TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4445-5p
miRNA Sequence: AGAUUGUUUCUUUUGCCGUGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX106872 6800 4980 4608 2732 2484 2271 839 612 157 25205 319 --26859 1974
NM_000092chr2114238 3695 3276 1583 1313 1203 761 635 589 514 352 13421 34283 3807 365 --
NM_000104chr243116 3097 2307 963 ----12254
NM_000112chr5125218 5035 4885 4559 4490 4480 1738 948 897 882 739 578 34503 1806 1603 22005 1277 --
NM_000115chr1352451 1749 1727 866 853 12667 --12149
NM_000126chr15------2200 82
NM_000138chr1562669 2479 2075 644 98 24 --22242 898 --
NM_000139chr1182802 2481 2205 2133 2033 1749 790 518 42120 2023 450 444 ----
NM_000176chr543911 3739 3108 2606 1288 43743 2542 831 528 --
NM_000202chrX93184 1103 755 737 661 654 601 457 247 12405 22509 140 13866
NM_000214chr2031531 602 215 ----2651 459
NM_000217chr1285338 3887 1073 923 896 884 509 301 14852 14103 1306
NM_000248chr382978 2952 2874 2775 2767 2451 2407 1124 12119 13043 11913
NM_000259chr1576288 6208 6065 5878 3981 712 28 34079 2289 1719 15078 --
NM_000314chr1072879 2235 2164 874 806 779 533 --1121 --
NM_000332chr6117207 7109 6612 5884 5581 5211 4404 4397 2724 2667 1354 --16079 11840
NM_000337chr596586 6036 5437 5157 5070 4482 4026 2190 1598 1730 26253 5417 12472
NM_000351chrX93410 2894 2852 1324 793 527 417 392 329 33095 1293 456 21009 797 11070
NM_000393chr282124 1843 1811 840 253 227 185 24 --12103 --
NM_000408chr263450 3156 2554 2319 558 89 23464 2547 --11187
NM_000448chr1173284 2380 1313 867 713 528 452 12047 22229 1208 --
NM_000461chr394450 4039 3832 3736 3688 3076 1863 1828 1356 34423 4115 257 ----
NM_000503chr891744 1737 1698 1522 1432 749 577 565 100 1712 ----
NM_000555chrX157353 6384 6241 6033 4968 2739 2507 2393 1292 1211 1193 1118 1083 740 336 15981 26188 2381 --
NM_000618chr12146372 5840 5087 4504 4433 2509 2184 1876 1789 969 874 679 471 238 14580 24376 2435 14269
NM_000618chr12146372 5840 5087 4504 4433 2509 2184 1876 1789 969 874 679 471 238 14580 24376 2435 14269
NM_000633chr1874413 4296 3903 3559 757 272 59 14511 1174 33551 3531 168
NM_000702chr142241 2080 2042 1935 42000 1566 786 482 --1198
NM_000719chr1296746 6483 5865 4605 2555 1434 1414 1406 981 14907 16529 --
NM_000793chr1495120 4722 4071 3102 2050 1090 968 870 349 23238 1704 ----
NM_000809chr4209305 8739 8634 8599 8570 8268 8063 7639 7010 2934 2772 2716 2706 2473 2461 2205 2031 978 611 601 --23130 3087 1810
NM_000813chr5155595 5142 4610 4506 4306 4111 4071 3663 2028 1827 1438 1398 1301 664 297 34269 4259 2140 --13891
NM_000814chr1543905 3533 1513 276 24065 1349 23695 2984 --
NM_000826chr452397 2091 2082 1900 1747 11994 --1633
NM_000829chr1181808 1475 902 665 652 624 498 220 --11799 --
NM_000838chr672774 1878 1722 1074 1034 342 270 --22766 807 --
NM_000866chr3141831 1806 1528 1492 1295 1194 738 681 622 326 227 207 149 71 11907 ----
NM_000875chr1587078 6739 6221 5720 5681 2691 362 29 --181 15497
NM_000899chr1284208 3962 3816 3753 3671 2698 1675 49 11089 33860 769 458 --
NM_000901chr482501 1901 1746 1600 999 681 471 116 22081 1812 ----
NM_000926chr11189200 9111 8850 8740 8510 7446 6735 6470 3581 3563 3457 2913 2789 2203 2160 1787 1516 1217 26668 5716 49348 8490 7636 7105 27467 1600
NM_000959chr1103731 3581 2832 1171 742 697 686 574 250 224 --23344 1149 11124
NM_000963chr1102283 2201 2111 1680 916 680 538 530 208 64 21852 1824 11898 --
NM_001001419chr584430 4267 3492 3247 3210 1696 804 463 --1297 --
NM_001001420chr584430 4267 3492 3247 3210 1696 804 463 --1297 --
NM_001001481chr893290 3212 2529 2512 2298 2213 2157 981 319 12384 ----
NM_001001484chr1052046 894 780 440 253 21946 525 22414 1840 --
NM_001001557chr842195 1801 447 430 ----12153
NM_001001664chr253308 3169 3099 2818 1086 1669 --22721 1125
NM_001001665chr262909 1249 1180 1015 1004 412 ----11059
NM_001001890chr2184313 4151 4137 3322 1573 1334 1165 346 24291 3079 13326 --
NM_001001928chr22107544 6865 6566 5537 2665 2277 600 440 430 123 47208 7011 6314 2256 ----
NM_001002257chr263129 2657 2454 2252 1075 168 --12785 1261
NM_001002860chr1484587 3930 3856 3630 3437 3100 1322 1096 22958 2942 --1222
NM_001003652chr18188431 6967 6759 6510 6267 6030 5954 5848 5260 5242 3382 3183 2491 1457 1390 913 899 292 1766 15270 1641
NM_001003674chr18136938 5670 5500 5451 5274 5249 4678 4459 4272 2504 1479 1288 214 46822 6204 4587 1470 16761 17088
NM_001003675chr18136938 5670 5500 5451 5274 5249 4678 4459 4272 2504 1479 1288 214 46822 6204 4587 1470 16761 17088
NM_001003712chr12123015 2922 2631 2597 2484 1606 1438 1379 1265 1156 472 285 --14032 --
NM_001003760chr663380 2719 2433 2276 998 172 11244 33424 3393 236 --
NM_001003800chr973775 3730 3597 3315 2659 2455 1059 ----23602 2876
NM_001004065chr9103856 3627 3598 3508 2984 919 651 626 601 355 22866 1514 1115 --
NM_001004330chr1251272 512 393 335 170 ----11518
NM_001004346chr451280 1172 1060 792 270 1310 2231 207 --
NM_001004419chr1294142 3900 3802 3459 2825 1839 1793 1488 478 1365 11449 --
NM_001004441chr561656 1226 1066 375 360 173 --21397 249 --
NM_001005404chr1794415 3353 3274 3169 3150 3121 1449 954 486 24041 742 ----
NM_001005473chr5206560 6243 6178 6150 5398 5279 5069 4804 4312 4154 4077 2143 2105 1878 1680 1450 1231 765 754 618 55594 1615 593 519 165 21541 420 34745 1821 1649
NM_001005502chr12104914 4516 3236 3193 2025 1908 995 358 161 114 13372 ----
NM_001005743chr1421330 1241 31288 1034 847 1363 1826
NM_001005744chr1421330 1241 31288 1034 847 1363 1826
NM_001005745chr1421330 1241 31288 1034 847 1363 1826
NM_001006600chr592478 2207 1795 1518 878 684 639 560 139 ----1240
NM_001007023chr1495120 4722 4071 3102 2050 1090 968 870 349 23238 1704 ----
NM_001007097chr965054 5008 4803 4507 4179 665 35017 1560 1413 23590 3420 --
NM_001008239chr1873872 3749 2947 2625 1238 673 311 12996 --13327
NM_001008495chr8102214 2071 2045 1970 1797 1554 839 788 454 135 --11785 --
NM_001008801chr1951824 1561 1522 535 37 11837 1752 1477
NM_001008925chr4113007 2543 2487 2444 1024 1017 898 852 651 179 81 12507 12796 --
NM_001009894chr1241565 1484 1406 1113 11712 1283 11299
NM_001009899chr386493 5921 5649 4886 4631 1718 833 594 3698 421 114 --1539
NM_001009909chr11123806 3752 3665 3642 3437 1043 1000 556 545 229 178 110 2654 207 23914 3240 1530
NM_001009959chr2132605 2495 1987 1755 1674 961 892 879 832 618 515 312 140 ------
NM_001010000chr1853334 3290 2921 2593 338 22167 886 32850 1359 468 --
NM_001010853chr653251 2361 2265 2033 570 1999 11160 23213 2383
NM_001010888chrX114629 4367 3378 1762 1400 1242 1062 962 84 68 52 --12940 --
NM_001010891chr596775 6543 6125 5944 5143 4504 1878 326 34 --36761 5769 1603 11050
NM_001010984chr182559 2338 2205 1858 726 360 345 24 --1984 --
NM_001011513chr4114108 3775 3365 3157 2841 2810 1536 1088 869 331 106 14095 23713 317 --
NM_001011537chr362111 1763 1553 480 185 169 ----1242
NM_001011666chr7206481 6173 5766 5617 5280 5160 4661 4631 4625 4521 4301 4105 2324 2239 1902 1709 1271 1067 710 547 15245 22091 1799 1869
NM_001012393chr1175082 4904 4710 3329 3188 1121 470 24927 224 21093 899 --
NM_001012418chr663322 1621 986 966 816 569 --13117 24246 827
NM_001012420chr1552682 2113 1977 1961 78 11837 --22659 2511
NM_001012423chr1552682 2113 1977 1961 78 11837 --12511
NM_001012755chrX134940 4694 4637 4298 4178 4120 3985 3718 3602 3544 1861 1852 1805 --13359 --
NM_001012968chrX82828 2520 2332 1986 1785 267 215 159 --12581 --
NM_001013620chr12168291 7612 6702 6163 5781 5305 2504 1727 1425 1227 812 704 626 449 214 40 37404 1701 425 2979 800 16763
NM_001014380chr1374950 3629 1928 1445 861 471 166 13860 --14707
NM_001014797chr10146357 5798 5431 5344 3056 2883 2596 2566 2366 1724 1456 1272 836 451 37853 1186 548 42832 2009 1262 583 --
NM_001017395chr363161 2740 977 648 305 133 13233 32282 283 262 --
NM_001017440chr7128216 7666 7044 6967 6773 5905 5806 5666 5024 3292 1116 782 1378 17194 --
NM_001018065chr994348 4193 4184 4038 1768 1663 1447 1299 456 --21712 1359 14946
NM_001018066chr994348 4193 4184 4038 1768 1663 1447 1299 456 --21712 1359 14946
NM_001018067chr175249 4446 4067 1977 1388 1279 329 24339 1005 13990 --
NM_001018068chr175249 4446 4067 1977 1388 1279 329 24339 1005 13990 --
NM_001018069chr175249 4446 4067 1977 1388 1279 329 24339 1005 13990 --
NM_001018074chr543911 3739 3108 2606 1288 43743 2542 831 528 --
NM_001018075chr543911 3739 3108 2606 1288 43743 2542 831 528 --
NM_001018076chr543911 3739 3108 2606 1288 43743 2542 831 528 --
NM_001018077chr543911 3739 3108 2606 1288 43743 2542 831 528 --
NM_001018089chr1553548 2525 303 46 37 11163 --180
NM_001024094chr543911 3739 3108 2606 1288 43743 2542 831 528 --
NM_001024647chr12107544 7443 7194 6291 5695 5489 3039 2575 1789 1538 35916 5014 2501 16200 --
NM_001024956chr1165141 4848 4553 909 384 80 193 24894 289 12173
NM_001025076chr10115488 4375 4066 2076 1915 1871 1395 699 470 416 410 --21779 1607 35825 3869 2482
NM_001025077chr10116846 5733 5424 4887 2753 2057 1828 1774 1768 894 781 --12965 37183 5227 4607
NM_001025079chr3104094 3897 3751 3391 3302 1555 645 517 284 200 ------
NM_001025108chr2113997 3649 3627 3505 3209 3093 1552 1474 560 247 132 1340 23533 2820 --
NM_001029858chr683039 2904 2866 2236 1254 1106 812 791 12425 ----
NM_001030055chr1464356 4321 3687 3004 1375 1046 1266 24406 2944 --
NM_001031679chr1273472 3345 3260 3022 973 961 936 ------
NM_001031700chr4102501 2440 2330 1556 1533 882 850 755 684 94 --22216 412 --
NM_001031732chr483064 1347 1239 1227 984 833 566 414 12425 43540 2626 2406 245 --
NM_001031804chr1653057 1592 1497 1126 920 1784 --14015
NM_001032395chr652607 2076 1050 412 322 1907 --11043
NM_001033045chr2113913 3083 3033 2987 2693 1676 1647 1631 933 799 655 1959 1812 14275
NM_001033047chr462327 2310 1946 1831 179 167 1604 --12653
NM_001033578chr822140 755 --2553 231 1350
NM_001037164chr731633 1472 587 --11701 2398 134
NM_001037165chr758377 8357 8075 7766 946 18497 --18080
NM_001037174chr221546 532 1912 --11923
NM_001037334chr1862417 1677 836 742 590 65 21764 530 22377 1907 21934 679
NM_001039199chr2065042 5012 4486 3799 1911 414 14576 --1334
NM_001039538chr232483 141 27 1237 1110 13127
NM_001039547chr3108021 7725 6972 5370 2573 1935 1281 1144 203 86 --28059 5142 --
NM_001039585chr1103988 3838 3089 1428 999 954 943 831 507 481 12655 23601 1406 11381
NM_001039590chrX63657 1248 1130 804 514 53 ----13805
NM_001039591chrX63657 1248 1130 804 514 53 ----13805
NM_001039618chr1175547 5299 3845 2279 2111 1143 788 --34581 824 268 --
NM_001039762chr1062066 1820 868 817 510 394 --1540 --
NM_001039840chrX125841 5663 5528 5265 5166 5104 4624 4386 2396 1587 927 863 21294 979 44628 3812 3742 641 22134 1518
NM_001039937chr1323413 682 --43245 3006 2870 1189 1551
NM_001040152chr784887 4699 3597 3157 1421 745 226 31 14627 1828 --
NM_001040202chr452434 1651 724 261 40 1236 1997 32471 492 466
NM_001040284chr16105940 5338 4746 2345 2047 1992 1868 1712 556 372 11969 21757 625 12034
NM_001040402chr453022 2819 2285 552 341 12203 12313 12483
NM_001040441chr1165454 4989 4911 4791 4783 3848 3614 3480 3341 2198 1436 937 804 737 384 265 14215 11262 1243
NM_001040665chr795044 4717 3962 3924 1993 1791 555 364 305 43420 1714 1572 280 1329 --
NM_001040712chr953375 3054 2571 2538 206 13460 1190 22576 818
NM_001040876chr451885 1754 1418 1306 1256 1756 ----
NM_001042355chr1694297 2103 2080 1878 874 835 535 433 306 ------
NM_001042357chr1091511 1428 1359 1341 1334 1183 261 209 104 11118 21531 1432 1416
NM_001042358chr1091511 1428 1359 1341 1334 1183 261 209 104 11118 21531 1432 1416
NM_001042360chr1091511 1428 1359 1341 1334 1183 261 209 104 11118 21531 1432 1416
NM_001042361chr1091542 1459 1390 1372 1365 1214 292 240 135 11149 21562 1463 1447
NM_001042363chr1091511 1428 1359 1341 1334 1183 261 209 104 11118 21531 1432 1416
NM_001042364chr1091542 1459 1390 1372 1365 1214 292 240 135 11149 21562 1463 1447
NM_001042365chr1091542 1459 1390 1372 1365 1214 292 240 135 11149 21562 1463 1447
NM_001042387chr1091542 1459 1390 1372 1365 1214 292 240 135 11149 21562 1463 1447
NM_001042389chr1091511 1428 1359 1341 1334 1183 261 209 104 11118 21531 1432 1416
NM_001042390chr1091511 1428 1359 1341 1334 1183 261 209 104 11118 21531 1432 1416
NM_001042392chr1091511 1428 1359 1341 1334 1183 261 209 104 11118 21531 1432 1416
NM_001042393chr1091542 1459 1390 1372 1365 1214 292 240 135 11149 21562 1463 1447
NM_001042395chr1091511 1428 1359 1341 1334 1183 261 209 104 11118 21531 1432 1416
NM_001042396chr1091542 1459 1390 1372 1365 1214 292 240 135 11149 21562 1463 1447
NM_001042397chr1091542 1459 1390 1372 1365 1214 292 240 135 11149 21562 1463 1447
NM_001042404chr12449 106 --11395 21741 531
NM_001042412chr1694297 2103 2080 1878 874 835 535 433 306 ------
NM_001042440chr551854 1832 1305 578 426 22044 679 21886 99 --
NM_001042441chr551854 1832 1305 578 426 22044 679 21886 99 --
NM_001042442chr551854 1832 1305 578 426 22044 679 21886 99 --
NM_001042443chr551854 1832 1305 578 426 22044 679 21886 99 --
NM_001042444chr551854 1832 1305 578 426 22044 679 21886 99 --
NM_001042445chr551854 1832 1305 578 426 22044 679 21886 99 --
NM_001042446chr551854 1832 1305 578 426 22044 679 21886 99 --
NM_001042453chrX31784 1662 71 31547 1534 330 --11461
NM_001042473chr1041652 1522 548 173 --11596 2866 213
NM_001042510chr841896 1463 248 168 11861 --1749
NM_001042511chr841896 1463 248 168 11861 --1749
NM_001042533chr373332 3280 2324 1241 1180 490 267 ----1372
NM_001042550chr981693 1597 1545 1455 1367 812 660 606 1135 ----
NM_001042555chr1273888 3133 3081 1708 1689 762 364 14458 12950 --
NM_001042599chr2107659 6870 5666 5169 3141 2507 2234 1714 1146 805 25388 2139 27804 2867 12099
NM_001042604chr394024 3504 3245 1262 702 406 371 272 103 23581 980 --1641
NM_001042749chrX42002 576 418 377 11541 2314 195 --
NM_001042750chrX42002 576 418 377 11541 2314 195 --
NM_001042751chrX42002 576 418 377 11541 2314 195 --
NM_001043351chr152281 2191 1905 349 340 --1363 --
NM_001044385chr2143975 3375 3261 2970 2812 2629 1327 1282 1123 618 486 273 221 26 ----13679
NM_001046chr582867 2753 2665 2450 2212 991 914 272 --12547 --
NM_001048183chr163750 3277 2997 2653 566 560 13665 33248 3037 660 --
NM_001083620chr452395 2089 2080 1898 1746 11992 --1632
NM_001099678chr3135613 4727 4592 4176 4008 2535 2439 2162 1998 1344 1163 911 675 12552 16376 26065 6051
NM_001100108chr188271 8124 7604 7487 7353 7268 2873 1738 --12506 15346
NM_001106chr3119800 9740 8804 8562 8250 8205 7380 6864 2407 1755 1647 ------
NM_001117chr1832533 482 150 1369 --21678 76
NM_001126chr11278 1970 1699 1384
NM_001146chr8102082 1707 1611 919 874 654 491 411 113 93 1728 ----
NM_001148chr452203 1751 1574 685 657 --11477 --
NM_001167chrX96716 5984 5570 5185 5125 5081 4593 2192 156 14954 15532 26604 4618
NM_001173chr1464356 4321 3687 3004 1375 1046 1266 24406 2944 --
NM_001177chr1241712 884 839 461 --1943 163
NM_001186chr21103125 2780 2748 2708 2175 448 397 332 259 92 --12044 --
NM_001198chr672092 762 561 397 379 357 83 22282 1676 12008 --
NM_001201chr463758 3097 3089 2799 719 346 43658 3290 2781 2679 1395 1451
NM_001204chr2127804 7474 7103 6993 6725 6386 4951 2433 1739 1541 1484 320 1336 ----
NM_001206chr963162 2340 2247 1136 880 663 12894 --12579
NM_001241chr282200 1980 1723 1657 649 541 346 104 ------
NM_001241chr282200 1980 1723 1657 649 541 346 104 ------
NM_001259chr7106172 4925 4219 3974 1835 1775 1759 1626 1343 500 --25226 4613 --
NM_001289chrX91480 1199 1135 667 445 391 345 257 230 21648 1124 1158 --
NM_001356chrX72490 2313 2282 2222 931 749 477 12261 --1179
NM_001364chr1164264 3227 1491 1191 1158 703 21882 1407 --11481
NM_001390chr1853636 2928 548 515 453 1574 1715 13439
NM_001396chr2182638 2630 2434 2238 2033 1765 912 675 1885 12815 1771
NM_001412chrX83785 3249 3019 864 709 434 164 51 ------
NM_001427chr732009 51 43 ----11439
NM_001432chr493526 2784 2734 2560 961 480 305 74 35 21572 811 1705 --
NM_001438chr183665 3423 3123 2852 2515 1344 1115 980 --13389 23484 972
NM_001483chr7--3995 386 156 1979 1773
NM_001527chr6104688 4609 4555 3974 3913 2960 1933 1579 600 589 --14519 --
NM_001609chr1063549 3115 1142 1080 898 888 13258 11785 22947 1023
NM_001621chr7133087 3059 2688 2638 2269 1967 1153 1104 898 876 751 736 511 32601 206 129 ----
NM_001621chr7133087 3059 2688 2638 2269 1967 1153 1104 898 876 751 736 511 32601 206 129 ----
NM_001627chr382033 1506 964 690 454 415 199 102 12055 ----
NM_001650chr1884068 3386 2680 1313 1104 861 417 140 1442 33316 1231 488 13897
NM_001709chr1192746 2452 2079 1123 998 489 291 151 98 12497 --1191
NM_001750chr551854 1832 1305 578 426 22044 679 21886 99 --
NM_001754chr2184313 4151 4137 3322 1573 1334 1165 346 24291 3079 13326 --
NM_001759chr12115325 5249 4576 4431 4309 4182 1487 445 241 179 41 --21633 504 --
NM_001777chr3104094 3897 3751 3391 3302 1555 645 517 284 200 ------
NM_001854chr171388 1268 1262 982 949 563 361 --11063 --
NM_001858chr6125166 4482 4457 3990 3821 3744 3468 3246 1827 579 225 166 13940 23419 1246 21399 697
NM_001874chr12104914 4516 3236 3193 2025 1908 995 358 161 114 13372 ----
NM_001918chr1169321 8301 8033 7902 7614 7469 7003 6629 6107 2958 2778 2175 1452 455 177 86 16798 12324 17647
NM_001931chr1111282 ----1202
NM_001966chr321235 558 11514 --1121
NM_001969chr1493824 3574 3215 2980 2812 2402 910 628 28 13696 ----
NM_002006chr4124897 4753 4608 4482 4401 4276 2145 1852 1532 1286 862 245 34780 532 351 2499 121 --
NM_002009chr1582188 1733 861 818 712 516 384 277 31991 454 261 --22820 881
NM_002017chr1161387 1195 1156 885 439 196 ----11208
NM_002025chrX147997 7768 6562 5869 5851 5639 3622 2430 2178 1919 1611 807 582 277 11193 25855 3118 --
NM_002033chr1194158 3855 3842 1611 1555 1485 1055 206 138 21266 970 22858 1525 --
NM_002040chr2143145 2155 1038 111 --1359 23096 261
NM_002126chr1784012 3827 3519 2995 1483 1060 728 573 23621 3443 24016 732 --
NM_002137chr742188 2116 505 94 ----12089
NM_002158chr273093 2690 1400 1304 917 624 448 22456 1469 21239 161 --
NM_002210chr263190 3065 2941 2508 1143 227 1733 --22546 412
NM_002214chr7115661 4987 4757 3959 1829 1712 1512 753 462 345 46 11735 35048 1969 423 14597
NM_002223chr1283891 3095 2976 2721 1587 1430 778 87 12629 1155 --
NM_002270chr5145305 5270 5183 5172 4732 4473 4457 4311 1774 1336 654 605 312 135 --23464 392 13450
NM_002285chr2113997 3649 3627 3505 3209 3093 1552 1474 560 247 132 1340 23533 2820 --
NM_002290chr661403 1305 1232 1069 450 78 --1209 --
NM_002310chr5126174 5399 5384 5295 4851 4386 4103 1518 1219 1141 922 621 1681 26583 6483 --
NM_002336chr12125089 3219 1934 1830 1530 1464 1288 1243 1194 991 561 327 ------
NM_002351chrX71568 1305 1169 1145 1119 1093 1087 --21648 316 --
NM_002356chr632191 1901 25 12896 11926 22842 636
NM_002374chr232483 141 27 1237 1110 13127
NM_002387chr554734 4187 3146 609 132 14504 23610 663 13471
NM_002449chr521315 1227 ----1983
NM_002451chr9133874 3763 3575 3484 3116 2894 2512 1069 571 564 549 484 297 11062 22977 581 --
NM_002515chr1481757 1565 632 623 512 469 154 137 ----1779
NM_002545chr1175082 4904 4710 3329 3188 1121 470 24927 224 21093 899 --
NM_002577chr384044 3842 3279 3156 2800 2587 1420 1021 12985 1719 --
NM_002581chr985616 5473 5305 3984 3464 1325 1139 554 34877 3831 72 55280 2136 924 876 587 14847
NM_002645chr1172953 2590 2195 680 613 490 36 12553 --1181
NM_002655chr8135235 4022 3550 3502 1874 1513 1476 914 878 772 390 347 88 --21449 1188 25124 471
NM_002709chr263376 3281 2433 1243 418 266 11191 13420 12628
NM_002710chr125924 835 809 776 304 1336 1237 --
NM_002715chr54878 425 330 71 ----1394
NM_002731chr1113001 2856 2635 2473 2362 2085 2070 1215 1021 448 308 ------
NM_002737chr17105456 5231 5186 4740 4514 4344 1348 1332 1301 310 24598 4390 ----
NM_002745chr2284493 3714 3405 3164 1573 1512 1362 1034 11721 33306 3250 1096 --
NM_002837chr12124484 4196 4075 3602 3496 3467 3108 1699 1531 1081 1063 353 31643 934 517 14280 --
NM_002839chr953375 3054 2571 2538 206 13460 1190 22576 818
NM_002843chr1142783 2713 1068 615 --1314 22471 1243
NM_002858chr14897 217 142 38 11152 11064 11264
NM_002886chr385213 5107 5041 4986 4962 3836 1751 1171 23319 3202 24376 3450 --
NM_002940chr451885 1754 1418 1306 1256 1756 ----
NM_002941chr321108 436 1100 21543 564 11627
NM_002977chr263460 2550 2526 2393 2242 1075 ----13289
NM_003016chr1721564 196 --1684 1438
NM_003034chr12137734 7707 7398 5954 5681 5560 2899 2748 1774 1739 658 400 127 36839 5524 5384 ----
NM_003068chr861027 826 724 372 199 106 --11001 --
NM_003071chr3101684 1661 1634 1523 1412 1316 434 224 192 147 --12040 --
NM_003081chr2051083 1001 930 477 156 1757 2915 298 --
NM_003108chr276492 6259 6134 6099 4984 1563 1437 14807 11131 --
NM_003112chr783051 2603 2487 1222 937 564 539 392 22305 628 ----
NM_003128chr262704 2501 2174 2066 1957 1790 1957 32117 2050 660 --
NM_003144chr642270 1958 534 407 1492 2423 21 1130
NM_003199chr1874563 4363 1734 1599 422 321 301 11130 14033 --
NM_003221chr673548 2975 2689 1526 1157 1056 192 23915 129 11444 --
NM_003262chr384789 4712 4393 3386 3252 2034 1253 548 21519 1226 ----
NM_003286chr20138 11047 --2947 765
NM_003292chr172310 1962 1931 1891 572 382 334 --1449 --
NM_003298chr3165706 5473 5397 5337 5078 4602 2086 1882 1537 1445 1201 982 678 410 155 149 35624 5286 551 1234 --
NM_003392chr384295 3618 1361 1155 1005 906 424 194 ------
NM_003404chr2032008 711 394 ----22036 381
NM_003412chr343075 2442 605 116 12700 23123 2706 12953
NM_003413chrX81708 1628 1422 1343 770 763 671 413 --11668 --
NM_003431chr13552 540 157 ----2460 43
NM_003468chr294379 3669 2988 2824 1702 965 695 437 322 14022 1295 14256
NM_003483chr12102589 2425 2340 1837 1021 913 821 553 265 215 22510 1921 ----
NM_003574chr1895588 5464 5026 4488 4118 2097 1306 1076 556 33952 1795 809 25185 343 --
NM_003590chr2113987 3601 3160 2981 1281 1105 1019 920 821 741 532 ------
NM_003615chr394024 3443 2777 2697 2437 1420 1167 572 557 ----23363 910
NM_003617chr194613 4605 4407 4221 1650 1323 1220 739 643 45007 1821 1172 260 44719 4156 3095 1721 --
NM_003671chr973303 3204 2552 999 876 160 69 23617 328 1867 --
NM_003744chr1421330 1241 31288 1034 847 1363 1826
NM_003759chr483456 3257 2818 1615 1038 305 258 100 23644 298 ----
NM_003772chr1171326 1076 1011 510 499 478 275 1193 ----
NM_003774chr1273246 2890 2308 2160 1351 1289 870 12849 22664 2618 --
NM_003816chr841343 1195 454 416 1572 11556 21527 490
NM_003873chr1052554 2401 2020 1905 577 2270 27 --1232
NM_003887chr231849 744 28 2384 274 21689 1499 1618
NM_003909chr893051 2917 2693 2576 2315 1105 1098 215 38 22493 642 ----
NM_003919chr74199 81 43 24 137 ----
NM_003930chr792547 2433 2331 2301 2086 2080 2053 1840 244 ----12213
NM_003939chr1043521 3111 845 90 --23085 1065 23260 98
NM_003994chr1284208 3962 3816 3753 3671 2698 1675 49 11089 33860 769 458 --
NM_004028chr1884068 3386 2680 1313 1104 861 417 140 1442 33316 1231 488 13897
NM_004117chr64849 719 330 79 --22088 2078 1804
NM_004124chr1483549 3451 3399 2915 2193 895 472 344 --12692 21094 673
NM_004136chr1593252 3201 3186 3178 2750 2475 2149 940 180 1588 ----
NM_004162chr341064 260 203 56 --21112 528 1842
NM_004171chr11219344 8499 8356 8051 7964 7787 7301 7154 6987 6815 5971 5894 2702 2556 1998 1809 1348 1266 675 547 193 33357 1621 786 ----
NM_004172chr54395 294 197 183 11713 ----
NM_004232chr18113404 3369 3291 3214 3053 2608 2540 1355 1307 1171 546 --12939 23459 253
NM_004272chr561983 1779 1558 466 326 289 ----11693
NM_004331chr852360 1951 1720 1071 304 ----12307
NM_004338chr18136938 5670 5500 5451 5274 5249 4678 4459 4272 2504 1479 1288 214 46822 6204 4587 1470 16761 17088
NM_004370chr651768 862 387 232 211 --1450 1353
NM_004412chr10105997 5882 5768 5668 5646 3858 2262 1910 1570 402 35395 4827 4329 2554 277 25327 1817
NM_004500chr1451963 542 489 384 265 21889 790 1307 --
NM_004501chr193857 3748 3714 3683 3164 3090 1214 572 541 --1373 --
NM_004505chr1731847 1715 1677 --1163 2383 333
NM_004586chrX105403 4473 3625 2060 1336 1141 605 591 468 263 --35393 4013 407 --
NM_004673chr14635 550 403 92 21322 1120 21151 336 --
NM_004685chr1392995 2914 2195 2135 2113 920 329 250 114 12243 199 --
NM_004726chrX105478 5183 4141 3918 2219 1930 1891 1170 604 127 --24925 974 --
NM_004734chr13112750 2580 2529 1239 1205 1188 1084 975 663 374 186 ------
NM_004736chr12685 48 1290 12075 12063
NM_004748chr15124046 3838 3704 3374 3288 2803 1699 1479 1252 661 535 390 ------
NM_004775chr1882343 1836 1672 1662 1576 1553 691 524 1157 ----
NM_004795chr1391956 1920 1840 1595 1370 551 442 183 37 ------
NM_004796chr1482437 2275 2231 1962 1835 1732 1717 925 ------
NM_004815chr184685 4414 4405 3792 1825 1805 1450 471 --14832 11514
NM_004857chr1494572 4499 3969 3851 3610 3207 3128 659 124 --11290 --
NM_004866chr5104994 4685 4667 4046 3161 3112 2020 1136 811 297 11205 1582 15018
NM_004904chr7206481 6173 5766 5617 5280 5160 4661 4631 4625 4521 4301 4105 2324 2239 1902 1709 1271 1067 710 547 15245 22091 1799 1869
NM_004956chr7134296 4136 3753 3637 3625 3481 3390 3207 3198 1654 798 674 113 --13787 1647
NM_004973chr621752 1309 ----21547 1535
NM_004985chr1293710 3591 1691 1399 1318 1296 1142 796 219 12897 11425 --
NM_004999chr663452 3339 3317 3308 3192 2768 23064 87 12752 --
NM_005036chr22107544 6865 6566 5537 2665 2277 600 440 430 123 47208 7011 6314 2256 ----
NM_005065chr1465401 5336 5287 3532 2075 1300 34684 3804 875 13608 --
NM_005086chr12101540 1430 1200 1175 1129 733 681 330 284 100 ------
NM_005126chr331556 663 109 3652 337 256 --12065
NM_005151chr1862417 1677 836 742 590 65 21764 530 22377 1907 21934 679
NM_005156chr973871 1361 1281 1002 886 745 629 13393 35152 834 271 --
NM_005180chr1061625 1479 1203 593 496 461 --21322 1094 --
NM_005188chr1137492 3116 2014 --37148 6138 286 13321
NM_005197chr14136015 5887 5395 5331 5058 4650 3937 1882 1770 1347 970 487 88 --15153 25793 5237
NM_005235chr2107659 6870 5666 5169 3141 2507 2234 1714 1146 805 25388 2139 27804 2867 12099
NM_005259chr241517 1372 1324 942 21167 113 2553 58 --
NM_005271chr1061111 1044 894 818 480 111 1308 --1334
NM_005277chr451734 783 704 460 143 11854 11462 11237
NM_005339chr4113996 3972 3276 3157 2957 2637 1625 1542 1457 1320 339 33764 3696 1713 44089 3837 2869 1525 --
NM_005359chr1895871 4626 992 933 757 529 461 70 58 25988 5049 2362 172 --
NM_005433chr1842593 714 511 433 --12388 1501
NM_005436chr1074022 3778 3033 1616 852 465 451 11357 ----
NM_005440chr1753313 2313 2282 123 49 ----23353 521
NM_005475chr1263260 2959 1281 1225 858 707 21147 751 12845 22918 2791
NM_005497chr17125658 5003 4757 4582 4516 4068 813 519 411 289 208 63 14591 35983 5051 4932 11714
NM_005502chr962918 2657 2625 2134 1200 354 --12359 --
NM_005504chr12106543 6391 5655 5502 5426 4861 4428 4064 2351 1226 26461 177 16001 --
NM_005509chr561659 1388 1356 472 225 25 31835 1306 249 11516 11896
NM_005578chr375174 3709 3122 1515 1142 1032 530 24148 1225 13284 --
NM_005596chr9136441 6119 5701 5218 4451 1930 1746 973 825 757 401 246 133 1263 --14055
NM_005603chr1841893 746 161 116 --21937 124 --
NM_005639chr1251589 1538 714 222 115 ----11185
NM_005665chr1124818 4626 4442 4201 3711 1393 1366 1150 596 254 154 74 13199 11410 14939
NM_005668chr5114475 4305 4272 3603 3225 1518 1310 1182 434 273 22 1249 11842 --
NM_005737chr272964 2800 2574 2383 2326 2276 1803 32480 2461 1887 ----
NM_005738chr731633 1472 587 --11701 2398 134
NM_005739chr15112062 1993 1982 1958 1867 1853 979 418 290 105 23 1545 11931 --
NM_005746chr752008 1889 1838 646 554 12022 22548 421 --
NM_005759chr244105 3433 2948 684 21008 512 24582 4124 14362
NM_005779chr542681 2672 660 227 23179 677 33054 293 51 --
NM_005795chr251012 776 696 605 544 1286 22926 2822 1848
NM_005807chr13536 161 44 2500 136 ----
NM_005813chr292580 2132 2066 1806 1663 978 886 238 180 12086 ----
NM_005819chr173478 2941 2279 698 640 534 146 --32441 2260 1285 --
NM_005836chr8291 53 ----1321
NM_005840chrX105463 5357 4990 2762 2755 2215 1667 1369 1124 805 37168 6176 5763 17541 1930
NM_005868chr782407 2400 1813 1739 1579 746 529 518 ------
NM_005898chr1173234 2654 2035 795 781 276 151 22054 926 1300 --
NM_005901chr18188431 6967 6759 6510 6267 6030 5954 5848 5260 5242 3382 3183 2491 1457 1390 913 899 292 1766 15270 1641
NM_005903chr584430 4267 3492 3247 3210 1696 804 463 --1297 --
NM_005909chr5104151 3787 3744 3568 1580 1499 1241 1100 935 193 12608 --2509 111
NM_005935chr4105194 5061 4537 4120 1972 1498 575 433 352 157 23397 1349 166 --
NM_005941chr8154133 4122 4082 4071 4010 3829 3585 3368 3264 3249 3240 2599 855 698 495 --12975 23053 1104
NM_005955chr1115522 5423 4163 4142 3568 1947 1908 1840 1545 1355 1156 --25021 4596 --
NM_005964chr1761490 1473 1264 1155 503 172 --11186 11586
NM_005966chr262174 1954 1491 688 213 204 11926 ----
NM_005999chr181372 1347 1339 1239 1211 1183 1102 357 --11332 --
NM_006007chr9114245 4162 4046 3397 3196 2779 2771 1796 1473 855 360 34320 1624 1432 23390 1713 21747 1156
NM_006037chr2124505 4423 4000 3971 3484 1817 1629 1611 1068 734 445 387 14298 ----
NM_006047chr2093017 2961 2412 2338 2253 2148 1359 857 554 12930 ----
NM_006073chr682150 2092 1594 1563 1401 329 319 302 --11923 --
NM_006080chr762733 2708 2437 2238 1090 50 22368 722 11855 --
NM_006095chr474080 3340 3247 2953 2796 1395 1338 11224 13275 --
NM_006154chr1562812 2679 2169 1134 1035 182 42605 2335 2028 928 ----
NM_006158chr841460 685 379 32 --11416 1550
NM_006203chr575014 4989 4946 4365 3519 1499 769 14897 33809 1207 1183 11998
NM_006206chr4112829 2795 2735 2540 2031 958 731 698 579 323 262 22499 1988 1741 1940
NM_006252chr1125872 5648 5506 5478 4886 2843 2454 835 671 606 539 271 37125 4836 2317 1876 --
NM_006283chr894458 4145 3986 3806 1636 1612 1530 689 83 31783 470 61 ----
NM_006300chr1961779 1591 916 826 443 159 22215 1575 11555 21496 98
NM_006306chrX115420 5398 5030 2374 2223 1944 1674 1653 932 382 285 --14384 --
NM_006330chr861469 1438 1389 526 278 145 --1380 21513 1198
NM_006379chr732129 846 782 11979 11456 1590
NM_006380chr17114206 4147 3773 3654 3232 3125 3038 2895 1322 1201 671 13721 14169 21294 993
NM_006393chr10114462 4263 3839 3761 3216 2908 2781 1084 505 490 410 1127 ----
NM_006457chr4114108 3775 3365 3157 2841 2810 1536 1088 869 331 106 14095 23713 317 --
NM_006489chr1481757 1565 632 623 512 469 154 137 ----1779
NM_006520chrX91482 1461 1451 1390 1165 680 495 267 154 ------
NM_006534chr2073250 2903 2666 2660 2383 1377 874 23116 2109 ----
NM_006544chr1485906 5661 5537 4808 4181 496 397 126 14942 11691 26075 527
NM_006546chr17116339 5882 5587 4769 4575 2247 2107 1662 1573 1480 1439 --21280 671 --
NM_006561chr10115488 4375 4066 2076 1915 1871 1395 699 470 416 410 --21779 1607 35825 3869 2482
NM_006599chr16167947 7051 7026 6467 6307 6011 3257 3198 3113 2643 2140 1096 718 442 354 221 26538 5602 1968 --
NM_006603chrX42002 576 418 377 11541 2314 195 --
NM_006609chr282971 2897 1823 1194 1118 886 850 159 1839 11924 1944
NM_006614chr393365 3263 3211 2766 1401 1113 922 508 384 --12770 1557
NM_006626chr972722 1660 980 906 692 680 154 1132 2588 540 --
NM_006628chr15104150 4120 3050 2838 1442 1266 872 541 367 180 21575 1367 12967 --
NM_006629chr1842172 1987 910 375 --12403 12792
NM_006654chr1273888 3133 3081 1708 1689 762 364 14458 12950 --
NM_006682chr7102312 2163 1050 932 618 318 256 227 220 162 ------
NM_006717chr953101 2493 752 724 117 --2963 764 13086
NM_006722chr382978 2952 2874 2775 2767 2451 2407 1124 12119 13043 11913
NM_006729chrX125630 4912 4714 4653 4530 4393 3807 3520 1692 1674 1327 1144 23848 178 35305 4184 2107 13709
NM_006731chr995815 3796 2280 1869 1857 1765 1497 907 850 14413 11643 --
NM_006750chr16137787 7772 7554 6502 6244 5619 5104 5068 2345 1770 1428 1071 173 27244 339 47021 6085 4981 420 --
NM_006851chr1282891 2764 2191 2022 2009 1100 674 125 22262 604 11968 174
NM_006885chr16104073 3757 3624 3162 3005 2717 1123 1016 752 644 ------
NM_006902chr192835 2574 2336 2111 2046 1308 1188 170 54 1910 --1151
NM_006915chrX92412 2296 2053 2047 1605 1013 337 173 87 12270 ----
NM_006918chr1165141 4848 4553 909 384 80 193 24894 289 12173
NM_006924chr1784402 3849 3245 1098 957 621 473 64 13021 11726 --
NM_007005chr951448 504 429 317 247 ----1587
NM_007007chr1284487 4400 3692 1938 1465 921 497 298 --2772 40 --
NM_007011chr1586727 6181 5154 4712 4337 4184 2101 367 21769 810 25085 1268 26159 1487
NM_007038chr21186029 5812 5626 5426 5263 5080 4646 4312 4156 3996 3956 3765 2294 2071 1995 1819 1799 1229 25496 346 44892 4225 2275 1999 --
NM_007106chr1392805 2366 2111 1832 1086 465 441 408 357 11825 31981 1113 97 --
NM_007114chr342615 2511 2023 831 22756 645 12366 12016
NM_007137chrX155423 5357 5296 4933 4479 4217 2107 1967 1601 1294 673 602 520 418 377 ----11381
NM_007157chrX62841 2111 1998 1009 846 455 148 1474 --
NM_007172chr2243274 3268 3160 2727 1298 13323 23191 3119
NM_007173chr11102046 1922 1709 1502 868 821 570 151 130 25 1287 --2891 826
NM_007203chr9103856 3627 3598 3508 2984 919 651 626 601 355 22866 1514 1115 --
NM_007249chr13218700 8399 7540 7194 6843 6774 6448 3645 2978 2131 2074 1992 1942 1897 1846 1571 1219 1008 984 565 442 37092 2717 1184 17605 17842
NM_007347chr15103144 2986 2940 2914 2288 2091 1166 529 405 310 ------
NM_012089chr171365 1077 490 455 192 46 23 21446 1381 11472 --
NM_012096chr373575 2706 2514 1427 1081 515 482 ----1911
NM_012097chr221546 532 1912 --11923
NM_012120chr652647 2199 1877 966 666 12591 --1659
NM_012141chr1323413 682 --43245 3006 2870 1189 1551
NM_012153chr1192134 2106 1892 1796 1666 1584 884 628 579 --32554 2508 2148 147
NM_012164chr9127573 6858 6851 6416 6203 5604 5580 5542 5027 4739 2268 2032 32618 1606 128 15011 --
NM_012214chr244879 4821 4723 161 21832 658 16038 11214
NM_012234chr393511 3256 3243 2909 2565 726 593 575 299 12752 23392 1016 32585 1476 234
NM_012252chr7155102 4772 3676 3536 3499 3369 2126 2032 2006 1953 1724 1595 1566 1050 37 54967 4685 3335 3296 2054 24450 371 --
NM_012257chr73809 260 148 1934 --1733
NM_012262chr1155094 4947 4648 4475 4237 3493 3466 3455 3402 3328 1947 1308 304 105 74 14390 --11921
NM_012281chr772359 2140 1973 1788 1659 746 78 12043 --11931
NM_012287chr362969 1335 1296 1219 1012 69 13456 14390 11569
NM_012294chr784003 3975 3878 3388 2777 1328 1122 595 1627 --13750
NM_012309chr11124984 4583 3508 3465 1963 1942 1836 1817 1663 1424 1214 1121 11481 24615 3219 --
NM_012382chr5154481 4429 4087 3880 3127 3004 2923 2782 1214 1089 970 963 793 627 319 11143 --12868
NM_012395chr753331 2602 1117 446 86 22838 2346 13099 1714
NM_012465chr10103121 2864 2238 2152 1316 1305 1206 749 94 65 --12211 --
NM_013231chr14113902 3769 3728 3251 3169 1363 1342 1308 1002 422 206 136 ----
NM_013255chr7258740 8651 8005 7994 7393 7357 7136 6730 6713 6465 5714 5608 5475 3552 3241 3146 2374 1750 1737 1611 1596 853 839 774 595 16986 36916 2700 2432 12496
NM_013257chr822140 755 --2553 231 1350
NM_013261chr4153552 3289 3236 3167 2661 2637 2597 2507 2455 2298 1131 703 176 167 144 ----11238
NM_013269chr1294069 3827 3729 3386 2752 1766 1720 1415 405 1292 11376 --
NM_013281chr2051434 1146 499 220 114 --1989 1360
NM_013374chr372299 1063 832 732 683 483 295 22096 436 --12434
NM_013381chr1272300 2244 2181 1908 1581 1558 888 2472 318 22411 26 12129
NM_013386chr151599 1539 1287 1141 133 1222 2245 46 --
NM_013937chr611152 --1153 1473
NM_013989chr1495120 4722 4071 3102 2050 1090 968 870 349 23238 1704 ----
NM_014021chr183213 3130 2543 2495 2255 1180 990 979 23311 707 1849 --
NM_014028chr662825 2759 1005 559 491 213 ----23093 267
NM_014039chr1151290 1233 1016 129 33 ----11193
NM_014048chr16105289 5046 4364 4352 4270 3464 3259 1693 1398 1246 1101 --14509
NM_014106chr15102778 2426 2401 2321 2156 2083 2023 1087 965 298 1554 122 --
NM_014109chr841118 788 307 238 ----1913
NM_014112chr8145504 5245 5134 4861 4849 4669 4571 3849 3729 1543 1521 1345 1272 765 123 25462 282 1224
NM_014141chr7135074 4976 3880 3753 3747 3651 3628 2122 1948 1371 1026 260 231 1662 ----
NM_014181chr272820 2511 2313 984 945 569 198 1649 --12476
NM_014211chr571737 1547 1391 1324 1227 549 118 --1651 --
NM_014325chr1231863 1774 825 ----1580
NM_014331chr496855 6251 6020 5082 4828 2871 932 229 27 47563 5756 3016 282 36068 5938 5306 --
NM_014379chr831038 811 276 139 2872 676 --
NM_014393chr852204 1660 570 537 426 --2645 31 --
NM_014421chr471937 1647 1599 732 607 596 231 ----11923
NM_014423chr5105304 4837 4369 4070 3821 2068 2012 1519 822 148 ----1724
NM_014445chr352372 2194 392 307 222 --187 21793 318
NM_014458chr151154 1060 557 169 133 --11368 --
NM_014495chr13545 258 27 2271 155 169 --
NM_014584chr1491097 1060 1019 607 324 216 86 79 36 ----1503
NM_014607chr262005 1828 1779 1608 1323 861 --12085 129
NM_014636chr994324 3968 1599 1410 1324 1308 1182 1162 693 --13418 --
NM_014670chr261342 1173 370 340 308 279 11037 1498 --
NM_014701chr1573218 2575 2568 2338 1243 1010 243 11080 --1683
NM_014702chr692832 2188 2162 1069 631 603 238 153 102 --12390 --
NM_014721chr697037 6687 5940 5619 5563 4524 2729 1527 1297 2947 300 22655 2168 16418
NM_014733chr561485 1438 891 751 659 332 2565 218 42291 2267 1638 1568 --
NM_014751chr872043 1912 1702 1355 546 211 181 --32165 2131 536 --
NM_014755chr2104296 3885 3782 3704 3622 3227 2809 417 288 257 --14228 --
NM_014779chr361125 1054 1016 745 365 222 1136 141 --
NM_014781chr871175 1164 1044 876 866 170 115 1498 ----
NM_014787chr142757 1725 609 60 11019 --11851
NM_014803chr1082936 2616 2358 2213 1969 1879 1817 949 --22977 293 --
NM_014810chr173605 3288 1255 850 482 440 148 --33013 2759 2258 --
NM_014812chr12449 106 --11395 21741 531
NM_014822chr45689 626 513 185 45 --1205 --
NM_014848chr1582843 2723 2486 2227 2107 1977 1033 840 ------
NM_014873chr163313 3147 1580 1263 1155 336 13745 23531 1751 34212 3562 3067
NM_014877chr17137809 6772 5896 5888 5878 5214 4893 2397 2044 1896 1491 1311 388 11500 27470 2124 --
NM_014899chr543080 2188 729 601 --12935 11007
NM_014904chr1073992 3325 2579 1312 1068 968 444 13576 23564 559 --
NM_014906chr1783980 3857 3775 3174 3165 2500 1615 545 ------
NM_014920chr683665 3627 3330 3055 1322 1314 1015 383 63148 2790 2712 1071 843 296 ----
NM_014923chr1352306 1727 1548 337 85 --31982 451 297 --
NM_014934chr1383351 3193 2798 2558 1474 959 189 138 13401 13586 --
NM_014946chr282803 2580 1934 1012 665 653 347 304 1291 1603 --
NM_014950chr1471642 1553 1512 1257 630 410 53 1382 ----
NM_014953chr13104321 4028 3960 3390 3203 2750 1238 213 147 118 12998 2412 393 --
NM_014962chr2052864 2242 822 475 441 22899 1883 1973 --
NM_014982chr14105002 4780 3789 3391 3303 2073 1299 1116 574 374 --24557 942 --
NM_014989chr631490 187 135 1101 153 21969 747
NM_014990chr1461330 1299 500 380 322 312 1509 ----
NM_014992chr147839 813 763 618 583 91 83 ------
NM_015008chr363161 2740 977 648 305 133 13233 32282 283 262 --
NM_015026chr1284148 3543 3420 3388 3334 3236 1392 1129 11798 13206 11495
NM_015032chr1342338 1849 986 772 --32894 2478 464 --
NM_015039chr184395 4325 4221 3806 3626 3543 1259 864 33933 3042 176 --13204
NM_015040chr2123423 2700 2557 2339 2268 2148 1095 963 843 663 441 341 13151 12152 --
NM_015045chr1062254 2115 1897 1868 730 525 11963 1239 11800
NM_015071chr546502 5762 5151 611 14905 --26012 4369
NM_015076chr693919 2798 1716 1703 1263 818 761 481 52 11016 24186 3418 1333
NM_015092chr16114484 4197 4029 3797 3471 1320 1246 1113 495 378 90 33653 3175 1494 ----
NM_015097chr352154 2146 1999 1644 416 11787 21538 380 --
NM_015115chr453022 2819 2285 552 341 12203 12313 12483
NM_015132chr781937 1925 1608 1384 391 356 306 169 --1662 11594
NM_015137chr852518 2493 571 536 107 11992 --21793 1046
NM_015144chr1641339 1145 1041 1032 11473 1585 1564
NM_015199chr322932 1062 --1278 11049
NM_015200chr441712 692 619 271 11621 --11872
NM_015206chr1593594 3377 1529 1322 1049 1041 1031 928 756 33895 2987 2966 22399 85 --
NM_015208chr1873444 3370 2773 2561 1466 1336 100 --13633 13215
NM_015247chr1694297 2103 2080 1878 874 835 535 433 306 ------
NM_015265chr252558 2493 1980 474 26 1295 11671 1757
NM_015294chr1741019 913 234 197 190 --1411
NM_015310chr898106 8040 8005 6061 5117 3134 2141 1997 1326 18088 1769 23013 2568
NM_015313chr1134838 3358 1833 44231 3673 3319 734 --13744
NM_015317chr252773 2573 2006 1938 383 1648 12668 1491
NM_015335chr1242587 444 367 117 --22491 1039 --
NM_015336chr12112187 2037 954 939 874 822 635 579 554 221 135 ------
NM_015347chr1252573 2263 1160 1021 169 1565 --1238
NM_015387chr282069 2013 1864 1461 1411 838 572 297 11551 --21977 284
NM_015394chr1272435 2201 1873 973 699 404 30 1543 ----
NM_015446chr151194 1098 1052 267 87 --21451 577 --
NM_015455chr573366 3262 3143 2588 2570 1364 783 --22581 1652 12498
NM_015535chr244181 2704 902 790 ----2377 152
NM_015550chr793389 3186 3155 2692 2398 1369 1262 1196 170 --22603 502 --
NM_015564chr562945 1410 1396 1088 714 274 --2913 332 --
NM_015576chr372900 2613 2515 1947 996 771 84 11183 --11129
NM_015605chr1091542 1459 1390 1372 1365 1214 292 240 135 11149 21562 1463 1447
NM_015640chr175249 4446 4067 1977 1388 1279 329 24339 1005 13990 --
NM_015879chr18127348 6633 6295 5803 5698 5596 2223 2201 909 851 544 288 27915 360 25878 1748 12940
NM_015886chr8115547 4321 3959 3813 3573 2280 2192 2098 818 756 568 65023 4668 4656 3919 3782 1338 24185 2004 35274 4759 1643
NM_015906chr184745 3675 3135 1899 922 752 595 164 ----14620
NM_016009chr1134807 4510 4276 3024 1555 1542 1374 1209 1145 850 751 649 384 154 14123 --
NM_016018chr872589 2557 2115 971 647 594 243 ----11734
NM_016040chr172714 2625 2121 2050 2033 852 529 42723 2166 547 66 --1861
NM_016076chr162659 2354 2192 2097 437 389 --12382 12156
NM_016081chr472238 2009 1800 1644 608 514 337 ------
NM_016083chr683359 2491 1481 1439 1351 521 324 281 23243 803 21011 234 13321
NM_016096chr841896 1463 248 168 11861 --1749
NM_016121chr151140 1051 965 719 148 ----3825 724 163
NM_016131chr252312 2207 2108 418 376 --42368 1877 1784 359 1308
NM_016132chr1593304 2556 1380 1339 1080 715 595 555 136 --1939 12999
NM_016217chr6103680 3266 2881 2778 2553 2354 2246 1021 893 691 ------
NM_016255chr6113325 3276 3226 3107 2426 1084 853 484 367 248 241 ------
NM_016260chr2177055 6925 6183 6102 5768 4893 4724 4642 2790 2608 2248 2232 2189 1179 1004 829 70 26392 5526 17233 24694 2384
NM_016275chr342174 984 353 218 --2875 807 --
NM_016322chr972919 2743 991 985 742 683 138 11152 12159 --
NM_016376chr1753510 2759 1699 1371 126 --23844 1398 --
NM_016396chr1572911 2474 2229 2177 1097 1083 138 11047 11068 --
NM_016448chr131889 487 304 --1739 11156
NM_016513chr683665 3627 3330 3055 1322 1314 1015 383 63148 2790 2712 1071 843 296 ----
NM_016530chr15114119 3547 3528 2957 1495 1092 975 708 574 329 206 13376 12786 13660
NM_016531chr4114219 4023 3837 3712 3329 3281 3154 3127 1555 1504 1405 --23395 3251 --
NM_016542chrX31784 1662 71 31547 1534 330 --11461
NM_016599chr451374 966 488 110 104 ----1172
NM_016613chr4102501 2440 2330 1091 1078 882 850 755 684 94 --22216 412 11110
NM_016620chr141378 1042 926 160 1320 --11228
NM_016953chr2145467 5389 4851 4313 3926 3908 2109 1949 1649 1259 966 341 304 64 24387 4250 55263 5063 4650 4561 992 --
NM_017420chr1493348 2983 1547 1477 1423 1127 828 391 385 23789 2561 ----
NM_017447chr2184423 4353 4180 3897 3878 3566 1231 395 ------
NM_017599chr12101787 1725 1600 1534 1456 1363 1283 810 542 501 ------
NM_017628chr4105269 4996 3877 3657 3461 3449 3403 1452 891 720 15186 44082 3881 262 134 24785 747
NM_017633chr6103610 3534 3222 3091 2583 1111 635 582 471 312 13742 --1612
NM_017637chr9169458 8071 7421 7300 7263 6772 3465 3261 2821 2566 2216 1910 1900 1621 382 357 26217 1029 36483 2418 563 17153
NM_017644chr354986 4956 4829 4293 117 --43261 1851 1839 554 --
NM_017650chr7136002 5848 5761 5453 5294 5185 4752 4708 4605 3860 2321 1972 1615 35224 4835 977 25440 195 --
NM_017658chr1433549 3015 611 ----33995 3181 199
NM_017709chr143875 2979 1367 448 ----13233
NM_017754chr684945 4432 4196 3737 3493 693 600 50 1619 ----
NM_017769chr14103267 2612 2562 2103 2035 1264 1228 1212 1080 370 22027 928 ----
NM_017770chr652757 2647 2586 2493 436 1454 --1478
NM_017778chr821282 82 1371 21150 165 31415 1381 178
NM_017813chr8125218 4618 4324 4276 4148 4117 3890 3757 3667 906 857 635 14229 14675 --
NM_017831chr1864112 3832 3548 3354 1723 996 11229 1479 13905
NM_017919chr995451 5320 5223 4581 3584 2331 1993 1710 1187 ------
NM_017944chr1152661 2243 1219 451 376 --22773 854 12644
NM_017945chr331409 1368 209 1367 --1310
NM_017958chr272491 2120 2075 1184 1061 97 52 --12605 1590
NM_017994chr772702 2161 1078 931 508 192 46 --1416 21829 495
NM_018036chr1484446 3459 2994 2755 1793 1375 956 134 --13953 --
NM_018084chr283110 2951 2774 2515 2353 1327 1278 909 12154 32202 351 148 --
NM_018092chr1631116 658 212 ----1217
NM_018157chr1233107 2604 1316 22079 1016 12179 12853
NM_018191chr1352096 2028 1424 865 505 --1366 11668
NM_018227chr473199 3001 2810 2383 1120 680 638 22758 2301 ----
NM_018254chr172367 2326 804 764 633 613 236 ----189
NM_018263chr292534 2442 2059 2026 1908 1654 994 473 300 --3866 814 685 11704
NM_018293chr362940 2614 2292 1109 965 859 1453 11953 --
NM_018299chr893290 3212 2529 2512 2298 2213 2157 981 319 12384 ----
NM_018351chr1274731 4674 1823 1298 1234 1165 154 11894 23404 355 --
NM_018362chr1153269 3057 2880 2596 999 13571 23791 470 1673
NM_018364chr154081 2904 2783 1207 855 --34005 2560 256 --
NM_018374chr7115010 4561 4113 3837 3745 3730 3479 3455 3290 3196 291 13570 1604 --
NM_018439chr1882466 2408 1906 1656 1618 1609 711 263 11918 ----
NM_018440chr8108403 8294 8098 7445 7421 6511 5296 3475 1503 990 22058 2014 22907 1815 22419 1350
NM_018452chr6_random83626 3170 945 916 734 671 368 287 32466 1460 475 12574 11102
NM_018466chrX3774 738 97 --1602 1644
NM_018475chr44698 681 613 443 1152 --1601
NM_018557chr281649 1588 1108 686 604 232 223 69 11124 1309 --
NM_018566chr1124788 4302 3668 3574 3202 1755 1653 1190 1158 1118 1019 665 11859 11683 12008
NM_018638chr1295691 4193 1952 1662 1635 742 696 357 36 --14875 1140
NM_018695chr592478 2207 1795 1518 878 684 639 560 139 ----1240
NM_018841chr183656 2655 2556 2486 1581 1560 737 128 1667 1205 --
NM_018945chr693302 3110 2933 2446 866 550 512 492 344 12508 12301 --
NM_018970chr7123070 2756 2576 2263 2081 2064 1152 1120 993 798 158 55 --12267 22246 343
NM_018976chr1282876 2369 2208 1797 1105 635 543 246 --32827 791 382 --
NM_018999chr1054819 4768 4624 1965 1689 1121 1766 43470 501 440 210
NM_019001chr394024 3504 3245 1262 702 406 371 272 103 23581 980 --1641
NM_019004chr782395 2209 922 823 718 598 502 325 22195 901 ----
NM_019022chr1893113 2557 2436 2161 1203 1172 508 369 187 --1255 --
NM_019072chr5114300 3434 3378 3260 2925 2667 1554 1254 832 174 123 --34281 4098 3277 --
NM_019083chr181663 1600 1573 1353 1286 499 475 97 2531 518 11643 --
NM_019117chrX92887 2672 2401 741 725 566 492 250 147 12700 31251 891 513 1105
NM_019596chr2152809 2758 2267 765 245 --11976 1384
NM_020122chr295580 5310 3997 3900 3852 2232 1611 519 23 25768 159 ----
NM_020340chr681677 1394 900 389 245 206 124 35 1534 1565 --
NM_020390chr3114625 4427 3926 3772 3451 3053 1474 1019 980 346 152 11616 --14863
NM_020403chr1331656 1132 292 11787 1724 11746
NM_020432chr7102119 2055 2044 1624 1455 1416 877 597 482 288 ------
NM_020443chr1106280 5796 5537 4961 4477 1646 1507 791 600 397 --16501 16821
NM_020453chr452095 1886 1872 1708 1497 --11795 --
NM_020466chr6154881 4551 4518 4502 4340 3926 3683 3225 3083 1832 1568 645 571 146 65 1262 13695 --
NM_020711chr2132605 2495 1987 1755 1674 961 892 879 832 618 515 312 140 ------
NM_020718chr1665983 5894 4271 2527 284 250 14730 14212 24322 2191
NM_020727chr21143654 3376 3348 3316 2865 2774 2743 1516 1129 1087 798 601 480 99 2722 304 22858 701 --
NM_020739chr15124046 3838 3704 3374 3288 2803 1699 1479 1252 661 535 390 ------
NM_020747chr55945 794 717 695 678 2955 821 ----
NM_020748chr174867 693 464 91 --1122 11995
NM_020772chr17148664 7769 6986 6289 5878 3059 2873 2848 2621 2036 1217 829 811 699 --26973 3443 18437
NM_020774chr18155935 4874 4714 4705 4655 4109 3891 2505 2111 1669 1587 1150 767 708 600 --21625 1102 1448
NM_020810chr1463298 1359 1225 804 483 275 22406 205 --1517
NM_020819chr671173 955 929 833 316 57 45 131 ----
NM_020830chr273105 2583 2405 1321 1237 1073 583 11050 ----
NM_020841chr12123015 2922 2631 2597 2484 1606 1438 1379 1265 1156 472 285 --14032 --
NM_020844chr8167646 7378 7346 7297 7106 6637 5549 5428 5124 4872 2805 1811 1755 1691 1579 946 36470 6172 5996 26211 358 27184 5020
NM_020854chr1851462 439 397 367 259 21151 600 11396 --
NM_020871chrX62425 1681 446 396 386 252 --1498 32283 1803 315
NM_020872chr371703 1474 1365 1346 1231 640 152 --11530 --
NM_020917chr19103548 3390 3270 2565 2532 1509 1269 701 320 187 23481 943 ----
NM_020918chr1082440 2348 2302 1325 1199 637 449 240 ------
NM_020921chr1453634 2973 1412 1314 909 21191 484 22354 1416 22578 1271
NM_020935chr221370 729 34013 3940 3916 13282 14238
NM_020940chr1062729 2375 2241 1865 505 221 22882 249 22286 591 1935
NM_020948chr183266 3059 2882 2703 2319 1424 1276 482 ----11333
NM_020977chr452203 1751 1574 685 657 --11477 --
NM_021033chr1343502 3431 2222 1102 21364 374 11207 --
NM_021038chr332335 2126 837 42302 2074 1120 508 12114 122
NM_021097chr252547 2317 1899 1007 877 12454 22719 2164 12272
NM_021148chr762362 2144 1580 934 765 246 ----22415 1788
NM_021183chrX62389 1986 1017 1004 827 670 ----12476
NM_021191chr1292503 2248 1881 986 482 452 342 294 114 12029 12328 --
NM_021252chr1041929 1298 727 444 --11636 12038
NM_021629chr3104005 3921 3750 3680 1748 1740 1606 1272 1253 629 11599 14057 --
NM_021813chr6135429 5291 5283 5100 4827 4726 4046 3594 2199 1989 1050 1023 136 --21054 1011 14974
NM_021911chr5155595 5142 4610 4506 4306 4111 4071 3663 2028 1827 1438 1398 1301 664 297 34269 4259 2140 --13891
NM_021912chr1543905 3533 1513 276 24065 1349 23695 2984 --
NM_021964chr3146521 6100 5527 4653 4276 2513 1368 1126 1022 297 216 142 101 24 11006 15594 16122
NM_021977chr683909 3762 3753 3703 1264 918 684 661 11404 23522 1336 11501
NM_021999chr132548 268 ----1342
NM_022048chr1576321 5638 5624 4701 3985 1775 706 15047 26270 632 --
NM_022049chr161850 1738 1574 1427 1259 447 11244 --21791 1586
NM_022058chr262027 1517 1349 792 566 369 32065 690 144 1618 11820
NM_022114chr153817 1507 1469 1374 1184 11649 34614 4023 1119 --
NM_022336chr2102415 2228 2214 1675 903 885 757 701 300 292 ------
NM_022351chr893422 3242 3111 2596 2431 1065 829 467 306 --1623 --
NM_022456chr12107544 7443 7194 6291 5695 5489 3039 2575 1789 1538 35916 5014 2501 16200 --
NM_022459chr13135686 5635 5143 5132 4982 4213 2259 2001 1970 1585 1200 1130 203 22040 1708 ----
NM_022469chr193311 3291 3075 2806 2464 2288 2279 971 664 13009 ----
NM_022491chr1223271 2686 11372 23576 3477 21246 892
NM_022763chr352969 2902 2632 2257 2078 11977 1601 --
NM_022781chr942938 2677 898 559 1165 1364 12055
NM_022841chr1552488 2131 2046 1864 578 ----22790 950
NM_022893chr261270 1237 1116 1023 857 327 11184 1546 --
NM_022912chr262890 2707 2121 2098 755 327 ----11153
NM_022918chr1171880 1642 851 532 285 274 186 12104 ----
NM_023016chr272817 2424 1097 967 627 552 353 11153 --12289
NM_023923chr163750 3277 2997 2653 566 560 13665 33248 3037 660 --
NM_024095chr1291463 1356 1258 1067 976 335 293 137 88 --11001 --
NM_024345chr9115987 5777 5235 5138 4097 2106 1925 1906 1872 941 874 14561 ----
NM_024423chr18134187 3455 3416 3359 3314 2613 1644 1061 758 636 522 271 166 1233 ----
NM_024524chr392945 2756 2631 2570 2558 2409 1050 1000 182 --13187 1196
NM_024611chr1553548 2525 303 46 37 11163 --180
NM_024613chr871708 1387 1218 1198 1174 1139 387 --11162 --
NM_024627chr2253805 3460 1373 900 22 13312 13482 --
NM_024646chr163594 3309 3032 1302 1081 960 33910 3533 2595 1157 11475
NM_024721chr852122 1993 971 790 629 12362 31847 1029 724 --
NM_024770chr2136585 6178 6001 5411 5014 4440 4305 2573 2467 2364 2355 1051 83 35511 1329 389 11305 --
NM_024884chr14114487 4103 3373 3366 3163 2980 1647 1457 984 316 153 ------
NM_024921chrX101951 1656 1561 1449 1389 1228 606 488 449 165 --11789 --
NM_024947chr3179589 8806 8463 7831 6664 6359 3437 3338 2450 2251 1552 1421 1084 1004 553 443 164 16921 26340 3681 16330
NM_024949chr484785 4680 3575 3523 1934 1710 1521 570 --24183 1359 --
NM_024989chr2138188 7394 7236 7223 6431 5796 5783 3004 2900 2859 1084 1041 653 47443 6487 6470 2631 25597 5004 --
NM_025054chr874053 3456 3294 1253 863 799 575 22867 481 ----
NM_025073chr193885 3435 3428 3063 1206 858 451 445 332 1760 ----
NM_025134chr1631729 406 55 ----2831 752
NM_025146chr342334 2201 854 297 --22355 1741 1183
NM_025235chr1041707 1402 386 169 ----1880
NM_030621chr1494230 4092 3933 3794 3641 3255 975 301 221 14204 ----
NM_030625chr1072239 1662 1614 991 654 180 128 --22520 2298 --
NM_030627chr5123662 2897 1594 1570 1553 1415 1183 537 406 363 324 186 --2741 554 --
NM_030647chr7116036 5967 5583 5098 4725 4652 3992 1506 505 331 173 15316 ----
NM_030648chr4105624 5598 5446 5032 4453 4004 3706 3550 2180 70 1436 24629 3503 --
NM_030650chr273715 3263 3057 1682 1650 885 560 --21479 839 1625
NM_030664chr1052046 894 780 440 253 21946 525 22414 1840 --
NM_030674chr12105411 5052 4620 4281 2151 1985 1962 482 372 338 3520 264 239 164 --
NM_030751chr1071788 1776 1536 1449 747 413 310 11615 ----
NM_030751chr1071788 1776 1536 1449 747 413 310 11615 ----
NM_030755chr1493104 2752 1890 1107 1081 746 469 269 242 12054 22424 802 --
NM_030806chr1109452 9067 7768 5726 3765 3339 2600 2162 1912 1625 37084 6738 708 --11302
NM_030816chr173322 2711 2439 2423 2324 1247 962 --1602 --
NM_030817chr1253041 2999 2880 2457 786 23392 2712 33480 2680 1067 13637
NM_030945chr5132676 2593 2502 2421 2287 2226 2125 2087 1969 855 161 151 62 ------
NM_031243chr742188 2116 505 94 ----12089
NM_031292chr1271754 1348 1279 1191 580 479 272 --11287 --
NM_031296chr452666 2574 2067 1907 1728 --22346 497 --
NM_031314chr1451963 542 489 384 265 21889 790 1307 --
NM_031418chr1182784 2327 2103 2028 1091 1058 668 184 --11896 --
NM_031427chr1443986 1129 426 50 45460 4722 1499 676 15870 --
NM_031442chrX52863 2462 2128 1985 1131 33159 2701 587 12418 --
NM_031468chr7128216 7666 7044 6967 6773 5905 5806 5666 5024 3292 1116 782 1378 17194 --
NM_031483chr2072854 2719 1003 691 284 237 90 --13193 --
NM_031844chr193857 3748 3714 3683 3164 3090 1214 572 541 --1373 --
NM_031845chr232483 141 27 1237 1110 13127
NM_031847chr232483 141 27 1237 1110 13127
NM_031911chr492367 1131 639 581 389 310 257 225 119 12573 ----
NM_032012chr995059 4699 4636 3607 3423 1793 807 734 541 21972 433 --11360
NM_032047chr342400 1549 889 329 --1498 11960
NM_032116chr1374950 3629 1928 1445 861 471 166 13860 --14707
NM_032145chr621224 491 21374 365 31777 1572 577 --
NM_032160chr1894240 4102 3441 3385 3273 3179 2911 2775 34 --1682 1828
NM_032186chr141378 1042 926 160 1320 --11228
NM_032199chr1043549 2950 2477 1502 12796 2501 340 1837
NM_032208chr253669 3246 2823 1059 816 21285 213 12247 1148
NM_032217chr461344 1337 1214 1164 983 391 ----11049
NM_032228chr1142771 1416 1075 339 11382 --12511
NM_032288chr362111 1763 1553 480 185 169 ----1242
NM_032321chr283067 2891 2845 2813 2473 646 459 183 22870 2231 2745 362 1250
NM_032373chr1085073 4971 4888 4844 2145 1435 1009 429 15472 ----
NM_032410chr83820 348 336 --1976 11198
NM_032435chr152190 2132 1605 1479 506 --22147 1654 1948
NM_032439chr1061471 1430 1357 1232 331 298 1592 21674 1076 --
NM_032457chr493698 3536 2794 2717 1259 732 623 541 505 --33766 3453 827 23427 950
NM_032499chr1551263 1121 679 275 53 --1484 1255
NM_032505chr372767 2146 2127 2106 2077 2022 1962 --21887 392 --
NM_032521chr2053145 2812 2494 2204 1297 --12186 --
NM_032778chr373332 3280 2324 1241 1180 490 267 ----1372
NM_032796chrX2562 175 171 235 25 1190
NM_032828chr1974861 3043 1557 1257 1025 910 235 34732 4394 3605 14407 --
NM_032837chr1761817 1780 1708 809 596 204 ----2833 555
NM_032859chr1353513 2719 2631 1066 711 21116 388 11509 --
NM_032968chrX74122 3904 3234 2924 1518 1333 63 --1222 12845
NM_032969chrX74122 3904 3234 2924 1518 1333 63 --1222 12845
NM_032973chrY74114 3896 3229 2919 1518 1333 63 --22839 222 --
NM_032975chr1853636 2928 548 515 453 1574 1715 13439
NM_032980chr1853636 2928 548 515 453 1574 1715 13439
NM_033020chr184745 3675 3135 1899 922 752 595 164 ----14620
NM_033181chr683359 2491 1481 1439 1351 521 324 281 23243 803 21011 234 13321
NM_033196chr192531 271 ----21572 1151
NM_033211chr552095 1942 1775 595 582 11688 11356 11956
NM_033224chr7238057 7892 7310 6159 5992 5882 5659 5501 3013 2719 2567 2371 2306 2164 2088 1867 1791 1683 1075 740 381 309 166 67905 7373 5806 1275 579 527 1153 17103
NM_033285chr874363 4037 3818 3762 1524 1515 435 11555 ----
NM_033331chr973303 3204 2552 999 876 160 69 23617 328 1867 --
NM_033360chr12103831 3712 1812 1520 1439 1417 1263 917 340 129 13018 11546 --
NM_033364chr3102030 1949 1891 1257 1240 737 650 168 148 48 11865 --21245 176
NM_033429chr15103196 3184 2960 1121 972 942 514 418 149 48 --22624 547 12839
NM_033430chr4113786 3245 3146 3087 2914 2545 1032 877 513 497 338 ------
NM_033437chr4113786 3245 3146 3087 2914 2545 1032 877 513 497 338 ------
NM_033505chr2126216 5992 5299 4852 4806 2689 2645 2474 2189 1646 787 141 ----26598 643
NM_033515chr62877 553 --11004 11290
NM_033637chr1043521 3111 845 90 --23085 1065 23260 98
NM_033656chr21185968 5795 4295 4132 3844 3808 2317 2266 2053 1938 1473 1178 1169 1077 997 845 776 90 1463 1407 --
NM_052832chr862894 2813 877 622 563 399 ------
NM_052885chr12134991 4201 3997 3917 3356 3063 3056 1078 997 663 226 188 58 23586 3546 21891 1044 24973 4028
NM_052904chr631178 1011 530 --21458 141 11257
NM_052905chr291903 1859 1835 1754 1677 1450 697 597 219 ------
NM_052917chr253027 2709 2239 209 126 21127 732 32637 2154 761 --
NM_052932chr1142372 739 600 81 1477 42357 2305 1662 773 --
NM_052937chr852380 541 524 347 254 21693 469 --12746
NM_053016chr9148028 6350 5827 5318 5076 2973 2727 2500 2156 2138 1777 1411 1324 787 25219 2980 46361 2193 1396 957 16892
NM_053064chr1493074 2793 2773 2738 2607 2568 2243 2225 754 11999 --22429 329
NM_058170chr181459 1432 1291 1263 1016 509 482 34 1533 ----
NM_058241chr282100 1880 1623 1557 884 549 441 246 ------
NM_058241chr282100 1880 1623 1557 884 549 441 246 ------
NM_080546chr972195 2073 1855 1813 700 560 44 11747 11909 --
NM_080629chr171388 1268 1262 982 949 563 361 --11063 --
NM_080630chr171388 1268 1262 982 949 563 361 --11063 --
NM_080645chr651768 862 387 232 211 --1450 1353
NM_080821chr2072153 1974 1778 796 776 506 227 1475 1166 --
NM_080832chrX51837 1817 1528 1522 1353 11702 --21822 271
NM_080867chr14155007 4647 4629 4506 4017 3663 3624 3314 3123 1609 1361 1344 1203 1110 817 24804 4783 14686 12017
NM_101395chr21113306 3298 3102 2906 2701 2433 1343 592 279 191 60 2409 331 23483 2134 --
NM_130391chr953375 3054 2571 2538 206 13460 1190 22576 818
NM_130392chr953375 3054 2571 2538 206 13460 1190 22576 818
NM_130393chr953375 3054 2571 2538 206 13460 1190 22576 818
NM_130436chr2182638 2630 2434 2238 2033 1765 912 675 1885 12815 1771
NM_130437chr21103265 3257 3061 2865 2660 2392 1302 551 238 150 2368 290 23442 2093 --
NM_130438chr21103215 3207 3011 2815 2610 2342 1252 501 188 100 2318 240 13392 11348
NM_130809chr573154 2587 1258 1079 562 454 261 ----1489
NM_130811chr2051083 1001 930 477 156 1757 2915 298 --
NM_133334chr4106187 5413 3972 3933 1996 1770 1019 1007 542 100 176 11269 --
NM_133370chr483064 1347 1239 1227 984 833 566 414 12425 43540 2626 2406 245 --
NM_133473chr1921313 608 21866 231 11825 --
NM_133493chr654168 4059 3451 3066 1701 --12863 11259
NM_133496chr154007 1471 1004 737 58 1537 --23513 1790
NM_133631chr321108 436 1100 21543 564 11627
NM_133646chr2145271 3517 3464 2161 1995 1860 1819 1813 1510 1246 723 516 453 82 24899 4379 11086 1605
NM_138316chr1031126 1050 132 ----11286
NM_138423chr1532196 601 471 --11804 12024
NM_138426chr772425 1527 862 699 474 400 103 --21953 1919 --
NM_138444chr13124617 4475 4177 4167 3654 3628 3405 3311 1614 1598 1246 509 14273 ----
NM_138459chr6103227 2891 2690 2679 2546 1467 1248 447 399 108 --12426 --
NM_138468chr286352 6190 4380 4279 4069 1283 634 308 16270 --14151
NM_138694chr663494 3289 3004 2708 1291 235 --13323 1155
NM_138713chr16167947 7051 7026 6467 6307 6011 3257 3198 3113 2643 2140 1096 718 442 354 221 26538 5602 1968 --
NM_138714chr16167947 7051 7026 6467 6307 6011 3257 3198 3113 2643 2140 1096 718 442 354 221 26538 5602 1968 --
NM_138731chr1494042 2989 2859 2753 1279 909 732 643 99 13345 11692 12715
NM_138773chr5140 1897 --1888
NM_138782chr582328 2095 2063 1884 1711 1535 803 773 11922 ----
NM_138970chr1482437 2275 2231 1962 1835 1732 1717 925 ------
NM_139279chr273359 3261 3136 2606 2420 708 552 --2922 661 --
NM_139319chr1281897 1719 1656 1630 1226 640 353 289 --11597 --
NM_139323chr2032008 711 394 ----22036 381
NM_144571chr4106687 6128 5511 2238 2229 1598 1519 626 602 307 --15280 --
NM_144578chr14135548 4190 4046 3833 3705 3520 2177 2146 1273 1185 1029 800 433 2386 185 14444 24732 4122
NM_144599chr1565175 4158 3978 1435 794 727 25293 801 ----
NM_144633chr351430 1423 1313 1225 385 2492 464 31510 255 172 --
NM_144664chr1172121 1783 1669 393 307 256 243 --22114 1602 --
NM_144721chr472755 2558 2303 2019 1057 434 80 32662 2156 205 ----
NM_144778chr1352345 2129 1887 516 398 --1862 1407
NM_144973chr1275029 4485 4405 3476 1453 1141 847 --21225 126 --
NM_145011chr1092073 2018 1699 848 842 600 581 423 113 ----148
NM_145055chr1873872 3749 2947 2625 1238 673 311 12996 --13327
NM_145176chr6103292 2561 2331 1419 1087 1022 884 822 723 659 22789 1177 12931 --
NM_145234chrX4910 800 735 85 ----1388
NM_145259chr2177003 6860 6163 5984 5901 5858 5561 5396 5233 4538 2160 1742 1555 1527 1028 602 437 --15371 11894
NM_145307chr10114533 4090 1280 1171 1135 1108 970 867 235 114 73 --14305 --
NM_145320chr793389 3186 3155 2692 2398 1369 1262 1196 170 --22603 502 --
NM_145321chr793389 3186 3155 2692 2398 1369 1262 1196 170 --22603 502 --
NM_145322chr793389 3186 3155 2692 2398 1369 1262 1196 170 --22603 502 --
NM_145698chr1041652 1522 548 173 --11596 2866 213
NM_145753chr361433 1391 1338 1264 558 205 11096 143 --
NM_145893chr16--31227 1210 1170 11283 1658
NM_147150chr9103856 3627 3598 3508 2984 919 651 626 601 355 22866 1514 1115 --
NM_148977chr1031126 1050 132 ----11286
NM_148978chr1031126 1050 132 ----11286
NM_152261chr1262527 2468 1891 1879 1683 915 11837 ----
NM_152277chr54707 419 220 177 21663 723 12031 --
NM_152332chr1462514 2120 1927 1030 987 641 1827 ----
NM_152380chr141468 1453 1133 416 2432 36 --1291
NM_152388chr2143975 3375 3261 2970 2812 2629 1327 1282 1123 618 486 273 221 26 ----13679
NM_152407chr552661 2428 2053 863 206 22141 739 11094 11987
NM_152446chr148984 794 665 606 185 146 70 47 ------
NM_152450chr1531492 758 297 21615 794 1777 11331
NM_152529chr2113913 3083 3033 2987 2693 1676 1647 1631 933 799 655 1959 1812 14275
NM_152622chr5113187 2824 2639 2607 2297 1283 1092 1079 910 669 452 43371 2980 2959 2593 ----
NM_152624chr5157378 7370 7328 7289 6841 6307 6213 6168 5855 5118 4585 1811 1078 370 299 32432 1563 1189 26585 5321 --
NM_152734chr674176 4101 1386 1095 632 521 77 ----11173
NM_152756chr594337 3363 3188 2888 1746 892 395 334 146 21414 1392 12854 --
NM_152758chr862933 2723 2531 572 342 40 ----1457
NM_152838chr2093017 2961 2412 2338 2253 2148 1359 857 554 12930 ----
NM_152903chr1352728 2401 893 414 208 11774 11141 --
NM_152924chr1586727 6181 5154 4712 4337 4184 2101 367 21769 810 25085 1268 26159 1487
NM_152995chr44771 680 333 306 ----1799
NM_152999chr795044 4717 3962 3924 1993 1791 555 364 305 43420 1714 1572 280 1329 --
NM_153020chr641350 1046 402 206 1687 11551 1556
NM_153182chr373332 3280 2324 1241 1180 490 267 ----1372
NM_153184chr341961 1502 1380 271 2654 467 --1150
NM_153188chr5145305 5270 5183 5172 4732 4473 4457 4311 1774 1336 654 605 312 135 --23464 392 13450
NM_153207chr12113551 3504 3119 2673 2507 1258 1190 1094 601 480 63 1619 1797 22797 384
NM_153262chr1103228 3204 3142 2953 2660 2326 1967 1290 1104 370 13245 2932 243 --
NM_153267chr93929 812 86 1310 2768 95 --
NM_153332chr873244 2768 2698 2364 2216 231 211 --22273 1105 --
NM_153371chr1342377 1693 528 492 22214 1621 1200 11802
NM_153456chr1396319 6208 5037 4007 3949 3939 2057 1973 1313 --12444 --
NM_153607chr523181 2024 22345 111 32996 2910 379 --
NM_153619chr1583616 3325 3222 3010 2766 2694 2483 2415 22680 2425 12398 --
NM_153634chr1281560 1484 1457 1250 1108 621 528 494 1484 1611 --
NM_153645chr2243274 3268 3160 2727 1298 13323 23191 3119
NM_153649chr152281 2191 1905 349 340 --1363 --
NM_170665chr1274573 4049 3825 3546 2810 1254 443 11217 11273 12987
NM_170706chr184395 4325 4221 3806 3626 3543 1259 864 33933 3042 176 --13204
NM_170709chr822140 755 --2553 231 1350
NM_170710chr482902 2633 2571 2226 1159 842 791 213 --1267 12190
NM_170731chr1192746 2452 2079 1123 998 489 291 151 98 12497 --1191
NM_170732chr1192746 2452 2079 1123 998 489 291 151 98 12497 --1191
NM_170733chr1192746 2452 2079 1123 998 489 291 151 98 12497 --1191
NM_170734chr1192746 2452 2079 1123 998 489 291 151 98 12497 --1191
NM_170735chr1192746 2452 2079 1123 998 489 291 151 98 12497 --1191
NM_172058chr891744 1737 1698 1522 1432 749 577 565 100 1712 ----
NM_172059chr891744 1737 1698 1522 1432 749 577 565 100 1712 ----
NM_172060chr891744 1737 1698 1522 1432 749 577 565 100 1712 ----
NM_172069chr2102312 2001 1879 1782 1438 797 776 341 177 121 --1937 --
NM_172070chr241766 634 303 60 1250 --12228
NM_172071chr1116967 6258 6008 5887 5343 4676 4624 2151 1609 1554 233 2948 765 16608 --
NM_172127chr461799 1712 1538 1524 274 55 ----1560
NM_172128chr451755 1668 1494 1480 230 ----1516
NM_173060chr551854 1832 1305 578 426 22044 679 21886 99 --
NM_173061chr551854 1832 1305 578 426 22044 679 21886 99 --
NM_173063chr551854 1832 1305 578 426 22044 679 21886 99 --
NM_173214chr16167947 7051 7026 6467 6307 6011 3257 3198 3113 2643 2140 1096 718 442 354 221 26538 5602 1968 --
NM_173468chr4105989 5596 5053 4949 1743 1722 1661 642 446 270 35804 2182 1678 34814 4246 1386 --
NM_173511chr293754 3355 3167 2787 2584 1463 1271 672 262 --33858 3142 583 --
NM_173531chr1983645 3411 2679 2410 1505 1243 1027 334 12729 23849 904 --
NM_173536chr494845 4094 4073 3978 3879 1318 1033 348 319 --24794 4557 14998
NM_173582chr11126182 5482 4349 2444 2009 1918 1848 1210 992 739 658 290 ----15668
NM_173642chr197521 7515 6849 3429 3396 3012 2672 1988 140 12533 --18132
NM_173654chr361881 1698 1667 1475 900 204 --32172 1818 79 --
NM_173808chr1124344 4173 3769 3068 957 934 845 834 781 680 627 469 199 13382 --
NM_173812chr1251367 1010 562 485 286 ----153
NM_173825chr3122405 2287 2104 2052 1220 902 736 656 639 541 282 159 2986 870 32186 1131 465 --
NM_173826chr381754 1605 1142 588 569 329 83 71 ------
NM_173829chr5146135 6125 5574 5039 4829 4524 4499 4039 3927 2092 1933 1910 1166 680 --24528 2395 --
NM_174909chr52777 70 ----3768 208 176
NM_174916chr1562330 1534 1482 1475 732 309 126 21525 416 21990 895
NM_175623chr12107544 7443 7194 6291 5695 5489 3039 2575 1789 1538 35916 5014 2501 16200 --
NM_175624chr12107639 7538 7289 6386 5790 5584 3134 2670 1884 1633 36011 5109 2596 16295 --
NM_175625chr12107639 7538 7289 6386 5790 5584 3134 2670 1884 1633 36011 5109 2596 16295 --
NM_175768chr651697 1324 642 636 38 11293 31645 1159 256 --
NM_175861chr1294797 4549 4297 4193 4177 4106 1785 1192 1060 14948 22011 1356 15011
NM_176081chr10105997 5882 5768 5668 5646 3858 2262 1910 1570 402 35395 4827 4329 2554 277 25327 1817
NM_176083chr10105997 5882 5768 5668 5646 3858 2262 1910 1570 402 35395 4827 4329 2554 277 25327 1817
NM_177438chr1494230 4092 3933 3794 3641 3255 975 301 221 14204 ----
NM_177974chr1532196 601 471 --11804 12024
NM_177985chr221546 532 1912 --11923
NM_178011chr1073045 2753 2651 1006 992 697 590 ----12459
NM_178151chrX157353 6384 6241 6033 4968 2739 2507 2393 1292 1211 1193 1118 1083 740 336 15981 26188 2381 --
NM_178152chrX157353 6384 6241 6033 4968 2739 2507 2393 1292 1211 1193 1118 1083 740 336 15981 26188 2381 --
NM_178153chrX157353 6384 6241 6033 4968 2739 2507 2393 1292 1211 1193 1118 1083 740 336 15981 26188 2381 --
NM_178509chr1773966 3900 3621 3041 2997 2580 1342 14030 32623 218 78 --
NM_178544chr1981632 1608 1601 1341 1127 274 253 112 --11774 --
NM_178815chr1042587 2160 836 595 11769 31088 958 239 --
NM_181265chr482902 2633 2571 2226 1159 842 791 213 --1267 12190
NM_181358chr144254 3509 1296 530 --13825 14091
NM_181443chr2052864 2242 822 475 441 22899 1883 1973 --
NM_181481chr18136938 5670 5500 5451 5274 5249 4678 4459 4272 2504 1479 1288 214 46822 6204 4587 1470 16761 17088
NM_181482chr18136938 5670 5500 5451 5274 5249 4678 4459 4272 2504 1479 1288 214 46822 6204 4587 1470 16761 17088
NM_181483chr18136938 5670 5500 5451 5274 5249 4678 4459 4272 2504 1479 1288 214 46822 6204 4587 1470 16761 17088
NM_181504chr563971 3141 2766 2758 1191 521 21575 1441 ----
NM_181523chr563971 3141 2766 2758 1191 521 21575 1441 ----
NM_181524chr563971 3141 2766 2758 1191 521 21575 1441 ----
NM_181659chr2073250 2903 2666 2660 2383 1377 874 23116 2109 ----
NM_181659chr2073250 2903 2666 2660 2383 1377 874 23116 2109 ----
NM_181706chr1142384 2072 437 333 22199 126 --22077 1985
NM_181782chr672237 2043 1801 1696 1598 1592 911 ----11894
NM_181787chr883756 3276 1058 975 820 733 402 372 13859 1907 --
NM_181789chr1543188 2998 2992 2220 13249 --23233 2966
NM_181836chr562611 2286 1931 1837 713 636 12442 22368 899 --
NM_181869chr1272171 759 736 535 300 234 50 21965 1019 11058 --
NM_182485chr493241 2976 2336 2309 1356 546 532 411 314 ------
NM_182493chr1665147 4832 4657 2092 1140 83 14173 34380 3953 3905 --
NM_182515chr19126595 6072 5865 5473 5412 5360 2396 1599 820 598 228 173 1756 12672 1924
NM_182551chr263129 2657 2454 2252 1075 168 --12785 1261
NM_182646chr493241 2976 2336 2309 1356 546 532 411 314 ------
NM_182691chr771397 1219 1030 984 432 382 235 --11401 --
NM_182692chr771397 1219 1030 984 432 382 235 --11401 --
NM_182758chr1553274 2940 741 607 368 ----11550
NM_182762chr7245724 5647 5068 4947 4609 4553 4277 4157 4138 4112 4092 4050 4007 3991 3941 3882 3875 2421 2326 1581 1475 963 735 393 25256 4100 105298 5110 4161 4142 4116 4076 4034 3945 2269 1972 --
NM_182765chr1062152 2059 1798 1472 576 23 22374 1993 --1850
NM_182767chr1281995 1830 1659 1400 559 320 136 98 21727 347 --1567
NM_182830chr1471907 1870 1654 1436 845 212 130 --11751 --
NM_182896chr351851 1454 1441 569 507 ----31777 1287 552
NM_182898chr7206481 6173 5766 5617 5280 5160 4661 4631 4625 4521 4301 4105 2324 2239 1902 1709 1271 1067 710 547 15245 22091 1799 1869
NM_182899chr7206481 6173 5766 5617 5280 5160 4661 4631 4625 4521 4301 4105 2324 2239 1902 1709 1271 1067 710 547 15245 22091 1799 1869
NM_182907chr672092 762 561 397 379 357 83 22282 1676 12008 --
NM_182948chr1113001 2856 2635 2473 2362 2085 2070 1215 1021 448 308 ------
NM_182975chr151048 993 933 359 26 ----1807
NM_183004chr1493824 3574 3215 2980 2812 2402 910 628 28 13696 ----
NM_183387chr143912 806 186 ----1764
NM_194071chr795188 5124 4778 4639 4052 3589 3554 916 873 25214 4406 ----
NM_194247chr253954 2975 1589 133 83 --13655 14213
NM_194282chr433124 1988 526 32857 2054 920 1567 184
NM_194283chr584016 3867 3678 3513 3171 3095 922 525 --1981 --
NM_194291chr892691 1091 955 732 686 635 493 113 92 --12718 --
NM_194301chr1461158 1127 328 208 150 140 1337 ----
NM_194314chr1195459 5422 5308 5282 5241 5199 4748 4580 4562 3643 2259 2158 1676 1510 1210 1076 832 646 122 --24936 650 --
NM_194328chr942938 2677 898 559 1165 1364 12055
NM_194329chr942938 2677 898 559 1165 1364 12055
NM_194330chr942938 2677 898 559 1165 1364 12055
NM_194332chr942938 2677 898 559 1165 1364 12055
NM_194434chr1895588 5464 5026 4488 4118 2097 1306 1076 556 33952 1795 809 25185 343 --
NM_197941chr5113096 2891 2565 2559 2436 2151 2071 665 541 499 353 11058 22480 609 --
NM_198150chr591134 1035 613 588 570 518 401 90 81 11503 1528 --
NM_198158chr382978 2952 2874 2775 2767 2451 2407 1124 12119 13043 11913
NM_198159chr382978 2952 2874 2775 2767 2451 2407 1124 12119 13043 11913
NM_198177chr382978 2952 2874 2775 2767 2451 2407 1124 12119 13043 11913
NM_198178chr382978 2952 2874 2775 2767 2451 2407 1124 12119 13043 11913
NM_198181chr1552476 2035 2023 1857 63 12423 --12333
NM_198268chr144254 3509 1296 530 --13825 14091
NM_198269chr144254 3509 1296 530 --13825 14091
NM_198320chr12104914 4516 3236 3193 2025 1908 995 358 161 114 13372 ----
NM_198391chr2051434 1146 499 220 114 --1989 1360
NM_198400chr1562812 2679 2169 1134 1035 182 42605 2335 2028 928 ----
NM_198468chr6104625 4370 4346 4006 3622 1648 1487 781 394 107 21450 1228 ----
NM_198485chr372445 2409 2307 2044 1986 1887 1703 12576 --2200 92
NM_198503chr182422 2334 2296 2210 2141 1896 1531 294 --1275 --
NM_198513chr832038 1906 1626 --1390 11425
NM_198549chr152929 2169 1305 226 22 ----12354
NM_198569chr652607 2076 1050 412 322 1907 --11043
NM_198581chr2207572 7171 7063 6512 5851 5566 5237 5162 4901 4752 4684 4636 2609 2156 1446 1164 975 719 391 363 36897 502 310 12711 25944 262
NM_198715chr176314 6028 5462 2489 1992 1876 1034 25533 2524 1206 --
NM_198793chr3104090 3893 3747 3387 3298 1551 641 513 280 196 ------
NM_198889chr461344 1337 1214 1164 983 391 ----11049
NM_198968chr1383351 3193 2798 2558 1474 959 189 138 13401 13586 --
NM_198990chr752500 502 478 436 203 --13088 11281
NM_199132chr1951824 1561 1522 535 37 11837 1752 1477
NM_199324chr473493 3466 3212 3017 1483 635 583 --2821 502 --
NM_199421chr14155007 4647 4629 4506 4017 3663 3624 3314 3123 1609 1361 1344 1203 1110 817 24804 4783 14686 12017
NM_199436chr282803 2580 1934 1012 665 653 347 304 1291 1603 --
NM_199454chr153817 1507 1469 1374 1184 11649 34614 4023 1119 --
NM_199482chr282069 2013 1864 1461 1411 838 572 297 11551 --21977 284
NM_201269chr141378 1042 926 160 1320 --11228
NM_201591chr451734 783 704 460 143 11854 11462 11237
NM_201592chr451734 783 704 460 143 11854 11462 11237
NM_203394chr12102756 2746 2268 2261 2158 2105 1693 787 621 529 --32311 1738 908 --
NM_203406chr552587 2432 1996 1145 796 ----12026
NM_203463chr2154908 4157 3802 3642 3484 1787 1778 1733 1704 1619 1612 1271 1256 508 225 ----23972 1878
NM_203487chr1331656 1132 292 11787 1724 11746
NM_206594chr183665 3423 3123 2852 2515 1344 1115 980 --13389 23484 972
NM_206595chr183665 3423 3123 2852 2515 1344 1115 980 --13389 23484 972
NM_206854chr6155412 5400 4784 4743 4469 4346 3614 3511 3476 3464 3321 3272 1642 1567 929 ------
NM_206855chr6176377 6365 5749 5708 5434 5311 4579 4476 4441 4429 4286 4237 2532 1894 623 505 150 1477 ----
NM_206866chr21103125 2780 2748 2708 2175 448 397 332 259 92 --12044 --
NM_206876chr263376 3281 2433 1243 418 266 11191 13420 12628
NM_206909chr898106 8040 8005 6061 5117 3134 2141 1997 1326 18088 1769 23013 2568
NM_207292chr332335 2126 837 42302 2074 1120 508 12114 122
NM_207293chr332335 2126 837 42302 2074 1120 508 12114 122
NM_207294chr332335 2126 837 42302 2074 1120 508 12114 122
NM_207295chr332335 2126 837 42302 2074 1120 508 12114 122
NM_207296chr332335 2126 837 42302 2074 1120 508 12114 122
NM_207297chr332360 2151 862 42327 2099 1145 533 12139 147
NM_207304chr1352232 2016 1774 403 285 --1749 1294
NM_207372chr1062092 1723 1502 535 481 328 --1319 --
NM_207410chr61542 ----2434 31
NM_212460chr731633 1472 587 --11701 2398 134
NM_213589chr265270 3385 1848 1688 1324 1004 25539 49 24930 1503 --
NM_213609chr31366 1129 --21048 257
NM_213651chr151599 1539 1287 1141 133 1222 2245 46 --