TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4453
miRNA Sequence: GAGCUUGGUCUGUAGCGGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531263 167 121 --1267 --
NM_000020chr1271917 1596 733 472 452 315 212 11796 --1888
NM_000021chr141137 ------
NM_000038chr52501 225 --12088 --
NM_000044chrX1321 ------
NM_000046chr532656 484 248 12632 22740 2575 --
NM_000067chr8159 ------
NM_000081chr131844 1192 237 ------
NM_000084chrX96816 6284 4633 4605 4228 2456 2326 982 855 1137 26448 4625 --
NM_000090chr21907 ------
NM_000112chr594941 3995 2109 1813 1458 1024 806 215 109 11868 21996 1978 12069
NM_000125chr663190 1352 1137 753 350 256 22729 333 --13576
NM_000127chr8150 ------
NM_000129chr651415 1305 557 249 231 ----1179
NM_000138chr1542211 715 197 109 ----1219
NM_000142chr441272 1204 1161 1031 --1500 --
NM_000163chr541973 856 566 291 1402 --21666 1547
NM_000167chrX1139 ------
NM_000168chr763259 3212 3089 2721 2632 2407 13048 ----
NM_000176chr523402 1426 1590 ----
NM_000189chr212060 ------
NM_000192chr1211019 --11306 --
NM_000214chr202263 129 11241 ----
NM_000216chrX73881 3540 2518 675 651 386 43 --13182 --
NM_000217chr1255132 4305 4296 935 776 --14386 --
NM_000222chr421992 546 ------
NM_000232chr442385 2207 1285 1272 11081 22323 770 --
NM_000248chr322520 1003 --11184 --
NM_000259chr1585712 4851 4658 4355 4314 2390 2058 1866 ----14334
NM_000267chr1742947 2396 542 444 --12513 --
NM_000268chr22153617 3387 3129 2977 2867 2688 2567 2496 1400 1374 1198 1036 662 568 490 --23790 2812 --
NM_000276chrX62193 1998 1376 200 111 52 11539 ----
NM_000280chr111382 ------
NM_000284chrX61892 1468 1395 1223 804 366 --1747 --
NM_000289chr121295 ------
NM_000314chr1032835 2675 1048 ------
NM_000315chr11192 ------
NM_000319chr1211087 ------
NM_000328chrX131 ------
NM_000332chr677170 6322 6300 5830 1369 1151 243 ----15618
NM_000333chr321090 216 2785 53 ----
NM_000346chr1751322 805 710 245 211 1161 ----
NM_000351chrX74317 3877 3764 2908 2891 1158 1082 13473 13745 --
NM_000353chr1661293 1027 846 820 421 150 --1931 --
NM_000358chr5194 1432 ----
NM_000362chr2253192 2933 2799 938 702 22392 1039 22872 1151 --
NM_000368chr9104182 3990 3964 3627 1710 1643 1041 776 616 104 --23091 3070 --
NM_000376chr1252972 1943 579 249 59 --1668 --
NM_000378chr112864 35 ------
NM_000379chr231402 1114 333 ------
NM_000390chrX33040 2719 1037 ------
NM_000393chr222022 193 ------
NM_000424chr123118 79 30 ------
NM_000430chr1753386 3029 1028 823 255 --1747 --
NM_000439chr51169 --122 --
NM_000452chr1331484 659 151 ------
NM_000461chr384638 3661 3571 3350 3268 1561 1112 277 1622 1883 --
NM_000480chr1141164 1129 328 262 ------
NM_000486chr1243121 2408 1137 141 --23021 426 --
NM_000489chrX43396 2947 2101 895 1432 ----
NM_000495chrX1439 ------
NM_000522chr711120 ------
NM_000531chrX1313 ------
NM_000533chrX31702 1436 302 --11710 --
NM_000536chr111504 1535 ----
NM_000550chr91890 ------
NM_000554chr1941203 593 518 272 12033 3960 482 279 --
NM_000555chrX107822 7782 7063 5904 2626 2008 1839 995 103 41 --11582 --
NM_000575chr21702 1958 1780 --
NM_000578chr241813 1303 534 374 --21799 631 --
NM_000599chr293608 3372 3051 2912 1763 1255 776 392 250 --13079 --
NM_000601chr7----1328 --
NM_000609chr1072860 2496 2284 1117 742 612 104 ------
NM_000611chr11136532 6488 6410 6191 5189 5023 4841 4452 2379 2335 2257 2037 1867 15467 16912 --
NM_000615chr1152926 2227 2155 1066 483 --22684 2172 --
NM_000618chr1246309 6094 5965 2497 --45695 5335 5230 2248 --
NM_000618chr1246309 6094 5965 2497 --45695 5335 5230 2248 --
NM_000621chr1321179 45 --11412 --
NM_000627chr22705 23 1929 1648 --
NM_000633chr1874608 4267 3917 3305 2021 318 100 1726 24649 4060 --
NM_000663chr1672935 2663 2505 2063 1928 1917 1203 ------
NM_000684chr1021266 1193 ------
NM_000689chr92208 41 1117 ----
NM_000700chr92221 66 125 ----
NM_000719chr12126067 5602 5558 5192 4431 4261 4236 2386 2219 1795 1740 1642 12679 26467 607 --
NM_000724chr101661 ------
NM_000767chr1941154 1054 545 318 --41230 1074 429 263 --
NM_000788chr411065 --1101 --
NM_000793chr1464801 4634 1318 1106 756 470 1703 ----
NM_000801chr2011091 1244 1787 --
NM_000807chr41584 ------
NM_000813chr525096 2087 33502 1619 546 ----
NM_000814chr15168 ------
NM_000816chr51572 ------
NM_000818chr102506 55 ------
NM_000826chr412063 --1932 --
NM_000827chr55994 919 873 634 34 ------
NM_000828chrX22087 1492 11992 --1445
NM_000829chr1112247 11538 11877 --
NM_000831chr1135879 5798 5753 5054 5010 4870 3986 3939 1917 1059 921 388 164 --25950 5510 --
NM_000838chr662707 1045 957 498 201 185 --12150 --
NM_000844chr32863 144 ------
NM_000859chr531349 1150 305 1686 ----
NM_000868chrX22283 2122 137 ----
NM_000875chr1566624 4931 4866 4638 1103 924 --32763 2025 1113 --
NM_000891chr1743556 2730 159 103 --11016 --
NM_000894chr19125 ------
NM_000901chr41126 ------
NM_000902chr353020 2726 2009 678 660 ------
NM_000921chr123483 265 60 ------
NM_000926chr1178055 7198 7078 6463 3117 1580 1141 19267 48089 7381 6299 2460 --
NM_000956chr143452 280 134 ------
NM_000958chr541318 1046 957 162 ------
NM_001001323chr1252721 2048 1998 556 295 1372 ----
NM_001001394chr21289 ------
NM_001001395chr1221877 1721 ----12513
NM_001001396chr144295 698 470 231 1662 ----
NM_001001481chr851007 872 627 277 185 12389 13264 --
NM_001001522chr112308 266 --1111 --
NM_001001549chr762632 2478 1863 1128 813 685 ------
NM_001001550chr762632 2478 1863 1128 813 685 ------
NM_001001555chr762632 2478 1863 1128 813 685 ------
NM_001001665chr252931 2702 2567 2242 2087 --11322 --
NM_001001685chr1792452 2163 1943 1155 1051 902 463 424 154 --21112 395 --
NM_001001890chr2124037 3534 --31484 1082 400 --
NM_001001924chr821626 306 1814 11787 --
NM_001001925chr821626 306 1814 11787 --
NM_001001931chr821626 306 1814 11787 --
NM_001001936chr1011171 ------
NM_001001971chr102241 147 ------
NM_001001974chr102811 137 11779 1761 --
NM_001001995chrX3676 557 130 ------
NM_001002027chr17174 ------
NM_001002243chr21108 ------
NM_001002257chr273377 2745 2593 1206 662 541 268 --33496 451 66 --
NM_001002258chr221999 630 1540 ----
NM_001002259chr122305 226 1311 ----
NM_001002762chr1072370 900 821 711 296 180 32 11138 12595 11169
NM_001002838chrX31475 684 287 ------
NM_001002843chr15------1360
NM_001002860chr1464239 4172 3034 1671 972 254 ----1700
NM_001002909chr172574 300 --21659 456 1242
NM_001003407chr1084374 3752 3120 1730 1623 1449 998 606 --13537 13268
NM_001003408chr1084374 3752 3120 1730 1623 1449 998 606 --13537 13268
NM_001003652chr1897589 7215 6380 2573 2300 2285 2001 1324 730 18466 ----
NM_001003712chr1233826 1088 66 11182 ----
NM_001003792chr3--1432 ----
NM_001003793chr3--1432 ----
NM_001003800chr963005 2996 1232 779 579 300 ------
NM_001003927chr172229 130 ------
NM_001003940chr1553072 2891 1507 931 163 ------
NM_001003942chr1553072 2891 1507 931 163 ------
NM_001003943chr1553076 2895 1511 935 167 ------
NM_001004317chr663301 3085 3060 1572 676 153 13996 14139 13561
NM_001004342chr185421 5009 4769 4039 3909 2332 1889 1507 25244 4927 75682 5597 5464 4485 1386 1309 73 24696 3847
NM_001004360chr221461 168 ----1759
NM_001004419chr1244630 4594 4281 23 14503 11348 --
NM_001004441chr531642 1436 1378 21612 486 ----
NM_001005266chr15135 183 ----
NM_001005267chr15135 183 ----
NM_001005268chr15135 183 ----
NM_001005269chr15135 183 ----
NM_001005271chr176722 289 266 204 61 30 1966 ----
NM_001005273chr176722 289 266 204 61 30 1966 ----
NM_001005354chr12155 ------
NM_001005375chrY21273 651 1142 ----
NM_001005386chr231877 948 127 ------
NM_001005404chr1762982 2926 1571 1346 843 65 --11187 13471
NM_001005463chr1021741 989 ------
NM_001005502chr1254911 3408 3190 3183 1285 14369 --11199
NM_001005505chr351736 541 391 308 127 ------
NM_001005609chrX53406 3270 1214 1198 1183 --43370 2955 1418 1335 --
NM_001005732chr211649 ------
NM_001005733chr211606 ------
NM_001005739chr22577 570 ------
NM_001005753chr241819 743 675 457 --12267 --
NM_001005849chr171573 ------
NM_001005920chr16----1370 --
NM_001006115chr372744 2649 2161 988 921 838 630 --52261 927 693 240 204 --
NM_001006617chr92918 58 ------
NM_001006619chr92918 58 ------
NM_001006620chr92918 58 ------
NM_001006621chr92918 58 ------
NM_001006641chr951200 1152 521 305 248 --2110 95 --
NM_001006642chr951200 1152 521 305 248 --2110 95 --
NM_001006643chr951200 1152 521 305 248 --2110 95 --
NM_001006945chr11658 --1273 --
NM_001007023chr1464801 4634 1318 1106 756 470 1703 ----
NM_001007097chr994556 3650 3343 2042 2030 1824 1384 229 66 14632 ----
NM_001007098chr1125 --1313 1604
NM_001007102chr611641 ------
NM_001007156chr1551788 1768 1717 779 510 --41846 1586 743 551 1571
NM_001007246chr211650 2680 211 --1489
NM_001007257chr12366 158 --199 --
NM_001007466chr654971 4340 3751 3204 1517 13637 --15118
NM_001007471chr91804 ------
NM_001007527chr51220 ------
NM_001007553chr1142 ------
NM_001007559chr1821963 1716 --21827 1661 --
NM_001008220chr553611 2725 957 781 204 --5857 747 629 516 491 --
NM_001008222chrX51343 1173 512 163 93 --1385 --
NM_001008239chr1833215 1474 327 ------
NM_001008392chr382828 2245 1327 1267 776 637 325 112 --11313 11089
NM_001008407chr761698 1611 1360 692 576 173 --11507 --
NM_001008408chr745134 4017 365 191 14142 2449 246 --
NM_001008495chr832207 1952 83 ------
NM_001008541chr101655 1661 12091 --
NM_001008541chr101655 1661 12091 --
NM_001008564chr133887 872 513 ------
NM_001008738chr532011 1925 563 12527 22265 1846 --
NM_001008783chr63835 751 326 ------
NM_001008860chr151649 ------
NM_001008892chr151649 ------
NM_001008894chr151649 ------
NM_001008895chr131329 --11182 --
NM_001009185chr51739 ------
NM_001009552chr8--1393 ----
NM_001009554chr453711 3301 987 661 84 14680 --14049
NM_001009554chr453711 3301 987 661 84 14680 --14049
NM_001009555chr41600 --21117 111 --
NM_001009899chr3114582 3945 2428 2270 2072 1971 1407 1009 574 513 229 26031 185 52184 2015 1910 1371 248 --
NM_001009959chr221719 262 ------
NM_001009960chr762392 2310 985 896 628 39 12253 21140 872 --
NM_001010853chr673238 3136 2431 2083 1319 1156 632 --41264 1132 717 551 --
NM_001010867chr1116013 5884 5705 5486 4368 4124 1699 1170 426 183 25 --55359 5181 2024 1140 1040 16428
NM_001010888chrX123328 3298 3279 2993 1358 1333 1327 1321 1257 455 275 260 1106 1621 --
NM_001010891chr5106681 6467 5975 5726 5179 4936 2709 2622 2596 60 15849 65290 5124 2541 2002 914 402 --
NM_001010908chr102594 554 ------
NM_001010932chr7----1328 --
NM_001010980chr173374 3009 2816 2715 2301 1040 447 12743 12633 11413
NM_001011513chr433740 235 147 1950 ----
NM_001011546chr201255 1779 ----
NM_001011551chrX2502 455 --1466 --
NM_001011645chrX1321 ------
NM_001011658chrX71384 791 680 625 578 459 374 --32089 1333 294 --
NM_001011666chr776438 6080 5844 5693 4547 4346 557 21429 1320 11549 15026
NM_001011708chr232936 2133 306 ------
NM_001011713chr1411105 ------
NM_001012267chr92257 232 11441 ----
NM_001012270chr1731919 1506 556 --11379 --
NM_001012271chr1732022 1609 659 --11482 --
NM_001012393chr1174836 4727 4531 3707 3428 1646 435 21203 804 23290 1612 --
NM_001012398chr16158 ------
NM_001012420chr1542336 2166 1054 484 --12815 --
NM_001012423chr1542336 2166 1054 484 --12815 --
NM_001012426chr682901 2753 2665 2369 2130 673 90 56 --52362 1099 845 791 664 --
NM_001012427chr682901 2753 2665 2369 2130 673 90 56 --52362 1099 845 791 664 --
NM_001012753chr1931132 828 38 ------
NM_001012755chrX34112 1692 1391 --23234 1225 --
NM_001012968chrX22659 2442 ------
NM_001012989chrX3617 513 479 ------
NM_001013031chr1053441 2963 990 955 830 12889 ----
NM_001013406chr73573 92 24 21277 501 --11651
NM_001013415chr421487 1375 ------
NM_001013438chr31217 --1823 170
NM_001013439chr3163 --1669 --
NM_001013620chr1277804 7324 6687 6385 2978 2922 1135 --23034 2867 --
NM_001013635chr1221019 201 ----11027
NM_001013699chr122352 196 ------
NM_001014380chr1363622 2344 1368 884 858 79 --55791 5162 2289 802 753 --
NM_001014797chr1085556 3053 2982 2750 2267 2021 1062 38 --16826 11617
NM_001014839chr11248 --11066 --
NM_001014841chr11248 --11066 --
NM_001015045chr432159 833 412 22035 1939 --1840
NM_001015877chrX22230 711 32678 611 293 ----
NM_001015881chrX3505 229 80 --1797 --
NM_001017368chr1732666 710 126 189 ----
NM_001017371chr22462 455 ----1244
NM_001017395chr313583 --1540 12301
NM_001017535chr1252972 1943 579 249 59 --1668 --
NM_001017923chr1411414 --2675 667 --
NM_001017926chr821267 417 --11501 --
NM_001017928chr3168 ------
NM_001018054chr111155 --11133 --
NM_001018057chr1131339 1132 468 --3182 170 87 --
NM_001018065chr975694 5245 5002 4531 1989 1900 154 22314 1510 34331 3717 2034 --
NM_001018066chr975694 5245 5002 4531 1989 1900 154 22314 1510 34331 3717 2034 --
NM_001018067chr145374 4064 3567 1996 14756 24009 3479 --
NM_001018068chr145374 4064 3567 1996 14756 24009 3479 --
NM_001018069chr145374 4064 3567 1996 14756 24009 3479 --
NM_001018074chr523402 1426 1590 ----
NM_001018075chr523402 1426 1590 ----
NM_001018076chr523402 1426 1590 ----
NM_001018077chr523402 1426 1590 ----
NM_001018111chr763106 2934 1540 1161 1120 58 --43060 2680 825 548 --
NM_001020658chr11423 --11360 --
NM_001020658chr11423 --11360 --
NM_001023567chr15----12207 --
NM_001024094chr523402 1426 1590 ----
NM_001024455chrX5981 821 674 275 263 1455 ----
NM_001024465chr6176 ------
NM_001024660chr341642 628 610 337 ------
NM_001024668chr121961 ------
NM_001024680chr211133 --21396 1262 --
NM_001024808chr1292479 2274 1112 767 711 644 637 127 119 1338 ----
NM_001024847chr362425 714 708 438 212 130 --11553 --
NM_001024948chr153289 2375 1399 1375 703 13242 ----
NM_001024956chr1164731 4713 4185 3754 3651 397 11085 24825 1695 --
NM_001025076chr1055433 5018 4943 2201 850 25752 4539 ----
NM_001025077chr1066791 6376 6301 4902 4771 2208 27110 5897 ----
NM_001025079chr344152 3429 3119 1636 13989 13533 --
NM_001025105chr52961 475 ------
NM_001025107chr162615 2172 1841 759 219 199 12056 1839 --
NM_001025107chr162615 2172 1841 759 219 199 12056 1839 --
NM_001025108chr293270 3027 2957 2842 2816 1162 1148 725 681 --32933 2761 1046 1255
NM_001025233chr12102797 2711 2688 2493 2261 1055 904 730 378 249 --1276 12695
NM_001025266chr333387 1836 1678 14201 33756 1623 42 --
NM_001025389chr1141164 1129 328 262 ------
NM_001025390chr1141164 1129 328 262 ------
NM_001025580chrX11012 ------
NM_001025616chr421372 341 1368 ----
NM_001029858chr663036 2499 2369 687 179 156 --11235 --
NM_001029863chr673027 2274 2256 2005 864 468 407 12464 ----
NM_001029875chr522755 2631 1945 2949 213 --
NM_001029882chr1----1651 --
NM_001029882chr1----1651 --
NM_001029884chr622594 672 --22031 1873 --
NM_001029998chr411264 ------
NM_001030001chr14----173 --
NM_001030007chr1643839 3465 1375 919 ------
NM_001030055chr1444678 3923 582 24 1492 11550 --
NM_001030272chr111186 ------
NM_001030273chr111186 ------
NM_001031623chr621373 426 ------
NM_001031684chr241441 1333 1203 1192 1926 1971 --
NM_001031690chr763117 2935 2008 1254 1183 1074 --23056 171 --
NM_001031695chr2285396 4854 4337 4027 4007 3961 2053 1803 24802 4117 25123 3579 --
NM_001031700chr452045 1930 139 82 67 22496 2081 12284 --
NM_001031732chr463487 2804 2742 2383 2267 150 13128 23500 2844 13335
NM_001031748chr122116 109 ------
NM_001031804chr1654248 3542 3184 2927 787 ------
NM_001032280chr611412 --1314 --
NM_001032293chr171438 --173 --
NM_001032363chr131780 154 82 --31724 1529 658 --
NM_001032363chr131780 154 82 --31724 1529 658 --
NM_001032380chr1031942 464 172 ------
NM_001033045chr233849 3464 3061 183 ----
NM_001033057chr322036 724 ------
NM_001033059chr61341 ------
NM_001033081chr171851 1699 1362 1281 507 487 44 ------
NM_001033082chr171851 1699 1362 1281 507 487 44 ------
NM_001033112chr52819 252 ------
NM_001033117chr3134596 4389 3671 3629 3449 3344 3287 1777 1434 1415 1171 932 739 ------
NM_001033506chr111396 1282 ----
NM_001033518chr721063 310 --12171 --
NM_001033519chr721063 310 --12171 --
NM_001033520chr721063 310 --12171 --
NM_001033551chr17113736 3730 3471 2996 1468 1244 800 674 649 290 144 --63816 3023 1287 1135 633 620 11627
NM_001033561chr172183 76 ------
NM_001033566chr172848 783 1864 1286 --
NM_001033568chr172848 783 1864 1286 --
NM_001033578chr832319 1922 216 ------
NM_001033602chr1341001 822 695 585 1866 12434 --
NM_001033659chr1751416 1238 1121 353 47 ----11050
NM_001033723chr832666 2130 360 22761 411 22525 2397 --
NM_001034025chr123300 235 28 --2895 379 --
NM_001034837chr51300 ------
NM_001034838chr51300 ------
NM_001034841chr16124951 4415 4250 4115 3974 3645 3397 1518 1175 826 724 132 1615 44608 4226 4060 1740 --
NM_001034845chr421373 987 --1427 --
NM_001034850chr52351 99 ------
NM_001034954chr103695 391 153 ------
NM_001034955chr103695 391 153 ------
NM_001034956chr103695 391 153 ------
NM_001034957chr103695 391 153 ------
NM_001035chr12896 863 1318 ----
NM_001035003chr41124 ------
NM_001035004chr41124 ------
NM_001035260chr101317 21352 467 ----
NM_001037132chr742183 1494 654 51 11634 ----
NM_001037133chr742183 1494 654 51 11634 ----
NM_001037290chr112642 392 ------
NM_001037304chr11------125
NM_001037331chr182646 319 ------
NM_001037339chr12482 206 ------
NM_001037340chr12482 206 ------
NM_001037341chr12482 206 ------
NM_001037341chr12482 206 ------
NM_001037497chr6128 ------
NM_001037553chr2184821 4645 4487 4471 3947 3322 1250 1176 --13216 --
NM_001037582chr441253 1242 587 301 --2551 246 --
NM_001037631chr2--1441 ----
NM_001038707chr132032 1554 488 ------
NM_001038707chr132032 1554 488 ------
NM_001039350chr731402 357 166 ------
NM_001039459chr74925 908 863 728 --1942 --
NM_001039538chr223227 2622 --1352 --
NM_001039547chr3117513 6859 6652 5967 4988 2737 2711 2100 1175 565 115 --32928 2822 2656 1348
NM_001039569chr253027 2573 2407 846 308 ------
NM_001039580chr444467 1215 1007 300 11576 21347 615 --
NM_001039585chr154211 3775 1357 361 130 ------
NM_001039590chrX43953 3120 2739 44 ----1673
NM_001039591chrX43953 3120 2739 44 ----1673
NM_001039618chr1124342 2320 --24728 243 --
NM_001039690chr16131692 881 734 719 695 689 645 410 374 368 362 278 228 ------
NM_001039762chr1041944 591 372 331 ------
NM_001039840chrX33985 1539 412 12186 ----
NM_001039888chr1----1719 --
NM_001039937chr1323575 1573 11051 ----
NM_001040057chr721463 1116 11221 ----
NM_001040097chr7----1167 --
NM_001040098chr7----1167 --
NM_001040099chr7----1167 --
NM_001040102chr10102519 2229 2002 1956 1923 1795 1772 992 626 407 --188 --
NM_001040103chr10102519 2229 2002 1956 1923 1795 1772 992 626 407 --188 --
NM_001040113chr162871 382 ------
NM_001040142chr222191 1497 ------
NM_001040143chr222191 1497 ------
NM_001040144chr16131692 881 734 719 695 689 645 410 374 368 362 278 228 ------
NM_001040146chr16131692 881 734 719 695 689 645 410 374 368 362 278 228 ------
NM_001040151chr1174533 4477 4350 4310 4138 1724 1096 --13423 11208
NM_001040152chr764603 3487 3446 883 800 121 --2818 767 --
NM_001040181chr31305 ------
NM_001040182chr31305 ------
NM_001040183chr31305 ------
NM_001040199chr31305 ------
NM_001040200chr31305 ------
NM_001040202chr422553 392 1444 ----
NM_001040214chr641531 660 611 282 --12062 --
NM_001040272chr941682 622 253 153 --2735 75 1843
NM_001040284chr1635357 4838 4143 15832 ----
NM_001040402chr422489 945 ------
NM_001040429chr1342808 2519 1271 473 --12839 1515
NM_001040441chr155146 4333 3628 3398 778 12063 25260 2179 --
NM_001040446chr552654 2532 2334 2181 432 --12591 --
NM_001040450chr1552784 2609 2488 1826 210 1324 12064 --
NM_001040453chr1552784 2609 2488 1826 210 1324 12064 --
NM_001040455chr1111055 ------
NM_001040624chr862389 2245 1924 546 498 360 1468 1560 --
NM_001040625chr862389 2245 1924 546 498 360 1468 1560 --
NM_001040626chr862389 2245 1924 546 498 360 1468 1560 --
NM_001040627chr862389 2245 1924 546 498 360 1468 1560 --
NM_001040628chr862389 2245 1924 546 498 360 1468 1560 --
NM_001040629chr862389 2245 1924 546 498 360 1468 1560 --
NM_001040630chr862389 2245 1924 546 498 360 1468 1560 --
NM_001040633chr73813 185 147 --1424 --
NM_001040665chr732010 825 353 23537 157 11974 --
NM_001040709chr142258 1889 965 712 --1764 --
NM_001040712chr973583 2781 2773 2728 2381 1204 654 ------
NM_001040715chr162941 780 ------
NM_001040876chr41386 1246 1265 --
NM_001042388chr182842 137 ------
NM_001042406chr64462 345 315 198 ------
NM_001042425chr611412 --1314 --
NM_001042430chr143531 414 209 --164 --
NM_001042453chrX2559 389 --1542 --
NM_001042473chr1021339 338 1651 ----
NM_001042475chr6----1275 --
NM_001042492chr1742947 2396 542 444 --12513 --
NM_001042493chr641931 1837 1694 1312 ------
NM_001042494chr1593610 2724 2604 2350 1320 1236 849 280 240 --12549 --
NM_001042495chr1593610 2724 2604 2350 1320 1236 849 280 240 --12549 --
NM_001042496chr1593610 2724 2604 2350 1320 1236 849 280 240 --12549 --
NM_001042497chr1593610 2724 2604 2350 1320 1236 849 280 240 --12549 --
NM_001042498chrX174 ------
NM_001042506chrX--11246 1476 --
NM_001042517chr132911 345 ------
NM_001042533chr382761 2620 2112 2032 1187 234 198 90 --12554 --
NM_001042537chrX52055 1989 1795 925 523 1104 ----
NM_001042539chr161235 --1187 --
NM_001042543chr411151 ------
NM_001042548chr2------134
NM_001042555chr1264671 4520 4396 2946 1074 1058 24492 3019 ----
NM_001042599chr286333 5331 2400 1763 1691 1231 1143 1092 25720 5317 --12382
NM_001042601chr342457 2257 997 935 ------
NM_001042603chr1284433 4139 3959 3476 3418 3360 1588 625 --33307 921 800 24817 2152
NM_001042604chr354209 3716 3116 1952 1107 13445 --13184
NM_001042632chr2062335 2226 1810 1796 1730 580 --21950 956 --
NM_001042633chr2062335 2226 1810 1796 1730 580 --21950 956 --
NM_001042646chr32400 342 ----1126
NM_001042669chr421372 341 1368 ----
NM_001042683chr6173 ------
NM_001042749chrX11485 1208 ----
NM_001042750chrX11485 1208 ----
NM_001042751chrX11485 1208 ----
NM_001043318chr1463584 1458 927 859 852 174 --42949 2822 2648 474 --
NM_001044305chr611178 ------
NM_001046chr512882 ------
NM_001048183chr183508 3086 2884 2799 2715 2633 729 584 --33453 3140 3028 --
NM_001071775chr1351711 1552 1430 300 34 ------
NM_001083620chr412061 --1931 --
NM_001094chr17174 --1533 --
NM_001095chr1261690 1535 1386 1195 514 249 ------
NM_001099678chr364873 4738 4452 2562 1878 256 ------
NM_001100108chr1107812 7136 7081 6908 6761 6723 6625 5250 2447 827 25896 2360 18346 17046
NM_001106chr3169770 9621 9344 8313 8075 7666 7507 7252 6950 6595 3632 3406 3260 2298 1682 772 12327 18635 13350
NM_001111chr162615 2172 1841 759 219 199 12056 1839 --
NM_001113490chrX63378 2624 1265 1056 514 479 ------
NM_001116chr1662767 2463 2152 742 619 81 --12054 --
NM_001117chr1852443 1913 1735 1552 568 --1328 --
NM_001121chr1011377 ------
NM_001122679chr531263 167 121 --1267 --
NM_001128chr1643839 3465 1375 919 ------
NM_001129chr72292 60 139 ----
NM_001148chr421833 167 ------
NM_001160chr1262149 995 969 868 671 375 12046 2914 616 1732
NM_001167chrX64357 2585 2387 2130 1950 111 --35813 2063 1895 25689 4845
NM_001173chr1444678 3923 582 24 1492 11550 --
NM_001178chr111186 ------
NM_001186chr2152309 2221 845 577 445 1585 ----
NM_001198chr621852 1576 ------
NM_001201chr423916 2903 11127 12848 --
NM_001204chr2147501 7165 6928 6855 5677 5363 4960 4735 2415 1235 1148 966 549 537 37317 1875 437 ----
NM_001206chr942440 2377 2291 789 ------
NM_001217chr19137 ------
NM_001219chr732143 2020 675 --22248 1822 --
NM_001237chr43458 416 117 ------
NM_001237chr43458 416 117 ------
NM_001241chr222004 406 ------
NM_001241chr222004 406 ------
NM_001254chr172961 915 --1401 --
NM_001256chr1712261 --22089 1925 --
NM_001259chr795365 4889 4570 4159 1183 823 339 134 23 --11519 --
NM_001260chr13----1133 --
NM_001271chr1542971 2048 1194 1023 --13046 12717
NM_001278chr103881 473 190 ------
NM_001284chr51422 ------
NM_001289chrX11239 21194 301 ----
NM_001290chr42766 190 ------
NM_001292chr1541004 997 911 94 ----11106
NM_001295chr361497 1053 959 407 282 50 ------
NM_001304chr1743607 2599 1031 39 --11408 --
NM_001310chr1232616 1085 558 ------
NM_001332chr5--1181 ----
NM_001351chr31725 154 ----
NM_001356chrX12298 137 ----
NM_001362chr143890 337 82 1633 ----
NM_001364chr1154329 3770 3611 3054 1661 13927 34494 4425 1465 --
NM_001369chr51469 1443 1376 --
NM_001386chr842102 1946 1706 685 12079 1250 --
NM_001387chr562909 2301 969 762 336 128 --12918 --
NM_001389chr211590 ------
NM_001390chr1882724 1210 1097 1064 1051 673 358 33 139 12351 --
NM_001391chr182790 287 ------
NM_001399chrX53406 3270 1214 1198 1183 --43370 2955 1418 1335 --
NM_001400chr13970 404 291 ------
NM_001402chr672056 1507 1396 1325 1299 800 772 ----11250
NM_001417chr1231580 1298 488 --11209 --
NM_001418chr111266 ------
NM_001418chr111266 ------
NM_001419chr1994343 3809 3393 2978 1370 1324 731 660 493 --21818 725 --
NM_001420chr1972905 2859 2845 2804 2645 1116 404 12205 22688 238 --
NM_001427chr751547 1337 665 620 498 --1299 --
NM_001430chr23549 341 147 --31888 1287 452 --
NM_001431chr621194 69 --1365 --
NM_001438chr153677 3012 3006 1112 905 ------
NM_001444chr8----150 --
NM_001454chr173334 169 39 --2817 742 --
NM_001483chr72815 106 ------
NM_001494chr101501 --1687 --
NM_001546chr631307 298 38 ----11423
NM_001565chr42240 96 ----1202
NM_001584chr111326 --21005 280 --
NM_001587chrX62193 1998 1376 200 111 52 11539 ----
NM_001604chr111382 ------
NM_001616chr21561 32430 2211 708 --23529 58
NM_001628chr7128 ------
NM_001634chr61341 ------
NM_001635chr71867 --1245 --
NM_001650chr1862809 2801 2524 1528 1029 473 --34132 867 580 --
NM_001655chr1132058 451 267 --2561 396 --
NM_001659chr1232412 1703 637 ------
NM_001668chr122023 461 --11860 --
NM_001677chr11373 ------
NM_001678chr1711223 11380 1461 --
NM_001679chr31300 ------
NM_001682chr1222435 270 186 ----
NM_001684chr134012 415 187 1379 ----
NM_001689chr221999 630 1540 ----
NM_001690chr342444 828 445 45 --1663 --
NM_001699chr1931696 1351 536 --2621 455 141
NM_001701chr911513 1176 ----
NM_001709chr1162841 2076 1996 1935 813 778 --11093 --
NM_001717chr15133 11247 ----
NM_001719chr201345 --135 --
NM_001723chr6141 --1299 --
NM_001729chr42357 36 ------
NM_001730chr132589 232 ------
NM_001730chr132589 232 ------
NM_001743chr21239 --1572 --
NM_001753chr721242 70 1540 177 --
NM_001754chr2124037 3534 --31484 1082 400 --
NM_001755chr1642118 802 759 288 22243 586 1735 --
NM_001759chr1254273 3736 3633 1820 992 ------
NM_001760chr63207 91 33 --1269 --
NM_001762chr71701 --181 --
NM_001769chr121381 ------
NM_001777chr344152 3429 3119 1636 13989 13533 --
NM_001789chr31262 --133 --
NM_001796chr161102 ------
NM_001802chr162828 196 ------
NM_001806chr1932144 1018 565 1887 --1849
NM_001830chrX22819 217 21288 953 23768 3671 --
NM_001839chr11105 ----160
NM_001842chr91398 --1184 --
NM_001845chr1341388 1369 1309 200 ------
NM_001854chr121027 78 ------
NM_001856chr11342 ------
NM_001858chr654600 4528 4244 3133 128 --34817 1710 863 --
NM_001859chr993932 3607 3426 2546 1495 1187 922 563 215 11329 --1290
NM_001874chr1254911 3408 3190 3183 1285 14369 --11199
NM_001884chr51438 186 ----
NM_001892chr52961 475 ------
NM_001895chr201985 ------
NM_001901chr61867 194 ----
NM_001904chr3----1419 --
NM_001918chr1108573 8077 7506 7387 7273 7025 6885 2735 2495 1930 --17110 --
NM_001920chr123707 631 548 ------
NM_001923chr113528 252 108 ------
NM_001924chr1171 ------
NM_001932chr173356 261 86 --123 --
NM_001933chr1441195 849 120 25 --2426 182 --
NM_001936chr731402 357 166 ------
NM_001938chr131927 1400 305 ------
NM_001939chrX72994 2380 983 500 334 278 237 --1960 --
NM_001941chr1851519 1475 1287 1182 151 1893 ----
NM_001949chr642876 1275 416 204 1570 32083 690 235 --
NM_001954chr61623 ------
NM_001964chr51126 --1242 --
NM_001967chr31524 ------
NM_001968chr4142 ------
NM_001969chr1473803 3796 3468 2602 1211 869 335 --12581 --
NM_001970chr172636 67 --196 --
NM_001977chr41120 ------
NM_001980chr1232094 659 459 11974 2576 404 --
NM_001987chr1254084 3876 3653 3300 2881 23293 2673 --1941
NM_001993chr11310 --2416 223 --
NM_002006chr455245 4358 4219 4073 2047 --13679 --
NM_002009chr1561893 1055 991 457 429 139 12129 ----
NM_002014chr121651 --1640 --
NM_002015chr1363325 2921 2356 2109 585 328 --12100 --
NM_002017chr1111352 ------
NM_002024chrX11605 11844 ----
NM_002025chrX98694 3269 2929 2436 2402 2083 2059 706 347 --38645 5902 2904 17634
NM_002031chr6------1248
NM_002039chr43829 715 144 ------
NM_002040chr212648 483 ------
NM_002045chr31372 ----1306
NM_002048chr91137 --1243 --
NM_002054chr21479 ------
NM_002056chr21704 ------
NM_002060chr13504 184 145 ------
NM_002061chr141838 1575 404 144 ------
NM_002063chrX1330 1165 --1822
NM_002072chr91929 ------
NM_002076chr1252723 1308 668 511 401 --32808 1253 611 --
NM_002086chr1731971 359 71 --1562 --
NM_002092chr494959 4248 4086 3824 3677 3596 1812 1353 643 11702 24359 4192 24568 1566
NM_002106chr41131 ------
NM_002139chrX1261 ------
NM_002140chr92883 837 ------
NM_002148chr21498 ------
NM_002158chr243279 2866 2474 2339 12594 23296 1006 --
NM_002166chr22726 114 ------
NM_002176chr9145 ------
NM_002198chr53712 123 105 --1654 --
NM_002199chr42778 244 ------
NM_002203chr564067 3009 1384 1198 551 318 ------
NM_002214chr764699 3585 2211 1260 1150 956 14861 21457 1205 --
NM_002221chr172210 1960 1151 997 981 645 404 --12529 --
NM_002223chr1252928 1313 971 666 119 11469 ----
NM_002227chr1165 1838 ----
NM_002228chr1177 --1131 --
NM_002232chr131386 1283 386 ------
NM_002239chr22227 144 ----1969
NM_002247chr1031919 1750 342 ------
NM_002254chr251476 1458 825 693 311 ------
NM_002265chr171464 ------
NM_002267chr132401 275 ------
NM_002268chr351879 616 441 382 112 11892 ----
NM_002270chr575552 4881 4863 4605 3922 3775 3561 23523 1539 11404 --
NM_002271chr1311791 42283 2223 1983 846 ----
NM_002285chr293270 3027 2957 2842 2816 1162 1148 725 681 --32933 2761 1046 1255
NM_002290chr621081 923 11484 ----
NM_002293chr122167 505 11855 --12316
NM_002310chr584550 2332 1008 919 472 418 240 41 15470 ----
NM_002313chr1084374 3752 3120 1730 1623 1449 998 606 --13537 13268
NM_002336chr1245048 4827 3537 795 24204 1884 ----
NM_002345chr12--1589 ----
NM_002353chr1162 ------
NM_002355chr124523 352 314 70 ------
NM_002356chr632614 2399 724 --1935 --
NM_002358chr41644 ------
NM_002359chr17104116 3963 3023 1719 1595 1324 1052 407 362 271 ------
NM_002373chr1521147 1021 --11380 --
NM_002374chr223227 2622 --1352 --
NM_002381chr23835 724 678 ------
NM_002384chr182398 115 --1962 --
NM_002397chr52860 198 ------
NM_002398chr231483 1041 255 11335 --1110
NM_002399chr1531363 462 183 ----1110
NM_002401chr1762488 1753 972 728 650 89 --32233 2124 514 --
NM_002403chr12409 142 ------
NM_002448chr41520 1787 ----
NM_002479chr12491 84 --290 42 --
NM_002489chr71296 ------
NM_002500chr21824 --1117 --
NM_002501chr19103798 3330 3185 3119 1099 1077 1063 694 546 280 ------
NM_002508chr1130 ------
NM_002514chr81205 11057 1766 --
NM_002522chr1763065 2610 1463 1275 1203 1140 --12828 --
NM_002523chr731162 250 37 --1467 11018
NM_002539chr2131 ------
NM_002543chr121282 21017 60 1221 --
NM_002545chr1174836 4727 4531 3707 3428 1646 435 21203 804 23290 1612 --
NM_002546chr81639 ------
NM_002547chrX74215 2874 1397 1281 893 768 270 12659 11269 --
NM_002553chr72492 44 --150 --
NM_002556chr112103 89 ------
NM_002569chr1571186 1123 1084 1060 388 335 26 --1619 --
NM_002570chr152817 149 11026 ----
NM_002572chr111308 ------
NM_002576chr11133 --11045 --
NM_002581chr934229 1107 495 44260 3459 1244 512 2439 178 --
NM_002583chr122486 107 ------
NM_002588chr561735 1152 638 566 423 74 ------
NM_002590chr132501 462 ------
NM_002592chr20----134 --
NM_002594chr2012208 ------
NM_002595chr122634 22 ------
NM_002600chr12482 206 ------
NM_002628chr3----1248 --
NM_002632chr142837 808 1276 ----
NM_002642chr1133 ------
NM_002646chr111489 --21434 33 11552
NM_002655chr865107 4945 4828 4366 3346 999 13497 23950 3260 --
NM_002667chr62441 335 11270 ----
NM_002687chr141983 ------
NM_002706chr21694 ------
NM_002709chr253560 3161 2242 1265 1220 ------
NM_002710chr12--1801 ----
NM_002711chr71233 2268 36 ----
NM_002713chr141096 977 416 325 ------
NM_002715chr511240 ------
NM_002716chr1153671 3065 2533 1044 111 ------
NM_002718chr342455 636 296 108 12439 12128 --
NM_002719chr1442318 1535 647 254 ------
NM_002721chr9--1461 ----
NM_002729chr101665 ------
NM_002731chr132537 2260 188 ------
NM_002736chr732226 719 86 11760 ----
NM_002738chr162418 42 --188 --
NM_002742chr141513 ------
NM_002745chr2231777 1417 1069 --13257 --
NM_002747chr1871836 680 658 478 450 433 22 ------
NM_002748chr151404 ------
NM_002753chr42741 263 --1324 --
NM_002756chr174770 324 202 166 184 1380 --
NM_002763chr1------162
NM_002833chr1521488 465 ----1434
NM_002834chr1253687 3589 3577 1431 1100 --13089 --
NM_002837chr1283943 3167 3144 1706 1649 1416 631 236 --43922 3252 3089 1194 --
NM_002839chr973583 2781 2773 2728 2381 1204 654 ------
NM_002843chr1122653 2273 --11229 --
NM_002851chr71567 ------
NM_002857chr132600 2202 787 --1636 --
NM_002858chr121070 154 11160 ----
NM_002869chr112787 493 21563 1363 ----
NM_002886chr344213 4206 1623 320 12039 1470 14395
NM_002890chr5--1185 ----
NM_002893chrX163 ------
NM_002906chr1121715 35 ------
NM_002920chr121356 ------
NM_002922chr12157 40 1526 ----
NM_002924chr11247 ------
NM_002940chr41386 1246 1265 --
NM_002941chr3------1365
NM_002942chr32938 309 1528 ----
NM_002948chr321227 265 ------
NM_002956chr1231028 544 410 --1378 --
NM_002968chr161310 ------
NM_002971chr33939 893 876 ------
NM_002973chr121473 ------
NM_002976chr22121 61 ------
NM_002990chr1682526 2091 1754 1640 1604 678 515 303 --22067 285 11990
NM_002998chr811765 --1365 --
NM_003010chr1741599 947 509 277 ------
NM_003011chr931472 1169 64 --1281 11260
NM_003017chr6295 74 --11293 --
NM_003026chr931156 129 90 ------
NM_003027chr151411 ------
NM_003030chr321675 206 ----11965
NM_003034chr1276878 6854 6644 6564 6454 139 80 11645 67091 6399 5537 3150 2758 1292 --
NM_003036chr11130 1300 1188 --
NM_003042chr342042 1797 862 238 ------
NM_003043chr374170 3610 3215 1225 1138 1027 923 --23616 1644 --
NM_003045chr1351282 1032 768 452 357 --44372 4049 3066 301 --
NM_003051chr131924 1883 688 ------
NM_003068chr821009 844 ------
NM_003071chr341814 1604 1582 298 ------
NM_003074chr32278 119 ------
NM_003077chr171249 ------
NM_003079chr171978 ------
NM_003107chr642574 1984 1887 380 ------
NM_003108chr245926 5384 5329 1748 ----12350
NM_003111chr22462 455 ----1244
NM_003112chr732396 2066 331 ------
NM_003113chr2146 ------
NM_003115chr11422 ------
NM_003128chr242617 2358 1993 62 --12773 1188
NM_003137chr621409 60 1539 ----
NM_003139chr112787 702 ------
NM_003144chr622069 895 ----1909
NM_003150chr1752265 2065 1952 948 497 ------
NM_003155chr842686 2177 2104 1947 12740 ----
NM_003156chr111999 ------
NM_003161chr1733277 2546 425 --23473 817 --
NM_003162chr23715 303 197 11016 1404 --
NM_003178chr331845 1386 276 21961 700 1419 --
NM_003180chr19394 76 26 ------
NM_003186chr112308 266 --1111 --
NM_003189chr162417 2363 1132 698 494 279 --22536 407 --
NM_003199chr1834678 685 271 11551 ----
NM_003206chr61414 ------
NM_003212chr341125 915 388 362 --1307 11062
NM_003220chr611412 --1314 --
NM_003221chr664142 3602 3545 3207 2904 705 ------
NM_003234chr352410 2372 2353 1803 452 1186 ----
NM_003236chr252916 2720 2606 2460 2381 12349 13180 2584 349
NM_003242chr362425 714 708 438 212 130 --11553 --
NM_003246chr1531562 1268 224 ------
NM_003253chr2131867 1565 208 11232 ----
NM_003262chr344532 1985 1751 133 14780 25047 4450 --
NM_003268chr1131 ----168
NM_003274chr2142869 2801 2567 2214 ------
NM_003290chr191115 ------
NM_003297chr121289 ------
NM_003298chr3104735 4715 4320 2360 1801 1710 1518 1356 893 427 24787 4773 14612 --
NM_003314chr5126 ------
NM_003319chr21827 11009 --1711
NM_003320chr11134205 3911 3898 3625 2759 1642 1627 1239 1034 955 762 554 499 --1302 --
NM_003326chr132511 1701 29 --149 --
NM_003330chr1231609 352 265 ------
NM_003336chrX1300 --1138 --
NM_003337chr51244 ------
NM_003339chr521249 1076 21486 1064 11168 --
NM_003340chr4--11040 ----
NM_003341chr31589 ------
NM_003342chr1742452 1133 907 112 13305 22804 2034 --
NM_003347chr2222188 2127 1300 22219 929 --
NM_003373chr1051567 1299 415 301 289 11915 11279 --
NM_003378chr71390 ------
NM_003387chr231940 1166 432 --2500 28 1203
NM_003390chr111175 --1972 --
NM_003392chr333665 2737 940 23886 3076 13634 12637
NM_003400chr21180 --1833 --
NM_003404chr2021825 1500 ------
NM_003406chr831884 751 326 1251 ----
NM_003410chrX22192 931 ------
NM_003411chrY21280 217 ------
NM_003430chr191135 ------
NM_003439chr732584 2572 21 22869 778 ----
NM_003453chr13185 ------
NM_003457chr171438 --173 --
NM_003458chr363899 3741 3397 3190 2931 2889 --1403 --
NM_003463chr642860 2718 576 133 1142 ----
NM_003468chr233103 873 792 ------
NM_003471chr331498 942 597 --11994 --
NM_003473chr10----1893 --
NM_003482chr1282740 2183 2009 731 639 219 168 21 --22763 428 12333
NM_003483chr12--12722 ----
NM_003489chr2123099 2109 ------
NM_003498chr1692753 2527 2120 1909 1890 1850 1798 819 437 --22694 2011 --
NM_003506chr81413 ------
NM_003507chr21482 11732 ----
NM_003558chr93256 163 23 ------
NM_003559chr17113821 3415 2479 1416 1394 1333 1097 1059 1013 803 496 --1811 --
NM_003564chr11102 ------
NM_003565chr1281636 1216 702 601 595 476 357 37 ------
NM_003566chr1221353 997 --1244 --
NM_003567chr12113 38 ------
NM_003583chr1211520 11182 ----
NM_003589chr131329 --11182 --
NM_003603chr441818 479 378 189 --1235 --
NM_003615chr332884 2769 868 ------
NM_003629chr142872 2223 542 140 --21051 220 --
NM_003633chr521904 87 ------
NM_003636chr1101737 1375 1362 1246 649 362 252 149 81 66 --21387 643 --
NM_003651chr123452 221 117 ------
NM_003663chr342853 1177 973 395 11294 12921 --
NM_003671chr952838 2820 1310 267 215 11407 1544 --
NM_003680chr11486 ------
NM_003701chr131743 ------
NM_003705chr21196 --1821 1635
NM_003713chr14516 336 206 52 11390 ----
NM_003714chr553098 2914 2862 2814 2084 ------
NM_003716chr31677 ------
NM_003722chr332647 1668 274 ----12168
NM_003735chr561735 1152 638 566 423 74 ------
NM_003736chr561735 1152 638 566 423 74 ------
NM_003743chr23856 492 348 ------
NM_003750chr101754 ------
NM_003759chr433762 1090 37 --1972 --
NM_003760chr11835 ------
NM_003769chr121215 ------
NM_003777chr71555 ------
NM_003778chr31746 ------
NM_003783chr12373 87 --11072 --
NM_003796chr192611 125 ------
NM_003800chr661894 1852 1597 1568 577 437 ------
NM_003819chr11282 ------
NM_003822chr152530 2293 2151 2029 104 --22506 929 --
NM_003828chrX1528 --192 --
NM_003829chr9----1310 --
NM_003861chr1432817 1933 232 1931 ----
NM_003872chr232147 944 589 ------
NM_003873chr1051746 1710 367 254 89 --1121 --
NM_003877chr12----3850 398 339 --
NM_003888chr1541642 1083 390 137 --11113 --
NM_003893chr101349 --1490 --
NM_003908chr2031207 1126 161 ------
NM_003913chr6--1539 ----
NM_003916chrX21168 122 ------
NM_003929chr11609 ------
NM_003934chr91226 ------
NM_003941chr742221 2194 725 218 ------
NM_003966chr5147502 6977 6712 6663 6557 6460 5943 5779 5659 5617 5114 2070 1169 121 12795 ----
NM_003972chr10--1161 ----
NM_003983chr1674060 3070 1402 1366 1136 1082 1021 33855 2748 156 24268 1165 11421
NM_004028chr1862809 2801 2524 1528 1029 473 --34132 867 580 --
NM_004040chr211332 ------
NM_004050chr1421843 213 --12709 --
NM_004060chr5--191 ----
NM_004067chr7197 --144 --
NM_004081chrY21273 651 1142 ----
NM_004082chr21106 ------
NM_004087chr3--31963 1747 163 ----
NM_004089chrX3505 229 80 --1797 --
NM_004090chr1762827 2766 2361 1137 1060 908 13077 165 --
NM_004094chr1442991 2425 1877 390 22290 739 ----
NM_004096chr1032158 2043 260 ------
NM_004098chr1041124 1117 1102 479 ------
NM_004099chr971796 1708 1603 580 307 299 28 --1482 1662
NM_004111chr112291 219 ------
NM_004115chr13--1107 ----
NM_004116chr2----1149 --
NM_004117chr622148 450 11601 ----
NM_004124chr1413500 --13202 --
NM_004134chr51466 ------
NM_004156chr8--1393 ----
NM_004161chr2153 11469 ----
NM_004162chr31122 ------
NM_004170chr931242 397 97 ------
NM_004171chr11118945 7569 7355 6037 3206 2598 2039 1979 1502 1253 73 29189 1421 19536 --
NM_004172chr541980 1969 1739 278 ------
NM_004183chr112694 663 ------
NM_004187chrX51100 998 938 386 74 ------
NM_004202chrY1281 1756 1272 --
NM_004227chr762194 2093 2033 732 204 111 --22322 845 --
NM_004229chrX12162 ------
NM_004230chr1951674 762 469 424 26 11887 51785 1618 882 705 388 --
NM_004235chr92707 121 ------
NM_004236chr151573 ------
NM_004238chr21226 --1313 --
NM_004241chr10186 ------
NM_004242chr6171 ------
NM_004253chr92885 602 1237 1655 --
NM_004272chr521990 1309 11501 11908 --
NM_004274chr1422106 867 12389 --1281
NM_004277chr621627 606 --1164 --
NM_004279chr73715 457 371 ----1633
NM_004293chr943057 2743 2361 250 12574 12996 --
NM_004294chr131731 ------
NM_004295chr1721289 842 ------
NM_004302chr1252749 2743 2512 2233 1792 1826 1372 --
NM_004313chr171457 ------
NM_004329chr103304 172 130 ------
NM_004330chr1511046 1835 ----
NM_004331chr872479 2380 1028 952 771 607 475 --12033 --
NM_004342chr732161 1751 43 11826 2324 25 --
NM_004354chr42669 171 ------
NM_004358chr2011148 ------
NM_004360chr1641980 1532 809 586 21868 562 3668 555 505 --
NM_004368chr1951068 938 776 384 268 --2885 722 --
NM_004370chr621531 462 --1826 --
NM_004380chr1662293 1746 445 339 107 63 --11720 --
NM_004392chr1321951 1821 --11067 --
NM_004393chr341957 1708 714 572 --11677 --
NM_004397chr1143954 1385 750 345 ------
NM_004412chr1045651 5148 5106 1317 14012 35223 4448 3986 --
NM_004419chr103919 304 201 --1142 --
NM_004420chr1192204 2094 554 272 261 233 187 140 39 11657 1337 --
NM_004430chr821013 640 12268 --12149
NM_004432chr9--156 ----
NM_004437chr152668 2402 2350 1424 1398 --22943 1343 --
NM_004438chr232972 636 555 12288 12253 12716
NM_004440chr61672 ------
NM_004442chr161707 1391 1173 491 133 35 --11469 --
NM_004447chr121368 ------
NM_004449chr2111353 ------
NM_004454chr31641 --22270 133 11420
NM_004457chr22295 76 ------
NM_004459chr1721608 643 192 --1734
NM_004469chrX1535 --159 --
NM_004482chr23273 171 117 ------
NM_004484chrX1248 ------
NM_004487chr31336 ----1920
NM_004496chr141380 ------
NM_004499chr51542 --1513 --
NM_004501chr133238 2880 2793 2907 522 ----
NM_004505chr1731417 1351 187 192 ----
NM_004514chr1772095 2003 1946 1101 606 395 284 --23068 789 --
NM_004515chr1----151 --
NM_004535chr2011678 --21670 180 11337
NM_004538chrX2233 122 ------
NM_004543chr2193 ------
NM_004554chr1441519 1381 1348 360 --11181 --
NM_004571chr2152774 2341 1201 500 122 ------
NM_004575chr42385 165 ------
NM_004576chr5154 ------
NM_004586chrX64996 4492 4059 2000 52 39 21178 185 25369 1390 --
NM_004588chr1173557 3088 2476 1566 1132 825 490 ------
NM_004593chr3------1200
NM_004598chr552699 2631 1336 853 26 ------
NM_004602chr201376 ------
NM_004612chr934346 4191 920 14480 ----
NM_004631chr111155 --11133 --
NM_004654chrY----11171 --
NM_004655chr1721201 545 ------
NM_004657chr23359 113 38 1463 1160 --
NM_004663chr15--1370 ----
NM_004685chr1352871 2788 2749 2518 2003 ------
NM_004687chr1721729 368 ------
NM_004694chr172230 184 ------
NM_004703chr1732586 2240 1697 --1228 --
NM_004709chrX31795 1467 270 11767 ----
NM_004711chr22113610 2955 2847 2716 2557 2537 2388 1253 1016 623 266 --2630 77 --
NM_004713chr142577 286 ------
NM_004719chr1252208 1972 1868 1830 908 --12100 --
NM_004723chr13878 379 327 ------
NM_004726chrX65589 5545 1927 1517 1175 391 35663 4979 4505 21872 1241 1705
NM_004734chr1332904 2741 734 22597 397 169 --
NM_004737chr22----1137 --
NM_004738chr2072113 1901 1762 1747 1689 1063 488 --22016 459 1650
NM_004744chr442730 1258 1141 494 13818 --13933
NM_004745chr8125708 5608 5437 5266 4848 4485 4454 4301 714 652 583 441 24343 2724 35799 5066 502 --
NM_004748chr1563596 3535 3136 824 694 501 1779 21680 243 --
NM_004756chr1931367 1231 939 1458 1579 --
NM_004760chr731877 1666 325 1992 ----
NM_004768chr141089 978 877 228 ------
NM_004774chr1752358 1224 745 739 137 --12653 --
NM_004776chr2052827 2779 2093 974 950 12232 11036 --
NM_004779chr511278 ------
NM_004786chr18----1202 --
NM_004788chr1152502 2345 2035 1902 1670 --1236 --
NM_004789chr9165 ------
NM_004795chr1331487 1429 416 ------
NM_004796chr141394 ------
NM_004798chr2062694 2556 2464 1153 765 535 --13160 --
NM_004799chr1190 ------
NM_004808chr1022908 624 ----12117
NM_004815chr154115 4081 4019 1621 522 1981 ----
NM_004820chr8----156 --
NM_004836chr21144 --1254 --
NM_004839chr152519 39 ------
NM_004840chrX32396 1516 882 ------
NM_004845chrX64056 3087 3006 1335 1142 339 --33562 3172 2614 --
NM_004857chr14114773 4375 3791 1603 1558 1153 515 507 327 157 35 13910 11522 --
NM_004865chr61135 ------
NM_004867chrX1161 ------
NM_004872chr11343 ------
NM_004896chr101232 21267 382 ----
NM_004898chr421931 743 1859 ----
NM_004902chr201734 ------
NM_004904chr776438 6080 5844 5693 4547 4346 557 21429 1320 11549 15026
NM_004906chr6--1265 1450 --
NM_004912chr73573 92 24 21277 501 --11651
NM_004926chr141117 ------
NM_004927chr1111421 11451 1476 1222
NM_004929chr81598 --1438 --
NM_004947chr362225 1841 1744 1032 372 133 --11025 --
NM_004953chr31448 ------
NM_004956chr764163 3544 3249 1620 1298 298 14018 ----
NM_004961chrX21105 54 ------
NM_004965chr212660 92 ------
NM_004973chr621387 85 ------
NM_004975chr2021015 199 ------
NM_004976chr11134663 4649 4310 4198 3944 3524 1830 1782 1662 1432 762 598 417 1325 11574 14413
NM_004985chr1243651 3495 1680 1004 12806 ----
NM_004992chrX147596 7409 7370 6911 5745 5679 3236 2938 2867 1313 1067 813 315 304 17636 11768 --
NM_004992chrX147596 7409 7370 6911 5745 5679 3236 2938 2867 1313 1067 813 315 304 17636 11768 --
NM_004999chr664369 4343 3967 3724 1654 992 11442 1881 --
NM_005000chr721046 198 ------
NM_005010chr742183 1494 654 51 11634 ----
NM_005023chr541562 347 76 54 ------
NM_005025chr3139 1179 ----
NM_005028chr10--11427 ----
NM_005032chrX21011 902 --1736 --
NM_005044chrX54008 3991 3527 1008 70 ------
NM_005045chr7------1983
NM_005056chr1294677 4383 4203 3720 3662 3604 1832 869 88 --33551 1165 1044 15061
NM_005063chr1042750 649 283 42 --2478 185 --
NM_005066chr12800 245 ------
NM_005077chr91323 ------
NM_005080chr22127 ----169
NM_005087chr3163 --1669 --
NM_005094chr91148 --3452 245 206 --
NM_005102chr2------134
NM_005104chr61595 ------
NM_005110chr51152 ------
NM_005116chr2054173 3616 1593 1425 831 11204 11698 --
NM_005121chr1753340 3073 2911 2827 1156 13564 1726 --
NM_005126chr331649 1405 684 ------
NM_005134chr182842 137 ------
NM_005135chr1593610 2724 2604 2350 1320 1236 849 280 240 --12549 --
NM_005140chrX--1760 2185 174 --
NM_005147chr163748 491 383 2974 394 ----
NM_005154chr151265 ------
NM_005156chr955272 4637 4198 1799 1428 --14736 1438
NM_005160chr22106213 5429 5078 4445 2719 2513 1800 1164 643 360 --22458 109 --
NM_005168chr221367 179 --11106 --
NM_005175chr17174 ------
NM_005181chr8189 ------
NM_005188chr11128315 7520 7438 5248 3003 2515 2142 1637 1506 695 516 441 --37218 6429 2860 --
NM_005194chr201556 ------
NM_005197chr14104236 4215 3810 2368 2245 1013 932 917 895 547 --1534 --
NM_005201chr32249 185 ------
NM_005207chr2283673 2590 1461 1445 1377 1361 697 671 --2781 616 --
NM_005214chr2--1404 ----
NM_005215chr181262 ------
NM_005230chr122628 605 ------
NM_005233chr332455 712 105 11815 ----
NM_005235chr286333 5331 2400 1763 1691 1231 1143 1092 25720 5317 --12382
NM_005238chr1133242 2418 623 ------
NM_005241chr331302 1132 32 ------
NM_005244chr201539 --1485 --
NM_005250chr1631753 1257 738 --31833 1729 1375 --
NM_005254chr151553 ------
NM_005264chr101744 ----151
NM_005271chr103190 141 65 ------
NM_005277chr421506 211 --1752 --
NM_005284chr6161 ------
NM_005311chr762632 2478 1863 1128 813 685 ------
NM_005316chr111345 ------
NM_005324chr1751911 1875 1369 352 199 ------
NM_005329chr1672343 2013 1940 1871 1656 1533 437 1721 11490 1318
NM_005336chr242070 1565 1511 175 --11953 --
NM_005339chr433527 1666 29 ----1255
NM_005347chr961561 1248 1092 571 528 138 ------
NM_005349chr43533 401 244 ------
NM_005359chr1842474 2121 1162 432 1568 12287 11805
NM_005374chr1731722 1539 510 --2837 745 1263
NM_005375chr62139 44 ------
NM_005378chr2----1298 --
NM_005380chr11428 --2818 180 --
NM_005386chr203831 655 607 ------
NM_005392chr951718 513 407 250 210 --31639 555 85 1735
NM_005397chr763106 2934 1540 1161 1120 58 --43060 2680 825 548 --
NM_005399chr1103807 3568 3078 2930 2818 1432 1173 1049 839 727 ------
NM_005400chr242381 2286 895 154 ------
NM_005402chr721212 256 11633 ----
NM_005406chr183645 110 83 --156 --
NM_005415chr21284 1730 ----
NM_005418chr113462 182 121 ------
NM_005424chr12383 95 ------
NM_005433chr1832264 2077 164 11048 ----
NM_005436chr1053919 3568 2983 2817 28 ------
NM_005455chr131841 1697 91 --11776 --
NM_005458chr941869 612 513 498 1454 11713 1844
NM_005465chr1----1540 --
NM_005475chr1272622 2484 2359 2345 2041 1028 545 13083 --12419
NM_005476chr92396 55 --11247 --
NM_005477chr1562043 1990 1634 971 879 714 --11764 --
NM_005477chr1562043 1990 1634 971 879 714 --11764 --
NM_005493chr61663 ------
NM_005494chr71565 ------
NM_005497chr17104928 4819 4793 4227 3777 2395 2372 722 578 192 --41828 1704 1654 130 25792 4739
NM_005499chr191524 ------
NM_005502chr963080 2475 838 697 651 427 --1508 --
NM_005509chr511536 --1572 --
NM_005517chr1171 ------
NM_005520chr52600 217 ------
NM_005530chr1531458 1404 199 ------
NM_005539chr1031426 929 107 ------
NM_005542chr72312 280 ----1248
NM_005562chr161713 1537 652 563 499 409 ------
NM_005566chr111526 ------
NM_005573chr51118 ------
NM_005574chr113758 511 161 ------
NM_005575chr5150 --1104 --
NM_005578chr354576 3788 1397 1333 561 --1699 14637
NM_005596chr9106327 6306 5842 5800 5332 5139 4850 4706 2218 96 35406 4842 449 11857 --
NM_005607chr81273 ------
NM_005610chr11743 --2690 306 --
NM_005611chr162881 364 ------
NM_005613chr1183 --1893 --
NM_005634chrX2690 485 --169 --
NM_005637chr1821963 1716 --21827 1661 --
NM_005639chr1241884 1809 1681 1308 --1645 --
NM_005665chr143891 3616 3156 593 11954 24752 538 11914
NM_005667chr2127 ------
NM_005668chr574543 4537 4342 3836 736 340 321 14300 2750 700 --
NM_005678chr155866 749 345 152 36 --148 --
NM_005688chr32914 351 ------
NM_005692chr73198 183 147 ------
NM_005711chr521010 164 ------
NM_005715chr612310 22581 1736 11127 --
NM_005717chr11282 ------
NM_005721chr21903 ------
NM_005722chr231877 948 127 ------
NM_005725chr142108 2061 1854 456 11663 ----
NM_005730chr1243171 2670 2225 482 --31108 1031 941 1332
NM_005736chr1051550 1290 1078 1016 422 --11140 --
NM_005746chr722235 210 12744 12703 --
NM_005748chr122838 365 ------
NM_005749chr173165 111 89 127 ----
NM_005759chr232953 1569 163 11769 --13252
NM_005765chrX1582 ------
NM_005768chr121147 ------
NM_005779chr543091 2831 447 355 11336 22368 249 2875 745
NM_005786chr183823 811 51 1242 ----
NM_005795chr231992 1970 261 ------
NM_005796chr161287 ------
NM_005801chr174276 252 240 216 ------
NM_005808chr382828 2245 1327 1267 776 637 325 112 --11313 11089
NM_005813chr22445 235 1379 ----
NM_005822chr62290 130 11883 ----
NM_005828chr1764675 4079 1660 959 902 851 34323 4231 501 11990 --
NM_005832chr3----1298 --
NM_005839chr11636 ------
NM_005840chrX76793 6043 2415 1785 1014 352 148 --22798 1566 15364
NM_005841chr42795 45 1422 ----
NM_005842chr13--1243 ----
NM_005845chr1311347 ------
NM_005852chr176722 289 266 204 61 30 1966 ----
NM_005853chr161400 ------
NM_005859chr511340 1377 21434 1255 --
NM_005862chr3--2920 870 ----
NM_005868chr731947 1620 1595 12323 ----
NM_005870chr133478 468 184 ------
NM_005875chr31381 ------
NM_005885chr51222 11509 ----
NM_005896chr22717 702 ------
NM_005898chr1142988 2518 2389 215 ------
NM_005901chr1897589 7215 6380 2573 2300 2285 2001 1324 730 18466 ----
NM_005902chr1584275 3502 3031 2822 1759 1247 1143 31 --14194 13305
NM_005904chr184917 521 462 282 11129 ----
NM_005906chr631200 1057 52 --1631 --
NM_005909chr573719 1199 1166 1006 877 687 617 ------
NM_005911chr231402 576 58 ------
NM_005923chr61270 ------
NM_005924chr721033 121 ------
NM_005926chr15----2554 406 --
NM_005933chr1172559 2109 1965 1891 624 457 384 ------
NM_005935chr475297 4480 2053 1570 1313 593 328 --14462 --
NM_005937chr1784073 3572 3488 3347 3060 1342 539 32 --32549 1464 1254 --
NM_005941chr863212 2764 2741 1110 887 98 --1865 --
NM_005943chr661330 1215 593 485 418 51 ------
NM_005955chr1124952 4743 4399 3900 3533 2051 1944 1538 1441 1326 728 648 24384 1389 21429 1022 --
NM_005957chr1104790 3199 3114 1649 1571 1535 1388 1270 1139 319 --23232 162 --
NM_005962chr101655 1661 12091 --
NM_005962chr101655 1661 12091 --
NM_005966chr232370 2074 1930 ------
NM_005967chr122539 161 ------
NM_005977chr134402 356 276 52 ------
NM_005982chr141183 ------
NM_005986chr1352464 479 468 418 44 ------
NM_006007chr954102 3706 3494 3250 638 13064 13670 --
NM_006011chr1564234 3567 2749 1635 538 405 199 23435 1242 --
NM_006015chr11951 ------
NM_006016chr61679 1833 ----
NM_006024chr71366 ------
NM_006030chr351736 541 391 308 127 ------
NM_006036chr252589 1823 637 517 286 1601 ----
NM_006037chr2104119 3462 1470 1420 1358 834 817 793 267 162 --24598 334 11171
NM_006038chr2031761 1564 1349 1436 ----
NM_006040chr163927 199 103 136 ----
NM_006041chr17----1128 --
NM_006047chr2013245 --13000 --
NM_006054chr1121049 171 --1115 --
NM_006067chr161827 ------
NM_006076chr7103042 2662 2537 2258 2207 2074 586 561 444 206 12852 ----
NM_006079chr61594 ------
NM_006080chr721818 1020 --1407 1699
NM_006089chrX51826 1440 1354 637 629 11629 11300 --
NM_006094chr832343 916 113 ------
NM_006095chr444177 3736 1779 24 ------
NM_006100chr31477 1238 ----
NM_006107chr171335 ------
NM_006108chr1141850 903 713 182 11542 1253 11811
NM_006135chr151330 1241 1207 954 397 ------
NM_006136chr721076 78 ------
NM_006141chr1642224 1019 899 586 ----1728
NM_006153chr31532 ------
NM_006154chr1542544 2366 352 245 22803 977 ----
NM_006159chr121613 1491 ----
NM_006166chr1242616 1907 913 429 ------
NM_006186chr21106 ------
NM_006191chr121280 ------
NM_006192chr2011062 ----11054
NM_006194chr142965 474 ------
NM_006202chr1941916 1874 1248 442 --2400 393 --
NM_006203chr554818 2162 1010 693 194 --13551 --
NM_006206chr432694 2214 1790 ------
NM_006210chr192249 185 11034 ----
NM_006218chr31214 ------
NM_006224chr1731757 326 74 --12381 --
NM_006237chr1321563 291 --1850 --
NM_006238chr651673 1610 784 566 468 --31680 643 535 --
NM_006241chr312046 12166 ----
NM_006246chr14----1398 --
NM_006251chr522055 252 22540 83 2703 536 --
NM_006252chr187576 5564 5417 5011 2343 1474 1438 697 15614 21070 528 --
NM_006256chr162202 2147 2079 1050 980 637 --126 --
NM_006258chr1031519 1373 1054 ------
NM_006264chr42398 96 ------
NM_006265chr811563 ------
NM_006267chr21648 1555 ----
NM_006268chr1161033 775 436 412 186 152 ------
NM_006275chr202685 262 ------
NM_006281chr81871 ----11116
NM_006281chr81871 ----11116
NM_006283chr894728 4630 3834 3729 3449 3231 1710 1289 1079 --14342 1854
NM_006288chr1141219 885 836 38 --2930 846 --
NM_006290chr651932 659 266 137 46 ------
NM_006293chr154896 680 258 66 --21014 127 --
NM_006298chr662992 2665 2586 2390 1265 269 --12743 --
NM_006306chrX85870 4557 4526 4002 2040 966 595 138 34423 2273 757 25834 40 --
NM_006313chr12--1227 ----
NM_006315chr473613 3144 2742 1615 1442 307 274 --23085 1700 --
NM_006321chr341442 1425 98 77 11541 ----
NM_006325chr121103 1600 ----
NM_006328chr112594 527 --1437 --
NM_006335chr11804 169 ----
NM_006343chr24334 147 101 34 ------
NM_006348chr71285 1345 --1603
NM_006353chr62446 72 ------
NM_006359chrX52055 1989 1795 925 523 1104 ----
NM_006361chr1761707 1567 1343 669 127 69 --176 --
NM_006366chr6----1895 --
NM_006371chr3135239 4657 3872 3797 3779 3645 3262 3204 1880 1425 1351 882 309 --41661 419 254 77 --
NM_006372chr61351 ------
NM_006377chr931222 1029 389 ------
NM_006379chr71401 ------
NM_006393chr10104319 3514 3505 2881 2758 1450 1385 787 658 377 ------
NM_006401chr9----1199 --
NM_006424chr471928 1869 1845 1629 692 623 416 ------
NM_006434chr103695 391 153 ------
NM_006439chr41414 ------
NM_006449chr251918 1698 1684 742 413 ------
NM_006451chr51797 ------
NM_006455chr17127 ------
NM_006457chr433740 235 147 1950 ----
NM_006459chr103500 448 311 --1326 --
NM_006460chr17------1267
NM_006475chr13----178 --
NM_006482chr1211520 11182 ----
NM_006496chr11704 ------
NM_006516chr161388 1221 1167 501 339 105 11262 1299 --
NM_006517chrX31990 1558 759 1789 1284 --
NM_006526chr2021607 113 ------
NM_006527chr44287 251 70 63 ------
NM_006534chr2043309 1297 1092 85 --12138 12409
NM_006540chr821577 1201 21041 494 ----
NM_006544chr1435574 1723 1494 ------
NM_006546chr1736013 1321 281 --25784 1343 --
NM_006547chr731693 137 105 ------
NM_006549chr1242965 2935 657 341 --1766 --
NM_006557chr951406 1197 1079 701 607 ------
NM_006561chr1055433 5018 4943 2201 850 25752 4539 ----
NM_006572chr1753377 617 336 290 211 1687 ----
NM_006575chr142409 210 11415 ----
NM_006595chr1111865 --11362 --
NM_006599chr1687869 7863 6750 2945 2827 2305 1915 1831 13285 --16959
NM_006602chr201118 ------
NM_006603chrX11485 1208 ----
NM_006609chr232709 2261 758 ------
NM_006614chr333293 1433 180 13250 ----
NM_006618chr121106 99 ------
NM_006621chr131971 1887 495 --1147 --
NM_006624chr1022096 1700 11491 --11864
NM_006625chr12156 35 ------
NM_006625chr12156 35 ------
NM_006625chr12156 35 ------
NM_006628chr1593558 3532 3371 3130 2892 1851 1716 929 291 42957 1551 1402 437 23643 3477 --
NM_006644chr13----1232 --
NM_006646chr1332809 2707 638 12205 12582 --
NM_006648chr91113 ------
NM_006650chr553611 2725 957 781 204 --5857 747 629 516 491 --
NM_006654chr1264671 4520 4396 2946 1074 1058 24492 3019 ----
NM_006667chrX1739 --11029 --
NM_006682chr722776 2031 21155 712 ----
NM_006694chr11253 ------
NM_006699chr132174 895 573 11013 ----
NM_006713chr5------193
NM_006717chr973244 3037 2590 2354 1064 556 243 1260 1794 --
NM_006720chr1084374 3752 3120 1730 1623 1449 998 606 --13537 13268
NM_006722chr322520 1003 --11184 --
NM_006726chr41341 ------
NM_006729chrX95607 5524 5430 5211 4180 4069 3869 1976 126 25247 3726 44353 4156 4038 3988 14305
NM_006734chr6----11574 --
NM_006738chr1574302 4012 3540 1529 1021 486 341 --13933 --
NM_006742chr1672002 1795 1759 1688 1625 1486 1362 --21475 703 --
NM_006749chr81321 --21141 167 1191
NM_006751chr21704 ------
NM_006754chr721109 799 --1268 --
NM_006756chr831000 553 73 ------
NM_006763chr111850 12045 2583 413 --
NM_006765chr82275 70 ------
NM_006766chr811761 12551 1532 --
NM_006775chr632772 307 113 11226 ----
NM_006805chr541465 1387 76 59 ------
NM_006807chr1741050 884 169 149 ------
NM_006814chr2062457 2168 2099 853 819 89 --128 --
NM_006815chr12----21304 519 --
NM_006826chr21820 ------
NM_006827chr1453171 3001 2982 2582 2438 12191 22527 941 --
NM_006832chr14188 1289 ----
NM_006836chr121509 ------
NM_006838chr12--11883 11704 --
NM_006851chr1232512 2359 1023 ------
NM_006852chr1752698 2238 1149 1104 201 --12231 --
NM_006854chr711859 ------
NM_006856chr122780 377 1947 ----
NM_006870chr201255 1779 ----
NM_006874chr43910 265 29 1287 ----
NM_006875chrX3865 608 173 ------
NM_006884chr321675 206 ----11965
NM_006885chr1623886 3714 13587 11034 --
NM_006888chr1432478 1201 659 1207 1840 --
NM_006892chr2031241 1149 81 ------
NM_006892chr2031241 1149 81 ------
NM_006899chr20189 ------
NM_006910chr16177 ------
NM_006914chr931581 956 578 ------
NM_006918chr1164731 4713 4185 3754 3651 397 11085 24825 1695 --
NM_006922chr232231 2164 1025 ------
NM_006924chr1743539 3446 2697 497 ----13981
NM_006930chr511942 1630 ----
NM_006937chr171573 ------
NM_006939chr141136 ------
NM_006940chr1231641 274 74 1233 1747 --
NM_006951chr101750 187 ----
NM_006982chr12182 ------
NM_006988chr211291 ------
NM_006990chr172110 1863 969 589 545 167 154 --22455 1921 11942
NM_006993chr10159 ------
NM_006996chr121813 733 ----11163
NM_006997chr101309 ------
NM_006999chr541569 810 583 411 --1601 --
NM_007005chr921359 1110 ------
NM_007006chr1693480 3409 3203 3102 2322 1303 1273 563 368 ------
NM_007008chr23894 325 206 1662 ----
NM_007011chr15165056 4981 4941 4717 4374 4334 2496 2488 2098 1702 1236 1121 732 495 441 289 --34575 550 487 1179
NM_007013chr83779 312 80 ------
NM_007030chr5115206 4773 3210 1781 1723 1376 1133 954 824 142 136 --24165 1410 --
NM_007033chr151969 1667 1485 850 260 --11811 --
NM_007034chr11703 ------
NM_007042chr3--185 2430 350 --
NM_007050chr20157358 7153 7127 7102 6940 6836 6062 5964 5709 5663 5227 2532 1532 251 50 27674 1744 37212 5400 212 --
NM_007052chrX1112 ------
NM_007053chr11154 --1226 --
NM_007054chr553938 2940 2470 918 615 --22854 2683 --
NM_007064chr341642 628 610 337 ------
NM_007067chr171349 ------
NM_007078chr1032529 2407 1959 ----1215
NM_007084chr133607 174 155 --11205 --
NM_007106chr1311732 1278 12598 --
NM_007109chr631443 1001 500 --11111 --
NM_007124chr6--1628 21748 72 --
NM_007129chr131771 ------
NM_007144chr1721041 33 ------
NM_007146chr171811 --12182 12246
NM_007150chrX3769 255 145 11400 2388 77 --
NM_007158chr1142 ------
NM_007159chr3--11434 ----
NM_007170chr12216 118 1110 1124 --
NM_007174chr1242316 1586 581 86 11494 ----
NM_007191chr12----137 --
NM_007195chr1873743 3324 2761 2652 1263 1050 69 --11374 --
NM_007200chr1574302 4012 3540 1529 1021 486 341 --13933 --
NM_007207chr1--2707 294 ----
NM_007212chr111807 ------
NM_007214chr63459 440 420 ------
NM_007222chr821267 417 --11501 --
NM_007236chr1542007 1598 1572 762 22039 529 22215 1517 --
NM_007249chr1388592 7837 6445 6152 2710 2071 1630 937 26062 453 ----
NM_007271chr62412 403 --11425 --
NM_007275chr331106 739 248 --3334 91 55 --
NM_007276chr71109 ------
NM_007278chr17184 --1432 --
NM_007286chr581987 1645 667 627 591 584 550 155 ------
NM_007287chr353020 2726 2009 678 660 ------
NM_007288chr353020 2726 2009 678 660 ------
NM_007289chr353020 2726 2009 678 660 ------
NM_007324chr1190 ------
NM_007325chrX22087 1492 11992 --1445
NM_007331chr412580 ------
NM_007347chr1562875 2866 2646 2437 2324 359 ----22270 233
NM_007350chr1244354 3455 3429 3125 33284 1743 1192 1946 --
NM_007358chr13787 734 504 ------
NM_007373chr1011754 ------
NM_007375chr1--12291 ----
NM_012069chrX22624 451 12450 22030 1864 1414
NM_012081chr563423 3139 2395 1339 577 39 1614 12586 --
NM_012082chr8176 ------
NM_012084chrX2177 65 ------
NM_012089chr121394 1228 1100 ----
NM_012090chr121015 22 ------
NM_012093chr11894 178 ----
NM_012095chr1063135 2683 2356 2156 74 41 1176 ----
NM_012104chr11----41509 1478 943 424 --
NM_012104chr11----41509 1478 943 424 --
NM_012105chr214319 259 174 22 --1902 --
NM_012110chr4131 ------
NM_012120chr642660 2517 2090 1910 11034 12382 --
NM_012137chr12649 364 --1193 11855
NM_012141chr1323575 1573 11051 ----
NM_012157chr32890 375 ------
NM_012158chr1321659 34 ------
NM_012164chr957155 5310 4844 2777 2249 11183 26305 2415 15318
NM_012166chr921234 27 ------
NM_012193chr1155277 4978 4733 4643 2046 --24134 3969 --
NM_012199chr174015 3659 3170 3134 3092 1587 46 --22840 1428 --
NM_012210chr921019 36 ------
NM_012214chr285529 5017 4428 4353 4261 2457 1396 1262 --22578 183 15241
NM_012215chr1031759 503 476 --11598 --
NM_012218chr1962425 1191 670 504 378 98 --2755 748 12229
NM_012224chr441070 982 800 69 ------
NM_012229chr1051296 993 498 246 23 ------
NM_012232chr1751447 862 577 258 76 --11369 --
NM_012234chr332883 2580 857 23430 3138 ----
NM_012243chr11929 ------
NM_012249chr232386 964 488 11133 ----
NM_012250chr1111195 --2322 310 --
NM_012257chr72959 668 1188 ----
NM_012259chr611234 11073 ----
NM_012262chr131977 1483 1121 13254 25221 4550 --
NM_012264chr2271751 1671 548 379 311 78 49 --41716 1642 848 172 --
NM_012264chr2271751 1671 548 379 311 78 49 --41716 1642 848 172 --
NM_012281chr721607 589 ------
NM_012286chrX1168 ------
NM_012287chr331744 1332 375 --23590 1277 11395
NM_012288chr6114851 4801 4282 3600 2217 1832 1288 699 285 64 44 --33955 3872 2267 --
NM_012290chr211069 --1602 --
NM_012294chr754000 939 786 424 64 --23349 2629 --
NM_012297chr422089 831 ------
NM_012300chr521905 494 ------
NM_012301chr721453 432 ------
NM_012306chr12113515 3460 3402 3145 2781 2678 1399 1275 1072 941 851 --23301 2399 --
NM_012308chr1192497 2154 1847 1584 1006 974 941 769 244 --3965 915 175 --
NM_012309chr1184164 3952 3592 1688 1485 741 424 79 14913 1838 --
NM_012316chr174616 4543 4320 4088 3839 3491 619 --34430 1906 949 --
NM_012325chr2011006 1362 11072 --
NM_012330chr1031667 327 175 ------
NM_012333chr121491 1416 ------
NM_012334chr554417 4078 3480 3071 187 --41685 1519 1164 109 13017
NM_012338chr72999 122 ------
NM_012340chr201233 ------
NM_012347chr652893 2797 1973 897 328 --12186 --
NM_012398chr197957 915 829 724 600 480 232 --42503 741 405 32 --
NM_012414chr1----1721 --
NM_012416chr941090 429 311 106 ------
NM_012417chr171573 1559 ----
NM_012420chr1042136 1960 405 132 ------
NM_012425chr1042190 1054 884 666 ------
NM_012431chr71878 --12623 --
NM_012446chr51423 1591 ----
NM_012448chr1761975 1662 951 854 624 463 11695 11812 --
NM_012449chr7162 ------
NM_012464chr432870 1127 265 1878 ----
NM_012470chr71453 ------
NM_012471chrX--11282 ----
NM_013229chr1262149 995 969 868 671 375 12046 2914 616 1732
NM_013231chr1414179 1194 ----
NM_013233chr211141 ------
NM_013247chr21551 ------
NM_013253chr1131339 1132 468 --3182 170 87 --
NM_013254chr121668 ------
NM_013257chr832319 1922 216 ------
NM_013261chr453005 2324 1387 951 672 ------
NM_013262chr61942 ------
NM_013269chr1234557 4521 4208 14430 11275 --
NM_013279chr1162109 1867 1827 1663 932 48 --21880 582 --
NM_013286chr353297 2647 1285 516 463 23630 360 1804 --
NM_013302chr16104523 4293 4095 3873 3796 2994 1164 702 413 31 --64358 4208 3559 893 498 332 --
NM_013309chr1552492 2220 1937 1851 115 ------
NM_013322chr721542 180 --11111 --
NM_013341chr232936 2133 306 ------
NM_013346chrX163 ------
NM_013352chr61903 ------
NM_013354chr8--21280 34 ----
NM_013363chr32390 24 ------
NM_013372chr1553327 2789 908 791 745 1914 ----
NM_013374chr322978 1001 1607 ----
NM_013437chr8134 ------
NM_013438chr911516 ------
NM_013444chrX1804 ------
NM_013446chr7----1406 --
NM_013448chr14----1519 --
NM_013449chr1242426 2145 1106 476 --12935 --
NM_013943chr133169 720 175 165 ----
NM_013989chr1464801 4634 1318 1106 756 470 1703 ----
NM_013993chr61623 ------
NM_013994chr61623 ------
NM_013995chrX22019 51 ------
NM_013999chr1731506 1123 393 11494 129 --
NM_014000chr1051567 1299 415 301 289 11915 11279 --
NM_014011chr22445 112 11615 ----
NM_014015chr162765 656 ------
NM_014016chr3--1477 ----
NM_014021chr143466 3193 1106 43 ------
NM_014034chr621194 531 133 ----
NM_014048chr1684659 3443 3411 3290 1840 1195 1152 478 11318 23483 155 11923
NM_014089chr133887 872 513 ------
NM_014106chr1532643 2237 2080 --22830 769 33014 613 187
NM_014110chr141096 977 416 325 ------
NM_014112chr885021 4936 4616 3441 1855 1829 852 570 11412 ----
NM_014141chr784992 4927 4126 3946 3345 1452 341 115 21075 731 13861 --
NM_014154chr32589 403 ------
NM_014155chr11115827 5420 5212 4649 4634 2786 2706 1482 923 809 752 --56069 4846 2827 1459 1290 --
NM_014181chr282502 2480 2148 1896 1070 588 175 119 ----1785
NM_014182chr121195 --1511 --
NM_014190chr471565 1533 1459 458 274 179 145 --11577 --
NM_014210chr172229 130 ------
NM_014211chr5177 --1168 --
NM_014213chr22405 219 ------
NM_014230chr17170 ------
NM_014232chr171307 --21542 494 --
NM_014232chr171307 --21542 494 --
NM_014233chr1741416 619 247 175 ------
NM_014234chr61163 ------
NM_014240chr363677 3649 2984 1560 993 196 --13301 --
NM_014243chr411906 ----12082
NM_014263chr10----11354 --
NM_014268chr1811278 --181 --
NM_014279chr91783 --1396 --
NM_014283chr11955 ------
NM_014284chr11248 --11066 --
NM_014290chr91156 ------
NM_014294chr811493 ----1205
NM_014299chr1951874 1476 796 372 222 2111 61 1773 --
NM_014300chr15----1321 --
NM_014309chr2285386 4844 4327 4017 3997 3951 2043 1793 24792 4107 25113 3569 --
NM_014332chrX------1321
NM_014333chr1142627 2074 1046 245 ------
NM_014335chr1521012 496 ------
NM_014363chr13173 ------
NM_014368chr931857 1404 1334 1553 176 --
NM_014372chr121760 484 1822 ----
NM_014382chr32542 67 ------
NM_014393chr821933 1549 --11645 --
NM_014394chr1031011 914 906 ------
NM_014395chr42323 76 11426 ----
NM_014399chr72899 68 1786 ----
NM_014400chr191402 ------
NM_014415chr321261 620 11169 ----
NM_014423chr524437 4053 14423 --14240
NM_014445chr322323 2176 --1170 --
NM_014454chr64371 215 195 71 ------
NM_014456chr1041569 1263 394 72 1249 21228 291 --
NM_014458chr12935 289 ------
NM_014469chr111219 ------
NM_014488chr112610 450 ------
NM_014491chr71144 ----1697
NM_014494chr1632289 1933 1762 1552 ----
NM_014496chrX1264 ------
NM_014515chr121923 ------
NM_014554chr1241485 684 537 126 11521 1235 --
NM_014563chrX71384 791 680 625 578 459 374 --32089 1333 294 --
NM_014573chr1771775 1630 1533 1293 1208 297 275 --1215 --
NM_014574chr141161 ------
NM_014577chr222232 45 --1147 --
NM_014584chr1431647 1283 1108 --11232 --
NM_014587chr1631536 387 104 --11170 --
NM_014592chr51300 ------
NM_014602chr3--1324 ----
NM_014613chr562831 2590 2526 2327 1005 509 ----12769
NM_014614chr241384 1237 84 27 ------
NM_014615chr1623132 402 22826 1173 23304 141 --
NM_014630chr15123944 3527 3429 3327 3259 2709 2632 2585 1447 1433 934 830 23178 3051 1280 11165
NM_014633chr113610 144 21 ------
NM_014636chr9104290 3609 3020 1148 1133 1095 759 412 397 85 11487 149 --
NM_014646chr1872907 2618 2583 1240 1085 166 152 --1543 --
NM_014655chr141805 888 400 120 --2829 465 1693
NM_014660chr74987 819 733 139 ------
NM_014661chr1083863 3448 3291 2857 2818 1022 526 219 --12548 --
NM_014665chr883422 3148 3042 2956 2447 1193 442 147 ----12874
NM_014666chr531202 1143 179 ------
NM_014670chr221102 102 ------
NM_014674chr333741 1101 954 ------
NM_014676chr11423 --11360 --
NM_014677chr821204 1094 ------
NM_014682chr821968 1588 --1892 --
NM_014683chr1731982 1734 426 12005 ----
NM_014689chr21202 ------
NM_014690chr763117 2935 2008 1254 1183 1074 --23056 171 --
NM_014705chr721733 487 ------
NM_014717chr19--1802 ----
NM_014720chr10----11634 --
NM_014721chr697043 6589 6134 5120 4725 2954 2851 2359 855 14732 12491 --
NM_014729chr84616 407 114 107 11546 ----
NM_014730chr12105018 4996 4952 4872 4549 4131 2006 1778 1628 1337 ----11548
NM_014730chr12105018 4996 4952 4872 4549 4131 2006 1778 1628 1337 ----11548
NM_014731chr201124 ------
NM_014732chr1675680 3720 2197 1968 1751 1159 1025 14463 33831 3665 267 --
NM_014733chr532044 291 121 ------
NM_014735chrX12100 ------
NM_014739chr633997 3563 2779 1603 --1528
NM_014741chr1132050 1609 186 --11733 12135
NM_014742chr2071587 1567 1559 1545 655 619 466 --123 --
NM_014743chr411013 ------
NM_014746chr293820 3236 3210 3191 1714 1089 673 276 131 --13155 13322
NM_014747chr175051 2074 2055 1599 1276 1202 809 --25040 1934 --
NM_014751chr831677 1656 403 1450 ----
NM_014755chr273998 3548 3193 2911 2834 677 174 --22947 1053 --
NM_014758chr1142036 1734 846 382 --12131 --
NM_014766chr783823 3466 3177 2555 1368 343 328 261 12862 ----
NM_014772chr1883268 3212 2624 2522 2433 600 215 206 ----1990
NM_014774chr162447 2418 2292 1243 683 605 --12214 --
NM_014791chr91284 ------
NM_014795chr2279 21 ------
NM_014800chr74925 908 863 728 --1942 --
NM_014802chr121369 ------
NM_014810chr142730 831 567 475 1581 ----
NM_014819chr552405 2093 2067 350 189 12080 1255 --
NM_014824chr1111368 --144 --
NM_014828chr1462275 2061 1990 1010 785 76 --1955 1158
NM_014830chr1263614 3436 3338 276 163 35 ------
NM_014836chr1031942 464 172 ------
NM_014838chr2272690 2309 2251 2147 2040 648 109 --1180 --
NM_014839chr112351 ----196
NM_014840chr1253349 2976 2209 1184 70 1434 1137 --
NM_014848chr153984 914 554 --12366 --
NM_014850chr3134596 4389 3671 3629 3449 3344 3287 1777 1434 1415 1171 932 739 ------
NM_014869chr331055 279 41 11024 2508 440 --
NM_014871chr121464 --1594 --
NM_014873chr144236 3593 3035 1529 --21410 1244 --
NM_014876chr2261704 1576 778 694 668 109 --1614 --
NM_014877chr17107671 6027 5345 5338 2869 2663 2545 2371 1662 723 56499 2103 1848 713 273 11751 --
NM_014883chr432159 833 412 22035 1939 --1840
NM_014897chr1742378 2330 2235 496 --12671 --
NM_014898chr1931895 1876 111 --22006 1840 1443
NM_014899chr523190 2889 ------
NM_014901chr552239 1647 921 613 93 --2641 185 --
NM_014903chr1241678 911 398 206 ------
NM_014906chr1733911 3471 1506 32782 1262 332 13328 --
NM_014909chr14153874 3834 3665 3532 2797 2641 1522 1299 1194 983 770 713 425 173 22 --23743 149 --
NM_014912chr1021128 593 3962 738 329 12759 --
NM_014917chr11145 ------
NM_014923chr131376 11860 ----
NM_014927chrX--196 ----
NM_014935chr173895 2996 2973 2748 1253 818 299 --23015 149 --
NM_014936chr632746 657 119 1935 1852 --
NM_014939chr1811314 ------
NM_014947chr143089 2638 1010 183 --1955 --
NM_014952chr1541637 1406 622 292 --1467 --
NM_014953chr1354180 2789 1747 1055 72 ------
NM_014961chr442068 1738 529 85 ------
NM_014962chr2022721 279 ------
NM_014969chr11277 --1407 --
NM_014982chr1464378 3743 3690 3566 1083 910 ----14804
NM_014988chr442799 975 495 286 --21749 81 --
NM_014989chr621818 1584 ------
NM_014990chr1421153 837 --1386 --
NM_014991chr432932 645 610 ------
NM_014992chr142710 645 1698 ----
NM_014994chr1521599 22 ------
NM_014999chr1231408 312 80 --1276 --
NM_015000chr122668 629 32783 2643 596 156 --
NM_015008chr323583 1475 --1540 12301
NM_015009chr32805 80 ------
NM_015017chr121196 320 --1265 1431
NM_015018chr61175 ------
NM_015020chr1663447 3342 2721 1561 203 149 13548 1316 --
NM_015024chr82378 284 ------
NM_015025chr252635 779 717 298 216 1978 ----
NM_015026chr1274388 4179 3660 1158 995 656 164 34770 3795 1738 23562 869 --
NM_015032chr1342565 2395 1058 68 ------
NM_015039chr144287 3560 3397 663 ------
NM_015042chr15123734 3346 3264 3253 3061 2679 2652 1269 1180 759 411 345 --13468 --
NM_015044chr16123263 3178 2742 2465 2194 2060 1205 1163 722 603 119 31 --1435 --
NM_015049chr21452 21308 34 22746 2328 --
NM_015051chr993238 3226 2882 2294 1209 1020 984 853 654 1752 12083 --
NM_015052chr731359 1121 191 1311 1395 --
NM_015056chr2172665 2546 2446 2313 1015 795 141 ------
NM_015062chr10--1201 ----
NM_015068chr713455 ------
NM_015071chr576393 4791 4756 4110 1993 1537 380 12202 1422 1665
NM_015076chr643264 2945 44 21 14427 12779 --
NM_015079chr1592086 1999 1181 932 910 851 672 358 220 23217 2708 22423 226 --
NM_015091chr14--1587 ----
NM_015092chr1644449 3427 3179 237 24284 1415 13302 --
NM_015094chr22133875 3846 3745 3459 3280 3201 3003 1540 1416 1277 784 233 173 ------
NM_015097chr321992 1977 ------
NM_015100chr121382 1313 ------
NM_015101chr132523 2399 393 11929 31770 1138 357 --
NM_015107chrX32014 1583 693 ------
NM_015113chr1792387 2142 2102 649 538 519 213 188 138 1547 ----
NM_015115chr422489 945 ------
NM_015137chr831770 759 500 --21685 57 --
NM_015144chr1662443 1610 945 775 668 384 --1369 --
NM_015149chr162049 1352 755 741 583 58 ------
NM_015153chr61648 ------
NM_015155chr1093273 3121 3047 2961 2223 1160 1096 536 128 1331 ----
NM_015156chr1474039 3403 2559 1570 645 552 301 1921 ----
NM_015158chr93866 123 42 ------
NM_015161chr161150 --1459 --
NM_015170chr8--12257 21832 531 1883
NM_015176chr131745 1160 98 ------
NM_015191chr1192560 2457 2409 2380 2292 1847 822 544 260 --12726 --
NM_015192chr2032727 328 279 --1172 --
NM_015199chr372404 2300 2125 2107 1920 789 167 ------
NM_015200chr432037 1867 47 --12225 --
NM_015202chr1641674 1593 1401 1128 ------
NM_015206chr1543793 2478 652 290 13292 12595 --
NM_015208chr1863801 2756 1599 1142 1107 48 ------
NM_015215chr122799 2014 ------
NM_015231chr113804 713 248 1734 ----
NM_015233chr1341001 822 695 585 1866 12434 --
NM_015245chr6152462 2304 2241 2134 2096 1846 1778 1767 1111 1080 759 607 499 208 103 ------
NM_015256chr51739 ------
NM_015263chr1521150 79 --1132 --
NM_015265chr2--11915 22333 2208 --
NM_015267chr121695 --21952 1670 11740
NM_015271chr433966 1546 1273 13690 ----
NM_015272chr161643 ------
NM_015275chr1212107 ------
NM_015277chr183711 125 35 11411 2481 149 --
NM_015278chr643078 2264 2198 606 23187 800 22343 1299 13142
NM_015282chr252709 2395 2282 951 726 --12493 --
NM_015288chr563063 2546 2486 1508 936 24 ------
NM_015289chr1552050 1521 1293 1271 436 --21915 590 --
NM_015291chr152271 2192 953 891 513 --12247 --
NM_015292chr124777 707 617 609 ------
NM_015299chr1493894 3643 3486 3153 3147 1575 706 674 363 13949 1314 --
NM_015313chr1153959 3945 3569 1827 1706 --1576 14006
NM_015315chr552976 2314 1210 408 298 --23395 1263 --
NM_015321chr19124718 4217 4102 4057 3455 3384 3304 3225 1933 1150 354 123 11033 54752 3360 3152 3020 93 11123
NM_015328chr752875 2539 2243 85 46 --22515 328 1556
NM_015330chr2272507 2500 1721 1656 975 584 55 --12555 --
NM_015335chr1232453 1933 900 ------
NM_015336chr1222579 1688 12533 ----
NM_015338chr2041776 1736 1234 557 --11783 --
NM_015339chr202231 170 2794 379 ----
NM_015343chr171344 ------
NM_015347chr1262930 2337 2328 1049 746 426 2304 66 11994 12384
NM_015349chr632227 1028 918 --11941 1786
NM_015353chr1732482 2422 90 --22294 2184 --
NM_015355chr1721528 1320 ------
NM_015356chr8169 ------
NM_015359chr852408 1923 959 776 179 ------
NM_015361chr21679 ------
NM_015365chrX11012 ------
NM_015379chr7185 ------
NM_015384chr5150 ------
NM_015385chr103695 391 153 ------
NM_015387chr21172 --11507 --
NM_015394chr1232454 249 68 ------
NM_015416chr121961 ------
NM_015429chr31785 ------
NM_015436chr422915 972 --12100 --
NM_015441chr11293 ------
NM_015446chr141369 623 582 175 11500 ----
NM_015455chr563548 3155 1411 1156 965 776 22893 2871 --13251
NM_015464chr73185 136 73 ------
NM_015475chr211048 1843 ----
NM_015477chr152164 98 ------
NM_015488chr231538 1440 110 ----11609
NM_015497chr153850 211 185 ------
NM_015506chr171849 1554 1475 1206 1196 524 301 --21497 412 --
NM_015508chr321609 169 11503 11238 --
NM_015509chr1251420 1131 565 472 148 ------
NM_015520chr372734 1793 534 501 489 465 240 ------
NM_015550chr743028 2960 2643 2207 23099 430 1438 --
NM_015553chr651825 1788 1543 1356 110 --34227 4077 1696 --
NM_015554chr1542517 2008 627 54 ------
NM_015555chr621373 426 ------
NM_015557chr173437 3403 3317 3299 3079 2825 2723 --33545 3450 1309 --
NM_015565chr2121667 389 ----1517
NM_015567chr1311021 ------
NM_015571chr632401 2096 481 ------
NM_015575chr283400 3008 2848 2656 1238 1051 701 131 --13350 --
NM_015576chr362649 2479 1923 1880 1003 906 ------
NM_015578chr191357 --1786 --
NM_015602chr131715 1269 1197 --134 --
NM_015609chr162558 2477 2361 1852 416 233 --1906 1744
NM_015610chr721063 310 --12171 --
NM_015626chr172260 60 ------
NM_015635chr941657 1371 636 228 --11547 --
NM_015640chr145374 4064 3567 1996 14756 24009 3479 --
NM_015652chr103247 91 83 ------
NM_015678chr1341597 394 353 201 21652 1172 11533 129
NM_015686chrX22100 596 --2546 250 --
NM_015723chr7----1225 --
NM_015840chr162615 2172 1841 759 219 199 12056 1839 --
NM_015841chr162615 2172 1841 759 219 199 12056 1839 --
NM_015844chr182398 115 --1962 --
NM_015845chr182224 176 --1740 --
NM_015846chr182398 115 --1962 --
NM_015847chr182398 115 --1962 --
NM_015852chr72590 506 ------
NM_015853chr11258 41 ------
NM_015866chr12366 158 --199 --
NM_015874chr43533 401 244 ------
NM_015878chr8144 1580 --11722
NM_015879chr18118383 7605 7587 6973 6724 6337 3316 2615 2439 1503 1099 37075 5768 5408 32659 1804 1451 --
NM_015881chr1131339 1132 468 --3182 170 87 --
NM_015906chr174700 3023 1799 1467 1244 478 217 11038 ----
NM_015920chr151418 ------
NM_015964chr164320 304 267 26 ------
NM_015980chr551538 1179 572 226 59 --2540 65 --
NM_015999chr1139 --3650 559 135 --
NM_016003chr721063 310 --12171 --
NM_016009chr153170 1958 1718 1693 316 21436 944 14165 --
NM_016018chr862608 863 716 672 280 209 ------
NM_016019chr7132 ------
NM_016022chr1----1168 --
NM_016032chrX51343 1173 512 163 93 --1385 --
NM_016040chr112343 1837 ----
NM_016075chr1323022 1148 ------
NM_016076chr142430 1260 882 259 42939 2872 2670 924 ----
NM_016079chr241819 743 675 457 --12267 --
NM_016083chr653620 3042 2640 1154 49 1402 ----
NM_016094chr3----1159 --
NM_016107chr5----1126 --
NM_016120chrX11150 11202 ----
NM_016131chr231918 857 124 ------
NM_016132chr1553179 3036 2945 636 178 22786 2207 21358 603 --
NM_016140chr164320 304 267 26 ------
NM_016156chr1161557 1544 1493 831 626 275 ------
NM_016173chr3103743 3673 3660 3531 3352 3326 1792 1294 1240 529 --23508 968 --
NM_016201chr342225 1902 1445 779 ------
NM_016203chr73813 185 147 --1424 --
NM_016206chr388400 8155 8086 7429 6957 3530 3132 375 11137 48428 2953 2477 1104 --
NM_016227chr11955 ------
NM_016231chr1721049 555 ------
NM_016248chr1343470 2632 1196 1134 ----12768
NM_016250chr14----1688 --
NM_016255chr652803 2778 2452 1159 656 ------
NM_016257chr183378 3365 2731 2483 1372 1302 629 134 12382 22644 2354 --
NM_016260chr276130 5529 2778 1926 1916 1844 1817 26450 5842 ----
NM_016261chr173779 767 149 1642 ----
NM_016269chr41295 --1229 --
NM_016284chr162693 297 1831 1835 --
NM_016287chr131639 813 683 ------
NM_016290chr5195 ------
NM_016306chr3--1106 ----
NM_016308chr12555 383 11378 ----
NM_016322chr963115 3057 2781 1103 1039 289 ------
NM_016338chr531177 477 42 1407 ----
NM_016339chr172197 53 --2691 678 --
NM_016374chr13491 193 130 21451 1189 ----
NM_016374chr13491 193 130 21451 1189 ----
NM_016376chr1764362 4178 1671 975 234 23 13190 1535 --
NM_016395chr1531548 1539 756 ------
NM_016396chr1532323 1185 1121 ------
NM_016418chr22163677 3447 3189 3037 2927 2748 2627 2556 1460 1434 1258 1096 722 628 550 31 --23850 2872 --
NM_016424chr1731840 699 123 ------
NM_016441chr251598 828 696 565 204 ------
NM_016442chr521915 910 ------
NM_016480chr52819 252 ------
NM_016486chr1----1190 --
NM_016506chr111447 --1471 1686
NM_016516chr22577 570 ------
NM_016526chr1152454 1868 1838 1663 431 ------
NM_016531chr432802 1468 249 33955 3519 502 13217 --
NM_016542chrX2559 389 --1542 --
NM_016559chr32283 210 ------
NM_016587chr71109 ------
NM_016588chr6----1710 --
NM_016592chr2061084 921 888 485 465 140 --1541 --
NM_016598chr331255 1138 547 ------
NM_016603chr51333 ------
NM_016604chr521181 217 --1899 --
NM_016605chr532768 154 87 --42525 2018 610 577 22147 818
NM_016607chrX1291 ------
NM_016620chr111271 ------
NM_016621chr1163336 1820 1093 880 408 260 ------
NM_016628chr101104 ------
NM_016644chr5180 ------
NM_016653chr2128 11011 ----
NM_016654chr151553 ------
NM_016823chr171460 11000 ----
NM_016824chr1011377 ------
NM_016929chr6124494 4350 3957 3436 3360 3331 3172 3029 1645 1553 685 114 11338 33348 1078 493 --
NM_016952chr1193865 2981 2642 2563 1629 1545 636 535 37 13133 21422 480 --
NM_017415chr573989 3950 3829 1670 1414 775 241 --13701 --
NM_017420chr1423300 3023 11235 ----
NM_017443chr941425 1242 1017 491 --11131 --
NM_017447chr2153581 3115 2912 1738 861 --14294 --
NM_017449chr161707 1391 1173 491 133 35 --11469 --
NM_017452chr201376 ------
NM_017453chr201376 ------
NM_017454chr201376 ------
NM_017459chr12409 142 ------
NM_017488chr221018 255 ------
NM_017519chr611014 ------
NM_017522chr111155 --11133 --
NM_017545chr201413 ------
NM_017548chr322090 717 ------
NM_017553chr1531216 900 262 ------
NM_017577chr31217 ------
NM_017582chr141401 1389 1305 33 --11158 --
NM_017594chr963328 2693 2114 1300 1231 202 22957 634 ----
NM_017599chr121428 ------
NM_017610chr1531717 1470 366 ------
NM_017612chr121140 ------
NM_017617chr951226 480 445 259 39 ------
NM_017628chr494290 4237 4203 3830 3517 3458 1195 1155 609 167 25028 4263 --
NM_017629chr121980 1932 ------
NM_017633chr653775 3444 2747 1240 921 13662 ----
NM_017634chr83798 777 285 ------
NM_017635chr111259 ------
NM_017637chr998686 7482 7060 6794 3535 3476 1772 1618 1007 12236 12919 12956
NM_017643chr1722170 1984 --22195 257 --
NM_017650chr765959 4487 4094 3925 1420 201 --15800 --
NM_017657chr21108 ------
NM_017658chr1424276 87 24243 3915 14291 --
NM_017661chr15------1360
NM_017664chr131145 ------
NM_017666chrX51989 1425 1380 716 44 --1109 --
NM_017672chr1521258 110 ------
NM_017680chr92754 320 ------
NM_017693chr1311131 1221 1151 --
NM_017709chr153695 3193 2728 1717 1005 13889 --1363
NM_017712chr19126274 5866 5637 4580 4422 3932 2215 1539 1117 756 643 90 --36192 1973 1807 11181
NM_017714chr202712 678 --1689 --
NM_017719chr322423 1852 21624 590 ----
NM_017737chr131998 108 84 11951 ----
NM_017753chr92245 22 ------
NM_017761chr151499 1411 1105 1041 339 --21432 227 11474
NM_017769chr1433114 997 626 12955 ----
NM_017770chr642655 2160 1882 1844 ------
NM_017772chr631707 1487 1251 ------
NM_017778chr811538 ------
NM_017780chr8197 ------
NM_017784chr31315 ------
NM_017802chr71681 ------
NM_017811chr952525 2277 2086 1081 611 11930 ----
NM_017813chr865743 5640 2151 2064 2038 1742 --11983 --
NM_017822chr121285 ------
NM_017847chr131858 1614 160 1585 ----
NM_017848chrX33374 3228 1314 11509 --23954 72
NM_017849chr283064 2757 2373 883 771 638 492 161 --22486 280 --
NM_017866chr8--1162 ----
NM_017873chr971980 1178 1024 841 519 330 228 --52878 1946 1123 797 545 --
NM_017887chr13468 156 56 ------
NM_017893chr1051016 463 360 207 33 --153 --
NM_017902chr1081240 1234 1179 1156 676 548 388 82 --23777 1074 --
NM_017913chr9126 ------
NM_017919chr935363 4684 1896 12326 1684 --
NM_017922chr142630 85 ------
NM_017925chr941427 590 561 68 ------
NM_017933chr21613 11589 ----
NM_017944chr1163117 2800 2515 2342 1181 995 12882 ----
NM_017952chr2104453 3883 3707 3574 3419 3240 2878 1380 767 171 13889 ----
NM_017953chr13778 410 130 --1488 --
NM_017957chr1751029 518 376 224 104 --21046 403 --
NM_018013chr642924 2259 215 116 12088 ----
NM_018018chr121142 147 ----
NM_018027chr1053068 2014 1033 536 88 ------
NM_018030chr181887 1360 ----
NM_018045chr172694 2404 2265 605 494 103 63 1426 ----
NM_018061chr1199 ------
NM_018064chr61116 ------
NM_018076chr10--124 ----
NM_018084chr232087 706 34 ------
NM_018086chr221736 1645 2541 243 ----
NM_018095chr111447 --1471 1686
NM_018098chr331234 1092 1017 1184 ----
NM_018101chr131211 897 73 --11118 1870
NM_018103chr1--170 ----
NM_018121chr1052967 2675 2436 856 672 12900 22755 427 --
NM_018126chr41169 --11485 --
NM_018133chr312138 --11997 --
NM_018155chr322322 1156 ------
NM_018164chr121217 ------
NM_018169chr12------1376
NM_018182chr1742109 1508 529 217 --1224 --
NM_018189chr321702 634 --1348 --
NM_018195chr1121797 163 11618 --11790
NM_018200chr151749 12313 12535 11849
NM_018202chr12778 155 ------
NM_018205chr1061961 1669 941 657 114 86 --22348 2190 1353
NM_018206chr161220 ------
NM_018214chr6----1365 --
NM_018225chr9105045 4787 4535 4182 4119 3683 1559 1533 484 96 --41644 1478 598 429 --
NM_018229chr1431077 915 374 --1471 --
NM_018239chr1061961 1669 941 657 114 86 --22348 2190 1353
NM_018241chr43718 421 376 --2390 340 --
NM_018243chr443896 2710 2570 480 --1661 --
NM_018246chr872718 872 702 693 658 274 142 --12389 12635
NM_018247chr632946 919 564 ------
NM_018254chr111932 --1289 --
NM_018257chr2042267 2260 1623 424 --1473 --
NM_018263chr261999 798 681 286 229 203 --12389 --
NM_018266chr31812 ------
NM_018273chr193276 66 44 134 ----
NM_018275chr71197 ------
NM_018286chr171832 ------
NM_018287chr102191 90 ------
NM_018293chr351944 1181 810 675 33 --12394 --
NM_018298chr12960 938 ------
NM_018299chr851007 872 627 277 185 12389 13264 --
NM_018307chr172848 783 1864 1286 --
NM_018312chr1132068 1426 457 --186 --
NM_018315chr421487 1375 ------
NM_018327chr2051580 1520 1212 492 218 --11380 --
NM_018340chr16114318 4185 4086 3993 3499 3457 1668 1533 543 372 105 --23969 3801 --
NM_018351chr1243646 3458 1451 861 ------
NM_018357chr152433 25 ------
NM_018362chr1133266 2822 587 --23206 2712 --
NM_018364chr133113 2620 143 14059 ----
NM_018372chr11658 --1273 --
NM_018373chr1466394 6141 5514 4141 2397 2189 22267 1179 35625 5119 4096 --
NM_018374chr754735 1643 1554 1488 805 13857 24792 1295 --
NM_018375chr141750 21638 373 ----
NM_018388chrX21306 246 11040 ----
NM_018393chr112541 210 ------
NM_018400chr1174533 4477 4350 4310 4138 1724 1096 --13423 11208
NM_018403chr393602 3129 3090 2826 2701 1404 677 444 148 --14139 --
NM_018416chr1242605 2234 485 331 ------
NM_018420chr112585 22890 397 ----
NM_018440chr8107224 7075 7032 6668 6278 5998 5947 5744 2545 233 38626 6533 1198 1315 --
NM_018444chr83535 513 104 ------
NM_018452chr6_random43735 2705 2649 2417 --13049 --
NM_018457chr12155 ------
NM_018462chr32842 771 ------
NM_018490chr1131674 1431 209 ------
NM_018509chr1721666 1314 --11523 --
NM_018534chr21585 ------
NM_018553chr172653 242 ------
NM_018557chr221333 513 --11095 --
NM_018566chr143845 3326 1762 176 23948 71 --13337
NM_018569chr421302 655 11535 ----
NM_018590chr1021689 1435 ------
NM_018593chr6153 1528 ----
NM_018638chr1234340 3654 1390 12284 ----
NM_018640chr1221877 1721 ----12513
NM_018644chr1162175 1810 1708 1402 1378 684 --1271 --
NM_018691chr521069 1029 ------
NM_018700chr551602 1530 1480 1406 442 ----1218
NM_018703chr16177 ------
NM_018704chr171745 1540 761 650 608 535 234 --11753 --
NM_018710chr81429 156 ----
NM_018712chr1121153 423 ----11260
NM_018718chr731594 526 222 --168 --
NM_018834chr5--1973 1331 1258
NM_018841chr163540 2444 1158 1141 834 342 --1156 --
NM_018847chr92525 376 11949 ----
NM_018898chr521515 362 --1251 --
NM_018899chr521515 362 --1251 --
NM_018900chr521515 362 --1251 --
NM_018901chr521515 362 --1251 --
NM_018902chr521515 362 --1251 --
NM_018903chr521515 362 --1251 --
NM_018904chr521515 362 --1251 --
NM_018905chr521515 362 --1251 --
NM_018906chr521515 362 --1251 --
NM_018907chr521515 362 --1251 --
NM_018908chr521515 362 --1251 --
NM_018909chr521515 362 --1251 --
NM_018910chr521515 362 --1251 --
NM_018911chr521515 362 --1251 --
NM_018912chr561735 1152 638 566 423 74 ------
NM_018913chr561735 1152 638 566 423 74 ------
NM_018914chr561735 1152 638 566 423 74 ------
NM_018915chr561735 1152 638 566 423 74 ------
NM_018916chr561735 1152 638 566 423 74 ------
NM_018917chr561735 1152 638 566 423 74 ------
NM_018918chr561735 1152 638 566 423 74 ------
NM_018919chr561735 1152 638 566 423 74 ------
NM_018920chr561735 1152 638 566 423 74 ------
NM_018921chr561735 1152 638 566 423 74 ------
NM_018922chr561735 1152 638 566 423 74 ------
NM_018923chr561735 1152 638 566 423 74 ------
NM_018924chr561735 1152 638 566 423 74 ------
NM_018925chr561735 1152 638 566 423 74 ------
NM_018926chr561735 1152 638 566 423 74 ------
NM_018927chr561735 1152 638 566 423 74 ------
NM_018928chr561735 1152 638 566 423 74 ------
NM_018929chr561735 1152 638 566 423 74 ------
NM_018955chr17190 ------
NM_018970chr732511 2451 1981 ------
NM_018992chr1661160 646 607 478 440 262 --1198 --
NM_018993chr2031122 329 125 ------
NM_018999chr1074725 4372 1573 594 539 406 335 11778 21946 522 1281
NM_019000chr52351 99 ------
NM_019001chr354209 3716 3116 1952 1107 13445 --13184
NM_019004chr7--12250 11969 --
NM_019008chr2253566 3164 3068 1481 683 --13419 22440 237
NM_019016chr171244 ------
NM_019022chr1812780 ------
NM_019024chr22480 126 ----177
NM_019036chr64462 345 315 198 ------
NM_019045chrX2806 268 --1689 177
NM_019049chr1--1292 ----
NM_019053chr1011127 ------
NM_019059chr7----1498 1378
NM_019063chr242236 1774 883 533 ------
NM_019072chr5104103 4020 3551 2935 2711 1449 1442 1289 889 356 13605 11535 11371
NM_019079chr11904 ------
NM_019083chr121597 1360 ------
NM_019087chr531578 274 22 1609 ----
NM_019091chr21846 ------
NM_019102chr71368 --1419 --
NM_019102chr71368 --1419 --
NM_019106chr2263266 2274 2225 1258 996 709 ------
NM_019555chr361559 1414 1346 612 225 183 1259 ----
NM_019590chr1011051 ------
NM_019600chr151642 --2619 41 --
NM_019605chr12613 182 ------
NM_019610chr121569 270 1402 ----
NM_019842chr62286 22 ------
NM_019843chr22125 ------
NM_019854chr121517 ------
NM_019859chr1041345 1088 540 433 ------
NM_019860chr1041393 1136 588 481 ------
NM_019891chr111070 ------
NM_019895chr31305 ------
NM_019903chr1011377 ------
NM_020039chr1261690 1535 1386 1195 514 249 ------
NM_020062chr203859 637 57 127 --1737
NM_020116chr411509 --21359 89 --
NM_020122chr275956 5498 5335 4408 2286 1771 1707 --11684 --
NM_020132chr2184821 4645 4487 4471 3947 3322 1250 1176 --13216 --
NM_020139chr421851 119 11908 ----
NM_020144chr732095 1881 1588 --11970 --
NM_020150chr1012248 21951 668 ----
NM_020154chr15158 ------
NM_020177chr563087 1169 1074 699 540 395 12056 ----
NM_020178chr173973 289 106 21264 855 ----
NM_020182chr2053484 2947 2900 2747 534 23470 176 33458 2456 1380 --
NM_020193chr1121138 46 ------
NM_020198chr1731258 392 41 ----11331
NM_020200chr1051135 828 393 89 76 --1753 --
NM_020205chr143232 3207 671 45 1495 1161 --
NM_020231chr32109 76 ------
NM_020235chr3181 ------
NM_020239chr132032 1554 488 ------
NM_020245chr654877 4246 3657 3110 1423 13543 --15024
NM_020310chr1792157 1113 1106 748 437 397 122 98 92 --1691 --
NM_020336chr2023517 913 --13509 --
NM_020340chr621687 419 --12122 --
NM_020341chr2011527 ------
NM_020342chr231781 529 117 ------
NM_020357chr321620 1433 ------
NM_020362chr14830 637 603 306 --1117 --
NM_020381chr651887 1858 374 314 193 1740 1574 --
NM_020382chr1231648 619 585 1536 1460 --
NM_020384chrX61904 1656 1644 1214 739 483 ------
NM_020390chr354115 3838 3589 1042 1016 --34205 1821 961 --
NM_020403chr13--1545 ----
NM_020420chrY21273 651 1142 ----
NM_020425chr641931 1837 1694 1312 ------
NM_020432chr7----157 --
NM_020433chr2061736 1467 1365 1257 1247 67 --21742 1283 --
NM_020440chr11155 1966 12338 12672
NM_020452chr121547 1541 --12069 11657
NM_020458chr261900 1697 1636 1576 650 557 --11582 --
NM_020463chr22504 167 11119 ----
NM_020466chr624609 3240 23801 3430 --14728
NM_020532chr23894 325 206 1662 ----
NM_020645chr113664 630 107 ------
NM_020651chr21179 21776 43 ----
NM_020654chr31448 ------
NM_020666chr52745 678 ------
NM_020673chr20197233 6175 6061 5635 5378 5134 4889 4737 2857 2638 2630 2243 1930 1873 1840 1211 1035 836 688 --47476 6006 5245 5081 --
NM_020686chr1672935 2663 2505 2063 1928 1917 1203 ------
NM_020698chr1293111 2241 2195 924 874 679 439 35 25 ------
NM_020699chr184741 4089 3993 1794 1056 898 535 309 35421 5361 3512 24481 1489 --
NM_020704chr71236 21882 834 12051 1283
NM_020708chr2081761 915 698 602 508 486 247 29 12119 12060 --
NM_020711chr221719 262 ------
NM_020718chr1695948 5400 5351 4738 4202 4034 2245 1509 1328 --15542 1239
NM_020727chr2133916 3800 2484 ------
NM_020728chr722466 857 --22579 1148 --
NM_020732chr611014 ------
NM_020734chr1233037 371 236 ------
NM_020739chr1563596 3535 3136 824 694 501 1779 21680 243 --
NM_020748chr171527 ------
NM_020749chr821626 306 1814 11787 --
NM_020752chr1062525 2231 837 694 548 318 12726 ----
NM_020754chr351385 568 497 96 81 ------
NM_020755chr641489 1208 331 165 ------
NM_020760chr231383 558 362 21794 406 11277 --
NM_020766chrX33425 1609 404 24159 435 1990 --
NM_020772chr1777733 6622 6251 6080 5243 2941 1396 --17719 16895
NM_020774chr1844711 4490 1406 484 --15452 --
NM_020776chr1861057 987 979 913 806 184 23078 1216 12894 --
NM_020782chr1254162 4071 1143 142 40 ----11722
NM_020783chr182605 81 196 ----
NM_020791chr1711414 11373 1973 --
NM_020794chr11327 ------
NM_020796chr532021 1879 1846 ------
NM_020800chr311400 --1475 --
NM_020801chr531612 634 24 --1209 --
NM_020803chr442318 2183 1687 1617 11663 ----
NM_020804chr651967 1903 1028 726 110 --21852 360 --
NM_020805chr1821426 1274 ------
NM_020809chr111516 11427 ----
NM_020830chr222547 2182 22439 2220 ----
NM_020839chr32236 194 --1458 --
NM_020841chr1233826 1088 66 11182 ----
NM_020850chr1683029 2573 2517 2210 2003 1004 596 535 --42540 2434 639 397 --
NM_020854chr1831384 227 45 ----1345
NM_020856chr1921386 278 ------
NM_020858chr152475 112 --1508 --
NM_020860chr451036 743 329 205 122 ------
NM_020868chr221461 168 ----1759
NM_020873chr32748 75 1638 ----
NM_020886chr112536 294 --21021 855 --
NM_020897chr171154 490 405 373 350 281 258 ------
NM_020899chr1741658 656 420 146 --11772 --
NM_020921chr1443267 2742 2632 1454 13430 11378 --
NM_020922chrX31475 684 287 ------
NM_020927chr1642285 1812 345 307 12158 11502 --
NM_020940chr1012303 1788 11944 --
NM_020947chr1652015 1921 1740 1470 318 12380 ----
NM_020952chr91804 ------
NM_020956chr19144763 4579 4552 4459 4406 4203 4116 4013 3889 3715 3252 2984 1559 1449 23753 3068 74434 3387 3282 3075 2997 693 180 2204 60
NM_020963chr12168 35 ------
NM_020964chr1874035 3949 3581 3238 3159 678 132 24025 3470 13413 13351
NM_020967chr203428 318 103 --2863 333 --
NM_020974chr116643 590 564 492 452 442 ------
NM_020977chr421833 167 ------
NM_020988chr162530 119 ------
NM_020993chr1292479 2274 1112 767 711 644 637 127 119 1338 ----
NM_021005chr151109 ------
NM_021007chr222191 1497 ------
NM_021033chr1333414 3191 1274 ------
NM_021064chr631826 1233 492 --21197 477 --
NM_021069chr441818 479 378 189 --1235 --
NM_021072chr51990 ----11662
NM_021097chr232634 2148 815 --11954 --
NM_021102chr191413 ------
NM_021106chr92261 36 --1745 1169
NM_021109chrX2312 108 --1290 --
NM_021109chrX2312 108 --1290 --
NM_021111chr911071 11145 ----
NM_021120chrX53216 1116 978 311 259 --12223 --
NM_021129chr10124 ------
NM_021132chr1021289 943 --180 --
NM_021136chr14------1278
NM_021140chrX1129 ------
NM_021145chr72375 29 1876 ----
NM_021148chr72931 689 --1876 --
NM_021151chr72390 200 1117 --1722
NM_021156chr205890 876 354 249 103 ------
NM_021165chr13236 144 68 1751 1655 --
NM_021191chr1212371 12271 ----
NM_021194chr1183 ------
NM_021202chr2022904 2612 --1812 --
NM_021205chr11891 --22827 2011 --
NM_021219chr21--148 ----
NM_021224chr91422 ------
NM_021238chr1221402 201 --3749 285 120 --
NM_021240chr92669 529 ------
NM_021252chr1031892 532 502 ------
NM_021255chr1433711 1115 896 --1298 --
NM_021620chr62591 291 ------
NM_021622chr102811 137 11779 1761 --
NM_021627chr31467 ------
NM_021629chr384712 4129 3586 3437 3192 1080 404 131 ----24437 1307
NM_021637chrX21093 34 1126 ----
NM_021639chr11373 ------
NM_021647chr453711 3301 987 661 84 14680 --14049
NM_021648chr662660 1840 1755 599 260 32 1453 --11953
NM_021803chr4175 ------
NM_021813chr684955 4824 4223 1520 1101 740 214 45 21630 1262 11401 --
NM_021815chr233053 2971 2940 ----1160
NM_021818chr1411521 11103 ----
NM_021872chr2011148 ------
NM_021873chr2011148 ------
NM_021911chr525096 2087 33502 1619 546 ----
NM_021912chr15168 ------
NM_021913chr1931696 1351 536 --2621 455 141
NM_021935chr32367 121 ------
NM_021940chr611178 ------
NM_021949chrX31873 492 227 --11788 --
NM_021954chr1362738 2669 1273 1170 635 584 13519 1389 --
NM_021956chr631257 151 24 11349 --1201
NM_021960chr142436 1033 530 341 --180 --
NM_021961chr1166284 4578 2168 1862 1507 305 --45942 2812 2194 2005 22992 1698
NM_021964chr355992 4850 4319 4198 4034 1117 --1266
NM_021967chr531180 452 285 --1397 --
NM_021977chr632975 2401 636 --22436 431 --
NM_021984chrX21105 54 ------
NM_021987chrX21105 54 ------
NM_021990chrX21105 54 ------
NM_022048chr1595555 5524 5235 4165 1611 1103 862 722 622 --25442 1426 --
NM_022051chr1--1228 ----
NM_022060chr1441108 309 268 110 ------
NM_022066chr1751021 989 921 859 196 --1998 --
NM_022068chr182570 78 1171 ----
NM_022075chr12250 83 ------
NM_022080chr2052761 1010 919 143 135 --11725 --
NM_022117chrX2599 227 --1432 --
NM_022118chr13------1447
NM_022121chr64960 479 354 72 ------
NM_022160chr91148 ------
NM_022166chr1684898 4495 4421 2202 2156 1521 1172 192 --24478 399 --
NM_022169chr1131087 1070 138 --21377 221 --
NM_022171chr361233 1189 1108 998 380 178 --11578 --
NM_022337chr111644 ------
NM_022351chr883848 3824 3020 2420 2401 1041 752 33 ------
NM_022373chr71983 ------
NM_022458chr762983 2920 2422 2124 939 684 ------
NM_022459chr1355667 5504 4201 1919 525 25526 2045 36253 4397 1307 --
NM_022463chr1741367 1181 480 110 --11029 --
NM_022469chr173342 3301 2709 1062 504 234 83 22218 657 ----
NM_022473chr1594130 4124 3361 1497 1051 797 420 406 123 11724 11621 --
NM_022476chr16158 ------
NM_022483chr511318 ------
NM_022491chr1263161 1345 925 837 809 744 23452 2848 12459 --
NM_022566chr151586 ------
NM_022572chr231538 1440 110 ----11609
NM_022648chr284417 4328 4259 3834 3275 1524 1019 422 11650 14236 1751
NM_022650chr5--1185 ----
NM_022658chr1211335 ------
NM_022716chr192846 2803 2770 2672 2423 2361 1008 702 668 --1283 1690
NM_022728chr7----1479 --
NM_022739chr1711098 ------
NM_022744chr1671317 1306 921 245 166 122 23 --1862 --
NM_022745chr142256 2087 435 390 12494 21191 1050 --
NM_022748chr7112554 2455 2378 2342 1830 1102 995 717 708 699 113 12708 1873 --
NM_022751chr181289 ------
NM_022755chr932599 2454 2121 --1886 --
NM_022756chr11257 --130 --
NM_022758chr653050 2606 2321 1004 777 12309 ----
NM_022763chr3----13024 --
NM_022771chr122334 235 --1392 --
NM_022778chr131259 1132 303 --11185 --
NM_022824chr541301 529 350 181 11361 ----
NM_022826chr21292 1781 ----
NM_022831chr121567 423 ------
NM_022832chr4172 11864 2835 744 --
NM_022838chrX--1253 ----
NM_022844chr162871 382 ------
NM_022845chr1652072 905 756 713 242 22197 540 1689 --
NM_022893chr222378 695 12610 ----
NM_022898chr1494577 4328 4075 3796 3660 1942 1508 1127 714 34829 1936 456 14811 --
NM_022903chr32229 34 ------
NM_022912chr242577 2455 2218 149 22776 737 ----
NM_022918chr1121391 192 1705 183 --
NM_022965chr441272 1204 1161 1031 --1500 --
NM_022978chr531180 452 285 --1397 --
NM_023002chr1972127 2056 1801 1618 1511 829 302 --21795 1332 --
NM_023009chr11512 --132 1232
NM_023015chr11678 --1116 --
NM_023019chr21106 ------
NM_023037chr1331119 841 255 ------
NM_023923chr183508 3086 2884 2799 2715 2633 729 584 --33453 3140 3028 --
NM_023925chr122305 226 1311 ----
NM_023926chr191151 ------
NM_023927chr521321 847 11099 ----
NM_023943chr31225 ------
NM_023948chr7----1167 --
NM_024007chr563136 959 890 620 294 221 12578 ----
NM_024017chr1741413 1095 285 127 --11140 --
NM_024052chr1742961 2683 2158 2006 22901 248 ----
NM_024060chr111337 ------
NM_024087chrX3598 461 236 ------
NM_024090chr431249 1180 219 1650 ----
NM_024095chr1221387 1090 ------
NM_024117chr92918 58 ------
NM_024122chrX------1279
NM_024294chr653050 2606 2321 1004 777 12309 ----
NM_024295chr82174 33 11951 ----
NM_024297chr171473 ------
NM_024311chr171161 --1580 --
NM_024328chr141232 ----1145
NM_024345chr976058 5033 3770 3703 1545 1177 1065 11283 --1187
NM_024424chr112864 35 ------
NM_024425chr112864 35 ------
NM_024426chr112864 35 ------
NM_024429chr73813 185 147 --1424 --
NM_024496chr143633 529 222 ------
NM_024511chr42689 439 --1358 --
NM_024524chr342829 2592 857 412 ------
NM_024529chr14930 803 432 40 ------
NM_024536chr21424 --1116 --
NM_024539chrX2495 213 ------
NM_024541chr1061895 1794 1756 653 301 176 --2597 118 --
NM_024545chr22581 505 ------
NM_024556chr111411 --2491 36 --
NM_024563chr521891 1223 ------
NM_024567chr81665 126 ----
NM_024582chr4----1977 --
NM_024613chr811705 ------
NM_024620chr1921229 461 1107 1573 --
NM_024631chr111556 1464 ----
NM_024640chr12901 154 ------
NM_024643chr143503 386 181 --136 --
NM_024646chr153914 3683 3303 760 366 22668 634 12575 --
NM_024665chr354134 3562 1752 1378 212 12888 ----
NM_024692chr2123 --11195 --
NM_024702chr17--165 1264 --
NM_024713chr1521390 1331 ------
NM_024721chr831081 274 253 1678 ----
NM_024722chr171377 --1215 --
NM_024761chr975029 4109 3309 3289 2106 1596 465 1736 1328 11543
NM_024769chr1131056 448 189 ------
NM_024770chr2115632 5401 2674 2052 1931 1836 965 957 781 634 216 26429 616 11458 --
NM_024772chr12517 448 ------
NM_024779chr124385 277 119 112 ------
NM_024798chr1572709 2591 2571 2453 2343 558 255 --42609 2268 668 503 12506
NM_024824chr1431322 563 162 ------
NM_024828chr911382 ------
NM_024834chr1041910 1837 690 130 ------
NM_024854chr1231578 1312 518 ------
NM_024881chr1993534 2977 2690 1224 1054 815 599 509 322 --33144 2441 1348 --
NM_024887chr182099 1508 1385 1338 681 633 181 136 --1715 --
NM_024896chr942227 2101 540 152 --1731 --
NM_024920chr411185 ------
NM_024944chr212247 118 ------
NM_024947chr388927 8825 8174 7424 3598 2983 1338 112 27722 2117 48260 8093 7343 6120 17510
NM_024948chr101231 183 ----
NM_024969chr21851 ------
NM_024971chr91804 ------
NM_024979chr132433 416 ------
NM_024989chr232553 2133 1252 11963 12220 --
NM_024991chr103695 391 153 ------
NM_025027chr192967 402 --11035 --
NM_025047chr31334 ------
NM_025054chr834087 3677 2870 --1187 --
NM_025057chr142517 501 ----1849
NM_025069chr81174 ------
NM_025077chr1--1263 ----
NM_025083chr1591655 1606 1595 1420 1310 546 525 231 210 11728 31815 1336 589 --
NM_025133chr22952 253 1152 ----
NM_025134chr1612332 ------
NM_025146chr332260 1800 412 --21753 550 --
NM_025147chr2--1936 ----
NM_025160chr121581 267 13733 24185 1009 --
NM_025164chr1132236 617 202 ------
NM_025179chr1104926 4648 1896 1747 1647 1622 1050 1013 278 263 --2164 44 --
NM_025181chr2167 ------
NM_025182chr95815 283 276 225 96 1289 ----
NM_025191chr132880 2706 79 ------
NM_025221chr41124 ------
NM_025222chr342884 2704 2161 301 --2816 250 --
NM_025263chr651763 1574 1562 1405 498 --21352 23 --
NM_030569chr1053100 2159 787 479 361 33369 2528 711 12042 --
NM_030576chr1782487 2192 2169 2133 1726 1625 288 74 --42158 1057 625 356 --
NM_030621chr1424241 458 12769 ----
NM_030625chr1042451 1706 1625 436 ------
NM_030627chr513037 23393 3382 ----
NM_030637chr141240 ------
NM_030640chr12--1839 ----
NM_030647chr745689 4925 1498 991 1638 14863 --
NM_030648chr454745 4019 3716 960 864 --31706 1631 1490 --
NM_030650chr264145 4043 3626 3299 3194 3155 1187 ----
NM_030670chr1222333 1842 11673 11800 --
NM_030671chr1222333 1842 11673 11800 --
NM_030674chr12115527 4890 4737 4562 4075 3854 3837 3686 2046 1694 87 12110 13939 --
NM_030751chr102405 261 ------
NM_030751chr102405 261 ------
NM_030755chr1472563 2537 2211 1954 313 239 171 --12482 --
NM_030758chr221456 ------
NM_030759chr101293 ------
NM_030762chr1231602 70 32 --11970 --
NM_030766chr121292 --1239 141
NM_030782chr5128 --1140 --
NM_030786chr11725 11385 --11474
NM_030806chr1139121 7467 6819 6583 5936 5870 2195 2022 1941 1900 903 660 526 --48314 8279 7319 3021 16959
NM_030809chr1282202 2053 886 396 384 377 307 249 ------
NM_030816chr142779 1339 1212 470 11053 13053 --
NM_030817chr1273632 3149 2454 2313 804 641 384 --22566 90 12838
NM_030885chr332089 672 55 1546 ----
NM_030912chr101595 ------
NM_030918chr185243 5041 4586 4053 2169 1577 682 128 --12037 --
NM_030922chr151649 ------
NM_030937chr11942 1524 ----
NM_030938chr173782 356 69 ------
NM_031216chr1832036 1386 70 12223 ----
NM_031217chr111125 ------
NM_031262chr92826 780 ------
NM_031263chr92883 837 ------
NM_031266chr51542 --1513 --
NM_031305chr421372 341 1368 ----
NM_031309chr862274 1610 799 403 208 176 --12087 --
NM_031371chr13491 193 130 21451 1189 ----
NM_031371chr13491 193 130 21451 1189 ----
NM_031372chr411491 ------
NM_031411chr521515 362 --1251 --
NM_031412chr1231215 950 325 ------
NM_031418chr1142601 2558 1751 366 --12611 --
NM_031422chr181102 ------
NM_031426chr972685 2315 2221 1012 402 371 359 --1365 --
NM_031427chr1443761 2053 1526 1054 14922 15770 --
NM_031439chr821373 1192 11869 1148 --
NM_031442chrX42264 2238 799 105 ------
NM_031444chr223458 247 208 12214 41574 1555 543 81 --
NM_031445chr262807 2620 2132 971 202 136 ------
NM_031480chr6164 1229 1169 --
NM_031844chr133238 2880 2793 2907 522 ----
NM_031845chr223227 2622 --1352 --
NM_031847chr223227 2622 --1352 --
NM_031849chr521515 362 --1251 --
NM_031857chr521515 362 --1251 --
NM_031860chr521515 362 --1251 --
NM_031892chrX2742 363 ----1920
NM_031922chr6--1480 ----
NM_031935chr12911 57 ------
NM_031938chr112642 392 ------
NM_031942chr23913 899 355 1130 ----
NM_032017chr181935 1423 1294 683 496 453 428 393 --21840 511 --
NM_032028chr51633 --152 --
NM_032041chr862389 2245 1924 546 498 360 1468 1560 --
NM_032047chr362030 1792 1784 791 409 261 ------
NM_032088chr561735 1152 638 566 423 74 ------
NM_032092chr561735 1152 638 566 423 74 ------
NM_032109chr521501 169 11513 ----
NM_032116chr1363622 2344 1368 884 858 79 --55791 5162 2289 802 753 --
NM_032121chrX2764 683 --2850 841 1802
NM_032139chr191417 --1129 --
NM_032144chr231163 639 342 21420 1224 ----
NM_032145chr611886 ------
NM_032148chr121410 127 1442 --
NM_032153chr351910 1862 1710 520 181 --42328 1822 933 199 --
NM_032156chr122305 226 1311 ----
NM_032160chr1844237 3819 3403 818 --23653 1320 --
NM_032182chr103415 326 189 ------
NM_032186chr111271 ------
NM_032189chr13115033 4204 3946 3913 3583 3497 3458 3220 3210 523 227 14490 ----
NM_032195chr211358 ------
NM_032199chr1063362 1544 1351 1068 840 235 ------
NM_032208chr232301 1415 628 --12879 --
NM_032217chr431179 958 416 ------
NM_032221chr2011309 --1303 --
NM_032228chr1123162 1363 ------
NM_032229chr131104 ------
NM_032242chr362907 2489 1252 842 446 255 --32301 696 436 12531
NM_032246chr151360 11047 ----
NM_032268chr1663041 2356 2122 1204 1114 189 --12411 --
NM_032281chr1972905 2859 2845 2804 2645 1116 404 12205 22688 238 --
NM_032303chr92312 188 31405 1189 174 ----
NM_032312chr21131 ------
NM_032352chr14--1553 ----
NM_032373chr1065889 5540 3697 610 506 184 11367 14473 --
NM_032379chr111689 1236 ----
NM_032403chr561735 1152 638 566 423 74 ------
NM_032408chr72949 322 --1888 --
NM_032410chr81455 1886 ----
NM_032424chr1111343 ------
NM_032431chr116717 397 336 187 147 71 1427 ----
NM_032438chr611641 ------
NM_032440chr1021181 814 1638 12128 --
NM_032445chr1552234 1991 1773 1027 949 22099 763 ----
NM_032446chr553486 3420 2732 1077 701 ------
NM_032452chr1451532 1332 1154 1041 588 ------
NM_032457chr421084 315 --1380 11220
NM_032458chrX32560 1041 294 43008 941 623 203 ----
NM_032471chr62948 113 1187 ----
NM_032487chr33446 423 315 ----1195
NM_032491chr1241130 893 886 231 1337 ----
NM_032505chr312593 1618 ----
NM_032507chr61226 ------
NM_032510chr1852049 1949 1011 273 220 --1966 --
NM_032512chrX41168 923 211 28 ------
NM_032517chr10--1130 ----
NM_032521chr2062963 2335 996 951 584 125 23020 2003 31278 915 695 --
NM_032539chrX1168 ------
NM_032550chr1011171 ------
NM_032557chr41277 ------
NM_032558chr911472 --1119 --
NM_032561chr224512 481 234 64 --134 --
NM_032562chr101402 ------
NM_032564chr112881 174 ------
NM_032575chr1681807 1731 1696 1426 1410 788 649 352 12000 21836 413 --
NM_032582chr1721370 199 192 ----
NM_032590chr12----1767 --
NM_032622chr451504 1137 1054 1008 305 ------
NM_032632chr1411755 1264 21848 1838 --
NM_032663chr1231649 1531 133 11270 31540 1480 172 1512
NM_032682chr363505 2908 2525 2388 1272 401 --33607 1185 390 --
NM_032711chr17104116 3963 3023 1719 1595 1324 1052 407 362 271 ------
NM_032737chr1972542 1959 1870 1028 461 433 108 ------
NM_032765chr51724 1230 ----
NM_032778chr382761 2620 2112 2032 1187 234 198 90 --12554 --
NM_032784chr61341 ------
NM_032786chr121209 ------
NM_032787chr3--1318 ----
NM_032810chr10--11448 1277 --
NM_032812chr101103 --1110 --
NM_032813chr132801 718 ------
NM_032817chr1053100 2159 787 479 361 33369 2528 711 12042 --
NM_032826chr764947 4542 4446 2103 1877 497 --14245 191
NM_032830chr16--177 ----
NM_032832chr62479 242 ------
NM_032837chr1721810 1743 22112 866 ----
NM_032859chr1323754 3115 --11365 --
NM_032864chr13644 121 84 ------
NM_032865chr171135 --1590 --
NM_032870chr6------1423
NM_032873chr1133980 2935 1676 --22957 459 --
NM_032892chr151104 ------
NM_032905chr1031093 878 55 1415 ----
NM_032932chr17146423 6409 6280 5497 5368 5302 5279 5170 4041 2086 2054 515 501 77 14893 12583 --
NM_032936chr7172 144 ----
NM_032943chr111689 1236 ----
NM_032947chr541145 875 52 26 --11279 --
NM_032949chr132501 462 ------
NM_032961chr411365 1431 ----
NM_032968chrX53886 2901 2651 2581 1322 12732 ----
NM_032969chrX53886 2901 2651 2581 1322 12732 ----
NM_032973chrY54134 3878 2646 2580 1322 12727 ----
NM_032975chr1882724 1210 1097 1064 1051 673 358 33 139 12351 --
NM_032978chr182790 287 ------
NM_032979chr182790 287 ------
NM_032980chr1882724 1210 1097 1064 1051 673 358 33 139 12351 --
NM_032981chr182790 287 ------
NM_032982chr752509 2199 1662 173 28 --22148 1885 --
NM_032983chr7103323 3013 2476 2128 2083 987 842 411 376 158 --22962 2699 --
NM_032995chr2111672 1609 1539 1137 1111 1079 595 326 312 306 289 ------
NM_033012chr131743 ------
NM_033020chr174700 3023 1799 1467 1244 478 217 11038 ----
NM_033030chr21155 ------
NM_033036chr112350 336 11455 1465 --
NM_033044chr121015 22 ------
NM_033055chr1------1241
NM_033081chr2011232 ------
NM_033089chr2021349 596 ------
NM_033103chr1921043 932 11239 1877 --
NM_033121chr1211321 1363 1173 1225
NM_033127chr1--1656 122 --
NM_033132chr1331743 778 78 --1236 --
NM_033133chr1782987 2710 2590 2449 1041 604 293 262 --1549 --
NM_033138chr732161 1751 43 11826 2324 25 --
NM_033139chr732161 1751 43 11826 2324 25 --
NM_033140chr732161 1751 43 11826 2324 25 --
NM_033141chr1442101 1908 1730 519 ------
NM_033143chr474624 4224 3565 1428 318 257 185 --13501 --
NM_033157chr732161 1751 43 11826 2324 25 --
NM_033181chr653620 3042 2640 1154 49 1402 ----
NM_033207chr10102519 2229 2002 1956 1923 1795 1772 992 626 407 --188 --
NM_033224chr787467 6717 6691 6342 5726 3183 1307 196 22793 1534 26803 6632 22590 361
NM_033225chr821249 554 22728 763 ----
NM_033260chr62797 658 --1297 --
NM_033281chr51188 ------
NM_033285chr873979 3102 1101 966 864 616 321 ------
NM_033290chrX73739 3604 2960 2609 796 494 79 ------
NM_033300chr111155 --11133 --
NM_033309chr1641139 908 389 135 --122 --
NM_033312chr1176 ------
NM_033326chr1112141 12110 ----
NM_033331chr952838 2820 1310 267 215 11407 1544 --
NM_033360chr1243772 3616 1801 1125 12927 ----
NM_033364chr341880 770 517 328 ------
NM_033380chrX1439 ------
NM_033381chrX1439 ------
NM_033393chr4102805 2703 2557 2478 2422 2087 1808 954 943 822 --12415 --
NM_033394chr231053 401 386 --11172 --
NM_033429chr1553223 2233 2018 352 239 1619 22896 815 --
NM_033449chr552149 2018 870 485 51 ------
NM_033480chr652893 2797 1973 897 328 --12186 --
NM_033481chr652893 2797 1973 897 328 --12186 --
NM_033503chr1553072 2891 1507 931 163 ------
NM_033505chr252631 2397 1926 1319 177 11511 14963 24588 1818
NM_033515chr62458 111 ------
NM_033551chr552976 2314 1210 408 298 --23395 1263 --
NM_033626chrX31777 1704 42 1201 21584 1427 --
NM_033631chr1123754 3317 3199 2836 2796 2761 1361 811 259 204 188 93 --21026 854 --
NM_033632chr421487 1375 ------
NM_033644chr521905 494 ------
NM_033645chr521905 494 ------
NM_033656chr2164914 4873 4713 4270 1083 598 45519 5408 4626 2283 14141 --
NM_044472chr11196 ------
NM_052845chr1283262 2782 2686 2645 2006 1301 1036 1001 --32991 2853 215 --
NM_052851chr1362258 1985 924 860 510 474 ------
NM_052860chr53271 76 38 1248 ----
NM_052875chr1162046 1739 1702 1337 584 539 ------
NM_052879chr1243681 2816 1390 676 ------
NM_052898chr821688 1336 ------
NM_052901chr951200 1152 521 305 248 --2110 95 --
NM_052905chr221394 497 11523 11688 --
NM_052906chr2284241 3801 3748 3101 1328 1195 960 68 --44814 4145 3658 447 --
NM_052913chr61728 ------
NM_052918chr1053640 3162 1189 1154 1029 13088 ----
NM_052927chr522105 1859 --11425 --
NM_052938chr15990 962 824 415 46 --1938 --
NM_052954chr212892 244 ------
NM_052966chr182732 1532 1367 1154 1077 790 573 79 11129 12487 --
NM_052971chr53410 275 97 --1418 --
NM_052978chr1431744 289 208 ------
NM_053016chr997658 7536 7161 6186 3128 2693 2312 1960 553 22600 2243 17021 16669
NM_053024chr3162 --1570 --
NM_053042chr432953 2383 847 128 ----
NM_053043chr745134 4017 365 191 14142 2449 246 --
NM_053053chr11682 ------
NM_053056chr1152736 2596 2304 1983 1015 --12367 --
NM_053279chr862776 2726 2614 1901 1101 797 11118 --179
NM_054016chr121257 129 ------
NM_054016chr121257 129 ------
NM_054016chr121257 129 ------
NM_054025chr1162175 1810 1708 1402 1378 684 --1271 --
NM_054035chr173759 175 120 --1626 --
NM_057178chr1732666 710 126 189 ----
NM_057749chr8124 2539 122 ----
NM_058170chr1--11326 ----
NM_058172chr421787 535 ----1477
NM_058237chr14--1784 --1770
NM_058240chr142588 119 11656 ----
NM_058241chr221904 306 ------
NM_058241chr221904 306 ------
NM_078470chr1092646 2243 1974 1831 703 531 306 276 102 --1646 --
NM_078483chr554087 3514 2829 2543 399 --31620 548 87 --
NM_078625chr6----11034 --
NM_080392chr1----1569 --
NM_080552chr201279 --1106 --
NM_080597chr181887 1360 ----
NM_080604chr64641 578 161 85 ------
NM_080617chr201212 ------
NM_080621chr2041394 474 252 159 --2119 70 --
NM_080625chr202147 25 ------
NM_080626chr122373 320 ------
NM_080629chr121027 78 ------
NM_080630chr121027 78 ------
NM_080645chr621531 462 --1826 --
NM_080654chr113858 209 158 21141 436 ----
NM_080669chr1794511 3812 3167 3021 1177 1129 1090 753 51 1875 11551 --
NM_080671chr231403 818 498 --21728 1562 12037
NM_080683chr42398 96 ------
NM_080684chr42398 96 ------
NM_080685chr42398 96 ------
NM_080717chr1211019 --11306 --
NM_080738chr161907 1818 1734 1600 1591 1303 ------
NM_080759chr1321951 1821 --11067 --
NM_080760chr1321951 1821 --11067 --
NM_080867chr1484969 4907 4090 4067 3685 581 309 187 --34814 3770 3605 11502
NM_100264chr101104 ------
NM_100486chr101104 ------
NM_130385chr11102866 2693 2589 2308 2232 809 769 441 81 63 --22556 2179 --
NM_130387chr3199 ------
NM_130391chr973583 2781 2773 2728 2381 1204 654 ------
NM_130392chr973583 2781 2773 2728 2381 1204 654 ------
NM_130393chr973583 2781 2773 2728 2381 1204 654 ------
NM_130434chr1521003 797 ------
NM_130439chr101655 1661 12091 --
NM_130439chr101655 1661 12091 --
NM_130442chr74925 908 863 728 --1942 --
NM_130459chr951614 1571 1271 1221 1043 --11086 --
NM_130795chr92261 36 --1745 1169
NM_130797chr731402 357 166 ------
NM_130809chr532533 1162 803 12888 ----
NM_133170chr20157358 7153 7127 7102 6940 6836 6062 5964 5709 5663 5227 2532 1532 251 50 27674 1744 37212 5400 212 --
NM_133264chr1732999 269 121 13772 ----
NM_133265chrX63378 2624 1265 1056 514 479 ------
NM_133328chr19134 ------
NM_133334chr466360 6096 5427 4587 2337 256 --55780 4762 4083 3910 1275 --
NM_133370chr463487 2804 2742 2383 2267 150 13128 23500 2844 13335
NM_133372chr532011 1925 563 12527 22265 1846 --
NM_133378chr21827 11009 --1711
NM_133432chr21827 11009 --1711
NM_133437chr21827 11009 --1711
NM_133445chr9123253 3125 3102 2589 2426 1409 1232 1026 800 573 236 173 13328 ----
NM_133477chr421251 631 12324 ----
NM_133503chr123707 631 548 ------
NM_133504chr123707 631 548 ------
NM_133505chr123707 631 548 ------
NM_133506chr123707 631 548 ------
NM_133507chr123885 809 726 1648 ----
NM_133631chr3------1365
NM_133638chr51287 ------
NM_133642chr22----1137 --
NM_133646chr265161 4191 1891 1203 1099 102 12076 15528 --
NM_133647chr1593610 2724 2604 2350 1320 1236 849 280 240 --12549 --
NM_134265chr172260 60 ------
NM_134427chr92261 36 --1745 1169
NM_134447chr192611 125 ------
NM_138270chrX43396 2947 2101 895 1432 ----
NM_138319chr152817 149 11026 ----
NM_138328chr1763432 2828 2638 2593 1158 419 --22210 698 --
NM_138340chr181235 ------
NM_138346chr11218 ------
NM_138357chr102226 193 ------
NM_138371chr121290 ------
NM_138409chr621317 168 11377 1248 --
NM_138426chr71309 ------
NM_138444chr1394590 4345 3366 3084 1498 1400 1146 865 427 24137 3762 11972 --
NM_138457chr682901 2753 2665 2369 2130 673 90 56 --52362 1099 845 791 664 --
NM_138459chr62820 53 13590 ----
NM_138468chr2145933 5195 4776 4730 2391 1868 1840 1719 1495 1292 1198 1122 878 699 14472 12078 --
NM_138473chr1234113 3380 567 --24828 849 --
NM_138494chr762392 2310 985 896 628 39 12253 21140 872 --
NM_138558chr141096 977 416 325 ------
NM_138576chr1494577 4328 4075 3796 3660 1942 1508 1127 714 34829 1936 456 14811 --
NM_138620chr91108 ------
NM_138635chr74819 780 654 345 13126 ----
NM_138713chr1687869 7863 6750 2945 2827 2305 1915 1831 13285 --16959
NM_138714chr1687869 7863 6750 2945 2827 2305 1915 1831 13285 --16959
NM_138730chr6196 ------
NM_138731chr14--33849 1357 754 3396 135 50 --
NM_138775chr113665 524 123 --1538 --
NM_138782chr562200 2075 1758 1626 874 639 --1527 --
NM_138795chr151453 626 519 497 88 --21242 59 --
NM_138957chr22----1114 --
NM_138966chr181212 ------
NM_138970chr141394 ------
NM_138971chr11----41509 1478 943 424 --
NM_138971chr11----41509 1478 943 424 --
NM_138972chr11----41509 1478 943 424 --
NM_138972chr11----41509 1478 943 424 --
NM_138973chr11----41509 1478 943 424 --
NM_138973chr11----41509 1478 943 424 --
NM_138980chr42610 132 --1193 --
NM_138981chr42741 263 --1324 --
NM_138982chr42610 132 --1193 --
NM_138991chr214319 259 174 22 --1902 --
NM_138992chr214456 371 219 207 --21099 720 --
NM_139014chr6----12199 --
NM_139135chr11951 ------
NM_139157chr113462 182 121 ------
NM_139168chr5----2776 319 --
NM_139169chr103750 576 71 ----1766
NM_139207chr121692 21624 775 ----
NM_139211chr4----171 --
NM_139212chr4----171 --
NM_139246chr92470 26 --11850 --
NM_139266chr2138 ------
NM_139276chr1752265 2065 1952 948 497 ------
NM_139283chr1222158 1582 1718 12542 --
NM_139312chr10----11354 --
NM_139316chr71867 --1245 --
NM_139321chr2063987 3745 3556 2609 1225 152 33497 577 34 ----
NM_139323chr2021825 1500 ------
NM_144488chr92261 36 --1745 1169
NM_144489chr92261 36 --1745 1169
NM_144567chr151843 1817 845 389 343 --42618 1928 1762 789 --
NM_144571chr456311 5175 735 721 96 25430 1706 14876 --
NM_144574chr141221 ------
NM_144578chr1464147 4094 3939 1996 1706 688 11126 ----
NM_144579chr292837 2710 2692 2629 2506 2086 976 861 780 --2869 463 --
NM_144598chr15----1167 --
NM_144599chr1585094 5062 3786 3669 3628 3357 920 532 21423 767 11758 --
NM_144607chr1722575 2285 1505 1749 12091
NM_144632chr232100 1910 780 ------
NM_144664chr1112500 12414 ----
NM_144667chr1221086 140 ------
NM_144668chr121138 ------
NM_144710chr21198 2961 375 --1600
NM_144720chr42140 21 ------
NM_144721chr452622 2576 2483 2449 1085 1312 ----
NM_144728chr1--2707 294 ----
NM_144729chr1--2707 294 ----
NM_144767chr1574302 4012 3540 1529 1021 486 341 --13933 --
NM_144777chr13158 ------
NM_144778chr1322162 597 ------
NM_144949chr22445 112 11615 ----
NM_144963chr8--22739 1089 11982 --
NM_144967chrX1798 --1232 --
NM_144982chr121129 ------
NM_145000chr51519 ------
NM_145013chr1152551 1934 1005 596 447 --22621 691 --
NM_145049chr5--1369 ----
NM_145053chr112397 22 ------
NM_145055chr1833215 1474 327 ------
NM_145074chr21551 ------
NM_145109chr174770 324 202 166 184 1380 --
NM_145113chr141274 11571 ----
NM_145203chr131815 ------
NM_145206chr1042740 2434 2071 1224 --11241 12203
NM_145207chr464793 4153 1203 904 794 652 11880 41929 1761 739 489 23303 1168
NM_145251chr141248 ----11555
NM_145259chr267086 6275 5319 4938 2744 285 16568 15525 --
NM_145307chr1044010 3865 1847 282 1124 ----
NM_145320chr743028 2960 2643 2207 23099 430 1438 --
NM_145321chr743028 2960 2643 2207 23099 430 1438 --
NM_145322chr743028 2960 2643 2207 23099 430 1438 --
NM_145341chr1041569 1263 394 72 1249 21228 291 --
NM_145349chr1761829 1539 1525 1380 660 556 1374 31793 694 147 --
NM_145690chr831884 751 326 1251 ----
NM_145698chr1021339 338 1651 ----
NM_145733chr2221055 63 ------
NM_145735chr1322510 2088 12575 11986 --
NM_145793chr101744 ----151
NM_145808chr752976 2747 2622 555 203 ------
NM_145810chr23913 899 355 1130 ----
NM_145861chr161907 1818 1734 1600 1591 1303 ------
NM_145891chr1621501 575 21433 348 ----
NM_145892chr1621501 575 21433 348 ----
NM_145893chr1621623 697 31555 470 81 ----
NM_146388chr1961101 957 905 880 527 270 ------
NM_147156chr101305 ------
NM_147164chr91398 --1184 --
NM_147175chrX42212 1441 1398 758 --1539 --
NM_147181chr41124 ------
NM_147182chr41124 ------
NM_147183chr41124 ------
NM_147189chr81127 12071 1486 --
NM_147233chr23856 492 348 ------
NM_148174chr8144 1580 --11722
NM_148894chr42979 130 --1332 --
NM_148898chr71144 ----1697
NM_148899chr71144 ----1697
NM_148957chr1342428 1642 217 182 ------
NM_152253chr22123861 3854 3631 3223 2833 2709 2676 1660 1581 1370 652 434 --24057 3936 --
NM_152261chr122489 79 ------
NM_152265chr111290 11445 ----
NM_152271chr81459 --2942 437 --
NM_152275chr24557 240 185 127 ------
NM_152280chr12662 349 --2434 38 --
NM_152284chr83820 699 191 --170 --
NM_152305chr341679 1628 109 76 ------
NM_152344chr1731498 1177 430 ------
NM_152352chr1842911 1211 852 837 12458 --22696 2487
NM_152375chr172633 2281 2084 1974 1923 1726 967 ----21948 703
NM_152380chr121651 1460 11421 ----
NM_152422chr961816 1270 1201 745 463 453 21862 184 ----
NM_152424chrX93737 3423 3396 3349 3168 3131 1201 921 524 31515 658 461 11528 1315
NM_152442chr1221425 59 ------
NM_152447chr141273 ------
NM_152467chr17132 ------
NM_152470chr1854091 3605 3468 3363 898 --1280 12895
NM_152487chr111394 ------
NM_152495chr12433 352 11088 ----
NM_152512chr221460 ------
NM_152515chr22376 69 ------
NM_152519chr251640 1450 695 551 364 1751 21584 1442 --
NM_152520chr221101 836 ------
NM_152529chr233849 3464 3061 183 ----
NM_152556chr722496 938 1405 133 --
NM_152557chr741263 1156 492 185 --1118 --
NM_152574chr91358 ------
NM_152588chr1211188 ------
NM_152594chr1532361 1604 926 ------
NM_152609chr11199 1336 ----
NM_152613chr2231058 98 35 ------
NM_152622chr543380 1071 1058 244 ------
NM_152624chr576755 2153 1546 1024 976 225 70 ----1329
NM_152625chr51278 ------
NM_152630chrX2549 59 ------
NM_152636chr1122355 1255 1799 2451 110 --
NM_152638chr1221275 230 11184 ----
NM_152641chr1242409 1034 433 77 --12823 --
NM_152653chr32520 51 ------
NM_152660chr12209 89 ------
NM_152666chr11806 1848 ----
NM_152673chr383991 3775 1605 1349 1064 606 142 22 13465 21569 718 --
NM_152688chr62831 648 ------
NM_152692chrX2502 455 --1466 --
NM_152694chrX1138 --1284 --
NM_152699chr363664 3054 3026 2891 1190 524 --32725 2306 35 --
NM_152723chr1121156 103 --1860 11096
NM_152724chr1042190 1054 884 666 ------
NM_152733chr6136439 6299 6266 5959 5812 5023 5000 4685 4085 2542 1691 793 288 --35895 5042 2458 --
NM_152737chr621391 209 ------
NM_152739chr73837 216 173 136 ----
NM_152745chr71927 ------
NM_152749chr72766 117 1403 2468 245 --
NM_152756chr543071 3038 1681 270 1367 13649 --
NM_152758chr862709 2302 2028 1207 546 216 --12450 --
NM_152774chr722271 540 11704 ----
NM_152787chrX22416 706 ------
NM_152789chr721463 1116 11221 ----
NM_152835chr142173 2008 969 813 --1161 --
NM_152838chr2013245 --13000 --
NM_152857chr6172 ------
NM_152858chr6172 ------
NM_152860chr122617 363 --21315 394 11461
NM_152888chr81793 --21006 652 --
NM_152896chr91576 ----1263
NM_152902chr122022 1653 ----11468
NM_152924chr15165056 4981 4941 4717 4374 4334 2496 2488 2098 1702 1236 1121 732 495 441 289 --34575 550 487 1179
NM_152989chr1231641 274 74 1233 1747 --
NM_152990chr6129 ------
NM_152996chr131932 662 119 --11742 --
NM_152999chr732010 825 353 23537 157 11974 --
NM_153005chr6164 1229 1169 --
NM_153015chr841018 995 711 402 ------
NM_153020chr6--1353 ----
NM_153029chr1683473 3311 2957 1554 1395 1003 777 53 --21466 1259 --
NM_153035chr152815 2667 2125 828 30 12197 ----
NM_153040chr15144 ------
NM_153181chr181212 ------
NM_153182chr382761 2620 2112 2032 1187 234 198 90 --12554 --
NM_153186chr93866 123 42 ------
NM_153188chr575552 4881 4863 4605 3922 3775 3561 23523 1539 11404 --
NM_153207chr1232991 2548 319 ------
NM_153208chr161159 2736 41 ----
NM_153211chr181138 ------
NM_153235chr62873 397 --1956 --
NM_153252chrX182 ------
NM_153255chr631025 323 154 177 ----
NM_153260chr1511513 1178 ----
NM_153262chr142373 912 700 73 ------
NM_153273chr372744 2649 2161 988 921 838 630 --52261 927 693 240 204 --
NM_153331chr31671 ------
NM_153343chr421544 393 22386 2314 ----
NM_153362chr62730 205 ------
NM_153365chr462768 2392 2296 939 875 253 ------
NM_153371chr1332188 1963 545 --1509 --
NM_153456chr1355313 4421 2194 1905 1554 32479 1878 1541 14699 --
NM_153487chr6124788 4601 3799 3537 3404 3292 3259 1789 1562 546 256 171 --34262 3706 3029 --
NM_153607chr552827 2270 2262 2182 316 21956 1227 ----
NM_153616chr152475 112 --1508 --
NM_153617chr152475 112 --1508 --
NM_153618chr152475 112 --1508 --
NM_153619chr1521350 846 ------
NM_153620chr741521 422 201 101 ------
NM_153634chr12184 --11382 --
NM_153687chr1211452 --1513 --
NM_153695chr91277 175 ----
NM_153704chr81465 --1387 --
NM_153705chr11102225 2211 1998 1926 1889 798 417 263 195 95 --164 --
NM_153706chr5----1219 --
NM_153747chr1133 ------
NM_153757chr431241 993 374 ------
NM_153812chr182238 1890 1734 1507 1499 425 142 129 --1481 --
NM_153828chr23894 325 206 1662 ----
NM_153831chr81273 ------
NM_170665chr1294151 3711 3205 3075 1623 1572 1540 1379 1058 ------
NM_170674chr1531363 462 183 ----1110
NM_170675chr1521039 138 ------
NM_170676chr1521039 138 ------
NM_170677chr1531363 462 183 ----1110
NM_170679chr511247 --1185 --
NM_170696chr1541642 1083 390 137 --11113 --
NM_170697chr1541642 1083 390 137 --11113 --
NM_170706chr144287 3560 3397 663 ------
NM_170709chr832319 1922 216 ------
NM_170731chr1162841 2076 1996 1935 813 778 --11093 --
NM_170732chr1162841 2076 1996 1935 813 778 --11093 --
NM_170733chr1162841 2076 1996 1935 813 778 --11093 --
NM_170734chr1162841 2076 1996 1935 813 778 --11093 --
NM_170735chr1162841 2076 1996 1935 813 778 --11093 --
NM_170750chrX3839 575 332 ------
NM_170768chr1151626 1184 1164 319 208 1297 1241 --
NM_171998chrX2211 111 --11818 --
NM_172020chr761792 1737 1416 1278 1272 631 11391 ----
NM_172070chr22400 65 1212 --12090
NM_172071chr166958 6881 5740 2797 2292 1730 --22237 1491 --
NM_172097chr152311 211 2664 34 ----
NM_172110chr201539 --1485 --
NM_172111chr201539 --1485 --
NM_172112chr201539 --1485 --
NM_172113chr201539 --1485 --
NM_172127chr431952 335 317 ------
NM_172128chr431908 291 273 ------
NM_172130chr1101737 1375 1362 1246 649 362 252 149 81 66 --21387 643 --
NM_172159chr331498 942 597 --11994 --
NM_172160chr331498 942 597 --11994 --
NM_172216chr1242965 2935 657 341 --1766 --
NM_172230chr116717 397 336 187 147 71 1427 ----
NM_172315chr1531363 462 183 ----1110
NM_172316chr1531363 462 183 ----1110
NM_172375chr144849 816 323 110 ------
NM_173054chr7------1983
NM_173091chr201133 ------
NM_173171chr21106 ------
NM_173172chr22414 323 ------
NM_173173chr21106 ------
NM_173214chr1687869 7863 6750 2945 2827 2305 1915 1831 13285 --16959
NM_173353chr121619 ------
NM_173355chr23290 51 38 ------
NM_173468chr495704 5327 4533 4049 2055 2015 1734 957 394 --13676 --
NM_173469chr1521562 296 21150 309 ----
NM_173470chrX52761 2177 1904 1045 673 12280 ----
NM_173476chr1682200 1886 1837 876 832 634 423 268 ----1724
NM_173477chr1751952 1911 1802 562 40 ------
NM_173478chr174748 727 355 95 ------
NM_173495chrX32162 2121 1960 ------
NM_173496chr1042233 2209 221 121 ------
NM_173505chr182343 70 ------
NM_173511chr242776 2566 1525 1499 --11444 --
NM_173515chr6143 ------
NM_173517chr7133 ------
NM_173519chr82437 395 ------
NM_173536chr444911 4373 4266 3941 1176 23611 3483 --
NM_173552chr3--1287 ----
NM_173557chr181753 ------
NM_173562chr673085 3000 2767 2402 2260 2185 385 --12586 --
NM_173576chr103745 688 276 2638 303 ----
NM_173582chr1166016 5933 4523 4189 3911 887 12525 ----
NM_173595chr12125198 4958 4496 3870 3345 1815 1643 1578 1010 384 242 207 --11154 --
NM_173602chr1273306 3168 3136 1284 1011 95 74 --11218 --
NM_173609chr15135 183 ----
NM_173642chr1138951 8639 7500 6774 6113 5725 5665 2704 2115 1845 1602 1171 1147 26131 1770 18662 12433
NM_173645chr21545 1149 ----
NM_173657chr35788 759 677 630 550 --1240 --
NM_173667chr552235 1923 1828 1506 94 1554 1732 --
NM_173683chr831669 380 185 ------
NM_173807chr12305 52 ------
NM_173808chr174272 4200 4109 2721 1636 987 328 44399 4073 3219 713 --13096
NM_173822chr231473 788 651 11343 ----
NM_173829chr543807 2352 994 222 35350 4415 1465 ----
NM_173833chr841488 1089 1041 299 ------
NM_173848chr82805 181 ------
NM_173851chr853787 3560 3387 3358 435 12867 33820 780 496 --
NM_174856chr20189 ------
NM_174858chr11894 178 ----
NM_174887chr171316 ------
NM_174890chr101516 1534 ----
NM_174921chr421177 160 1838 ----
NM_174934chr1163591 2635 2272 2198 772 558 --1348 --
NM_174938chr9--1346 ----
NM_175607chr311528 ------
NM_175612chr311528 ------
NM_175624chr1297563 7063 6931 6339 5713 5549 2827 2723 2582 --11518 15037
NM_175625chr1297563 7063 6931 6339 5713 5549 2827 2723 2582 --11518 15037
NM_175709chr2282939 2881 1189 1000 915 772 191 112 --22746 952 --
NM_175736chr1286473 6199 5174 4953 4923 2173 885 532 27091 5011 26749 1304 --
NM_175767chr551438 1361 1254 1147 478 1197 11240 --
NM_175834chr121289 ------
NM_175848chr2031241 1149 81 ------
NM_175848chr2031241 1149 81 ------
NM_175849chr2031241 1149 81 ------
NM_175849chr2031241 1149 81 ------
NM_175850chr2031241 1149 81 ------
NM_175850chr2031241 1149 81 ------
NM_175852chr152891 2214 1021 663 50 --11956 11952
NM_175854chr1332308 2139 532 ------
NM_175856chr51174 ------
NM_175863chr611014 ------
NM_175866chr141398 475 435 145 ------
NM_175907chr1822799 2033 12191 ----
NM_175920chr5150 --1104 --
NM_175921chr534285 1138 335 1416 --1686
NM_175929chr13--1107 ----
NM_176081chr1045651 5148 5106 1317 14012 35223 4448 3986 --
NM_176083chr1045651 5148 5106 1317 14012 35223 4448 3986 --
NM_176801chr471565 1533 1459 458 274 179 145 --11577 --
NM_177414chr14516 336 206 52 11390 ----
NM_177424chr12680 267 ------
NM_177438chr1424241 458 12769 ----
NM_177452chr1411586 12109 ----
NM_177454chr23754 335 123 ------
NM_177538chr2127803 7797 7392 6195 5998 5887 5375 3135 3071 2300 1591 1292 28215 3559 68340 7337 6310 6140 5832 2827 --
NM_177559chr201985 ------
NM_177560chr201985 ------
NM_177947chrX1291 ------
NM_177948chrX1291 ------
NM_177968chr2----1437 --
NM_177969chr21694 ------
NM_177972chr11134205 3911 3898 3625 2759 1642 1627 1239 1034 955 762 554 499 --1302 --
NM_177990chr2011527 ------
NM_177995chr961816 1270 1201 745 463 453 21862 184 ----
NM_177999chr9122543 2381 2341 2297 1404 1082 893 791 511 426 376 22 1577 53441 2509 1360 1108 234 --
NM_178006chr1362258 1985 924 860 510 474 ------
NM_178007chr1362258 1985 924 860 510 474 ------
NM_178010chr1231641 274 74 1233 1747 --
NM_178011chr1033080 2194 742 ----12499
NM_178123chr22299 204 ------
NM_178126chr1742065 1761 1750 858 --3804 646 475 --
NM_178140chr52761 211 12465 1125 12723
NM_178151chrX107822 7782 7063 5904 2626 2008 1839 995 103 41 --11582 --
NM_178152chrX107822 7782 7063 5904 2626 2008 1839 995 103 41 --11582 --
NM_178153chrX107822 7782 7063 5904 2626 2008 1839 995 103 41 --11582 --
NM_178161chr101311 ------
NM_178169chr122338 195 ------
NM_178177chr32626 39 ------
NM_178234chr81213 ------
NM_178313chr21645 --11468 11605
NM_178423chr721281 840 --1298 --
NM_178425chr721281 840 --1298 --
NM_178426chr122123 561 --11960 --
NM_178427chr122023 461 --11860 --
NM_178454chr1------1627
NM_178496chr331309 1065 154 ------
NM_178502chr121176 ------
NM_178578chr2062457 2168 2099 853 819 89 --128 --
NM_178580chr201170 ----155
NM_178582chr201997 1429 ----
NM_178584chr21198 2961 375 --1600
NM_178585chr432932 645 610 ------
NM_178586chr1442318 1535 647 254 ------
NM_178815chr1032777 2400 1862 ------
NM_178863chr16198 ------
NM_178868chr31295 ------
NM_181054chr14--1141 ----
NM_181077chr1512179 --12200 --
NM_181093chr13381 337 74 ------
NM_181302chr141221 ------
NM_181308chr141221 ------
NM_181351chr1152926 2227 2155 1066 483 --22684 2172 --
NM_181358chr153707 3593 2822 2742 764 --13574 --
NM_181361chr3----1298 --
NM_181442chr202231 170 2794 379 ----
NM_181443chr2022721 279 ------
NM_181457chr2124 ------
NM_181486chr1211019 --11306 --
NM_181504chr521113 867 14131 32888 1512 206 13496
NM_181521chr16106558 6348 5521 5388 2733 1751 493 429 269 55 --26536 2017 11658
NM_181523chr521113 867 14131 32888 1512 206 13496
NM_181524chr521113 867 14131 32888 1512 206 13496
NM_181656chr171979 ------
NM_181659chr2043309 1297 1092 85 --12138 12409
NM_181659chr2043309 1297 1092 85 --12138 12409
NM_181671chr171884 1870 ----
NM_181672chrX21916 724 1461 ----
NM_181673chrX21916 724 1461 ----
NM_181674chr5154 ------
NM_181675chr5154 ------
NM_181676chr5154 ------
NM_181677chr5154 ------
NM_181678chr5154 ------
NM_181689chr203831 655 607 ------
NM_181746chr12250 83 ------
NM_181762chrX1300 --1138 --
NM_181777chrX1300 --1138 --
NM_181784chr231702 990 622 ----22411 295
NM_181794chr62948 113 1187 ----
NM_181795chr62948 113 1187 ----
NM_181807chr111381 ------
NM_181809chr1153397 3162 3137 3115 3008 2875 1547 1325 1267 1176 1142 643 515 139 92 --42953 754 588 340 --
NM_181828chr22163677 3447 3189 3037 2927 2748 2627 2556 1460 1434 1258 1096 722 628 550 31 --23850 2872 --
NM_181829chr22163677 3447 3189 3037 2927 2748 2627 2556 1460 1434 1258 1096 722 628 550 31 --23850 2872 --
NM_181830chr22163677 3447 3189 3037 2927 2748 2627 2556 1460 1434 1258 1096 722 628 550 31 --23850 2872 --
NM_181832chr22163692 3462 3204 3052 2942 2763 2642 2571 1475 1449 1273 1111 737 643 565 46 --23865 2887 --
NM_181833chr22153617 3387 3129 2977 2867 2688 2567 2496 1400 1374 1198 1036 662 568 490 --23790 2812 --
NM_181836chr522310 444 --12430 --
NM_181838chr521249 1076 21486 1064 11168 --
NM_181861chr1262149 995 969 868 671 375 12046 2914 616 1732
NM_181868chr1262149 995 969 868 671 375 12046 2914 616 1732
NM_181869chr1262234 1080 1054 953 756 460 12131 2999 701 1817
NM_181886chr4--11040 ----
NM_181887chr4--11040 ----
NM_181888chr4--11040 ----
NM_181889chr4--11040 ----
NM_181890chr4--11040 ----
NM_181891chr4--11040 ----
NM_181892chr4--11087 ----
NM_181893chr4--11040 ----
NM_181897chr342455 636 296 108 12439 12128 --
NM_182485chr43901 586 193 ----1255
NM_182487chr9133949 3670 3257 3108 2976 2749 2698 1363 1107 1038 339 289 200 --13081 --
NM_182493chr1664895 3993 3716 1929 1114 805 --24813 1763 --
NM_182503chr684561 4412 4393 2152 1235 1102 305 25 ----14628
NM_182509chr1431155 427 349 --31291 1083 337 --
NM_182511chr1811015 ------
NM_182526chr1462526 2254 1903 1082 976 109 --162 --
NM_182529chr7138 ------
NM_182540chrX3872 324 32 1253 ----
NM_182551chr273377 2745 2593 1206 662 541 268 --33496 451 66 --
NM_182565chr171205 --1629 --
NM_182569chr17177 ------
NM_182616chr154800 336 152 102 --1312 1844
NM_182641chr1721608 643 192 --1734
NM_182643chr832343 916 113 ------
NM_182646chr43901 586 193 ----1255
NM_182648chr14----1519 --
NM_182649chr20----134 --
NM_182666chr31589 ------
NM_182691chr73549 400 250 ------
NM_182692chr73549 400 250 ------
NM_182700chr761749 1586 716 597 565 46 ------
NM_182706chr8169 ------
NM_182715chr721109 799 --1268 --
NM_182729chr1231609 352 265 ------
NM_182742chr1231609 352 265 ------
NM_182743chr1231609 352 265 ------
NM_182744chr11428 --2818 180 --
NM_182757chr662811 2620 2151 621 496 165 ------
NM_182763chr142425 1022 519 330 --169 --
NM_182789chr51797 ------
NM_182830chr1442147 818 716 37 ----1640
NM_182898chr776438 6080 5844 5693 4547 4346 557 21429 1320 11549 15026
NM_182899chr776438 6080 5844 5693 4547 4346 557 21429 1320 11549 15026
NM_182907chr621852 1576 ------
NM_182917chr31448 ------
NM_182918chr2111353 ------
NM_182920chr311366 --21245 921 --
NM_182936chr142588 119 11656 ----
NM_182944chr14--192 ----
NM_182948chr132537 2260 188 ------
NM_182970chr2084218 3996 3981 3879 2951 1354 967 68 1723 11695 --
NM_182972chr132632 1818 450 ------
NM_182975chr1--11125 ----
NM_182976chr11245 ------
NM_183002chr142588 119 11656 ----
NM_183004chr1473803 3796 3468 2602 1211 869 335 --12581 --
NM_183009chr81100 ------
NM_183043chr134402 356 276 52 ------
NM_183044chr134402 356 276 52 ------
NM_183049chr42308 108 --1286 --
NM_183061chr31132 ------
NM_183238chr1243568 3420 982 143 --13036 --
NM_183323chr51797 ------
NM_183353chrX11150 11202 ----
NM_183377chr17174 --1533 --
NM_183393chr31677 ------
NM_183394chr31677 ------
NM_184234chr201734 ------
NM_194247chr263201 3141 3081 1578 1269 1099 ------
NM_194278chr1463584 1458 927 859 852 174 --42949 2822 2648 474 --
NM_194285chr1162720 1339 1242 1211 1196 141 23325 653 12957 --
NM_194286chr12166168 5886 5564 5494 5321 5169 4925 3789 3773 2340 1775 1442 1292 1257 939 539 15650 25753 1008 --
NM_194291chr8----12848 --
NM_194292chr131614 665 93 1264 ----
NM_194301chr141981 --1214 --
NM_194317chr242299 1842 1830 131 12658 1227 --
NM_194454chr73573 92 24 21277 501 --11651
NM_194455chr73573 92 24 21277 501 --11651
NM_194456chr73573 92 24 21277 501 --11651
NM_194463chrX2495 213 ------
NM_197968chr13185 ------
NM_197970chr21155 ------
NM_198057chrX3505 229 80 --1797 --
NM_198074chr141097 494 456 35 --1898 --
NM_198081chr622732 1971 ------
NM_198097chr7--166 ----
NM_198098chr771618 1223 1161 521 491 143 97 ------
NM_198158chr322520 1003 --11184 --
NM_198159chr322520 1003 --11184 --
NM_198177chr322520 1003 --11184 --
NM_198178chr322520 1003 --11184 --
NM_198181chr1532097 1910 1073 --12584 --
NM_198215chr102241 147 ------
NM_198225chr1031942 464 172 ------
NM_198240chr1231028 544 410 --1378 --
NM_198241chr31448 ------
NM_198242chr31448 ------
NM_198243chr15----2254 239 --
NM_198244chr31448 ------
NM_198268chr153707 3593 2822 2742 764 --13574 --
NM_198269chr153707 3593 2822 2742 764 --13574 --
NM_198270chrX33366 1103 117 ------
NM_198273chr532220 1005 215 --1916 --
NM_198279chrX1311 ------
NM_198320chr1254911 3408 3190 3183 1285 14369 --11199
NM_198336chr72224 192 ----1160
NM_198392chr661940 1810 1629 552 350 202 ------
NM_198396chr17146 ------
NM_198400chr1542544 2366 352 245 22803 977 ----
NM_198404chr133857 283 46 1797 ----
NM_198440chr2292478 2344 2241 1996 1937 715 537 508 210 --12083 --
NM_198447chr1----1286 --
NM_198451chrX4648 542 445 102 ------
NM_198465chrX42062 1909 629 192 --12091 --
NM_198504chr31206 ------
NM_198513chr81256 ------
NM_198527chr152505 118 --2438 65 --
NM_198549chr153190 3100 2582 742 482 ------
NM_198560chr383800 1097 994 817 673 347 132 78 --1139 --
NM_198581chr2127509 6509 6065 5563 5234 5181 5047 4963 4633 2878 1894 360 --77489 6619 6468 5509 5347 4882 673 --
NM_198715chr165912 5671 4682 2419 2180 1885 14347 11064 --
NM_198793chr344148 3425 3115 1632 13985 13529 --
NM_198794chr142409 210 11415 ----
NM_198859chr364491 4204 3518 3156 1968 1392 15027 24700 241 --
NM_198889chr431179 958 416 ------
NM_198896chr112787 493 21563 1363 ----
NM_198900chr1286473 6199 5174 4953 4923 2173 885 532 27091 5011 26749 1304 --
NM_198903chr51572 ------
NM_198904chr542069 1932 572 394 ------
NM_198935chr203985 935 162 ------
NM_198956chr761749 1586 716 597 565 46 ------
NM_198989chr131414 ------
NM_199000chr74749 705 629 470 1661 ----
NM_199003chr81110 11255 ----
NM_199004chr171457 ------
NM_199050chr2173543 3212 2861 2415 1373 909 24 --12714 --
NM_199054chr1942021 1902 473 118 167 1126 --
NM_199160chr921798 1345 1494 ----
NM_199168chr101303 ------
NM_199169chr2053484 2947 2900 2747 534 23470 176 33458 2456 1380 --
NM_199170chr2053484 2947 2900 2747 534 23470 176 33458 2456 1380 --
NM_199171chr2053484 2947 2900 2747 534 23470 176 33458 2456 1380 --
NM_199188chr1243681 2816 1390 676 ------
NM_199189chr5--1973 1331 1258
NM_199190chr1243681 2816 1390 676 ------
NM_199244chr91827 --1282 --
NM_199246chr5--191 ----
NM_199297chr11------125
NM_199320chr442482 2036 1107 884 --11872 12202
NM_199320chr442482 2036 1107 884 --11872 12202
NM_199324chr433332 3095 2418 --12790 --
NM_199327chr42795 45 1422 ----
NM_199328chr211241 1160 ----
NM_199330chr152519 39 ------
NM_199331chr152519 39 ------
NM_199332chr152519 39 ------
NM_199342chr1163 ------
NM_199355chr1631389 541 479 11618 ----
NM_199421chr1484969 4907 4090 4067 3685 581 309 187 --34814 3770 3605 11502
NM_199423chr16----1379 1326
NM_199461chr1033138 1352 759 ------
NM_199478chrX31702 1436 302 --11710 --
NM_199482chr21172 --11507 --
NM_201263chr122141 277 --11518 --
NM_201266chr232147 944 589 ------
NM_201267chr21585 ------
NM_201269chr111271 ------
NM_201278chr1161557 1544 1493 831 626 275 ------
NM_201279chr232147 944 589 ------
NM_201280chr631416 1159 94 ------
NM_201281chr1161557 1544 1493 831 626 275 ------
NM_201428chr1121049 171 --1115 --
NM_201429chr1121049 171 --1115 --
NM_201430chr112975 97 --141 --
NM_201437chr831000 553 73 ------
NM_201535chr14----1688 --
NM_201536chr14----1688 --
NM_201537chr14----1688 --
NM_201538chr14----1688 --
NM_201539chr14----1688 --
NM_201540chr14----1688 --
NM_201541chr14----1688 --
NM_201545chr1--11106 11455 --
NM_201567chr31262 --133 --
NM_201570chr101661 ------
NM_201571chr101661 ------
NM_201572chr101661 ------
NM_201590chr101661 ------
NM_201591chr421506 211 --1752 --
NM_201592chr421506 211 --1752 --
NM_201593chr101661 ------
NM_201596chr101661 ------
NM_201597chr101661 ------
NM_201613chr121329 --1671 --
NM_201624chr121196 320 --1265 1431
NM_201995chr111242 ------
NM_201999chr43910 265 29 1287 ----
NM_202002chr123618 71 28 ------
NM_203283chr43533 401 244 ------
NM_203284chr43533 401 244 ------
NM_203301chr1411395 ------
NM_203327chr2054173 3616 1593 1425 831 11204 11698 --
NM_203329chr11136532 6488 6410 6191 5189 5023 4841 4452 2379 2335 2257 2037 1867 15467 16912 --
NM_203330chr11136532 6488 6410 6191 5189 5023 4841 4452 2379 2335 2257 2037 1867 15467 16912 --
NM_203331chr11136532 6488 6410 6191 5189 5023 4841 4452 2379 2335 2257 2037 1867 15467 16912 --
NM_203342chr152668 2402 2350 1424 1398 --22943 1343 --
NM_203343chr152668 2402 2350 1424 1398 --22943 1343 --
NM_203346chr242070 1565 1511 175 --11953 --
NM_203350chr121736 1592 --11671 --
NM_203351chr1762488 1753 972 728 650 89 --32233 2124 514 --
NM_203364chr1111169 11146 ----
NM_203372chr22295 76 ------
NM_203391chrX1139 ------
NM_203406chr542930 2036 1843 203 ------
NM_203437chr21108 ------
NM_203446chr2122730 349 --1616 --
NM_203453chr941715 569 281 107 ------
NM_203458chr143878 3835 568 464 1956 ----
NM_203459chr12916 120 ------
NM_203487chr13--1545 ----
NM_203504chr422089 831 ------
NM_203505chr422089 831 ------
NM_203506chr1731971 359 71 --1562 --
NM_205848chr142367 2234 992 502 --166 --
NM_205860chr152530 2293 2151 2029 104 --22506 929 --
NM_205861chr182099 1508 1385 1338 681 633 181 136 --1715 --
NM_206594chr153677 3012 3006 1112 905 ------
NM_206595chr153677 3012 3006 1112 905 ------
NM_206809chr631168 152 81 1793 ----
NM_206814chr641534 518 447 41 11159 ----
NM_206852chr14------1278
NM_206853chr613529 --13575 --
NM_206854chr624790 991 --14836 --
NM_206855chr655755 4001 3971 1956 78 --15801 --
NM_206857chr14------1278
NM_206860chr101309 ------
NM_206861chr101309 ------
NM_206862chr101309 ------
NM_206866chr2152309 2221 845 577 445 1585 ----
NM_206876chr253560 3161 2242 1265 1220 ------
NM_206907chr522055 252 22540 83 2703 536 --
NM_206914chr1252197 1654 347 66 42 --1830 --
NM_206927chr111689 1236 ----
NM_206928chr111689 1236 ----
NM_206929chr111689 1236 ----
NM_206930chr111689 1236 ----
NM_206943chr22705 23 1929 1648 --
NM_206944chr91804 ------
NM_206945chr91804 ------
NM_206946chr91804 ------
NM_206947chr91804 ------
NM_207009chr101891 1359 ----
NM_207012chr1063135 2683 2356 2156 74 41 1176 ----
NM_207112chr161140 ------
NM_207119chr1061961 1669 941 657 114 86 --22348 2190 1353
NM_207123chr43829 715 144 ------
NM_207171chr121382 1313 ------
NM_207299chr92245 22 ------
NM_207304chr1322049 484 ------
NM_207325chr1951799 1693 737 692 105 ------
NM_207361chr13116311 6001 5824 5531 4593 3878 2187 2176 2100 1540 485 --15658 --
NM_207380chr1593237 3110 2291 981 919 833 703 413 300 13553 22542 2285 --
NM_207387chr1751434 702 523 163 24 11772 ----
NM_207396chr151421 604 492 188 29 --3436 300 133 --
NM_207404chr332109 1503 377 --12222 1552
NM_207413chr8------1431
NM_207429chr1132286 1854 296 --12629 --
NM_207445chr153822 240 181 ------
NM_207517chr1541513 1440 781 406 11258 ----
NM_207520chr23894 325 206 1662 ----
NM_207521chr23894 325 206 1662 ----
NM_207645chr111277 2452 375 1490 --
NM_207647chr921995 203 12042 ----
NM_207660chr1431322 563 162 ------
NM_207661chr1431322 563 162 ------
NM_207662chr1431322 563 162 ------
NM_212467chr1572410 2259 2252 2100 1653 970 273 --22149 328 --
NM_212535chr16146 ------
NM_212543chr31746 ------
NM_212552chr2173 ------
NM_212554chr10--1662 136 --
NM_213589chr263757 3445 3396 1993 1329 773 --34698 4102 1897 15480
NM_213594chr1241130 893 886 231 1337 ----
NM_213618chr113462 182 121 ------
NM_213654chr32589 403 ------
NM_213662chr1742359 2159 2046 591 ------