TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4449
miRNA Sequence: CGUCCCGGGGCUGCGCGAGGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000046chr542798 1065 731 264 21951 257 ----
NM_000084chrX75945 5543 5173 4427 4369 4237 1712 ------
NM_000104chr21201 ----13081
NM_000266chrX1178 134 1118 1406
NM_000337chr5--16434 --21360 1117
NM_000610chr112522 384 ----166
NM_000875chr1576716 6688 2774 2289 2256 2010 382 12578 12018 --
NM_000912chr863231 2973 2293 2158 898 36 ------
NM_001001389chr112522 384 ----166
NM_001001390chr112522 384 ----166
NM_001001391chr112522 384 ----166
NM_001001392chr112568 430 ----1112
NM_001003652chr1877396 7371 5613 5512 3404 2654 836 ------
NM_001005609chrX63796 3677 2862 1515 1013 901 --1879 --
NM_001007024chr1793189 1333 1293 1238 1188 1139 1098 982 942 --1628 13328
NM_001007025chr1793189 1333 1293 1238 1188 1139 1098 982 942 --1628 13328
NM_001007279chr221630 2905 343 2785 649 1605
NM_001010867chr1116636 6017 5494 4539 4303 2406 1780 951 307 298 128 1779 25418 2114 --
NM_001010888chrX53955 3293 3248 679 544 ------
NM_001011658chrX51945 1746 1418 841 515 --1383 --
NM_001012393chr1111854 --11822 1541
NM_001012426chr693039 2811 2673 2300 825 814 583 365 120 ------
NM_001012427chr693039 2811 2673 2300 825 814 583 365 120 ------
NM_001013839chr1762284 1855 1653 736 452 131 --1508 1106
NM_001014797chr1077614 6296 5211 4968 3277 1029 896 26871 6672 ----
NM_001017440chr777782 7454 6692 6375 5776 5197 3281 --1949 --
NM_001017970chr141583 ----11683
NM_001018067chr145338 4172 4095 3490 ----1471
NM_001018068chr145338 4172 4095 3490 ----1471
NM_001018069chr145338 4172 4095 3490 ----1471
NM_001024858chr1422814 33 1966 31061 900 650 11180
NM_001025266chr384067 3979 3565 1843 930 806 551 273 --23846 1713 --
NM_001029883chr2--12013 12465 22634 2089
NM_001031680chr14989 413 333 95 ----2350 217
NM_001033518chr772763 2733 2641 1990 1766 589 27 --12609 1498
NM_001033519chr772763 2733 2641 1990 1766 589 27 --12609 1498
NM_001033520chr772763 2733 2641 1990 1766 589 27 --12609 1498
NM_001043318chr1452737 1493 733 713 633 --23629 27 --
NM_001167chrX76217 5871 5736 5382 4090 2468 2121 --15609 14814
NM_001399chrX63796 3677 2862 1515 1013 901 --1879 --
NM_001543chr574658 1842 1749 1435 1416 713 427 ----145
NM_002025chrX13210 ----18136
NM_002254chr222001 41 12206 1447 11652
NM_002545chr1111854 --11822 1541
NM_002646chr132183 1656 1523 ----1399
NM_002699chr171499 1129 1112 961 389 323 207 --11105 --
NM_002737chr1735220 4943 806 --25791 4811 24579 549
NM_002886chr354853 3537 3497 1812 496 --24143 698 --
NM_002957chr992896 1406 1326 1223 1110 1048 694 362 302 23700 2546 23557 3395 11100
NM_003108chr2136675 2862 2725 2693 2677 2465 2456 2342 2332 2315 1926 1915 409 12066 44792 2819 2534 2278 --
NM_003466chr272364 2156 2141 2100 2059 1947 785 12023 --154
NM_003644chr17116056 5984 5878 5719 5549 4357 2538 2039 1446 1413 526 --35491 4693 1076 --
NM_004035chr17125104 4806 4571 4436 4042 3760 3641 3331 1887 1396 1294 970 ----1769
NM_004061chr51454 ----1136
NM_004350chr14989 413 333 95 ----2350 217
NM_004501chr153774 1406 1311 549 377 ------
NM_004822chr17133620 3337 1146 1129 514 469 402 361 276 218 152 130 45 --13190 --
NM_004871chr1793189 1333 1293 1238 1188 1139 1098 982 942 --1628 13328
NM_004976chr1185064 4746 4505 4384 3234 1512 1013 933 1344 ----
NM_004992chrX36708 6549 5881 28293 470 37609 6486 1773 18226
NM_004992chrX36708 6549 5881 28293 470 37609 6486 1773 18226
NM_005184chr191412 --21385 403 11238
NM_005188chr1137960 7779 7411 ----15392
NM_005458chr94931 635 277 240 1160 2709 24 --
NM_005504chr12------158
NM_005730chr1283068 2932 2239 1020 946 740 633 544 ------
NM_005901chr1877396 7371 5613 5512 3404 2654 836 ------
NM_005906chr6166 ----11689
NM_005934chr1991928 1902 1886 834 786 316 294 42 34 11006 21699 778 --
NM_006114chr191191 ----1466
NM_006282chr2064104 3300 1620 847 504 288 1582 ----
NM_006546chr1775085 4868 4251 4105 1499 1112 940 26391 4681 --22620 99
NM_006628chr1523701 3566 ----11712
NM_006827chr1432751 2616 1226 --158 13066
NM_006943chr2073199 1137 992 857 683 653 636 ----12885
NM_007011chr1585555 5027 5019 4489 1716 1101 675 168 15956 ----
NM_007292chr17125104 4806 4571 4436 4042 3760 3641 3331 1887 1396 1294 970 ----1769
NM_007350chr1233433 3201 52 13159 --13279
NM_012234chr31360 ----1590
NM_012296chr1141200 1082 206 164 23853 1320 23543 3517 11025
NM_012405chr173648 3429 2913 2776 1289 756 349 ----153
NM_012412chr7------154
NM_013382chr1482148 957 885 761 537 180 140 57 ------
NM_013951chr272364 2156 2141 2100 2059 1947 785 12023 --154
NM_013952chr282441 2233 2218 2177 2136 2024 1576 862 12100 --1131
NM_013953chr282441 2233 2218 2177 2136 2024 1576 862 12100 --1131
NM_013992chr282441 2233 2218 2177 2136 2024 1576 862 12100 --1131
NM_014283chr1------1263
NM_014563chrX51945 1746 1418 841 515 --1383 --
NM_014586chr2164399 3709 3617 1095 1088 509 11632 13041 --
NM_014655chr162204 2137 2099 1442 459 133 ------
NM_014730chr1275158 4698 3338 3260 1365 458 407 14438 ----
NM_014730chr1275158 4698 3338 3260 1365 458 407 14438 ----
NM_014772chr1843488 2972 1286 507 --22905 983 23181 381
NM_014952chr1541663 1292 772 753 --1461 1618
NM_015042chr1584005 3963 3247 2703 1390 1028 752 509 13936 13907 --
NM_015051chr932894 2874 2170 ----22177 728
NM_015077chr1744565 4071 3877 1000 --34340 3742 1783 14202
NM_015156chr1443654 2878 1264 273 ----151
NM_015219chr1762284 1855 1653 736 452 131 --1508 1106
NM_015553chr664516 4285 4207 3494 415 251 --14167 --
NM_015575chr242901 2264 1042 757 --13409 --
NM_015610chr772763 2733 2641 1990 1766 589 27 --12609 1498
NM_015640chr145338 4172 4095 3490 ----1471
NM_015879chr1837569 6805 236 17692 --1980
NM_016003chr772763 2733 2641 1990 1766 589 27 --12609 1498
NM_016206chr398892 7845 7575 3218 2689 2532 1948 1074 54 --17519 --
NM_016227chr1------1263
NM_016946chr153371 2963 2720 2224 546 --13239 --
NM_017415chr544090 805 781 515 13775 --11578
NM_017596chr183988 3717 3278 3074 1774 1695 1633 1596 1210 23189 1502 13132
NM_017637chr948880 8803 7326 3689 19165 17076 --
NM_017643chr17------194
NM_018092chr16------11029
NM_018667chr1651917 1781 1006 792 135 22682 990 12289 12115
NM_019067chrX94736 4404 4075 3942 1715 1580 1243 398 366 ------
NM_020123chr10--1492 --11218
NM_020452chr141745 605 581 425 11575 1325 1155
NM_020813chr194701 605 304 236 ----21170 921
NM_020820chr2061359 1093 527 512 357 44 11162 1120 1154
NM_020956chr19104688 4061 3632 3457 3363 3026 1248 1152 712 107 --14321 13302
NM_021020chr863297 3080 2988 902 807 42 --13380 1114
NM_021961chr1136953 1042 281 1373 25110 2311 --
NM_022336chr22809 507 --12250 1198
NM_022462chr1942293 1150 510 217 --22886 1016 --
NM_022766chr2262606 2249 681 655 592 29 ----12363
NM_024541chr1051925 1692 1303 510 325 --21633 688 --
NM_024786chr57794 773 752 708 685 664 620 ------
NM_024887chr132067 1879 543 ----21458 177
NM_024947chr358182 7921 7567 7489 6970 --28319 1269 --
NM_024963chr7135566 5480 5414 5395 4798 4192 2355 2035 1122 763 651 551 367 --53786 3603 2309 413 59 --
NM_030650chr223506 466 ----11486
NM_030670chr1231991 877 749 187 --12032
NM_030671chr1231991 877 749 187 --12032
NM_031468chr777782 7454 6692 6375 5776 5197 3281 --1949 --
NM_031844chr153774 1406 1311 549 377 ------
NM_031904chr1151898 1765 1469 768 398 12088 1162 1598
NM_032242chr352992 2880 2624 2075 767 11002 1470 32516 237 61
NM_032458chrX32193 555 359 22123 342 ----
NM_032932chr1776433 6303 5839 4819 4403 1646 1215 22540 655 22121 41 --
NM_033387chr921767 144 --22087 1658 11902
NM_052896chr141576 780 762 752 --1145 11841
NM_052906chr2293765 3687 3422 3391 1150 906 817 451 304 14325 13959 14737
NM_053064chr1421058 831 ----142
NM_057175chr4------1558
NM_080491chr1141200 1082 206 164 23853 1320 23543 3517 11025
NM_130830chr363770 3589 3193 2990 51 37 1859 11111 --
NM_133334chr466150 6057 5952 5941 5018 4139 24815 4406 14004 --
NM_138375chr18------21157 1035
NM_138457chr693039 2811 2673 2300 825 814 583 365 120 ------
NM_145735chr1322386 1141 ----12113
NM_152924chr1585555 5027 5019 4489 1716 1101 675 168 15956 ----
NM_153450chr11170 178 --1698
NM_170672chr21518 2161 129 11204 --
NM_175709chr2262971 2910 2180 315 216 52 --12312 1269
NM_177999chr963385 917 883 674 661 49 ----1631
NM_182970chr20103922 3587 2720 1408 1268 1129 873 673 205 98 --161 13105
NM_194278chr1452737 1493 733 713 633 --23629 27 --
NM_194318chr1331898 502 198 ----11765
NM_199245chr1242041 1850 834 130 11779 22406 369 --
NM_201432chr17116056 5984 5878 5719 5549 4357 2538 2039 1446 1413 526 --35491 4693 1076 --
NM_201433chr17116056 5984 5878 5719 5549 4357 2538 2039 1446 1413 526 --35491 4693 1076 --
NM_201436chr7------154
NM_201517chr7------154
NM_205861chr132067 1879 543 ----21458 177
NM_207306chr153275 3011 2878 1588 128 11468 --1215
NM_207396chr13662 526 222 ----155