TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4454
miRNA Sequence: GGAUCCGAGUCACGGCACCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000899chr1231583 546 442 ----23394 3341
NM_001011513chr454057 3975 3969 3110 2582 21197 849 ----
NM_001042404chr121538 1222 ----11481
NM_001042599chr246480 5580 2645 1131 ----16053
NM_001106chr359576 6161 572 185 37 ----1192
NM_001969chr1433808 3456 723 ----1261
NM_002025chrX58482 6359 3424 3153 2976 23595 2444 16856 --
NM_002247chr1021765 1720 --11734 12092
NM_002270chr535343 2263 1762 --11569 15600
NM_002310chr556368 6104 4703 2114 961 11524 12270 --
NM_002655chr824806 1249 ----14437
NM_003966chr577098 6782 6138 1801 872 750 99 15581 11574 17426
NM_003994chr1231583 546 442 ----23394 3341
NM_004703chr1722482 1686 ----2876 823
NM_004999chr612799 13888 --33498 2912 1534
NM_005235chr246480 5580 2645 1131 ----16053
NM_006380chr1733634 2905 38 ----13916
NM_006457chr454057 3975 3969 3110 2582 21197 849 ----
NM_006544chr1475165 1840 1600 1092 651 557 182 ------
NM_007006chr1622626 782 13289 --11005
NM_007011chr1576668 6328 4283 4274 1697 1372 98 --11281 16125
NM_007195chr1853348 3073 2621 1490 945 ----154
NM_007249chr1358035 6109 1953 386 38 --17810 18648
NM_014155chr1127034 3018 25286 1065 13006 --
NM_014721chr647175 6013 2708 1078 ----11654
NM_014812chr121538 1222 ----11481
NM_015906chr124113 3276 --12988 23460 3016
NM_016083chr623476 881 11050 --11293
NM_018361chr81127 13880 11032 11518
NM_020123chr103982 367 217 ----21560 30
NM_033020chr124113 3276 --12988 23460 3016
NM_033181chr623476 881 11050 --11293
NM_080867chr1445053 4887 1765 79 1717 --13505
NM_133367chr633301 689 465 ----1203
NM_144963chr822629 949 ----1895
NM_145307chr1024320 3797 13637 --11323
NM_145753chr311669 --1298 1251
NM_152924chr1576668 6328 4283 4274 1697 1372 98 --11281 16125
NM_153188chr535343 2263 1762 --11569 15600
NM_173468chr444162 3962 2441 2430 15879 ----
NM_173851chr81190 ----23735 3479
NM_175861chr12------25843 2359
NM_177538chr222625 139 41560 714 577 441 --18566
NM_181054chr141852 1339 11265 1136
NM_183004chr1433808 3456 723 ----1261
NM_199421chr1445053 4887 1765 79 1717 --13505
NM_206853chr621460 1397 --1476 13366
NM_206854chr613714 --11737 14627
NM_207303chr1031449 902 76 ----1863