TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4445-3p
miRNA Sequence: CACGGCAAAAGAAACAAUCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511257 ------
NM_000020chr1232319 571 188 11892 ----
NM_000021chr1431035 1023 948 --1294 --
NM_000024chr51338 ------
NM_000038chr5--1735 1342 --
NM_000044chrX1155 ------
NM_000080chr172775 262 ------
NM_000081chr111366 ------
NM_000084chrX55592 5020 1856 1654 678 --25391 786 --
NM_000088chr1711374 ------
NM_000090chr21637 --1173 --
NM_000108chr731746 1535 274 ------
NM_000109chrX12370 ------
NM_000110chr12463 336 --2772 24 --
NM_000112chr535504 5112 1673 1383 ----
NM_000125chr634175 4140 3743 11272 11339 13038
NM_000142chr42623 232 --11193 --
NM_000163chr512096 ------
NM_000167chrX21574 124 ------
NM_000168chr71798 --2944 373 --
NM_000176chr512750 --13847 --
NM_000188chr101177 1718 ----
NM_000194chrX1160 ------
NM_000208chr1943619 3133 359 232 23925 3853 ----
NM_000210chr21659 2411 79 ----
NM_000214chr2041711 538 91 63 ------
NM_000232chr4--22679 121 ----
NM_000245chr711475 --11872 --
NM_000248chr322965 699 ------
NM_000252chrX--21524 1402 ----
NM_000259chr1554858 4773 4216 636 192 36364 4743 2496 14807 --
NM_000264chr953074 2733 2296 585 353 ------
NM_000267chr1733247 3155 1256 ------
NM_000276chrX12078 ----1384
NM_000282chr131218 ------
NM_000304chr17----1147 --
NM_000309chr1135 ------
NM_000314chr1033122 1021 957 --12754 --
NM_000321chr13--11343 1276 --
NM_000322chr631654 1363 1154 ------
NM_000332chr621282 793 12387 16185 --
NM_000345chr41226 11043 1322 --
NM_000346chr1711656 ------
NM_000362chr2243439 1076 449 146 --11117 --
NM_000368chr954107 4023 3927 3482 893 --14806 --
NM_000387chr3146 ------
NM_000408chr222614 706 ----23416 174
NM_000411chr21----1157 --
NM_000428chr1422332 2218 12494 ----
NM_000430chr1733590 2540 2481 --11232 --
NM_000451chrX----21564 792 --
NM_000461chr333467 917 500 13964 ----
NM_000462chr152725 565 ------
NM_000489chrX32583 985 864 ------
NM_000492chr711018 11168 ----
NM_000495chrX1102 1408 ----
NM_000503chr821830 1650 --1127 --
NM_000522chr71933 ------
NM_000555chrX57741 7560 5490 1587 1104 --11644 --
NM_000599chr21863 ----14553
NM_000601chr71280 ------
NM_000610chr1123008 707 12895 ----
NM_000618chr1235555 1411 519 --1220 11380
NM_000618chr1235555 1411 519 --1220 11380
NM_000627chr21264 ------
NM_000675chr224599 532 260 212 ------
NM_000684chr1021211 190 ------
NM_000685chr31829 ------
NM_000685chr31829 ------
NM_000719chr1256057 4266 2531 1933 1699 --26237 1959 --
NM_000720chr31418 ------
NM_000724chr10--11657 1134 --
NM_000726chr22513 118 ------
NM_000780chr821110 794 ------
NM_000801chr2021055 843 --11022 --
NM_000812chr4184 --1365 --
NM_000813chr535039 390 123 14084 ----
NM_000814chr15----14057 --
NM_000816chr5----1205 --
NM_000817chr22424 77 ------
NM_000826chr422448 113 ------
NM_000829chr11------1744
NM_000831chr111909 12443 11424 16274
NM_000838chr6--12780 21914 1830 --
NM_000844chr321044 1005 1421 ----
NM_000859chr531664 1147 216 ------
NM_000865chr61186 ------
NM_000868chrX--11691 1101 --
NM_000872chr1021484 37 ------
NM_000875chr1566125 5712 2356 2122 726 131 ------
NM_000891chr1722817 1189 --13609 --
NM_000899chr1233766 1697 575 --13270 --
NM_000901chr42844 326 1707 1701 --
NM_000918chr171657 ------
NM_000922chr111298 ----1881
NM_000926chr1158003 7952 7429 2609 1270 16243 13734 --
NM_000944chr42820 72 --1768 --
NM_000949chr5----1218 --
NM_000950chrX--1434 ----
NM_000958chr51303 11186 --1327
NM_000966chr1221069 1016 ------
NM_001001323chr122684 192 1832 ----
NM_001001331chr332098 728 180 ------
NM_001001344chrX12312 22256 2196 ----
NM_001001389chr1123008 707 12895 ----
NM_001001390chr1123008 707 12895 ----
NM_001001391chr1123008 707 12895 ----
NM_001001392chr1123054 753 12941 ----
NM_001001396chr154477 4453 3904 3892 386 ------
NM_001001419chr524624 792 23606 543 ----
NM_001001420chr524624 792 23606 543 ----
NM_001001436chr161130 ------
NM_001001484chr101414 --1655 --
NM_001001549chr721066 179 ------
NM_001001550chr721066 179 ------
NM_001001555chr721066 179 ------
NM_001001567chr21--1165 ----
NM_001001568chr21--1165 ----
NM_001001571chr21--1165 ----
NM_001001572chr21--1165 ----
NM_001001573chr21--1165 ----
NM_001001574chr21--1165 ----
NM_001001575chr21--1165 ----
NM_001001576chr21--1165 ----
NM_001001577chr21--1165 ----
NM_001001579chr21--1165 ----
NM_001001580chr21--1165 ----
NM_001001581chr21--1165 ----
NM_001001582chr21--1165 ----
NM_001001584chr21--1165 ----
NM_001001585chr21--1165 ----
NM_001001664chr214090 ------
NM_001001715chr131429 ------
NM_001001740chr11230 ------
NM_001001740chr11230 ------
NM_001001933chr11129 ------
NM_001001974chr1032267 1978 35 1484 ----
NM_001002026chr32617 434 ------
NM_001002032chr172645 25 ------
NM_001002033chr173745 125 25 ------
NM_001002233chr81441 --12018 --
NM_001002243chr21252 ------
NM_001002295chr1021088 254 ------
NM_001002762chr1062679 2466 811 665 322 235 ------
NM_001002843chr152297 79 11272 ----
NM_001002860chr1454366 4072 3049 1224 654 --14294 --
NM_001002909chr17--12242 1409 --
NM_001003406chr2253228 2991 2928 2116 1071 ------
NM_001003407chr1065024 4928 4769 1248 1007 968 ------
NM_001003408chr1065024 4928 4769 1248 1007 968 ------
NM_001003652chr1866229 5596 2590 2346 1834 347 ----12240
NM_001003674chr1857052 7007 4645 4594 1311 35474 4993 1890 15295 --
NM_001003675chr1857052 7007 4645 4594 1311 35474 4993 1890 15295 --
NM_001003688chr4----1765 --
NM_001003694chr31441 ------
NM_001003712chr121753 11612 1782 --
NM_001003792chr31174 ------
NM_001003793chr31174 ------
NM_001003940chr1543203 2724 831 311 ------
NM_001003942chr1543203 2724 831 311 ------
NM_001003943chr1543207 2728 835 315 ------
NM_001004019chr31117 ------
NM_001004065chr963437 3327 2944 1397 1154 312 ------
NM_001004303chr1--1668 ----
NM_001004303chr1--1668 ----
NM_001004317chr633507 1808 1678 ------
NM_001004342chr135667 1806 1548 13787 15893 --
NM_001004354chr91748 152 ----
NM_001004419chr1223505 1047 ------
NM_001004431chr17--1211 ----
NM_001005271chr1721070 1051 --1933 --
NM_001005273chr1721070 1051 --1933 --
NM_001005353chr1168 --1318 --
NM_001005353chr1168 --1318 --
NM_001005375chrY31841 1427 124 ------
NM_001005404chr1723183 790 ------
NM_001005476chr2173 ------
NM_001005526chr2198 ------
NM_001005609chrX53060 2740 1188 638 80 11245 1658 --
NM_001005732chr211502 --1601 --
NM_001005733chr211459 --1558 --
NM_001005746chr22513 118 ------
NM_001005747chr22513 118 ------
NM_001005861chr3----1905 --
NM_001006115chr322010 471 --170 --
NM_001006600chr5--11909 --12449
NM_001006618chr9159 ------
NM_001006623chr23915 690 105 --12387 --
NM_001006636chr21961 ------
NM_001006944chr111727 ------
NM_001006946chr221313 737 ------
NM_001007024chr1732832 1571 185 --23747 1441 --
NM_001007025chr1732832 1571 185 --23747 1441 --
NM_001007097chr975081 5045 4444 1173 1016 950 85 ----14903
NM_001007098chr12108 64 1330 196 --
NM_001007102chr621399 1059 --11598 --
NM_001007226chr174983 933 208 57 ------
NM_001007227chr174983 933 208 57 ------
NM_001007228chr174983 933 208 57 ------
NM_001007229chr174983 933 208 57 ------
NM_001007230chr174983 933 208 57 ------
NM_001007246chr2131312 686 103 11867 11697 --
NM_001007257chr121476 151 --11235 --
NM_001007271chr101981 --1414 --
NM_001007553chr11789 --11123 --
NM_001007559chr1811653 ------
NM_001007565chr31156 ------
NM_001008220chr533799 3535 1519 ------
NM_001008222chrX1157 ------
NM_001008239chr1843583 3348 2892 911 1990 12574 --
NM_001008392chr323240 996 ------
NM_001008495chr822258 1754 ------
NM_001008528chr1751808 1641 231 141 41 11300 ----
NM_001008540chr2------1385
NM_001008541chr1011547 ------
NM_001008541chr1011547 ------
NM_001008701chr1912004 ----1899
NM_001008738chr512271 ------
NM_001009552chr8--1238 ----
NM_001009955chr11506 ------
NM_001009955chr11506 ------
NM_001009993chr253561 2955 1672 1630 1390 --24212 1027 --
NM_001010857chr11112 ------
NM_001010861chr132779 2375 2293 ------
NM_001010862chrX23284 361 --1980 --
NM_001010888chrX14621 24615 3945 11754 --
NM_001010927chr61481 ------
NM_001010932chr71280 ------
NM_001010989chr161552 ------
NM_001010990chr161552 ------
NM_001011537chr322251 449 --21838 411 --
NM_001011645chrX1155 ------
NM_001011666chr736405 6269 452 --11176 --
NM_001011705chr13--126 ----
NM_001011708chr222586 495 ------
NM_001011724chr131281 ------
NM_001011725chr131281 ------
NM_001012329chr172202 2036 1847 956 847 600 32 --12373 --
NM_001012420chr1541830 1810 421 331 1717 --12236
NM_001012423chr1531830 1810 331 1717 ----
NM_001012426chr633067 1053 697 ------
NM_001012427chr633067 1053 697 ------
NM_001012506chr3--1151 ----
NM_001012512chr181195 --1183 --
NM_001012513chr181206 --1194 --
NM_001012643chr191206 --1525 --
NM_001012751chr102180 117 ------
NM_001012755chrX11721 --13530 --
NM_001012761chr5----12737 --
NM_001012968chrX12723 1695 1923 --
NM_001012980chrX----121 --
NM_001013031chr1023135 1021 --11319 --
NM_001013406chr7--11136 ----
NM_001013415chr421199 214 ------
NM_001013438chr321022 404 1654 ----
NM_001013439chr32868 250 ------
NM_001013620chr1247905 7037 3391 3155 ------
NM_001014283chr1332169 1472 82 ----1482
NM_001014380chr1325250 673 11597 ----
NM_001014765chr121531 50 ------
NM_001014797chr1076242 6075 2966 1885 1865 1231 973 --22587 945 --
NM_001014839chr11680 ------
NM_001014841chr11680 ------
NM_001015045chr421567 506 --22468 444 --
NM_001015877chrX22400 322 1883 ----
NM_001015885chr20--1329 ----
NM_001015887chr321815 140 ------
NM_001017369chr4------11082
NM_001017371chr211219 11148 ----
NM_001017395chr333427 2641 2596 --13416 22631 1000
NM_001017424chr12601 70 11528 11374 --
NM_001017425chr12601 70 11528 11374 --
NM_001017440chr756845 6234 3111 746 53 ------
NM_001017916chr1722061 1780 --11604 --
NM_001017917chr1722061 1780 --11604 --
NM_001017969chr91545 ----1662
NM_001017995chr543316 868 716 41 ------
NM_001017999chr12423 253 --1750 --
NM_001017999chr12423 253 --1750 --
NM_001018000chr12423 253 --1750 --
NM_001018000chr12423 253 --1750 --
NM_001018001chr12423 253 --1750 --
NM_001018054chr121178 370 ------
NM_001018064chr911577 1502 ----
NM_001018067chr154835 4681 3938 504 284 13736 11956 --
NM_001018068chr154835 4681 3938 504 284 13736 11956 --
NM_001018069chr154835 4681 3938 504 284 13736 11956 --
NM_001018074chr512750 --13847 --
NM_001018075chr512750 --13847 --
NM_001018076chr512750 --13847 --
NM_001018077chr512750 --13847 --
NM_001018111chr741165 414 314 63 1951 11394 --
NM_001020658chr11233 ------
NM_001020658chr11233 ------
NM_001020818chr1921725 1644 --1205 --
NM_001020819chr1921725 1644 --1205 --
NM_001020820chr1921725 1644 --1205 --
NM_001020821chr1921725 1644 --1205 --
NM_001020825chr51225 --11322 --
NM_001023567chr1522357 1851 ------
NM_001023587chr321004 934 11106 ----
NM_001024094chr512750 --13847 --
NM_001024226chr111073 1130 ----
NM_001024227chr111073 1130 ----
NM_001024228chr111073 1130 ----
NM_001024455chrX42219 1894 87 66 ------
NM_001024463chr151778 1882 ----
NM_001024647chr1277459 6267 4983 2670 1165 936 166 ------
NM_001024649chr51958 ------
NM_001024808chr1222113 185 1302 ----
NM_001024957chr112125 22 ------
NM_001025076chr1045676 1361 681 258 --45910 5869 3802 2158 --
NM_001025077chr1077034 4578 2719 2039 1616 1354 1244 --37268 7227 5160 --
NM_001025079chr324014 3244 1757 ----
NM_001025081chr1821525 373 ------
NM_001025090chr1821525 373 ------
NM_001025092chr1821525 373 ------
NM_001025101chr1821525 373 ------
NM_001025266chr341615 1201 481 82 14462 ----
NM_001025366chr62489 280 ------
NM_001025366chr62489 280 ------
NM_001025367chr62489 280 ------
NM_001025367chr62489 280 ------
NM_001025368chr62489 280 ------
NM_001025368chr62489 280 ------
NM_001025369chr62505 296 ------
NM_001025369chr62505 296 ------
NM_001025370chr62489 280 ------
NM_001025370chr62489 280 ------
NM_001025579chr172756 306 1424 ----
NM_001025580chrX----1289 12715
NM_001025595chr411686 ------
NM_001025616chr42518 433 ------
NM_001025780chr9141 1290 ----
NM_001029858chr61581 --1315 12525
NM_001029863chr61314 --2984 62 --
NM_001029875chr532739 376 179 ------
NM_001029882chr11494 ------
NM_001029882chr11494 ------
NM_001030006chr1752493 851 269 80 33 --11079 --
NM_001030007chr1643984 2854 1425 71 13104 --1599
NM_001030055chr1424672 1555 ------
NM_001030287chr11483 ------
NM_001031690chr742360 2106 1057 396 ------
NM_001031695chr2245377 4979 1459 1377 --12074 --
NM_001031700chr452372 2090 433 376 316 ------
NM_001031702chr32779 114 ------
NM_001031804chr1623351 1343 --1540 --
NM_001031812chr522100 50 ----11736
NM_001032282chr8----1330 --
NM_001032288chr2021320 347 --11338 --
NM_001032293chr17158 ------
NM_001032296chr1332689 1956 1065 ------
NM_001032367chr151462 1432 ----
NM_001032393chrX1678 ------
NM_001033059chr61431 --1237 --
NM_001033081chr111704 1218 ----
NM_001033082chr111704 1218 ----
NM_001033085chr2153 ------
NM_001033117chr344749 4431 4246 1195 11015 14378 --
NM_001033503chr5195 ------
NM_001033506chr11196 ------
NM_001033507chr11129 11881 ----
NM_001033518chr732244 352 69 ------
NM_001033519chr732244 352 69 ------
NM_001033520chr732244 352 69 ------
NM_001033551chr1763236 3094 2852 2745 1292 910 1926 13931 --
NM_001033557chr2----1133 1342
NM_001033561chr17------1755
NM_001033566chr171985 ------
NM_001033568chr171985 ------
NM_001033581chr1121 ------
NM_001033581chr1121 ------
NM_001033582chr1121 ------
NM_001033756chr62423 214 --1727 --
NM_001033756chr62423 214 --1727 --
NM_001034837chr5------1775
NM_001034838chr5------1775
NM_001034845chr41232 ------
NM_001034852chr1431762 1472 424 1340 1395 --
NM_001034954chr101610 --11008 13248
NM_001034955chr101610 --11008 13248
NM_001034956chr101610 --11008 13248
NM_001034957chr101610 --11008 13248
NM_001035chr12948 88 ------
NM_001037132chr72587 506 1112 11713 --
NM_001037133chr72587 506 1112 11713 --
NM_001037172chr31167 1912 --21035 926
NM_001037317chr132779 2375 2293 ------
NM_001037334chr1842278 865 502 319 --1383 --
NM_001037339chr11233 ----1717
NM_001037340chr11233 ----1717
NM_001037341chr11233 ----1717
NM_001037341chr11233 ----1717
NM_001039459chr711168 ------
NM_001039467chr202151 71 ------
NM_001039538chr2------13676
NM_001039547chr3--13216 21810 1406 --
NM_001039574chr121068 1020 ------
NM_001039577chr14807 180 140 21 23882 251 ----
NM_001039585chr133683 213 146 ------
NM_001039590chrX43783 3474 3108 1437 1645 21411 157 --
NM_001039591chrX43783 3474 3108 1437 1645 21411 157 --
NM_001039618chr1121470 756 --14689 15047
NM_001039711chr11729 ------
NM_001039712chr11729 ------
NM_001039716chr12897 42 ------
NM_001039762chr1011664 --12367 --
NM_001039840chrX34611 4198 710 --189 --
NM_001039935chr52379 340 ------
NM_001039937chr1343317 3269 1228 1017 ------
NM_001040001chr6--11913 ----
NM_001040057chr711139 --1995 --
NM_001040092chr8----1360 --
NM_001040101chr42363 156 1274 ----
NM_001040135chr73758 128 104 1526 ----
NM_001040142chr222155 406 ------
NM_001040143chr222155 406 ------
NM_001040152chr753617 3116 814 349 312 --25120 1515 15072
NM_001040153chr131972 ------
NM_001040167chr71805 --11193 --
NM_001040181chr31462 --1426 --
NM_001040182chr31462 --1426 --
NM_001040183chr31462 --1426 --
NM_001040199chr31462 --1426 --
NM_001040200chr31462 --1426 --
NM_001040284chr161888 --13625 --
NM_001040402chr423085 891 --3264 164 70 --
NM_001040441chr123930 194 ------
NM_001040450chr151221 ------
NM_001040453chr151221 ------
NM_001040455chr113974 246 73 ------
NM_001040624chr822634 107 21758 422 22476 162 --
NM_001040625chr822634 107 21758 422 22476 162 --
NM_001040626chr822634 107 21758 422 22476 162 --
NM_001040627chr822634 107 21758 422 22476 162 --
NM_001040628chr822634 107 21758 422 22476 162 --
NM_001040629chr822634 107 21758 422 22476 162 --
NM_001040630chr822634 107 21758 422 22476 162 --
NM_001040653chr342616 1669 866 845 ------
NM_001040694chr111359 ------
NM_001040712chr923574 882 ----1685
NM_001042355chr1665371 3983 3536 3355 1145 91 ------
NM_001042388chr182820 645 ----1623
NM_001042404chr12643 323 ------
NM_001042412chr1665371 3983 3536 3355 1145 91 ------
NM_001042413chr923455 434 ------
NM_001042453chrX11516 ------
NM_001042473chr101198 ------
NM_001042475chr6150 ------
NM_001042486chr2031405 1356 254 ------
NM_001042492chr1733247 3155 1256 ------
NM_001042510chr81140 42170 2055 1353 737 ----
NM_001042511chr81140 42170 2055 1353 737 ----
NM_001042537chrX42283 1996 962 886 --2932 593 --
NM_001042555chr1234783 4025 1290 --1605 --
NM_001042599chr237107 6651 5551 15964 ----
NM_001042601chr333082 705 374 ------
NM_001042603chr1244605 1535 1039 994 --22040 755 --
NM_001042604chr364802 4480 4262 3796 563 158 ----13528
NM_001042616chr4--2213 24 ----
NM_001042632chr2041974 1934 500 452 22532 1742 ----
NM_001042633chr2041974 1934 500 452 22532 1742 ----
NM_001042669chr42518 433 ------
NM_001042681chr11172 --11939 --
NM_001042682chr11172 --11939 --
NM_001042682chr11172 --11939 --
NM_001042728chr1221069 1016 ------
NM_001043351chr132251 877 587 ------
NM_001044305chr631321 507 50 11222 ----
NM_001044722chr522100 50 ----11736
NM_001044723chr522100 50 ----11736
NM_001046chr512998 ------
NM_001049chr1422497 121 ------
NM_001083620chr422446 113 ------
NM_001083621chr124088 1142 14221 ----
NM_001095chr1211611 1630 --11339
NM_001106chr379654 8023 3397 2971 2382 2102 1287 27248 971 49353 7788 3105 352 --
NM_001113490chrX22306 426 ------
NM_001116chr16139 --12097 --
NM_001117chr181531 ------
NM_001122679chr511257 ------
NM_001124chr11----1470 --
NM_001128chr1643984 2854 1425 71 13104 --1599
NM_001135chr15190 ------
NM_001144chr1641399 1358 452 110 ------
NM_001146chr8----1277 --
NM_001148chr42818 651 1385 12060 --
NM_001149chr1031267 1063 281 ----1490
NM_001157chr101230 ------
NM_001167chrX22613 915 16711 ----
NM_001173chr1424672 1555 ------
NM_001174chrX1142 --1244 --
NM_001204chr247189 1914 1861 329 27524 5967 --17759
NM_001206chr9----23070 468 --
NM_001222chr1021717 600 1195 --1653
NM_001256chr1722668 1942 11850 ----
NM_001259chr746382 4466 1820 120 --12339 25602 1982
NM_001271chr1542236 2076 2010 117 13245 ----
NM_001282chr1752493 851 269 80 33 --11079 --
NM_001284chr5----1172 --
NM_001290chr4----1746 --
NM_001293chr111411 ------
NM_001304chr1732814 2642 1412 13021 ----
NM_001312chr142486 471 ------
NM_001315chr631646 1631 302 12260 ----
NM_001329chr101170 1539 ----
NM_001332chr5----11079 --
NM_001351chr321820 36 ------
NM_001356chrX32446 2363 1777 ----1221
NM_001385chr8----1168 --
NM_001390chr1833251 2268 376 --13520 --
NM_001396chr2112267 --12555 --
NM_001399chrX53060 2740 1188 638 80 11245 1658 --
NM_001402chr621769 520 ------
NM_001406chr1731715 1213 136 11632 ----
NM_001408chr141475 1318 421 151 ----11630
NM_001416chr171343 ------
NM_001420chr1932563 2246 2094 ------
NM_001427chr72388 364 ------
NM_001430chr211943 ------
NM_001431chr62397 378 ------
NM_001438chr1--12253 ----
NM_001451chr161296 --11051 --
NM_001453chr621759 537 --11719 --
NM_001455chr633314 3142 1622 11321 --13984
NM_001463chr24782 307 288 59 ------
NM_001483chr7--1112 1206 154
NM_001493chrX1607 --1571 --
NM_001495chr82899 126 ------
NM_001497chr962669 2568 2492 2460 2278 51 1936 1333 --
NM_001527chr634736 3631 735 --21353 471 --
NM_001530chr141968 ------
NM_001546chr621076 249 ------
NM_001584chr1121118 1081 1833 ----
NM_001587chrX12078 ----1384
NM_001609chr1024402 4180 141 ----
NM_001610chr113797 206 70 ------
NM_001614chr172175 30 1714 ----
NM_001614chr172175 30 1714 ----
NM_001616chr251108 909 797 510 174 --1444 --
NM_001619chr1121040 42 ------
NM_001620chr11--1811 ----
NM_001634chr61431 --1237 --
NM_001635chr711070 11031 ----
NM_001658chr111073 1130 ----
NM_001662chr7----1393 --
NM_001663chr141515 --1859 1429
NM_001664chr3148 ------
NM_001668chr141844 1512 739 483 ------
NM_001670chr223740 234 84 ------
NM_001674chr11483 ------
NM_001677chr12859 313 --1422 --
NM_001682chr121398 1546 ----
NM_001683chr332098 728 180 ------
NM_001684chr154194 4170 3621 3609 103 ------
NM_001690chr322411 2016 ------
NM_001699chr1921445 321 ------
NM_001701chr911348 ----11005
NM_001709chr1132084 942 502 12329 22600 252 --
NM_001718chr61934 ----11152
NM_001730chr1311210 --11498 1210
NM_001730chr1311210 --11498 1210
NM_001746chr51958 ------
NM_001753chr741796 1306 1195 1145 ------
NM_001759chr1211291 14680 1611 --
NM_001777chr324014 3244 1757 ----
NM_001821chr131456 409 24 --13800 --
NM_001830chrX2450 247 11420 ----
NM_001839chr11721 1192 ----
NM_001842chr9------1565
NM_001845chr131175 ------
NM_001854chr1--1283 ----
NM_001855chr91640 ------
NM_001858chr624027 1808 11693 ----
NM_001859chr943289 3154 1388 1238 ----13954
NM_001860chr91240 11125 ----
NM_001880chr21302 ------
NM_001895chr201801 --11177 --
NM_001904chr321035 362 --1280 --
NM_001915chr1722061 1780 --11604 --
NM_001933chr142414 109 ----1949
NM_001938chr121576 418 11917 ----
NM_001946chr122840 24 1208 ----
NM_001949chr622495 1052 12253 1335 --
NM_001968chr4--1838 ----
NM_001980chr1221759 1490 ------
NM_001981chr112337 1580 1869 --
NM_001998chr31117 ------
NM_001999chr51961 ------
NM_002006chr465603 1688 1517 1117 753 218 ------
NM_002010chr131119 ------
NM_002025chrX--27118 2619 28326 2571 16717
NM_002028chr1421264 1113 ------
NM_002035chr1822476 53 1947 ----
NM_002040chr2122987 2820 ------
NM_002051chr1021088 254 ------
NM_002063chrX--11255 ----
NM_002074chr141556 1282 1162 158 1204 ----
NM_002077chr91722 12105 ----
NM_002086chr1712153 --21987 487 --
NM_002091chr181195 --1183 --
NM_002095chr8157 --1261 --
NM_002107chr11487 ------
NM_002126chr1724122 594 ------
NM_002128chr1322468 2263 --12445 12525
NM_002130chr521635 186 --11302 --
NM_002137chr732418 1914 842 ------
NM_002140chr9----1178 --
NM_002149chr2----144 --
NM_002156chr21179 ------
NM_002158chr21411 --2515 166 --
NM_002181chr2--135 1537 --
NM_002193chr221257 623 --11877 --
NM_002202chr53953 908 397 ------
NM_002207chr31116 --1493 --
NM_002214chr744604 350 226 115 --12057 --
NM_002223chr1243735 3506 1158 988 --1943 --
NM_002241chr122101 1971 11131 ----
NM_002242chr21255 --11568 --
NM_002252chr21136 ------
NM_002264chr333229 1511 812 ------
NM_002267chr1332307 785 764 ------
NM_002268chr311209 1598 ----
NM_002271chr1332010 1853 1776 12343 --1984
NM_002293chr132201 1879 111 ------
NM_002296chr111134 ------
NM_002309chr2252811 2336 1039 420 23 ------
NM_002310chr534935 4213 989 16188 46381 2348 1901 695 --
NM_002313chr1065024 4928 4769 1248 1007 968 ------
NM_002332chr121737 ------
NM_002336chr1264528 4370 1564 894 739 205 --24325 611 --
NM_002355chr122991 481 ------
NM_002356chr61749 --22807 2060 --
NM_002359chr1773187 2884 1302 1162 1154 1147 293 --1187 14266
NM_002360chr732624 2165 692 1413 12609 --
NM_002373chr1521297 845 11344 ----
NM_002374chr2------13676
NM_002380chr81379 ------
NM_002382chr1411198 ------
NM_002384chr181682 ------
NM_002385chr1821525 373 ------
NM_002399chr1521351 1281 ------
NM_002401chr1752257 1817 519 77 38 1748 12239 --
NM_002430chr2232415 529 111 1375 ----
NM_002444chrX----21797 618 --
NM_002473chr2221087 102 --21243 462 --
NM_002480chr1221129 606 ------
NM_002499chr151332 12430 1636 --
NM_002500chr221194 60 ------
NM_002501chr1911168 --11318 --
NM_002509chr201329 ------
NM_002519chr1121397 144 ----1585
NM_002541chr71156 --1866 --
NM_002567chr122744 722 --1597 --
NM_002577chr323643 301 14024 ----
NM_002581chr955344 4646 3897 1188 837 --25529 1275 --
NM_002582chr162374 34 ------
NM_002588chr531624 1291 609 1238 ----
NM_002595chr1221576 319 ------
NM_002600chr11233 ----1717
NM_002606chr21--1165 ----
NM_002608chr2211223 ----154
NM_002613chr16115097 4341 3682 3311 1726 1601 1479 1248 979 629 399 14887 21205 268 --
NM_002618chr21125 ------
NM_002628chr311124 ------
NM_002645chr111150 --1220 --
NM_002648chr621147 261 ------
NM_002655chr825222 1130 14749 1732 15278
NM_002670chr321646 346 ------
NM_002705chr162682 74 ------
NM_002710chr122793 154 ------
NM_002716chr1133582 898 649 ------
NM_002721chr9199 ------
NM_002730chr1921374 334 ------
NM_002731chr1----12880 --
NM_002734chr17--1413 21970 227 --
NM_002737chr1784303 1903 1883 1876 1805 1732 902 735 --11847 --
NM_002744chr1121 ------
NM_002755chr152799 322 ------
NM_002756chr171210 --1976 --
NM_002787chr71581 ------
NM_002806chr141242 ------
NM_002813chr1221451 485 --31470 1330 1283 --
NM_002821chr61128 --1757 --
NM_002822chr1211675 ------
NM_002823chr21675 --1601 --
NM_002834chr1233849 2772 815 ----13554
NM_002835chr72495 132 ------
NM_002839chr923574 882 ----1685
NM_002840chr121353 105 11557 ----
NM_002843chr1111149 11331 13387 --
NM_002844chr62992 905 ------
NM_002848chr1221184 309 --1834 --
NM_002852chr31244 ------
NM_002867chr11133 --1548 --
NM_002869chr1122225 132 --11555 1536
NM_002874chr91500 --22246 1790 --
NM_002890chr5----1351 --
NM_002892chr14134 11453 ----
NM_002893chrX----1300 --
NM_002897chr21752 1629 1527 1512
NM_002906chr1111754 --12121 --
NM_002912chr61625 ------
NM_002941chr32522 328 --1118 --
NM_002958chr3----1905 --
NM_002968chr16--1277 --1288
NM_002970chrX174 ------
NM_002994chr421822 187 11454 1245 --
NM_002997chr221313 737 ------
NM_002998chr81777 12171 ----
NM_003010chr1721950 1737 --11677 --
NM_003011chr911278 11485 ----
NM_003016chr17----21718 251 --
NM_003026chr931372 1147 256 ------
NM_003028chr952930 784 150 98 88 --11217 --
NM_003043chr32427 39 ------
NM_003047chr121361 1120 ------
NM_003051chr121246 339 --11581 11717
NM_003060chr511208 --1104 --
NM_003063chr11177 1148 ----
NM_003068chr82344 237 ------
NM_003069chrX----1733 --
NM_003071chr321963 1390 --1689 --
NM_003076chr122598 111 ------
NM_003077chr172106 65 ------
NM_003081chr2061041 883 425 319 285 33 --1922 --
NM_003087chr101227 ------
NM_003093chr6172 ------
NM_003107chr632485 2228 2128 ------
NM_003108chr246237 1643 460 174 --26926 1004 17086
NM_003111chr211219 11148 ----
NM_003112chr712895 ------
NM_003128chr242458 687 499 317 ------
NM_003136chr14148 1386 ----
NM_003137chr611598 12244 22167 463 --
NM_003144chr641506 557 315 154 ------
NM_003150chr1722270 466 ----12379
NM_003155chr822482 1921 ------
NM_003156chr113937 323 235 --1273 --
NM_003161chr1753329 2713 2402 1133 205 --11056 --
NM_003178chr321603 97 --1867 --
NM_003179chrX----1122 --
NM_003188chr61132 ------
NM_003204chr1721802 273 ------
NM_003211chr1221397 1191 ------
NM_003223chr162534 527 ------
NM_003246chr151563 ------
NM_003247chr621664 416 11277 ----
NM_003257chr1511269 --11391 --
NM_003262chr313198 --11053 --
NM_003263chr4143 ------
NM_003269chr6--11172 1826 --
NM_003290chr191103 ------
NM_003291chr132565 222 ------
NM_003297chr12--122 ----
NM_003298chr366186 5278 5061 4226 2466 502 ------
NM_003336chrX3909 379 117 ------
NM_003337chr51203 ------
NM_003338chr101313 ------
NM_003344chr741514 1422 638 464 11637 ----
NM_003348chr1211190 --21331 576 --
NM_003349chr2021320 347 --11338 --
NM_003356chr112819 128 ------
NM_003369chr111837 --11124 --
NM_003370chr19--1617 ----
NM_003373chr103543 480 86 --1444 --
NM_003374chr5--1813 ----
NM_003376chr62489 280 ------
NM_003376chr62489 280 ------
NM_003387chr2------1264
NM_003390chr11--1748 1284 --
NM_003392chr344300 4221 3965 1611 --12821 --
NM_003400chr23647 638 71 ------
NM_003406chr82620 68 ------
NM_003410chrX2571 108 ------
NM_003411chrY1103 --11620 --
NM_003413chrX11801 ----11453
NM_003418chr3----1124 1779
NM_003423chr1911054 ------
NM_003453chr131597 ------
NM_003457chr17158 ------
NM_003459chr22671 564 ------
NM_003463chr613379 1625 1214 --
NM_003467chr2------1385
NM_003468chr221309 100 24393 3958 1455 --
NM_003470chr1621183 521 ------
NM_003471chr331788 149 103 11764 --1243
NM_003472chr611282 --1169 --
NM_003477chr11--1261 ----
NM_003478chr1153065 2604 1245 410 214 13250 ----
NM_003483chr12--1240 22832 2664 --
NM_003488chr17------1882
NM_003498chr165796 375 232 108 82 ------
NM_003506chr82997 361 ------
NM_003507chr21316 11876 ----
NM_003513chr6126 ------
NM_003557chr121394 338 --11121 --
NM_003558chr92598 222 --1213 --
NM_003563chr174983 933 208 57 ------
NM_003566chr1222461 2332 --21062 412 --
NM_003569chr6------1618
NM_003574chr1865667 4782 4694 4595 634 22 --1367 11661
NM_003575chr721153 70 --31481 1352 1008 --
NM_003576chr1332689 1956 1065 ------
NM_003580chr8--1477 ----
NM_003583chr1223778 46 13516 ----
NM_003590chr223547 3503 1545 1752 --
NM_003603chr441884 626 427 164 ------
NM_003610chr20--1329 ----
NM_003615chr332663 445 94 --13131 --
NM_003618chr21264 ------
NM_003620chr171934 ----1206
NM_003628chr2173 ------
NM_003629chr123219 1113 --13400 --
NM_003630chr61671 ------
NM_003633chr521949 787 ----32326 1663 337
NM_003642chr2153 ------
NM_003644chr17145546 5206 5008 4944 4632 4475 4354 2258 1325 1158 1082 297 256 248 ------
NM_003648chr242424 1012 629 299 12589 ----
NM_003659chr21834 ------
NM_003668chr121247 1118 ----
NM_003670chr321148 492 ------
NM_003671chr92340 234 ------
NM_003672chr13699 427 90 ------
NM_003684chr12892 711 ------
NM_003687chr511062 ------
NM_003690chr21474 ------
NM_003710chr151462 1432 ----
NM_003713chr1159 --11078 --
NM_003714chr522205 417 ------
NM_003718chr71185 ------
NM_003728chr41270 ------
NM_003735chr531624 1291 609 1238 ----
NM_003736chr531624 1291 609 1238 ----
NM_003743chr21167 ------
NM_003749chr131223 ------
NM_003750chr101954 ------
NM_003758chr151183 --1251 --
NM_003758chr151183 --1251 --
NM_003760chr11628 ------
NM_003774chr121184 ------
NM_003794chr321088 1074 ------
NM_003795chr6----1225 --
NM_003799chr1823187 485 --1156 --
NM_003818chr202916 822 1813 ----
NM_003819chr11200 ------
NM_003822chr132914 1085 840 11231 ----
NM_003827chr192436 72 ------
NM_003829chr92879 87 ------
NM_003831chr1821817 1794 ------
NM_003846chr11674 ----1712
NM_003850chr131221 ------
NM_003877chr121979 ------
NM_003895chr2122204 1924 --22081 1602 --
NM_003908chr2031322 1069 1045 ------
NM_003909chr832431 1977 314 --21866 379 --
NM_003913chr643247 3129 1656 378 ------
NM_003924chr4----197 --
NM_003932chr22129 --1591 11654
NM_003934chr91182 ------
NM_003941chr711570 1709 --2179 108
NM_003942chr111727 ------
NM_003947chr321329 231 ------
NM_003953chr132304 910 815 --1251 --
NM_003958chr683923 3883 3822 3732 3046 2750 2443 676 ------
NM_003972chr10128 ------
NM_003983chr1633122 1070 670 --1848 --
NM_003994chr1233766 1697 575 --13270 --
NM_003998chr41564 ------
NM_004006chrX12370 ------
NM_004007chrX12370 ------
NM_004009chrX12370 ------
NM_004010chrX12370 ------
NM_004011chrX12370 ------
NM_004012chrX12370 ------
NM_004013chrX12370 ------
NM_004014chrX12370 ------
NM_004015chrX12370 ------
NM_004016chrX12284 ------
NM_004017chrX12370 ------
NM_004018chrX12284 ------
NM_004020chrX12370 ------
NM_004021chrX12284 ------
NM_004022chrX12284 ------
NM_004023chrX12284 ------
NM_004037chr12713 73 --1835 --
NM_004050chr1421937 781 ------
NM_004055chr1131394 298 212 1903 1123 --
NM_004056chr81182 1828 1962 --
NM_004061chr51438 ------
NM_004065chrX1209 ------
NM_004067chr71251 --2523 225 --
NM_004081chrY31841 1427 124 ------
NM_004087chr311851 11867 ----
NM_004093chr1333032 841 248 23047 2757 ----
NM_004100chr62249 154 ------
NM_004103chr81616 --168 --
NM_004114chrX2420 53 ------
NM_004133chr81114 11982 --1472
NM_004136chr1523043 1108 13276 ----
NM_004152chr191231 ------
NM_004156chr8--1238 ----
NM_004157chr32345 100 --1124 --
NM_004170chr911850 ------
NM_004171chr1149001 8693 1486 177 --13477 --
NM_004200chr111733 12916 ----
NM_004227chr742888 2667 256 164 --12208 --
NM_004232chr182306 94 --33563 3040 1297 --
NM_004236chr152454 159 1230 ----
NM_004238chr2----1280 --
NM_004261chr11368 ------
NM_004262chr411304 ------
NM_004267chr3----1146 --
NM_004272chr511314 11711 --11367
NM_004274chr141124 ----1752
NM_004291chr51138 ------
NM_004294chr13------1702
NM_004302chr122713 701 12943 ----
NM_004305chr22432 373 ------
NM_004309chr1741035 922 240 224 ------
NM_004311chr1051110 465 458 388 68 ------
NM_004330chr1521120 54 1168 ----
NM_004331chr81722 ------
NM_004338chr1857052 7007 4645 4594 1311 35474 4993 1890 15295 --
NM_004342chr71237 ------
NM_004349chr8----1380 --
NM_004370chr632123 1698 1618 ----1661
NM_004380chr1632167 976 303 12560 1295 12507
NM_004384chr522100 50 ----11736
NM_004385chr51670 --1136 --
NM_004392chr131264 ------
NM_004393chr31508 ------
NM_004397chr1131719 1241 1072 23960 1173 ----
NM_004408chr92489 446 ------
NM_004411chr72591 259 --1106 --
NM_004417chr52561 178 ------
NM_004420chr1132286 1830 1534 ------
NM_004430chr832741 2089 458 ------
NM_004431chr1167 ------
NM_004432chr9----1452 --
NM_004436chr1----1593 --
NM_004438chr22316 160 1309 --13332
NM_004440chr61626 ------
NM_004449chr211535 ------
NM_004451chr111710 ------
NM_004454chr332060 1986 1477 22040 1911 ----
NM_004457chr211716 --1507 --
NM_004458chrX11764 --11006 --
NM_004459chr171428 ------
NM_004464chr434147 3506 509 ------
NM_004469chrX----164 --
NM_004481chr142679 904 797 23 12580 ----
NM_004483chr161479 ------
NM_004494chr121264 45 ------
NM_004504chr22652 397 ------
NM_004508chr101815 11121 ----
NM_004514chr1762959 2654 2520 2511 1051 321 ----12244
NM_004525chr221461 163 ------
NM_004540chr21----1192 --
NM_004571chr212582 140 --12999 --
NM_004575chr41621 --11456 11449
NM_004586chrX45253 4047 3404 128 24243 3318 ----
NM_004588chr1133689 3663 819 --13652 --
NM_004593chr32610 157 ------
NM_004595chrX1366 160 ----
NM_004612chr94690 352 312 286 13105 --14412
NM_004622chr232023 1885 28 11943 ----
NM_004631chr121178 370 ------
NM_004634chr31441 ------
NM_004651chrX1363 ------
NM_004654chrY11398 ------
NM_004657chr22364 30 ------
NM_004660chrY22231 1709 ------
NM_004663chr15------11434
NM_004671chr18--1206 ----
NM_004687chr17--12088 ----
NM_004703chr17--21732 457 ----
NM_004705chr111573 --2838 594 --
NM_004711chr2213358 ------
NM_004719chr1212842 --11159 --
NM_004725chr102401 205 ----11449
NM_004729chrX--12164 --160
NM_004730chr531463 828 440 1365 ----
NM_004733chr31502 ------
NM_004734chr131313 ------
NM_004736chr12836 579 11778 ----
NM_004745chr836118 4645 2114 12091 15560 --
NM_004747chr1031395 1203 377 ------
NM_004748chr1534259 3785 3766 ----12688
NM_004768chr1--2310 73 --1370
NM_004776chr2083000 2838 1309 963 836 362 351 340 12536 22965 769 --
NM_004788chr1122236 151 ------
NM_004796chr1431892 1603 780 1257 12162 --
NM_004798chr2032650 2628 164 ------
NM_004834chr232522 382 237 --1826 --
NM_004835chr31829 ------
NM_004835chr31829 ------
NM_004840chrX32096 1775 1697 --1198 --
NM_004842chr63491 159 85 ------
NM_004845chrX--14007 13478 --
NM_004850chr221302 564 ----11337
NM_004857chr14----13246 --
NM_004859chr1712414 1682 1849 --
NM_004865chr6----1306 1171
NM_004871chr1732832 1571 185 --23747 1441 --
NM_004884chr151554 1375 1436 --
NM_004887chr511073 ------
NM_004898chr412731 --11967 --
NM_004904chr736405 6269 452 --11176 --
NM_004912chr7--11136 ----
NM_004926chr1411753 ------
NM_004947chr332607 2254 150 ----1435
NM_004956chr741116 1062 951 68 12901 2741 567 11393
NM_004965chr213561 523 192 ------
NM_004968chr7187 ------
NM_004973chr62497 487 1219 11590 175
NM_004976chr1125071 249 ------
NM_004978chr131731 1683 515 ------
NM_004985chr1214465 ------
NM_004992chrX77619 6961 6581 6363 1340 1183 280 12464 11945 --
NM_004992chrX77619 6961 6581 6363 1340 1183 280 12464 11945 --
NM_004993chr1411275 ------
NM_004999chr623058 1073 --1682 --
NM_005003chr16125 ------
NM_005010chr72587 506 1112 11713 --
NM_005016chr12136 ------
NM_005025chr31213 ------
NM_005032chrX1839 ----1293
NM_005037chr31205 ------
NM_005054chr211388 ------
NM_005063chr1023610 543 --13386 --
NM_005065chr1435410 5091 3717 14056 ----
NM_005067chr31212 ------
NM_005087chr32868 250 ------
NM_005105chr1----3461 298 87 --
NM_005109chr322142 593 ------
NM_005116chr2071300 873 854 510 233 148 58 13285 14159 --
NM_005121chr1713734 ------
NM_005134chr182820 645 ----1623
NM_005149chr111417 ------
NM_005151chr1842278 865 502 319 --1383 --
NM_005153chr163808 739 514 ------
NM_005156chr945322 4630 3307 1753 15002 --11970
NM_005180chr10----11535 --
NM_005194chr20----1445 --
NM_005197chr1445622 4051 2464 2353 14577 15203 --
NM_005219chr541531 630 384 269 --1474 --
NM_005221chr7----150 --
NM_005230chr12176 ------
NM_005231chr112929 168 ------
NM_005233chr312437 ------
NM_005235chr237107 6651 5551 15964 ----
NM_005238chr1163514 3052 2635 1313 1137 674 --12406 --
NM_005276chr1241621 1168 666 498 ------
NM_005276chr1241621 1168 666 498 ------
NM_005277chr4--11318 ----
NM_005284chr61458 ----1438
NM_005296chrX----1154 --
NM_005311chr721066 179 ------
NM_005318chr22----11259 --
NM_005324chr17--21797 1331 ----
NM_005329chr16196 ------
NM_005334chrX11748 --1190 --
NM_005339chr413829 --33853 3470 1671 11731
NM_005347chr911596 122 ----
NM_005354chr19164 ------
NM_005358chr132724 53 ------
NM_005359chr1856115 5364 4564 373 134 --12110 --
NM_005374chr1721878 814 ------
NM_005387chr111253 --1189 --
NM_005392chr9--11438 ----
NM_005397chr741165 414 314 63 1951 11394 --
NM_005398chr10----11150 --
NM_005399chr111676 --23474 738 --
NM_005418chr112476 86 1178 ----
NM_005433chr1822181 1106 ------
NM_005442chr32623 167 --1457 --
NM_005455chr121539 537 ------
NM_005460chr5150 ------
NM_005461chr2021677 392 ------
NM_005493chr61119 ------
NM_005497chr1724050 112 1368 25347 4675 --
NM_005499chr19--1175 ----
NM_005502chr91474 11305 ----
NM_005509chr5--21210 220 ----
NM_005522chr71509 ------
NM_005537chr133741 432 61 1789 ----
NM_005544chr21710 ------
NM_005546chr51535 1556 1527 --
NM_005562chr161704 1670 1390 632 507 343 ------
NM_005570chr18149 ------
NM_005578chr3----1348 14856
NM_005581chr192483 367 ------
NM_005586chr61263 ----1646
NM_005596chr934689 1720 1571 ------
NM_005598chr131276 277 223 ------
NM_005611chr1611216 ------
NM_005626chr1--196 ----
NM_005627chr61663 ------
NM_005634chrX1604 ----1147
NM_005637chr1811653 ------
NM_005647chrX32390 2372 370 ------
NM_005655chr8----1330 --
NM_005657chr151124 ------
NM_005667chr21394 ------
NM_005668chr544464 4223 3407 3334 13389 ----
NM_005669chr511995 ------
NM_005678chr153675 652 404 ------
NM_005686chr11614 1523 1483 --
NM_005688chr351306 1268 1237 1201 1155 --11163 1429
NM_005715chr6--12744 1904 --
NM_005717chr1144 --11251 --
NM_005724chr15171 ------
NM_005725chr11263 1825 1115 --
NM_005734chr111751 ------
NM_005736chr1031024 355 139 ------
NM_005737chr242937 2063 360 323 12872 ----
NM_005746chr712305 ------
NM_005759chr254406 3312 2921 1151 888 23989 1076 14777 --
NM_005776chr141845 ------
NM_005777chr3180 ------
NM_005778chr3199 1342 ----
NM_005779chr521100 572 1968 ----
NM_005795chr222093 627 22695 510 12470 --
NM_005801chr171179 ------
NM_005808chr323240 996 ------
NM_005819chr12782 302 --2338 81 2798 477
NM_005826chr11110 ------
NM_005828chr1734897 361 191 ------
NM_005840chrX87218 5270 2768 2231 1741 1597 701 378 --15347 --
NM_005842chr132715 157 --1125 --
NM_005852chr1721070 1051 --1933 --
NM_005859chr52631 425 11537 ----
NM_005862chr3--1737 1882 --
NM_005871chr101245 --1113 --
NM_005873chr202151 71 ------
NM_005885chr53331 192 162 ------
NM_005886chr161112 1262 ----
NM_005896chr21548 ------
NM_005898chr11------1875
NM_005900chr4----1765 --
NM_005901chr1866229 5596 2590 2346 1834 347 ----12240
NM_005902chr1524360 1495 --1840 --
NM_005903chr524624 792 23606 543 ----
NM_005909chr51172 ------
NM_005910chr1762855 2663 1175 1165 717 637 ----14127
NM_005917chr22173 51 ------
NM_005920chr123324 1449 13777 ----
NM_005930chr14165 ------
NM_005933chr1122283 2220 12691 ----
NM_005935chr4----15238 --
NM_005938chrX21329 320 ------
NM_005941chr841055 208 146 78 ------
NM_005955chr185147 4983 4464 3917 3806 3615 868 699 ------
NM_005962chr1011547 ------
NM_005962chr1011547 ------
NM_005977chr13164 ------
NM_005994chr17----1679 --
NM_005996chr12259 48 --21276 1084 --
NM_006007chr924033 877 ------
NM_006011chr1521182 1006 ------
NM_006015chr11116 11024 11051 --
NM_006016chr61249 22240 1799 ----
NM_006017chr41741 ------
NM_006036chr21894 1648 11603 --
NM_006040chr163429 148 92 ------
NM_006043chr161682 ------
NM_006047chr2023306 572 --143 2545 187
NM_006048chr13455 402 82 ------
NM_006054chr1111477 ------
NM_006060chr72757 450 --13703 --
NM_006070chr31156 ------
NM_006079chr62660 170 ------
NM_006080chr7--12975 ----
NM_006086chr16182 --1282 --
NM_006094chr822001 477 ------
NM_006095chr413568 14300 23084 739 13757
NM_006100chr31116 ------
NM_006106chr113782 183 166 --12990 --
NM_006116chr2221582 385 ------
NM_006122chr1542537 817 156 149 ------
NM_006133chr1121978 810 1516 --12411
NM_006134chr21----11570 --
NM_006139chr222774 552 ------
NM_006141chr1612637 12618 ----
NM_006153chr3126 --1238 --
NM_006158chr81219 11332 1446 --
NM_006162chr1821791 1291 ------
NM_006166chr1231825 1051 1013 11694 --1505
NM_006180chr911577 1502 ----
NM_006186chr2--1484 ----
NM_006191chr123929 881 27 ------
NM_006194chr14----11218 --
NM_006196chr22259 37 --1383 --
NM_006197chr822055 476 ----11534
NM_006203chr513501 --11139 --
NM_006206chr421947 474 --12284 --
NM_006209chr8----1360 --
NM_006241chr31924 --11590 --
NM_006243chr1--1166 ----
NM_006251chr523157 2098 ------
NM_006256chr11959 1905 ----
NM_006257chr103984 921 191 ------
NM_006258chr102353 31 ------
NM_006264chr4--1169 ----
NM_006281chr81181 ------
NM_006281chr81181 ------
NM_006283chr831958 1827 153 --14678 --
NM_006285chr92216 73 ------
NM_006293chr151702 --11026 --
NM_006313chr1221214 271 1435 ----
NM_006330chr82540 392 21625 1369 ----
NM_006352chr122031 1665 --11550 --
NM_006357chr21414 ------
NM_006359chrX42283 1996 962 886 --2932 593 --
NM_006362chr11----167 --
NM_006372chr61507 ------
NM_006373chr1721038 282 ------
NM_006375chrX11596 1212 ----
NM_006377chr91445 --11233 --
NM_006380chr1713300 --11349 --
NM_006386chr2252326 2122 844 691 568 ------
NM_006393chr1044295 3518 1494 1403 --14217 --
NM_006403chr611653 --11809 --
NM_006421chr8----1915 --
NM_006434chr101610 --11008 13248
NM_006454chr483069 2820 2320 1219 334 314 157 103 ------
NM_006459chr1011702 ------
NM_006465chr15--21462 167 ----
NM_006466chr201126 ------
NM_006469chr121159 1091 1149 ----
NM_006482chr1223778 46 13516 ----
NM_006504chr1032877 772 618 --1757 --
NM_006526chr2012122 --11743 --
NM_006534chr2043413 2729 2595 212 ------
NM_006537chr152578 211 ------
NM_006538chr263483 3210 3074 2966 2937 2614 24149 2845 ----
NM_006539chr16------1544
NM_006542chr11168 ------
NM_006546chr1744786 2199 1735 1619 --16661 --
NM_006557chr91537 --1369 --
NM_006561chr1045676 1361 681 258 --45910 5869 3802 2158 --
NM_006565chr16--11273 1181 --
NM_006570chr9180 ------
NM_006572chr171694 --22816 969 1202
NM_006574chr33269 249 226 ------
NM_006575chr141490 ------
NM_006589chr11158 1110 ----
NM_006593chr2------1223
NM_006595chr112779 127 ------
NM_006599chr1647284 2285 1839 1057 15849 ----
NM_006601chr12--1107 --11005
NM_006609chr223002 2574 ------
NM_006626chr932349 937 117 ------
NM_006634chr21226 1178 ----
NM_006646chr1322964 1218 --1335 --
NM_006650chr533799 3535 1519 ------
NM_006654chr1234783 4025 1290 --1605 --
NM_006691chr1131031 896 870 ------
NM_006698chr2021208 527 ------
NM_006700chr124311 291 159 58 ------
NM_006703chr6--1438 1153 --
NM_006711chr164643 518 185 170 ------
NM_006720chr1065024 4928 4769 1248 1007 968 ------
NM_006722chr322965 699 ------
NM_006726chr4--2862 408 ----
NM_006727chr5152 ------
NM_006732chr1931869 1492 856 12047 ----
NM_006736chr22584 340 --1172 --
NM_006738chr152978 62 14488 23395 2931 --
NM_006745chr4------11082
NM_006751chr21344 ------
NM_006754chr72786 132 --11205 --
NM_006755chr111175 ------
NM_006756chr811011 ------
NM_006761chr172562 281 ------
NM_006763chr121552 45 --11335 11364
NM_006766chr8------1107
NM_006769chr11688 ------
NM_006775chr632219 530 99 --13037 1866
NM_006777chrX42377 2122 2112 1118 ------
NM_006788chr1821942 404 --11463 --
NM_006791chr151205 1245 ----
NM_006795chr1121507 255 --1313 --
NM_006803chr811585 11284 1733 --
NM_006806chr211381 ------
NM_006811chr201262 ------
NM_006814chr201393 12594 ----
NM_006823chr821287 477 11004 ----
NM_006827chr1462514 2318 2290 2176 1175 1073 ------
NM_006838chr1231477 1379 1251 ------
NM_006846chr51252 ------
NM_006848chr112204 159 ------
NM_006854chr711717 1245 ----
NM_006874chr41892 ----1828
NM_006885chr1612861 ------
NM_006888chr1422975 2159 --23242 806 --
NM_006892chr2011167 ------
NM_006892chr2011167 ------
NM_006899chr202292 112 ------
NM_006908chr711048 ------
NM_006910chr162353 127 ------
NM_006922chr2----22056 208 --
NM_006924chr1734006 1395 788 --13889 --
NM_006936chr2141199 1122 990 888 --3909 477 43 11226
NM_006939chr1411082 11093 ----
NM_006947chr411220 ------
NM_006963chr10--11234 ----
NM_006981chr932491 1864 626 --12437 --
NM_006982chr12187 ------
NM_006997chr102403 62 ------
NM_007005chr911262 --21163 514 --
NM_007006chr1633336 1047 708 ------
NM_007007chr1244780 4113 1540 724 13890 24624 950 --
NM_007015chr13--126 ----
NM_007023chr221118 269 ------
NM_007034chr11804 ------
NM_007050chr2067889 7181 6921 2434 1512 42 12866 1183 15105
NM_007078chr1011943 --11226 --
NM_007087chr161795 ------
NM_007107chr311947 22388 254 ----
NM_007111chr133313 304 179 ------
NM_007124chr63684 646 415 ------
NM_007125chrY11115 --11041 --
NM_007126chr91422 ------
NM_007135chr91174 ------
NM_007137chrX74723 3962 3715 1848 1587 985 900 14281 --13514
NM_007158chr11789 --11123 --
NM_007172chr2222062 39 ------
NM_007174chr1231883 1799 817 --12265 --
NM_007197chr1221049 153 ------
NM_007200chr152978 62 14488 23395 2931 --
NM_007203chr963437 3327 2944 1397 1154 312 ------
NM_007207chr1127 ------
NM_007214chr6----153 --
NM_007216chr111263 ------
NM_007221chr12374 133 ------
NM_007225chr1731002 757 679 ------
NM_007235chr121344 ------
NM_007238chr2074424 3484 1162 983 430 370 127 --13157 14350
NM_007249chr1321152 260 --1654 --
NM_007269chr11187 --170 --
NM_007270chr721513 408 ------
NM_007294chr1731347 1203 1168 ------
NM_007295chr1731347 1203 1168 ------
NM_007296chr1731347 1203 1168 ------
NM_007297chr1731347 1203 1168 ------
NM_007298chr1731347 1203 1168 ------
NM_007299chr1731347 1203 1168 ------
NM_007300chr1731347 1203 1168 ------
NM_007302chr1731347 1203 1168 ------
NM_007303chr1731347 1203 1168 ------
NM_007304chr1731347 1203 1168 ------
NM_007305chr1731347 1203 1168 ------
NM_007308chr41226 ------
NM_007322chr192526 392 ------
NM_007347chr1522656 1101 --13107 --
NM_007358chr11749 --1563 --
NM_007363chrX1975 --1868 --
NM_007372chr171778 ------
NM_007373chr1041790 1479 1132 203 21720 1126 ----
NM_007374chr141409 --2470 142 --
NM_007375chr121103 239 21113 593 ----
NM_009585chr31829 ------
NM_009585chr31829 ------
NM_012064chr12----1159 --
NM_012069chrX1260 --12544 --
NM_012081chr513631 ------
NM_012082chr8----1708 --
NM_012084chrX--1557 ----
NM_012089chr121118 306 --11129 --
NM_012090chr111061 --11086 --
NM_012096chr31402 ------
NM_012102chr11172 --11939 --
NM_012104chr11--12590 ----
NM_012104chr11--12590 ----
NM_012120chr622702 571 12858 --22642 881
NM_012129chr711760 ----12472
NM_012141chr1343317 3269 1228 1017 ------
NM_012156chr2033319 2742 1241 13393 1699 --
NM_012158chr13------167
NM_012164chr957249 1943 1848 1799 1323 --14701 --
NM_012193chr1153495 2007 722 542 183 --14546 --
NM_012197chr921458 1393 ------
NM_012199chr144153 3543 2986 1601 ------
NM_012214chr236309 1788 936 --14130 --
NM_012218chr1932756 2127 1186 --1127 --
NM_012232chr171357 --12193 --
NM_012234chr353174 2616 1288 344 291 --1895 --
NM_012243chr11278 ------
NM_012244chr1411220 --11350 --
NM_012250chr1111048 ------
NM_012257chr71376 ------
NM_012262chr165231 5199 4701 4095 3750 84 31318 959 532 13781 13821
NM_012278chrX1141 ------
NM_012281chr711824 ------
NM_012288chr623698 740 15594 24332 1142 14718
NM_012290chr2--11360 ----
NM_012293chr231605 136 34 ------
NM_012294chr753950 3723 1553 871 96 ------
NM_012296chr1123529 670 --13886 --
NM_012297chr422400 927 --2961 600 12521
NM_012302chr11266 ------
NM_012304chr531878 1645 963 12554 ----
NM_012308chr1132290 536 251 ------
NM_012309chr1123065 299 24786 4534 13299 --
NM_012319chr18--179 1134 --
NM_012320chr1641399 249 150 45 ------
NM_012326chr21254 1570 ----
NM_012329chr1711491 11687 ----
NM_012333chr121262 659 ------
NM_012402chr112487 191 ------
NM_012405chr123092 2499 ------
NM_012416chr91481 --11254 --
NM_012428chr151226 ------
NM_012434chr621200 1155 ------
NM_012446chr51457 ------
NM_012454chr61481 ------
NM_012464chr42910 431 ------
NM_012479chr721833 959 12750 1706 --
NM_013227chr15190 ------
NM_013230chrY--11711 1560 --
NM_013231chr1433466 2783 252 --22818 345 --
NM_013242chr161381 2164 109 ----
NM_013254chr121175 ------
NM_013255chr758640 7591 6029 5357 1219 17646 27978 407 --
NM_013261chr433662 3145 1461 ------
NM_013269chr1223432 974 ------
NM_013279chr111109 --1165 --
NM_013281chr2011405 --1348 --
NM_013283chr51687 1296 ----
NM_013286chr31247 ------
NM_013293chr7--1531 1155 --
NM_013320chr121147 ------
NM_013341chr222586 495 ------
NM_013374chr323069 190 ------
NM_013381chr12------1276
NM_013396chr2121348 85 ------
NM_013410chr1168 --1318 --
NM_013433chr1931986 578 571 ------
NM_013436chr2--1682 ----
NM_013437chr831357 1302 1017 ------
NM_013438chr91104 1439 ----
NM_013446chr721052 115 ------
NM_013448chr14--2487 73 ----
NM_013943chr113290 ------
NM_013960chr8------1673
NM_013995chrX32236 1613 502 ------
NM_014000chr103543 480 86 --1444 --
NM_014011chr22894 145 ------
NM_014021chr112840 13007 ----
NM_014023chr1072554 2265 1830 1815 1780 494 402 --12255 --
NM_014030chr1721038 472 ------
NM_014048chr1654384 3248 1975 921 577 14529 15117 --
NM_014112chr834154 1963 1288 24021 995 ----
NM_014117chr161379 ------
NM_014153chr16----1629 --
NM_014155chr1167184 6540 5839 5399 2397 2262 1691 24725 1017 --
NM_014157chr1612789 1949 --1857
NM_014184chr1------1138
NM_014206chr11172 ------
NM_014212chr121314 --1961 --
NM_014217chr12601 70 11528 11374 --
NM_014232chr1721586 1319 ------
NM_014232chr1721586 1319 ------
NM_014243chr432121 1840 574 ------
NM_014248chr22162 --1123 --
NM_014251chr72794 26 ------
NM_014263chr1031397 1135 27 ------
NM_014268chr182537 112 ----11002
NM_014271chrX2232 86 ------
NM_014278chr41177 ------
NM_014283chr111326 ------
NM_014284chr11680 ------
NM_014309chr2245367 4969 1449 1367 --12064 --
NM_014319chr1211245 ------
NM_014325chr1221764 339 ------
NM_014333chr112626 188 --2703 145 1589
NM_014342chr1121465 927 ------
NM_014351chr2221219 85 11247 ----
NM_014363chr1311260 ----161
NM_014365chr121819 ------
NM_014372chr11412 ------
NM_014390chr71530 ------
NM_014392chr42363 156 1274 ----
NM_014393chr81206 ------
NM_014399chr73375 245 179 ------
NM_014417chr19--1883 ----
NM_014421chr42542 355 ------
NM_014447chr411685 ------
NM_014454chr62747 257 ----1831
NM_014456chr101422 ------
NM_014482chr21103 ------
NM_014491chr71939 ------
NM_014494chr1612165 ------
NM_014504chr71478 --1719 --
NM_014515chr121868 1789 ----
NM_014552chr221424 362 --1943 --
NM_014562chr2167 --1748 --
NM_014564chr92315 284 ------
NM_014572chr1331653 1644 334 ------
NM_014574chr1411243 ------
NM_014584chr141444 11604 11220 --
NM_014592chr5------1775
NM_014601chr1941500 1429 1329 28 ------
NM_014612chr911471 11074 21098 589 --
NM_014613chr512271 --1750 --
NM_014615chr1623523 419 11107 --13621
NM_014616chr333244 2696 296 ------
NM_014618chr91330 1278 ----
NM_014629chr841340 954 895 23 1290 ----
NM_014630chr1541462 740 363 307 ----12998
NM_014635chr211356 ------
NM_014636chr913912 1488 1770 14296
NM_014647chr1632254 1884 1845 --11925 --
NM_014655chr13723 164 27 ------
NM_014659chr151778 1882 ----
NM_014660chr711076 ----1348
NM_014665chr842772 603 280 65 ------
NM_014667chr31470 ----11963
NM_014670chr221222 156 --11132 --
NM_014671chr731145 1074 326 ------
NM_014676chr11233 ------
NM_014682chr821822 446 22323 367 --199
NM_014685chr161552 ------
NM_014686chr1952349 1897 1880 776 349 --11921 --
NM_014690chr742360 2106 1057 396 ------
NM_014701chr1523096 664 --12665 --
NM_014705chr742122 1404 596 167 --1585 --
NM_014706chr1231097 782 495 ------
NM_014707chr7----11572 --
NM_014709chr2154 ------
NM_014717chr19--1785 ----
NM_014718chr12----1696 --
NM_014720chr1031322 1186 479 --11289 --
NM_014721chr645963 1083 370 215 12677 17029 15078
NM_014729chr812201 --21525 262 --
NM_014730chr1223755 1000 ------
NM_014730chr1223755 1000 ------
NM_014732chr1634527 1281 829 --15827 --
NM_014740chr17142 ------
NM_014741chr1131723 767 380 ------
NM_014752chr112371 40 ------
NM_014755chr221648 606 --13746 --
NM_014772chr1842893 2456 2343 457 ------
NM_014774chr132978 2885 539 --12855 --
NM_014781chr81948 ------
NM_014784chr121083 723 ------
NM_014787chr112742 12670 11782 1826
NM_014790chr51348 ------
NM_014795chr2171 ------
NM_014800chr711168 ------
NM_014807chr11----1817 --
NM_014810chr11908 ------
NM_014812chr12643 323 ------
NM_014827chr111276 ----11207
NM_014828chr141840 ----1185
NM_014829chr51110 --158 --
NM_014830chr1211154 ----13810
NM_014835chr2032088 627 187 ------
NM_014839chr12978 241 ------
NM_014840chr1232983 556 86 --1822 --
NM_014850chr344749 4431 4246 1195 11015 14378 --
NM_014862chr1524106 562 128 21355 603 --
NM_014868chr121851 2371 80 ----
NM_014870chr124088 1142 14221 ----
NM_014872chr91742 12142 ----
NM_014873chr122954 480 14638 23660 1788 --
NM_014874chr131819 1521 184 ------
NM_014876chr2231857 514 57 ------
NM_014877chr1722426 138 --16578 --
NM_014883chr421567 506 --22468 444 --
NM_014900chr22998 404 ------
NM_014901chr532273 1447 545 ------
NM_014902chr2031405 1356 254 ------
NM_014903chr121815 ------
NM_014906chr1723353 2489 ------
NM_014912chr1053470 2872 886 693 635 ------
NM_014918chr151193 ------
NM_014920chr622518 588 13299 ----
NM_014921chr1912004 ----1899
NM_014923chr131441 11573 ----
NM_014932chr32566 474 --11802 --
NM_014934chr1333823 3678 969 1403 ----
NM_014937chr1011261 ------
NM_014938chr1242035 1948 916 806 12210 1213 --
NM_014939chr182299 46 ------
NM_014942chr61426 12200 ----
NM_014946chr222560 882 ------
NM_014947chr143108 2968 1917 327 13073 ----
NM_014962chr2012020 --12571 --
NM_014988chr41968 --11779 --
NM_014991chr432892 2391 841 ------
NM_014994chr1532026 713 268 ------
NM_014997chr752942 2232 1999 1156 713 ------
NM_015000chr1233024 2715 316 11157 ----
NM_015008chr333427 2641 2596 --13416 22631 1000
NM_015020chr1643233 3200 703 372 ----13793
NM_015024chr831446 1259 947 ------
NM_015025chr2--162 12640 --
NM_015026chr121772 13579 11184 --
NM_015027chr1631990 1349 597 --2430 210 --
NM_015032chr1332656 2606 1121 12172 ----
NM_015035chr2066244 5039 4928 2533 458 92 1661 ----
NM_015039chr11114 --23595 1613 --
NM_015040chr243173 2964 2382 2276 ------
NM_015042chr1523620 78 --23378 119 --
NM_015044chr1622199 440 --22759 55 --
NM_015045chr1031909 357 342 ------
NM_015046chr942648 2016 632 109 ------
NM_015049chr21334 12871 22440 2204 --
NM_015051chr9--22307 353 ----
NM_015068chr722469 1598 --23972 367 13924
NM_015071chr586206 5258 4530 2381 1894 1778 1370 1173 16324 12146 --
NM_015074chr154325 4167 3723 2002 406 ----14905
NM_015076chr623655 1803 1326 11181 --
NM_015092chr1621423 763 --22941 1883 --
NM_015093chr61453 ------
NM_015094chr2211715 11091 1586 14181
NM_015115chr423085 891 --3264 164 70 --
NM_015130chr411305 --1309 --
NM_015132chr711613 ------
NM_015137chr8----1790 12311
NM_015138chr1521029 348 1777 --1156
NM_015144chr1623360 2593 --183 --
NM_015153chr6------1243
NM_015155chr1022704 2398 ------
NM_015156chr1444016 3840 975 675 13777 ----
NM_015161chr16--164 11356 --
NM_015172chr121471 1367 1170 ----
NM_015178chr82346 33 ------
NM_015184chr32452 211 ------
NM_015192chr2032495 741 574 --1901 --
NM_015199chr312468 1626 ----
NM_015208chr1823016 1317 ------
NM_015209chr12423 253 --1750 --
NM_015215chr11440 13187 ----
NM_015221chr102486 30 1366 ----
NM_015236chr42336 108 ----1602
NM_015246chr1641992 1728 528 51 ------
NM_015247chr1665371 3983 3536 3355 1145 91 ------
NM_015252chr21810 ------
NM_015263chr151343 ------
NM_015265chr222165 2113 ------
NM_015267chr124452 415 378 129 ------
NM_015278chr612171 12190 13261 --
NM_015288chr573766 2387 1531 1066 648 354 275 --12663 --
NM_015294chr1731110 1102 345 11054 --155
NM_015296chr1321255 921 11212 ----
NM_015310chr837990 6109 2455 22443 1629 12513 --
NM_015314chr721042 659 --1382 --
NM_015315chr531223 1124 555 --11195 --
NM_015317chr21237 11153 11756 --
NM_015327chr121316 277 ------
NM_015328chr762801 2145 2004 708 579 112 --12834 12076
NM_015336chr12130 ------
NM_015344chr822079 171 ------
NM_015347chr1232706 2283 585 ------
NM_015349chr632274 974 576 --1186 --
NM_015355chr17--11234 ----
NM_015359chr821048 617 1164 12401 --
NM_015365chrX----1289 12715
NM_015375chr12501 120 15030 ----
NM_015385chr101610 --11008 13248
NM_015387chr21273 ------
NM_015396chr3------1482
NM_015429chr321027 156 ------
NM_015444chr3--189 --1427
NM_015447chr92623 262 ------
NM_015455chr522791 2699 --11230 --
NM_015458chr825218 4975 14994 --11626
NM_015459chr11----1217 --
NM_015460chr341839 1554 1547 1453 ------
NM_015461chr181218 ------
NM_015464chr7186 ------
NM_015470chr251109 1088 1038 872 46 ------
NM_015475chr231019 941 186 ------
NM_015477chr151358 ------
NM_015488chr221482 339 ------
NM_015497chr152855 734 ------
NM_015508chr321412 1114 ------
NM_015509chr1221185 548 11643 ----
NM_015527chr164833 610 273 106 ------
NM_015530chr23639 269 251 ------
NM_015541chr321305 497 --1336 --
NM_015549chr141583 ------
NM_015554chr15--2432 37 11971 --
NM_015559chr183810 733 360 1788 ----
NM_015564chr51420 ------
NM_015569chr134145 3759 3638 ------
NM_015570chr7----11735 --
NM_015575chr252942 2681 1391 1357 290 ----11009
NM_015576chr32987 337 ------
NM_015577chr52718 64 11780 ----
NM_015578chr1911565 ------
NM_015601chr102986 690 ------
NM_015610chr732244 352 69 ------
NM_015626chr17------1354
NM_015635chr92580 387 ------
NM_015640chr154835 4681 3938 504 284 13736 11956 --
NM_015676chr14----1101 --
NM_015691chrX1276 ------
NM_015695chr661982 1946 1698 820 412 192 ------
NM_015702chr2------125
NM_015726chr121792 1557 11735 ----
NM_015844chr181682 ------
NM_015846chr181682 ------
NM_015847chr181682 ------
NM_015850chr852056 1990 890 530 226 --22415 827 --
NM_015866chr121476 151 --11235 --
NM_015869chr31205 ------
NM_015885chr11145 ------
NM_015898chr1922398 1566 ------
NM_015902chr83284 146 94 --124 --
NM_015906chr174680 4590 3336 1091 1020 555 92 --11553 --
NM_015912chr832210 2133 356 11821 ----
NM_015915chr141237 ------
NM_015920chr151589 ------
NM_015981chr531984 297 92 12157 22475 30 1713
NM_015984chr11551 ------
NM_015999chr1164 ------
NM_016003chr732244 352 69 ------
NM_016009chr113364 13186 34826 4384 1022 --
NM_016018chr811144 --11130 --
NM_016019chr72987 329 --1870 --
NM_016032chrX1157 ------
NM_016040chr122514 889 11753 ----
NM_016048chr521000 727 ------
NM_016057chr122922 55 ----1323
NM_016061chr221410 221 --11664 --
NM_016076chr112500 12897 ----
NM_016083chr623099 1175 13008 23500 938 --
NM_016096chr81140 42170 2055 1353 737 ----
NM_016103chr5195 ------
NM_016121chr1--1906 ----
NM_016131chr241681 686 164 54 ------
NM_016132chr1531371 759 41 13081 13278 --
NM_016133chr2----11666 --
NM_016162chr122613 117 1287 ----
NM_016169chr1013241 ------
NM_016185chr173745 125 25 ------
NM_016195chr10----1119 --
NM_016201chr331777 1667 1471 --22286 595 --
NM_016205chr421200 558 ------
NM_016227chr111326 ------
NM_016230chr6--1362 ----
NM_016231chr171601 --11479 --
NM_016234chr102749 690 ------
NM_016243chr12592 26 ------
NM_016248chr1323669 3050 12569 12563 --
NM_016255chr61299 ------
NM_016257chr153298 2911 2757 2529 1009 ------
NM_016258chr11721 ------
NM_016260chr211653 16802 16144 15001
NM_016272chr221598 --1846 --
NM_016277chr611018 ------
NM_016289chr221851 106 --21612 45 --
NM_016300chr31117 ------
NM_016308chr112083 ----1533
NM_016322chr922351 1170 12029 1433 --
NM_016377chr63491 159 85 ------
NM_016395chr1511357 --11920 --
NM_016396chr1522130 1960 ------
NM_016436chr201493 --12117 --
NM_016441chr231833 677 436 12238 ----
NM_016451chr111205 ------
NM_016463chr5----1163 --
NM_016467chr231123 546 144 ------
NM_016470chr20--1399 ----
NM_016479chr32133 93 ------
NM_016485chr61918 1792 ----
NM_016507chr1721059 764 ------
NM_016513chr622518 588 13299 ----
NM_016525chr92386 338 ------
NM_016529chr131245 ------
NM_016530chr1521418 360 12692 ----
NM_016531chr423078 689 --13194 --
NM_016542chrX11516 ------
NM_016559chr31562 --1597 --
NM_016569chr12259 48 --21276 1084 --
NM_016570chr121314 1195 ----
NM_016575chr1254676 4118 1697 1514 475 ------
NM_016577chr363972 3918 3173 2886 1481 809 ------
NM_016578chr11------1192
NM_016603chr5----12212 --
NM_016605chr532459 1070 681 11953 ----
NM_016607chrX11653 ------
NM_016620chr111148 ------
NM_016621chr1133396 1414 405 --23371 1467 --
NM_016623chr8--126 ----
NM_016626chr1811418 ----11728
NM_016630chr15------1389
NM_016631chr211844 ------
NM_016651chr1411142 ------
NM_016834chr1762855 2663 1175 1165 717 637 ----14127
NM_016835chr1762855 2663 1175 1165 717 637 ----14127
NM_016836chr21752 1629 1527 1512
NM_016839chr21752 1629 1527 1512
NM_016841chr1762855 2663 1175 1165 717 637 ----14127
NM_016931chr11----1340 --
NM_016936chr1631703 1482 184 ------
NM_016937chrX1948 ------
NM_016946chr143006 1391 1150 998 11424 ----
NM_016953chr2--15293 15691 --
NM_017412chr8133 ------
NM_017420chr14--13759 ----
NM_017455chr151226 ------
NM_017481chr111189 ------
NM_017519chr6----2254 191 --
NM_017522chr121178 370 ------
NM_017544chrX----1222 --
NM_017545chr201120 ------
NM_017548chr31347 1496 ----
NM_017582chr151547 1223 582 291 233 164 11241 --
NM_017583chr1121705 634 --11482 --
NM_017593chr41178 ------
NM_017599chr122817 230 ------
NM_017602chrX2762 176 --1651 --
NM_017610chr152764 699 1508 ----
NM_017626chr1021517 1304 ------
NM_017629chr131878 1850 1671 ------
NM_017633chr643675 3096 3002 2593 ----1326
NM_017637chr988752 8015 6436 5760 2944 2620 2010 645 --19314 --
NM_017641chr12135 ------
NM_017649chr102877 414 1103 ----
NM_017650chr755115 4763 1725 1375 812 11878 ----
NM_017657chr21252 ------
NM_017658chr1424363 3400 --13254 11387
NM_017661chr152297 79 11272 ----
NM_017666chrX22184 1730 ------
NM_017672chr152961 120 ------
NM_017694chr211808 ------
NM_017699chr3147 ------
NM_017700chr41111 ------
NM_017709chr121180 677 1648 ----
NM_017724chr31227 1710 ----
NM_017736chr163219 117 57 11159 ----
NM_017737chr1--1704 1275 --
NM_017738chr91153 ------
NM_017742chr18----1299 --
NM_017752chrX41877 1775 1632 828 ------
NM_017753chr91376 ------
NM_017762chr1572353 2056 1943 957 904 626 454 1847 12227 --
NM_017780chr81917 ------
NM_017787chr1032865 1881 850 ----1414
NM_017793chr151222 ------
NM_017798chr202784 85 --2953 128 --
NM_017811chr922809 2687 ------
NM_017813chr834213 1787 1315 1870 15304 15754
NM_017816chr4157 ------
NM_017824chr101331 1949 --12675
NM_017831chr1811482 ------
NM_017848chrX11774 ------
NM_017880chr2128 ------
NM_017896chr2053419 1249 632 326 193 --13246 --
NM_017919chr975812 4130 3811 2012 736 163 55 13869 ----
NM_017934chr6185 ------
NM_017938chrX11966 ----11995
NM_017944chr1143129 2599 2110 664 --1911 --
NM_017955chr143931 472 99 ------
NM_017958chr222203 1160 ------
NM_017987chr102721 583 --2737 575 --
NM_017988chr12--1931 ----
NM_017994chr722925 2562 --32799 2610 784 --
NM_018004chr31388 ------
NM_018011chr131646 ------
NM_018030chr181381 --21061 283 --
NM_018036chr1434191 1563 240 14397 ----
NM_018048chr1211958 ------
NM_018064chr6------1239
NM_018070chr11506 ------
NM_018084chr212704 1468 ----
NM_018086chr21325 --21195 345 --
NM_018092chr1611262 ------
NM_018098chr31342 --1955 --
NM_018105chr81870 ------
NM_018117chr101755 ------
NM_018121chr1022940 717 11003 ----
NM_018144chr10----1266 --
NM_018150chr12867 828 ------
NM_018157chr12--13224 ----
NM_018181chr1821872 1402 --11713 --
NM_018195chr11------1697
NM_018201chr932506 460 155 ------
NM_018211chr1152 ------
NM_018214chr631231 140 43 ------
NM_018216chr11105 ------
NM_018227chr4----22247 2093 --
NM_018230chr11482 --1380 --
NM_018243chr433850 3529 149 --13815 --
NM_018246chr831898 1871 168 ------
NM_018247chr622016 327 11247 ----
NM_018254chr112219 22038 2020 ----
NM_018263chr222088 712 --12417 --
NM_018287chr101177 ------
NM_018293chr332498 2455 504 ------
NM_018307chr171985 ------
NM_018315chr421199 214 ------
NM_018323chr4177 ------
NM_018327chr2021390 650 ------
NM_018330chr1021070 107 11705 ----
NM_018339chr911646 ------
NM_018351chr1244307 3883 3810 1724 ------
NM_018361chr823267 1474 ------
NM_018362chr111516 --13050 --
NM_018364chr1----1368 --
NM_018374chr7----25128 1235 --
NM_018388chrX1487 ----1521
NM_018394chr341593 1490 1475 181 --11161 --
NM_018403chr323477 2743 --11595 --
NM_018416chr1222571 2346 ------
NM_018425chr1042649 2403 2219 601 ------
NM_018427chr16--1500 1357 --
NM_018440chr857628 5934 5630 2158 2041 12272 11822 16779
NM_018444chr811593 1861 1339 --
NM_018452chr6_random32855 2822 113 --12432 11234
NM_018462chr31636 ------
NM_018482chr82263 90 ------
NM_018489chr12798 764 ------
NM_018553chr1731290 662 630 ------
NM_018557chr231466 1147 160 125 ----
NM_018566chr1--15130 ----
NM_018569chr411106 --11253 --
NM_018571chr2150 ------
NM_018602chr1531569 1558 133 ------
NM_018650chr11842 ------
NM_018660chr852885 2323 2138 2034 1042 12491 ----
NM_018667chr1632610 2387 376 ------
NM_018682chr71177 1262 ----
NM_018689chr1532575 1081 925 ------
NM_018691chr511074 ------
NM_018695chr5--11909 --12449
NM_018700chr52304 169 ------
NM_018703chr162353 127 ------
NM_018704chr111582 --1801 --
NM_018710chr82324 185 11351 ----
NM_018715chr112081 12254 ----
NM_018890chr711048 ------
NM_018898chr5----11893 1173
NM_018899chr5----11893 1173
NM_018900chr5----11893 1173
NM_018901chr5----11893 1173
NM_018902chr5----11893 1173
NM_018903chr5----11893 1173
NM_018904chr5----11893 1173
NM_018905chr5----11893 1173
NM_018906chr5----11893 1173
NM_018907chr5----11893 1173
NM_018908chr5----11893 1173
NM_018909chr5----11893 1173
NM_018910chr5----11893 1173
NM_018911chr5----11893 1173
NM_018912chr531624 1291 609 1238 ----
NM_018913chr531624 1291 609 1238 ----
NM_018914chr531624 1291 609 1238 ----
NM_018915chr531624 1291 609 1238 ----
NM_018916chr531624 1291 609 1238 ----
NM_018917chr531624 1291 609 1238 ----
NM_018918chr531624 1291 609 1238 ----
NM_018919chr531624 1291 609 1238 ----
NM_018920chr531624 1291 609 1238 ----
NM_018921chr531624 1291 609 1238 ----
NM_018922chr531624 1291 609 1238 ----
NM_018923chr531624 1291 609 1238 ----
NM_018924chr531624 1291 609 1238 ----
NM_018925chr531624 1291 609 1238 ----
NM_018926chr531624 1291 609 1238 ----
NM_018927chr531624 1291 609 1238 ----
NM_018928chr531624 1291 609 1238 ----
NM_018929chr531624 1291 609 1238 ----
NM_018945chr622345 305 1712 ----
NM_018948chr12994 158 ------
NM_018951chr721237 470 --1298 --
NM_018953chr12----2791 743 --
NM_018959chr192586 153 ------
NM_018976chr1211955 ------
NM_018979chr121893 ------
NM_018999chr1034617 1561 1054 --14083 --
NM_019001chr364802 4480 4262 3796 563 158 ----13528
NM_019004chr742388 2120 813 223 1869 ----
NM_019006chr15--1705 1627 --
NM_019008chr2283718 3136 2654 2623 1302 1137 323 112 ------
NM_019009chr1182117 1953 1937 1777 910 738 278 72 --1490 1300
NM_019015chr7------198
NM_019046chr103724 257 41 ------
NM_019067chrX34733 674 169 ------
NM_019083chr11118 ------
NM_019084chr1012228 ------
NM_019091chr21851 2756 53 ----
NM_019096chr62343 119 --131 --
NM_019106chr2242856 2289 2263 633 --13454 --
NM_019114chr922025 433 1747 ----
NM_019116chr1673065 2915 2330 1350 1329 820 53 --21336 730 --
NM_019558chr2156 ------
NM_019590chr10------197
NM_019597chrX1678 ------
NM_019600chr15--1744 ----
NM_019605chr12493 125 ------
NM_019610chr1------11525
NM_019859chr1021515 68 ------
NM_019860chr1021563 116 ------
NM_019895chr31462 --1426 --
NM_020039chr1211611 1630 --11339
NM_020116chr4--11206 ----
NM_020122chr22960 312 138 --14638
NM_020123chr102612 477 ------
NM_020148chr1833036 160 130 --12912 --
NM_020151chr211213 2108 67 ----
NM_020156chr7----1528 --
NM_020159chr4----11188 --
NM_020182chr2033285 2920 2569 ----13325
NM_020193chr111145 ------
NM_020201chr171699 ------
NM_020205chr143368 3086 2602 711 ------
NM_020214chr151266 ------
NM_020238chr111359 ------
NM_020244chr12239 32 ------
NM_020245chr634297 1548 263 --12012 --
NM_020248chr172202 2036 1847 956 847 600 32 --12373 --
NM_020337chr431000 963 86 ------
NM_020342chr242563 2291 2129 985 ------
NM_020346chr11------1120
NM_020354chr10287 44 ------
NM_020403chr1321695 480 --11265 --
NM_020416chr431051 739 727 ------
NM_020420chrY31841 1427 124 ------
NM_020429chr742922 2198 730 288 --11991 --
NM_020432chr722169 352 ------
NM_020443chr136444 2320 2199 1163 ----
NM_020445chr73758 128 104 1526 ----
NM_020449chrX2679 80 ------
NM_020456chr132412 118 ------
NM_020465chr1611752 1563 11558 --
NM_020466chr623962 697 1771 ----
NM_020474chr181373 ------
NM_020482chr61241 ------
NM_020630chr102676 571 ------
NM_020640chr331933 1762 345 ------
NM_020644chr112113 71 ------
NM_020647chr8170 --32234 655 497 --
NM_020689chr2031451 608 114 ------
NM_020697chr821173 36 --3909 376 353 --
NM_020699chr123471 1041 11301 11424 --
NM_020713chr2042695 2218 906 663 ------
NM_020717chrX41695 1421 729 274 ------
NM_020718chr1666333 5442 5342 4431 1987 1693 --11566 12238
NM_020732chr6----2254 191 --
NM_020734chr12181 ------
NM_020739chr1534259 3785 3766 ----12688
NM_020747chr5--1880 --1167
NM_020748chr1731982 207 34 ------
NM_020755chr611320 ------
NM_020762chr121133 ------
NM_020766chrX14347 --24025 540 11391
NM_020770chr111237 ------
NM_020772chr1777140 6049 2817 2266 2235 951 356 --27255 6786 --
NM_020774chr1854159 1601 1561 1397 1354 ----16212
NM_020791chr1721316 1274 --11305 --
NM_020794chr121016 89 ------
NM_020796chr511858 --12334 --
NM_020801chr5------1651
NM_020804chr632574 1814 926 ------
NM_020808chr11815 --1110 --
NM_020809chr1142290 1957 900 666 ----12044
NM_020810chr141864 ------
NM_020839chr3----1524 --
NM_020841chr121753 11612 1782 --
NM_020854chr181571 1163 ----
NM_020859chr443050 2959 913 363 ------
NM_020861chr6----11071 --
NM_020866chr13137 ------
NM_020873chr31293 ------
NM_020918chr1032794 1045 584 --23394 594 --
NM_020927chr164815 696 418 109 193 ----
NM_020947chr1621908 530 ------
NM_020958chr141135 ------
NM_020964chr181291 --259 34 11892
NM_020977chr42818 651 1385 12060 --
NM_020987chr1031267 1063 281 ----1490
NM_020988chr1611133 1179 2827 52 --
NM_020993chr1222113 185 1302 ----
NM_021003chr141813 ------
NM_021007chr222155 406 ------
NM_021033chr131289 144 13121 11051
NM_021038chr3------23365 3029
NM_021045chr1062465 2401 1989 1666 981 891 --1804 --
NM_021069chr441884 626 427 164 ------
NM_021072chr521819 269 ------
NM_021096chr2253228 2991 2928 2116 1071 ------
NM_021101chr31867 11687 12149 --
NM_021111chr911267 ------
NM_021116chr7148302 6730 6589 5670 3624 3122 2889 2881 2724 2559 2327 1606 998 763 17635 16773 --
NM_021120chrX53111 3050 2671 983 439 12413 ----
NM_021131chr91929 --11451 --
NM_021132chr101972 ------
NM_021140chrX11185 ------
NM_021145chr72321 142 ------
NM_021148chr7--11747 ----
NM_021153chr181170 ------
NM_021168chr1621577 1479 ------
NM_021190chr11137 ------
NM_021215chr2042418 2137 1736 1641 1503 ----
NM_021249chr1431464 1439 186 ------
NM_021255chr1452728 1572 1175 860 88 ------
NM_021620chr6--1732 ----
NM_021622chr1032267 1978 35 1484 ----
NM_021637chrX1230 ------
NM_021643chr211766 11271 --11405
NM_021728chr14----1927 --
NM_021807chr711026 --1488 --
NM_021809chr2031651 379 199 --31957 1641 519 --
NM_021813chr643881 3699 1711 82 14512 14819 --
NM_021814chr621646 264 188 ----
NM_021825chr11121 ------
NM_021905chr62822 43 ------
NM_021911chr535039 390 123 14084 ----
NM_021912chr15----14057 --
NM_021913chr1921445 321 ------
NM_021925chr231455 1345 1161 ------
NM_021935chr31687 --2991 967 --
NM_021940chr631321 507 50 11222 ----
NM_021946chrX31267 221 198 ------
NM_021949chrX12607 22551 2491 ----
NM_021954chr132884 663 22744 751 1176 --
NM_021956chr6136 1976 11514 --
NM_021959chr61149 ------
NM_021960chr111735 ------
NM_021964chr345686 4735 2236 1905 185 ----
NM_021988chr2021320 347 --11338 --
NM_021999chr13--1543 ----
NM_022037chr21271 --1767 --
NM_022041chr1631713 1702 894 1362 ----
NM_022048chr1526396 228 ------
NM_022051chr12638 168 ------
NM_022072chr31246 ------
NM_022079chr102986 690 ------
NM_022114chr143661 1635 1623 1562 14719 ----
NM_022137chr1431762 1472 424 1340 1395 --
NM_022162chr1611100 11222 ----
NM_022166chr1645285 2414 1626 1078 15396 ----
NM_022170chr71460 ----1188
NM_022173chr21271 --1767 --
NM_022307chr7187 ------
NM_022442chr2021320 347 --11338 --
NM_022456chr1277459 6267 4983 2670 1165 936 166 ------
NM_022457chr11230 ------
NM_022459chr1345824 1551 185 56 14042 ----
NM_022463chr1711480 ------
NM_022465chr1222182 1077 ------
NM_022473chr1533669 759 187 ------
NM_022474chr1422320 2081 22049 1021 --12357
NM_022484chr7--177 ----
NM_022497chr332938 2547 411 ------
NM_022572chr221482 339 ------
NM_022574chr721714 294 --12009 --
NM_022650chr5----1351 --
NM_022652chr122840 24 1208 ----
NM_022658chr1211070 --11061 --
NM_022719chr2263483 2826 2365 1547 794 583 --1215 13787
NM_022726chr631786 1512 492 ------
NM_022735chr12343 139 11370 ----
NM_022737chr1921024 309 ------
NM_022739chr171903 ------
NM_022749chr821065 288 ------
NM_022753chr142650 988 160 90 --2899 76 12549
NM_022756chr121097 974 ------
NM_022771chr121254 ------
NM_022781chr943107 1296 636 291 --33060 855 620 --
NM_022784chr15138 ------
NM_022802chr101170 1539 ----
NM_022822chr11------1880
NM_022824chr51330 ------
NM_022826chr21173 ------
NM_022828chr511758 ------
NM_022831chr111676 ------
NM_022836chr1----3539 406 400 --
NM_022841chr151120 ------
NM_022893chr21413 --1430 12920
NM_022894chr21225 1175 ----
NM_022898chr1453968 3435 3331 2928 702 ------
NM_022910chr1611752 1563 11558 --
NM_022912chr273048 2745 2560 2114 1211 1107 248 12273 ----
NM_022918chr1141855 1831 1561 604 ------
NM_022965chr42623 232 --11193 --
NM_022977chrX11764 --11006 --
NM_023000chr14134 11453 ----
NM_023001chr14134 11453 ----
NM_023009chr12751 48 ------
NM_023012chr12----1548 --
NM_023037chr1321007 225 --1804 --
NM_023039chr5--1280 ----
NM_023071chr1211123 ------
NM_023076chr1622707 71 ------
NM_023105chr852056 1990 890 530 226 --22415 827 --
NM_023106chr852056 1990 890 530 226 --22415 827 --
NM_023110chr852056 1990 890 530 226 --22415 827 --
NM_023111chr852056 1990 890 530 226 --22415 827 --
NM_023929chr812539 --1120 --
NM_024007chr511932 ------
NM_024034chr202182 47 ------
NM_024050chr19--1185 ----
NM_024055chr51616 ------
NM_024069chr192703 98 ------
NM_024085chr22754 692 ------
NM_024090chr411843 1553 ----
NM_024293chr21160 --161 --
NM_024312chr121132 11611 ----
NM_024329chr111148 --11183 --
NM_024490chr15--1580 ----
NM_024520chr2----142 --
NM_024523chr71941 ----1966
NM_024524chr343118 2343 1036 28 12551 ----
NM_024539chrX11169 11216 ----
NM_024551chr12----11018 12569
NM_024551chr12----11018 12569
NM_024554chr131169 108 58 --31586 1459 172 --
NM_024563chr5----21737 1437 --
NM_024567chr82579 260 ------
NM_024569chr132381 987 892 --1328 --
NM_024612chr171278 --1417 --
NM_024617chr91767 ------
NM_024620chr191139 ------
NM_024625chr7124 --2633 480 --
NM_024630chr61554 ------
NM_024646chr113296 --13570 --
NM_024652chr1521204 129 ------
NM_024659chr21961 ------
NM_024665chr324545 232 ------
NM_024669chr52379 340 ------
NM_024698chr1131204 1131 477 ------
NM_024742chr1651643 1312 1215 425 82 ------
NM_024779chr121443 --1410 --
NM_024780chr161196 ------
NM_024811chr1141920 1784 1317 724 ------
NM_024828chr911512 ------
NM_024854chr1211496 ------
NM_024887chr12663 147 11630 ----
NM_024896chr942515 2463 2366 654 ------
NM_024900chr44872 866 820 812 11557 ----
NM_024900chr44872 866 820 812 11557 ----
NM_024909chr621366 320 ------
NM_024915chr842462 2231 1773 114 --11817 --
NM_024930chr522124 610 ------
NM_024944chr211183 ------
NM_024945chr941102 801 435 313 ------
NM_024953chr1232314 2304 2049 ------
NM_024991chr101610 --11008 13248
NM_024997chr1641043 946 353 236 ------
NM_025054chr81589 --1658 --
NM_025065chr1299 31 1594 ----
NM_025073chr144497 4179 3158 1058 --14231 --
NM_025074chr423013 2835 --11061 --
NM_025076chr21616 --2271 75 --
NM_025083chr1531558 704 30 ------
NM_025125chr1021622 425 ------
NM_025126chr122293 175 --1516 --
NM_025133chr21363 ------
NM_025134chr161709 ------
NM_025146chr341709 700 590 37 --12733 --
NM_025151chr81441 --12018 --
NM_025164chr1121683 153 ------
NM_025179chr1----23251 106 --
NM_025181chr2------1730
NM_025191chr11166 13387 ----
NM_025195chr821514 188 ------
NM_025202chr221026 83 ------
NM_025211chr9175 ------
NM_025222chr3--1143 ----
NM_025235chr102617 80 --1870 --
NM_030583chr81379 ------
NM_030594chr151139 ------
NM_030621chr1442977 1538 1182 1173 24032 1213 ----
NM_030625chr10159 --2725 81 --
NM_030627chr543509 3285 1641 247 ------
NM_030647chr736024 5593 1032 14573 14509 --
NM_030648chr42225 97 1419 ----
NM_030652chr6----1290 --
NM_030660chr1411275 ------
NM_030661chr721185 207 ------
NM_030664chr101414 --1655 --
NM_030667chr1221184 309 --1834 --
NM_030668chr1221184 309 --1834 --
NM_030669chr1221184 309 --1834 --
NM_030670chr1222216 874 --11866 --
NM_030671chr1222216 874 --11866 --
NM_030674chr1245420 1799 1286 908 ------
NM_030751chr10195 ------
NM_030751chr10195 ------
NM_030762chr1241610 1559 1378 1371 ------
NM_030780chr821401 528 ------
NM_030786chr12227 207 ------
NM_030790chr16--1224 ----
NM_030805chr22335 226 --11060 --
NM_030806chr187943 7131 7028 6987 6696 1558 582 224 ------
NM_030809chr12--12494 ----
NM_030881chr2252326 2122 844 691 568 ------
NM_030915chr232053 285 193 --11969 --
NM_030916chr11308 ------
NM_030939chr62234 194 ------
NM_030945chr5------199
NM_030948chr6130 ------
NM_030963chr6----1579 --
NM_030981chr1131045 365 235 ------
NM_031216chr18136 --129 --
NM_031243chr732418 1914 842 ------
NM_031244chr6----11137 --
NM_031262chr9----1121 --
NM_031263chr9----1178 --
NM_031267chr71185 ------
NM_031268chr16115097 4341 3682 3311 1726 1601 1479 1248 979 629 399 14887 21205 268 --
NM_031305chr42518 433 ------
NM_031372chr421460 672 ------
NM_031411chr5----11893 1173
NM_031412chr122939 182 ------
NM_031418chr1121823 536 1905 ----
NM_031431chr13----11848 --
NM_031439chr811393 --1265 --
NM_031442chrX12992 ------
NM_031452chr151173 ------
NM_031468chr756845 6234 3111 746 53 ------
NM_031476chr164982 760 610 530 ------
NM_031483chr2012415 ------
NM_031845chr2------13676
NM_031847chr2------13676
NM_031849chr5----11893 1173
NM_031850chr31829 ------
NM_031850chr31829 ------
NM_031857chr5----11893 1173
NM_031860chr5----11893 1173
NM_031890chr2212603 --12263 --
NM_031899chr3196 --1285 --
NM_031953chr41169 ------
NM_031989chr12136 ------
NM_031992chr71460 ----1188
NM_032012chr955213 3813 753 364 168 11201 14496 --
NM_032041chr822634 107 21758 422 22476 162 --
NM_032047chr311971 ------
NM_032049chr31829 ------
NM_032049chr31829 ------
NM_032052chr2241332 1070 441 397 ------
NM_032088chr531624 1291 609 1238 ----
NM_032092chr531624 1291 609 1238 ----
NM_032102chr1133094 2824 183 ------
NM_032116chr1325250 673 11597 ----
NM_032124chr181321 ------
NM_032144chr2----11412 1385
NM_032145chr621650 214 --11812 --
NM_032153chr332356 2342 2011 ------
NM_032160chr1822956 385 ------
NM_032186chr111148 ------
NM_032192chr171199 1741 ----
NM_032195chr21------1506
NM_032208chr243310 2320 826 363 ------
NM_032229chr132730 34 1811 ----
NM_032236chr111008 --1763 --
NM_032281chr1932563 2246 2094 ------
NM_032288chr322251 449 --21838 411 --
NM_032291chr111237 ------
NM_032295chr7----163 --
NM_032312chr23659 91 65 ------
NM_032403chr531624 1291 609 1238 ----
NM_032420chr51706 ------
NM_032435chr122185 88 12351 1164 --
NM_032438chr621399 1059 --11598 --
NM_032440chr1012110 --11842 1733
NM_032445chr15----1430 --
NM_032446chr5149 1952 23066 219 --
NM_032452chr142508 481 --1293 --
NM_032458chrX22730 652 11213 ----
NM_032466chr831582 1540 1397 ------
NM_032468chr831582 1540 1397 ------
NM_032472chr2138 ------
NM_032499chr153584 186 117 ------
NM_032510chr1852228 2135 2032 1975 1795 --1408 --
NM_032521chr202340 219 --1242 --
NM_032523chr22497 199 ------
NM_032549chr73357 105 25 --1413 --
NM_032552chr921282 28 ------
NM_032558chr921295 1168 ------
NM_032575chr16----11968 --
NM_032578chr1031433 1238 21 ------
NM_032594chr14--1830 ----
NM_032596chr91102 --1122 --
NM_032663chr1212053 --11720 --
NM_032682chr322602 2248 ------
NM_032689chr191568 ------
NM_032711chr1773187 2884 1302 1162 1154 1147 293 --1187 14266
NM_032727chr10----1326 --
NM_032731chr1711498 --11475 --
NM_032777chr821433 1370 ------
NM_032812chr10--1116 ----
NM_032813chr132997 947 --1335 --
NM_032859chr13--13671 11095 --
NM_032869chr811842 1697 ----
NM_032875chr17----2780 774 --
NM_032900chr1063162 2389 1510 1471 813 102 12781 ----
NM_032932chr1736005 5307 4908 --15356 --
NM_032936chr7----133 --
NM_032947chr5--1974 1124 --
NM_032971chrY2950 267 ------
NM_032972chrY2950 267 ------
NM_032975chr1833251 2268 376 --13520 --
NM_032980chr1833251 2268 376 --13520 --
NM_032982chr722503 535 --11596 --
NM_032983chr743317 1349 517 418 --12410 --
NM_032998chr11729 ------
NM_033016chr2211223 ----154
NM_033020chr174680 4590 3336 1091 1020 555 92 --11553 --
NM_033044chr111061 --11086 --
NM_033056chr10----1688 --
NM_033082chr12----1170 --
NM_033083chr3--12773 13389 --
NM_033089chr202522 442 ------
NM_033102chr141287 1272 889 106 ------
NM_033102chr141287 1272 889 106 ------
NM_033103chr19--1222 1865 --
NM_033105chr8192 ------
NM_033132chr1321867 1514 ------
NM_033138chr71237 ------
NM_033139chr71237 ------
NM_033140chr71237 ------
NM_033143chr434478 3837 840 ------
NM_033157chr71237 ------
NM_033161chr91598 21954 1639 ----
NM_033181chr623099 1175 13008 23500 938 --
NM_033182chr121531 50 ------
NM_033201chr1611048 ------
NM_033211chr52462 340 168 ----
NM_033224chr732211 892 827 12175 --12342
NM_033225chr832880 2586 328 12960 12052 --
NM_033285chr821467 165 ------
NM_033290chrX53274 3000 2798 2629 2398 12387 23770 617 --
NM_033326chr111389 ------
NM_033331chr92340 234 ------
NM_033345chr1150 ------
NM_033360chr1214586 ------
NM_033380chrX1102 1408 ----
NM_033381chrX1102 1408 ----
NM_033389chr1764357 4061 3691 3416 1626 1010 --1286 --
NM_033401chr16----2394 218 --
NM_033426chr1462691 2591 2152 1887 311 156 --153 --
NM_033449chr541941 1351 749 37 ------
NM_033495chrX1288 127 1941 --
NM_033496chr101177 1718 ----
NM_033497chr101177 1718 ----
NM_033498chr101177 1718 ----
NM_033500chr101177 1718 ----
NM_033503chr1543203 2724 831 311 ------
NM_033505chr286675 6428 5887 4747 4654 4605 1240 960 12076 ----
NM_033512chr83943 729 389 --22943 767 --
NM_033515chr621275 53 ------
NM_033516chr91316 ------
NM_033549chr511006 ------
NM_033551chr531223 1124 555 --11195 --
NM_033631chr112496 --23271 1396 --
NM_033632chr421199 214 ------
NM_033642chrX2420 53 ------
NM_044472chr1127 1530 1508 --
NM_052845chr1253166 3008 1294 1167 282 ------
NM_052855chr171619 ------
NM_052867chr1311144 --11229 --
NM_052879chr1253965 3235 3074 1400 296 --11094 --
NM_052885chr1223969 1051 14827 --13269
NM_052900chr81105 ------
NM_052905chr22386 373 ------
NM_052906chr221606 --14893 --
NM_052911chr182975 59 ------
NM_052917chr22999 82 1876 ----
NM_052918chr1033334 1220 155 ------
NM_052923chr6------1225
NM_052927chr51160 ------
NM_052934chr11633 1395 ----
NM_052940chr1----1223 --
NM_053002chr3----1982 --
NM_053016chr967843 7355 2317 1895 540 463 37984 7880 1013 1425 --
NM_053024chr311446 ------
NM_053025chr331801 1459 564 ------
NM_053026chr331801 1459 564 ------
NM_053027chr331801 1459 564 ------
NM_053028chr331801 1459 564 ------
NM_053031chr331801 1459 564 ------
NM_053032chr331801 1459 564 ------
NM_053046chr193370 175 145 ------
NM_053056chr1142943 2713 2037 766 --12206 --
NM_053064chr1422847 2542 ------
NM_053067chr91104 ------
NM_053280chr111193 ------
NM_054016chr11157 ----12021
NM_054016chr11157 ----12021
NM_054016chr11157 ----12021
NM_057161chr62143 38 ------
NM_057175chr421686 397 ------
NM_057749chr8192 ----11072
NM_058179chr92925 268 ------
NM_058191chr212862 823 ------
NM_058229chr81166 ------
NM_078471chr172465 381 ------
NM_080391chr1------1550
NM_080392chr1----140 1599
NM_080491chr1123529 670 --13886 --
NM_080546chr922170 1578 ------
NM_080594chr164643 518 185 170 ------
NM_080597chr181381 --21061 283 --
NM_080629chr1--1283 ----
NM_080630chr1--1283 ----
NM_080645chr632123 1698 1618 ----1661
NM_080683chr4--1169 ----
NM_080684chr4--1169 ----
NM_080685chr4--1169 ----
NM_080723chr61401 ------
NM_080732chr193370 175 145 ------
NM_080738chr131788 1714 619 ------
NM_080752chr201408 ------
NM_080759chr131264 ------
NM_080760chr131264 ------
NM_080867chr1413899 ----14513
NM_080872chr822573 815 13957 ----
NM_130391chr923574 882 ----1685
NM_130392chr923574 882 ----1685
NM_130393chr923574 882 ----1685
NM_130435chr1032877 772 618 --1757 --
NM_130436chr2112267 --12555 --
NM_130438chr2112844 --13132 --
NM_130439chr1011547 ------
NM_130439chr1011547 ------
NM_130440chr121353 105 11557 ----
NM_130442chr711168 ------
NM_130811chr2061041 883 425 319 285 33 --1922 --
NM_130838chr152725 565 ------
NM_130839chr152725 565 ------
NM_130847chr1145822 5790 5617 1405 ------
NM_133170chr2067889 7181 6921 2434 1512 42 12866 1183 15105
NM_133263chr51141 ------
NM_133264chr1723311 2898 ------
NM_133265chrX22306 426 ------
NM_133329chr2176 --1758 --
NM_133334chr486406 6273 6093 5201 4932 4740 2470 2033 15419 16052 --
NM_133372chr512271 ------
NM_133452chr1931208 928 879 ------
NM_133510chr14----1121 --
NM_133631chr32522 328 --1118 --
NM_133634chr2111511 --11678 --
NM_133638chr51490 1564 ----
NM_133646chr254913 3710 3635 1793 1617 ------
NM_134265chr17------1354
NM_134421chr2----144 --
NM_138270chrX32583 985 864 ------
NM_138288chr14----11970 --
NM_138316chr10156 --1441 --
NM_138357chr1011484 11279 ----
NM_138373chr1921725 1644 --1205 --
NM_138423chr1511700 138 ----
NM_138426chr7----1353 11792
NM_138444chr1311746 13437 ----
NM_138457chr633067 1053 697 ------
NM_138468chr224706 365 15837 ----
NM_138473chr1224905 1153 --1724 --
NM_138565chr112929 168 ------
NM_138576chr1453968 3435 3331 2928 702 ------
NM_138621chr263483 3210 3074 2966 2937 2614 24149 2845 ----
NM_138633chr63491 159 85 ------
NM_138635chr752696 2075 1227 285 43 1975 ----
NM_138711chr31205 ------
NM_138712chr31205 ------
NM_138713chr1647284 2285 1839 1057 15849 ----
NM_138714chr1647284 2285 1839 1057 15849 ----
NM_138729chr11100 ------
NM_138731chr141174 ------
NM_138771chr7174 1212 ----
NM_138782chr5--1721 --11678
NM_138799chr22649 282 1478 ----
NM_138927chr21--1871 ----
NM_138959chr185129 4715 1532 1171 1071 569 218 104 --25863 1841 11513
NM_138966chr181202 ------
NM_138970chr1431892 1603 780 1257 12162 --
NM_138971chr11--12590 ----
NM_138971chr11--12590 ----
NM_138972chr11--12590 ----
NM_138972chr11--12590 ----
NM_138973chr11--12590 ----
NM_138973chr11--12590 ----
NM_138994chr16----2394 218 --
NM_139012chr631646 1631 302 12260 ----
NM_139014chr631726 1711 382 12340 11453 --
NM_139015chr1251605 1363 1337 484 119 11152 11222 --
NM_139035chrX----1733 --
NM_139048chr321126 256 ------
NM_139056chr531132 1091 1073 ------
NM_139057chr1552696 2139 1784 780 737 1936 ----
NM_139062chr17172 --1101 --
NM_139071chr122598 111 ------
NM_139078chr121247 1118 ----
NM_139131chr111253 --1189 --
NM_139135chr11116 11024 11051 --
NM_139136chr121431 ------
NM_139156chr12713 73 --1835 --
NM_139157chr112476 86 1178 ----
NM_139276chr1722270 466 ----12379
NM_139312chr1031397 1135 27 ------
NM_139316chr711070 11031 ----
NM_139319chr1211862 ------
NM_139343chr22432 373 ------
NM_139344chr22432 373 ------
NM_139345chr22432 373 ------
NM_139346chr22432 373 ------
NM_139347chr22432 373 ------
NM_139348chr22432 373 ------
NM_139349chr22432 373 ------
NM_139350chr22432 373 ------
NM_139351chr22432 373 ------
NM_144498chr2032088 627 187 ------
NM_144571chr426385 1393 ----1132
NM_144578chr14180 14767 ----
NM_144582chr221869 1758 --21921 419 --
NM_144595chr131972 ------
NM_144657chrX1581 ------
NM_144703chr2031035 811 437 ------
NM_144728chr1127 ------
NM_144729chr1127 ------
NM_144767chr152978 62 14488 23395 2931 --
NM_144949chr22894 145 ------
NM_144963chr811840 ------
NM_144973chr1234754 3562 1464 ------
NM_145014chr111340 --1312 --
NM_145055chr1843583 3348 2892 911 1990 12574 --
NM_145109chr171210 --1976 --
NM_145112chr1411198 ------
NM_145113chr1411470 ------
NM_145117chr11----22972 256 --
NM_145203chr131887 1177 ----
NM_145206chr102636 391 13154 ----
NM_145259chr235280 2765 583 17151 14972 --
NM_145284chrX2203 35 --1617 --
NM_145307chr1022950 1266 --11758 --
NM_145331chr61132 ------
NM_145332chr61280 ------
NM_145333chr61280 ------
NM_145341chr101422 ------
NM_145349chr1751725 1637 1444 353 224 ------
NM_145686chr232522 382 237 --1826 --
NM_145687chr232522 382 237 --1826 --
NM_145690chr82620 68 ------
NM_145698chr101198 ------
NM_145716chr11506 ------
NM_145733chr22278 52 --11243 --
NM_145735chr1332061 900 494 --172 --
NM_145739chr22497 199 ------
NM_145805chr152546 469 ------
NM_145808chr732812 605 414 --1901 --
NM_145858chr21----1419 --
NM_145861chr131788 1714 619 ------
NM_145868chr101230 ------
NM_145869chr101230 ------
NM_145891chr1621521 228 11706 ----
NM_145892chr1621521 228 11706 ----
NM_145893chr1621643 350 11828 ----
NM_145912chr2221167 434 ------
NM_147150chr963437 3327 2944 1397 1154 312 ------
NM_147164chr9------1565
NM_147168chr91102 --1122 --
NM_147175chrX11436 --21998 269 --
NM_147189chr8----11431 --
NM_147223chr22350 40 ------
NM_147233chr21167 ------
NM_148177chr81166 ------
NM_148894chr41827 1112 ----
NM_148898chr71939 ------
NM_148899chr71939 ------
NM_148977chr10156 --1441 --
NM_148978chr10156 --1441 --
NM_152233chr1431464 1439 186 ------
NM_152253chr2243922 3661 1305 1038 --1521 --
NM_152261chr123741 642 114 ------
NM_152265chr11134 --11303 --
NM_152277chr532077 1701 776 ------
NM_152280chr122723 712 --12989 --
NM_152282chr31167 1912 --21035 926
NM_152308chr162843 220 --1814 --
NM_152309chr1022258 123 ------
NM_152317chr12----150 --
NM_152345chr171463 ----1235
NM_152414chr811202 ------
NM_152417chr821106 414 ------
NM_152423chrX21449 41 1491 ----
NM_152424chrX74719 4275 4166 3591 3550 1745 1313 24416 286 11492 --
NM_152437chr1212359 ------
NM_152447chr14--1111 ----
NM_152470chr1814161 ------
NM_152475chr193390 91 29 ------
NM_152538chr321815 140 ------
NM_152553chr61242 ------
NM_152557chr721332 122 ------
NM_152588chr121477 ----1161
NM_152594chr1532308 2133 2113 --12323 --
NM_152622chr512812 ----1430
NM_152624chr556670 5968 2917 2077 659 --12945 --
NM_152629chr923455 434 ------
NM_152641chr1232616 917 227 22358 817 22527 1025 --
NM_152716chr1121269 1056 11423 ----
NM_152721chr18--1759 ----
NM_152744chr712737 13094 1929 --
NM_152758chr82419 252 --12958 --
NM_152789chr711139 --1995 --
NM_152835chr121081 521 ------
NM_152838chr2023306 572 --143 2545 187
NM_152857chr6----1961 --
NM_152858chr6----1961 --
NM_152860chr1221444 377 ------
NM_152879chr242424 1012 629 299 12589 ----
NM_152890chr12968 48 ------
NM_152896chr91621 ------
NM_152988chr1961819 1740 1556 150 115 26 ------
NM_153013chr522360 682 --12057 --
NM_153020chr61364 ------
NM_153035chr142896 1987 125 59 12037 ----
NM_153181chr181202 ------
NM_153184chr3--21797 1483 ----
NM_153207chr121310 ------
NM_153223chr511450 ------
NM_153235chr611821 ------
NM_153261chr16------11293
NM_153262chr133217 3037 2599 ------
NM_153267chr9--1615 ----
NM_153273chr322010 471 --170 --
NM_153321chr17----1147 --
NM_153322chr17----1147 --
NM_153367chr1021035 187 13996 13766 --
NM_153374chr15----2398 375 --
NM_153437chr9181 ------
NM_153487chr644117 3662 2949 362 13202 14736 --
NM_153499chr1242781 2390 517 28 ------
NM_153500chr1242781 2390 517 28 ------
NM_153607chr512699 --22793 1123 --
NM_153619chr15127 12972 12726 --
NM_153631chr721185 207 ------
NM_153632chr721185 207 ------
NM_153634chr121629 ------
NM_153645chr2222062 39 ------
NM_153649chr132251 877 587 ------
NM_153690chr3----1799 --
NM_153715chr721237 470 --1298 --
NM_153746chr61554 ------
NM_153748chr121431 ------
NM_170606chr71725 ------
NM_170662chr3----1435 --
NM_170665chr1244095 2848 1433 983 ------
NM_170674chr1521351 1281 ------
NM_170675chr1521027 957 ------
NM_170676chr1521027 957 ------
NM_170677chr1521351 1281 ------
NM_170706chr11114 --23595 1613 --
NM_170711chr192762 329 ------
NM_170724chr611009 11123 ----
NM_170731chr1132084 942 502 12329 22600 252 --
NM_170732chr1132084 942 502 12329 22600 252 --
NM_170733chr1132084 942 502 12329 22600 252 --
NM_170734chr1132084 942 502 12329 22600 252 --
NM_170735chr1132084 942 502 12329 22600 252 --
NM_170768chr1111355 ------
NM_171825chr531984 297 92 12157 22475 30 1713
NM_171998chrX3490 198 177 ------
NM_172020chr741511 1287 615 517 ------
NM_172037chr821009 77 1430 11045 --
NM_172058chr821830 1650 --1127 --
NM_172059chr821830 1650 --1127 --
NM_172060chr821830 1650 --1127 --
NM_172070chr242261 668 581 98 ------
NM_172071chr157213 6852 4977 915 47 --14552 --
NM_172103chr62249 154 ------
NM_172105chr62249 154 ------
NM_172127chr43735 643 549 --1430 --
NM_172128chr43691 599 505 --1386 --
NM_172159chr331788 149 103 11764 --1243
NM_172160chr331788 149 103 11764 --1243
NM_172169chr1021717 600 1195 --1653
NM_172170chr1021717 600 1195 --1653
NM_172171chr1021717 600 1195 --1653
NM_172173chr1021717 600 1195 --1653
NM_172226chr1242781 2390 517 28 ------
NM_172238chr6138 ------
NM_172315chr1521351 1281 ------
NM_172316chr1521351 1281 ------
NM_172337chr14----1927 --
NM_172344chr2176 --1758 --
NM_172387chr1821744 1244 ------
NM_172388chr1821791 1291 ------
NM_172389chr1821791 1291 ------
NM_173075chr4195 --21680 1370 2472 210
NM_173083chr12914 168 ------
NM_173156chr131499 425 246 1783 11417 --
NM_173171chr2--1484 ----
NM_173173chr2--1484 ----
NM_173174chr81616 --168 --
NM_173175chr81616 --168 --
NM_173176chr81616 --168 --
NM_173198chr932491 1864 626 --12437 --
NM_173200chr932491 1864 626 --12437 --
NM_173214chr1647284 2285 1839 1057 15849 ----
NM_173354chr2121680 280 12040 11948 --
NM_173359chr3287 34 1386 1293 --
NM_173470chrX32431 1069 386 --12069 --
NM_173475chr1621177 478 1151 ----
NM_173491chr5150 21295 60 ----
NM_173500chr1511418 --11363 --
NM_173510chr2222894 2121 ------
NM_173511chr223941 747 ------
NM_173514chr52644 88 ------
NM_173576chr1022139 932 --11614 --
NM_173591chr123973 241 94 --1981 --
NM_173595chr1235263 4538 4038 15287 ----
NM_173602chr1223622 723 1407 ----
NM_173642chr1108562 8235 7810 6531 6329 6120 3325 725 288 242 --17572 --
NM_173653chr311262 ------
NM_173672chr6--12566 12507 --
NM_173698chrX21269 32 ------
NM_173794chrX--1182 ----
NM_173797chr5--11216 ----
NM_173808chr111489 --13904 --
NM_173814chr152406 63 ----1533
NM_173848chr81850 ------
NM_173851chr833163 2527 1218 ------
NM_174856chr202292 112 ------
NM_174909chr52714 131 ----1849
NM_174911chr831005 837 375 --11572 --
NM_175607chr331078 614 578 --126 --
NM_175610chr1511269 --11391 --
NM_175612chr331078 614 578 --126 --
NM_175613chr3----126 --
NM_175623chr1277459 6267 4983 2670 1165 936 166 ------
NM_175634chr8----1380 --
NM_175635chr8----1380 --
NM_175636chr8----1380 --
NM_175747chr62997 237 --1858 --
NM_175767chr51630 ------
NM_175768chr61240 11180 11718 --
NM_175848chr2011167 ------
NM_175848chr2011167 ------
NM_175849chr2011167 ------
NM_175849chr2011167 ------
NM_175850chr2011167 ------
NM_175850chr2011167 ------
NM_175854chr1332517 1072 864 ------
NM_175856chr51763 ------
NM_175863chr6----2254 191 --
NM_175876chr112755 1664 ----
NM_175902chr171308 ------
NM_175907chr1822865 2339 ------
NM_176812chr202226 146 --1704 --
NM_176814chr721373 145 ------
NM_177398chr11129 11881 ----
NM_177399chr11129 11881 ----
NM_177414chr1159 --11078 --
NM_177438chr1442977 1538 1182 1173 24032 1213 ----
NM_177559chr201801 --11177 --
NM_177560chr201801 --11177 --
NM_177947chrX11653 ------
NM_177948chrX11653 ------
NM_177952chr141813 ------
NM_177974chr1511700 138 ----
NM_177996chr2033319 2742 1241 13393 1699 --
NM_177999chr953672 3082 3022 2335 437 ------
NM_178000chr91929 --11451 --
NM_178001chr91929 --11451 --
NM_178003chr91929 --11451 --
NM_178011chr101524 ------
NM_178014chr62961 90 --1889 --
NM_178138chr92315 284 ------
NM_178148chr61444 162 ----
NM_178151chrX57741 7560 5490 1587 1104 --11644 --
NM_178152chrX57741 7560 5490 1587 1104 --11644 --
NM_178153chrX57741 7560 5490 1587 1104 --11644 --
NM_178314chr122813 220 ------
NM_178426chr141944 1612 839 583 ------
NM_178427chr141844 1512 739 483 ------
NM_178450chr51178 ------
NM_178496chr3152 ------
NM_178562chr71912 ------
NM_178568chr1721302 129 11136 ----
NM_178578chr201393 12594 ----
NM_178585chr432892 2391 841 ------
NM_178812chr821479 59 ------
NM_181054chr1411114 ------
NM_181093chr11445 ------
NM_181349chr742922 2198 730 288 --11991 --
NM_181354chr821504 1203 ------
NM_181356chr61140 --1839 --
NM_181358chr12719 412 ------
NM_181443chr2012020 --12571 --
NM_181453chr211356 ------
NM_181481chr1857052 7007 4645 4594 1311 35474 4993 1890 15295 --
NM_181482chr1857052 7007 4645 4594 1311 35474 4993 1890 15295 --
NM_181483chr1857052 7007 4645 4594 1311 35474 4993 1890 15295 --
NM_181504chr521180 785 --22712 461 --
NM_181505chr171199 1741 ----
NM_181507chr111263 ------
NM_181508chr111263 ------
NM_181523chr521180 785 --22712 461 --
NM_181524chr521180 785 --22712 461 --
NM_181552chr71386 ------
NM_181598chr141237 ------
NM_181642chr151462 1432 ----
NM_181645chr11--1212 ----
NM_181659chr2043413 2729 2595 212 ------
NM_181659chr2043413 2729 2595 212 ------
NM_181670chr121960 ------
NM_181672chrX1518 ------
NM_181673chrX1518 ------
NM_181704chr21146 ------
NM_181762chrX3909 379 117 ------
NM_181777chrX3909 379 117 ------
NM_181782chr612218 ------
NM_181839chr821287 477 11004 ----
NM_181844chr171191 ----11465
NM_181873chr1275 22 ------
NM_181876chr431051 739 727 ------
NM_182314chrX11596 1212 ----
NM_182484chr21146 ------
NM_182485chr433695 2720 601 ------
NM_182487chr944403 3556 1638 782 ------
NM_182503chr611272 --11894 --
NM_182511chr1811051 --1341 --
NM_182543chr10----145 --
NM_182557chr1121746 426 1621 ----
NM_182641chr171428 ------
NM_182643chr822001 477 ------
NM_182646chr433695 2720 601 ------
NM_182648chr14--2487 73 ----
NM_182678chr21414 ------
NM_182697chr741514 1422 638 464 11637 ----
NM_182700chr721660 738 ------
NM_182715chr72786 132 --11205 --
NM_182728chr1411220 --11350 --
NM_182757chr62636 553 ------
NM_182763chr111724 ------
NM_182765chr101537 ------
NM_182767chr1222089 738 ------
NM_182796chr51687 1296 ----
NM_182830chr141656 ------
NM_182898chr736405 6269 452 --11176 --
NM_182899chr736405 6269 452 --11176 --
NM_182918chr211535 ------
NM_182931chr71177 1262 ----
NM_182948chr1----12880 --
NM_182964chr11----22972 256 --
NM_182970chr2043859 3550 1309 567 1837 1762 --
NM_182972chr122094 423 --21014 895 --
NM_182978chr183703 235 103 ------
NM_183006chr2031405 1356 254 ------
NM_183043chr13164 ------
NM_183044chr13164 ------
NM_183061chr3136 ------
NM_183078chr683829 3789 3728 3638 2952 2656 2349 582 ------
NM_183227chr611018 ------
NM_183376chr1542322 956 673 175 ------
NM_183397chr2084648 3708 1386 1207 654 594 351 90 --13381 14574
NM_194247chr243634 1520 1185 804 --13965 --
NM_194271chr122293 175 --1516 --
NM_194281chr18191 ------
NM_194285chr1123365 2661 ------
NM_194291chr8161 ------
NM_194298chr101669 --1247 --
NM_194314chr113545 --35097 4891 4549 --
NM_194318chr1322456 72 --1625 --
NM_194328chr943107 1296 636 291 --33060 855 620 --
NM_194329chr943107 1296 636 291 --33060 855 620 --
NM_194330chr943107 1296 636 291 --33060 855 620 --
NM_194332chr943107 1296 636 291 --33060 855 620 --
NM_194434chr1865667 4782 4694 4595 634 22 --1367 11661
NM_194442chr111134 ------
NM_194454chr7--11136 ----
NM_194455chr7--11136 ----
NM_194456chr7--11136 ----
NM_194463chrX11169 11216 ----
NM_197941chr541988 968 868 631 ------
NM_197968chr131597 ------
NM_198077chr1----1495 --
NM_198123chr81105 ------
NM_198124chr81105 ------
NM_198158chr322965 699 ------
NM_198159chr322965 699 ------
NM_198177chr322965 699 ------
NM_198178chr322965 699 ------
NM_198181chr1542730 2683 507 417 ------
NM_198182chr221424 362 --1943 --
NM_198217chr133741 432 61 1789 ----
NM_198218chr133741 432 61 1789 ----
NM_198219chr133741 432 61 1789 ----
NM_198236chr121083 723 ------
NM_198243chr151819 --2608 100 --
NM_198261chr12----1548 --
NM_198262chr12----1548 --
NM_198264chr11158 1110 ----
NM_198268chr12719 412 ------
NM_198269chr12719 412 ------
NM_198270chrX43314 3136 3097 2866 ------
NM_198391chr2011405 --1348 --
NM_198404chr131629 ------
NM_198484chr335890 1401 559 ----12138
NM_198503chr1164 ------
NM_198507chr51354 --1139 --
NM_198513chr8--12005 ----
NM_198570chr71344 ------
NM_198581chr297395 7094 5173 2629 1902 1485 1262 732 57 ------
NM_198793chr324010 3240 1753 ----
NM_198794chr141490 ------
NM_198829chr711048 ------
NM_198844chr171977 --1267 --
NM_198859chr333557 1493 124 ----13702
NM_198896chr1122225 132 --11555 1536
NM_198902chr15171 ------
NM_198903chr5----1205 --
NM_198904chr5----1205 --
NM_198935chr2032498 768 214 12294 ----
NM_198956chr721660 738 ------
NM_198968chr1333823 3678 969 1403 ----
NM_198993chr1751715 1626 1276 340 294 ------
NM_198995chr181202 ------
NM_199003chr811154 ------
NM_199076chr102877 414 1103 ----
NM_199144chr2021320 347 --11338 --
NM_199169chr2033285 2920 2569 ----13325
NM_199170chr2033285 2920 2569 ----13325
NM_199171chr2033285 2920 2569 ----13325
NM_199188chr1253965 3235 3074 1400 296 --11094 --
NM_199190chr1253965 3235 3074 1400 296 --11094 --
NM_199203chr2021320 347 --11338 --
NM_199320chr431939 1840 1821 12948 ----
NM_199320chr431939 1840 1821 12948 ----
NM_199321chr171977 --1267 --
NM_199421chr1413899 ----14513
NM_199427chr202436 48 ------
NM_199436chr222560 882 ------
NM_199440chr21179 ------
NM_199454chr143661 1635 1623 1562 14719 ----
NM_199461chr1023629 796 ------
NM_199462chr12501 120 15030 ----
NM_199482chr21273 ------
NM_201269chr111148 ------
NM_201428chr1111477 ------
NM_201429chr1111477 ------
NM_201430chr1111403 ------
NM_201432chr17145546 5206 5008 4944 4632 4475 4354 2258 1325 1158 1082 297 256 248 ------
NM_201433chr17145546 5206 5008 4944 4632 4475 4354 2258 1325 1158 1082 297 256 248 ------
NM_201437chr811011 ------
NM_201521chr62366 132 ------
NM_201522chr62366 132 ------
NM_201523chr62366 132 ------
NM_201559chr633314 3142 1622 11321 --13984
NM_201568chr131499 425 246 1783 11417 --
NM_201569chr131499 425 246 1783 11417 --
NM_201570chr10--11657 1134 --
NM_201571chr10--11657 1134 --
NM_201572chr10--11657 1134 --
NM_201590chr10--11657 1134 --
NM_201591chr4--11318 ----
NM_201592chr4--11318 ----
NM_201593chr10--11657 1134 --
NM_201596chr10--11657 1134 --
NM_201597chr10--11657 1134 --
NM_201627chr51402 ------
NM_201628chr163176 2200 1089 650 478 74 ------
NM_201999chr41892 ----1828
NM_203301chr142268 94 ------
NM_203303chrX144 ------
NM_203318chr172465 381 ------
NM_203327chr2071300 873 854 510 233 148 58 13285 14159 --
NM_203350chr121434 432 ------
NM_203351chr1752257 1817 519 77 38 1748 12239 --
NM_203354chr14165 ------
NM_203355chr14165 ------
NM_203356chr14165 ------
NM_203365chr2140 ------
NM_203372chr211716 --1507 --
NM_203379chr102749 690 ------
NM_203380chr102749 690 ------
NM_203390chr821343 219 ------
NM_203391chrX21574 124 ------
NM_203404chr12713 73 --1835 --
NM_203406chr522546 1138 12358 ----
NM_203437chr21252 ------
NM_203446chr2123014 2734 --32891 2412 691 193
NM_203459chr132563 753 737 12569 12326 --
NM_203463chr233954 3108 1074 1202 --1374
NM_203464chr1168 --1318 --
NM_203487chr1321695 480 --11265 --
NM_203499chr171778 ------
NM_203504chr422400 927 --2961 600 12521
NM_203505chr422400 927 --2961 600 12521
NM_203506chr1712153 --21987 487 --
NM_205768chr122031 1665 --11550 --
NM_205842chr2--1682 ----
NM_205860chr132914 1085 840 11231 ----
NM_205861chr12663 147 11630 ----
NM_206594chr1--12253 ----
NM_206595chr1--12253 ----
NM_206839chr151205 1245 ----
NM_206853chr621482 686 ------
NM_206854chr631947 660 155 ------
NM_206855chr631625 1120 972 ------
NM_206860chr102403 62 ------
NM_206861chr102403 62 ------
NM_206862chr102403 62 ------
NM_206907chr523157 2098 ------
NM_206909chr837990 6109 2455 22443 1629 12513 --
NM_206943chr21264 ------
NM_207042chr1----1593 --
NM_207045chr1----1593 --
NM_207046chr1----1593 --
NM_207292chr3------23365 3029
NM_207293chr3------23365 3029
NM_207294chr3------23365 3029
NM_207295chr3------23365 3029
NM_207296chr3------23365 3029
NM_207297chr3------23390 3054
NM_207299chr91376 ------
NM_207306chr154067 3562 260 177 146 1165 13926 --
NM_207311chr12--11186 ----
NM_207317chr52344 292 ------
NM_207325chr1921556 520 ------
NM_207343chr111334 ------
NM_207366chr711585 ------
NM_207381chr1531241 281 28 ------
NM_207517chr1531518 1242 28 --1638 --
NM_207518chr1921374 334 ------
NM_207577chr1121105 237 12818 ----
NM_207645chr1111309 ------
NM_212471chr17--1413 21970 227 --
NM_212472chr17--1413 21970 227 --
NM_213618chr112476 86 1178 ----
NM_213662chr1722364 560 ----12473