062 1405
NM_004006chrX----22333 234 --
NM_004007chrX----22333 234 --
NM_004009chrX----22333 234 --
NM_004010chrX----22333 234 --
NM_004011chrX----22333 234 --
NM_004012chrX----22333 234 --
NM_004013chrX----22333 234 --
NM_004014chrX----22333 234 --
NM_004015chrX----22333 234 --
NM_004016chrX----22247 148 --
NM_004017chrX----22333 234 --
NM_004018chrX----22247 148 --
NM_004020chrX----22333 234 --
NM_004021chrX----22247 148 --
NM_004022chrX----22247 148 --
NM_004023chrX----22247 148 --
NM_004028chr1823358 1580 --24135 3700 --
NM_004040chr25415 299 218 190 111 1431 ----
NM_004052chr10150 ------
NM_004059chr9165 ------
NM_004060chr521081 250 ------
NM_004085chrX1576 1189 ----
NM_004089chrX41259 1136 357 275 --11159 --
NM_004093chr1322601 2473 12695 23161 2962 --
NM_004094chr1431975 1069 272 11896 23026 2835 --
NM_004100chr622500 2083 --32455 2299 861 --
NM_004112chr1741662 1517 1474 654 ------
NM_004114chrX----1196 --
NM_004124chr14--13572 ----
NM_004130chr3----2226 87 --
NM_004171chr1188546 8417 6721 3545 2724 1504 987 498 23070 2974 68325 6903 6800 6355 2983 2385 12538
NM_004181chr4--1287 ----
NM_004183chr112642 122 ------
NM_004185chr12692 517 ------
NM_004187chrX2588 77 ------
NM_004200chr1163284 1071 1042 591 441 81 11121 ----
NM_004202chrY2212 184 ------
NM_004227chr733012 2903 2389 --12660 --
NM_004229chrX22066 381 ------
NM_004235chr91204 --1653 --
NM_004263chr251542 1357 354 157 79 21844 1116 11650 --
NM_004272chr531377 1322 660 --1444 1185
NM_004274chr1422852 254 ------
NM_004279chr742074 1696 1672 671 --1778 1823
NM_004293chr911006 --13690 --
NM_004302chr1221924 541 1636 22928 2199 --
NM_004311chr1053128 3020 2864 2425 2188 11962 1508 --
NM_004319chr162274 1271 1058 540 431 70 --11954 --
NM_004321chr2103496 3361 2905 2896 2564 2320 1351 672 488 61 13426 ----
NM_004327chr22112411 2035 1741 1682 1644 939 795 653 270 163 39 --12228 --
NM_004338chr1867040 6624 5606 5560 4960 1843 16966 11938 --
NM_004342chr71662 --1216 11713
NM_004362chr4185 ------
NM_004370chr62533 478 1406 --21543 98
NM_004380chr1632482 2419 2182 ------
NM_004386chr1922257 435 ------
NM_004389chr23842 181 131 ------
NM_004392chr1322601 1749 ----12241
NM_004393chr382234 2161 918 680 139 80 64 42 ----11910
NM_004396chr17128 ------
NM_004397chr1164260 3992 3838 2720 927 428 --1348 --
NM_004405chr23804 768 202 --1306 --
NM_004411chr71772 ------
NM_004412chr1035974 5923 1112 24685 2009 24366 707 --
NM_004415chr61626 ------
NM_004423chr372199 1950 1788 1051 805 756 596 21858 1723 ----
NM_004426chr1211448 --1433 --
NM_004428chr11718 ------
NM_004429chrX81106 1023 966 500 475 350 178 42 ------
NM_004430chr862812 1816 1708 868 455 57 ------
NM_004432chr91461 ------
NM_004437chr133128 2887 1183 12315 ----
NM_004438chr23682 669 588 ----1257
NM_004440chr611260 ------
NM_004441chr311187 ------
NM_004447chr1251152 1128 757 401 386 ------
NM_004454chr322019 102 ------
NM_004457chr251478 1283 1249 595 181 ------
NM_004458chrX2999 41 ------
NM_004459chr171645 ------
NM_004474chr12995 427 ------
NM_004475chr1741188 924 264 170 --11117 --
NM_004480chr141546 ------
NM_004481chr141930 1789 864 53 --12691 12591
NM_004499chr52545 104 ------
NM_004500chr142608 55 --11942 --
NM_004501chr123743 982 33368 878 836 ----
NM_004504chr222414 125 --22318 826 13045
NM_004505chr173635 286 29 ----1230
NM_004512chr91256 ------
NM_004514chr1732650 1988 594 ------
NM_004516chr1921043 148 --1131 --
NM_004520chr51102 --1649 --
NM_004540chr211109 ----1121
NM_004560chr93991 386 121 ------
NM_004561chr1141828 1449 584 230 ------
NM_004569chr141485 --1470 --
NM_004571chr2163213 3182 3083 2717 2577 2418 --1537 --
NM_004575chr421500 225 11320 ----
NM_004576chr5--1345 ----
NM_004586chrX74338 3807 3550 1736 1569 1285 680 35413 5275 1504 ----
NM_004588chr1173686 2603 1489 1374 1002 441 361 21272 1151 13640 --
NM_004593chr31865 --1337 --
NM_004596chr19----1153 --
NM_004598chr553330 2981 2971 847 148 --1766 --
NM_004602chr2041484 1461 1243 248 ------
NM_004612chr911052 14036 11040 24168 3094
NM_004613chr2031408 1272 21 --1175 --
NM_004615chrX1630 ------
NM_004622chr232468 1891 409 1225 ----
NM_004626chr114240 133 99 73 ------
NM_004630chr114882 854 428 205 ------
NM_004635chr351017 453 392 37 24 ------
NM_004637chr321266 514 ------
NM_004640chr62204 33 ------
NM_004646chr192359 71 1430 ----
NM_004655chr171215 1267 ----
NM_004660chrY2925 507 --11898 --
NM_004663chr151480 --1276 --
NM_004664chr121272 ------
NM_004670chr1021706 1063 ------
NM_004671chr18----165 --
NM_004694chr171200 ------
NM_004703chr1721783 26 --22443 2140 --
NM_004709chrX51712 1505 1446 1423 1392 ------
NM_004711chr2263392 3187 2921 936 783 298 ------
NM_004717chr731547 1439 1231 ------
NM_004718chr24613 478 280 170 ------
NM_004725chr1031407 1176 976 ------
NM_004726chrX44592 3886 2297 763 24802 384 35702 4755 3865 --
NM_004730chr521891 1641 ------
NM_004733chr32436 407 ------
NM_004734chr1342936 2351 2211 765 --1896 --
NM_004736chr122185 1447 ------
NM_004741chr1031544 1273 534 ------
NM_004742chr321335 99 --11688 --
NM_004745chr8105962 5928 4418 4304 1158 993 665 548 230 52 --11380 --
NM_004747chr101587 --189 --
NM_004755chr141435 1298 ----
NM_004768chr1----11131 --
NM_004774chr1752361 1249 1053 930 542 --1718 --
NM_004776chr2043186 2724 257 205 --1371 --
NM_004779chr53836 310 28 11297 ----
NM_004788chr1112351 11856 11018 --
NM_004794chrX189 ------
NM_004796chr142419 319 12150 --1403
NM_004798chr2063353 2508 2289 1376 893 495 11406 1355 1761
NM_004801chr21254 ------
NM_004805chr231214 1012 135 ------
NM_004808chr1063158 2993 2460 965 709 269 2870 737 --11019
NM_004822chr17141565 1356 1310 1281 1135 1115 1090 1073 881 760 601 577 346 311 ------
NM_004824chr631206 364 89 ------
NM_004831chr19--1898 ----
NM_004834chr242781 2709 2582 908 22452 2225 ----
NM_004844chr31343 ----11105
NM_004850chr221761 1596 21665 1531 ----
NM_004857chr1464613 1406 1259 887 721 357 1791 ----
NM_004860chr171127 ------
NM_004863chr14125206 4744 4354 4287 4213 4163 3563 1769 1602 1194 688 396 24814 4130 3920 304 51 --
NM_004869chr1841633 1191 1175 693 1628 ----
NM_004874chr8187 --128 --
NM_004879chr111220 ------
NM_004898chr442837 2684 2408 1009 ------
NM_004902chr203791 667 650 ------
NM_004904chr746082 1532 1031 210 15433 ----
NM_004921chr121740 794 --1138 --
NM_004926chr1411135 ------
NM_004929chr811332 --1152 --
NM_004937chr1792605 2398 1917 932 841 833 356 308 166 11686 1818 --
NM_004939chr2------143
NM_004947chr332153 1813 44 --11626 --
NM_004956chr743169 3062 1306 328 ----13919
NM_004959chr951327 317 310 196 53 11100 11317 --
NM_004961chrX21371 140 11482 ----
NM_004965chr21--1760 ----
NM_004969chr101375 ------
NM_004973chr611447 11130 1514 --
NM_004976chr11134528 4519 4282 4018 3999 3947 3679 1702 1683 706 156 108 93 1581 23442 507 --
NM_004983chr1----1233 --
NM_004985chr1244021 1383 933 225 ------
NM_004992chrX208170 6776 6546 6384 6050 6023 5905 5861 5784 5523 5368 3039 1898 1642 1452 1123 819 700 570 540 13303 1881 17183
NM_004992chrX208170 6776 6546 6384 6050 6023 5905 5861 5784 5523 5368 3039 1898 1642 1452 1123 819 700 570 540 13303 1881 17183
NM_005006chr2--1314 1686 --
NM_005011chr731581 1305 1144 ------
NM_005044chrX84474 4153 2944 1046 995 879 807 398 --11493 --
NM_005045chr71796 ------
NM_005056chr1264276 3861 3514 1702 1626 825 --11730 --
NM_005057chr121383 103 21452 1318 --11405
NM_005063chr1053047 2976 2489 2363 60 ------
NM_005065chr1454917 4789 4332 776 449 11495 --11362
NM_005066chr11141 1817 ----
NM_005076chr174075 4049 2612 1433 829 611 84 ----23532 2569
NM_005087chr3165 157 ----
NM_005093chr20134975 4830 4249 4035 3795 3475 1680 1655 1051 727 421 221 138 14707 1794 --
NM_005095chr121752 843 11590 ----
NM_005096chrX41185 990 248 42 ------
NM_005102chr24786 684 587 579 ------
NM_005103chr111276 ------
NM_005109chr352148 1679 1642 969 375 1759 ----
NM_005112chr421011 653 1162 ----
NM_005116chr20113900 3821 1657 1617 1585 1526 1289 1277 594 426 23 12811 11060 --
NM_005119chr11833 ------
NM_005121chr1713619 ----11402
NM_005124chr62292 269 ------
NM_005134chr182654 395 ------
NM_005135chr1543144 3102 2853 1514 --2814 102 13679
NM_005137chr22162466 2384 2313 2296 1896 1890 1678 1633 1622 888 712 641 399 184 95 43 ------
NM_005153chr161720 ------
NM_005154chr151234 ------
NM_005156chr944942 3344 1774 462 11783 25179 5155 11808
NM_005161chr1161882 672 537 306 300 23 --1324 --
NM_005163chr142381 32 ------
NM_005168chr231355 1221 707 ------
NM_005169chr112260 28 ------
NM_005180chr1021463 681 ------
NM_005188chr11177957 7744 7254 7079 7020 6935 6905 6770 6469 5706 5700 2732 2498 1661 1334 608 384 28328 2186 68244 7790 6048 5533 5512 945 16879
NM_005190chr61984 --1100 --
NM_005194chr201439 1528 ----
NM_005197chr1425484 793 21747 1414 2537 314 --
NM_005202chr161500 1474 758 598 212 188 ------
NM_005206chr1741437 1270 376 328 21341 1207 ----
NM_005207chr2273196 2984 2592 2390 1432 351 42 --13704 --
NM_005214chr221066 747 ------
NM_005219chr551604 1539 329 212 139 1440 1654 --
NM_005220chr173397 338 286 ------
NM_005222chr7--166 ----
NM_005229chrX2417 302 --11083 --
NM_005235chr227346 6711 --17225 --
NM_005238chr1133540 2557 260 ------
NM_005243chr22--1123 ----
NM_005254chr1511105 ------
NM_005257chr18------11037
NM_005269chr12------1140
NM_005271chr102949 375 ------
NM_005277chr421887 1345 ------
NM_005284chr62168 105 ------
NM_005308chr101185 ------
NM_005311chr742686 2381 2094 63 --32360 946 698 12037
NM_005324chr1731947 1905 379 ------
NM_005327chr43728 648 68 --1212 --
NM_005328chr81658 ------
NM_005329chr1641969 527 241 163 --1784 --
NM_005336chr292091 2073 1622 1514 799 698 677 178 32 ------
NM_005339chr464058 3305 969 434 186 32 1455 ----
NM_005347chr921343 574 ----11692
NM_005359chr1846131 2618 2277 216 15746 16498 --
NM_005370chr1931242 1026 50 ------
NM_005376chr121117 31 ------
NM_005378chr21179 1591 1751 --
NM_005385chr342765 1914 613 347 --175 1598
NM_005388chr92576 346 ------
NM_005392chr941539 1254 598 143 ------
NM_005398chr10--2173 62 ----
NM_005402chr7----1259 --
NM_005407chr1441331 543 492 152 ------
NM_005425chr16123 ----1127
NM_005429chr4170 --1118 --
NM_005436chr1023859 3702 --13980 --
NM_005458chr942332 1573 860 548 12127 22118 768 --
NM_005466chr142396 23 1164 ----
NM_005475chr1252729 2100 728 709 159 ------
NM_005477chr1542409 958 829 463 ------
NM_005477chr1542409 958 829 463 ------
NM_005479chr1031403 1073 294 ------
NM_005487chr2241618 597 424 314 ------
NM_005497chr17125780 5720 5555 5379 5213 4775 4474 4309 2466 2299 1364 781 45619 5490 4246 1170 14993 --
NM_005499chr191552 ------
NM_005502chr912792 13097 1895 --
NM_005505chr128827 345 299 197 144 119 46 33 ------
NM_005509chr511199 ------
NM_005512chr1161930 1709 1316 409 354 38 ------
NM_005517chr11576 ------
NM_005520chr5----1220 --
NM_005521chr102833 56 ------
NM_005523chr781550 1519 1446 1437 1036 1007 425 268 ------
NM_005529chr14937 647 388 335 ------
NM_005530chr1561126 1120 1079 205 177 96 ----11408
NM_005537chr131200 ------
NM_005539chr103901 481 194 1294 11152 --
NM_005544chr21258 ------
NM_005570chr182464 458 ----11162
NM_005575chr52142 52 1585 --146
NM_005578chr365167 3258 3176 1103 433 374 ------
NM_005581chr192470 376 ------
NM_005586chr64630 558 227 27 ------
NM_005587chr152353 266 ------
NM_005595chr12742 315 ------
NM_005596chr936330 5687 2132 --12369 --
NM_005603chr182527 459 1229 11832 --
NM_005604chr622502 2346 11955 ----
NM_005605chr81125 ------
NM_005609chr11----138 --
NM_005614chr72826 725 1977 1165 --
NM_005618chr61466 --1176 --
NM_005627chr6--1834 ----
NM_005637chr18--12010 ----
NM_005639chr12--1691 ----
NM_005643chr62621 172 1752 ----
NM_005647chrX83275 3257 2796 2617 1124 992 628 252 --12387 --
NM_005652chr16165 --1766 --
NM_005655chr81126 --185 --
NM_005665chr174639 4552 3837 1898 1529 1242 803 --24360 528 --
NM_005667chr2146 ------
NM_005668chr521844 490 14043 13383 14060
NM_005677chr361425 1300 1293 1095 580 157 11324 11264 --
NM_005688chr331071 1013 138 ------
NM_005715chr631082 791 594 12756 1763 --
NM_005718chr32786 727 1280 ----
NM_005721chr211020 --1373 --
NM_005724chr152297 131 --1706 --
NM_005730chr12103604 3383 2770 2417 1116 1094 963 927 816 676 1852 1338 --
NM_005736chr1041293 206 199 90 --21554 1353 --
NM_005737chr242145 771 683 201 11870 ----
NM_005738chr731855 1520 89 11903 11960 --
NM_005739chr1531684 410 309 --2841 126 11594
NM_005744chr15--1118 ----
NM_005746chr71768 1738 ----
NM_005749chr171114 ------
NM_005752chr1631246 1015 979 --1457 --
NM_005754chr5----198 1410
NM_005759chr243339 1386 398 170 --14681 11315
NM_005766chr1351338 1117 997 877 75 ------
NM_005776chr141162 --196 --
NM_005779chr523275 382 ------
NM_005785chr1251668 1613 1227 402 236 ------
NM_005786chr1831081 205 63 ------
NM_005789chr1721871 35 ------
NM_005801chr173686 552 243 ----199
NM_005808chr353361 2910 284 65 28 --21391 583 13120
NM_005809chr19145 --125 --
NM_005813chr222441 402 1449 12037 --
NM_005822chr62743 597 11607 ----
NM_005828chr17114531 3516 3208 3172 2003 1842 1579 1357 1117 729 651 24874 758 1932 --
NM_005832chr3----2339 95 --
NM_005836chr8124 ------
NM_005839chr1----1948 --
NM_005840chrX44722 2804 2355 1220 1628 11736 --
NM_005841chr4----11016 --
NM_005842chr131175 ------
NM_005862chr3----11097 173
NM_005866chr94878 775 575 302 ------
NM_005872chr11188 ------
NM_005880chr1611543 ----1438
NM_005885chr531172 634 522 ------
NM_005888chr12135 ------
NM_005897chr121205 1036 11103 ----
NM_005898chr1132415 961 851 ------
NM_005902chr1584658 4452 3152 2990 1265 904 589 464 13509 12804 --
NM_005907chr62470 104 ------
NM_005909chr554121 2932 2863 1531 580 ------
NM_005910chr1794068 3623 3362 3161 1521 1060 891 713 687 --23744 751 11653
NM_005911chr22916 597 --11368 --
NM_005920chr173474 2929 2744 1084 970 694 582 ------
NM_005924chr71730 ------
NM_005933chr1142042 618 475 333 --12022 1854
NM_005937chr17114076 3635 3410 1620 1211 816 808 402 246 69 54 --21402 118 1548
NM_005938chrX41171 962 951 419 ------
NM_005941chr863835 2786 902 363 110 101 ------
NM_005943chr611217 --31334 1270 422 --
NM_005944chr321104 211 ------
NM_005955chr1125081 4799 4686 4556 4487 3772 3742 1449 1213 703 637 267 --1689 --
NM_005962chr101495 --1518 --
NM_005962chr101495 --1518 --
NM_005966chr211738 --1147 --
NM_005973chr13350 329 50 ------
NM_005990chr582336 2104 946 725 501 190 103 30 --32392 1069 773 --
NM_006007chr973953 3622 1248 1143 686 554 125 1384 ----
NM_006011chr1564236 3646 3048 2702 1507 994 ------
NM_006022chr131253 ------
NM_006030chr341458 1384 1267 139 --1450 --
NM_006037chr294629 4395 4041 1836 1293 823 796 725 32 11665 1315 --
NM_006038chr2051572 1352 453 444 100 ------
NM_006040chr162384 283 --11012 --
NM_006043chr161740 --1199 --
NM_006047chr2033453 2682 118 --23220 1131 --
NM_006048chr11249 ------
NM_006054chr1151625 1586 284 104 98 ------
NM_006063chr2------184
NM_006067chr161272 1797 192 --
NM_006076chr782556 2315 2127 1016 861 464 238 78 ------
NM_006085chr13270 173 107 142 ----
NM_006095chr463918 3511 1478 1039 87 69 11662 ----
NM_006100chr31111 ------
NM_006106chr1132110 1100 832 --1287 --
NM_006108chr113961 427 69 ------
NM_006113chr151910 1758 1438 220 61 12078 1229 --
NM_006136chr721288 1201 --11080 --
NM_006141chr162363 151 12642 11812 --
NM_006145chr1921046 236 1909 ----
NM_006148chr17102909 2883 2857 2361 1865 1823 1150 697 377 287 11134 22186 111 --
NM_006159chr122205 155 ------
NM_006166chr1252527 2285 2122 868 665 ----147
NM_006180chr921945 1389 --1586 --
NM_006183chr121570 ------
NM_006191chr12124 ------
NM_006202chr1931922 1308 750 11462 11815 --
NM_006203chr545299 5252 4991 241 ------
NM_006216chr21631 1646 ----
NM_006241chr322283 490 ----11793
NM_006243chr12710 345 ------
NM_006246chr141955 --1384 --
NM_006251chr533085 2117 471 ------
NM_006252chr165550 5331 5114 4948 2179 1834 25598 5018 17559 --
NM_006256chr111914 --12690 --
NM_006258chr1011177 ----1345
NM_006265chr811471 21371 106 ----
NM_006267chr221733 721 ------
NM_006268chr112816 133 ------
NM_006275chr2021835 453 12186 12285 --
NM_006277chr23585 564 463 ------
NM_006282chr2094441 4015 3840 2958 2877 1472 1021 700 306 --13930 --
NM_006283chr884362 4308 4297 4091 3814 3650 870 141 11265 33490 1714 1227 --
NM_006291chr1482056 1782 1763 1447 1362 1253 811 26 ------
NM_006298chr641038 805 275 189 --23014 1012 --
NM_006306chrX95895 5103 4196 4026 3798 3718 2140 1852 1170 23941 1584 ----
NM_006313chr12192 ------
NM_006315chr454127 3186 3076 1702 982 13987 --13952
NM_006317chr51757 --1569 --
NM_006320chr411024 ------
NM_006324chr16163 ------
NM_006336chr961494 1393 1251 1180 1100 395 11508 ----
NM_006352chr111862 ------
NM_006359chrX42126 1992 1945 506 ------
NM_006362chr11171 ------
NM_006364chr141281 ------
NM_006366chr6--21258 535 ----
NM_006367chr131051 797 761 ------
NM_006369chr1144 ------
NM_006371chr3125003 4804 4660 3820 3800 3744 3336 1886 1797 1669 653 164 ------
NM_006373chr1741042 932 468 278 ------
NM_006375chrX21636 742 1301 11520 --
NM_006377chr911005 --1440 11284
NM_006379chr722329 2124 --1829 --
NM_006380chr172301 218 1163 23066 1481 --
NM_006386chr2242098 2049 552 212 --11814 --
NM_006391chr11--132 145 --
NM_006393chr1043244 2761 1432 507 14119 11327 --
NM_006401chr91389 --1202 --
NM_006403chr621432 444 --11205 --
NM_006420chr2042596 2378 226 122 --21281 1242 --
NM_006434chr1061152 866 712 606 476 379 --1157 --
NM_006451chr521059 1047 1951 ----
NM_006454chr4122994 2779 2745 2068 1929 846 499 449 433 270 168 26 --22258 2003 --
NM_006457chr463232 1389 1160 778 612 150 51294 823 682 547 520 ----
NM_006458chr113296 277 26 ------
NM_006459chr1041455 1354 597 258 --11370 --
NM_006460chr171161 ------
NM_006464chr253207 1816 1351 708 356 --24587 3931 --
NM_006467chr512214 ------
NM_006469chr12639 197 11165 ----
NM_006480chr5182 --1318 --
NM_006482chr1231476 1050 826 13564 ----
NM_006489chr1431893 266 224 ------
NM_006504chr1042662 2144 846 769 --12955 --
NM_006517chrX2568 238 --22188 325 --
NM_006538chr2103758 3750 3589 3121 2694 1129 759 634 624 45 1841 11279 --
NM_006540chr84501 200 132 64 --1231 --
NM_006544chr1465531 5382 4891 4551 3951 1047 11624 ----
NM_006546chr17155895 5884 5438 5294 5259 5053 5015 4771 4452 4295 4162 4037 1894 1732 76 --25154 4490 --
NM_006558chr81206 ------
NM_006559chr121176 387 ------
NM_006561chr1045168 5093 5073 978 1513 ----
NM_006572chr1712278 23494 549 ----
NM_006574chr3--1231 ----
NM_006578chr1561733 1478 1462 1107 464 380 ------
NM_006591chr1121592 615 ------
NM_006593chr2----1526 --
NM_006595chr1121576 1405 ------
NM_006599chr1656938 6064 5434 2881 165 ------
NM_006603chrX1720 ------
NM_006609chr222774 2406 ------
NM_006618chr121406 297 ----1108
NM_006620chr624606 1821 11725 --14208
NM_006621chr121927 557 --11436 --
NM_006624chr1011925 1760 ----
NM_006625chr11342 ------
NM_006625chr11342 ------
NM_006625chr11342 ------
NM_006628chr1573418 3285 3133 3018 2917 1788 1567 24531 760 ----
NM_006636chr21857 ------
NM_006644chr131431 ----1156
NM_006650chr563614 3600 2606 759 442 210 --32818 1402 473 --
NM_006654chr1234744 1108 582 ----11022
NM_006660chr15173 ------
NM_006675chr12103318 3240 3200 2979 2866 2829 2348 810 789 119 --12448 --
NM_006690chr2042292 2205 1496 531 ------
NM_006693chr75817 771 574 145 77 --1866 --
NM_006695chr172233 225 ------
NM_006696chr5160 ------
NM_006698chr2041300 1288 293 132 ------
NM_006699chr12747 306 ------
NM_006713chr52743 683 1820 ----
NM_006717chr923247 3119 --2636 215 --
NM_006720chr1055030 4983 4111 458 134 --11782 --
NM_006721chr10--1159 ----
NM_006722chr332544 347 302 ------
NM_006726chr42773 343 11032 ----
NM_006729chrX11297 --14244 11908
NM_006731chr995264 5228 5096 4094 1921 1467 1069 695 473 14760 21196 853 --
NM_006734chr641386 1033 177 95 ------
NM_006736chr231913 1522 1337 11694 11178 --
NM_006741chr1231012 940 422 ------
NM_006749chr821214 990 ------
NM_006751chr21312 ------
NM_006759chr21306 ------
NM_006763chr121997 1339 1634 1242 --
NM_006766chr812489 ------
NM_006775chr633107 3010 96 12639 ----
NM_006777chrX42913 1167 294 257 ----1643
NM_006788chr1861992 772 650 642 616 457 --11905 --
NM_006790chr5--1330 ----
NM_006791chr151527 ------
NM_006796chr18----129 --
NM_006802chr151123 916 885 836 759 ------
NM_006803chr851723 1405 727 310 249 --181 --
NM_006805chr511318 11222 ----
NM_006807chr171501 --1874 --
NM_006809chr201162 ------
NM_006811chr201628 --1720 1288
NM_006813chr62912 861 ----1146
NM_006823chr81221 ------
NM_006827chr141365 13232 ----
NM_006832chr14190 --1942 --
NM_006836chr122512 89 ------
NM_006838chr122460 88 ------
NM_006846chr52268 256 --198 --
NM_006851chr1212833 ------
NM_006852chr1752588 1845 1779 1759 814 ----1463
NM_006854chr721689 1536 ------
NM_006874chr41838 --1777 --
NM_006875chrX1176 ------
NM_006884chr33279 48 30 ----11684
NM_006885chr1623474 1294 12659 ----
NM_006888chr1452655 2494 2176 2152 326 23247 1297 ----
NM_006889chr331594 1415 450 --21486 971 --
NM_006898chr21299 ------
NM_006906chr116355 243 228 136 86 42 --1621 --
NM_006908chr711316 ------
NM_006922chr21968 1651 1615 --
NM_006924chr1724085 2876 ------
NM_006925chr14--1425 ----
NM_006931chr1242017 1949 1783 1353 31853 1729 773 ----
NM_006940chr1231818 1564 387 11731 2624 593 --
NM_006947chr42364 160 ------
NM_006950chrX3821 756 750 ------
NM_006955chr1042186 1218 756 77 --13377 12318
NM_006965chr182863 414 ----1258
NM_006990chr162229 2103 1971 819 532 257 ----11825
NM_006991chr33806 394 228 1163 ----
NM_006999chr531950 413 320 11789 ----
NM_007005chr9----11233 --
NM_007006chr16137 --23206 2690 13187
NM_007007chr122325 65 1375 1714 --
NM_007011chr1585634 5468 4523 4311 2287 1098 684 475 25538 1741 11367 15222
NM_007014chr1651506 1463 1345 198 152 21694 458 ----
NM_007015chr13--1280 ----
NM_007027chr33452 239 55 ------
NM_007038chr2165942 5238 4479 3767 3746 2017 21908 730 25660 1372 --
NM_007039chr142248 134 ------
NM_007050chr20157796 7437 6721 6452 5620 5360 4985 2830 2779 2413 2150 1246 1080 625 514 17121 15638 12843
NM_007054chr573801 2943 2628 2508 2428 1420 1254 11189 23589 489 --
NM_007055chr1051306 1256 1140 807 390 11210 ----
NM_007064chr321645 1103 --11393 --
NM_007067chr17166 ------
NM_007078chr1083043 2778 2613 2547 2369 2362 972 716 12684 22995 468 --
NM_007081chr2211138 --1448 --
NM_007084chr1331579 517 201 ------
NM_007106chr1332499 630 99 1105 ----
NM_007118chr51618 ------
NM_007124chr611658 11813 ----
NM_007125chrY--11324 ----
NM_007126chr94139 119 102 33 ------
NM_007129chr131714 ------
NM_007144chr1711222 ------
NM_007146chr1732758 2038 454 --32730 2416 951 --
NM_007150chrX51970 1677 1669 698 198 --21472 467 --
NM_007153chr1943205 3089 3023 739 13159 ----
NM_007158chr12306 212 ------
NM_007159chr31632 ------
NM_007170chr12712 355 --1819 --
NM_007172chr2242678 2208 1076 414 1579 1647 13284
NM_007174chr1231698 931 813 --11827 1294
NM_007175chr883159 2653 2569 995 988 670 452 416 --22370 1050 --
NM_007184chr3134 1551 121 --
NM_007189chr771513 1355 1213 1082 980 338 190 ------
NM_007203chr913415 --13253 --
NM_007207chr11754 --1323 --
NM_007212chr111436 ------
NM_007214chr6--11131 --21214 344
NM_007222chr811749 --1334 --
NM_007236chr1542126 1827 387 291 ------
NM_007245chr16156 ------
NM_007249chr13118256 8098 6938 6896 5694 3297 2771 2517 2241 2214 209 16620 25834 788 1294
NM_007271chr651767 1653 1440 1403 699 ------
NM_007285chr16137 ------
NM_007294chr173908 832 139 ------
NM_007295chr173908 832 139 ------
NM_007296chr173908 832 139 ------
NM_007297chr173908 832 139 ------
NM_007298chr173908 832 139 ------
NM_007299chr173908 832 139 ------
NM_007300chr173908 832 139 ------
NM_007302chr173908 832 139 ------
NM_007303chr173908 832 139 ------
NM_007304chr173908 832 139 ------
NM_007305chr173908 832 139 ------
NM_007320chr191133 ------
NM_007331chr442457 2098 334 216 --12140 --
NM_007345chr1811640 ------
NM_007350chr1264437 3769 3580 2954 503 343 --11291 --
NM_007353chr772152 2134 1893 1162 1141 276 78 12744 --1473
NM_007358chr121938 73 ----1533
NM_007371chr92672 521 ------
NM_007373chr1021484 613 ------
NM_012062chr121310 --1236 --
NM_012064chr1231090 854 806 ------
NM_012072chr2084258 4101 4074 3882 3364 3144 912 680 ------
NM_012081chr512531 ------
NM_012083chr1031251 341 96 ------
NM_012095chr1053411 3250 3084 2259 1399 ------
NM_012102chr162203 2014 1834 1825 968 742 1535 1833 --
NM_012104chr1143623 3613 3480 755 13822 23724 427 --
NM_012104chr1143623 3613 3480 755 13822 23724 427 --
NM_012120chr642427 2093 2000 555 --1874 --
NM_012137chr12825 366 1294 --12677
NM_012141chr1332762 1199 261 11652 ----
NM_012156chr2073246 2869 2293 2250 1333 1309 1303 --12690 1909
NM_012164chr965976 2883 2526 695 367 178 1814 1544 --
NM_012183chr1----1547 --
NM_012193chr1174220 3518 2017 1367 1316 958 278 25378 2146 13628 --
NM_012197chr921084 200 11034 2340 154 --
NM_012199chr163528 3316 3024 2995 1756 343 ------
NM_012218chr19113029 2987 2907 2845 2310 2142 1000 983 933 888 552 ------
NM_012232chr1772139 2129 1971 1862 1740 1480 838 1773 ----
NM_012234chr333373 1404 762 23749 3198 13514 13462
NM_012243chr1186 ------
NM_012247chr101389 ------
NM_012249chr212958 ------
NM_012252chr732064 1656 1215 14653 --11973
NM_012261chr202144 119 --1669 --
NM_012272chr124324 96 90 31 ------
NM_012282chrX----1567 --
NM_012287chr344188 3769 1476 1182 ------
NM_012288chr6135524 4491 4303 3800 3778 3532 1608 1445 1379 736 463 448 93 --25541 4569 --
NM_012296chr1173915 3256 3111 2926 1445 1197 176 --11397 --
NM_012300chr511907 ------
NM_012301chr71121 ----11670
NM_012307chr182702 21 ------
NM_012308chr1152452 1808 1009 623 599 ------
NM_012309chr112559 267 --21205 88 --
NM_012316chr1225508 5177 5013 4864 4698 4520 4407 3888 3707 3618 2245 2176 1854 1756 1600 1446 1436 1392 1303 1297 1226 951 44948 4768 4635 1481 ----
NM_012325chr20----11388 --
NM_012326chr23803 754 716 ------
NM_012329chr1721574 1316 ------
NM_012333chr12589 274 ------
NM_012334chr574162 3852 3219 2967 833 593 205 14097 --1690
NM_012341chr10----1424 --
NM_012342chr10137 ------
NM_012384chr2041749 991 584 324 --1860 --
NM_012388chr151852 31138 1005 961 --23148 893
NM_012395chr722494 937 23370 3015 ----
NM_012399chr2221383 143 1210 1516 --
NM_012402chr1151391 1354 335 173 131 11286 ----
NM_012417chr171501 ------
NM_012425chr1042440 2274 2100 521 22344 2209 12593 --
NM_012448chr1742064 1954 1792 340 ------
NM_012454chr6------1536
NM_012464chr422295 280 --1789 --
NM_012471chrX21658 580 --1556 --
NM_012473chr222482 286 ------
NM_012479chr742266 2129 1060 268 1876 ----
NM_012482chr12703 666 ------
NM_013231chr1493915 3336 3083 2976 2920 1104 766 738 603 14081 ----
NM_013240chr2164102 1354 1290 1197 1030 818 --1757 --
NM_013252chr751906 922 887 527 484 --1273 --
NM_013253chr111192 ------
NM_013261chr432889 1466 1321 --1962 --
NM_013269chr1234560 1523 938 1757 ----
NM_013272chr151339 ------
NM_013277chr12--1998 1418 --
NM_013279chr1182290 2228 2169 1830 1521 941 741 557 --21923 331 --
NM_013293chr7----1508 --
NM_013309chr1552329 2171 1698 1681 145 12106 12617 --
NM_013313chr2273372 2622 2424 2378 775 612 446 2516 381 11060 --
NM_013316chr71309 ------
NM_013341chr272721 2469 2457 2402 2352 1093 309 1446 12218 12940
NM_013354chr8--148 ----
NM_013357chr81144 ------
NM_013372chr153720 175 133 ----22627 2228
NM_013373chr227993 883 637 249 238 155 110 ------
NM_013382chr1481841 1663 1650 844 708 670 620 24 ------
NM_013386chr121486 24 11699 ----
NM_013390chr941694 1231 702 346 ------
NM_013396chr212328 80 ----1398
NM_013403chr194195 128 113 101 ------
NM_013411chr151978 1117 1056 426 416 ------
NM_013433chr1941967 1766 1415 1389 ------
NM_013436chr21303 1605 ----
NM_013437chr831346 1228 135 ------
NM_013442chr9127 ------
NM_013449chr1232652 2387 1064 ------
NM_013450chr211129 ----1829
NM_013986chr22--1123 ----
NM_013993chr61803 ------
NM_013994chr61803 ------
NM_013995chrX22595 1957 11024 ----
NM_014000chr103719 590 113 ----1209
NM_014011chr2--12277 12574 --
NM_014016chr32620 251 --1537 --
NM_014021chr132173 1267 1248 --13159 --
NM_014023chr1051973 1165 424 271 148 --12669 --
NM_014039chr112892 191 ------
NM_014043chr31414 ------
NM_014079chr31127 1694 2874 23 --
NM_014112chr835484 4151 107 1646 13688 164
NM_014153chr161170 2702 101 ----
NM_014155chr1167374 671 659 315 212 97 11810 37330 4933 725 --
NM_014191chr12--11049 ----
NM_014216chr1461436 1050 392 347 331 266 11595 ----
NM_014231chr1252084 1777 864 648 489 ------
NM_014232chr171189 ------
NM_014232chr171189 ------
NM_014233chr1751696 840 428 397 265 ------
NM_014234chr61143 ------
NM_014240chr333761 3218 1118 33830 3696 3668 1354 --
NM_014243chr42571 75 ------
NM_014250chr2241618 597 424 314 ------
NM_014253chrX52522 1949 1768 562 40 12008 ----
NM_014275chr55844 767 590 255 136 --1686 --
NM_014280chr1----1639 1277
NM_014283chr121406 488 --1603 162
NM_014292chr2261338 1183 487 449 309 108 ------
NM_014299chr1961845 1685 1666 1517 877 137 ------
NM_014309chr2255042 4752 4650 645 41 1285 11254 --
NM_014323chr221918 ------
NM_014326chr1541058 380 267 147 ----1917
NM_014333chr1131137 1053 890 --12630 --
NM_014338chr225921 842 303 120 98 ------
NM_014342chr11----31187 585 560 --
NM_014351chr2251357 1166 1022 531 250 --11275 1272
NM_014361chr11298 39 ------
NM_014368chr952089 1984 1487 617 154 --1262 --
NM_014372chr111858 --1487 1669
NM_014376chr552452 669 442 157 70 ------
NM_014382chr321221 44 ------
NM_014393chr841967 1707 923 211 --12153 --
NM_014396chr741610 1446 794 785 11514 ----
NM_014417chr193831 172 127 ----1859
NM_014423chr52949 742 --25134 3906 14275
NM_014431chr1051399 630 502 379 48 --11235 --
NM_014447chr411496 --1538 --
NM_014449chr122200 38 ------
NM_014455chr11311 ------
NM_014458chr12927 74 ------
NM_014460chr22101524 1102 689 632 487 466 345 145 139 127 --21479 1266 --
NM_014480chr191632 ------
NM_014488chr111206 ------
NM_014491chr71184 ------
NM_014494chr1642382 1840 258 92 ------
NM_014502chr112385 150 ------
NM_014504chr731616 830 222 ------
NM_014505chr122496 362 ----1183
NM_014506chr941144 1102 1031 100 ------
NM_014515chr12------1283
NM_014517chr321717 1297 ------
NM_014522chrX--1207 ----
NM_014548chr15----11079 11448
NM_014554chr122879 334 --12126 --
NM_014563chrX21889 88 --12022 --
NM_014571chr163030 2054 954 705 633 608 ------
NM_014574chr141291 1232 1615 --
NM_014588chr201263 ------
NM_014612chr921205 74 ------
NM_014614chr22579 148 --1573 --
NM_014615chr161856 --13335 11221
NM_014616chr332544 2300 371 --1291 1650
NM_014630chr1553600 3223 941 495 261 --32642 2589 1058 --
NM_014636chr95861 825 750 136 56 13156 24309 997 --
NM_014640chr2283 66 ------
NM_014646chr1862817 2535 962 473 231 217 1731 ----
NM_014647chr161842 1613 2485 472 --
NM_014660chr72235 169 --2431 142 --
NM_014661chr10113908 3846 3633 3382 3280 2860 2400 683 387 167 100 --23071 2572 --
NM_014665chr853622 2749 2576 1330 415 --1647 --
NM_014666chr51414 ------
NM_014671chr72619 599 ------
NM_014676chr121206 94 ------
NM_014677chr8----2858 114 --
NM_014680chr171143 ------
NM_014682chr841758 813 674 362 ------
NM_014683chr1731639 874 65 11564 ----
NM_014686chr1932021 1692 372 21903 1596 ----
NM_014690chr793076 2440 2386 1256 854 674 279 234 196 ------
NM_014702chr623321 3071 13510 ----
NM_014705chr71527 ------
NM_014707chr73466 352 262 ------
NM_014711chr16----21920 818 1796
NM_014717chr19144 --175 --
NM_014719chr731124 1008 911 --1212 --
NM_014720chr1011163 11473 ----
NM_014721chr6117327 7303 7237 5860 5025 2990 2956 2190 1865 642 140 --24977 1794 11301
NM_014723chr20112476 2243 2192 2185 2070 2057 1305 794 677 497 34 ------
NM_014727chr19168 --1310 --
NM_014729chr822026 1723 1895 1136 --
NM_014730chr12104974 4939 4507 4348 4314 3457 1593 1028 739 622 --11810 --
NM_014730chr12104974 4939 4507 4348 4314 3457 1593 1028 739 622 --11810 --
NM_014731chr2071186 611 539 461 431 421 352 ------
NM_014733chr521884 903 --1425 --
NM_014735chrX2616 600 1421 ----
NM_014736chr151949 2889 755 ----
NM_014739chr614160 --11069 --
NM_014742chr2031246 1147 25 21767 164 ----
NM_014743chr452658 2593 1158 489 269 ------
NM_014746chr273894 3390 2917 2878 1191 1021 421 --13796 --
NM_014747chr1155488 4983 4716 4700 4572 4500 4475 4468 4231 1874 1432 1159 852 393 116 --1406 --
NM_014748chr23398 358 65 ------
NM_014751chr821983 1711 ------
NM_014752chr1121980 543 ------
NM_014755chr243913 2921 1643 1351 ------
NM_014762chr162597 779 685 421 208 66 ------
NM_014764chr121880 ------
NM_014765chr162682 2466 2403 2223 1029 96 11018 12144 --
NM_014767chr10123345 3338 2991 2983 2685 2487 2292 1420 1131 883 799 519 13419 2943 528 --
NM_014770chr1231178 884 329 ------
NM_014772chr1893526 3336 2881 2852 2813 2240 2204 854 140 --13278 13024
NM_014774chr142944 2537 2157 1211 --32422 2004 886 --
NM_014779chr31253 --11118 --
NM_014781chr82345 327 ------
NM_014784chr13720 706 55 1322 ----
NM_014787chr152611 2304 1747 1065 901 --22760 2129 --
NM_014806chr91453 ------
NM_014810chr143522 980 863 335 ------
NM_014812chr1193 ------
NM_014819chr521823 1531 1320 ----
NM_014820chr322001 775 12045 ----
NM_014822chr4--1584 ----
NM_014826chr164111 1716 1702 1201 1126 93 1661 22836 1162 --
NM_014827chr1----1478 1558
NM_014828chr1421993 251 --22388 60 --
NM_014832chr1331797 656 61 ------
NM_014835chr2031607 796 294 ------
NM_014836chr102361 189 11717 1276 --
NM_014840chr1253020 2979 2905 945 482 --12221 --
NM_014841chr631166 1097 347 ------
NM_014847chr12149 52 ------
NM_014849chr13827 801 449 ------
NM_014850chr364758 3631 1723 1657 701 132 1402 ----
NM_014853chr1761308 1241 370 310 132 35 --11346 --
NM_014857chr1--1216 ----
NM_014871chr122586 521 ------
NM_014872chr942272 1963 1855 438 --32116 2087 940 --
NM_014873chr123524 771 --44656 1100 527 504 --
NM_014877chr1756829 6348 5695 5436 5315 --21976 727 --
NM_014881chr10----150 --
NM_014883chr451658 946 915 811 772 --11912 --
NM_014890chr31228 ------
NM_014891chr751539 1490 1323 486 127 21393 1259 1456 --
NM_014893chrY22216 577 --11585 --
NM_014897chr1763265 3229 2096 1088 1007 358 --1607 12383
NM_014899chr533119 2928 786 ------
NM_014900chr2----21029 451 --
NM_014901chr561915 1463 1443 559 208 96 ------
NM_014902chr2031483 1471 1283 --1356 --
NM_014903chr1222413 152 12226 --12403
NM_014904chr1033776 3514 1363 --1898 --
NM_014905chr2----2366 268 --
NM_014906chr1721392 1115 13024 12643 --
NM_014912chr101337 ------
NM_014913chr18----11464 --
NM_014918chr1521532 1079 --11245 --
NM_014921chr1972380 2338 2048 1907 1045 993 171 --12403 --
NM_014923chr1321789 434 ------
NM_014934chr1323752 485 --12920 --
NM_014935chr1103794 3156 2869 2794 2606 1466 1043 688 456 259 ------
NM_014938chr1262513 1580 371 328 319 175 --11008 --
NM_014939chr1831389 1036 295 --11215 --
NM_014946chr233044 3029 2401 --22806 1123 --
NM_014947chr122183 1151 ------
NM_014949chr13926 262 84 ------
NM_014952chr15101730 1657 1587 1551 1283 527 457 295 219 115 --1498 --
NM_014964chr1762078 1935 1661 592 194 66 ------
NM_014969chr121112 240 ------
NM_014977chr141228 ------
NM_014978chr1041477 1274 706 668 ------
NM_014982chr1465286 5106 4983 4407 587 135 ----15326
NM_014988chr421072 990 --12290 --
NM_014989chr621643 1549 1119 --11520
NM_014991chr4166 2472 35 23180 619 --
NM_014994chr1531919 1669 289 21737 160 1871 11604
NM_014997chr752290 2014 1965 976 277 --21896 1117 --
NM_015000chr1222147 307 1881 --22565 731
NM_015002chr1261670 1544 1497 1480 349 254 1247 --12048
NM_015008chr333107 2888 2860 13421 ----
NM_015020chr1622587 822 13222 ----
NM_015023chr151736 1473 444 420 293 ------
NM_015025chr21928 ------
NM_015026chr1231897 1029 378 --23591 884 --
NM_015032chr1332782 2252 71 1303 --12234
NM_015033chr9113246 2935 2927 2713 2522 2430 842 794 764 712 57 33300 2633 2406 1519 --
NM_015035chr20126240 5519 5353 5083 4123 2509 2264 938 442 174 157 36 36669 6108 5423 24920 2115 --
NM_015039chr153998 3526 3068 1396 1201 --24080 839 --
NM_015040chr252999 2970 1324 1157 593 1208 --1819
NM_015042chr155986 969 785 697 649 --12656 --
NM_015044chr1673230 2960 2692 2396 1282 763 587 12929 12782 --
NM_015050chr631073 926 241 ------
NM_015052chr721183 260 ----1226
NM_015060chr73237 231 54 ------
NM_015061chr92876 35 ------
NM_015068chr773415 3161 3087 2422 1484 689 309 --12524 --
NM_015074chr1154846 4647 4475 4094 4038 3928 3761 3311 3217 1485 1324 1250 1159 734 398 53998 3863 1228 1096 854 11796 --
NM_015076chr654403 4127 2980 1724 1038 ------
NM_015079chr1553064 2510 838 761 746 12855 4802 646 406 385 --
NM_015092chr1664020 1767 1731 1331 203 24 21671 1535 33659 2999 1295 13784
NM_015093chr61656 1599 2373 58 --
NM_015094chr22134712 4031 3790 3132 3025 1542 1407 690 577 424 418 398 267 --13569 --
NM_015097chr32728 173 ------
NM_015100chr121657 1527 ----11386
NM_015107chrX61620 957 925 429 363 300 --1718 --
NM_015115chr41678 12982 ----
NM_015124chr2252344 746 728 515 328 2769 720 ----
NM_015129chrX31791 1576 646 ------
NM_015132chr721437 453 11835 1143 --
NM_015133chr1651358 1007 932 578 134 ------
NM_015137chr822388 1033 ----1875
NM_015138chr1542736 2728 768 228 11137 1665 --
NM_015141chr342773 2249 2017 1819 ------
NM_015143chr4--1276 ----
NM_015144chr1642580 1208 371 196 --23005 2651 --
NM_015147chr253340 2280 2152 2116 470 12056 --12912
NM_015149chr152149 1904 1852 1355 368 11793 ----
NM_015153chr6------1652
NM_015155chr1063099 2281 2211 245 113 97 1400 ----
NM_015156chr1463872 1361 1338 972 385 251 21242 835 13374 --
NM_015163chr1431293 1268 30 ------
NM_015167chr174201 98 70 56 122 ----
NM_015170chr81103 ------
NM_015172chr14528 374 119 95 ----1200
NM_015176chr1------11225
NM_015187chr4--1879 --1812
NM_015192chr2032794 793 770 12449 ----
NM_015193chr83243 231 25 --21402 44 --
NM_015196chr4141 ------
NM_015199chr332555 2227 2220 --12787 --
NM_015206chr1553824 2683 2481 2466 1022 153 ----
NM_015208chr1834058 4022 4008 33962 3825 3137 23456 730 --
NM_015209chr141519 910 523 40 1465 ----
NM_015213chr111289 --2747 312 --
NM_015215chr122174 1983 11261 ----
NM_015219chr17112429 2353 2172 1932 880 727 497 296 219 91 70 ------
NM_015226chr16----21116 674 --
NM_015231chr112348 125 1899 ----
NM_015236chr421223 1076 ------
NM_015239chr92181 71 ------
NM_015252chr2----1842 --
NM_015260chr1921545 178 ------
NM_015265chr241064 1035 580 137 --12373 --
NM_015267chr123697 685 569 ------
NM_015268chr3----1572 --
NM_015269chr1--1610 ----
NM_015270chr1282175 2146 1906 1755 1696 1555 357 333 11728 1753 --
NM_015271chr424047 3748 --14343 --
NM_015282chr262607 1118 582 544 441 267 1194 12399 --
NM_015288chr583843 3348 3097 2951 2418 1406 886 614 --12394 --
NM_015289chr1561820 1714 1600 1541 1429 37 ------
NM_015299chr1463541 3126 2932 1543 693 548 --12763 --
NM_015305chr1471740 1713 1696 1273 535 181 163 ------
NM_015310chr887875 7203 6606 2595 2517 810 644 301 12168 45067 2696 1313 99 --
NM_015313chr111114 ----24039 1525
NM_015315chr583067 2842 2736 2652 2119 1295 956 104 11157 --13354
NM_015317chr232575 2534 385 1258 ----
NM_015321chr19124733 4603 4220 3919 3806 3458 3280 3131 3081 1266 300 109 --196 14406
NM_015326chr132140 1927 79 ----12657
NM_015327chr121273 848 ------
NM_015328chr731174 985 411 1168 22408 848 --
NM_015329chr1942275 469 73 35 22180 1821 ----
NM_015332chr763247 2467 2367 2241 1260 1178 ------
NM_015335chr121421 12366 1344 12147
NM_015336chr12155 ------
NM_015338chr2051801 1217 1198 255 231 ------
NM_015344chr852067 1878 1789 1594 207 ------
NM_015347chr1221977 753 ------
NM_015349chr62237 115 ------
NM_015355chr172773 627 ------
NM_015365chrX43473 1511 1248 678 14246 ----
NM_015374chr2241270 1172 933 386 --1116 --
NM_015375chr1104369 4203 3431 3360 3353 3275 3122 1987 944 777 2848 714 34694 4464 1308 --
NM_015385chr1061152 866 712 606 476 379 --1157 --
NM_015387chr231509 341 239 ------
NM_015396chr321394 329 ------
NM_015446chr131685 1616 1375 ------
NM_015455chr531561 1191 974 ----1581
NM_015458chr8125189 4658 4157 4121 3820 2044 1927 1791 1578 205 195 41 34061 3927 800 15088 --
NM_015461chr181730 ------
NM_015470chr281244 1180 846 488 480 320 241 97 ------
NM_015472chr32220 83 ------
NM_015472chr32220 83 ------
NM_015477chr1531033 241 155 ------
NM_015481chr1211103 ----1837
NM_015493chr1961987 1439 1391 797 772 766 2866 731 ----
NM_015509chr121289 --11491 --
NM_015513chr3287 53 ------
NM_015520chr312496 12035 22792 2249 --
NM_015530chr2--1212 ----
NM_015534chr131127 961 899 ------
NM_015535chr243399 1471 1383 163 ------
NM_015541chr32987 74 ------
NM_015542chr10----1993 --
NM_015554chr1532176 2160 459 --11061 --
NM_015560chr322878 452 22050 475 ----
NM_015564chr512270 12681 13562 --
NM_015565chr2132080 661 531 --11834 --
NM_015568chr20124300 3974 3949 3910 3432 3036 2867 1359 1328 1170 564 224 ----1879
NM_015569chr134582 1236 593 ----14793
NM_015570chr721186 739 ------
NM_015571chr62736 497 1118 --1171
NM_015575chr261396 1343 1178 964 754 344 --23439 3199 --
NM_015577chr521523 1397 ------
NM_015590chr11705 ------
NM_015605chr101301 ----1508
NM_015609chr152561 2137 2061 1029 806 12310 ----
NM_015627chr171690 1477 1471 1259 607 251 122 ------
NM_015630chr211005 ------
NM_015635chr921436 799 ------
NM_015640chr154403 4219 3992 3255 2010 13857 13768 --
NM_015649chr19--1263 ----
NM_015676chr14157 ------
NM_015678chr13------1613
NM_015680chr2166 ------
NM_015695chr61188 12093 ----
NM_015702chr2------1237
NM_015713chr853462 1400 1362 1326 1182 ------
NM_015719chr192783 233 1693 ----
NM_015726chr141779 1517 1485 1190 ------
NM_015855chr112802 105 ------
NM_015866chr131439 372 101 ------
NM_015872chr141399 1364 644 538 1562 ----
NM_015878chr8--11983 147 --
NM_015879chr1867844 7143 3222 3142 3127 2662 27118 579 17054 --
NM_015881chr111192 ------
NM_015885chr111195 ------
NM_015892chr1072453 2260 1721 403 329 291 270 1479 ----
NM_015898chr1942416 1738 689 357 --12277 --
NM_015904chr22580 220 ------
NM_015906chr1--14739 44417 3694 1027 208 --
NM_015912chr811697 1784 ----
NM_015948chr61431 ------
NM_015949chr72976 136 ------
NM_015981chr562673 2550 2513 2386 2013 157 ------
NM_015990chr41433 ----1888
NM_015995chr15115424 5149 4946 4308 2178 1472 999 540 486 424 381 11517 1416 --
NM_015999chr13482 93 83 ------
NM_016016chr172320 103 ------
NM_016021chr612101 ------
NM_016038chr72472 70 ------
NM_016045chr201416 ------
NM_016048chr52795 269 ------
NM_016061chr21493 --1265 11045
NM_016072chr1242141 2046 713 328 12203 1809 199
NM_016073chr151983 ------
NM_016083chr6--13647 1213 --
NM_016120chrX21216 1105 ------
NM_016131chr21217 ------
NM_016132chr1522908 203 ------
NM_016152chr3----11190 --
NM_016156chr1111612 --12143 12360
NM_016185chr174183 70 49 34 ------
NM_016192chr2140 ------
NM_016194chr1561733 1478 1462 1107 464 380 ------
NM_016200chr71198 ------
NM_016203chr71426 ------
NM_016205chr4--11379 ----
NM_016206chr378889 6896 2743 2707 2686 726 572 12500 13562 --
NM_016227chr121406 488 --1603 162
NM_016231chr1721146 54 188 ----
NM_016242chr41141 ------
NM_016247chr32394 35 ------
NM_016248chr1323755 425 --13986 --
NM_016256chr162412 238 --140 --
NM_016260chr236424 1194 234 17432 ----
NM_016264chr192368 194 ------
NM_016269chr42409 111 1747 183 --
NM_016270chr192303 180 ------
NM_016272chr2262597 1997 1842 638 431 214 --12115 --
NM_016301chr12----135 --
NM_016303chrX2391 44 ------
NM_016306chr3----1358 --
NM_016308chr13713 669 646 ------
NM_016311chr1184 ------
NM_016322chr932535 409 47 ------
NM_016329chr32117 103 ------
NM_016338chr5278 57 ------
NM_016352chr751278 1151 240 198 126 11426 ----
NM_016357chr1211236 1257 ----
NM_016376chr1793317 3111 2797 1731 1200 1123 732 337 69 13481 43793 1674 1631 1508 --
NM_016413chr131438 ------
NM_016424chr1721338 760 ------
NM_016433chr123498 136 99 2569 433 ----
NM_016441chr242051 1727 451 347 1254 ----
NM_016470chr202549 44 ------
NM_016472chr142416 389 ------
NM_016480chr51751 1642 ----
NM_016488chr1211720 ------
NM_016506chr111256 --1214 --
NM_016507chr1742150 2050 1049 526 ------
NM_016522chr1111556 ------
NM_016530chr1542663 1588 1516 632 ------
NM_016544chr243358 1273 1013 1002 1833 12958 --
NM_016545chr14674 646 236 185 ------
NM_016564chr115991 974 937 717 376 --1620 --
NM_016570chr122326 182 ------
NM_016575chr1263813 3566 2007 1935 1547 331 35377 5036 312 21861 796 15193
NM_016577chr384341 3691 1668 1450 1418 646 497 42 ------
NM_016578chr11------1492
NM_016592chr2011251 ------
NM_016604chr521086 437 ------
NM_016605chr532134 1793 90 1614 12688 --
NM_016612chr81494 ------
NM_016613chr432101 505 251 --12752 --
NM_016621chr1173970 3508 3427 3401 3066 703 141 ------
NM_016626chr18--11374 ----
NM_016628chr101137 ------
NM_016631chr212755 212 --1787 --
NM_016643chr1641013 844 678 244 2947 748 ----
NM_016644chr51556 ------
NM_016654chr1511105 ------
NM_016821chr3281 38 ------
NM_016823chr1741307 1140 246 198 21211 1077 ----
NM_016830chr122446 139 ------
NM_016834chr1794068 3623 3362 3161 1521 1060 891 713 687 --23744 751 11653
NM_016835chr1794068 3623 3362 3161 1521 1060 891 713 687 --23744 751 11653
NM_016841chr1794068 3623 3362 3161 1521 1060 891 713 687 --23744 751 11653
NM_016929chr683515 1785 1404 1398 1099 840 243 148 ----11151
NM_016932chr2124 ------
NM_016936chr16--1838 ----
NM_016946chr193591 2835 1446 990 866 781 599 385 214 2844 76 23555 1038 --
NM_016952chr1173959 3806 3105 2581 1537 1259 61 1726 21179 1155 --
NM_017415chr5134335 3541 3446 3408 3346 3229 1573 1361 1090 778 512 104 49 23312 3124 11192 --
NM_017418chr9173 ------
NM_017420chr1413253 --11415 --
NM_017423chr412211 --1578 --
NM_017447chr2134398 3082 1527 ------
NM_017452chr2041484 1461 1243 248 ------
NM_017453chr2041484 1461 1243 248 ------
NM_017454chr2041484 1461 1243 248 ------
NM_017491chr421011 653 1162 ----
NM_017510chr52618 157 ------
NM_017519chr61195 ------
NM_017520chr132168 134 1105 1127 1145
NM_017544chrX3889 809 696 ------
NM_017551chr1072322 2241 2222 1718 561 478 426 ------
NM_017553chr154993 937 931 288 1200 ----
NM_017563chr3105945 5780 5425 4291 2488 2412 1948 1524 370 245 45849 5715 4687 857 26168 278 --
NM_017577chr31332 11321 11658 --
NM_017583chr1141575 1567 1534 708 ------
NM_017590chr2252550 2266 352 270 63 --12224 --
NM_017594chr942387 1355 1268 561 ------
NM_017600chr122212 71 ------
NM_017610chr1531924 1472 286 11422 11860 11884
NM_017617chr931001 514 53 11254 11307 --
NM_017628chr434797 4187 78 --11868 11850
NM_017632chr41467 ----1420
NM_017633chr663373 3060 2962 2557 2399 826 1520 23085 924 --
NM_017637chr979112 6440 6134 1779 1609 1417 1362 --12832 29132 5840
NM_017641chr121445 21149 983 --1467
NM_017643chr1712289 --12035 --
NM_017645chr923111 2704 --1813 --
NM_017649chr1021240 821 11260 190 --
NM_017650chr786104 5771 4523 4272 1845 1697 962 520 12201 14608 --
NM_017651chr631577 568 363 1500 31599 1546 1502 --
NM_017657chr22643 347 ------
NM_017664chr132400 161 ------
NM_017672chr151497 ------
NM_017681chrX2844 548 ------
NM_017686chr11991 ------
NM_017693chr13------1155
NM_017694chr221804 1657 ------
NM_017714chr201647 ------
NM_017719chr332063 782 465 ------
NM_017736chr1662208 2043 1999 1221 764 484 --13160 12261
NM_017741chr442800 2320 2154 424 32224 2088 328 ----
NM_017742chr181637 --1777 --
NM_017747chr5------1384
NM_017749chr113732 690 182 --1824 --
NM_017752chrX11989 --1366 --
NM_017753chr91161 ------
NM_017758chr1731064 976 155 ------
NM_017770chr632183 1058 49 ------
NM_017772chr62476 51 1538 ----
NM_017778chr811329 --1447 --
NM_017786chr81556 --1145 --
NM_017799chr1431568 1384 56 ------
NM_017811chr942102 726 614 329 ------
NM_017813chr854460 3816 1475 1180 50 ------
NM_017847chr13611 445 175 ------
NM_017848chrX104629 3825 3231 3215 1687 1281 886 553 187 159 ------
NM_017849chr232184 1242 1012 ------
NM_017856chrX31916 1329 137 32138 795 663 ----
NM_017857chr112219 75 ------
NM_017895chr202169 76 ------
NM_017902chr10104893 4780 4378 4330 1126 871 520 503 439 296 --24753 312 --
NM_017905chr132463 39 --1206 --
NM_017907chr112425 158 ------
NM_017921chr1752223 1566 922 612 469 ------
NM_017922chr141441 --188 --
NM_017925chr931349 663 510 1441 11430 --
NM_017933chr221566 1066 --11338 --
NM_017938chrX2509 119 --1254 --
NM_017944chr1111891 11017 ----
NM_017954chr731659 277 137 1116 ----
NM_017955chr141796 ------
NM_017988chr121322 ------
NM_017994chr772819 2454 2446 2322 418 74 68 1142 12200 --
NM_018003chr1522010 1786 21690 1555 ----
NM_018010chr311597 ------
NM_018011chr13----1124 --
NM_018014chr23433 158 65 ------
NM_018017chr1012862 21019 261 22748 230 --
NM_018027chr1072825 2564 2417 2405 2037 884 511 --1606 --
NM_018028chr191393 --1871 --
NM_018045chr152809 2360 2063 368 253 --21984 814 --
NM_018054chr161511 ------
NM_018061chr1------1260
NM_018070chr11510 1571 ----
NM_018071chr142701 184 ------
NM_018084chr222409 2020 --12699 --
NM_018085chr1158113 6633 6353 6185 5779 5738 2836 2328 2103 2049 1845 1679 1256 1043 795 21327 1191 21120 1007 15346
NM_018086chr231780 1480 524 ------
NM_018095chr111256 --1214 --
NM_018110chr163538 456 102 ----11286
NM_018117chr10--1773 ----
NM_018121chr1042690 2337 926 386 1965 ----
NM_018128chr1751223 1137 1063 995 364 11407 1100 --
NM_018147chr3193 ------
NM_018150chr1--1874 ----
NM_018172chr1141531 1180 1108 1041 --11557 --
NM_018181chr1811698 --11798 --
NM_018182chr1762057 1974 1619 1548 760 246 ------
NM_018184chr332160 1986 1739 ------
NM_018195chr1131800 165 94 ------
NM_018200chr1552604 2256 2159 1595 120 ------
NM_018202chr11158 ------
NM_018205chr10112356 2282 2080 2060 1793 1550 867 216 209 89 48 --22017 1827 --
NM_018222chr1141486 1373 1309 1212 --11625 --
NM_018227chr413212 ------
NM_018231chr161334 ------
NM_018239chr10112356 2282 2080 2060 1793 1550 867 216 209 89 48 --22017 1827 --
NM_018243chr483593 2880 2641 811 596 581 282 255 22729 2594 1588 --
NM_018265chr151389 1377 748 489 264 --12090 --
NM_018275chr75578 519 488 131 117 ------
NM_018287chr1011274 ------
NM_018293chr312327 --11847 --
NM_018299chr81843 12524 ----
NM_018310chr8142 ------
NM_018312chr1122199 772 --1255 --
NM_018313chr312539 --12107 --
NM_018315chr421463 1086 --1369 --
NM_018325chr921416 487 --1154 1591
NM_018330chr101230 1570 ----
NM_018364chr124136 1391 ------
NM_018365chr151103 ------
NM_018371chr81242 ------
NM_018374chr734697 1462 881 --11451 --
NM_018375chr141669 --11705 --
NM_018399chr65755 714 601 531 259 ------
NM_018400chr11104480 4317 4090 3572 3425 3265 2976 1541 547 30 14555 ----
NM_018403chr353001 2835 2681 2505 322 --13674 --
NM_018413chr12--1206 ----
NM_018416chr121757 195 1768 1608
NM_018424chr941746 1608 413 340 --1171 --
NM_018425chr1032006 1870 52 1384 22063 720 --
NM_018427chr162515 266 --21605 74 11358
NM_018429chr522315 136 ----2747 728
NM_018434chr5----1180 --
NM_018440chr887183 6393 5985 5447 3368 2019 1613 499 36297 6159 3218 130 --
NM_018442chr11284 ------
NM_018449chr93321 198 133 ------
NM_018452chr6_random31465 535 31 ------
NM_018482chr822229 1860 ----1471
NM_018489chr122343 2187 12197 ----
NM_018553chr1741780 1385 637 36 ------
NM_018566chr133706 3247 2046 ------
NM_018584chr121059 104 --2862 846 --
NM_018602chr152413 222 --11114 --
NM_018638chr1274979 4927 1849 1383 1333 664 42 ----14088
NM_018639chr1221445 286 11380 ----
NM_018640chr12----12594 --
NM_018644chr1142192 1825 653 147 --12079 --
NM_018672chr171728 ------
NM_018682chr7------189
NM_018689chr1542559 1971 765 376 ------
NM_018696chr18287 35 ------
NM_018700chr531351 1193 649 ------
NM_018711chr1241357 1110 537 44 ------
NM_018712chr11----11413 --
NM_018713chr14293 235 164 56 ------
NM_018717chr43879 776 622 ------
NM_018718chr73752 594 393 --21673 337 --
NM_018834chr52714 140 ------
NM_018841chr133335 799 121 --13366 1425
NM_018844chr741795 1710 1690 536 --11990 1189
NM_018890chr711316 ------
NM_018898chr551469 388 222 191 144 --21996 651 --
NM_018899chr551469 388 222 191 144 --21996 651 --
NM_018900chr551469 388 222 191 144 --21996 651 --
NM_018901chr551469 388 222 191 144 --21996 651 --
NM_018902chr551469 388 222 191 144 --21996 651 --
NM_018903chr551469 388 222 191 144 --21996 651 --
NM_018904chr551469 388 222 191 144 --21996 651 --
NM_018905chr551469 388 222 191 144 --21996 651 --
NM_018906chr551469 388 222 191 144 --21996 651 --
NM_018907chr551469 388 222 191 144 --21996 651 --
NM_018908chr551469 388 222 191 144 --21996 651 --
NM_018909chr551469 388 222 191 144 --21996 651 --
NM_018910chr551469 388 222 191 144 --21996 651 --
NM_018911chr551469 388 222 191 144 --21996 651 --
NM_018945chr633268 3026 1204 12797 11258 13536
NM_018963chr2121375 247 11024 11437 1213
NM_018970chr7--12854 32930 1264 775 --
NM_018976chr1232841 2389 1777 ------
NM_018992chr1671544 1443 1130 463 366 353 77 ------
NM_018999chr1083434 3408 3103 1590 967 833 802 795 24892 1077 --11182
NM_019001chr313523 14425 11281 --
NM_019004chr7------1783
NM_019046chr106832 781 745 290 239 49 1685 1842 --
NM_019053chr10--11035 1779 --
NM_019064chr171831 ------
NM_019084chr1022043 1729 ------
NM_019091chr221007 456 ------
NM_019102chr7--1169 1146 --
NM_019102chr7--1169 1146 --
NM_019106chr2263056 1354 719 270 130 102 --2628 192 --
NM_019116chr1673668 3152 2467 872 854 668 64 ------
NM_019555chr33528 176 32 ------
NM_019556chrX--11335 ----
NM_019557chr14862 588 197 130 ------
NM_019593chr2053104 3055 2812 2759 585 ------
NM_019595chr23585 564 463 ------
NM_019596chr2172855 2462 1080 722 682 512 210 1581 ----
NM_019597chrX1217 ------
NM_019610chr121541 770 ------
NM_019857chrX2610 37 ------
NM_019858chr122200 38 ------
NM_019859chr10174 --11029 11489
NM_019860chr101122 --11077 11537
NM_019891chr1----1367 --
NM_019896chr22210 193 ------
NM_020116chr421732 509 11808 11758 --
NM_020121chr13166 ------
NM_020122chr2105835 5044 5023 4948 4783 4610 4068 4021 654 102 24853 4723 1670 15136
NM_020134chr22968 752 ------
NM_020137chrX3338 137 105 ------
NM_020140chr12161 ------
NM_020144chr721959 1895 ------
NM_020148chr1842480 2410 2297 2277 12593 12269 --
NM_020152chr212716 160 ------
NM_020154chr15--1196 ----
NM_020159chr421172 427 ------
NM_020177chr53914 831 97 ------
NM_020178chr1721033 836 ------
NM_020180chr182441 176 ----1955
NM_020193chr1111084 ------
NM_020198chr1711238 11145 11083 1619
NM_020204chr11137 ------
NM_020205chr163126 3034 2521 573 223 117 ------
NM_020226chr41691 ------
NM_020228chr113494 56 43 ------
NM_020235chr31114 ------
NM_020238chr118969 898 428 355 244 184 80 56 ------
NM_020239chr122085 1644 --12060 --
NM_020245chr6114806 3752 3660 3639 1928 1544 880 339 327 282 202 14232 11977 --
NM_020336chr2033251 2453 570 ------
NM_020337chr432560 455 76 ----1715
NM_020338chr10123449 3190 3125 2968 2491 2484 1481 1286 1167 1007 448 262 --31450 672 81 --
NM_020341chr2021317 90 ------
NM_020342chr212232 11035 1203 --
NM_020346chr1111269 21372 1350 ----
NM_020348chr1042367 634 436 263 --12663 --
NM_020366chr14173 ------
NM_020390chr344940 4898 4523 852 --34442 3153 460 --
NM_020401chr121184 ------
NM_020403chr13----21110 699 --
NM_020429chr71587 --12689 --
NM_020432chr711980 --171 --
NM_020433chr2031260 531 164 1558 21793 1716 --
NM_020443chr166701 5496 4456 2386 1837 1814 ------
NM_020452chr131930 1903 617 --11600 --
NM_020455chr642646 2571 1834 970 ------
NM_020457chr161567 --1459 --
NM_020463chr211382 ------
NM_020466chr694974 4812 4762 4655 3242 1883 551 433 384 34717 455 319 34033 1589 1043 --
NM_020630chr102668 81 ------
NM_020640chr34837 690 203 192 ----136
NM_020647chr822184 630 ------
NM_020649chr17155 ------
NM_020651chr211183 ------
NM_020654chr321276 394 ------
NM_020655chr1621037 528 1212 ----
NM_020659chr194546 127 85 29 ------
NM_020666chr52844 658 ------
NM_020673chr2067699 7435 6627 3004 1525 1193 17558 22419 181 22375 1263
NM_020689chr2031580 1409 309 ------
NM_020699chr135039 4990 718 189 14958 --
NM_020706chr21153 ------
NM_020708chr2042339 1905 1607 153 ------
NM_020711chr22421 172 ----11837
NM_020727chr2113049 12946 13546 --
NM_020728chr763029 2863 2692 1958 296 254 22767 2627 ----
NM_020732chr61195 ------
NM_020734chr1213160 --11347 --
NM_020742chrX32366 930 591 12290 11082 --
NM_020748chr171173 --1355 1392
NM_020749chr821376 396 ------
NM_020755chr61141 ------
NM_020760chr231386 600 195 ------
NM_020766chrX24257 3779 ------
NM_020772chr1777381 6782 2697 2582 1958 1706 1406 --46671 2121 1305 1148 --
NM_020773chr452457 1868 1845 854 581 22621 2186 ----
NM_020774chr1845846 5807 4559 1635 13963 14867 --
NM_020778chr15103954 3625 3218 1324 1225 1193 721 484 447 56 --21464 597 11851
NM_020783chr1842374 770 749 83 ------
NM_020792chr332521 2201 1825 ------
NM_020796chr521141 108 22521 912 ----
NM_020801chr52590 521 ------
NM_020804chr682473 2048 1915 1894 1866 1743 913 388 --12121 --
NM_020805chr1821943 1287 ------
NM_020808chr121005 954 ------
NM_020810chr1423425 471 ------
NM_020830chr233321 2169 200 --21190 853 --
NM_020834chr1421263 28 --1477 --
NM_020836chr142741 163 --1122 --
NM_020839chr321273 578 --11263 --
NM_020841chr1232860 1521 49 ------
NM_020843chr15----1306 --
NM_020844chr885351 5126 2924 2300 1162 914 817 757 26992 692 --1981
NM_020845chr12152518 2488 2416 2401 2225 2169 1985 917 723 419 341 193 178 98 69 ------
NM_020851chr1551734 1363 1226 632 548 11783 21529 1170 --
NM_020854chr18--1221 ----
NM_020858chr151959 195 ----
NM_020866chr131289 ------
NM_020870chr442151 1531 606 196 --11420 --
NM_020873chr3----1208 --
NM_020888chr172021 1878 1531 1340 504 458 156 --21791 516 --
NM_020917chr1973942 3777 3589 880 865 703 574 23846 3712 13963 --
NM_020921chr1422732 1398 ------
NM_020922chrX1294 --11606 --
NM_020925chr131060 232 144 ------
NM_020926chrX1381 1300 1101 --
NM_020927chr1622287 2246 ------
NM_020935chr254272 4083 3077 1625 1305 ----1504
NM_020940chr10--21143 394 ----
NM_020947chr1642058 1885 629 123 --11974 --
NM_020948chr1----32885 2465 801 --
NM_020951chr1951920 1751 1622 1535 361 --1108 --
NM_020956chr1984723 4354 4144 3869 3583 3199 3160 235 14752 1602 --
NM_020962chr152427 312 22385 91 ----
NM_020964chr1851631 994 940 687 658 11783 33127 1092 776 11252
NM_020971chr191271 ------
NM_020977chr422011 407 ------
NM_020983chr1282175 2146 1906 1755 1696 1555 357 333 11728 1753 --
NM_021003chr142856 806 ------
NM_021007chr21962 1711 ----
NM_021012chr17102948 2707 2567 2558 2439 2308 2211 2137 421 294 --12846 --
NM_021020chr883213 3193 3147 2813 1280 1193 254 25 ------
NM_021035chr2031206 356 190 2260 127 ----
NM_021038chr3--23280 394 --12646
NM_021045chr1021938 903 11892 ----
NM_021069chr421945 171 ------
NM_021072chr521824 1757 1944 ----
NM_021079chr17103129 3088 3057 2532 2302 2077 1195 1115 1060 761 12689 12638 --
NM_021096chr22143151 3091 2838 2735 2691 2500 2161 882 741 607 472 355 167 152 ------
NM_021097chr232905 969 660 ------
NM_021111chr911322 ------
NM_021120chrX62765 2446 2408 1145 778 374 ------
NM_021132chr1021250 279 ------
NM_021148chr722104 255 ------
NM_021155chr1922177 1832 --1161 11181
NM_021161chr143546 482 157 ------
NM_021174chr81760 ------
NM_021183chrX--1911 ----
NM_021190chr12470 233 ------
NM_021192chr22168 60 1311 1438 --
NM_021202chr2093025 2596 2275 964 827 820 624 524 327 --22435 516 --
NM_021215chr2031638 1509 406 ------
NM_021218chr92999 832 2903 767 ----
NM_021222chr1--21366 1080 ----
NM_021240chr91531 ------
NM_021242chrX2752 236 --1288 1743
NM_021249chr1421262 1044 --1179 --
NM_021252chr1031768 603 318 ----11592
NM_021260chr1451144 1129 551 500 153 ------
NM_021574chr22112411 2035 1741 1682 1644 939 795 653 270 163 39 --12228 --
NM_021622chr103897 475 21 ------
NM_021629chr364072 3671 3343 3274 1460 745 ------
NM_021637chrX1144 --1955 --
NM_021639chr11152 ------
NM_021643chr21247 11476 1229 --
NM_021648chr662540 2375 2043 1763 563 174 --22472 729 --
NM_021738chr101148 ------
NM_021813chr655602 5310 5216 1425 245 --35277 3986 63 --
NM_021814chr6197 ------
NM_021911chr553713 1872 266 247 60 ------
NM_021913chr1911299 --11700 --
NM_021931chr2021022 133 ------
NM_021940chr611438 1149 ----
NM_021945chr693237 2776 2706 2560 2536 2426 1415 1005 43 --1522 --
NM_021946chrX31290 1203 357 ----1493
NM_021949chrX42788 2118 814 483 ----12852
NM_021959chr62281 32 ------
NM_021961chr1177129 6898 6866 6093 2370 2011 1865 11316 35175 2675 1130 --
NM_021962chr1782347 2270 1811 1635 666 587 500 51 --11717 --
NM_021963chrX1484 --1537 --
NM_021964chr366419 6401 5522 4322 2255 2127 --26367 5713 --
NM_021965chr931338 1182 217 ------
NM_021967chr541274 1234 1168 1083 ------
NM_021979chr141316 ------
NM_021984chrX21371 140 11482 ----
NM_021987chrX21371 140 11482 ----
NM_021988chr2041472 440 430 363 --1475 --
NM_021990chrX21371 140 11482 ----
NM_021998chrX194 ------
NM_022048chr1586234 6209 5360 4301 2490 1893 1407 541 12425 ----
NM_022049chr111673 ------
NM_022062chr112538 135 --1253 --
NM_022075chr11140 ------
NM_022080chr2052357 1935 922 815 120 1587 22522 147 --
NM_022112chr1171931 1396 825 595 441 428 217 21708 1422 1336 --
NM_022114chr194639 4424 3974 3364 3242 1227 923 789 593 ------
NM_022130chr52951 336 ------
NM_022131chr331326 592 94 ------
NM_022133chr811716 --11491 --
NM_022137chr1411923 11961 12077 --
NM_022143chr731085 1059 1045 ------
NM_022153chr10103658 3433 3155 2616 1376 1328 1093 1031 637 515 ------
NM_022154chr41205 --21102 148 --
NM_022166chr16169 --24401 1639 --
NM_022167chr171823 ------
NM_022170chr751369 1325 1229 204 54 --21283 133 --
NM_022171chr341139 629 462 163 2399 205 ----
NM_022336chr262333 1958 1758 1551 806 157 1218 1617 --
NM_022343chr941297 974 107 85 ------
NM_022346chr421402 341 1145 ----
NM_022367chr13709 549 175 ------
NM_022373chr71660 1348 ----
NM_022442chr2041472 440 430 363 --1475 --
NM_022459chr1366286 5868 4327 1049 688 121 ------
NM_022465chr121587 --13076 --
NM_022470chr341254 1218 317 39 21158 1024 1897 1796
NM_022473chr1562766 1778 1672 1524 1364 143 21428 1299 ----
NM_022484chr711402 ------
NM_022491chr1242391 2251 608 485 ----13306
NM_022494chr10133 ------
NM_022497chr3112839 2824 2644 1215 1163 1049 437 422 296 272 238 63651 2845 1476 1460 1119 985 22784 318 --
NM_022552chr21958 ------
NM_022648chr274282 3239 1785 1338 896 656 45 14036 24239 3566 --
NM_022652chr121833 1123 ----
NM_022716chr162991 2616 2453 2021 1255 704 ------
NM_022719chr2273336 1323 1049 320 263 96 42 11391 23180 3087 --
NM_022726chr6190 ------
NM_022728chr72203 68 ------
NM_022733chr131019 784 353 ------
NM_022744chr1651048 1018 1006 982 521 --1933 --
NM_022756chr121050 127 ------
NM_022758chr682943 2910 2255 1006 780 683 459 45 --11088 --
NM_022766chr2282613 2090 2025 1855 1001 882 674 371 21925 1790 --1891
NM_022771chr12--1826 ----
NM_022776chr321400 576 ------
NM_022780chr261837 1685 1666 1656 1496 754 ------
NM_022781chr922386 1118 ------
NM_022782chr12----1293 --
NM_022784chr152822 178 ------
NM_022802chr1021619 492 ------
NM_022818chr1621411 467 --1228 --
NM_022822chr116287 178 158 91 82 74 ------
NM_022824chr531917 669 105 ------
NM_022841chr1512684 ------
NM_022842chr342736 2360 581 278 --12111 1259
NM_022843chr1341449 1429 984 246 ------
NM_022845chr1622021 1479 ------
NM_022893chr253127 2516 2322 614 172 ----12304
NM_022894chr22556 293 ------
NM_022898chr1454798 3613 3485 985 362 ------
NM_022903chr3146 ------
NM_022912chr222804 2733 12954 --22607 2497
NM_022917chr961234 1005 959 850 303 113 11104 ----
NM_022965chr471449 1392 1370 1003 430 176 124 ------
NM_022970chr1011145 --185 11087
NM_022977chrX2999 41 ------
NM_022978chr541274 1234 1168 1083 ------
NM_023000chr1421274 210 ------
NM_023001chr1421274 210 ------
NM_023008chr191333 2237 121 ----
NM_023009chr1--1596 1528 --
NM_023010chrX----1813 --
NM_023012chr12189 ------
NM_023015chr11575 --1717 --
NM_023018chr171370 1260 1006 593 135 90 80 ------
NM_023067chr32249 92 --11252 --
NM_023076chr1682704 2264 1087 1039 979 287 273 168 12712 1704 --
NM_023079chr1791782 1697 1679 739 460 439 422 405 167 ------
NM_023923chr1123691 3455 2494 2377 2328 1422 1318 1253 956 813 587 335 21188 748 ----
NM_023929chr822759 2311 --11007 --
NM_023931chr1651244 637 517 478 395 ------
NM_024007chr553189 2561 2046 833 675 12052 --1476
NM_024045chr10133 ------
NM_024046chr331248 1174 479 ------
NM_024052chr1752893 2559 2299 2009 656 ------
NM_024071chr143103 69 21 --2457 416 --
NM_024076chr1982103 1898 1783 956 794 745 281 54 --1354 --
NM_024085chr231035 393 128 ------
NM_024086chr1783384 2942 2862 2698 2408 564 336 55 22768 2635 63809 3639 3324 2449 772 703 --
NM_024117chr931360 203 42 ------
NM_024293chr21270 --1619 --
NM_024294chr682943 2910 2255 1006 780 683 459 45 --11088 --
NM_024297chr174557 466 229 87 ------
NM_024315chr71103 ------
NM_024329chr151177 1164 1029 87 74 ------
NM_024332chrX1732 1667 11854 --
NM_024337chr51254 ------
NM_024408chr183295 2807 2363 1291 1092 876 806 323 11053 ----
NM_024415chr5----124 --
NM_024424chr11165 ------
NM_024425chr11165 ------
NM_024426chr11165 ------
NM_024429chr71426 ------
NM_024494chr12692 517 ------
NM_024509chr191170 ------
NM_024511chr431140 842 820 23451 3318 ----
NM_024520chr2----1100 --
NM_024522chr121694 187 --21512 114 --
NM_024523chr741243 1090 430 424 ------
NM_024524chr322168 1253 --42948 2779 482 397 --
NM_024528chrX151 ------
NM_024529chr11876 11000 --1202
NM_024539chrX1387 --1849 --
NM_024554chr13289 93 54 ------
NM_024556chr111199 --1506 --
NM_024561chr133873 497 330 11251 ----
NM_024565chr541629 490 417 129 --11226 --
NM_024594chr511516 --2736 372 --
NM_024624chr231301 670 156 ------
NM_024639chr641134 708 638 121 --1908 12756
NM_024657chrX143 ------
NM_024659chr23293 126 117 ------
NM_024665chr334204 4055 1555 --1194 --
NM_024676chr151094 893 862 523 29 11352 ----
NM_024692chr221368 1267 ------
NM_024713chr1511548 ------
NM_024721chr82877 465 1209 ----
NM_024725chr11------1224
NM_024738chr1241895 1782 210 27 12000 11889 --
NM_024740chr1163371 2830 1474 1430 961 391 21403 83 --14027
NM_024742chr1671922 1597 1282 1266 754 629 228 ------
NM_024744chr222238 281 ------
NM_024751chr41651 --12026 --
NM_024759chr82750 100 ------
NM_024762chr193378 328 261 ------
NM_024770chr286489 4924 4745 2167 1998 1298 730 252 14486 1220 14628
NM_024785chr21378 11029 ----
NM_024804chr13347 250 24 1117 ----
NM_024834chr102577 133 ------
NM_024837chr1551720 1274 588 566 534 --1692 --
NM_024852chr12539 458 ------
NM_024873chr43954 789 82 ------
NM_024875chr1061777 1574 1529 1256 501 480 --11549 --
NM_024884chr144797 628 415 294 44577 3464 702 197 13994 --
NM_024900chr432257 1676 702 ------
NM_024900chr432257 1676 702 ------
NM_024930chr52854 417 ----1109
NM_024939chr163247 171 105 --1290 --
NM_024941chr51556 11432 11469 --
NM_024943chr41836 2740 607 ----
NM_024944chr21173 ------
NM_024947chr358697 3808 3222 2546 735 49464 9369 8772 6499 18349 11944
NM_024949chr434029 3816 794 ------
NM_024953chr1222705 1736 ------
NM_024963chr7275675 5597 5496 5352 5170 5098 5032 4845 4809 4748 3954 3816 3806 3611 2380 2352 2129 2093 1502 1298 1169 1003 621 524 333 278 55 34615 1073 940 ----
NM_024969chr22834 330 ------
NM_024989chr231740 1488 309 36457 5085 1516 1285 13075
NM_024991chr1061152 866 712 606 476 379 --1157 --
NM_025040chr1931537 140 122 ------
NM_025054chr854042 3950 2792 1382 1278 ----1888
NM_025058chr15704 626 247 218 139 ------
NM_025073chr153458 3441 3242 1815 548 24462 4158 1690 --
NM_025076chr21135 ------
NM_025077chr12212 57 ------
NM_025090chr171178 ------
NM_025106chr111381 21875 1495 ----
NM_025134chr1622474 854 ------
NM_025138chr13--1348 ----
NM_025141chr151507 1514 ----
NM_025146chr321808 35 ------
NM_025160chr173813 3201 1385 511 495 424 368 --21001 638 --
NM_025164chr1151958 1907 668 620 30 1193 ----
NM_025179chr164477 4446 4012 3833 1032 102 ------
NM_025181chr2299 26 ------
NM_025184chrX----1640 --
NM_025191chr123473 1300 13372 ----
NM_025195chr841630 1624 1612 580 ------
NM_025203chr251411 1404 1258 425 58 11368 ----
NM_025208chr112104 30 ------
NM_025219chr2082250 2183 2085 1500 800 614 586 260 ------
NM_025221chr4196 ------
NM_025222chr372505 2340 1011 904 818 760 685 ------
NM_025235chr101108 21488 247 --11525
NM_025237chr1721383 423 --11558 --
NM_025248chr1782976 2779 2406 1978 1201 1175 629 28 --12355 1706
NM_025250chr793029 2846 2792 2486 2096 1168 925 540 109 ------
NM_025263chr631553 462 409 ----21385 211
NM_030623chr22224 184 ------
NM_030625chr1032353 1781 113 --1304 --
NM_030627chr512761 ----1111
NM_030634chr152387 2025 998 610 292 ------
NM_030637chr141214 ------
NM_030647chr766006 5812 1822 1501 515 60 --14660 11680
NM_030648chr434810 4401 963 ------
NM_030650chr284260 4186 4095 3975 3045 1517 1481 106 44164 4030 2663 1546 ----
NM_030661chr711416 ------
NM_030761chr172710 2520 1846 677 667 482 197 ------
NM_030762chr1241644 1318 505 379 ------
NM_030784chr62312 36 ------
NM_030791chr142549 411 ------
NM_030806chr1128971 8673 8293 6902 6881 3505 3187 3139 2685 2435 967 662 --13553 --
NM_030809chr1231619 927 766 1638 12435 --
NM_030813chr115927 900 693 574 118 1875 ----
NM_030816chr133388 3055 2752 ------
NM_030820chr631066 1032 285 ------
NM_030881chr2242098 2049 552 212 --11814 --
NM_030885chr321783 517 ------
NM_030906chr11------1101
NM_030915chr262278 2140 2089 2025 1786 1720 11989 ----
NM_030918chr144501 3869 3732 1599 1327 11291 --
NM_030920chr1----1170 --
NM_030925chr1341967 1829 1627 1556 --1200 --
NM_030926chr23838 282 272 ----191
NM_030927chr1061587 1172 1118 600 534 478 ------
NM_030938chr171369 ------
NM_030949chr621190 1123 --11543 --
NM_030958chr81362 ------
NM_030963chr61243 ------
NM_030964chr573499 2786 2670 2559 1291 890 115 11209 23140 2428 --
NM_030978chr91168 --1348 --
NM_030981chr1131056 231 208 --1105 11085
NM_031157chr12----1656 --
NM_031216chr1842084 1917 125 41 11847 ----
NM_031266chr52545 104 ------
NM_031268chr1694562 4266 1838 1696 1661 1395 1245 934 568 14983 25125 1749 --
NM_031271chr8----11375 --
NM_031284chr151611 --1131 --
NM_031298chr17------1155
NM_031305chr421582 332 11519 ----
NM_031314chr142608 55 --11942 --
NM_031407chrX2479 193 ------
NM_031411chr551469 388 222 191 144 --21996 651 --
NM_031418chr1112589 --12688 --
NM_031422chr18----1398 --
NM_031424chr202578 531 ------
NM_031445chr252917 2623 744 419 139 31040 1007 967 13010 --
NM_031453chr1042217 1826 167 48 ------
NM_031459chr151491 1426 544 504 115 --21345 528 --
NM_031476chr1651809 1120 972 232 141 12637 ----
NM_031478chr162481 272 --1529 --
NM_031483chr2082782 2351 826 649 625 497 474 65 12334 ----
NM_031844chr123743 982 33368 878 836 ----
NM_031845chr233708 3381 438 --13592 --
NM_031847chr233708 3381 438 --13592 --
NM_031849chr551469 388 222 191 144 --21996 651 --
NM_031857chr551469 388 222 191 144 --21996 651 --
NM_031860chr551469 388 222 191 144 --21996 651 --
NM_031886chr1982430 2404 2256 2121 2085 1708 1611 363 11890 12378 --
NM_031904chr1152077 1577 1466 1330 219 --31384 1358 819 --
NM_031911chr422103 895 --1350 1543
NM_031934chr172277 70 ------
NM_031935chr11105 ------
NM_031953chr4134 ------
NM_031954chr1241171 1002 710 107 --2595 578 --
NM_031990chr1941357 429 294 276 ----11455
NM_031991chr1941357 429 294 276 ----11455
NM_031992chr751369 1325 1229 204 54 --21283 133 --
NM_032012chr953976 1682 1591 946 199 ------
NM_032042chr532216 1784 65 ------
NM_032047chr332244 1617 841 ------
NM_032050chr221918 ------
NM_032052chr2231303 374 119 ------
NM_032105chr197353 7321 7027 5362 2433 2397 2079 1872 1655 48093 5064 2337 2203 17645 --
NM_032121chrX31736 1032 413 11842 ----
NM_032145chr621664 1256 --1726 --
NM_032147chr122974 747 ------
NM_032153chr332517 1029 184 12310 ----
NM_032182chr1031415 588 502 ------
NM_032189chr1345073 4718 4382 230 --14075 --
NM_032192chr173723 155 145 ------
NM_032199chr1023507 2435 --12918 --
NM_032208chr223033 2887 --13368 --
NM_032221chr2022052 1466 --11579 --
NM_032229chr13----1201 --
NM_032233chr143370 342 253 ------
NM_032246chr152240 152 ------
NM_032268chr1682551 2325 1164 1072 946 372 289 93 ------
NM_032281chr1933120 2628 429 --12466 --
NM_032283chr181507 1501 1309 740 695 459 286 32 11853 --1609
NM_032288chr331776 1460 204 11746 ----
NM_032307chr91808 2299 166 ----
NM_032316chr3102312 2243 1905 1851 939 774 658 628 565 113 1709 ----
NM_032320chr111660 ------
NM_032329chr2123798 3616 3250 3182 1643 1250 1179 1089 860 800 663 606 --23880 164 --
NM_032360chr1------128
NM_032373chr1034143 1252 306 35002 4047 3913 15384 --
NM_032420chr5--1642 ----
NM_032421chr751324 1305 584 252 232 --22074 2053 --
NM_032424chr111252 ------
NM_032434chr2----1383 --
NM_032438chr62557 263 ------
NM_032440chr1052719 1881 1066 406 297 1290 11946 --
NM_032449chr152731 2564 2287 801 541 22635 2499 22428 768 --
NM_032457chr443907 3251 342 168 13180 ----
NM_032471chr61316 21130 272 ----
NM_032503chr641004 778 665 226 1941 ----
NM_032505chr322097 581 11732 ----
NM_032509chr852295 2268 2114 1852 1692 --21746 234 --
NM_032510chr1832244 740 223 42426 643 510 201 ----
NM_032521chr202398 251 12078 ----
NM_032548chr32431 155 ------
NM_032552chr961521 1251 769 331 308 127 ------
NM_032557chr41135 ------
NM_032560chr141222 ------
NM_032564chr114830 741 191 86 ------
NM_032569chr1641563 1224 711 74 --21628 367 11826
NM_032582chr173650 298 29 ----1242
NM_032596chr92112 29 ------
NM_032622chr41342 ------
NM_032626chr161288 ------
NM_032632chr1421714 420 --1734 --
NM_032638chr351459 1287 1103 469 145 11522 ----
NM_032682chr333029 2390 105 --22457 379 --
NM_032711chr17104242 4149 3719 3621 3606 3382 3277 1247 592 536 ------
NM_032778chr343232 2085 834 572 ------
NM_032781chr116355 243 228 136 86 42 --1621 --
NM_032793chr11347 ------
NM_032800chr132563 1690 240 ------
NM_032801chr1152363 1704 690 640 272 --11829 --
NM_032802chr151220 ------
NM_032818chr962486 2100 1934 982 889 265 22004 200 ----
NM_032827chr261125 1062 993 915 904 56 ------
NM_032838chr191132 --1255 --
NM_032859chr131713 185 ----
NM_032866chr1572491 2406 2321 2297 1985 1045 1039 ----1403
NM_032873chr1173661 3256 2891 2786 1301 858 405 ------
NM_032875chr171743 1666 1728 --
NM_032900chr1063791 3615 1543 1165 95 82 --23663 3134 --
NM_032905chr1021047 408 ------
NM_032906chr42641 233 ------
NM_032949chr13--1370 ----
NM_032961chr441367 929 254 176 11030 ----
NM_032978chr18--11117 ----
NM_032979chr18--11117 ----
NM_032981chr18--11117 ----
NM_033016chr223414 353 106 --11163 --
NM_033020chr1--14739 44417 3694 1027 208 --
NM_033023chr731252 1052 413 ------
NM_033025chr195793 747 629 212 205 ------
NM_033027chr371147 1109 1083 305 272 245 75 --11139 --
NM_033081chr201978 --11123 1463
NM_033089chr201927 --1166 --
NM_033118chr205848 722 670 202 23 --2860 245 --
NM_033133chr1763658 3300 2436 2345 1338 856 --11084 --
NM_033135chr112104 30 ------
NM_033136chr531717 417 297 11415 ----
NM_033137chr531717 417 297 11415 ----
NM_033138chr71662 --1216 11713
NM_033139chr71662 --1216 11713
NM_033140chr71662 --1216 11713
NM_033141chr1422216 2048 22120 1983 ----
NM_033157chr71662 --1216 11713
NM_033177chr6239 26 ------
NM_033181chr6--13647 1213 --
NM_033201chr162473 157 --21018 240 --
NM_033222chr9------11029
NM_033224chr745327 5161 3185 1090 57926 7833 7572 5231 5110 ----
NM_033225chr833107 2696 2273 --13169 --
NM_033228chr51158 ------
NM_033240chr1541089 670 641 497 ------
NM_033260chr62761 245 ------
NM_033266chr163396 334 167 --159 --
NM_033272chr2------1150
NM_033274chr533359 2933 889 ------
NM_033278chr113296 277 26 ------
NM_033285chr8--24006 760 34271 1565 956 --
NM_033290chrX53652 2946 2852 2671 2612 --13608 --
NM_033304chr8131 ------
NM_033309chr1641000 428 137 102 ------
NM_033310chr113255 104 66 ------
NM_033331chr9102976 2901 2891 2884 2722 2656 1250 983 550 298 --22737 1102 --
NM_033360chr1244142 1504 1054 346 ------
NM_033375chr1731438 1282 499 ------
NM_033393chr462807 2078 620 547 172 158 1414 12482 --
NM_033419chr1761600 1251 1032 666 470 300 --1182 --
NM_033421chr2041845 675 534 217 ------
NM_033425chr1133303 2748 1263 12683 22495 673 --
NM_033427chr71547 ------
NM_033429chr153267 253 33 --1383 --
NM_033449chr551732 1517 691 566 494 --1630 --
NM_033503chr15133474 3369 3075 3050 2961 2949 2933 2797 2669 2618 1235 776 246 --1843 --
NM_033505chr296108 5963 5779 4764 4485 4219 1435 915 755 45169 5123 5032 46 36219 4978 1015 --
NM_033512chr872336 2070 2031 1982 815 564 556 ----12893
NM_033540chr3------1959
NM_033542chr203749 202 147 --1305 --
NM_033549chr54861 275 213 102 ------
NM_033551chr583067 2842 2736 2652 2119 1295 956 104 11157 --13354
NM_033624chr1261670 1544 1497 1480 349 254 1247 --12048
NM_033626chrX41728 575 372 299 ------
NM_033631chr193849 3201 2899 2410 1552 1354 861 552 380 22539 1448 13672 --
NM_033632chr421463 1086 --1369 --
NM_033637chr1043003 1548 1206 415 11226 13039 13362
NM_033642chrX----1196 --
NM_033644chr511907 ------
NM_033645chr511907 ------
NM_033656chr2135073 5067 5003 --14708 --
NM_044472chr12550 524 ------
NM_052820chr91550 2487 396 ----
NM_052832chr832598 992 670 ------
NM_052840chr1531485 1288 1274 11422 ----
NM_052845chr1262198 2038 1235 765 63 22 --12488 --
NM_052849chr153640 321 289 ------
NM_052860chr52861 78 --1332 --
NM_052879chr1253593 3119 2916 520 331 --1641 --
NM_052896chr192480 1860 1010 927 884 823 799 315 127 --1860 --
NM_052898chr821767 1634 ------
NM_052900chr8131 ------
NM_052901chr97671 524 421 314 307 170 51 --11140 --
NM_052906chr22134683 4342 4232 3751 3635 3512 1733 1680 1476 1198 1088 1076 903 --13649 --
NM_052907chr122884 405 ------
NM_052918chr1023729 1119 --1351 --
NM_052925chr1921055 325 ----1162
NM_052927chr521592 654 22131 846 ----
NM_052934chr161501 659 390 225 117 69 ------
NM_052936chrX4888 874 346 29 --1267 --
NM_052937chr811914 --12702 --
NM_052950chr1341732 1619 1510 246 ------
NM_052978chr1441571 463 364 239 ------
NM_052996chr1681585 1504 1493 1483 1431 1230 614 497 ------
NM_053016chr976843 6211 6103 5750 5153 3072 2314 26604 3147 47840 960 635 514 137
NM_053023chr1153142 3016 869 498 112 ------
NM_053024chr311211 ------
NM_053044chr42710 36 1918 ----
NM_053056chr1163079 3049 2940 2902 2395 712 --13030 --
NM_053064chr141651 ------
NM_053281chrX138 ------
NM_054013chr55844 767 590 255 136 --1686 --
NM_054016chr13739 573 370 21620 643 ----
NM_054016chr13739 573 370 21620 643 ----
NM_054016chr13739 573 370 21620 643 ----
NM_054025chr1142192 1825 653 147 --12079 --
NM_054114chr6--170 131 --
NM_057175chr41611 ------
NM_057178chr173157 74 44 --1992 --
NM_058237chr144838 748 411 314 ------
NM_058241chr222119 853 1538 ----
NM_058241chr222119 853 1538 ----
NM_078474chr151507 1514 ----
NM_078483chr553988 3815 3363 1285 932 ----13698
NM_078625chr641335 1294 1181 1111 ------
NM_079421chr19----1477 --
NM_080391chr11567 ------
NM_080392chr11616 ------
NM_080491chr1173915 3256 3111 2926 1445 1197 176 --11397 --
NM_080538chr361425 1300 1293 1095 580 157 11324 11264 --
NM_080539chr361425 1300 1293 1095 580 157 11324 11264 --
NM_080541chr361425 1300 1293 1095 580 157 11324 11264 --
NM_080544chr361319 1194 1187 989 474 51 11218 11158 --
NM_080546chr911715 1417 ----
NM_080599chr10----1993 --
NM_080600chr192431 196 1495 ----
NM_080607chr203834 344 119 --11059 --
NM_080616chr202487 53 --1481 --
NM_080617chr2021091 183 --1140 --
NM_080629chr111252 ------
NM_080630chr111252 ------
NM_080632chrX----1813 --
NM_080645chr62533 478 1406 --21543 98
NM_080654chr113212 175 37 ----1163
NM_080669chr17134836 4587 3655 3577 3416 3170 3139 1868 1861 1562 1271 953 678 14422 ----
NM_080676chr2022772 1024 --13101 --
NM_080686chr6--136 ----
NM_080717chr121172 --1384 --
NM_080725chr2011915 --21356 657 --
NM_080738chr122034 1426 --2712 159 --
NM_080743chr621872 1016 ------
NM_080759chr1322601 1749 ----12241
NM_080760chr1322601 1749 ----12241
NM_080792chr2052124 1566 908 745 360 21938 790 ----
NM_080829chr204927 266 69 58 ------
NM_080862chr361108 1036 854 453 254 247 --1318 --
NM_080867chr1414717 14973 24039 3197 11142
NM_080872chr843789 3159 2805 38 --12537 --
NM_080927chr342249 640 357 201 --1417 --
NM_100264chr101137 ------
NM_100486chr101137 ------
NM_130385chr1173095 2976 2949 2841 2676 2030 697 ------
NM_130391chr943445 3348 3150 2333 ----13554
NM_130392chr943445 3348 3150 2333 ----13554
NM_130393chr943445 3348 3150 2333 ----13554
NM_130435chr1042662 2144 846 769 --12955 --
NM_130436chr2111767 --12164 --
NM_130438chr2112344 --12741 --
NM_130439chr101495 --1518 --
NM_130439chr101495 --1518 --
NM_130440chr151350 1187 1172 1009 544 --11582 --
NM_130459chr971629 1494 1429 1059 661 506 120 ------
NM_130797chr731775 1679 1311 --11393 --
NM_130799chr113747 564 26 ----1146
NM_130800chr113747 564 26 ----1146
NM_130801chr113747 564 26 ----1146
NM_130802chr113747 564 26 ----1146
NM_130803chr113747 564 26 ----1146
NM_130804chr113747 564 26 ----1146
NM_130831chr322878 452 22050 475 ----
NM_130832chr322878 452 22050 475 ----
NM_130833chr322878 452 22050 475 ----
NM_130834chr322878 452 22050 475 ----
NM_130835chr322878 452 22050 475 ----
NM_130836chr322878 452 22050 475 ----
NM_130837chr322878 452 22050 475 ----
NM_130838chr152341 159 --11424 --
NM_130839chr152341 159 --11424 --
NM_130846chr12--1280 ----
NM_133170chr20157796 7437 6721 6452 5620 5360 4985 2830 2779 2413 2150 1246 1080 625 514 17121 15638 12843
NM_133171chr2041060 472 341 233 189 ----
NM_133264chr1742887 2621 914 388 11097 ----
NM_133265chrX43348 2898 1105 869 ----12762
NM_133329chr231589 633 361 --1715 --
NM_133334chr456137 6030 4736 2122 743 15394 25853 4976 --
NM_133378chr21668 ------
NM_133432chr21668 ------
NM_133433chr51621 --1308 --
NM_133437chr21668 ------
NM_133445chr943308 2654 2396 133 ------
NM_133452chr195939 883 252 178 32 ------
NM_133478chr242009 475 280 238 1749 ----
NM_133499chrX4891 826 820 37 ------
NM_133634chr2121652 601 ------
NM_133638chr51156 ------
NM_133646chr2105111 5001 4039 3873 1787 1716 959 825 651 482 13808 11340 172
NM_133647chr1543144 3102 2853 1514 --2814 102 13679
NM_134421chr25733 651 613 113 41 ------
NM_134447chr19----1194 --
NM_138300chr171218 1211 1152 1110 1063 595 172 ------
NM_138317chr143546 482 157 ------
NM_138318chr143546 482 157 ------
NM_138333chr952449 2321 1732 883 504 --12026 --
NM_138335chr42275 26 ------
NM_138338chr2232164 143 33 --21304 939 --
NM_138373chr1941740 1327 515 495 11230 1445 --
NM_138395chr22339 23 ------
NM_138415chr222551 60 --21257 699 --
NM_138423chr151938 ----12200
NM_138437chrX----2315 77 --
NM_138444chr131567 23589 3058 14055 2941 702
NM_138457chr6153275 3220 3210 3177 3125 2904 2415 1262 1154 876 817 759 733 590 522 ------
NM_138459chr652510 2348 651 358 35 ------
NM_138468chr275732 5151 5096 3971 2438 2272 1574 73876 2342 2207 1742 1514 1380 777 ----
NM_138473chr1224752 3209 --14772 15165
NM_138479chr142052 1514 1465 771 --21880 252 --
NM_138492chr561493 1419 1325 386 372 191 21397 1262 ----
NM_138494chr722102 1928 11832 ----
NM_138559chr23423 148 55 ------
NM_138576chr1454798 3613 3485 985 362 ------
NM_138578chr2071325 1143 1093 1061 1053 979 358 11251 11443 --
NM_138621chr2103758 3750 3589 3121 2694 1129 759 634 624 45 1841 11279 --
NM_138635chr742885 2712 1290 332 ----12817
NM_138694chr631070 275 27 --12392 --
NM_138713chr1656938 6064 5434 2881 165 ------
NM_138714chr1656938 6064 5434 2881 165 ------
NM_138731chr1433803 2914 21 ------
NM_138735chr21254 ------
NM_138766chr5----2412 109 --
NM_138771chr7----1201 --
NM_138782chr541761 918 841 641 ------
NM_138795chr141574 599 544 458 ------
NM_138821chr5----2412 109 --
NM_138822chr5----2412 109 --
NM_138927chr211743 ------
NM_138931chr33974 325 157 ------
NM_138966chr181441 ------
NM_138967chr15132464 2322 2186 2061 1804 1793 1743 1673 1553 881 871 643 252 1164 12210 --
NM_138970chr142419 319 12150 --1403
NM_138971chr1143623 3613 3480 755 13822 23724 427 --
NM_138971chr1143623 3613 3480 755 13822 23724 427 --
NM_138972chr1143623 3613 3480 755 13822 23724 427 --
NM_138972chr1143623 3613 3480 755 13822 23724 427 --
NM_138973chr1143623 3613 3480 755 13822 23724 427 --
NM_138973chr1143623 3613 3480 755 13822 23724 427 --
NM_138980chr41159 1460 ----
NM_138981chr43290 95 34 1591 ----
NM_138982chr41159 1460 ----
NM_138995chr231324 200 62 11261 ----
NM_139014chr632188 783 250 --1621 --
NM_139015chr1241675 1481 1351 82 ------
NM_139035chrX2600 593 ------
NM_139045chr92880 807 ------
NM_139046chr10137 ------
NM_139048chr31913 ------
NM_139062chr17----169 --
NM_139125chr32391 24 --1210 --
NM_139136chr12--1258 --1891
NM_139168chr521681 267 ------
NM_139207chr122795 651 ------
NM_139215chr171280 ------
NM_139246chr93825 273 267 --12221 --
NM_139266chr2163 178 ----
NM_139280chr1751358 1242 1236 1208 1128 11191 --1175
NM_139283chr123891 725 130 11650 ----
NM_139318chr14--1197 ----
NM_139321chr2064176 3129 1291 1085 720 451 --23911 3142 --
NM_139323chr2021483 1314 --11829 --
NM_144498chr2031607 796 294 ------
NM_144563chr21329 ------
NM_144563chr21329 ------
NM_144568chr14--1679 ----
NM_144571chr4106965 6531 5554 5317 4660 4429 1809 1358 1158 933 15596 1725 --
NM_144576chr122611 453 --199 --
NM_144579chr292840 2773 2509 2468 2189 2036 1915 1850 436 --12208 --
NM_144582chr272261 2241 981 660 325 228 164 --1910 --
NM_144586chr231214 249 187 ------
NM_144598chr15136 ------
NM_144599chr1554997 4738 4663 4186 3824 24973 437 1937 --
NM_144609chr1721213 1184 --11111 --
NM_144611chr172596 530 1416 ----
NM_144633chr331180 1027 233 ------
NM_144643chr42103 79 ------
NM_144664chr11----22434 2363 --
NM_144685chr191204 ------
NM_144721chr442486 2430 2132 1814 11718 --12682
NM_144726chr52781 445 ------
NM_144728chr11754 --1323 --
NM_144729chr11754 --1323 --
NM_144778chr1332424 907 833 11777 ----
NM_144949chr2--12277 12574 --
NM_144963chr8--1526 ----
NM_144982chr123537 211 94 ------
NM_144992chr2--1134 1531 --
NM_145012chr101760 ------
NM_145049chr52951 190 ------
NM_145055chr1833341 2381 1385 ----13818
NM_145109chr173687 365 284 ------
NM_145112chr14136 ------
NM_145113chr143308 228 222 ------
NM_145173chr1962581 1681 1594 986 641 311 1226 12448 --
NM_145176chr633380 2843 1340 ----12340
NM_145185chr1961911 1621 1244 782 487 481 --21460 723 --
NM_145206chr1073278 3142 2921 2767 2702 2097 642 --140 --
NM_145239chr1641214 1118 191 122 ------
NM_145245chr1931221 1146 427 1232 ----
NM_145268chr731164 1108 998 2933 324 ----
NM_145279chr181742 1708 444 376 248 175 150 80 11662 ----
NM_145284chrX----11839 --
NM_145296chr194634 94 34 28 ----1785
NM_145303chr61186 ------
NM_145304chr71131 ------
NM_145307chr1023743 534 ------
NM_145313chr1051557 1279 1254 1206 503 ------
NM_145349chr1741576 578 489 332 ------
NM_145647chr8--1165 ----
NM_145649chr662587 2390 1753 796 789 630 12294 157 --
NM_145655chr662587 2390 1753 796 789 630 12294 157 --
NM_145686chr242781 2709 2582 908 22452 2225 ----
NM_145687chr242781 2709 2582 908 22452 2225 ----
NM_145690chr821709 1426 ------
NM_145698chr1021973 1736 11513 --1722
NM_145716chr11510 1571 ----
NM_145725chr14163 ------
NM_145726chr14163 ------
NM_145735chr1352478 2317 2019 47 33 --1602 1774
NM_145799chrX33122 2907 1977 ------
NM_145808chr7162 12131 1841 --
NM_145861chr122034 1426 --2712 159 --
NM_145868chr103283 128 74 1672 1483 --
NM_145869chr103283 128 74 1672 1483 --
NM_145888chr1911337 1201 ----
NM_145891chr1621124 57 11393 ----
NM_145892chr1621124 57 11393 ----
NM_145893chr1621246 179 11515 ----
NM_145912chr22134248 4019 3928 3700 3421 3063 2946 2897 1746 819 780 368 27 --14068 --
NM_146388chr1951003 843 280 174 82 1142 1422 --
NM_147150chr913415 --13253 --
NM_147157chr94878 775 575 302 ------
NM_147161chr141056 481 377 336 ----1212
NM_147168chr92112 29 ------
NM_147175chrX11949 --11968 11704
NM_147181chr4196 ------
NM_147182chr4196 ------
NM_147183chr4196 ------
NM_147189chr85925 517 186 137 108 ------
NM_147202chr962546 1716 1100 1091 806 549 ------
NM_147223chr251990 1663 1595 611 94 --2964 682 --
NM_147233chr241807 1480 1412 428 --2781 499 --
NM_148174chr8--11983 147 --
NM_148178chr9251 33 --121 --
NM_148179chr9251 33 --121 --
NM_148571chr1741863 1679 408 240 11717 11622 --
NM_148898chr71184 ------
NM_148899chr71184 ------
NM_148921chr1762078 1935 1661 592 194 66 ------
NM_148976chr11--1203 ----
NM_152133chr6--170 131 --
NM_152233chr1421262 1044 --1179 --
NM_152240chr341254 1218 317 39 21158 1024 1897 1796
NM_152263chr175257 4261 3691 2194 1667 1213 96 64988 4855 4031 1422 1413 1117 --14227
NM_152280chr143369 2963 2707 2134 13415 ----
NM_152282chr331402 316 76 ------
NM_152284chr82701 266 1292 ----
NM_152287chr1682470 2419 2365 2199 1847 801 402 35 42269 2138 938 306 ----
NM_152289chr1961571 1309 1284 1064 538 170 ------
NM_152305chr3178 11716 21433 291 --
NM_152309chr103646 593 386 --158 --
NM_152330chr1452471 2016 1729 770 625 ------
NM_152371chr171918 1439 1347 1243 541 432 313 ----11963
NM_152376chr151905 773 641 427 119 1384 2164 80 --
NM_152380chr151411 1176 1084 512 258 ------
NM_152388chr233849 1043 505 --22805 744 --
NM_152409chr543154 1149 983 95 11053 --1569
NM_152410chr61189 ------
NM_152424chrX114693 4280 3599 3158 1731 1675 1488 775 620 527 35 --23771 924 --
NM_152437chr1232231 2050 1709 ------
NM_152441chr121105 --1258 --
NM_152462chr172248 183 ------
NM_152470chr1893660 3365 3114 3082 2600 2525 1307 1053 111 13617 ----
NM_152475chr1932542 2407 424 12713 ----
NM_152493chr121469 135 --11454 --
NM_152520chr211222 1414 ----
NM_152529chr273310 3274 1418 851 602 434 165 51372 1305 1214 506 369 14212 1816
NM_152538chr32675 313 ------
NM_152542chr431364 856 666 1601 ----
NM_152550chr5158 1455 ----
NM_152551chr613026 ----12232
NM_152556chr712265 ------
NM_152563chr1141531 1180 1108 1041 --11557 --
NM_152588chr1221163 499 ------
NM_152594chr1511713 11669 11607 --
NM_152605chr1921321 490 ------
NM_152608chr121712 868 11625 ----
NM_152621chr4----1256 --
NM_152622chr521073 404 ------
NM_152629chr974009 2848 2792 1539 1262 1083 677 --13832 --
NM_152636chr1132478 2396 579 22456 2330 ----
NM_152638chr1221277 375 --1966 --
NM_152641chr1241840 1043 602 541 ------
NM_152653chr3--1654 ----
NM_152660chr11880 ------
NM_152682chr431786 1738 1181 ------
NM_152688chr6----2835 48 --
NM_152695chrX31922 1869 588 ------
NM_152699chr321358 27 ------
NM_152721chr18153 --138 --
NM_152724chr1042440 2274 2100 521 22344 2209 12593 --
NM_152733chr6176302 6148 5935 5927 5732 5123 5007 4033 2532 2414 2200 2122 1975 1233 795 604 321 16244 16183 --
NM_152736chr62917 878 ------
NM_152739chr72839 187 --2757 397 1290
NM_152745chr74977 839 286 30 --11119 --
NM_152754chr732693 1545 1423 ------
NM_152756chr533206 3025 1466 11279 22857 994 --
NM_152758chr842353 2246 859 642 ------
NM_152774chr722100 1818 ------
NM_152787chrX23490 2747 23414 687 ----
NM_152788chr12161 ------
NM_152789chr721402 1130 ------
NM_152793chr7113951 3798 3286 3205 1878 1734 1356 1094 822 653 415 --34672 4372 3961 --
NM_152835chr122707 480 ------
NM_152836chr811716 --11491 --
NM_152837chr811716 --11491 --
NM_152838chr2033453 2682 118 --23220 1131 --
NM_152857chr61223 --1347 1144
NM_152858chr61223 --1347 1144
NM_152860chr1221485 1092 1622 ----
NM_152879chr272013 963 797 776 670 473 294 --22625 70 --
NM_152924chr1585634 5468 4523 4311 2287 1098 684 475 25538 1741 11367 15222
NM_152989chr1231818 1564 387 11731 2624 593 --
NM_152991chr112573 221 ------
NM_153015chr83886 803 28 ------
NM_153020chr631390 412 231 ------
NM_153026chr121433 --1481 --
NM_153029chr16144101 3923 3491 2861 2801 2673 2563 1398 1292 1283 1140 831 246 24 --11469 --
NM_153035chr193246 3080 2912 2187 777 492 462 170 49 23150 3106 12970 --
NM_153181chr181441 ------
NM_153182chr343232 2085 834 572 ------
NM_153184chr31486 ------
NM_153188chr545151 3895 2213 566 ----12206
NM_153207chr1213873 11088 33887 3018 2515 --
NM_153235chr622337 2033 11706 21819 61 --
NM_153240chr32434 177 2508 369 ----
NM_153247chr751071 812 767 57 37 ------
NM_153261chr1611015 ------
NM_153262chr132681 2164 1228 --1198 --
NM_153273chr382785 2672 2399 2364 2000 1716 970 149 --12653 --
NM_153321chr171948 ------
NM_153322chr171948 ------
NM_153331chr32243 204 ------
NM_153335chr1721377 100 ------
NM_153346chrX3776 251 85 ------
NM_153347chr115897 843 801 347 98 --1790 --
NM_153365chr492689 2409 1104 1082 1055 1017 316 219 160 ------
NM_153367chr1093815 3809 3489 1548 856 832 241 219 116 22948 2679 ----
NM_153371chr133877 376 191 ------
NM_153437chr9195 ------
NM_153487chr6184740 3975 3857 3735 3568 3343 3282 2981 1792 1713 1578 1425 1399 1341 742 733 422 127 11513 ----
NM_153499chr1262735 2714 2488 2029 2009 758 11084 ----
NM_153500chr1262735 2714 2488 2029 2009 758 11084 ----
NM_153607chr532190 568 473 --21985 786 --
NM_153616chr151959 195 ----
NM_153617chr151959 195 ----
NM_153618chr151959 195 ----
NM_153619chr1512435 11333 --12402
NM_153620chr7--11500 ----
NM_153631chr711416 ------
NM_153632chr711416 ------
NM_153645chr2242678 2208 1076 414 1579 1647 13284
NM_153687chr1271532 1499 1146 1083 1047 612 563 --11140 --
NM_153689chr221786 171 ------
NM_153712chr273796 3006 2346 1024 655 619 416 --12573 --
NM_153748chr12--1258 --1891
NM_153756chr181655 1456 1326 1239 768 564 489 400 ------
NM_153757chr4147 11044 ----
NM_153759chr21958 ------
NM_153810chr1033965 1828 853 24919 3546 11056 --
NM_153812chr111815 21644 464 1400 --
NM_170606chr7134 11455 ----
NM_170607chr1721566 1231 ------
NM_170609chr631057 178 104 ------
NM_170662chr31117 ------
NM_170665chr1263520 3253 2931 1469 1070 669 1660 13613 --
NM_170672chr2----11213 1340
NM_170674chr1521142 982 ------
NM_170675chr151818 ------
NM_170676chr151818 ------
NM_170677chr1521142 982 ------
NM_170679chr51939 ----1521
NM_170696chr1531202 41 32 ------
NM_170697chr1531202 41 32 ------
NM_170706chr153998 3526 3068 1396 1201 --24080 839 --
NM_170710chr431281 1105 939 12668 ----
NM_170719chr13--1348 ----
NM_170731chr1152691 2644 1944 1879 215 ------
NM_170732chr1152691 2644 1944 1879 215 ------
NM_170733chr1152691 2644 1944 1879 215 ------
NM_170734chr1152691 2644 1944 1879 215 ------
NM_170735chr1152691 2644 1944 1879 215 ------
NM_170739chr112278 41 ------
NM_170750chrX2154 113 --2843 323 --
NM_170751chr631206 364 89 ------
NM_170752chr631206 364 89 ------
NM_171825chr562673 2550 2513 2386 2013 157 ------
NM_171998chrX2803 286 12537 ----
NM_171999chr181178 1765 ----
NM_172020chr772032 1776 1487 1419 706 684 634 ------
NM_172027chr32431 155 ------
NM_172028chr32431 155 ------
NM_172070chr221519 375 --11649 --
NM_172103chr622500 2083 --32455 2299 861 --
NM_172105chr622500 2083 --32455 2299 861 --
NM_172159chr332035 100 46 1923 ----
NM_172160chr332035 100 46 1923 ----
NM_172169chr1071671 740 596 478 384 185 73 ------
NM_172170chr1071671 740 596 478 384 185 73 ------
NM_172171chr1071671 740 596 478 384 185 73 ------
NM_172173chr1071671 740 596 478 384 185 73 ------
NM_172211chr13838 595 544 ------
NM_172226chr1262735 2714 2488 2029 2009 758 11084 ----
NM_172232chr171728 ------
NM_172315chr1521142 982 ------
NM_172316chr1521142 982 ------
NM_172344chr231589 633 361 --1715 --
NM_173054chr71796 ------
NM_173156chr142198 1613 873 645 11467 ----
NM_173172chr2----11082 --
NM_173201chr164291 283 261 104 ------
NM_173214chr1656938 6064 5434 2881 165 ------
NM_173468chr484849 2425 2255 1763 1186 853 296 121 ------
NM_173470chrX12812 22863 716 --12368
NM_173475chr1651629 1112 1101 627 283 1462 ----
NM_173511chr232698 802 200 --13984 --
NM_173515chr62824 204 --1237 --
NM_173552chr342023 413 319 302 ------
NM_173595chr12104508 4270 4168 2095 1800 851 740 708 559 172 --1805 --
NM_173602chr1253188 2891 2817 1241 360 1608 23207 837 --
NM_173631chr19----11341 --
NM_173644chr201277 --11814 --
NM_173694chrX22451 1825 ------
NM_173794chrX1162 ------
NM_173797chr5--11134 1420 --
NM_173808chr111174 14099 ----
NM_173822chr221975 1832 11851 1507 --
NM_173825chr322501 2140 21888 344 ----
NM_173851chr833952 2565 1369 ------
NM_173854chr162286 1926 1919 873 646 201 ------
NM_173872chr42767 285 ------
NM_174916chr152958 684 ------
NM_174934chr11133575 3142 3130 3001 2973 2890 2682 1442 1312 1054 682 218 157 --12276 --
NM_175061chr722105 2043 ------
NM_175566chr11298 39 ------
NM_175610chr151343 1948 ----
NM_175624chr1255482 2976 2904 2279 494 35386 5252 2205 16669 --
NM_175625chr1255482 2976 2904 2279 494 35386 5252 2205 16669 --
NM_175629chr21958 ------
NM_175709chr2252323 2167 1948 625 371 ------
NM_175736chr12267424 7418 7113 6325 6263 5621 5293 4737 3133 3109 2888 2821 2513 2374 2353 2000 1936 1862 1836 1772 1750 1552 1118 1068 939 888 1172 21715 1320 --
NM_175747chr63903 884 746 ------
NM_175748chr1451890 1685 614 553 483 ------
NM_175847chr1941357 429 294 276 ----11455
NM_175852chr172812 2269 2112 1210 713 265 53 --13083 --
NM_175856chr51186 ------
NM_175858chr21177 --1343 --
NM_175859chrX2610 37 ------
NM_175862chr331594 1415 450 --21486 971 --
NM_175863chr61195 ------
NM_175884chr72405 230 ------
NM_175907chr1832716 1103 337 --12803 --
NM_175920chr52142 52 1585 --146
NM_175924chr32246 96 ------
NM_176081chr1035974 5923 1112 24685 2009 24366 707 --
NM_176083chr1035974 5923 1112 24685 2009 24366 707 --
NM_176814chr7----1566 --
NM_176822chr111161 ------
NM_176863chr1721871 35 ------
NM_177398chr171854 1425 1355 1346 1340 1248 578 ------
NM_177399chr171854 1425 1355 1346 1340 1248 578 ------
NM_177414chr11339 --1265 --
NM_177422chr12539 458 ------
NM_177424chr132037 1709 50 --1416 --
NM_177452chr1412058 ------
NM_177559chr202124 67 1928 ----
NM_177560chr202124 67 1928 ----
NM_177925chr1232607 973 326 --13133 --
NM_177952chr142856 806 ------
NM_177968chr212149 22053 198 ----
NM_177974chr151938 ----12200
NM_177990chr2021317 90 ------
NM_177996chr2073246 2869 2293 2250 1333 1309 1303 --12690 1909
NM_177999chr9103628 3585 3148 2971 1121 1085 960 707 471 359 --1614 --
NM_178010chr1231818 1564 387 11731 2624 593 --
NM_178013chr14122268 2138 2057 1185 1066 947 889 646 566 436 280 175 22298 2226 194 --
NM_178140chr541755 393 240 146 1508 1128 12696
NM_178151chrX66873 6604 5940 2753 2128 1640 47638 2561 1852 971 15700 --
NM_178152chrX66873 6604 5940 2753 2128 1640 47638 2561 1852 971 15700 --
NM_178153chrX66873 6604 5940 2753 2128 1640 47638 2561 1852 971 15700 --
NM_178154chr141546 ------
NM_178155chr141546 ------
NM_178156chr141546 ------
NM_178157chr141546 ------
NM_178169chr12----1198 --
NM_178190chr11265 ------
NM_178191chr141606 1044 452 374 ------
NM_178270chrX4888 874 346 29 --1267 --
NM_178313chr222174 809 11863 11831 --
NM_178424chr51178 ------
NM_178426chr141640 914 588 462 ------
NM_178427chr141540 814 488 362 ------
NM_178441chr1451144 1129 551 500 153 ------
NM_178502chr12----1539 --
NM_178553chr22232 161 ------
NM_178554chr341113 878 849 99 --13038 --
NM_178558chr7--196 ----
NM_178585chr4166 2472 35 23180 619 --
NM_178812chr811325 ------
NM_178830chr193195 172 35 --2617 110 --
NM_178839chr2192 ------
NM_178863chr163448 442 356 --1472 --
NM_180989chr1331656 1569 618 ------
NM_181265chr431281 1105 939 12668 ----
NM_181332chrX32366 930 591 12290 11082 --
NM_181336chr631000 417 79 --3477 361 34 --
NM_181349chr71587 --12689 --
NM_181351chr1152833 2412 2114 2026 1871 ------
NM_181358chr183815 3710 3576 3528 3269 3244 3109 1672 ----24212 3041
NM_181361chr3----2339 95 --
NM_181457chr21208 ------
NM_181458chr21341 ------
NM_181459chr21107 ------
NM_181460chr21154 ------
NM_181481chr1867040 6624 5606 5560 4960 1843 16966 11938 --
NM_181482chr1867040 6624 5606 5560 4960 1843 16966 11938 --
NM_181483chr1867040 6624 5606 5560 4960 1843 16966 11938 --
NM_181486chr121172 --1384 --
NM_181504chr573305 2695 450 440 420 340 79 ------
NM_181505chr173723 155 145 ------
NM_181521chr16147028 6545 6363 6106 5539 5464 5319 4594 2007 1787 1778 1486 443 41 --11706 17049
NM_181523chr573305 2695 450 440 420 340 79 ------
NM_181524chr573305 2695 450 440 420 340 79 ------
NM_181571chr102889 240 --1732 --
NM_181671chr172812 210 ------
NM_181672chrX1727 191 ----
NM_181673chrX1727 191 ----
NM_181674chr5--1345 ----
NM_181675chr5--1345 ----
NM_181676chr5--1345 ----
NM_181677chr5--1345 ----
NM_181678chr5--1345 ----
NM_181701chr972130 2021 1741 1634 936 801 110 --1232 --
NM_181712chr141992 1640 1473 196 21544 1408 1817 --
NM_181714chr61715 --1408 --
NM_181746chr11140 ------
NM_181762chrX1343 11034 ----
NM_181777chrX1343 11034 ----
NM_181782chr631956 1720 92 ------
NM_181783chr1231744 572 321 ------
NM_181784chr251634 933 523 451 362 ------
NM_181794chr61316 21130 272 ----
NM_181795chr61316 21130 272 ----
NM_181809chr173587 2672 2562 1386 1303 1067 884 --1243 11552
NM_181825chr222616 82 ------
NM_181838chr511429 1452 ----
NM_181839chr81221 ------
NM_181886chr4----1991 --
NM_181887chr4----1991 --
NM_181888chr4----1991 --
NM_181889chr4----1991 --
NM_181890chr4----1991 --
NM_181891chr4----1991 --
NM_181892chr4----11038 --
NM_181893chr4----1991 --
NM_182314chrX21636 742 1301 11520 --
NM_182485chr41316 --13652 --
NM_182493chr1664058 3982 3552 1202 686 640 11272 ----
NM_182503chr665375 5223 4851 3780 1655 175 --34724 4135 3568 --
NM_182509chr141430 --11276 --
NM_182515chr1976719 4797 4632 4252 4094 1038 95 24701 949 11388 --
NM_182526chr1472394 2280 858 469 371 269 23 --12128 --
NM_182543chr10149 ------
NM_182553chr112451 47 --1243 --
NM_182557chr1182199 1910 1739 1684 1675 1390 125 86 12224 1905 --
NM_182580chr1102414 2192 2137 1949 1943 1909 908 538 293 216 --12583 --
NM_182641chr171645 ------
NM_182646chr41316 --13652 --
NM_182663chr12636 530 --22286 1601 --
NM_182664chr12766 660 --22416 1731 --
NM_182665chr12636 530 --22286 1601 --
NM_182666chr32662 35 ------
NM_182679chr11705 ------
NM_182685chr11718 ------
NM_182691chr71955 ------
NM_182692chr71955 ------
NM_182697chr731135 1119 460 --1276 --
NM_182700chr74675 479 444 65 ------
NM_182718chr102889 240 --1732 --
NM_182719chr102889 240 --1732 --
NM_182724chr102889 240 --1732 --
NM_182725chr102889 240 --1732 --
NM_182757chr632153 1303 321 --2679 394 13323
NM_182758chr1543820 2869 2807 792 13748 ----
NM_182763chr1----22274 2036 1664
NM_182764chr2041060 472 341 233 189 ----
NM_182765chr102740 568 22280 1869 11461 --
NM_182769chr102889 240 --1732 --
NM_182770chr102889 240 --1732 --
NM_182771chr102889 240 --1732 --
NM_182772chr102889 240 --1732 --
NM_182789chr521059 1047 1951 ----
NM_182797chr2041222 1170 318 180 11381 ----
NM_182830chr144863 839 415 392 --11737 --
NM_182831chr1631601 269 64 ------
NM_182850chr102889 240 --1732 --
NM_182898chr746082 1532 1031 210 15433 ----
NM_182899chr746082 1532 1031 210 15433 ----
NM_182907chr6--276 62 ----
NM_182920chr321339 120 ------
NM_182931chr7------189
NM_182935chr362237 1917 1747 1690 693 177 ------
NM_182948chr152979 2943 2922 2786 201 12581 22263 706 --
NM_182970chr20174141 3544 3185 2821 2768 1651 1560 1482 1462 1365 1284 1189 1151 766 678 530 35 --24000 575 --
NM_182972chr142235 1939 882 408 ------
NM_183004chr1473805 2851 2804 2625 1225 402 148 ------
NM_183006chr2031483 1471 1283 --1356 --
NM_183057chr82208 197 ------
NM_183060chr102889 240 --1732 --
NM_183078chr643400 3355 2664 2465 --13607 --
NM_183079chr202329 47 ------
NM_183323chr521059 1047 1951 ----
NM_183353chrX21216 1105 ------
NM_183376chr1512602 --1671 --
NM_183377chr173690 632 322 ----1683
NM_183393chr3121 --162 --
NM_183394chr3121 --162 --
NM_183416chr12501 418 21625 178 --1839
NM_183422chr131253 ------
NM_183425chr2061682 1488 1471 1371 628 285 ------
NM_184234chr203791 667 650 ------
NM_194248chr27961 770 761 408 353 328 287 ------
NM_194259chr161522 ------
NM_194260chr161522 ------
NM_194261chr161522 ------
NM_194278chr14103936 3330 3176 1461 1354 1256 1020 987 958 680 --13594 13837
NM_194282chr432850 2799 2793 22633 2032 ----
NM_194285chr1132790 2699 952 --13352 22725 1343
NM_194286chr12176145 6032 5775 5428 5279 5223 5211 3926 3919 2343 1426 1220 1040 958 308 220 175 12428 --16204
NM_194313chr951511 1256 1232 688 296 --145 --
NM_194314chr134179 3793 1971 11117 11851 --
NM_194322chr27961 770 761 408 353 328 287 ------
NM_194328chr922386 1118 ------
NM_194329chr922386 1118 ------
NM_194330chr922386 1118 ------
NM_194332chr922386 1118 ------
NM_194356chr1232047 883 86 ------
NM_194358chr1251668 1613 1227 402 236 ------
NM_194359chr1251668 1613 1227 402 236 ------
NM_194434chr1874579 4105 2309 2029 1577 1438 631 --21114 621 --
NM_194463chrX1387 --1849 --
NM_197941chr5--12986 1306 --
NM_198047chr22190 182 1531 ----
NM_198057chrX41259 1136 357 275 --11159 --
NM_198077chr11474 --1652 --
NM_198123chr8131 ------
NM_198124chr8131 ------
NM_198148chr103919 846 793 --1298 --
NM_198158chr332544 347 302 ------
NM_198159chr332544 347 302 ------
NM_198177chr332544 347 302 ------
NM_198178chr332544 347 302 ------
NM_198181chr1521923 665 ----1463
NM_198195chr3--1182 ----
NM_198204chr1721566 1231 ------
NM_198205chr1721566 1231 ------
NM_198217chr131200 ------
NM_198218chr131200 ------
NM_198219chr131200 ------
NM_198225chr102361 189 11717 1276 --
NM_198236chr13720 706 55 1322 ----
NM_198256chr211739 ------
NM_198261chr12189 ------
NM_198262chr12189 ------
NM_198268chr183815 3710 3576 3528 3269 3244 3109 1672 ----24212 3041
NM_198269chr183815 3710 3576 3528 3269 3244 3109 1672 ----24212 3041
NM_198273chr522391 1041 ----12889
NM_198281chr442327 1357 1257 70 --12128 --
NM_198395chr5----198 1410
NM_198396chr171412 ------
NM_198399chr311322 --11666 --
NM_198402chr31351 ------
NM_198465chrX41808 1139 748 52 ------
NM_198467chr72144 98 ----1515
NM_198468