TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4440
miRNA Sequence: UGUCGUGGGGCUUGCUGGCUUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr832352 215 154 1630 --12095
NM_000068chr193619 370 281 21565 537 3517 460 249 1979
NM_000217chr121281 ----1199
NM_000222chr441998 528 232 58 ------
NM_000280chr112391 372 1199 ----
NM_000503chr821266 228 11410 ----
NM_000599chr223407 834 14612 23251 1381 13598
NM_000609chr1042281 2032 1991 277 1175 1678 --
NM_000633chr1824193 84 --34499 1316 1206 --
NM_000641chr19--11585 11567 --
NM_000875chr1576271 5462 4343 2093 1862 1440 1178 ------
NM_000961chr2033603 3274 856 ----11490
NM_000965chr3------1415
NM_001001331chr321879 1794 ----12355
NM_001001396chr141140 429 97 60 14174 ----
NM_001003652chr1825786 24 26522 784 ----
NM_001003712chr1233711 1451 1075 ----13596
NM_001005473chr566372 5083 4877 4036 1253 24 ------
NM_001005502chr1224564 729 --25197 113 --
NM_001008408chr745786 2007 1283 149 2881 712 ----
NM_001009555chr431261 1144 206 ------
NM_001014797chr1046252 5225 5020 44 --37297 2331 1676 --
NM_001018009chr3------1414
NM_001025077chr1047331 5709 2971 57 1609 ----
NM_001029858chr633068 3023 1253 11178 11344 --
NM_001029875chr5----12930 1275
NM_001030055chr1424017 189 ----1879
NM_001031804chr1633327 1152 1101 23807 2824 ----
NM_001037174chr2--32085 1968 692 ----
NM_001037332chr511725 --12023 1176
NM_001037333chr511725 --12023 1176
NM_001039762chr102860 534 1662 ----
NM_001040152chr761961 1599 274 265 163 126 ------
NM_001044385chr2------12968
NM_001100108chr127559 5473 12582 15927 --
NM_001113490chrX33459 2322 859 --13355 --
NM_001116chr1672837 2326 2088 1168 1131 726 388 1579 1470 --
NM_001117chr1812090 ----1435
NM_001173chr1424017 189 ----1879
NM_001204chr224919 4884 --11192 --
NM_001222chr102712 272 11903 ----
NM_001338chr21------1464
NM_001604chr112391 372 1199 ----
NM_001683chr321879 1794 ----12355
NM_001795chr1621038 1030 11564 ----
NM_001874chr1224564 729 --25197 113 --
NM_002025chrX45837 1673 1236 29 16283 ----
NM_002158chr232893 2439 1174 ------
NM_002270chr534805 4122 1785 ------
NM_002645chr1113136 ----11001
NM_002657chr2043509 3281 2775 77 --23456 856 --
NM_002718chr322681 2485 12158 ----
NM_002837chr1244441 2993 461 275 ------
NM_003099chr1555419 2298 2084 397 355 --1131 12229
NM_003128chr211040 1574 --11954
NM_003236chr231093 1064 524 1564 1221 --
NM_003369chr1132732 2079 1987 1950 12262 --
NM_003489chr2123083 2375 13061 11103 --
NM_003583chr1232968 764 300 140 ----
NM_003629chr162945 2786 2557 2392 445 63 --12500 --
NM_003692chr9------1149
NM_003821chr8------1140
NM_003908chr2031365 938 481 --11307 --
NM_003966chr537255 1488 1076 --26644 61 --
NM_004124chr141467 ----12434
NM_004393chr331572 846 324 --21512 824 --
NM_004437chr1--11132 --13447
NM_004449chr2121212 211 11243 ----
NM_004598chr522760 2504 32465 2068 967 ----
NM_004745chr885118 4482 2769 2638 1337 1237 674 170 25944 846 16678 26585 4586
NM_004748chr1543987 3853 1698 1030 13611 ----
NM_004844chr3------1414
NM_004845chrX24043 561 --13250 13116
NM_004859chr171734 ----12174
NM_004992chrX56184 3111 2692 2183 1157 --16798 12886
NM_004992chrX56184 3111 2692 2183 1157 --16798 12886
NM_005063chr1073715 3579 3491 3071 2817 931 611 --12720 --
NM_005065chr1445001 3531 1884 872 1113 ----
NM_005116chr2043921 3506 1125 482 13417 ----
NM_005197chr1475862 5475 5266 1852 1762 588 33 ------
NM_005436chr101379 ----11469
NM_005596chr91560 26161 4712 --15073
NM_005786chr18------1354
NM_005901chr1825786 24 26522 784 ----
NM_005909chr533161 2971 1725 ------
NM_005910chr1784002 3954 3807 3502 2630 1390 964 535 --11130 --
NM_006203chr575458 4515 1429 1413 515 213 81 ------
NM_006251chr5------1943
NM_006256chr132506 265 252 ------
NM_006306chrX105885 5665 5648 5431 5414 5381 4334 4324 3819 3765 ------
NM_006482chr1232968 764 300 140 ----
NM_006599chr1643207 1047 923 65 ------
NM_006852chr1711907 1155 --12735
NM_006924chr1734435 1657 1137 13256 ----
NM_007007chr1234630 4461 1915 13858 ----
NM_007172chr2243328 864 600 364 12949 ----
NM_007249chr1368651 6766 6406 6166 2308 180 --28105 114 --
NM_007331chr432182 2052 1677 22449 643 ----
NM_012097chr2--32085 1968 692 ----
NM_012164chr925058 2267 17385 15790 12359
NM_012193chr1124824 3987 --12171 11064
NM_012214chr275322 4238 3988 2427 2019 1320 915 --16377 --
NM_012219chr352959 2446 2382 2100 373 --22803 2573 --
NM_012297chr422265 2169 ----1259
NM_012463chr1231238 1180 554 ------
NM_012479chr721745 64 --21694 125 --
NM_014112chr833434 1388 1209 23522 609 ----
NM_014325chr1211598 ----12183
NM_014376chr511725 --12023 1176
NM_014423chr534736 1605 56 15367 ----
NM_014795chr211082 ----11334
NM_014838chr2222589 1774 198 32031 1137 87 1562
NM_014877chr1725788 543 26895 2357 15518 --
NM_014932chr321870 614 ------
NM_014934chr1323622 76 23406 3342 13243 --
NM_014951chr1042049 1906 1871 964 ------
NM_015052chr71111 --21023 1005 --
NM_015071chr526078 168 35565 1913 776 --2716 47
NM_015170chr832302 1670 729 1502 ----
NM_015553chr644748 4095 1505 1258 ------
NM_015564chr522206 1141 13050 ----
NM_015995chr1544519 4479 270 102 ----13568
NM_016009chr121599 34 --14815 --
NM_016022chr1----153 1959
NM_016083chr653981 3632 2395 579 132 ------
NM_016152chr3------1415
NM_016206chr326776 6068 38571 7254 1699 ----
NM_016356chr622766 120 --1499 --
NM_016376chr1723070 1136 13630 23763 1340 13247
NM_016834chr1784002 3954 3807 3502 2630 1390 964 535 --11130 --
NM_016835chr1784002 3954 3807 3502 2630 1390 964 535 --11130 --
NM_016841chr1784002 3954 3807 3502 2630 1390 964 535 --11130 --
NM_017563chr345234 2381 1676 617 ------
NM_017849chr242200 2154 1985 248 ------
NM_018176chr421538 1526 1191 ----
NM_018243chr441617 1058 432 196 1548 13468 1397
NM_018482chr81711 11674 --1459
NM_018509chr1731688 1411 556 --1608 --
NM_020122chr245884 5749 4762 500 25764 1471 ----
NM_020148chr1832812 349 33 --1471 --
NM_020348chr1012391 ----1899
NM_020416chr462038 999 862 266 66 58 ------
NM_020443chr145795 2639 2211 930 11018 --15434
NM_020466chr644757 3786 3597 3309 13796 --14075
NM_020475chr832289 152 91 1567 --12032
NM_020476chr832289 152 91 1567 --12032
NM_020477chr832289 152 91 1567 --12032
NM_020478chr832352 215 154 1630 --12095
NM_020480chr832289 152 91 1567 --12032
NM_020647chr832208 637 241 --1575 --
NM_020663chr142678 90 --1178 1796
NM_020697chr821251 212 ----11200
NM_020718chr1614185 --22323 990 --
NM_020739chr1543987 3853 1698 1030 13611 ----
NM_020841chr1233711 1451 1075 ----13596
NM_021005chr15--1974 --1726
NM_021638chr42358 106 14167 1123 13276
NM_021648chr622599 703 11015 ----
NM_021961chr1166669 6448 5586 5149 4955 2823 ----17326
NM_022114chr154395 3797 3518 1613 50 ------
NM_022166chr1611276 --2923 882 --
NM_022458chr721051 148 157 ----
NM_022748chr752623 2212 1900 1155 119 --12386 --
NM_022781chr921068 802 ----12188
NM_024345chr921994 130 ----1422
NM_024420chr11403 ----159
NM_024665chr314573 ----14461
NM_024942chr1011303 1219 --31283 1264 1180
NM_024947chr332208 1935 255 26850 2057 ----
NM_030634chr11549 --22057 117 --
NM_030761chr12958 813 12720 --12703
NM_032632chr1421949 97 --11586 --
NM_032804chr1032089 814 442 ------
NM_033181chr653981 3632 2395 579 132 ------
NM_033290chrX43366 1416 1346 417 ------
NM_033340chr10155 ----1917
NM_033514chr23519 144 31 ------
NM_052905chr2172 --11630 --
NM_053043chr745786 2007 1283 149 2881 712 ----
NM_130438chr212965 483 ----2538 253
NM_133265chrX33459 2322 859 --13355 --
NM_138713chr1643207 1047 923 65 ------
NM_138714chr1643207 1047 923 65 ------
NM_144664chr1121812 1617 --12207 --
NM_145206chr1043186 931 904 358 ------
NM_148955chr1555419 2298 2084 397 355 --1131 12229
NM_152280chr133450 2480 373 ----13429
NM_152388chr2------12968
NM_152581chrX127 --1508 11025
NM_152754chr733868 3610 896 ------
NM_152826chr1555419 2298 2084 397 355 --1131 12229
NM_152835chr122927 2453 12795 ----
NM_153029chr1663969 3335 3242 2571 1457 450 --24122 3843 --
NM_153188chr534805 4122 1785 ------
NM_153207chr12------11613
NM_153645chr2243328 864 600 364 12949 ----
NM_153812chr122147 721 1748 ----
NM_170665chr1233926 1214 1145 ------
NM_171998chrX41005 962 371 256 ------
NM_172058chr821266 228 11410 ----
NM_172059chr821266 228 11410 ----
NM_172060chr821266 228 11410 ----
NM_172169chr102712 272 11903 ----
NM_172170chr102712 272 11903 ----
NM_172171chr102712 272 11903 ----
NM_172173chr102712 272 11903 ----
NM_173214chr1643207 1047 923 65 ------
NM_173463chr443575 1366 1234 363 ------
NM_173468chr446110 3858 2350 1064 --11354 --
NM_173511chr223193 596 11347 ----
NM_173582chr1122418 1177 123 ----
NM_174911chr8----13379 1564
NM_177452chr1422201 1596 ----1171
NM_177985chr2--32085 1968 692 ----
NM_178140chr552524 2344 957 778 689 ------
NM_178526chr1911930 --1574 1769
NM_181876chr462038 999 862 266 66 58 ------
NM_181897chr322681 2485 12158 ----
NM_182503chr635138 5066 441 --24473 1011 --
NM_182918chr2121212 211 11243 ----
NM_182920chr341071 1017 974 961 ------
NM_194286chr1246017 4735 894 797 ----11683
NM_194328chr921068 802 ----12188
NM_194329chr921068 802 ----12188
NM_194330chr921068 802 ----12188
NM_194332chr921068 802 ----12188
NM_198281chr423115 2278 12840 ----
NM_198320chr1224564 729 --25197 113 --
NM_198595chr42358 106 14167 1123 13276
NM_198968chr1323622 76 23406 3342 13243 --
NM_199454chr154395 3797 3518 1613 50 ------
NM_203327chr2043921 3506 1125 482 13417 ----
NM_203342chr1--11132 --13447
NM_203343chr1--11132 --13447
NM_203504chr422265 2169 ----1259
NM_203505chr422265 2169 ----1259
NM_206854chr645315 3471 296 45 33697 2043 1852 ----
NM_206855chr656280 4436 1261 1010 685 14662 ----
NM_206907chr5------1943
NM_207406chr445976 5628 1773 1345 22173 1878 12504 --
NM_212464chr1531335 801 168 --1175 --
NM_212467chr1551912 946 511 343 148 ------