TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4461
miRNA Sequence: GAUUGAGACUAGUAGGGCUAGGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr832177 519 229 --1929 1776
NM_000038chr561994 1385 807 549 301 69 11632 ----
NM_000051chr1173490 3469 2304 620 580 523 181 ------
NM_000052chrX92993 2953 1222 924 816 458 419 163 76 --1878 --
NM_000067chr82526 466 1659 ----
NM_000081chr131875 589 274 11197 ----
NM_000084chrX106721 6704 6014 5619 4893 4219 2648 2539 2323 453 24870 2078 24322 1324 --
NM_000089chr71226 ------
NM_000090chr21231 --1242 --
NM_000091chr262755 2622 1975 572 205 164 1926 21141 131 --
NM_000092chr293451 2775 1680 1601 598 470 462 359 282 1783 44202 4174 3270 3144 --
NM_000093chr942459 2401 1562 340 --2654 630 22513 2280
NM_000096chr31957 --1366 --
NM_000097chr311000 --11026 --
NM_000109chrX12060 11764 --12672
NM_000111chr71120 ------
NM_000115chr1342692 432 267 234 --21871 468 --
NM_000124chr10125 ------
NM_000125chr674274 3764 3599 1606 1498 293 155 ------
NM_000138chr1582425 1872 1817 1615 784 656 435 194 12129 52381 2363 553 521 331 12394
NM_000141chr102983 970 --1549 --
NM_000158chr33462 247 221 1135 2683 625 --
NM_000161chr1421209 312 11575 191 11909
NM_000163chr562263 2254 2167 1977 421 183 21478 1448 21871 1724 1263
NM_000165chr62437 34 21707 1307 ----
NM_000167chrX31418 1394 1345 --21479 75 --
NM_000168chr762744 2417 2081 2058 1296 458 --32206 749 136 12435
NM_000176chr543400 2568 2439 1030 1265 12709 --
NM_000183chr2----164 1176
NM_000189chr272316 2299 2204 1591 1540 931 678 --12266 --
NM_000192chr122507 214 --2458 449 --
NM_000202chrX73710 1107 773 605 561 521 390 1669 43257 3138 2442 1159 --
NM_000208chr19104652 3453 1891 1163 895 790 730 464 258 146 11563 14667 --
NM_000210chr272253 1998 1684 664 646 271 248 --11800 --
NM_000214chr2021694 1668 1647 ----
NM_000217chr1264401 4014 2153 1255 738 188 23478 1364 ----
NM_000222chr431919 1777 80 ------
NM_000237chr871265 730 701 407 194 170 104 ----1678
NM_000242chr1062471 2240 2064 1880 867 544 12226 21921 1832 12634
NM_000245chr73864 716 429 11751 11623 --
NM_000248chr342030 1997 992 779 ----1958
NM_000252chrX31324 322 125 --31245 982 976 --
NM_000254chr142638 1193 1112 298 ----11201
NM_000259chr15165997 5666 5507 5278 5082 4972 4848 4488 2476 2081 1940 1906 1470 993 716 655 25546 1980 22280 1020 15402
NM_000264chr952883 1219 793 502 334 --12590 --
NM_000267chr1783511 2971 2622 740 692 627 548 434 --1297 --
NM_000284chrX51369 610 495 95 54 --11848 --
NM_000297chr462014 1745 1346 766 640 484 1447 1294 12064
NM_000310chr131249 488 380 ----1509
NM_000314chr102749 254 11162 42322 1103 1006 899 --
NM_000321chr1321685 1480 ------
NM_000330chrX41526 1437 508 324 --2299 170 1789
NM_000332chr696568 5889 5803 5499 5356 4639 2423 2326 1247 --35720 1308 104 --
NM_000337chr5146422 6161 5421 5127 5090 5063 4799 4606 2517 1561 1515 903 799 780 35684 4323 1946 22635 451 --
NM_000340chr32980 311 ------
NM_000345chr46991 873 244 118 97 67 ------
NM_000346chr1751789 1762 1641 1263 700 --11647 --
NM_000367chr662291 2208 1932 588 436 318 ------
NM_000378chr11160 --11262 --
NM_000393chr271968 1859 678 608 579 309 139 --11419 31910 1403 220
NM_000399chr1021206 780 ----11111
NM_000406chr492802 2379 2361 2079 1961 1150 1057 161 146 22388 2345 12114 --
NM_000408chr292961 2728 2463 2222 2201 945 733 643 515 --32636 2270 239 11158
NM_000411chr2172973 2879 2473 2283 2150 2063 714 --12302 --
NM_000421chr17------1336
NM_000430chr1783724 3190 3136 2947 2366 985 667 655 1461 32657 1272 706 --
NM_000439chr552546 2126 770 323 208 --1317 11571
NM_000441chr731921 930 55 11994 ----
NM_000444chrX1385 --1336 --
NM_000448chr1163206 2236 1999 871 826 149 1240 1574 33231 2288 711
NM_000452chr1381831 1547 1416 1345 753 664 275 44 1640 11284 --
NM_000454chr21197 --1217 --
NM_000461chr333164 3048 1736 21721 1258 --12915
NM_000462chr1521796 1529 --11824 --
NM_000480chr113524 437 39 11222 ----
NM_000484chr2131071 950 756 ------
NM_000489chrX83357 3281 2832 2449 826 597 453 236 --11268 --
NM_000492chr731487 1469 1148 ------
NM_000493chr641104 1092 894 220 ------
NM_000495chrX31115 805 324 ------
NM_000509chr4------1182
NM_000522chr711131 186 ----
NM_000533chrX41682 336 300 77 --22018 1277 --
NM_000553chr83626 463 146 ------
NM_000555chrX147820 7673 7533 7147 7126 7115 6927 6754 6306 5743 5028 2537 455 100 37776 2388 1163 47907 5551 1217 281 --
NM_000559chr11129 ------
NM_000560chr13612 225 176 1706 2728 532 --
NM_000565chr181947 1555 1473 642 625 473 195 97 ------
NM_000572chr13953 932 890 ----1224
NM_000574chr131332 1049 920 ------
NM_000575chr21394 --2930 435 --
NM_000595chr64602 228 152 40 ------
NM_000599chr284535 4330 3916 1757 1301 1053 1032 885 ------
NM_000601chr7------1353
NM_000615chr1162442 2188 1961 1936 1901 579 13028 1644 --
NM_000618chr12166458 6165 6022 5963 5820 5676 5625 5510 4713 4615 4240 1569 1557 1550 1273 298 --65604 4880 4450 2467 1597 1489 --
NM_000618chr12166458 6165 6022 5963 5820 5676 5625 5510 4713 4615 4240 1569 1557 1550 1273 298 --65604 4880 4450 2467 1597 1489 --
NM_000627chr21240 ------
NM_000663chr1663121 2597 2581 2009 1902 396 22872 2184 1623 --
NM_000684chr1021164 1035 ------
NM_000686chrX31209 384 250 ----21555 1506
NM_000689chr9--2520 34 ----
NM_000719chr1276742 5555 5274 4102 2087 1913 1606 21518 933 141 --
NM_000724chr1031709 1645 1393 --1654 --
NM_000793chr1494889 4621 4317 3858 3665 1791 1220 613 79 14465 25035 557 --
NM_000801chr2031088 905 808 --2978 831 --
NM_000806chr541787 409 98 60 ----11387
NM_000807chr42740 258 ------
NM_000809chr4179085 9040 8860 8702 8508 8426 8252 6934 6246 6119 5896 3326 3284 3113 2661 2197 988 28690 1076 79135 8109 6437 3232 3215 2836 2377 27051 3084
NM_000813chr5114861 4645 4501 3980 3783 3733 1479 1370 1291 1124 1056 25140 4440 44495 4238 4131 1107 15380
NM_000814chr1583623 3444 3264 2979 1164 911 151 22 --1839 13014
NM_000816chr52499 212 ----1553
NM_000824chr42377 148 ------
NM_000826chr452612 2159 986 689 281 --12196 --
NM_000828chrX21725 1653 --1594 1139
NM_000829chr1162020 1803 1775 1755 835 29 22334 2076 ----
NM_000844chr3143 2785 194 11074 --
NM_000865chr61224 ------
NM_000868chrX82359 1634 978 878 719 391 339 82 12254 1950 --
NM_000875chr15106897 6539 5590 5355 4863 4432 2680 2521 252 107 1266 44453 2484 1836 815 25580 189
NM_000876chr651363 1005 289 114 76 --11412 11451
NM_000879chr5192 1279 ----
NM_000891chr1783292 2864 2429 2369 1142 686 376 143 13383 --11453
NM_000899chr1294176 3851 3323 2942 2722 1554 1446 466 316 22691 498 33106 1500 943 --
NM_000902chr3123211 3171 3123 3083 2863 2638 2007 998 985 700 590 238 ------
NM_000910chr461896 745 703 643 626 358 ----11283
NM_000912chr8103179 3131 3002 2243 1141 1119 396 343 246 51 13059 ----
NM_000926chr11109263 8599 8426 8192 7689 2091 1509 1085 909 504 17633 1831 27540 1990
NM_000935chr31294 --21208 177 --
NM_000944chr421728 547 11520 1703 12144
NM_000945chr22590 189 1826 --1182
NM_000950chrX63263 3208 2381 2273 932 329 ----22607 982
NM_000956chr143736 712 210 ----11016
NM_000958chr551241 1211 1143 845 151 ------
NM_000963chr151755 1676 817 599 270 ------
NM_000965chr311073 ------
NM_000983chr131337 1158 1151 --2345 191 --
NM_001001132chr21------21182 324
NM_001001323chr1263185 2777 2554 2371 1072 1054 --23115 600 --
NM_001001342chr1051096 1050 536 356 135 ------
NM_001001394chr21688 --1464 1729
NM_001001395chr1232387 2238 685 22777 1000 12077 --
NM_001001419chr5135195 5123 4997 4577 4568 4562 4309 4059 1816 1793 1023 704 261 13681 44687 2065 399 21 --
NM_001001420chr5135195 5123 4997 4577 4568 4562 4309 4059 1816 1793 1023 704 261 13681 44687 2065 399 21 --
NM_001001433chr2063032 2350 1029 1000 880 556 ------
NM_001001436chr163735 75 57 1898 1873 --
NM_001001481chr873252 2932 2195 1138 726 650 403 --13081 11336
NM_001001483chr111324 1438 125 1149
NM_001001484chr1031966 708 433 ------
NM_001001521chr24314 283 242 219 ------
NM_001001549chr761937 1816 1779 680 502 461 12585 --1420
NM_001001550chr761937 1816 1779 680 502 461 12585 --1420
NM_001001555chr761937 1816 1779 680 502 461 12585 --1420
NM_001001556chr1541382 1037 188 136 --1501 1305
NM_001001557chr832041 1546 402 ------
NM_001001664chr2184111 3993 3586 3532 3227 3128 2696 2591 2524 1656 1489 1390 938 930 540 416 350 223 --13348 --
NM_001001665chr253189 1206 943 857 431 2366 289 ----
NM_001001669chr582729 2650 2628 2195 1912 1695 755 548 --11876 --
NM_001001701chr462310 2229 1496 690 242 206 ----195
NM_001001713chr213387 320 63 ------
NM_001001890chr2164021 3843 2880 2731 1727 1391 --13575 --
NM_001001928chr22218343 8181 7270 7147 6282 6097 5400 5394 5308 3184 3023 2936 2897 2647 1543 1494 1018 867 501 254 222 16461 17422 17948
NM_001001938chr984041 3372 2900 1292 1214 1058 876 131 --1628 13722
NM_001001974chr1031942 1512 42 22260 400 12154 1224
NM_001001994chrX----1364 --
NM_001001995chrX51262 765 536 311 128 2355 334 --1605
NM_001001996chrX----1364 --
NM_001002257chr232597 301 142 32452 1073 738 13532 11122
NM_001002295chr101782 --1832 1814
NM_001002814chr8133709 3672 3068 2963 2757 2536 2422 1510 1329 1290 747 541 389 --13506 --
NM_001002838chrX61843 1628 1602 1427 1279 1198 ------
NM_001002843chr1561240 1216 1196 339 276 71 ------
NM_001002857chr151324 ------
NM_001002858chr151324 ------
NM_001002860chr1484704 4497 4420 4394 3838 3040 1328 1111 --13183 13573
NM_001002906chrY--1198 --1428
NM_001003652chr18188462 7935 7342 7166 7109 6630 5291 2434 2275 1860 1643 1364 1073 889 616 505 240 35 15685 38177 5372 5313 26319 1636
NM_001003674chr18136869 6659 6277 5437 4620 4376 2648 2490 2222 2063 1856 1372 1182 11120 27047 593 16798
NM_001003675chr18136869 6659 6277 5437 4620 4376 2648 2490 2222 2063 1856 1372 1182 11120 27047 593 16798
NM_001003678chr11------1114
NM_001003679chr162103 2082 1985 1446 589 233 --12149 31592 1360 611
NM_001003681chr2241723 1639 604 375 11309 1485 --
NM_001003688chr421077 998 ----21210 921
NM_001003694chr33619 598 120 ------
NM_001003712chr1242716 1552 810 530 1491 13351 --
NM_001003800chr953614 2762 2686 2413 90 ----11167
NM_001003810chr41547 1642 1215 --
NM_001004051chrX----1245 1325
NM_001004065chr933960 2902 233 ------
NM_001004317chr674148 3671 3531 1351 1283 922 521 11517 23924 3813 --
NM_001004342chr1116082 5648 5356 4256 3749 1349 1050 913 900 330 279 14578 25276 4238 --
NM_001004360chr241773 1720 1589 44 ------
NM_001004419chr1294628 4598 4571 4213 3636 3536 3519 2806 990 21735 190 24537 4057 --
NM_001005335chr19------1308
NM_001005375chrY61790 1475 597 409 238 98 --11386 --
NM_001005386chr252513 1939 1658 825 476 1995 ----
NM_001005404chr1794532 4410 3773 3605 3191 3097 2923 1557 729 12972 ----
NM_001005415chr191427 ------
NM_001005416chr191427 ------
NM_001005463chr1022498 764 --21938 248 --
NM_001005473chr5176223 5988 5797 5005 4916 4569 4017 2261 2116 1835 1787 1759 1167 1125 760 458 265 25774 2170 36604 4416 854 15219
NM_001005474chr32342 265 --1247 --
NM_001005739chr21543 ------
NM_001005751chr10179 1171 ----
NM_001005845chr861433 1308 1246 695 337 326 ------
NM_001005849chr171413 --163 --
NM_001005910chr32520 273 --2691 227 --
NM_001005911chr32520 273 --2691 227 --
NM_001006117chrY1186 ------
NM_001006600chr542461 2140 1754 860 ------
NM_001006605chr141119 995 865 829 ------
NM_001006605chr141119 995 865 829 ------
NM_001006617chr951216 916 531 356 284 ------
NM_001006619chr951216 916 531 356 284 ------
NM_001006620chr951216 916 531 356 284 ------
NM_001006621chr951216 916 531 356 284 ------
NM_001006623chr292333 2270 1911 1604 1038 732 517 250 201 --22255 179 --
NM_001006624chr142023 2002 646 603 ------
NM_001006636chr22924 717 ----21016 948
NM_001006639chrX--1532 180 --
NM_001006640chrX--1532 180 --
NM_001006641chr931795 1149 102 21667 1417 ----
NM_001006642chr931795 1149 102 21667 1417 ----
NM_001006643chr931795 1149 102 21667 1417 ----
NM_001006657chr233154 3049 2267 --11043 --
NM_001006684chrX----1183 --
NM_001007023chr1494889 4621 4317 3858 3665 1791 1220 613 79 14465 25035 557 --
NM_001007024chr1784350 4182 3145 2960 2807 1678 661 654 ------
NM_001007025chr1784350 4182 3145 2960 2807 1678 661 654 ------
NM_001007067chr84937 918 223 178 ------
NM_001007068chr84937 918 223 178 ------
NM_001007069chr84937 918 223 178 ------
NM_001007070chr84937 918 223 178 ------
NM_001007097chr9135089 4553 4203 3466 3340 3316 3272 3188 1821 1794 682 370 219 ----11607
NM_001007099chr12831 706 --3741 725 128 --
NM_001007100chr12831 706 --3741 725 128 --
NM_001007102chr6--11202 21681 419 1384
NM_001007214chr11514 1701 ----
NM_001007237chr172722 2069 1994 996 535 387 307 ------
NM_001007245chr7----154 --
NM_001007246chr2121794 1735 --21883 269 --
NM_001007250chr14953 828 38 24 --3863 847 250 --
NM_001007256chr1----1111 --
NM_001007257chr131155 954 30 11489 ----
NM_001007277chr112960 889 ------
NM_001007464chr61166 1146 ----
NM_001007466chr694910 3878 3597 3264 1738 998 618 539 41 15208 11593 --
NM_001007467chr22199 ------
NM_001007527chr53552 502 191 ------
NM_001007559chr1871934 1835 1684 1579 1500 538 284 ------
NM_001008239chr1873649 3476 3423 3397 2966 2556 2431 1222 12682 --
NM_001008388chr42303 153 --161 --
NM_001008391chr11--1205 ----
NM_001008392chr32307 237 ------
NM_001008393chr432729 2421 376 --11129 --
NM_001008401chr1921248 1211 ------
NM_001008405chr731540 1414 429 21818 183 ----
NM_001008408chr7145757 5583 5542 4724 4454 4235 3965 1857 1459 1374 618 470 442 268 34492 2363 1929 --15194
NM_001008495chr812127 --12095 1640
NM_001008541chr1031914 1500 69 154 ----
NM_001008541chr1031914 1500 69 154 ----
NM_001008564chr1351718 1616 1381 900 786 --1223 --
NM_001008660chr1181514 1340 385 267 259 139 101 92 ------
NM_001008712chr8------170
NM_001008738chr582899 2298 1869 1076 1021 999 649 484 22225 990 22686 1094 --
NM_001008744chr1421381 1124 --1199 --
NM_001008783chr63908 832 749 ------
NM_001008925chr493219 3127 3041 2904 2791 2621 2549 757 551 1875 ----
NM_001009554chr464608 4488 4062 3953 3597 280 11226 1436 11613
NM_001009554chr464608 4488 4062 3953 3597 280 11226 1436 11613
NM_001009567chr10171 ------
NM_001009571chr741117 659 644 495 ----11719
NM_001009880chr22104285 3963 3922 3434 3173 3086 1913 1360 940 403 14750 ----
NM_001009894chr12101734 1636 1569 1257 471 426 324 302 140 70 ------
NM_001009899chr3115743 5351 4984 4620 4212 4071 1968 1739 1394 553 199 ----16195
NM_001009909chr1183588 3477 2872 2630 2597 1090 370 146 23964 875 12895 --
NM_001009955chr13450 242 229 ------
NM_001009955chr13450 242 229 ------
NM_001009958chr7192 1562 ----
NM_001009960chr742389 2085 2071 1954 --1206 1534
NM_001009993chr254516 4179 327 193 111 --21524 103 14570
NM_001010000chr1893463 3359 3320 3186 2202 1354 1226 401 292 1808 12277 1112
NM_001010853chr663202 1303 725 391 292 92 ----12606
NM_001010861chr172816 2795 2691 1728 839 732 281 --12717 --
NM_001010867chr1106595 6154 4644 4352 4199 2324 2034 1926 1893 479 --26582 2198 --
NM_001010888chrX113935 3924 3646 3614 3465 3370 2991 2946 1716 893 629 14259 14443 13995
NM_001010895chr921415 632 --1721 124
NM_001010924chr1061214 909 802 459 442 326 ------
NM_001010932chr7------1353
NM_001010934chr71217 ------
NM_001010971chr12959 656 --1114 --
NM_001010984chr192470 2279 2033 1939 1775 1767 1686 732 250 ----1825
NM_001010986chrX52079 1886 937 129 44 --1417 --
NM_001010989chr16--1568 ----
NM_001010990chr16--1568 ----
NM_001011513chr453873 3738 1531 1416 972 24132 81 23982 1518 --
NM_001011515chr4162 ------
NM_001011516chr4162 ------
NM_001011666chr7146149 5568 5190 4252 4190 2434 2115 2018 1655 1557 1153 1108 431 104 25303 2604 11848 --
NM_001011713chr1441226 1081 1039 497 11585 11306 1462
NM_001011885chr1521560 1410 1164 --1502
NM_001012264chr141723 ------
NM_001012267chr941779 1437 764 514 2570 64 ----
NM_001012279chr6--1174 ----
NM_001012393chr11134491 4436 4266 3916 3827 3588 2026 1980 1955 1644 1638 1352 1072 --1464 1576
NM_001012398chr162940 898 1339 1449 1748
NM_001012410chr33512 491 463 ------
NM_001012420chr1512443 12449 52699 2376 988 440 230 --
NM_001012421chr93628 590 314 1251 ----
NM_001012423chr1512443 12449 52699 2376 988 440 230 --
NM_001012751chr1041718 1593 552 39 --21611 1264 2781 80
NM_001012754chr1341933 1836 1666 25 --146 --
NM_001013031chr1042733 2501 2162 1087 --23512 855 --
NM_001013399chr63925 733 252 --1288 --
NM_001013439chr31278 ------
NM_001013620chr12188208 7832 6724 6093 5968 5754 5415 5299 5221 5176 3290 3042 2540 2343 1892 1451 1421 1107 138 16439 11975
NM_001013699chr123552 416 163 ------
NM_001014342chr131583 323 126 1427 --1116
NM_001014380chr13115152 4424 4230 3790 3751 2196 2177 1235 978 941 874 --34681 1890 1408 --
NM_001014797chr10117789 7749 7182 5522 5216 1605 1580 1500 1421 1067 488 26351 6043 18040 35252 5151 712
NM_001015048chr1443194 2589 2297 2032 23187 452 12462 23073 106
NM_001015049chr1443194 2589 2297 2032 23187 452 12462 23073 106
NM_001015508chr83751 307 249 188 ----
NM_001015877chrX83049 2856 2847 2713 2674 2387 2320 817 23112 1232 ----
NM_001015880chr1051443 1427 1245 529 297 --2663 91 --
NM_001015881chrX11064 ----11270
NM_001015882chr93728 193 34 ------
NM_001017368chr1772763 2600 2087 1919 900 858 623 22688 2267 --12848
NM_001017371chr221318 1285 --11187 --
NM_001017395chr373640 3580 2557 2495 1301 687 255 23451 2987 21382 804 --
NM_001017405chr42831 247 ------
NM_001017424chr121761 354 ------
NM_001017425chr121761 354 ------
NM_001017434chr11724 --1522 --
NM_001017523chr121575 ------
NM_001017923chr1421095 679 ----11146
NM_001017926chr851630 1537 1138 564 152 1630 ----
NM_001017969chr91237 --167 --
NM_001017995chr544857 4217 1767 809 --2749 73 --
NM_001017999chr152293 1870 1818 1796 1688 ------
NM_001017999chr152293 1870 1818 1796 1688 ------
NM_001018000chr152293 1870 1818 1796 1688 ------
NM_001018000chr152293 1870 1818 1796 1688 ------
NM_001018001chr152293 1870 1818 1796 1688 ------
NM_001018009chr321080 369 --11173 11202
NM_001018037chr961303 1217 456 415 297 99 11113 --11440
NM_001018054chr111027 ------
NM_001018056chr93583 534 385 --1431 --
NM_001018065chr9115760 3974 3766 3742 1898 1797 1734 1408 806 800 246 14599 25426 1679 15492
NM_001018066chr9115760 3974 3766 3742 1898 1797 1734 1408 806 800 246 14599 25426 1679 15492
NM_001018067chr175038 5014 4032 3587 2001 1839 1495 --31941 1596 783 --
NM_001018068chr175038 5014 4032 3587 2001 1839 1495 --31941 1596 783 --
NM_001018069chr175038 5014 4032 3587 2001 1839 1495 --31941 1596 783 --
NM_001018072chr121575 ------
NM_001018074chr543400 2568 2439 1030 1265 12709 --
NM_001018075chr543400 2568 2439 1030 1265 12709 --
NM_001018076chr543400 2568 2439 1030 1265 12709 --
NM_001018077chr543400 2568 2439 1030 1265 12709 --
NM_001018111chr783326 1458 1158 835 620 221 156 142 ------
NM_001020825chr52875 43 --1184 --
NM_001023567chr15--1469 31586 996 442 --
NM_001023587chr32410 157 --11076 11163
NM_001024094chr543400 2568 2439 1030 1265 12709 --
NM_001024218chr144833 256 187 137 ------
NM_001024226chr121191 402 ----11096
NM_001024227chr121191 402 ----11096
NM_001024228chr121191 402 ----11096
NM_001024647chr12137559 7240 6874 6502 6242 5699 5687 5605 4894 1986 1828 477 353 15442 66723 6065 6003 4789 2548 2064 --
NM_001024649chr542340 2113 688 336 --12233 --
NM_001024660chr31131 ----1456
NM_001024808chr1282873 2755 1917 1800 1109 1006 165 116 --11764 --
NM_001024855chr371922 1897 1882 1793 1519 1214 317 --11734 --
NM_001024924chr41514 ------
NM_001024934chr62476 169 ------
NM_001024935chr62476 169 ------
NM_001024936chr62476 169 ------
NM_001024947chr53761 355 62 11069 ----
NM_001024948chr183373 3238 2671 2394 2247 602 529 214 --13456 1692
NM_001024956chr11115500 5447 5096 4959 4332 4138 2203 2054 1332 1242 22 34367 3669 382 22039 1727 --
NM_001025076chr10136142 6087 6080 6005 5377 5141 4866 4626 4489 4307 2062 894 100 56244 6237 4200 2490 870 2827 747 --
NM_001025077chr10177500 7445 7438 7363 6735 6499 6224 5984 5847 5665 5105 5026 4899 2252 1458 712 72 47602 7595 5558 2228 22185 2105 --
NM_001025079chr363562 3555 3209 3151 2587 843 13974 13463 13105
NM_001025100chr1883786 3751 3702 3535 1401 1383 480 301 13581 13174 --
NM_001025105chr54586 496 260 137 --11384 --
NM_001025108chr294110 4081 3329 3194 3024 2941 1563 940 818 ------
NM_001025233chr1252034 1968 764 410 165 ------
NM_001025252chr873177 2938 2313 2065 918 427 409 12194 11062 --
NM_001025253chr873177 2938 2313 2065 918 427 409 12194 11062 --
NM_001025266chr3114688 4516 3391 3384 3329 3135 1514 1422 991 670 263 --11799 14228
NM_001025356chr128921 745 602 550 352 272 224 110 ----1528
NM_001025366chr631879 1326 136 ----11536
NM_001025366chr631879 1326 136 ----11536
NM_001025367chr631879 1326 136 ----11536
NM_001025367chr631879 1326 136 ----11536
NM_001025368chr631879 1326 136 ----11536
NM_001025368chr631879 1326 136 ----11536
NM_001025369chr631895 1342 152 ----11552
NM_001025369chr631895 1342 152 ----11552
NM_001025370chr631879 1326 136 ----11536
NM_001025370chr631879 1326 136 ----11536
NM_001025389chr113524 437 39 11222 ----
NM_001025390chr113524 437 39 11222 ----
NM_001025580chrX53700 3101 1544 997 803 24140 468 23671 295 11099
NM_001025595chr4--11512 11311 --
NM_001025616chr471501 1475 731 637 339 268 237 ----11725
NM_001025780chr91145 --1601 1356
NM_001029858chr673393 3014 2951 2848 2584 1258 1077 42797 2379 1158 566 13080 --
NM_001029860chr81319 ------
NM_001029863chr651222 1198 728 388 152 12339 12242 12575
NM_001029875chr552844 2617 2198 2068 2015 11916 1595 --
NM_001029955chr463332 1037 988 558 537 479 33462 3434 545 --1860
NM_001030007chr1693463 3135 2954 2796 1601 1288 977 818 37 --12507 12534
NM_001030055chr1484383 3987 3683 3666 3251 1716 972 428 --34103 1362 801 13705
NM_001030288chr16145268 4947 4784 3738 3345 1963 1869 1442 1043 902 544 468 346 38 14237 1195 --
NM_001031623chr621727 628 --11220 --
NM_001031679chr1262832 2576 1034 953 90 36 --13328 175
NM_001031684chr231145 1038 404 1260 1275 --
NM_001031709chr101289 --1358 --
NM_001031710chr73398 166 113 ------
NM_001031716chr21359 1886 ----
NM_001031732chr473706 3676 3650 2802 1432 554 547 ------
NM_001031804chr1683760 3560 3357 2884 938 583 374 366 --11285 13583
NM_001031812chr551786 1483 646 337 94 --1418 11981
NM_001032282chr82382 41 --1355 --
NM_001032283chr12--1114 --145
NM_001032284chr12--1114 --145
NM_001032380chr1031358 713 62 1263 21805 1698 11709
NM_001032394chr632847 639 541 1362 1629 22237 1945
NM_001032395chr632714 506 408 1229 1496 22104 1812
NM_001033045chr284181 3963 2779 1494 1221 991 628 110 --34189 3953 2887 24227 3857
NM_001033047chr442092 1847 930 736 --12051 22023 1676
NM_001033057chr331875 803 458 ------
NM_001033059chr631406 1377 308 22067 768 11691 --
NM_001033085chr23327 301 245 ------
NM_001033087chr2043082 2120 1326 1072 22955 2374 ----
NM_001033112chr53885 794 71 1143 ----
NM_001033503chr54439 410 143 29 184 --1468
NM_001033506chr11----2444 111 --
NM_001033561chr173722 614 180 --1673 --
NM_001033566chr171962 --1698 --
NM_001033568chr171962 --1698 --
NM_001033578chr822389 174 11656 ----
NM_001033602chr133849 572 307 1107 22361 656 1315
NM_001033659chr1731674 1462 1222 ----1325
NM_001033756chr631813 1260 70 ----11470
NM_001033756chr631813 1260 70 ----11470
NM_001033925chr1011451 21970 802 11327 --
NM_001034025chr123850 795 267 11046 ----
NM_001034155chr9196 ------
NM_001034845chr481370 1262 1018 962 879 302 265 96 11290 ----
NM_001034850chr541204 458 349 50 11643 ----
NM_001035chr13957 828 314 --159 --
NM_001035003chr421436 1416 ------
NM_001035004chr421436 1416 ------
NM_001037132chr741451 796 458 155 1300 1645 --
NM_001037133chr741451 796 458 155 1300 1645 --
NM_001037164chr731952 577 186 ------
NM_001037165chr798725 8117 8068 7498 6902 6124 3366 3026 1662 12311 25892 1027 --
NM_001037172chr321166 1027 ------
NM_001037174chr242269 1781 1742 251 21612 1505 12020 --
NM_001037290chr113878 833 804 ------
NM_001037317chr172816 2795 2691 1728 839 732 281 --12717 --
NM_001037332chr552479 1905 743 587 402 ----12070
NM_001037333chr552479 1905 743 587 402 ----12070
NM_001037334chr1862306 2131 1659 686 494 288 12392 ----
NM_001037339chr131795 666 487 11710 ----
NM_001037340chr131795 666 487 11710 ----
NM_001037341chr131795 666 487 11710 ----
NM_001037341chr131795 666 487 11710 ----
NM_001037535chrX61477 1199 1111 1017 604 116 ----1327
NM_001037536chrX61477 1199 1111 1017 604 116 ----1327
NM_001037540chrX61477 1199 1111 1017 604 116 ----1327
NM_001037553chr2184910 4398 4180 4042 3969 1653 1019 717 ------
NM_001037582chr451203 1087 671 574 151 ------
NM_001037631chr22465 437 11118 2881 72 --
NM_001037872chr22697 142 ------
NM_001037954chr1183372 3000 2634 2178 1363 981 656 395 ------
NM_001038707chr162341 1953 1702 919 540 360 22080 565 22021 686 --
NM_001038707chr162341 1953 1702 919 540 360 22080 565 22021 686 --
NM_001039091chrX41077 548 317 228 ----11405
NM_001039199chr2065032 3743 3064 1896 1110 219 ----1714
NM_001039395chr952342 2220 2073 352 145 12170 22356 1967 --
NM_001039465chr142439 374 ------
NM_001039538chr283617 3431 3225 2882 2601 2284 516 227 --23648 2689 --
NM_001039547chr3177654 6768 6561 6429 5758 3166 3082 3073 2985 2830 2331 901 763 747 616 601 558 37754 6961 546 47023 5455 1758 1502 24911 4889
NM_001039570chr2284174 4143 2983 1711 1631 1200 1040 477 11125 23476 1231 14511
NM_001039571chr2284174 4143 2983 1711 1631 1200 1040 477 11125 23476 1231 14511
NM_001039577chr163407 3316 3142 2883 500 285 ----21169 1151
NM_001039590chrX63318 2844 1288 1123 854 274 ------
NM_001039591chrX63318 2844 1288 1123 854 274 ------
NM_001039618chr11125638 5628 5558 5007 4914 4862 4837 2158 1117 777 130 41 14830 25128 358 --
NM_001039693chr294057 3695 3663 3380 3226 3075 2810 1646 367 1863 ----
NM_001039711chr11380 --11106 --
NM_001039712chr11380 --11106 --
NM_001039762chr103517 370 24 --1610 11983
NM_001039802chr131237 1042 252 1938 21375 1222 --
NM_001039840chrX166061 5960 5791 5566 5535 5483 5069 4972 4583 4136 4121 2363 2234 1704 1558 807 11443 53998 1504 1161 206 181 --
NM_001039937chr1374140 3877 3174 2972 1404 1151 306 13263 --13933
NM_001040001chr631408 1362 1310 1759 2228 156 --
NM_001040020chr741504 1331 1173 1118 --2596 45 --
NM_001040033chr13612 225 176 1706 2728 532 --
NM_001040057chr731000 409 58 ------
NM_001040142chr221789 1777 1181 22351 1761 11807
NM_001040143chr221789 1777 1181 22351 1761 11807
NM_001040147chr181624 --1572 --
NM_001040152chr7104784 4009 3806 3303 3177 1857 1832 1768 405 330 15138 33201 2051 1209 --
NM_001040153chr132339 202 2949 763 1137 1803
NM_001040159chr431357 537 407 11442 ----
NM_001040181chr341182 1139 468 208 1163 175 --
NM_001040182chr341182 1139 468 208 1163 175 --
NM_001040183chr341182 1139 468 208 1163 175 --
NM_001040199chr341182 1139 468 208 1163 175 --
NM_001040200chr341182 1139 468 208 1163 175 --
NM_001040202chr472496 2010 1829 838 436 369 314 --11856 --
NM_001040214chr631748 1461 39 12275 ----
NM_001040284chr16135752 5252 5083 4941 4780 4349 3735 1847 1456 693 680 641 605 35952 2087 711 24128 1369 24041 1764
NM_001040402chr463046 2881 2449 1977 870 724 --23196 2804 --
NM_001040429chr1383534 3371 3346 3061 2924 2645 996 366 --12623 --
NM_001040441chr1134310 4287 4158 2202 1911 1582 1431 1398 1057 688 399 389 334 --11164 24192 629
NM_001040450chr1542589 2057 516 164 --12309 --
NM_001040453chr1542589 2057 516 164 --12309 --
NM_001040665chr7104029 3941 3849 3507 3370 3151 1427 1054 369 126 ------
NM_001040708chr83826 432 349 ------
NM_001040712chr952778 2396 1363 734 95 21221 44 11051 --
NM_001040876chr451855 1722 1617 1559 242 1129 ----
NM_001042355chr1665333 4966 4932 3827 594 543 --1461 --
NM_001042403chr1221021 837 --1257 1362
NM_001042404chr141876 758 258 176 --21287 128 1447
NM_001042406chr64830 445 340 132 1419 ----
NM_001042412chr1665333 4966 4932 3827 594 543 --1461 --
NM_001042413chr951432 1210 496 388 242 1573 33233 2882 559 --
NM_001042424chr452522 2368 1101 692 419 ----1858
NM_001042453chrX4567 477 351 277 ----1365
NM_001042492chr1783511 2971 2622 740 692 627 548 434 --1297 --
NM_001042494chr15143746 3367 3234 2827 2732 2383 1229 965 756 663 390 375 238 37 13353 11264 --
NM_001042495chr15143746 3367 3234 2827 2732 2383 1229 965 756 663 390 375 238 37 13353 11264 --
NM_001042496chr15143746 3367 3234 2827 2732 2383 1229 965 756 663 390 375 238 37 13353 11264 --
NM_001042497chr15143746 3367 3234 2827 2732 2383 1229 965 756 663 390 375 238 37 13353 11264 --
NM_001042506chrX21117 570 ----11379
NM_001042537chrX32515 892 310 --1274 --
NM_001042543chr451543 1426 1142 1035 365 --11205 --
NM_001042548chr22799 662 ------
NM_001042550chr921428 175 2658 604 ----
NM_001042555chr1264400 2994 1897 1071 721 691 13079 24020 902 12901
NM_001042599chr2107700 7034 6908 6896 6486 6448 6397 5567 880 632 17880 --12232
NM_001042601chr372898 2080 1307 1118 1002 700 29 --33289 720 576 --
NM_001042603chr1295072 4936 4788 4255 3710 1573 1272 482 274 --23568 2096 11986
NM_001042604chr3134568 4060 4039 3935 3510 3044 2970 2954 1610 1330 1150 1057 754 23699 229 24557 3021 --
NM_001042669chr471501 1475 731 637 339 268 237 ----11725
NM_001042683chr611771 --3728 395 209 1175
NM_001042771chr1--1426 ----
NM_001043351chr172014 1831 1794 1612 1456 768 405 --1898 --
NM_001044305chr631340 1328 159 --1644 1289
NM_001044385chr273671 3068 3056 2711 2603 1007 267 --21292 206 22627 134
NM_001044722chr551786 1483 646 337 94 --1418 11981
NM_001044723chr551786 1483 646 337 94 --1418 11981
NM_001046chr552542 2522 1059 1050 70 --2207 201 21137 1083
NM_001048183chr173547 3443 3287 2807 2657 1448 982 11470 --21115 223
NM_001049chr1432449 2137 877 12331 12410 --
NM_001071775chr1331348 773 602 --11295 --
NM_001079874chr11509 --1150 1359
NM_001083620chr452610 2157 985 688 280 --12194 --
NM_001099678chr3146454 6336 5731 5014 4624 3931 2402 2292 1522 1252 897 839 695 101 --16271 15706
NM_001100108chr1157999 7659 7258 6721 6631 6557 5932 5688 5340 3072 1750 1616 1379 338 163 26365 1588 28193 1717 --
NM_001106chr3169767 9130 8574 8166 8087 6649 6063 3571 3136 2262 1341 1292 983 731 357 32 --18614 --
NM_001113490chrX33304 1067 948 --33241 2642 298 --
NM_001121chr1021449 663 11352 --1356
NM_001123chr101177 --2281 127 1258
NM_001126chr14840 766 352 57 --1259 --
NM_001128chr1693463 3135 2954 2796 1601 1288 977 818 37 --12507 12534
NM_001144chr1621336 1104 ----11326
NM_001146chr862020 1953 1748 1718 1490 868 ------
NM_001148chr431618 1458 1425 1214 ----
NM_001149chr101297 --1959 --
NM_001153chr24891 203 88 34 --1722 --
NM_001160chr1232517 2387 2188 21746 538 2789 97 --
NM_001166chr11----2181 101 1471
NM_001167chrX166290 5835 5821 5455 4880 4564 4538 4298 2629 2404 2230 1504 1371 1201 1166 1119 36770 4614 1259 ----
NM_001173chr1484383 3987 3683 3666 3251 1716 972 428 --34103 1362 801 13705
NM_001179chr4--1251 ----
NM_001186chr2172919 2870 2455 2306 2233 1084 842 --12612 --
NM_001198chr63170 106 32 11657 1350 --
NM_001200chr201709 1849 ----
NM_001201chr483774 3153 1387 1109 1014 470 110 30 23241 615 --23004 1262
NM_001204chr2207201 7180 6925 6717 6368 5756 5544 5375 5160 5104 2977 2867 2616 2578 2158 2014 1328 1307 355 288 --25339 5321 1812
NM_001221chr4140 ------
NM_001222chr101119 ------
NM_001225chr11135 ----195
NM_001227chr1051359 1249 1046 521 224 1272 ----
NM_001233chr7122292 2250 2206 2135 1895 1771 1715 1669 1604 1552 889 160 ------
NM_001235chr11------1683
NM_001241chr221611 1488 2335 215 1522 --
NM_001241chr221611 1488 2335 215 1522 --
NM_001254chr1731040 949 912 ------
NM_001256chr1752691 2555 2520 2124 376 32428 913 828 ----
NM_001257chr161118 --11491 --
NM_001259chr7196387 5500 5475 5249 4771 4752 4698 4568 4193 4031 2523 1887 1804 1674 1265 1244 580 505 236 15196 24730 1217 16016
NM_001262chr12357 287 ------
NM_001270chr51793 ----1421
NM_001284chr54378 183 164 97 ------
NM_001289chrX31499 485 198 ------
NM_001304chr1763673 2957 1463 984 646 444 22921 2507 ----
NM_001310chr1292986 2747 2023 1989 1898 704 464 183 161 1108 ----
NM_001315chr662307 1900 1589 568 493 323 --11781 --
NM_001316chr201471 ------
NM_001326chr112463 310 ------
NM_001331chr1162631 2510 2346 1992 245 192 --1431 --
NM_001332chr51598 ------
NM_001343chr541546 1345 469 386 --11118 11736
NM_001346chr3112755 2735 2402 1875 1864 1797 1051 879 810 497 184 --22716 2710 --
NM_001351chr341772 1396 307 150 1500 1732 --
NM_001356chrX62336 2148 2097 1982 760 724 1359 ----
NM_001359chr8180 --198 --
NM_001362chr14----11009 --
NM_001364chr1154666 4406 1163 974 457 ----24448 3662
NM_001386chr832191 2068 1685 11899 11971 --
NM_001389chr21150 --1467 --
NM_001390chr1861243 884 759 262 234 31 32231 1427 581 ----
NM_001391chr185999 891 309 284 265 --1115 --
NM_001392chr18--1236 ----
NM_001400chr131098 968 396 ------
NM_001412chrX113781 3634 3207 2998 2550 2383 1001 958 687 679 179 ------
NM_001415chrX31827 78 56 ------
NM_001418chr112695 264 --1176 --
NM_001418chr112695 264 --1176 --
NM_001419chr19134813 4797 4730 4584 4540 4115 3598 1705 1302 524 435 343 202 ----14260
NM_001420chr1912971 ------
NM_001427chr721893 1384 11532 129 --
NM_001429chr222715 46 ------
NM_001430chr231679 264 230 ----11550
NM_001431chr62859 497 --3876 242 75 --
NM_001432chr493284 3244 2946 2835 2625 2523 1296 981 587 23799 1043 22602 1156 12546
NM_001438chr1113029 3010 3003 2977 2881 2282 2272 2220 1193 845 834 --13163 12470
NM_001448chrX31773 1626 1499 ------
NM_001452chr6------1724
NM_001482chr152694 640 1796 1363 --
NM_001490chr993391 2670 1371 1353 1160 789 752 634 562 ----13040
NM_001527chr664613 3944 1313 1199 655 124 24034 3989 24731 3606 13891
NM_001530chr142149 127 --2718 214 11003
NM_001533chr19------1308
NM_001542chr172722 2069 1994 996 535 387 307 ------
NM_001546chr631132 992 378 ------
NM_001550chr7----154 --
NM_001608chr22925 710 1785 ----
NM_001609chr1073203 1799 1760 1625 1178 990 332 21273 1037 22803 680 --
NM_001612chr11------2239 218
NM_001621chr722897 468 --31063 853 516 --
NM_001621chr722897 468 --31063 853 516 --
NM_001630chr101826 ----1610
NM_001634chr631406 1377 308 22067 768 11691 --
NM_001642chr11--11302 --2353 322
NM_001650chr1883715 3168 2816 1526 1384 621 229 131 23210 3058 22840 585 --
NM_001655chr1122067 419 11655 11609 --
NM_001656chr551794 1346 794 477 82 ----11553
NM_001658chr121191 402 ----11096
NM_001663chr1482267 2208 2075 1853 1003 784 577 504 1672 21962 82 --
NM_001668chr121901 658 ------
NM_001677chr12371 111 ------
NM_001681chr121223 ----1650
NM_001682chr1262899 2491 2268 2085 786 768 --22829 314 --
NM_001688chr12609 349 ------
NM_001690chr362108 2086 836 503 428 80 11790 ----
NM_001695chr8154174 3594 3275 3091 2958 1511 1209 1159 1129 964 948 872 771 474 152 --1482 13839
NM_001699chr1951596 1380 1309 312 30 ------
NM_001701chr92566 440 --161 --
NM_001702chr8--1572 ----
NM_001709chr1122917 1802 --12167 --
NM_001714chr122516 496 ------
NM_001717chr1551440 1296 979 579 450 ----11077
NM_001730chr1331395 1117 266 --11258 1429
NM_001730chr1331395 1117 266 --11258 1429
NM_001731chr123757 637 328 --1190 --
NM_001744chr51154 ------
NM_001746chr542340 2113 688 336 --12233 --
NM_001753chr751709 1447 687 656 67 11167 1143 --
NM_001754chr2164021 3843 2880 2731 1727 1391 --13575 --
NM_001760chr61348 ------
NM_001766chr141537 800 436 203 11697 ----
NM_001777chr363562 3555 3209 3151 2587 843 13974 13463 13105
NM_001786chr101132 ------
NM_001791chr131237 1042 252 1938 21375 1222 --
NM_001792chr184883 856 198 45 ------
NM_001797chr162578 48 1783 ----
NM_001806chr19102959 2868 2780 2642 2101 1921 1118 1012 867 767 12095 --1284
NM_001826chr1--1123 ----
NM_001827chr92215 32 1258 ----
NM_001830chrX4983 924 590 215 33450 2829 850 23489 1395 --
NM_001831chr831217 1091 481 1226 1946 --
NM_001845chr1321266 424 1506 --1207
NM_001854chr151393 1111 1067 601 247 1947 ----
NM_001855chr9121 1153 133 --
NM_001858chr6125162 4399 4373 4088 3861 3778 2020 1077 880 799 685 589 --21702 1437 24172 61
NM_001859chr983889 3843 2686 1185 827 791 327 235 ------
NM_001872chr132295 264 ----1399
NM_001881chr10----1361 --
NM_001884chr52519 474 1181 ----
NM_001890chr4139 1133 --1358
NM_001892chr54586 496 260 137 --11384 --
NM_001902chr12382 95 ------
NM_001918chr1159247 8711 8332 8185 8139 7118 6791 6781 6762 5941 1901 1594 1440 682 574 16292 48921 6283 1314 661 27318 236
NM_001920chr123636 628 552 --1761 --
NM_001935chr23845 160 62 --1900 --
NM_001938chr121772 705 --11485 --
NM_001942chr1851608 1461 681 668 542 ------
NM_001946chr122406 391 ------
NM_001949chr642294 1205 639 414 1405 1864 --
NM_001951chr82657 255 ----163
NM_001957chr492248 2089 1804 1579 847 820 367 325 105 ------
NM_001966chr331541 283 212 --1368 11304
NM_001967chr3--1478 2589 104 --
NM_001969chr1473931 3539 2704 1067 614 590 465 11515 12839 --
NM_001977chr451768 1660 1278 369 304 1199 41434 1420 1237 436 --
NM_001980chr1241970 682 427 89 --1845 11821
NM_001981chr162216 2208 1648 843 513 393 --31879 1831 709 --
NM_001987chr1294276 3289 3162 3094 2648 2613 1610 1515 1354 --21271 1191 14333
NM_002006chr4135282 5117 4815 4639 4077 3909 2292 2192 2073 1265 816 653 99 34654 4420 2215 64681 4270 3723 1828 1675 1335 1960
NM_002009chr154807 549 291 72 1987 12694 --
NM_002015chr133993 816 325 11100 12938 --
NM_002024chrX32213 2113 1943 --2394 342 21771 353
NM_002025chrX209113 8943 8621 8472 7751 7677 7050 6578 6556 6149 6053 3538 2848 1989 1923 1080 737 593 485 240 56658 5907 5684 3615 3115 17297 19156
NM_002033chr1154074 3420 2990 2777 1652 --11560 --
NM_002037chr6----166 --
NM_002040chr2142933 959 449 37 12975 23010 2018 --
NM_002044chr1541382 1037 188 136 --1501 1305
NM_002051chr101782 --1832 1814
NM_002054chr22477 427 --1445 --
NM_002061chr141582 1503 1388 386 2532 40 --11532
NM_002063chrX31287 335 37 ----21294 793
NM_002069chr73616 178 32 --11228 --
NM_002077chr972153 1696 1676 816 682 542 514 --11380 --
NM_002092chr484246 3659 3486 3368 1209 1169 779 703 11277 ----
NM_002094chr161434 ------
NM_002128chr1342542 2087 2061 1864 --1973 1200
NM_002129chr4--189 --1402
NM_002130chr521623 1052 ------
NM_002138chr41547 1642 1215 --
NM_002139chrX1208 --1462 1472
NM_002140chr91784 ------
NM_002146chr172473 441 ------
NM_002156chr21284 ------
NM_002158chr293474 3385 3144 2352 1225 1094 283 118 36 1347 23698 487 11050
NM_002187chr551089 1019 892 406 218 ------
NM_002194chr2------1162
NM_002196chr2021142 1104 11092 11064 --
NM_002196chr2021142 1104 11092 11064 --
NM_002202chr531032 313 246 ------
NM_002203chr573906 3714 3508 3007 2794 1261 353 --33581 2561 508 --
NM_002210chr283214 3175 3016 2504 1115 435 256 237 13010 12886 --
NM_002214chr7125499 3954 3828 3668 1768 1672 1634 1519 1379 546 522 23 23864 3591 34062 2220 1652 --
NM_002223chr1273660 3053 2783 2735 2681 1090 353 13773 21372 1054 --
NM_002232chr141281 432 234 201 132 ----
NM_002241chr192901 2868 1909 1114 1024 740 668 635 621 --11212 --
NM_002242chr261595 1549 1274 532 467 393 --189 --
NM_002247chr1041944 1821 1541 1479 1697 ----
NM_002264chr3104555 4102 3787 3665 3582 1467 1402 1162 1089 94 25017 1431 --13690
NM_002267chr1362394 2368 2324 2238 1809 238 136 1144 --
NM_002270chr585463 4014 3784 3752 3574 2081 2072 1434 35283 5208 1005 54628 3718 1862 1370 765 --
NM_002285chr294110 4081 3329 3194 3024 2941 1563 940 818 ------
NM_002293chr152689 2488 2348 851 381 ----1388
NM_002294chrX187 --3401 358 64 --
NM_002296chr151139 374 339 260 252 --11317 21309 285
NM_002306chr14--1125 --1154
NM_002310chr5125884 5778 5745 5665 5642 4531 2296 2183 2097 629 281 202 1866 14439 26228 37
NM_002312chr132217 99 --11061 --
NM_002317chr51275 ----1144
NM_002335chr111191 ------
NM_002336chr12134849 4351 4200 4102 4079 3952 3917 1501 1370 1282 883 411 189 --14307 13727
NM_002355chr12378 68 33 --21434 941 11288
NM_002356chr632366 2136 198 22429 765 12182 --
NM_002374chr283617 3431 3225 2882 2601 2284 516 227 --23648 2689 --
NM_002397chr542164 1766 159 63 11743 ----
NM_002398chr22972 363 1320 --1271
NM_002399chr1561321 1239 1058 907 145 72 1409 ----
NM_002408chr143638 327 215 ------
NM_002438chr10171 ------
NM_002444chrX51996 1735 1623 1336 636 1607 ----
NM_002460chr683280 2568 2488 1500 1234 596 381 111 --13341 11033
NM_002467chr8168 --1330 --
NM_002481chr1197854 7519 7085 6819 5929 5497 5367 3182 2771 2748 2643 2512 2449 2326 1611 1314 768 733 562 32695 1928 1286 36694 2884 173 --
NM_002482chr11734 191 1136 --
NM_002486chr962133 1930 635 599 109 43 1689 1611 --
NM_002487chr151765 ------
NM_002500chr21395 ------
NM_002515chr1441482 1402 1395 53 ------
NM_002518chr21981 ------
NM_002519chr1121238 1061 1447 21392 1370 --
NM_002524chr151103 986 705 180 42 1892 --1144
NM_002526chr641209 1123 541 46 1573 ----
NM_002544chr172266 119 ------
NM_002545chr11134491 4436 4266 3916 3827 3588 2026 1980 1955 1644 1638 1352 1072 --1464 1576
NM_002547chrX124010 3567 3200 2753 1259 1173 1077 965 503 406 332 326 --24176 3504 --
NM_002577chr343989 2552 1359 913 24042 2875 13607 --
NM_002578chrX2310 116 ------
NM_002581chr974806 4730 4484 4244 1742 1340 422 13657 15592 --
NM_002585chr11331 ------
NM_002590chr133505 498 404 ------
NM_002594chr2052456 1730 1533 887 394 --3930 765 120 --
NM_002595chr1231955 1772 1268 1496 31872 1202 552 --
NM_002597chr13336 275 262 ------
NM_002600chr131795 666 487 11710 ----
NM_002601chr2124 ------
NM_002612chr741374 584 275 122 --21930 1719 --
NM_002641chrX51973 1841 1822 1685 1658 2498 136 11816 --
NM_002645chr1122802 158 2930 263 12311 12828
NM_002649chr761735 1576 1389 1094 552 78 --21070 378 --
NM_002655chr8114577 4408 3898 3636 3344 3280 1520 1217 748 321 303 34424 1893 696 ----
NM_002656chr641115 888 405 150 ------
NM_002657chr2033896 2638 25 12739 43873 3097 2524 1523 --
NM_002664chr241603 1569 1433 55 1247 11343 --
NM_002667chr631155 998 209 ------
NM_002670chr321489 1079 1136 11307 --
NM_002687chr142884 840 ------
NM_002706chr21478 ------
NM_002707chr2----1367 --
NM_002709chr263355 3155 2897 2847 2250 144 --23221 2947 --
NM_002710chr1211103 ------
NM_002711chr7125 --1687 --
NM_002713chr12893 777 --21114 450 1233
NM_002715chr551204 1154 970 521 406 ------
NM_002716chr1183700 2746 2418 1362 919 597 151 67 12404 11453 --
NM_002718chr382502 2491 2435 1805 697 677 548 494 1988 11916 --
NM_002719chr1442205 1975 1859 726 12098 2493 487 --
NM_002731chr153182 2751 2568 2561 35 12467 --12700
NM_002734chr1711940 --22275 159 --
NM_002737chr1755369 1489 1016 924 220 11272 --14321
NM_002738chr161779 ------
NM_002745chr2264538 1538 1079 1066 790 169 24574 1360 13799 --
NM_002748chr153834 428 401 --1966 --
NM_002750chr102237 55 ------
NM_002765chrX41077 548 317 228 ----11405
NM_002808chr3--1143 ----
NM_002812chr192430 366 ------
NM_002822chr1241646 377 316 272 ------
NM_002825chr71533 ------
NM_002827chr2011666 ------
NM_002828chr181161 11004 1881 --
NM_002833chr15--21592 1468 1215 --
NM_002837chr1283112 2818 1703 1679 1463 1102 1006 468 11205 ----
NM_002839chr952778 2396 1363 734 95 21221 44 11051 --
NM_002840chr121239 644 ------
NM_002841chr3125 1456 1156 --
NM_002844chr621259 397 ----1167
NM_002849chr121877 --1979 11100
NM_002851chr7----1286 --
NM_002858chr131317 1181 280 ------
NM_002869chr112324 268 12000 11428 --
NM_002874chr962194 1922 1882 992 594 183 --12286 12531
NM_002893chrX2284 142 ------
NM_002897chr21564 ------
NM_002902chr154509 185 105 98 --1127 --
NM_002920chr121353 ------
NM_002930chr18--178 ----
NM_002940chr451855 1722 1617 1559 242 1129 ----
NM_002941chr331669 494 427 --21273 639 --
NM_002948chr361279 1194 1184 1133 816 381 2270 33 ----
NM_002956chr1211312 ------
NM_002959chr193941 3812 3472 3350 2949 2933 2826 969 806 --11404 --
NM_002970chrX------1245
NM_002977chr272827 2259 1308 1241 1096 903 110 ------
NM_002979chr12831 706 --3741 725 128 --
NM_002994chr41324 ----11437
NM_002998chr8102095 2039 1945 1935 1926 865 523 348 245 46 ------
NM_003011chr941437 1384 1074 110 11129 1155 11330
NM_003014chr72358 150 11199 ----
NM_003017chr631405 1177 554 ------
NM_003028chr9103399 2610 2542 1536 1408 1342 1274 646 591 375 --12415 13903
NM_003030chr341532 1319 561 450 --11637 --
NM_003034chr12127859 7636 7484 5834 3251 3142 2791 2581 2380 2299 1667 1641 1398 18096 --
NM_003042chr352032 1779 859 488 91 ------
NM_003043chr381648 1567 1204 1047 1037 966 496 407 ------
NM_003045chr13134918 4799 4593 4392 4193 3617 3180 3073 1515 982 964 912 611 ----13703
NM_003051chr161893 1439 1425 653 326 91 ------
NM_003068chr831006 803 358 ------
NM_003070chr92761 614 ------
NM_003071chr342088 508 475 320 ------
NM_003081chr2031015 415 312 --1332 --
NM_003092chr20--1364 ----
NM_003095chr12164 ------
NM_003101chr171648 1473 1420 1395 1097 1038 574 ----11382
NM_003106chr321057 38 ------
NM_003108chr2105599 5307 4955 2086 1739 1496 938 692 551 294 45873 4932 1210 896 25256 1371 --
NM_003111chr221318 1285 --11187 --
NM_003112chr772681 2157 2072 2063 785 583 341 --23026 2343 1287
NM_003114chr81332 --1877 --
NM_003123chr16145268 4947 4784 3738 3345 1963 1869 1442 1043 902 544 468 346 38 14237 1195 --
NM_003128chr2102856 2614 2170 2006 1896 1053 1032 343 276 103 --1672 1258
NM_003131chr631800 1570 281 ----12293
NM_003140chrY------192
NM_003142chr2196 ------
NM_003144chr642047 1969 796 363 22079 849 1446 --
NM_003155chr83718 702 415 ------
NM_003157chr32705 268 ------
NM_003161chr1773363 3222 2895 1396 1288 536 252 --13389 --
NM_003174chr102783 625 1673 2808 107 --
NM_003178chr352260 542 475 423 24 --2847 114 --
NM_003182chr7----1474 --
NM_003182chr7----1474 --
NM_003199chr18105317 5099 4994 4781 4400 4340 3768 1410 1342 69 --14380 --
NM_003221chr663999 3543 3131 3049 627 216 --1205 --
NM_003223chr16------1140
NM_003234chr331702 784 624 22377 611 ----
NM_003235chr8--185 ----
NM_003236chr252870 2345 997 649 226 23448 880 --13254
NM_003244chr183405 145 27 ------
NM_003246chr1541785 1333 835 177 11400 ----
NM_003253chr211170 --21245 538 1257
NM_003257chr1531406 367 49 ------
NM_003262chr3105194 5145 4473 4300 2040 1964 1805 978 945 791 23324 1759 14342 --
NM_003269chr611000 ------
NM_003270chrX3219 187 142 ------
NM_003286chr2031185 258 111 ------
NM_003290chr193994 293 199 ------
NM_003291chr132815 521 2584 167 1208 --
NM_003292chr142051 715 665 481 12241 12030 --
NM_003298chr3105155 4953 4783 4627 3864 2155 2057 1383 266 246 16217 26192 3838 14406
NM_003300chr141477 ------
NM_003304chr321252 524 --1572 136
NM_003319chr23952 386 37 --1151 --
NM_003336chrX21136 813 ------
NM_003337chr531499 516 310 --1617 --
NM_003338chr1051751 1226 615 583 56 ------
NM_003339chr511571 11138 ----
NM_003342chr1753331 3126 1203 626 595 --22572 804 11122
NM_003350chr83711 340 27 ------
NM_003359chr421300 531 --21012 319 --
NM_003372chrX4702 198 158 48 ------
NM_003376chr631879 1326 136 ----11536
NM_003376chr631879 1326 136 ----11536
NM_003380chr10280 65 1305 ----
NM_003383chr93583 534 385 --1431 --
NM_003385chr23865 737 400 --21041 38 --
NM_003387chr242547 2385 2039 613 2954 745 ----
NM_003390chr111410 1894 193 --
NM_003391chr73606 366 121 ----1575
NM_003392chr383317 3089 2800 1409 933 594 551 359 --13639 14228
NM_003405chr221781 --1580 --
NM_003409chr1851424 1391 1077 179 160 ------
NM_003410chrX43080 2769 2420 609 2511 167 ----
NM_003411chrY11505 1156 ----
NM_003412chr353044 2333 2267 1075 1005 1923 ----
NM_003413chrX61464 1398 1319 417 281 183 --11964 --
NM_003418chr31627 ------
NM_003423chr1931826 1692 987 1263 22348 1902 --
NM_003430chr1961601 1458 1244 1203 503 164 --11115 --
NM_003431chr13557 174 90 ------
NM_003453chr13182 ------
NM_003454chr1621052 190 ----21496 607
NM_003463chr653305 3061 1348 456 448 11077 12799 --
NM_003468chr254194 4184 3647 3132 870 13234 32899 386 265 --
NM_003470chr1641624 1420 733 693 --1437 --
NM_003471chr351854 1748 914 658 349 1619 ----
NM_003472chr641246 1232 1220 1089 1318 ----
NM_003473chr1031125 154 75 ------
NM_003478chr1173313 3019 2523 870 626 619 354 2756 569 1967 11110
NM_003483chr1252531 2219 2017 664 298 ------
NM_003488chr1731012 282 240 ------
NM_003489chr2173135 3028 2785 2523 1315 1064 1007 13328 --1616
NM_003498chr1622682 2149 12732 --22802 2428
NM_003503chr131269 439 369 11306 ----
NM_003505chr751607 1365 636 338 94 ------
NM_003557chr141266 1074 574 265 --1390 --
NM_003566chr1283353 2702 2581 1360 1040 995 760 582 23329 64 22999 2620 --
NM_003567chr1135 ------
NM_003574chr18195693 5611 5112 4897 4788 4770 4751 4394 4174 4066 3990 3522 2044 1498 1332 1059 942 921 821 1615 15190 --
NM_003583chr1273291 3064 2927 2447 1418 1046 132 22950 99 ----
NM_003590chr2104005 3891 3798 2871 1415 1242 1176 1114 1070 1010 --14088 --
NM_003592chr71185 ------
NM_003603chr42645 363 11933 ----
NM_003607chr154222 3550 3452 1380 160 14360 1445 13033
NM_003615chr3124039 3958 3586 3477 3276 3218 1161 929 839 615 295 206 --12669 --
NM_003617chr174391 3202 799 406 395 205 102 24938 4603 11514 23467 3412
NM_003620chr172851 756 ----1817
NM_003630chr62506 484 ----2166 120
NM_003640chr921141 1013 ------
NM_003642chr23327 301 245 ------
NM_003658chr111872 ------
NM_003659chr241164 888 239 51 --21045 968 --
NM_003663chr393459 2602 2526 1274 1113 801 654 521 354 --22379 569 --
NM_003670chr351126 947 900 425 346 11461 1907 --
NM_003671chr973238 3168 2982 1198 484 251 213 --1993 --
NM_003672chr121994 1602 ------
NM_003675chr102431 356 ------
NM_003679chr143452 2789 1083 843 ----12765
NM_003685chr192940 212 ------
NM_003687chr5132 --11069 --
NM_003688chrX1258 ------
NM_003701chr132957 811 1128 ----
NM_003705chr22826 194 ------
NM_003716chr32748 723 ----11035
NM_003722chr372614 2387 2362 1998 799 524 68 --1663 --
NM_003749chr1351562 1555 462 308 277 12426 2838 656 --
NM_003750chr104886 850 752 34 ------
NM_003758chr153637 511 458 ----11031
NM_003758chr153637 511 458 ----11031
NM_003759chr484294 4051 3532 3513 2659 1715 357 160 --1236 24154 2615
NM_003762chr13243 108 94 --11459 --
NM_003763chr2063032 2350 1029 1000 880 556 ------
NM_003772chr114399 289 89 65 1497 ----
NM_003774chr1282924 2571 2138 1221 1001 850 254 70 1308 23185 1051 --
NM_003783chr131033 808 157 --1773 --
NM_003784chr181624 --1572 --
NM_003787chr1821413 1086 --2687 281 --
NM_003794chr36986 732 721 325 136 26 1740 1810 --
NM_003796chr191395 ------
NM_003799chr1873670 3373 3026 756 508 436 356 1475 11530 168
NM_003800chr672213 2032 1949 1730 924 828 185 12225 22059 2041 --
NM_003822chr163147 2606 1984 786 454 29 1171 12178 13180
NM_003861chr1452237 2117 2014 1117 580 ------
NM_003872chr262982 2346 2041 1218 1168 975 --1101 --
NM_003873chr1072472 2427 958 933 747 139 129 1542 ----
NM_003877chr124960 921 741 661 ------
NM_003885chr1762628 2217 1995 1800 507 35 12691 1720 --
NM_003887chr232259 1515 934 ----1450
NM_003888chr1551468 482 346 207 76 ------
NM_003893chr101347 ------
NM_003895chr2131673 661 315 ----1600
NM_003901chr1082740 2377 1846 802 550 389 290 23 12519 22709 655 --
NM_003902chr1----4852 733 302 94 --
NM_003913chr694258 4161 3655 3565 3340 3233 2965 1679 1471 --13719 33985 1253 1035
NM_003916chrX1363 --21492 266 --
NM_003931chr62476 169 ------
NM_003932chr2241808 1515 1415 1325 --11484 1509
NM_003934chr93439 297 215 1814 --1922
NM_003939chr1094035 3897 3621 3320 2725 2615 1339 1100 855 ------
NM_003941chr772110 2012 1940 1749 536 383 310 --12445 --
NM_003947chr3----11215 11036
NM_003953chr152780 2718 2550 2202 337 --22895 2800 --
NM_003956chr101337 ------
NM_003966chr5137825 7617 7339 6999 5858 5765 5558 5390 2118 1976 1285 119 108 11910 37178 7029 6579 --
NM_003971chr171530 ------
NM_003972chr1041039 432 168 95 --1289 --
NM_003981chr1541088 1055 969 420 --1882 --
NM_003983chr1694151 3715 3697 3274 3143 2896 2869 1264 984 24199 1666 12877 --
NM_003986chr112344 328 ------
NM_003994chr1294176 3851 3323 2942 2722 1554 1446 466 316 22691 498 33106 1500 943 --
NM_004006chrX12060 11764 --12672
NM_004007chrX12060 11764 --12672
NM_004009chrX12060 11764 --12672
NM_004010chrX12060 11764 --12672
NM_004011chrX12060 11764 --12672
NM_004012chrX12060 11764 --12672
NM_004013chrX12060 11764 --12672
NM_004014chrX12060 11764 --12672
NM_004015chrX12060 11764 --12672
NM_004016chrX11974 11678 --12586
NM_004017chrX12060 11764 --12672
NM_004018chrX11974 11678 --12586
NM_004020chrX12060 11764 --12672
NM_004021chrX11974 11678 --12586
NM_004022chrX11974 11678 --12586
NM_004023chrX11974 11678 --12586
NM_004028chr1883715 3168 2816 1526 1384 621 229 131 23210 3058 22840 585 --
NM_004035chr1795061 3574 1992 1522 1383 1264 1166 722 421 25211 2067 23813 1152 --
NM_004039chr151324 ------
NM_004055chr1182217 1807 1627 666 561 221 162 155 --11796 12264
NM_004060chr551174 1066 944 388 132 ----21329 1238
NM_004075chr121219 152 161 --
NM_004080chr741431 1220 560 84 11009 2366 178 --
NM_004081chrY61790 1475 597 409 238 98 --11386 --
NM_004086chr142761 645 1323 ----
NM_004087chr371923 1606 1252 585 452 345 286 --2649 466 --
NM_004089chrX11064 ----11270
NM_004098chr1021184 1122 ------
NM_004100chr6102134 1955 992 794 786 756 537 381 68 39 11775 1101 1882
NM_004109chr1172335 2135 2091 2074 1545 592 62 1542 32214 2108 1787 --
NM_004113chr351703 1358 1268 711 680 21749 404 ----
NM_004117chr632116 2082 49 22075 857 ----
NM_004119chr133486 257 161 ----1758
NM_004124chr1463249 3120 2464 1335 1050 752 23057 1087 ----
NM_004128chr132415 165 ------
NM_004133chr862491 2150 1706 566 494 65 12397 22044 398 --
NM_004136chr1532479 2243 885 33199 1128 938 22194 987 --
NM_004161chr221592 1448 ------
NM_004162chr33387 199 159 ------
NM_004170chr941839 1643 519 59 11561 1605 11891
NM_004171chr11189228 7979 7032 6186 3529 3286 3240 3222 2470 2055 2002 1839 1403 1174 689 613 583 119 12679 59686 8252 3679 2443 2159 23866 1184
NM_004172chr582001 1887 1873 1848 1663 758 601 410 ----12041
NM_004180chr21185 ------
NM_004229chrX51800 1624 1471 1436 221 --22211 1500 1751
NM_004232chr1853734 1483 1285 426 281 11353 23341 3313 --
NM_004236chr151571 ------
NM_004237chr51921 ------
NM_004241chr102593 183 2670 553 ----
NM_004253chr93756 335 208 --1642 --
NM_004261chr12931 746 --1811 --
NM_004267chr31172 ------
NM_004274chr1463235 2754 2031 1163 618 550 ----12268
NM_004279chr761523 880 771 365 211 119 1601 1925 --
NM_004280chr61296 --1315 --
NM_004288chr23176 164 21 --1932 --
NM_004291chr51143 ------
NM_004293chr973755 2601 2481 2463 1205 579 179 22902 1184 --23797 1397
NM_004296chr1434060 3247 701 ------
NM_004301chr3----1118 --
NM_004304chr22322 300 ------
NM_004311chr1063109 2088 857 344 255 200 ------
NM_004317chr191214 1202 ----
NM_004319chr182861 2842 2750 2443 2130 2072 2031 376 ------
NM_004329chr1031242 280 101 11448 11234 1964
NM_004331chr862127 1808 1764 768 396 140 1148 ----
NM_004337chr872073 1871 1711 1525 463 373 182 1847 21544 804 --
NM_004338chr18136869 6659 6277 5437 4620 4376 2648 2490 2222 2063 1856 1372 1182 11120 27047 593 16798
NM_004342chr731548 685 47 --21578 882 1124
NM_004349chr821035 301 ------
NM_004354chr45335 301 287 196 42 1773 1603 --
NM_004370chr641651 698 621 287 --11743 12203
NM_004379chr251430 626 339 249 215 21410 601 1678 11369
NM_004380chr1642194 982 826 372 ------
NM_004382chr1711058 ------
NM_004384chr551786 1483 646 337 94 --1418 11981
NM_004386chr1921824 819 ----11475
NM_004392chr1352659 2248 994 696 527 --12609 --
NM_004397chr1151539 1383 1127 393 360 --34173 3554 332 14321
NM_004398chr111418 ------
NM_004411chr72727 224 ------
NM_004419chr102701 302 --1437 --
NM_004423chr382711 2293 2182 2052 1976 1865 629 540 --11681 --
NM_004428chr12766 169 ------
NM_004432chr942327 2017 1743 183 12281 ----
NM_004437chr183597 3473 2968 2934 1051 807 491 103 13504 --13212
NM_004438chr252834 1007 934 904 227 22881 2459 ----
NM_004440chr631383 542 535 --1741 --
NM_004441chr361285 1226 1177 1041 891 102 --2309 173 --
NM_004447chr125891 800 788 734 256 ------
NM_004449chr2151427 1295 588 306 277 ------
NM_004450chr142261 158 ------
NM_004454chr351837 1781 1635 588 491 ------
NM_004456chr71235 ------
NM_004457chr231586 462 74 --21738 1404 --
NM_004458chrX42669 2103 1869 52 1500 ----
NM_004459chr1741938 1563 1556 1501 11719 ----
NM_004464chr4114088 3787 3568 3534 3020 1536 1357 1286 1248 1128 432 --24254 138 23395 2989
NM_004472chr54693 687 538 106 ------
NM_004482chr25871 822 675 216 181 ------
NM_004483chr162375 58 --1456 --
NM_004491chr1954223 4147 2659 136 127 --24314 1687 --
NM_004496chr1431010 509 459 --11166 --
NM_004501chr163603 3512 3326 2823 2776 563 --1940 --
NM_004502chr171208 ------
NM_004513chr1593881 3718 2965 2431 1426 1347 329 247 70 13628 ----
NM_004520chr51305 --1140 --
NM_004523chr1031247 616 380 11565 11236 11487
NM_004525chr231447 1263 478 1490 ----
NM_004529chr9--11217 2997 494 --
NM_004537chr1251220 344 245 153 97 11557 2583 188 11045
NM_004540chr214594 571 257 87 ----1221
NM_004559chr12395 353 ----1251
NM_004560chr94849 365 314 62 ------
NM_004566chr1012519 ------
NM_004571chr211159 --2697 372 --
NM_004575chr43465 192 115 --11208 --
NM_004580chr1551775 670 507 413 346 --11363 --
NM_004583chr172214 202 ------
NM_004586chrX205478 5341 4982 4953 4775 4442 4333 4325 4297 4023 3959 3815 3636 3606 2191 2106 1942 1762 852 712 24606 3986 23999 3874 --
NM_004588chr1163625 3207 3180 1471 1400 768 --13814 --
NM_004593chr33719 689 586 ------
NM_004595chrX2467 329 ------
NM_004598chr5113107 2284 2028 1240 1158 761 731 709 573 340 251 22891 2305 12735 13337
NM_004600chr121556 370 ------
NM_004612chr984773 3982 3872 3559 1831 489 416 293 --13614 --
NM_004621chr1161261 1213 1188 1077 521 74 11174 --1972
NM_004622chr242308 1598 120 92 1720 ----
NM_004631chr111027 ------
NM_004634chr33619 598 120 ------
NM_004637chr31965 ------
NM_004642chr123466 151 91 --1623 --
NM_004660chrY22022 557 1357 11461 --
NM_004661chr531219 1173 835 11311 31255 344 42 --
NM_004667chr15----1438 --
NM_004670chr1051443 1427 1245 529 297 --2663 91 --
NM_004673chr161562 1463 1378 1309 499 55 11200 11592 1548
NM_004677chrY--1198 --1428
NM_004681chrY2712 678 ------
NM_004687chr1731853 1388 245 12099 1584 --
NM_004690chr61669 1787 ----
NM_004694chr171106 ------
NM_004696chr11858 --2816 600 --
NM_004703chr1772499 2101 2027 1952 902 867 82 12385 ----
NM_004705chr112164 76 --1881 --
NM_004709chrX51763 1572 1524 250 214 1286 2260 34 21331 110
NM_004719chr1262863 2502 1970 1050 353 54 ------
NM_004725chr101177 11362 2942 579 --
NM_004726chrX124429 4348 4320 3893 3751 3717 2182 2086 2046 1533 729 244 24420 3690 34030 3618 2241 24877 1454
NM_004727chr1521699 416 11500 11893 11760
NM_004730chr571664 1589 1426 627 579 475 120 ------
NM_004731chr1231888 1656 139 ------
NM_004734chr1383119 2992 2719 2428 1010 931 878 212 ------
NM_004736chr141640 1584 829 211 ------
NM_004738chr2042391 2301 1029 342 --12560 1953
NM_004745chr8166955 6869 6694 6068 5891 5813 5605 5270 5190 5083 4845 4299 2611 2304 922 291 --45613 4859 2396 1059 16606
NM_004748chr1593775 3600 1703 1431 1421 1295 1095 626 202 23939 3275 ----
NM_004760chr752501 2480 2400 1744 631 --1213 --
NM_004763chr28843 798 742 406 350 294 234 52 --1187 --
NM_004768chr141087 975 802 87 --167 --
NM_004772chr521246 575 11597 ----
NM_004774chr1783036 2925 2734 2577 2405 1930 1222 901 12563 12472 --
NM_004775chr1842181 2142 1756 765 12353 11518 --
NM_004779chr551243 1146 1100 513 413 ------
NM_004780chrX--1532 180 --
NM_004788chr1121065 317 --2828 633 --
NM_004789chr91294 ------
NM_004796chr1411938 --32219 2143 2024 --
NM_004797chr353489 2765 2567 972 607 --12689 --
NM_004798chr20102981 2926 2910 2582 2397 1055 652 612 217 147 1580 ----
NM_004801chr22634 177 ------
NM_004805chr22493 160 ----1328
NM_004815chr1104326 3737 3512 3337 3185 3149 3105 1746 1618 332 23361 2994 21785 535 --
NM_004824chr621484 1019 ------
NM_004834chr242419 2363 851 692 --21249 979 11046
NM_004836chr23960 759 106 ------
NM_004840chrX62388 1733 606 497 236 73 ----12451
NM_004842chr631685 1457 703 --11124 11788
NM_004844chr321080 369 --11173 11202
NM_004845chrX94174 4154 3278 3180 1280 1269 1102 739 509 ------
NM_004849chr661481 1447 647 416 320 74 11087 ----
NM_004857chr1484770 4312 3565 3491 957 913 609 39 180 54204 3178 2987 1911 1791 --
NM_004859chr1762827 2464 2307 1964 359 286 1280 2223 66 --
NM_004865chr6----1419 --
NM_004866chr575064 4792 4422 4379 1727 1383 348 ----1185
NM_004869chr1821379 383 ----1536
NM_004871chr1784350 4182 3145 2960 2807 1678 661 654 ------
NM_004873chr1443194 2589 2297 2032 23187 452 12462 23073 106
NM_004874chr81430 ------
NM_004879chr112838 767 ------
NM_004887chr51950 1737 ----
NM_004897chr104732 673 660 199 --1350 1632
NM_004898chr472757 2540 2283 1941 1022 1001 855 --31151 1089 893 --
NM_004902chr202864 594 --1540 --
NM_004904chr7146149 5568 5190 4252 4190 2434 2115 2018 1655 1557 1153 1108 431 104 25303 2604 11848 --
NM_004921chr162007 1854 1577 905 723 368 11626 11008 --
NM_004926chr1431867 1636 1292 ------
NM_004932chr541366 1274 594 280 --11676 --
NM_004947chr342223 1846 1821 650 135 ----
NM_004949chr1811671 11542 1394 --
NM_004952chr11929 ------
NM_004953chr31442 ------
NM_004956chr774167 3509 3235 3220 3098 2857 1487 ------
NM_004966chr102957 30 --1217 --
NM_004985chr1251607 1378 1342 1195 24 --14239 --
NM_004992chrX108488 7091 6900 6830 5710 5574 3287 2936 1858 749 --26214 3293 --
NM_004992chrX108488 7091 6900 6830 5710 5574 3287 2936 1858 749 --26214 3293 --
NM_004999chr6114326 4259 4109 3747 3736 3673 2847 1317 837 597 335 --1771 1850
NM_005006chr24908 695 342 230 ------
NM_005010chr741451 796 458 155 1300 1645 --
NM_005016chr121331 ------
NM_005023chr561206 948 521 344 222 175 21567 1011 ----
NM_005036chr22218343 8181 7270 7147 6282 6097 5400 5394 5308 3184 3023 2936 2897 2647 1543 1494 1018 867 501 254 222 16461 17422 17948
NM_005040chr11----122 --
NM_005056chr12105316 5180 5032 4499 3954 1817 1516 726 518 231 --13812 12230
NM_005057chr171799 1574 1201 554 390 221 197 ----11238
NM_005063chr10103541 3426 3131 2839 2823 2409 2345 727 309 29 12530 --11342
NM_005065chr1484660 4652 4113 3591 3488 3281 2069 1070 --1354 --
NM_005069chr2131343 1188 1128 21779 572 --11686
NM_005079chr873177 2938 2313 2065 918 427 409 12194 11062 --
NM_005086chr1211440 --11567 1679
NM_005087chr31278 ------
NM_005088chrX2767 216 --1274 --
NM_005097chr102108 63 ------
NM_005102chr22799 662 ------
NM_005104chr61632 1611 1726 --
NM_005119chr131300 1069 1043 ----1891
NM_005121chr17123610 3520 3351 3262 3224 3037 2954 2894 2412 1154 487 362 22448 1512 41280 656 573 85 --
NM_005123chr122345 265 ------
NM_005126chr3--12131 12015 --
NM_005135chr15143746 3367 3234 2827 2732 2383 1229 965 756 663 390 375 238 37 13353 11264 --
NM_005151chr1862306 2131 1659 686 494 288 12392 ----
NM_005153chr161651 ------
NM_005154chr151216 --1677 --
NM_005156chr9133446 3315 2138 1933 1724 1709 1627 1399 1040 979 890 778 677 --64781 4229 4088 1958 1420 1366 21205 268
NM_005159chr1532184 774 591 11478 1574 --
NM_005164chr1292674 2555 2548 2408 2050 932 730 655 315 --21675 617 21712 521
NM_005181chr82624 265 ------
NM_005188chr11178313 7873 6844 6694 6041 5776 5420 5277 5161 3267 3018 2945 2573 2564 2301 1009 151 27798 7236 ----
NM_005189chr1722344 627 ------
NM_005190chr63925 733 252 --1288 --
NM_005194chr201554 ------
NM_005197chr1465894 5419 4034 3848 907 619 15646 25539 3953 --
NM_005207chr2233328 2324 789 ------
NM_005208chr17198 ------
NM_005214chr22428 400 11081 2844 35 --
NM_005221chr71242 --1257 --
NM_005227chr1--1534 ----
NM_005229chrX41303 413 251 70 --11040 1856
NM_005230chr121251 --1549 --
NM_005233chr3102525 2512 2428 2385 2257 1782 1650 951 855 729 --21990 617 --
NM_005235chr2107700 7034 6908 6896 6486 6448 6397 5567 880 632 17880 --12232
NM_005238chr1183202 3123 2597 2436 907 620 608 253 ----32359 1352 640
NM_005239chr2182004 1765 1571 1509 1357 1322 486 310 11715 --32043 1333 599
NM_005241chr331043 949 891 --1988 1189
NM_005249chr142819 613 ------
NM_005254chr1541099 536 330 323 ------
NM_005256chr111785 ----1249
NM_005257chr1851273 1182 868 554 503 11399 ----
NM_005259chr241368 1272 1127 1034 --11243 --
NM_005261chr81999 ----1958
NM_005264chr103865 715 101 1708 ----
NM_005271chr102485 126 ------
NM_005277chr441764 1730 651 242 --11421 --
NM_005278chrX----1364 --
NM_005279chr24862 803 738 667 ------
NM_005281chr11139 11003 ----
NM_005284chr62399 345 ------
NM_005295chr71123 ------
NM_005311chr761937 1816 1779 680 502 461 12585 --1420
NM_005312chr932672 2373 422 --11840 --
NM_005324chr1771608 1589 1426 802 437 416 166 ------
NM_005328chr82616 533 ----1760
NM_005339chr464327 3743 1448 777 766 516 13061 13380 21522 229
NM_005342chrX52619 1884 969 384 140 --12842 --
NM_005356chr1--1426 ----
NM_005358chr1331496 701 370 11888 ----
NM_005359chr1876218 6007 5475 2145 2056 1306 398 --31379 644 590 15106
NM_005373chr161439 1225 1175 580 315 47 11672 ----
NM_005378chr2199 ------
NM_005381chr21151 ------
NM_005385chr382363 2327 2063 1950 1085 1076 901 107 --2529 125 22578 90
NM_005397chr783326 1458 1158 835 620 221 156 142 ------
NM_005399chr143550 3366 1392 1023 23414 2986 13785 24298 906
NM_005400chr252917 2686 2011 1207 714 ------
NM_005406chr1841398 999 421 363 11315 ----
NM_005407chr1451425 1356 1291 251 110 ------
NM_005414chr31251 ------
NM_005415chr23769 289 178 ------
NM_005433chr1862417 1968 1804 579 556 476 22611 1797 12520 1517
NM_005436chr1052511 1189 891 717 25 13194 34066 1207 788 --
NM_005445chr101309 ------
NM_005455chr151527 1226 1159 235 127 ------
NM_005458chr942273 1994 1758 122 ------
NM_005461chr2061897 1527 1440 604 557 536 ------
NM_005487chr2241723 1639 604 375 11309 1485 --
NM_005493chr61613 --1760 --
NM_005494chr7184 --1417 --
NM_005497chr17134912 4761 4495 3799 3774 2428 2220 1876 1836 1677 1336 774 679 --25836 1498 --
NM_005502chr9102954 2531 2470 2258 2158 941 777 219 153 138 --11265 --
NM_005504chr12146242 6154 5927 5874 5841 4986 4927 4667 4496 4423 1668 1643 1111 271 24311 724 15404 --
NM_005506chr442934 2580 1075 580 --12196 12290
NM_005509chr541511 1474 421 379 1533 1435 --
NM_005522chr731239 885 478 ------
NM_005530chr1531435 183 134 --11222 --
NM_005542chr751913 730 345 324 88 ------
NM_005544chr23958 849 361 --3773 691 351 --
NM_005546chr522142 2035 ------
NM_005578chr3115136 5113 4709 4252 4180 1844 1815 1438 1216 1087 895 24560 705 14593 24342 874
NM_005584chr133633 72 41 ------
NM_005585chr15--1434 --1275
NM_005593chr121566 ------
NM_005595chr12699 690 ------
NM_005596chr9136337 6295 6171 5907 5813 5732 5692 5185 4148 1829 1417 1000 705 34855 4719 433 13950 --
NM_005602chr34972 929 318 150 ------
NM_005604chr642466 2353 1878 1723 11835 11557 --
NM_005611chr1671285 1245 1166 1130 368 361 86 ----11332
NM_005613chr131625 1453 285 11827 --12210
NM_005614chr73784 412 191 --1215 1237
NM_005625chr84937 918 223 178 ------
NM_005637chr1871934 1835 1684 1579 1500 538 284 ------
NM_005638chrX----41542 1421 1302 410 --
NM_005639chr1261931 1512 1498 1438 1210 505 170 11379 --
NM_005647chrX53435 2833 2681 1049 895 ------
NM_005655chr82382 41 --1355 --
NM_005662chr8193 ------
NM_005665chr173511 3454 3122 3112 713 428 389 11216 24339 3720 --
NM_005668chr564417 2928 1505 1484 1253 723 --1876 24270 2939
NM_005669chr532249 2158 195 --1825 --
NM_005708chr131415 ------
NM_005722chr252513 1939 1658 825 476 1995 ----
NM_005730chr1273218 2535 1446 1300 1156 705 427 ----11312
NM_005738chr731952 577 186 ------
NM_005746chr772531 2437 2382 1104 461 245 162 11080 1986 --
NM_005748chr1293364 3256 2858 2418 1259 1206 865 643 476 22142 1273 22115 462 11076
NM_005751chr7193 ------
NM_005752chr161302 21236 1052 ----
NM_005756chrX61410 1392 1343 1035 984 599 ------
NM_005759chr2134552 4416 3975 3949 3935 1663 1550 1463 1176 1140 993 563 329 24156 3943 14110 --
NM_005776chr144808 781 627 276 ------
NM_005777chr3----1112 --
NM_005779chr573529 3198 2720 1307 1130 444 279 12212 23646 2608 --
NM_005788chr111741 1127 --1662
NM_005795chr292991 2973 2384 2220 2143 2047 1844 959 535 33049 2404 87 ----
NM_005796chr161401 --1364 --
NM_005797chr1131413 1324 240 --1445 1580
NM_005808chr32307 237 ------
NM_005813chr241966 1801 1752 294 --1263 --
NM_005826chr1------1644
NM_005828chr1784227 3234 1972 856 740 588 263 186 --1983 --
NM_005830chr13123 ------
NM_005839chr1152 ------
NM_005840chrX137276 7160 6461 5239 4790 4768 2479 2325 1755 1718 1393 1186 1168 --57321 6969 6005 2690 345 36054 4809 926
NM_005842chr131597 ------
NM_005843chr261786 1695 1678 1593 1527 95 ----11893
NM_005857chr141022 959 201 174 ------
NM_005859chr51543 ------
NM_005862chr32941 866 11030 --1847
NM_005868chr732319 1549 39 --1187 --
NM_005870chr131182 ------
NM_005882chr42831 247 ------
NM_005898chr1152831 2470 2215 744 390 --22686 1019 12356
NM_005900chr421077 998 ----21210 921
NM_005901chr18188462 7935 7342 7166 7109 6630 5291 2434 2275 1860 1643 1364 1073 889 616 505 240 35 15685 38177 5372 5313 26319 1636
NM_005902chr15124655 4525 4033 3886 3768 1821 1475 1398 1185 860 789 605 --23947 3010 --
NM_005903chr5135195 5123 4997 4577 4568 4562 4309 4059 1816 1793 1023 704 261 13681 44687 2065 399 21 --
NM_005906chr621661 1136 11047 1571 --
NM_005907chr621285 118 21582 53 1317 11672
NM_005909chr5124298 3379 3257 3181 3071 1710 1451 1332 1268 774 526 56 13627 63287 3230 1156 681 602 164 12848
NM_005911chr221185 973 --11460 --
NM_005920chr1123246 3207 3059 3043 2723 2564 2546 2469 1504 882 495 24 22696 2655 --13760
NM_005922chr6----137 1491
NM_005923chr62707 219 --1461 --
NM_005930chr142122 105 1816 2211 182 --
NM_005935chr463601 3232 1239 357 150 22 --25003 4202 1388
NM_005941chr893353 1488 1371 779 745 732 330 268 130 1696 ----
NM_005955chr1145437 4991 4846 4840 4380 4374 4151 3856 3844 3792 2092 2059 1795 1339 25461 4496 14683 --
NM_005962chr1031914 1500 69 154 ----
NM_005962chr1031914 1500 69 154 ----
NM_005966chr252072 1549 754 709 536 22282 78 --21852 1801
NM_005969chr1121080 191 --11196 1993
NM_005977chr131869 ----1331
NM_005985chr201745 1805 ----
NM_005989chr741488 1358 528 166 --11051 --
NM_005996chr1231131 412 349 ----21568 502
NM_006007chr953693 3516 3492 3098 1336 11689 43865 3183 1358 934 13974
NM_006015chr131269 1214 1056 ------
NM_006016chr651661 1651 1643 689 435 ----11485
NM_006022chr131941 --1908 11083
NM_006024chr71929 --1301 1817
NM_006033chr1872337 2224 1825 1718 1705 415 107 --22187 317 --
NM_006036chr251821 766 582 560 220 ------
NM_006037chr294740 4050 3871 1882 1685 1356 1307 646 175 ------
NM_006038chr2061770 1621 802 633 179 87 ------
NM_006040chr1621428 1261 ------
NM_006042chr172468 406 --2155 115 --
NM_006047chr2033088 531 401 13550 22657 105 --
NM_006048chr131238 1107 1020 ------
NM_006079chr62591 343 ------
NM_006080chr782535 2326 2260 2253 1982 1865 1835 248 12865 32769 1133 792 11106
NM_006085chr151357 1217 1172 371 297 1543 ----
NM_006095chr4124360 4174 3960 2805 1582 1286 918 903 801 671 455 277 --11621 13940
NM_006108chr1141827 496 485 433 11509 12233 11599
NM_006113chr11509 --1150 1359
NM_006134chr2131202 1166 604 11033 --2628 69
NM_006135chr141127 1047 1031 109 11318 --11385
NM_006136chr771315 1074 1042 940 838 542 295 11136 ----
NM_006141chr1622222 2129 12805 ----
NM_006147chr12398 198 ------
NM_006148chr1752637 2202 2080 952 509 --1721 --
NM_006158chr861718 1518 1134 576 460 151 11442 21622 1272 --
NM_006159chr12--2583 532 1135 --
NM_006166chr1242312 1809 1703 813 ------
NM_006178chr1751554 999 594 312 264 --2573 350 1621
NM_006183chr123437 169 49 --1460 --
NM_006190chr23967 786 146 ------
NM_006195chr921422 883 --11088 --
NM_006203chr5175574 5377 5059 4852 4649 4606 3646 2122 1669 1622 1407 1025 1007 497 398 286 142 11951 --15530
NM_006206chr441942 1810 985 431 1213 42326 2068 1003 223 12951
NM_006210chr1921195 182 1869 ----
NM_006224chr1731674 400 345 --12517 --
NM_006226chr211390 --11280 --
NM_006246chr144373 357 211 180 ------
NM_006251chr543177 928 711 249 22900 370 ----
NM_006252chr1167312 7157 6922 6901 6877 6691 5969 5138 4650 4622 1170 794 701 684 620 496 12763 46248 5769 3001 319 11674
NM_006253chr1231237 1068 336 --1327 11277
NM_006256chr152776 2439 1934 1841 48 1804 ----
NM_006258chr101327 ------
NM_006265chr811139 11358 ----
NM_006267chr241564 1457 677 433 ------
NM_006275chr2061883 1682 1005 850 770 618 --22195 429 22523 1012
NM_006281chr81276 1794 ----
NM_006281chr81276 1794 ----
NM_006282chr2084346 4041 3339 3013 1071 835 763 212 24095 3657 32885 736 331 --
NM_006283chr884648 4609 4018 3437 3262 1722 1566 1305 --31429 1359 1020 --
NM_006286chr3------127
NM_006290chr621778 440 --11825 11794
NM_006298chr693274 3085 2989 2642 2583 2379 1248 1004 996 11256 ----
NM_006306chrX75867 4271 2146 1713 1703 1190 903 24512 1980 ----
NM_006307chrX1298 ------
NM_006310chr1721189 104 11025 ----
NM_006313chr1221053 514 ----21726 200
NM_006317chr51146 --1585 --
NM_006320chr42966 918 ------
NM_006321chr342060 1559 1381 319 ------
NM_006325chr121347 ------
NM_006329chr145738 548 527 297 268 ------
NM_006330chr851347 651 576 335 258 ------
NM_006352chr12418 296 ----1816
NM_006353chr61182 ----11435
NM_006359chrX32515 892 310 --1274 --
NM_006364chr1451235 991 971 376 256 ------
NM_006366chr621294 523 ----1414
NM_006367chr13753 252 99 ------
NM_006372chr61474 ----2521 201
NM_006378chr941214 1042 472 135 ------
NM_006379chr762256 2069 1851 796 311 52 12143 ----
NM_006380chr1753832 3678 1595 1358 232 23153 423 24139 891 --
NM_006386chr2271763 1663 1570 964 759 527 36 ------
NM_006387chr1921114 94 ----11088
NM_006393chr1051049 1032 669 415 389 --14111 13352
NM_006403chr661790 1575 1551 1498 558 543 ----1710
NM_006408chr72950 171 ------
NM_006416chr63534 185 72 ----1740
NM_006419chr4--1771 ----
NM_006420chr2043171 3132 2625 113 12968 --12950
NM_006457chr453873 3738 1531 1416 972 24132 81 23982 1518 --
NM_006460chr1731409 1247 244 1604 1522 --
NM_006469chr12550 276 ----1412
NM_006474chr142023 2002 646 603 ------
NM_006482chr1273291 3064 2927 2447 1418 1046 132 22950 99 ----
NM_006489chr1441482 1402 1395 53 ------
NM_006496chr151949 1819 1543 447 340 1308 1253 --
NM_006503chr19--1116 ----
NM_006504chr1032807 1138 159 --42979 1107 500 249 1314
NM_006519chr62237 217 ------
NM_006520chrX41469 1183 591 465 1476 11545 --
NM_006526chr2051764 1704 1373 695 593 ------
NM_006527chr43718 255 152 --1554 --
NM_006529chr451534 1417 1133 673 356 --11196 --
NM_006534chr2073264 3160 2634 2268 2092 346 24 --33303 1219 1211 --
NM_006536chr11789 ------
NM_006537chr152569 232 --1101 --
NM_006538chr284208 3118 2777 2768 1568 1512 414 336 1325 33059 2894 2628 --
NM_006544chr14155878 5680 5346 5264 5102 4916 3815 3714 1974 1773 1298 1115 1063 513 436 24990 2002 15706 13807
NM_006546chr17125374 4932 4201 4191 2173 1558 1347 1325 885 402 310 174 --26667 2096 --
NM_006547chr731675 1595 352 --1472 21855 322
NM_006549chr1252813 2261 864 500 114 21813 528 ----
NM_006551chr11178 --140 --
NM_006552chr11180 --142 --
NM_006557chr961770 1740 1462 1170 605 283 --21497 115 --
NM_006559chr151032 978 463 345 157 ------
NM_006561chr10136142 6087 6080 6005 5377 5141 4866 4626 4489 4307 2062 894 100 56244 6237 4200 2490 870 2827 747 --
NM_006566chr1831015 957 470 ------
NM_006575chr142407 333 3219 149 73 21203 383 --
NM_006577chr221018 145 ----1795
NM_006580chr31128 ------
NM_006595chr1171976 1862 1739 642 581 487 173 196 ----
NM_006599chr16157966 7924 7696 7072 6199 6185 5883 5505 5270 3310 3235 2564 1192 819 331 37296 3111 440 11905 36495 5797 468
NM_006602chr201304 1760 2688 278 1233
NM_006609chr242961 2702 2169 1020 1566 ----
NM_006614chr383206 2748 2738 2611 1166 1118 1109 631 22261 812 12775 --
NM_006620chr684517 3102 1740 1539 948 403 368 58 --23659 3500 23270 3014
NM_006624chr1041697 568 464 434 ----1607
NM_006628chr1594434 4344 4039 3651 2997 2886 1104 911 459 44098 2964 1135 52 44241 3142 1291 332 14110
NM_006629chr1872696 2642 2264 1761 1051 810 522 12852 ----
NM_006633chr52811 711 --1724 --
NM_006642chr1--170 --1289
NM_006644chr132505 29 ------
NM_006646chr1352424 2333 2218 2212 2060 ----12771
NM_006654chr1264400 2994 1897 1071 721 691 13079 24020 902 12901
NM_006667chrX31090 785 336 --1413 --
NM_006699chr142142 1648 607 570 12543 ----
NM_006710chr221043 952 1929 2992 80 --
NM_006713chr52330 249 1648 --1601
NM_006717chr9103242 3048 3034 2962 2878 2669 2620 2102 1129 295 --1676 --
NM_006718chr641115 888 405 150 ------
NM_006721chr101177 --2281 127 1258
NM_006722chr342030 1997 992 779 ----1958
NM_006724chr6----137 1491
NM_006729chrX84164 3593 1259 865 570 343 324 313 15660 25005 1167 --
NM_006738chr1594653 4560 3169 3145 3057 2981 1435 715 232 13239 33875 2922 2907 --
NM_006746chrX61477 1199 1111 1017 604 116 ----1327
NM_006750chr16157883 7380 7169 6955 6587 6257 5424 5256 5241 2774 1896 1440 977 588 242 15041 27460 6074 22635 2321
NM_006751chr23913 721 252 --1406 --
NM_006754chr7------1989
NM_006756chr831440 284 213 21524 1273 ----
NM_006759chr24314 283 242 219 ------
NM_006761chr174683 180 170 116 ------
NM_006766chr882673 2089 1804 1759 1710 1060 808 424 --1791 --
NM_006775chr672330 1949 1242 1002 504 364 331 11929 --12528
NM_006777chrX52254 1875 862 826 397 --1389 --
NM_006791chr151197 1644 1219 --
NM_006793chr10273 29 --1289 --
NM_006805chr511570 ------
NM_006807chr1751099 1084 222 167 45 ----11359
NM_006813chr63932 380 359 ------
NM_006818chr15993 742 650 180 51 --1782 --
NM_006827chr1473396 2701 2550 2187 850 592 534 --1439 --
NM_006832chr14--21041 79 ----
NM_006838chr1241838 1683 1203 498 --2770 454 --
NM_006846chr5--1274 ----
NM_006851chr1282670 2596 928 874 783 661 497 456 ------
NM_006852chr1762696 2034 2014 1990 1895 834 12000 22521 567 1734
NM_006873chr2143345 3274 3207 3187 3145 2500 2458 2304 2165 1258 1242 732 621 312 ----13295
NM_006874chr411078 --1789 --
NM_006884chr341532 1319 561 450 --11637 --
NM_006885chr16144136 4084 3168 3104 3080 3058 1520 1200 1082 1055 735 706 504 66 ----1350
NM_006888chr1483080 2203 2171 1304 1199 1171 412 247 13524 23166 1225 12757
NM_006895chr232138 1821 1477 --12069 --
NM_006908chr761195 1178 450 274 259 116 11506 ----
NM_006910chr16128 ------
NM_006913chr61408 1451 ----
NM_006914chr9--2390 122 ----
NM_006915chrX52069 2042 1927 353 325 --1409 --
NM_006918chr11115500 5447 5096 4959 4332 4138 2203 2054 1332 1242 22 34367 3669 382 22039 1727 --
NM_006920chr23625 365 285 ------
NM_006922chr232482 873 484 11670 32529 2298 2292 12342
NM_006924chr1744130 3664 3201 1595 --1425 --
NM_006925chr142439 374 ------
NM_006930chr561746 1311 525 328 108 99 --21368 191 11535
NM_006937chr171413 --163 --
NM_006940chr1221755 122 ------
NM_006943chr2042951 2173 697 545 11078 23187 2208 --
NM_006947chr42545 133 --11550 1489
NM_006955chr1043432 2875 2661 2630 199 --12214
NM_006963chr105929 912 384 291 37 ------
NM_006965chr181212 --1224 --
NM_006981chr932173 1202 429 --22813 2709 --
NM_006993chr10163 ------
NM_006996chr131870 1804 463 ------
NM_006997chr101439 ------
NM_007005chr931420 1327 141 ------
NM_007006chr1683100 2887 2779 1119 949 822 734 620 ----13560
NM_007007chr12104656 4521 4139 3758 3036 1218 1202 979 887 576 ----13485
NM_007008chr22703 194 ------
NM_007010chr1751666 1566 1471 1182 453 --31464 618 171 --
NM_007011chr15136898 5983 5811 1834 1810 1424 1399 1059 1047 976 895 513 88 --11963 --
NM_007013chr831013 817 116 ------
NM_007023chr25920 897 762 696 51 --1871 --
NM_007027chr3------1192
NM_007034chr12385 321 1726 ----
NM_007036chr521004 914 1970 ----
NM_007038chr2185883 5798 5300 5250 4331 4079 1775 498 12439 55907 4516 1237 884 671 11879
NM_007039chr1452255 680 667 366 224 1540 ----
NM_007045chr61119 --1213 --
NM_007050chr2087476 6951 6381 5584 3071 2057 1772 222 16899 37913 6642 5018 --
NM_007054chr583889 3744 3617 2600 1517 777 352 232 11498 197 --
NM_007064chr31131 ----1456
NM_007068chr2241066 942 365 153 ------
NM_007078chr1062356 2173 1993 1138 955 389 22933 1083 1713 --
NM_007084chr1341319 1242 1164 605 ------
NM_007106chr1362171 2152 1964 1729 940 762 32326 2233 645 --12131
NM_007107chr362403 2364 1769 1658 580 455 ------
NM_007111chr131330 ------
NM_007112chr11182 ------
NM_007118chr52321 64 ------
NM_007123chr111280 1509 --31205 861 359
NM_007124chr631739 1343 1279 --2807 591 --
NM_007129chr132950 775 ------
NM_007135chr9--1150 ----
NM_007137chrX125071 4810 4326 4127 3760 3646 2087 1836 1749 926 508 173 ------
NM_007145chr1931259 1155 433 1965 ----
NM_007150chrX42158 1835 732 142 --32131 1896 177 --
NM_007157chrX62918 2889 1173 1155 446 217 --1759 --
NM_007166chr1181514 1340 385 267 259 139 101 92 ------
NM_007170chr12747 667 --1644 --
NM_007174chr1242149 1728 1653 257 --12169 1458
NM_007175chr893380 3361 3037 2615 2329 804 740 686 291 12396 1982 --
NM_007187chr132970 914 ------
NM_007191chr121287 --1462 1478
NM_007192chr144971 409 374 334 --11140 --
NM_007195chr1872759 2643 1396 1382 1047 520 388 2581 101 --43644 2425 2312 238
NM_007200chr1594653 4560 3169 3145 3057 2981 1435 715 232 13239 33875 2922 2907 --
NM_007203chr933960 2902 233 ------
NM_007212chr172302 2057 2018 1614 1486 674 108 ------
NM_007214chr621010 205 --1951 --
NM_007222chr851630 1537 1138 564 152 1630 ----
NM_007235chr121458 ------
NM_007246chr451018 894 828 249 113 ------
NM_007249chr13179247 9204 9177 8892 6734 6311 6037 5782 3420 3315 3217 3140 2920 2363 2058 595 219 17614 38532 7519 6954 16689
NM_007269chr13458 131 118 ------
NM_007275chr321184 59 ----11191
NM_007285chr16------1132
NM_007287chr3123211 3171 3123 3083 2863 2638 2007 998 985 700 590 238 ------
NM_007288chr3123211 3171 3123 3083 2863 2638 2007 998 985 700 590 238 ------
NM_007289chr3123211 3171 3123 3083 2863 2638 2007 998 985 700 590 238 ------
NM_007292chr1795061 3574 1992 1522 1383 1264 1166 722 421 25211 2067 23813 1152 --
NM_007315chr221023 541 --11458 --
NM_007325chrX21725 1653 --1594 1139
NM_007341chr213387 320 63 ------
NM_007350chr12134646 4629 4465 4107 4073 3647 3307 2997 1069 880 705 485 397 33147 2849 821 ----
NM_007358chr15731 502 228 214 93 ----2570 428
NM_007359chr1721472 29 1422 ----
NM_007361chr142548 173 ------
NM_007365chr162190 762 692 537 473 169 ------
NM_007375chr12553 102 --22638 910 --
NM_012069chrX72729 2719 2706 2038 948 755 85 ------
NM_012081chr5113670 3638 3597 3015 2705 2481 2278 1367 946 756 272 13755 1443 --
NM_012082chr83944 830 189 --2691 605 --
NM_012092chr261611 1402 611 553 203 134 2708 541 --1669
NM_012093chr141193 1139 962 74 ------
NM_012095chr1062354 1391 1284 1020 361 162 12206 1688 12186
NM_012096chr392683 2423 1400 1264 891 719 705 575 546 1786 13136 --
NM_012097chr242269 1781 1742 251 21612 1505 12020 --
NM_012099chr1931191 905 188 ------
NM_012104chr1132615 814 708 13858 22535 729 13344
NM_012104chr1132615 814 708 13858 22535 729 13344
NM_012105chr214346 180 172 114 ------
NM_012108chr4149 ------
NM_012110chr41255 ------
NM_012115chr62141 25 ----1588
NM_012118chr41295 --1430 --
NM_012120chr662994 2882 2819 2012 1918 209 ----32750 2394 1944
NM_012124chr114952 785 704 137 ------
NM_012137chr162764 2502 1952 1876 1030 655 --12917 --
NM_012141chr1374140 3877 3174 2972 1404 1151 306 13263 --13933
NM_012154chr82339 166 ------
NM_012156chr2063380 3289 3060 2143 2079 309 13425 1689 --
NM_012157chr33907 888 272 --1236 --
NM_012158chr1351819 1466 1369 504 27 --11412 --
NM_012164chr9167490 7350 6988 6575 6120 5992 5442 5287 4791 4766 4681 1974 1758 1645 1163 835 --16474 --
NM_012177chr62390 164 1625 190 1208
NM_012183chr11511 ------
NM_012191chr3--138 ----
NM_012193chr11145321 4922 4647 4235 4142 3779 1535 1517 1338 1117 836 697 690 231 1917 31739 1437 95 --
NM_012199chr164454 3960 3854 1190 1007 468 14064 --11182
NM_012214chr2106191 5865 5504 2170 1995 1537 1208 1153 683 597 --44620 800 639 220 --
NM_012215chr1041942 1681 1668 38 1292 2520 403 --
NM_012219chr393239 3144 2717 2230 1083 955 591 501 195 11100 13189 --
NM_012223chr241275 1235 334 176 ------
NM_012224chr42967 288 --1394 --
NM_012234chr363589 3305 3149 2344 1185 736 --33122 3036 1278 --
NM_012238chr1061264 1240 554 356 338 239 187 11492 --
NM_012243chr13839 748 51 1794 ----
NM_012247chr102905 63 1790 ----
NM_012249chr2113408 3103 2834 2666 2345 817 614 602 246 225 42 12631 11334 --
NM_012250chr1131179 500 64 11275 1441 --
NM_012257chr741067 788 96 22 ------
NM_012259chr6------11220
NM_012262chr1155019 5004 4804 4745 4582 4558 3881 3306 3281 2013 1594 1558 1280 351 64 1670 44916 4900 1537 1127 13346
NM_012281chr732389 146 56 --22133 510 22098 1813
NM_012286chrX2634 184 ------
NM_012288chr6105663 5561 4343 3973 3855 2308 2086 1044 655 108 14410 --1200
NM_012290chr211649 ------
NM_012300chr531860 463 275 32419 1963 1558 --12559
NM_012302chr111275 ------
NM_012304chr542574 1941 1760 482 1515 ----
NM_012307chr182902 709 --1277 --
NM_012309chr11104817 4491 3526 3047 1210 1080 917 463 448 263 --23639 3135 --
NM_012316chr1135623 5481 5204 5098 4890 4548 3909 3769 3489 3465 1520 1209 767 13938 21526 1200 --
NM_012319chr182715 302 --1940 --
NM_012322chr72435 349 ------
NM_012327chr1831199 576 485 2496 73 21267 587 --
NM_012330chr102529 82 ------
NM_012333chr121614 186 1166 1667 --
NM_012334chr574687 3948 3763 3569 3466 3149 1090 --21694 721 --
NM_012338chr711222 ----1491
NM_012343chr55973 437 357 180 162 1317 ----
NM_012347chr682817 2790 1970 1913 1138 915 538 326 1301 1391 --
NM_012382chr594524 4065 3723 3030 2752 1562 948 349 203 33622 1757 414 1586 --
NM_012383chr92365 336 ------
NM_012388chr152215 203 --1329 --
NM_012405chr1103861 2863 2654 1072 1060 1000 972 943 763 624 --43120 932 926 95 --
NM_012416chr92883 226 11233 ----
NM_012421chr11289 ----1455
NM_012425chr1042128 1693 1018 76 ------
NM_012428chr153772 322 95 ------
NM_012430chr32549 176 ----1756
NM_012437chr1157 2515 23 ----
NM_012449chr7159 131 ----
NM_012464chr452323 1841 1120 1047 711 --1660 --
NM_012465chr1053409 2190 1102 626 112 ------
NM_012479chr742709 2504 1709 796 --12510 --
NM_012482chr12555 494 --1117 --
NM_013229chr1232517 2387 2188 21746 538 2789 97 --
NM_013231chr1441582 1217 235 190 ------
NM_013233chr221214 1134 ------
NM_013235chr51738 139 1343 --
NM_013243chr1551061 542 470 366 29 ------
NM_013248chr202214 71 ------
NM_013252chr752317 2181 481 418 205 --32301 2226 2142 --
NM_013255chr7278619 8517 8417 8340 8100 7495 7371 6277 6149 5978 5900 5863 5511 3530 3326 3283 3225 3004 2722 2710 2639 1606 1435 1351 615 509 128 38396 7454 2042 --28883 848
NM_013256chr193671 190 143 --1679 --
NM_013257chr822389 174 11656 ----
NM_013261chr493796 3451 3053 2925 1381 1179 930 878 420 --11200 13550
NM_013262chr631279 1106 360 ------
NM_013269chr1284555 4525 4498 4140 3563 3463 3446 917 21662 117 24464 3984 --
NM_013281chr2031269 1101 170 1541 ----
NM_013282chr1951328 933 343 259 160 11156 1996 1215
NM_013293chr74756 727 615 182 ------
NM_013309chr15102433 2355 2113 1770 861 748 628 418 308 128 1330 1564 1719
NM_013313chr2273174 3011 2511 2373 934 639 234 1309 2801 213 --
NM_013354chr831305 216 164 ----1173
NM_013357chr83720 614 587 ------
NM_013372chr1522787 499 ------
NM_013381chr1272374 2185 1879 1742 854 819 392 12219 1518 12298
NM_013386chr141624 1266 1131 41 ----21464 242
NM_013390chr931114 607 404 --11537 --
NM_013391chr51105 --1136 --
NM_013396chr2141050 1030 309 49 11569 ----
NM_013400chr721066 360 ------
NM_013423chrX41279 1109 850 111 --11240 --
NM_013427chrX41279 1109 850 111 --11240 --
NM_013436chr2------1152
NM_013437chr821114 891 2412 226 --11077
NM_013446chr74287 216 149 102 ------
NM_013448chr143773 652 607 --1130 --
NM_013450chr22869 257 ----1363
NM_013451chr102202 23 ------
NM_013943chr143159 706 292 158 --1509 --
NM_013952chr21287 --12367 --
NM_013953chr21287 --12367 --
NM_013989chr1494889 4621 4317 3858 3665 1791 1220 613 79 14465 25035 557 --
NM_013992chr21287 --12367 --
NM_013995chrX32073 929 131 --2756 710 --
NM_013996chr7----1474 --
NM_013996chr7----1474 --
NM_013997chr7----1474 --
NM_013997chr7----1474 --
NM_013998chr7----1474 --
NM_013998chr7----1474 --
NM_014005chr572513 2461 2268 2236 926 830 473 11109 12079 --
NM_014007chr911130 ------
NM_014011chr242473 2336 622 355 --21903 1020 --
NM_014016chr341647 1560 459 386 ------
NM_014021chr163464 2410 2153 1103 345 158 ------
NM_014031chr5--2242 122 ----
NM_014043chr341622 1491 582 514 ----11649
NM_014048chr16115309 5285 4713 4014 3955 1741 1393 1314 1275 952 662 14096 --13825
NM_014057chr931078 351 56 --11578 --
NM_014089chr1351718 1616 1381 900 786 --1223 --
NM_014106chr1531092 959 872 12045 1787 --
NM_014110chr12893 777 --21114 450 1233
NM_014112chr8115309 5214 5012 4726 3402 2101 1860 1516 1303 908 774 2704 57 25104 518 23833 3815
NM_014117chr16112758 2720 2517 2354 2201 2028 1775 726 540 307 193 --12106 12035
NM_014154chr331480 1352 1138 ------
NM_014155chr11147244 7189 6898 6803 6222 6010 5824 4838 2747 2479 2404 2221 1546 759 36556 5550 46 15664 --
NM_014178chr142494 30 ------
NM_014181chr272844 2644 1894 576 546 283 21 12568 ----
NM_014217chr121761 354 ------
NM_014223chr1------1233
NM_014243chr441753 1582 615 526 ------
NM_014250chr2241723 1639 604 375 11309 1485 --
NM_014253chrX42295 1854 1761 738 12345 2280 135 --
NM_014263chr1021280 1093 11430 11306 --
NM_014264chr4156 ------
NM_014267chr111142 ------
NM_014268chr181394 ------
NM_014280chr11284 ----1131
NM_014282chr91236 ------
NM_014283chr12960 586 ----11502
NM_014290chr92182 79 ------
NM_014329chr161331 ------
NM_014331chr4157337 6720 6379 6182 5972 5819 5431 4791 2940 2688 2475 2389 2119 1508 1228 27206 6634 22000 422 --
NM_014332chrX--156 ----
NM_014333chr1142476 2366 2332 641 1801 12043 12824
NM_014338chr2221018 62 --1260 --
NM_014342chr1131393 1243 1055 --1312 11426
NM_014344chr111178 --1158 1896
NM_014345chr62965 125 ------
NM_014361chr111381 --1465 --
NM_014374chr721066 360 ------
NM_014376chr552479 1905 743 587 402 ----12070
NM_014382chr331795 1634 422 ------
NM_014386chr5167 ----1273
NM_014409chr121178 64 ----1841
NM_014415chr321588 409 --11502 1483
NM_014421chr451749 1691 1568 681 547 --11899 --
NM_014423chr5165251 4723 4610 4568 3957 3708 3498 2133 1990 1875 1768 1529 1188 888 687 547 --35554 5264 2038 --
NM_014432chr62323 186 11233 11462 --
NM_014435chr41244 --1647 1594
NM_014447chr4--11511 11310 --
NM_014452chr671101 975 465 415 407 323 35 ------
NM_014456chr1081710 1413 1352 691 539 473 327 228 ------
NM_014458chr141342 1107 502 175 --11160 11210
NM_014469chr113761 213 36 1570 ----
NM_014470chr12----1783 --
NM_014488chr111528 ------
NM_014491chr72902 312 ------
NM_014494chr1652205 1968 1931 1712 942 ------
NM_014495chr13461 440 121 --1190 --
NM_014496chrX1281 ------
NM_014504chr722036 1589 11884 31831 1338 241 --
NM_014517chr321745 1205 ------
NM_014548chr1511066 --11128 --
NM_014572chr1371754 1745 1434 1383 1213 525 464 ----1198
NM_014574chr1421288 300 --1154 --
NM_014575chr33459 453 127 1187 1155 --
NM_014583chr32449 206 ------
NM_014584chr1441105 1040 303 90 ------
NM_014586chr2154410 4045 3126 3022 1040 --34431 4139 1476 --
NM_014588chr202687 209 --2497 95 --
NM_014602chr3298 92 ------
NM_014606chr441019 388 347 40 11547 11071 --
NM_014608chr151134 ------
NM_014612chr921156 502 11547 ----
NM_014613chr582791 2758 2633 2603 2523 2346 2315 2185 --11083 1516
NM_014630chr1563770 3746 2943 1560 1233 884 13093 ----
NM_014633chr111106 ----1502
NM_014636chr934277 2694 1559 --44043 3713 2740 318 --
NM_014637chr82466 333 --1448 --
NM_014647chr1652025 1915 1484 405 69 1255 2766 214 --
NM_014660chr721045 851 1442 --191
NM_014666chr521218 941 ------
NM_014670chr231618 613 424 21091 23 --11082
NM_014671chr731543 1110 203 --21332 292 --
NM_014674chr373373 2784 2697 2580 1534 770 757 1186 13210 --
NM_014677chr871202 1167 944 276 231 147 94 1985 1315 --
NM_014682chr842166 1508 824 430 12283 ----
NM_014683chr1752072 2001 545 310 105 --11864 1811
NM_014685chr16--1568 ----
NM_014700chr1611382 ------
NM_014701chr1573035 3011 2707 2681 283 267 72 --23425 2540 --
NM_014705chr72682 302 --22165 1378 --
NM_014707chr742296 1494 1474 878 --11895 --
NM_014709chr22615 140 ------
NM_014710chrX------1330
NM_014711chr1622131 468 ----31707 1465 165
NM_014715chr111270 1886 --165
NM_014717chr19--1849 ----
NM_014718chr122838 137 --1688 --
NM_014720chr1071747 1351 1336 1246 616 252 78 1489 21734 377 --
NM_014721chr697348 4602 2256 2041 1961 1570 1511 694 668 17120 45364 5153 5035 1903 --
NM_014725chrX21096 891 ------
NM_014729chr821589 586 12262 ----
NM_014730chr1274682 4123 4045 3479 1621 820 788 --21837 762 11294
NM_014730chr1274682 4123 4045 3479 1621 820 788 --21837 762 11294
NM_014733chr572295 2197 1881 1829 1642 589 151 21718 1509 ----
NM_014735chrX62114 2104 2042 824 554 159 1259 21991 1822 --
NM_014739chr6123500 3471 3417 3249 3145 1394 1372 1217 1178 1146 1035 72 --44040 3866 3342 1249 --
NM_014743chr453206 2704 566 300 106 ------
NM_014746chr263675 3418 3329 1530 922 859 11727 22875 1453 14319
NM_014750chr142193 163 ------
NM_014751chr831941 1493 1429 ------
NM_014752chr1131754 1391 345 11924 1380 2674 393
NM_014755chr243654 3452 1264 1033 --23730 3538 1423
NM_014758chr116903 863 565 493 444 365 12510 11766 --
NM_014764chr1231089 873 153 ------
NM_014765chr142116 1064 592 325 12484 22205 31 --
NM_014774chr163245 2408 2243 2019 1249 891 ------
NM_014775chr22199 ------
NM_014776chr1262918 2867 1102 625 168 55 1136 22611 580 --
NM_014787chr162639 2563 2507 2060 941 835 ----12071
NM_014791chr92289 125 ------
NM_014795chr21548 11049 21382 1166 --
NM_014803chr1032905 2750 1828 --32047 1937 1043 12849
NM_014810chr132962 821 118 43294 1472 1372 480 12564 --
NM_014812chr141876 758 258 176 --21287 128 1447
NM_014819chr532411 2338 641 --12324 --
NM_014820chr331664 1591 629 ------
NM_014822chr43610 457 418 ------
NM_014824chr1131622 1574 1409 ------
NM_014826chr154222 3550 3452 1380 160 14360 1445 13033
NM_014828chr1442445 2356 478 210 12137 12475 --
NM_014829chr531973 1753 876 --2518 366 --
NM_014830chr1253642 2955 2516 1317 911 11347 13594 --
NM_014832chr1351714 1635 1607 1300 473 ------
NM_014835chr2022297 240 1570 1317 --
NM_014836chr1031358 713 62 1263 21805 1698 11709
NM_014838chr22102754 2743 2736 2508 1800 1000 833 752 359 117 ------
NM_014839chr152238 1990 1789 492 231 1446 ----
NM_014840chr1233224 2546 291 ----11015
NM_014841chr631324 1219 83 --1365 --
NM_014857chr12199 89 ------
NM_014858chr111215 ------
NM_014859chr1731363 1210 1126 ------
NM_014864chr194292 4096 3738 3049 2740 1691 1636 1094 714 --54382 3936 3697 3578 271 --
NM_014868chr122563 295 1858 ----
NM_014873chr184851 4541 3591 1910 1267 809 631 116 1430 ----
NM_014877chr17147736 7676 6995 6763 6292 6276 5470 5449 5420 5223 2857 1369 1208 128 1386 27717 1148 --
NM_014879chr351106 1094 409 254 52 2787 130 ----
NM_014887chr133727 645 82 ------
NM_014888chr741504 1331 1173 1118 --2596 45 --
NM_014892chr61139 --1615 1180
NM_014893chrY52306 1678 718 431 298 1366 1777 --
NM_014897chr1752679 2030 715 262 90 --22006 1079 1632
NM_014899chr552972 2571 1930 1237 171 1126 2513 293 1727
NM_014903chr12151 ------
NM_014904chr1063915 2708 2697 771 706 377 --1229 --
NM_014905chr23691 519 413 --1309 --
NM_014906chr17113730 3453 2898 2708 1258 817 583 328 234 125 119 --32739 370 169 24126 1201
NM_014912chr1052609 2199 876 261 177 11040 23256 110 13124
NM_014918chr1541469 1427 1308 51 11445 ----
NM_014920chr6133605 3050 1318 1179 1114 1009 950 823 730 713 481 447 246 13616 ----
NM_014923chr131774 --1486 --
NM_014926chr34711 357 182 39 ------
NM_014932chr341878 1628 1315 73 --1195 21221 787
NM_014934chr1383807 3581 3260 3233 2468 954 444 309 --12981 --
NM_014936chr6102866 2141 2103 2094 950 881 733 668 654 498 --22607 1046 --
NM_014939chr1821255 273 --11092 1626
NM_014946chr2102777 2347 2308 2031 1979 1028 477 445 403 62 --23035 960 22544 1010
NM_014947chr122846 2087 --12221 --
NM_014950chr14--2706 168 11747 11183
NM_014953chr1384344 4236 3564 2958 1442 1395 963 218 24272 1100 ----
NM_014961chr431840 1385 46 ----1572
NM_014962chr2032640 1159 433 --32387 1947 298 1698
NM_014969chr121075 313 ----11195
NM_014977chr141509 ------
NM_014978chr1041673 1359 674 307 ----11424
NM_014982chr14103741 3371 3343 1559 1320 1227 1067 870 775 598 11569 141 --
NM_014988chr442364 1118 862 95 1887 --11032
NM_014989chr622017 1631 ----1133
NM_014990chr141862 1335 ----
NM_014991chr4103297 2957 2411 2013 1027 920 790 642 608 505 ------
NM_014996chr3395 32 23 ------
NM_014997chr742817 1085 766 515 1291 1258 --
NM_014999chr1231597 1033 640 --1452 --
NM_015008chr373640 3580 2557 2495 1301 687 255 23451 2987 21382 804 --
NM_015009chr32231 70 ------
NM_015020chr1663805 2860 1558 742 219 139 23863 1521 ----
NM_015024chr811485 ----11086
NM_015025chr212357 ----1868
NM_015026chr1284274 4206 3567 3243 1273 1263 1074 400 --1357 43298 1461 1425 804
NM_015027chr1621573 277 ----11393
NM_015032chr1352591 2219 559 459 391 1673 11814 --
NM_015035chr20116690 5565 5545 4851 4175 4115 1889 1808 1383 670 646 --11862 --
NM_015039chr193573 3558 3539 3522 3376 2683 888 858 625 13624 14374 --
NM_015040chr283419 3304 2434 2417 1348 321 261 238 --12102 32518 2249 952
NM_015042chr1584098 1624 1302 1290 1150 933 541 243 --14304 --
NM_015044chr1683261 3195 2740 2635 2386 775 446 29 --12829 --
NM_015045chr1042167 1858 829 812 1684 --12285
NM_015046chr932415 456 398 ----12402
NM_015049chr262649 2424 2032 1054 656 456 ------
NM_015051chr9123366 3113 2993 2888 2791 2526 2464 1065 803 414 185 31 11027 1547 --
NM_015052chr751382 1324 253 124 81 --21106 210 --
NM_015054chr121147 ------
NM_015055chr1142695 1812 598 372 12734 12888 --
NM_015059chr15123626 3379 3350 2857 2781 1422 1323 1191 870 421 311 245 ----23750 998
NM_015060chr7----1209 --
NM_015068chr773636 2861 2658 966 709 684 620 13990 31014 903 61 --
NM_015071chr5155499 4242 4162 4094 4036 2442 2237 2210 2089 2007 1435 1280 1185 305 177 --22270 1273 34537 983 475
NM_015072chr142607 453 ------
NM_015076chr674063 3563 1694 1198 803 507 352 11261 1823 --
NM_015091chr143759 556 244 ------
NM_015092chr1654705 3762 2924 1461 711 --34071 1504 758 23882 3323
NM_015097chr352216 1687 170 79 32 --12159 11870
NM_015107chrX31838 1700 639 ------
NM_015110chr942117 1865 852 598 1273 21704 898 --
NM_015115chr463046 2881 2449 1977 870 724 --23196 2804 --
NM_015129chrX51688 1471 1098 331 249 ------
NM_015130chr441255 445 181 147 ------
NM_015132chr781894 1757 780 714 283 252 201 113 ------
NM_015137chr83367 187 79 22464 2283 ----
NM_015141chr382457 1828 1106 1026 773 480 328 273 ------
NM_015144chr16112788 2547 1542 1460 1369 1259 1028 872 759 167 93 13732 ----
NM_015149chr132096 1731 1452 --31763 1539 533 --
NM_015155chr1052911 2786 2072 681 68 ----12179
NM_015156chr1474037 3725 3204 2571 917 711 159 11413 --11480
NM_015158chr92847 542 ------
NM_015163chr1461845 1253 718 404 297 173 ------
NM_015170chr832253 1792 1764 ----11733
NM_015176chr131336 1158 327 --11719 --
NM_015185chrX62685 2640 2374 919 642 284 23044 693 ----
NM_015187chr42348 44 --1654 --
NM_015192chr2063046 2919 2889 2628 867 367 11950 ----
NM_015197chr1473437 2783 1169 689 413 380 120 12168 --1560
NM_015198chr741193 524 310 238 ------
NM_015199chr352927 2621 2051 2008 687 ------
NM_015200chr432598 2318 2273 ------
NM_015203chr11171 ------
NM_015206chr1563815 3741 2657 2463 725 199 33578 1039 1029 31517 1075 996 --
NM_015208chr1873293 3176 3071 2753 2675 1097 396 11112 --12846
NM_015209chr152293 1870 1818 1796 1688 ------
NM_015216chr5----1555 --
NM_015225chr972795 2708 2440 987 565 417 160 22974 2104 --1261
NM_015231chr112675 218 ----1956
NM_015233chr133849 572 307 1107 22361 656 1315
NM_015239chr92200 138 ------
NM_015247chr1665333 4966 4932 3827 594 543 --1461 --
NM_015250chr951916 715 404 381 145 ------
NM_015251chr1641958 1492 506 348 22019 1545 11634 --
NM_015252chr21790 ----1962
NM_015262chr10179 1171 ----
NM_015263chr1511082 ------
NM_015264chr22104285 3963 3922 3434 3173 3086 1913 1360 940 403 14750 ----
NM_015265chr261975 854 794 681 587 505 42704 2426 1932 825 12292 --
NM_015271chr474323 3964 3869 2899 1581 1383 611 --44255 3949 3678 63 --
NM_015272chr1642097 662 632 295 41472 1387 559 37 --1249
NM_015275chr1252046 381 364 183 131 22032 687 1533 --
NM_015277chr182485 249 21328 288 11285 --
NM_015278chr653267 2218 2155 1339 994 21057 600 ----
NM_015285chr1852278 1634 553 378 157 12522 12508 --
NM_015288chr533491 2723 933 ------
NM_015310chr8127578 7211 7049 6934 5783 3161 3110 3022 2434 807 307 53 16982 38438 7887 1190 --
NM_015313chr1133931 3170 1444 ------
NM_015317chr2196 --11071 12283
NM_015323chr621105 165 --11724 --
NM_015328chr773142 3120 2819 2523 2011 833 407 --12619 12884
NM_015336chr1272423 2417 2388 2004 927 854 145 --1237 21039 889
NM_015339chr2021057 288 ------
NM_015344chr841813 1618 532 406 11576 1682 --
NM_015347chr12102629 2407 2370 2142 2125 1191 1097 1007 297 147 --1191 --
NM_015349chr632212 324 257 12609 1154 --
NM_015354chr91336 ------
NM_015355chr1741699 1585 246 130 12023 11716 --
NM_015358chr2141115 844 58 35 11142 ----
NM_015359chr842406 1921 530 499 --1241 --
NM_015361chr23807 709 640 --2896 631 --
NM_015365chrX53700 3101 1544 997 803 24140 468 23671 295 11099
NM_015379chr71232 1200 --1263
NM_015387chr211396 12087 11385 --
NM_015393chr493656 3530 3349 1260 1188 636 477 379 102 --23150 655 --
NM_015397chr92385 242 1143 21732 47 --
NM_015423chr1181511 1412 1355 1082 647 329 313 237 11431 1683 --
NM_015429chr341117 1087 1076 943 ------
NM_015431chr1113603 3564 3555 3412 2616 1087 615 417 371 335 215 --13339 1321
NM_015435chr831215 1002 532 --1302 1447
NM_015436chr493038 2946 2860 2723 2610 2440 2368 576 370 1694 ----
NM_015446chr11371 1134 1646 --
NM_015455chr5104005 3769 3293 3113 3052 2640 1582 1534 1345 902 --1120 33141 2856 2578
NM_015458chr8104447 4231 4183 3486 1864 1833 1598 865 788 438 14846 --1145
NM_015463chr2------1836
NM_015464chr77962 704 332 268 191 182 143 ------
NM_015465chr52733 193 --1724 --
NM_015475chr21149 ----1343
NM_015477chr152638 96 1415 1340 --
NM_015483chr7--2215 139 1848 --
NM_015508chr351499 1462 1123 221 40 11049 11332 --
NM_015509chr1251339 1122 578 481 357 --11533 --
NM_015526chr1951276 1177 538 486 134 11481 21298 1155 --
NM_015534chr12314 256 ------
NM_015535chr2193975 3966 3600 3205 3189 3149 3097 2882 2856 2561 1680 1526 1391 1341 1261 1093 563 293 32 --44075 1188 669 128 22714 373
NM_015550chr763325 2704 2262 983 174 154 ----11014
NM_015553chr665189 4235 3375 1266 752 383 11715 34733 3857 3215 --
NM_015554chr1562957 2913 2089 1852 552 63 --12637 --
NM_015555chr621727 628 --11220 --
NM_015564chr563392 2428 2351 1366 992 483 13229 23197 3061 11189
NM_015567chr132130 93 --1857 --
NM_015569chr1104785 4292 3651 3026 2954 1826 1673 1203 1131 986 --24738 3969 11019
NM_015570chr73661 508 144 1536 11300 --
NM_015571chr692641 2398 2385 2301 2196 744 359 94 50 --1527 --
NM_015575chr253358 2834 2492 192 128 --22288 774 13580
NM_015576chr31973 --22597 2520 --
NM_015577chr541568 1539 1439 1199 --1431 --
NM_015578chr1941707 1363 199 151 11895 ----
NM_015601chr105861 802 340 329 123 ------
NM_015608chr102607 495 ------
NM_015626chr1731213 932 75 ------
NM_015630chr2----1952 --
NM_015633chr1241020 955 862 80 ------
NM_015635chr921722 265 ------
NM_015640chr175038 5014 4032 3587 2001 1839 1495 --31941 1596 783 --
NM_015657chr221060 24 --1295 2953 310
NM_015659chr1693413 3100 2745 2307 1412 1194 797 403 32 ------
NM_015660chr71229 ------
NM_015670chr17----1136 --
NM_015713chr873489 3343 3221 3209 2368 2193 1167 12348 --22252 1446
NM_015852chr7103598 3395 3140 3075 2876 1389 1264 416 343 91 ------
NM_015855chr113588 311 296 --1674 --
NM_015866chr131155 954 30 11489 ----
NM_015878chr811562 21580 1489 32100 2038 100 --
NM_015879chr18187740 7504 6058 5813 5778 5754 5640 5316 5250 5231 5196 3432 3134 2964 2561 2319 1262 942 ------
NM_015885chr111731 ------
NM_015886chr895066 5005 2067 1769 1582 1188 660 576 500 --55314 4369 3711 1974 473 15761
NM_015888chr182713 1187 1006 365 333 281 245 75 21224 481 --22334 345
NM_015892chr1062328 2255 2124 848 485 236 ------
NM_015902chr82722 380 --1706 --
NM_015905chr7149 2587 149 ----
NM_015906chr1104866 4580 4275 3591 3049 1763 1158 817 665 221 14570 54497 4294 3540 3520 1885 --
NM_015920chr153683 611 474 ----1159
NM_015952chr61166 1146 ----
NM_015975chrX71768 1613 1467 1319 665 186 30 ----2443 216
NM_015986chr174358 331 302 165 ------
NM_016002chr11170 ------
NM_016009chr174906 3788 3748 3635 3279 1668 429 24035 3660 34853 3864 1654 --
NM_016019chr71262 1406 ----
NM_016021chr672643 2628 2619 2533 2328 1910 1217 23033 372 ----
NM_016023chr81358 --31821 373 315 --
NM_016025chr1661813 1747 1701 1568 390 289 ------
NM_016026chr1431418 152 86 ------
NM_016040chr152765 2597 2083 1772 659 ----12380
NM_016048chr52976 334 ----1882
NM_016072chr1221557 576 11647 11949 42432 1941 1485 570
NM_016076chr142344 1280 1137 1112 12775 --13025
NM_016078chr172905 382 --11002 --
NM_016081chr441774 1766 1424 819 ------
NM_016083chr663618 3510 2633 2457 887 110 1605 33885 909 249 11498
NM_016097chr185966 842 359 340 246 --1901 --
NM_016098chr62481 356 ------
NM_016103chr54439 410 143 29 184 --1468
NM_016104chr61166 1146 ----
NM_016106chr141196 1156 ----
NM_016107chr52974 928 ----1460
NM_016127chr82733 685 --1759 --
NM_016129chr4----1101 --
NM_016131chr242033 633 314 114 12238 ----
NM_016132chr1572538 2429 2268 2159 1184 1065 175 13407 13203 11106
NM_016133chr231501 1170 607 --11151 --
NM_016141chr32779 261 1751 1558 --
NM_016142chr1111319 21071 1008 1132 1102
NM_016147chr111459 ------
NM_016152chr311073 ------
NM_016195chr102226 203 1148 ----
NM_016205chr441319 1256 227 89 11391 195 --
NM_016206chr3208661 7941 7737 7508 7352 6853 6474 6361 6112 3391 3352 3329 2769 2091 1736 1586 1395 1187 700 508 28883 6371 27692 837 1674
NM_016217chr652783 2764 1271 711 470 23259 2608 --12808
NM_016224chr631694 1681 419 11474 1268 --
NM_016227chr12960 586 ----11502
NM_016231chr1741650 1461 1396 1305 --11578 --
NM_016235chr161242 ----11509
NM_016248chr1343790 3243 3006 2656 14020 --13014
NM_016252chr2----1203 --
NM_016255chr653221 3115 576 282 262 --62535 2474 2156 929 920 629 23360 1030
NM_016258chr11648 --193 1799
NM_016260chr2147589 7549 7046 6267 6056 5871 5594 4728 3040 1865 1162 1134 1068 452 16571 25735 1473 11792
NM_016261chr174638 318 290 82 1667 --158
NM_016262chr6163 --130 --
NM_016271chr1822293 1788 --32355 1622 860 12092
NM_016272chr2262350 2337 2147 2125 1826 1794 --12532 --
NM_016275chr362660 2431 1977 846 779 156 --1767 12238
NM_016279chr52147 94 ------
NM_016281chr1211035 --1947 --
NM_016283chr51313 123 ----
NM_016289chr252219 1725 748 697 557 ------
NM_016297chr2103560 2687 2392 1287 1273 758 402 351 244 209 13120 11065 --
NM_016299chr10----191 --
NM_016302chr32804 708 1658 ----
NM_016306chr32258 114 ----197
NM_016308chr151453 1439 1262 763 425 --2828 107 12070
NM_016316chr22697 142 ------
NM_016322chr963208 2804 969 592 525 371 ------
NM_016323chr41262 ------
NM_016352chr741494 1434 435 204 ------
NM_016356chr682157 2080 1940 1045 937 874 863 415 ------
NM_016357chr1251284 1140 1054 1000 144 11254 ----
NM_016373chr162666 151 1850 1791 --
NM_016374chr121447 33 --11329 --
NM_016374chr121447 33 --11329 --
NM_016376chr1783814 3732 2851 744 582 425 403 158 --44385 4255 2988 1403 --
NM_016377chr631685 1457 703 --11124 11788
NM_016395chr1551733 1648 707 688 310 --1113 --
NM_016396chr1562645 2159 820 737 426 175 32500 2227 990 11039 --
NM_016422chr1143134 3122 2432 1108 22834 2466 ----
NM_016436chr2052428 2312 823 354 190 ----1770
NM_016441chr241800 1660 1554 27 --22144 1472 --
NM_016442chr572187 1963 1551 1482 654 524 126 --22150 572 --
NM_016447chr7138 --1204 --
NM_016454chr15187 ----1336
NM_016470chr202528 165 --1147 --
NM_016472chr1451475 1404 1137 515 259 21044 408 ----
NM_016478chr71300 ------
NM_016480chr53885 794 71 1143 ----
NM_016486chr11452 ----1494
NM_016496chr191427 ------
NM_016507chr1732177 1169 982 ------
NM_016512chr8--1247 ----
NM_016513chr6133605 3050 1318 1179 1114 1009 950 823 730 713 481 447 246 13616 ----
NM_016516chr21543 ------
NM_016519chr4------1178
NM_016530chr15123981 3801 3533 3386 3270 2653 1328 1215 775 507 193 131 --13309 --
NM_016531chr453416 2965 1210 784 498 1919 12706 --
NM_016542chrX4567 477 351 277 ----1365
NM_016557chr33938 785 93 --1371 --
NM_016569chr1231131 412 349 ----21568 502
NM_016578chr111129 1594 ----
NM_016584chr12------1286
NM_016591chr561111 863 481 469 237 94 ------
NM_016598chr341386 1088 127 108 --11466 --
NM_016599chr451437 1046 605 340 139 --31448 1112 145 1553
NM_016603chr562009 1383 889 520 307 177 11998 ----
NM_016605chr532206 1720 734 --12279 --
NM_016623chr82213 153 ------
NM_016626chr1821642 340 21777 1228 ----
NM_016631chr213959 647 78 1128 1266 --
NM_016654chr1541099 536 330 323 ------
NM_016824chr1021449 663 11352 --1356
NM_016831chr152315 2156 1495 1475 658 ------
NM_016836chr21564 ------
NM_016839chr21564 ------
NM_016929chr694626 4492 4451 3826 3692 3667 1587 947 339 24501 4145 1605 11767
NM_016950chr431357 537 407 11442 ----
NM_016952chr1183222 2961 2650 1551 498 431 151 88 ----1419
NM_016953chr274541 4163 2356 1765 1493 1265 108 --35986 5770 1310 14203
NM_017413chrX42301 2058 988 600 ------
NM_017420chr1473723 3534 3018 2333 580 547 532 13592 ----
NM_017423chr441594 1363 570 530 --12197 1560
NM_017447chr2154302 4208 2840 1777 977 --22904 1624 23689 553
NM_017455chr153772 322 95 ------
NM_017510chr5------1650
NM_017519chr631294 1224 1040 ------
NM_017522chr111027 ------
NM_017544chrX4872 678 663 173 --1370 --
NM_017545chr201403 1107 1174 --
NM_017548chr352151 523 289 223 114 22198 1467 ----
NM_017553chr1541313 416 267 243 ------
NM_017558chr164432 174 167 101 ------
NM_017582chr141704 1584 1406 192 ------
NM_017594chr9103055 2528 2464 2318 2061 1333 1229 1021 917 907 11162 21201 547 --
NM_017599chr1241897 1562 538 462 11454 21973 1412 --
NM_017610chr152649 487 21376 550 1805 --
NM_017617chr91371 --11295 --
NM_017628chr4135287 3895 3810 3722 2062 1778 1668 1498 1463 1113 1010 1002 877 --11399 21929 1361
NM_017629chr141951 1765 248 59 ----11341
NM_017632chr4----1318 --
NM_017633chr663115 2660 2446 1158 1118 188 --13362 --
NM_017635chr1151310 1000 581 160 154 11343 11602 --
NM_017637chr9138414 7885 7394 7122 6410 5911 5835 3474 2787 2600 2226 1108 501 17405 68234 8203 6711 6365 2459 1552 17441
NM_017643chr1742409 1981 1032 957 --2742 188 --
NM_017644chr3144591 4508 4454 3731 3461 3267 1793 1352 1313 1007 800 775 750 155 --35028 4521 1198 --
NM_017650chr7115919 4748 4323 3877 3825 3803 2253 2143 1988 1772 1025 --41155 517 510 176 --
NM_017658chr1483936 3150 1627 1601 1465 1308 1198 904 13177 ----
NM_017661chr1561240 1216 1196 339 276 71 ------
NM_017664chr131260 ----1877
NM_017666chrX71941 1668 1416 713 455 429 205 --31856 1527 343 --
NM_017691chr151404 ------
NM_017693chr132361 217 2309 262 --11080
NM_017694chr231870 752 234 1772 ----
NM_017709chr163620 1714 1121 514 420 55 22977 1515 12985 --
NM_017716chr112246 62 1286 ----
NM_017719chr32757 586 --11932 --
NM_017737chr142082 1947 1380 761 --12165 --
NM_017738chr9--1117 ----
NM_017742chr1811512 126 ----
NM_017745chrX----1226 --
NM_017747chr51282 1416 ----
NM_017752chrX101818 1619 1564 1475 1455 846 770 510 252 233 ------
NM_017761chr131514 995 198 ------
NM_017768chr13647 326 88 ----1637
NM_017769chr1473111 3105 2387 723 394 388 263 1250 32443 2043 651 --
NM_017770chr652911 2525 2293 2230 1938 --12071 --
NM_017779chr14930 460 446 331 --1182 --
NM_017784chr331193 1094 849 ------
NM_017787chr1052444 2371 2136 1803 83 12057 22846 421 --
NM_017789chr22281 267 ------
NM_017798chr202789 305 11260 ----
NM_017801chr372445 2142 2029 1770 1655 892 224 22360 1708 ----
NM_017811chr972961 2529 2522 1172 634 363 40 21037 354 1153 --
NM_017813chr835572 2159 196 --45152 1883 1277 1117 --
NM_017824chr1072647 2550 2526 2243 2198 786 380 --32333 2214 1718 32720 2155 630
NM_017830chr42281 33 ------
NM_017831chr1874104 3488 1727 1003 953 906 818 1945 --11530
NM_017832chr941174 1013 904 443 ------
NM_017848chrX73848 1721 1318 1168 1126 713 243 14672 ----
NM_017860chr13600 318 39 --158 --
NM_017867chr4134 ------
NM_017880chr24443 306 142 34 --1134 --
NM_017896chr2063561 1367 1350 963 761 720 --13530 13105
NM_017902chr10125637 4415 4064 4020 1844 1829 1685 1427 1302 428 406 107 25758 1353 25505 5314 14184
NM_017919chr9145580 5438 5041 4869 4498 4269 4106 1927 1600 1297 1245 906 650 372 15561 35431 3553 3523 --
NM_017922chr14121 ------
NM_017925chr941702 1407 687 217 --1400 --
NM_017933chr221088 76 --21345 1206 --
NM_017938chrX52193 1897 1811 1705 1649 ------
NM_017944chr1161209 1084 951 888 875 151 1374 --12250
NM_017946chr721052 39 11040 ----
NM_017954chr741117 659 644 495 ----11719
NM_017955chr1441217 860 440 380 ------
NM_017974chr211318 ------
NM_017978chr5189 ------
NM_017987chr1062098 1905 1777 459 196 183 --1357 --
NM_017988chr125940 872 828 629 255 --141 --
NM_017994chr762696 2543 2380 2191 1882 133 1491 ----
NM_018010chr331420 95 75 --11475 --
NM_018018chr1241935 1870 1499 387 21189 628 2701 446 --
NM_018030chr183972 884 47 ------
NM_018048chr122786 149 12063 ----
NM_018050chr121565 --124 --
NM_018053chr15853 787 703 688 188 --1656 --
NM_018064chr61114 ------
NM_018070chr13450 242 229 ------
NM_018078chr46978 425 382 295 282 29 ------
NM_018084chr232240 576 398 --22710 2207 164
NM_018085chr1177583 6905 6027 5955 5913 4946 2616 2601 2223 1875 1433 1103 1056 936 492 206 90 ------
NM_018086chr271567 1411 711 581 515 331 230 11884 11614 --
NM_018087chr12246 172 ------
NM_018098chr341089 960 403 180 ------
NM_018105chr821221 254 ------
NM_018120chr821104 353 ------
NM_018121chr1052673 2057 1012 220 197 144 23217 551 --
NM_018122chr11293 ------
NM_018126chr461323 1096 564 477 333 98 --1463 --
NM_018131chr102780 618 138 ----
NM_018133chr341965 1393 547 420 ------
NM_018137chr131312 1259 907 --1470 --
NM_018151chr26558 537 308 159 123 88 1799 ----
NM_018155chr343248 2568 328 243 12938 ----
NM_018157chr1242615 2589 1270 656 ----126
NM_018168chr1461391 1288 1004 518 486 56 ------
NM_018169chr124439 399 148 104 ------
NM_018178chr141690 705 592 430 ----11981
NM_018182chr1741677 611 494 81 ------
NM_018184chr352002 1861 1824 296 238 22014 406 ----
NM_018195chr1171987 1911 1584 1497 1401 738 521 11966 ----
NM_018202chr14711 370 340 263 ------
NM_018211chr121870 519 --31532 398 220 12225
NM_018227chr452945 2290 1144 118 58 --12150 --
NM_018241chr42701 209 1839 1960 1768
NM_018243chr493964 3610 3318 3031 1633 1162 854 742 649 --13758 --
NM_018247chr652151 1948 993 850 580 ------
NM_018254chr162225 1800 1698 788 556 411 ----11741
NM_018257chr2072489 2481 2264 2109 1636 623 501 ------
NM_018261chr41514 ------
NM_018263chr292627 2606 2592 2512 2434 1997 565 537 133 --12548 --
NM_018286chr173852 760 380 --2929 838 --
NM_018290chr421207 298 ------
NM_018293chr392955 2644 2398 2194 2172 2021 850 607 99 12990 ----
NM_018299chr873252 2932 2195 1138 726 650 403 --13081 11336
NM_018300chr191184 2620 121 ----
NM_018302chr492420 2400 2188 2008 1564 876 850 714 351 12164 1907 --
NM_018307chr171962 --1698 --
NM_018313chr332313 1739 523 --2726 169 --
NM_018318chr123841 820 724 --1968 --
NM_018319chr1421381 1124 --1199 --
NM_018321chr52135 55 ------
NM_018323chr451900 1455 667 468 105 11660 --11843
NM_018330chr1031616 1231 1216 ----1255
NM_018339chr931777 1561 719 ------
NM_018351chr12124009 3971 3759 3653 3502 2955 1882 1553 1302 1267 999 215 34300 3300 542 --1289
NM_018361chr873829 3561 3176 1609 1226 1204 635 12684 22536 368 --
NM_018362chr1193890 3506 2616 2601 1496 1465 1245 990 250 1576 43388 3073 1486 329 24008 697
NM_018364chr1103983 3716 3509 3210 1114 969 560 427 334 260 --33734 3329 641 --
NM_018367chr1152543 1022 921 502 291 12021 --22281 377
NM_018373chr1496258 6209 5692 5482 2401 1562 1308 1175 616 12529 --11760
NM_018374chr7124488 4171 3382 3207 1862 1626 1572 1531 1472 1203 1063 364 --159 --
NM_018383chr241439 557 535 141 --11538 11971
NM_018388chrX1543 ------
NM_018401chr451774 1618 1541 1504 621 1356 ----
NM_018403chr3114130 4088 3920 3567 2707 2594 1656 1420 335 318 133 --22719 160 1593
NM_018409chr483194 3169 2540 1316 1068 891 631 300 --1737 12737
NM_018416chr1252504 2285 1053 587 404 12004 --12638
NM_018427chr1621615 526 11709 ----
NM_018437chr92396 69 148 ----
NM_018440chr8198318 8215 8088 8014 7862 7740 7072 6833 6419 5545 5333 3285 3112 2466 1871 1684 1104 1090 878 1515 38552 7645 3034 13207
NM_018444chr852150 797 580 497 29 --11567 --
NM_018464chr102371 335 ----1445
NM_018469chr1751464 1013 992 949 111 --11523 --
NM_018482chr892242 1981 1961 1878 1736 1596 985 942 539 22250 2193 22617 386 --
NM_018489chr111844 1145 12352 --
NM_018490chr1161875 1249 700 440 161 146 11267 ----
NM_018553chr1751837 1686 218 171 152 ----1296
NM_018566chr195148 4058 3678 1847 1468 1271 1011 971 922 --34939 3605 1400 --
NM_018569chr461411 1157 652 602 393 209 --1304 11287
NM_018590chr1031584 1373 173 11400 --11341
NM_018638chr12115274 5247 4833 4688 4549 3821 1639 1560 1528 750 56 21521 598 44506 3600 3474 1898 --
NM_018640chr1232387 2238 685 22777 1000 12077 --
NM_018650chr132150 1873 122 12066 ----
NM_018657chr34736 683 577 270 ------
NM_018685chr721000 46 --1233 1392
NM_018686chr122351 272 ------
NM_018695chr542461 2140 1754 860 ------
NM_018700chr521673 1215 ----1468
NM_018703chr16128 ------
NM_018710chr841151 1004 197 121 ------
NM_018834chr53800 335 28 1365 ----
NM_018841chr142637 786 170 117 13960 33190 3088 540 12613
NM_018844chr741782 1656 671 202 22060 425 ----
NM_018846chr74619 398 166 113 ------
NM_018890chr761195 1178 450 274 259 116 11506 ----
NM_018945chr673051 1482 1325 1221 1029 582 440 ----12744
NM_018970chr732541 2271 174 --22616 1935 1361
NM_018976chr1262918 2688 2472 1068 280 27 --12868 12357
NM_018977chrX21011 953 ------
NM_018999chr1064003 929 843 758 546 328 --24410 3277 14205
NM_019000chr541204 458 349 50 11643 ----
NM_019001chr3134568 4060 4039 3935 3510 3044 2970 2954 1610 1330 1150 1057 754 23699 229 24557 3021 --
NM_019004chr74457 198 99 88 ------
NM_019005chr7------1364
NM_019008chr2262929 2600 2564 2498 2381 494 --11497 --
NM_019016chr17132 1226 ----
NM_019022chr1852669 2285 2050 1977 591 11954 --12362
NM_019027chr452502 2382 1599 338 181 1380 ----
NM_019028chr111324 1438 125 1149
NM_019035chr461951 1837 1798 1613 1431 619 --22016 417 1447
NM_019036chr64830 445 340 132 1419 ----
NM_019042chr72326 98 --1197 --
NM_019049chr13565 270 42 --1585 --
NM_019063chr272081 1673 1486 1412 798 658 157 4909 744 214 136 21985 724 --
NM_019072chr5124231 4177 3611 3505 2833 1432 822 784 697 584 277 152 1309 24150 1710 --
NM_019083chr151249 649 625 488 382 11376 ----
NM_019084chr1072601 2054 962 949 833 303 264 11982 1912 12293
NM_019087chr521489 440 --11080 --
NM_019091chr21296 --1799 --
NM_019094chr12113751 3710 2503 1451 1301 858 843 779 553 152 122 23821 654 13277 --
NM_019098chr811843 1704 21806 355 --
NM_019102chr71331 ----1409
NM_019102chr71331 ----1409
NM_019114chr93797 563 343 1698 1905 --
NM_019116chr16123655 3572 3385 3118 2725 1027 1016 701 566 293 177 121 --33546 1049 382 --
NM_019117chrX123325 3304 2740 2509 2316 2301 1202 926 878 665 345 44 1958 12499 --
NM_019555chr361829 1580 1531 1343 559 307 ------
NM_019556chrX31427 1184 113 ------
NM_019558chr21104 1321 ----
NM_019590chr1041439 510 305 113 1221 ----
NM_019593chr2063032 2882 1214 745 653 622 12799 22927 102 --
NM_019596chr2172356 1999 989 792 749 327 313 ------
NM_019605chr12485 227 --1695 --
NM_019606chr7----1519 --
NM_019610chr141892 1616 728 214 12200 --1480
NM_019617chr2------1135
NM_019842chr61391 ------
NM_019884chr191400 1587 ----
NM_019891chr121351 1012 ----1156
NM_019895chr341182 1139 468 208 1163 175 --
NM_019903chr1021449 663 11352 --1356
NM_020066chr11298 --1968 --
NM_020069chr11------2239 218
NM_020116chr431740 602 54 --1424 --
NM_020122chr2115323 4533 4429 4283 3772 1828 1784 1769 1755 1402 489 --31036 919 812 11816
NM_020132chr2184910 4398 4180 4042 3969 1653 1019 717 ------
NM_020133chr6146255 6158 6005 5278 5083 4983 4703 4274 4133 2499 2222 2094 878 150 14765 15040 --
NM_020135chr61459 ------
NM_020141chr161727 1678 1500 841 415 349 ------
NM_020143chr26982 926 874 411 291 127 1445 ----
NM_020144chr75765 698 647 459 139 178 11565 --
NM_020147chr15141 ------
NM_020157chr2041042 829 270 170 1737 ----
NM_020159chr441320 1076 590 190 11739 21623 23 --
NM_020168chr1551312 975 430 404 180 ----2988 95
NM_020177chr563296 2931 2326 982 635 392 11005 11226 22114 841
NM_020178chr1731065 1006 31 1792 1354 --
NM_020193chr113898 333 132 --1483 --
NM_020198chr1731420 198 84 ------
NM_020205chr153229 2741 1168 925 652 --1388 --
NM_020216chr11416 ------
NM_020225chr4196 --1307 --
NM_020226chr42613 561 ------
NM_020235chr31385 ------
NM_020239chr162341 1953 1702 919 540 360 22080 565 22021 686 --
NM_020245chr684816 3784 3503 3170 1644 904 524 445 15114 11499 --
NM_020297chr12103188 2580 897 746 684 518 452 321 160 94 1177 ----
NM_020309chr198936 905 440 369 260 252 202 171 --1874 --
NM_020319chr74672 286 227 139 1716 ----
NM_020337chr4103128 2853 2831 2248 2164 1953 976 847 827 137 32458 1156 486 1176 12796
NM_020341chr2031636 1464 171 1278 2620 409 --
NM_020342chr232357 2170 2061 ----12179
NM_020346chr1121530 1067 --1476 11281
NM_020348chr1092472 2124 1975 1966 1832 1787 823 739 650 12769 ----
NM_020353chr3178 --41954 576 449 183 --
NM_020357chr35635 578 521 368 192 ------
NM_020361chr84329 276 260 77 1312 ----
NM_020381chr641971 1726 747 475 ----1409
NM_020390chr3124791 3931 3836 3730 3399 3280 3137 1834 1668 1656 1608 1439 --23235 778 --
NM_020420chrY61790 1475 597 409 238 98 --11386 --
NM_020423chr1------1567
NM_020424chr165844 716 592 168 108 ------
NM_020432chr762147 2040 1652 1532 1459 99 ----11789
NM_020443chr1106999 6738 6598 6510 6303 6144 5848 5120 2731 1154 16851 34910 2466 299 17017
NM_020452chr121918 570 --12180 --
NM_020453chr451987 1421 1315 301 33 --31801 1300 633 --
NM_020455chr632847 639 541 1362 1629 22237 1945
NM_020456chr1382000 1951 1847 1524 919 636 518 97 ------
NM_020466chr684838 4180 3051 1339 1203 212 202 28 13681 --34406 3993 1126
NM_020473chrX51973 1841 1822 1685 1658 2498 136 11816 --
NM_020475chr832114 456 166 --1866 1713
NM_020476chr832114 456 166 --1866 1713
NM_020477chr832114 456 166 --1866 1713
NM_020478chr832177 519 229 --1929 1776
NM_020480chr832114 456 166 --1866 1713
NM_020482chr65796 735 708 613 63 ------
NM_020532chr22703 194 ------
NM_020640chr342073 1810 668 417 ----11984
NM_020644chr111334 ------
NM_020647chr821754 728 22199 265 11576 11854
NM_020651chr261837 1792 1669 1265 710 302 --1699 --
NM_020652chr171208 ------
NM_020653chr172445 283 --144 --
NM_020654chr341548 1291 1157 1022 11325 21525 610 --
NM_020661chr1241857 1438 689 457 --12001 --
NM_020673chr20197514 7282 7218 6402 6183 5863 5711 5253 5104 3061 2782 2705 2519 2499 2188 1697 1533 1021 359 11621 26898 5363 --
NM_020686chr1663121 2597 2581 2009 1902 396 22872 2184 1623 --
NM_020693chr111479 ------
NM_020698chr12133109 3010 2806 2772 2418 2031 750 703 528 234 173 149 32 ------
NM_020699chr155287 1798 1607 796 491 ------
NM_020717chrX94961 4530 4241 3848 3779 3722 3623 1295 80 --21980 57 13353
NM_020718chr16136114 5910 5168 4354 4303 4155 2654 1928 1364 1335 1185 571 161 11955 ----
NM_020727chr21183988 3797 3757 3529 3153 2968 2492 2452 1477 1355 1346 1288 1208 1068 496 415 403 45 11202 23331 646 --
NM_020728chr742889 2094 1131 1004 33191 1179 123 3897 842 489 --
NM_020732chr631294 1224 1040 ------
NM_020734chr1273336 3100 2784 2388 2235 695 568 --1614 --
NM_020739chr1593775 3600 1703 1431 1421 1295 1095 626 202 23939 3275 ----
NM_020742chrX42460 2088 1837 316 --1838 --
NM_020748chr1781766 1721 1714 1652 646 544 494 126 ------
NM_020752chr1042822 1161 627 459 --42512 2092 1912 817 22587 926
NM_020754chr331319 1127 464 ------
NM_020760chr231486 1281 84 --1227 11571
NM_020761chr1731886 1706 790 ------
NM_020766chrX74510 3814 3304 1715 1583 661 169 ------
NM_020771chr621414 1260 ------
NM_020772chr17157558 7366 6980 6249 5456 2906 2772 2541 2244 2153 1918 1021 902 223 204 13440 28384 8311 27994 1171
NM_020774chr18115913 5668 5307 5293 4216 3973 1714 1689 1620 672 331 --25214 2213 35597 5356 55
NM_020776chr1873074 2485 2256 1212 615 326 309 --1174 1570
NM_020779chr233154 3049 2267 --11043 --
NM_020782chr1264734 4511 3807 3320 3000 818 11802 13173 --
NM_020783chr182762 587 32331 2301 226 --12117
NM_020794chr161455 1173 1085 529 507 283 --11117 1563
NM_020801chr541819 833 421 335 --12442 --
NM_020805chr1851664 1272 693 473 281 --11222 --
NM_020806chr144833 256 187 137 ------
NM_020808chr1187 ------
NM_020809chr1132254 1852 766 --22018 886 1850
NM_020819chr6152 ------
NM_020825chr1683400 3100 2704 2462 906 899 634 303 ------
NM_020830chr262988 2371 1999 879 550 344 --12296 --
NM_020839chr35597 378 353 310 252 --1138 --
NM_020841chr1242716 1552 810 530 1491 13351 --
NM_020843chr152428 415 ------
NM_020844chr8157447 6977 6602 5896 5824 5632 5359 5014 4801 4733 2560 2376 1583 940 407 14881 32318 2223 634 --
NM_020858chr1552156 2018 494 449 341 ------
NM_020859chr463792 2515 1426 852 594 43 --13755 11081
NM_020866chr134964 875 857 362 11052 ----
NM_020868chr241773 1720 1589 44 ------
NM_020871chrX62021 846 616 454 63 54 1202 1305 --
NM_020872chr361666 1271 1200 1179 252 92 1186 21763 610 11188
NM_020873chr31141 2313 286 ----
NM_020917chr1931478 1066 80 12444 22782 593 13388
NM_020918chr101782 ----1267
NM_020921chr14133408 3333 3141 2615 2594 2555 2474 2262 856 699 648 637 69 --23440 2870 --
NM_020922chrX61843 1628 1602 1427 1279 1198 ------
NM_020925chr13574 564 517 --11069 --
NM_020940chr1062651 2150 956 836 741 65 22227 1851 11832 --
NM_020948chr183469 3369 2657 2563 1258 1029 751 123 1423 23655 2330 1727
NM_020977chr431618 1458 1425 1214 ----
NM_020987chr101297 --1959 --
NM_020988chr1621159 1125 11350 ----
NM_020993chr1282873 2755 1917 1800 1109 1006 165 116 --11764 --
NM_021003chr143714 544 217 --1674 --
NM_021005chr152155 68 ------
NM_021007chr221789 1777 1181 22351 1761 11807
NM_021009chr12122 ----150
NM_021032chr351703 1358 1268 711 680 21749 404 ----
NM_021033chr1393488 3293 3046 2879 1033 620 572 558 207 --13459 --
NM_021038chr373411 3094 2811 2691 2230 807 436 ----1865
NM_021045chr1052615 969 471 127 47 12044 ----
NM_021061chr8124041 3867 3760 3539 3525 3461 1653 1502 1243 855 753 454 33773 3622 3421 11090 --
NM_021063chr6------168
NM_021064chr641537 1467 286 274 ------
NM_021069chr42645 363 11933 ----
NM_021072chr562092 1884 855 726 698 356 --1527 --
NM_021076chr221401 --1547 --
NM_021083chrX83212 2977 2961 2320 2300 1336 1182 930 12493 23657 2745 --
NM_021090chr2295043 4825 4100 3536 3448 3064 3053 1540 1246 --21609 248 --
NM_021097chr232113 984 229 22041 1998 22775 939 --
NM_021116chr7128938 8656 8137 7865 7431 6520 6141 5885 5618 2811 710 662 16685 19038 --
NM_021132chr1041077 541 436 360 --1349 --
NM_021136chr141695 ------
NM_021140chrX1753 ------
NM_021144chr9------1474
NM_021145chr751185 872 404 373 94 ------
NM_021151chr751102 1086 1066 832 388 ------
NM_021156chr2071152 966 888 757 277 111 83 ----11146
NM_021163chr773176 2756 1495 1092 763 523 405 33850 2427 1327 ----
NM_021176chr231663 1340 401 11861 11586 21520 1238
NM_021183chrX62449 2117 1866 1779 381 338 22266 368 --1986
NM_021188chr142433 44 ------
NM_021190chr141253 956 285 42 --11063 --
NM_021191chr1241842 1770 798 77 ----1815
NM_021205chr152845 2258 974 828 401 --1136 --
NM_021215chr2052367 2354 2321 1550 282 --12129 12053
NM_021224chr92429 139 --121 --
NM_021238chr1241592 1547 1442 293 1687 11690 --
NM_021252chr1052102 2002 636 624 247 ------
NM_021255chr1473881 3779 3368 3277 2842 1581 789 23334 2993 21615 1369 --
NM_021622chr1031942 1512 42 22260 400 12154 1224
NM_021627chr32932 917 ------
NM_021633chr121412 1231 ------
NM_021638chr454518 4459 3568 835 659 --24850 4088 --
NM_021643chr241912 1235 1175 114 --1564 --
NM_021647chr464608 4488 4062 3953 3597 280 11226 1436 11613
NM_021648chr662698 2179 1710 955 492 228 --12248 12535
NM_021738chr102783 625 1673 2808 107 --
NM_021813chr6135796 5569 5043 4198 4086 4053 1301 890 634 369 347 257 167 --35379 641 321 --
NM_021814chr61472 11637 --11616
NM_021818chr1421350 213 ------
NM_021908chr71290 ----1907
NM_021911chr5114861 4645 4501 3980 3783 3733 1479 1370 1291 1124 1056 25140 4440 44495 4238 4131 1107 15380
NM_021912chr1583623 3444 3264 2979 1164 911 151 22 --1839 13014
NM_021913chr1951596 1380 1309 312 30 ------
NM_021940chr631340 1328 159 --1644 1289
NM_021942chr42945 767 1847 --1212
NM_021956chr631345 1130 281 1494 ----
NM_021960chr172617 2255 2125 1797 664 658 303 2630 464 --11040
NM_021961chr11117072 7051 6848 6153 6113 6039 5627 2581 1760 1430 1274 --24624 1307 36659 5852 1368
NM_021963chrX4636 234 177 112 ------
NM_021964chr3145794 4972 4391 4331 4317 2659 2509 2322 1973 1918 1362 1297 956 882 14361 25073 1616 24274 1669
NM_021965chr911400 --1909 --
NM_021967chr541268 1022 253 43 ----11204
NM_021973chr41677 1643 ----
NM_021977chr653800 3215 2502 2395 135 11131 23724 3269 --
NM_021994chr751198 761 264 153 134 1728 1362 --
NM_021998chrX51372 1299 230 137 88 11139 --1988
NM_021999chr133711 315 145 ------
NM_022048chr15176150 6062 5943 5717 5518 5474 5294 5082 4925 4878 4756 4289 4135 4094 2382 1010 46 --32301 1575 900 --
NM_022058chr23522 106 99 ----1811
NM_022073chr1451656 1594 1434 1038 59 21633 1194 1477 --
NM_022079chr105861 802 340 329 123 ------
NM_022085chr631407 1066 449 1468 1578 1981
NM_022114chr131405 1369 900 ------
NM_022118chr131403 ------
NM_022123chr142600 593 ------
NM_022129chr1051347 1338 1289 995 106 11204 11142 --
NM_022130chr52287 35 1523 ----
NM_022133chr831515 1422 264 --11748 --
NM_022138chr631204 601 274 ------
NM_022144chrX163 ------
NM_022160chr93448 146 122 ------
NM_022166chr16146103 5826 5586 5411 5379 4827 4592 4018 2266 2252 2231 688 211 37 ------
NM_022334chr28843 798 742 406 350 294 234 52 --1187 --
NM_022351chr8123490 2837 2730 2711 1294 1264 965 837 611 188 182 137 --11344 1209
NM_022373chr72923 72 --2826 258 1818
NM_022454chr81794 --2639 348 --
NM_022456chr12137559 7240 6874 6502 6242 5699 5687 5605 4894 1986 1828 477 353 15442 66723 6065 6003 4789 2548 2064 --
NM_022459chr13136240 5744 5713 5561 5123 2532 1927 897 584 400 252 89 22 26370 3987 35865 1684 1281 --
NM_022461chr321209 303 11203 --1529
NM_022462chr1973700 3184 1276 1100 249 206 200 ----1272
NM_022470chr34990 965 476 106 ------
NM_022474chr14112850 2538 2180 1963 1891 1863 757 747 598 383 250 12726 ----
NM_022475chr41621 --1604 --
NM_022476chr162940 898 1339 1449 1748
NM_022482chr2072097 1900 724 653 436 250 207 --21878 323 --
NM_022491chr1273461 3281 3159 2778 2263 1302 539 22205 77 ----
NM_022495chr143590 542 469 --1159 --
NM_022552chr21873 --1210 --
NM_022576chr13336 275 262 ------
NM_022652chr122406 391 ------
NM_022659chr82535 479 1340 ----
NM_022716chr163000 2884 2670 2152 772 271 13072 22809 2120 13195
NM_022726chr651679 1475 1466 1295 1222 --11090 --
NM_022728chr72566 129 --1654 --
NM_022730chr211065 ------
NM_022735chr171882 1470 1458 1279 1230 608 510 ------
NM_022739chr176866 840 373 364 182 73 1244 ----
NM_022753chr132482 2327 386 --12737 --
NM_022763chr343030 1259 1023 536 ----11016
NM_022771chr124960 761 747 52 1220 ----
NM_022776chr341497 1297 348 231 ------
NM_022780chr241682 1351 268 249 ------
NM_022781chr983121 2917 2836 2696 1164 236 143 74 12195 1912 --
NM_022782chr12--1398 ----
NM_022818chr1631462 234 157 ------
NM_022826chr231150 1121 777 1946 1832 --
NM_022828chr531116 407 68 11614 ----
NM_022838chrX--185 ----
NM_022840chr1821395 59 --1305 --
NM_022841chr1542781 968 170 164 --22147 62 --
NM_022842chr362945 2720 2501 2186 1064 152 12133 13237 --
NM_022843chr1311535 --11215 --
NM_022875chr52416 406 --1362 --
NM_022877chr52416 406 --1362 --
NM_022893chr232999 2330 788 ------
NM_022894chr221288 1172 --21129 287 11142
NM_022898chr1454825 4748 1587 1086 651 ----14679
NM_022899chr341537 1432 1344 250 11268 1582 --
NM_022918chr1161615 1422 1381 1367 865 625 1184 ----
NM_022970chr102983 970 --1549 --
NM_022977chrX42669 2103 1869 52 1500 ----
NM_022978chr541268 1022 253 43 ----11204
NM_023016chr272439 2303 2210 1950 1129 1034 396 ----2795 44
NM_023037chr1341123 1002 982 395 ------
NM_023076chr1642879 2827 378 221 12093 ----
NM_023923chr173547 3443 3287 2807 2657 1448 982 11470 --21115 223
NM_023929chr852726 2571 912 500 233 --32101 1802 591 --
NM_024007chr573152 3071 2041 1239 826 649 298 ----1584
NM_024052chr1762998 2680 749 558 376 217 1728 22815 2448 --
NM_024061chr7192 1562 ----
NM_024077chr92642 513 --1706 --
NM_024090chr441589 1551 1524 617 --1579 --
NM_024094chr83787 158 130 ----1901
NM_024117chr951216 916 531 356 284 ------
NM_024312chr1261628 1539 1230 1185 624 599 ------
NM_024321chr19------1113
NM_024345chr9146101 5919 5836 5619 4911 4760 4680 4611 3934 3926 1819 1514 1336 58 26139 4775 --16017
NM_024408chr193253 3065 2592 2478 1173 1129 793 653 639 13659 ----
NM_024411chr2041127 1094 526 326 --11120 --
NM_024416chr931078 351 56 --11578 --
NM_024423chr1873859 2945 2827 1086 933 423 286 --23919 322 --
NM_024424chr11160 --11262 --
NM_024425chr11160 --11262 --
NM_024426chr11160 --11262 --
NM_024511chr493125 3098 2412 2339 2306 2157 1386 945 927 1673 1534 --
NM_024520chr2190 1247 ----
NM_024524chr372740 2194 2062 1044 706 697 329 --1905 --
NM_024529chr11953 11007 ----
NM_024539chrX--11020 1363 1224
NM_024548chr33304 251 41 --21599 588 --
NM_024556chr111415 --1405 --
NM_024569chr152857 2795 2627 2279 414 --22972 2877 --
NM_024582chr44908 763 738 364 --1178 --
NM_024594chr561793 1781 722 565 312 250 ------
NM_024598chr1611333 ------
NM_024607chr884505 3811 3210 2812 1524 1229 894 153 --24125 3936 --
NM_024612chr1751133 928 805 389 319 1267 ----
NM_024615chr51221 ------
NM_024617chr94937 860 691 318 ------
NM_024631chr111121 ----1499
NM_024639chr662930 2855 2578 991 535 78 --11956 --
NM_024646chr173301 3011 2719 1345 1258 895 330 --33281 1025 948 --
NM_024659chr22924 717 ----21016 948
NM_024665chr393621 3592 3097 1883 1618 1454 1359 1226 1064 --13125 --
NM_024668chr5189 ------
NM_024670chr1051189 1152 651 536 126 --21370 664 --
NM_024674chr182768 2708 1996 1292 805 787 428 114 1718 ----
NM_024680chr112519 121 --1221 --
NM_024692chr251609 1469 740 206 118 ------
NM_024713chr1561407 1388 1185 555 213 36 11267 ----
NM_024715chr551680 1324 619 351 37 1209 ----
NM_024721chr862538 2387 419 366 287 272 ------
NM_024744chr252527 2096 1962 323 245 --21988 1677 12128
NM_024749chr162123 1633 723 694 483 246 --21429 685 --
NM_024761chr9114624 4600 4530 3971 3911 3854 3596 3382 3374 2081 171 --13951 --
NM_024770chr2136308 6298 6094 5025 4846 4240 2692 2668 1874 1762 1481 277 75 --45573 5142 4543 1642 --
NM_024779chr1221200 987 ------
NM_024780chr162881 205 ------
NM_024792chr1731191 276 263 --11231 --
NM_024806chr111219 ------
NM_024814chr71135 ----1394
NM_024817chr15105419 5024 4782 4631 4181 3986 2033 893 507 302 --25287 4947 --
NM_024824chr1451211 1117 560 500 159 --11670 --
NM_024828chr951459 1379 1043 373 275 ------
NM_024830chr511779 --32190 1598 788 --
NM_024835chr171106 --276 27 --
NM_024837chr1531715 1581 1212 --41860 1539 760 688 --
NM_024841chr1162105 2056 1784 1512 733 721 12447 ----
NM_024857chr171299 1326 197 --
NM_024884chr14104420 4201 3908 1825 1678 1492 1140 595 334 204 1489 11546 13099
NM_024909chr61131 1313 21639 1585 --
NM_024913chr711402 11229 ----
NM_024920chr421483 507 ------
NM_024921chrX41959 1871 734 697 --11759 11345
NM_024930chr582521 2319 2048 1875 1782 714 653 94 --1577 --
NM_024939chr1641585 1474 385 117 --11184 --
NM_024941chr531480 1285 582 --11329 --
NM_024944chr2121254 1232 ----1472
NM_024945chr931154 889 410 ------
NM_024947chr3208823 8606 8513 8473 8418 8122 7632 7517 7366 6295 6046 3573 2579 2519 2454 2397 1660 1095 374 265 38148 6934 6635 45837 2599 670 636 16955
NM_024948chr10------133
NM_024949chr4135023 4957 4177 3729 3652 3470 3145 1470 1423 1271 1254 634 151 11344 ----
NM_024953chr1242641 811 677 498 --22689 2077 --
NM_024956chr152523 195 ------
NM_024960chr202492 79 ------
NM_024963chr775951 5293 4871 4122 2190 883 850 --130 --
NM_024979chr132478 431 ------
NM_024989chr2147686 6955 6843 6141 6015 2394 2138 1959 1576 1474 1316 816 671 481 17762 37510 7504 1543 --
NM_024993chr251313 1143 384 138 121 11489 ----
NM_025054chr873568 3371 3352 3290 1485 1178 467 14219 33427 3303 295 --
NM_025065chr1185 ------
NM_025090chr1721421 1141 31515 1331 1188 ----
NM_025107chr662018 1952 1920 710 245 192 ----11787
NM_025109chr171468 ------
NM_025114chr121164 ----1140
NM_025133chr22801 191 31097 1078 343 ----
NM_025134chr16102507 2178 2134 1906 1870 908 839 804 717 170 1283 ----
NM_025135chr182499 125 ------
NM_025146chr372642 1735 1680 991 360 302 163 ------
NM_025147chr211121 ------
NM_025152chr1452015 1988 1320 1250 503 ----1456
NM_025154chr721478 245 1116 ----
NM_025160chr164328 4222 3801 3707 1017 761 21184 285 21231 1173 23494 597
NM_025179chr194529 4251 4199 4154 4051 3280 1766 217 63 11324 1915 --
NM_025181chr23789 738 270 ------
NM_025191chr173045 2897 2703 2546 1324 1245 604 22285 733 1654 12262
NM_025195chr821323 33 ------
NM_025208chr1192285 1835 1699 1677 858 743 472 354 139 ----12047
NM_025212chr4124 ------
NM_025221chr421436 1416 ------
NM_025222chr363050 2532 2416 310 299 213 --12024 --
NM_025235chr1041974 1852 1462 778 ----12261
NM_030579chr1673278 3168 1349 1289 720 361 177 23623 2830 ----
NM_030621chr1422930 1365 --23123 1474 --
NM_030623chr251506 522 383 257 87 ------
NM_030625chr10102568 2448 2293 1066 960 538 281 159 108 51 --122 22283 986
NM_030627chr554010 3412 3028 2879 735 ------
NM_030629chr1611501 --11615 11337
NM_030647chr7125737 5438 5057 5003 4798 4785 4075 1949 1720 848 550 524 12375 11239 14531
NM_030648chr4114721 4699 4578 4258 4017 3727 2235 2040 1623 1381 1119 15384 ----
NM_030650chr273917 3731 2983 2858 2669 1467 149 --43854 2742 1198 604 1542
NM_030664chr1031966 708 433 ------
NM_030674chr12125430 5163 4781 4352 3799 3763 3699 3615 1336 675 225 41 --35133 4492 1275 --
NM_030751chr103402 292 246 153 ----
NM_030751chr103402 292 246 153 ----
NM_030755chr1492816 2615 2139 1903 1032 764 698 446 281 1981 11068 22928 24
NM_030759chr101291 ------
NM_030762chr1261903 1852 1615 606 490 340 --12009 --
NM_030773chr2031813 1283 282 11784 11142 --
NM_030786chr141943 1403 696 545 --1243 --
NM_030799chr582232 1672 1554 1425 761 676 355 62 11834 11781 --
NM_030803chr211318 ------
NM_030806chr175978 5868 3686 2078 1575 1252 801 11493 58660 8512 3695 647 158 --
NM_030809chr1281968 1904 1866 1796 997 668 556 69 --22418 2101 --
NM_030810chr631407 1066 449 1468 1578 1981
NM_030816chr163581 3365 1321 1002 844 402 22343 537 ----
NM_030881chr2271763 1663 1570 964 759 527 36 ------
NM_030885chr361889 1687 763 728 709 391 --12105 --
NM_030917chr41194 ------
NM_030920chr131300 822 249 ------
NM_030925chr1372118 1949 606 552 546 349 307 21941 1801 ----
NM_030933chr1198 --186 --
NM_030934chr161718 1625 1567 766 756 24 1267 31482 342 88 --
NM_030938chr1741031 779 283 197 ------
NM_030962chr1141627 1310 1153 491 ----11246
NM_030963chr61460 ------
NM_030978chr91146 ------
NM_031216chr1842122 1383 883 401 --21778 895 --
NM_031217chr115457 194 107 69 48 ------
NM_031244chr611104 ------
NM_031262chr91727 ------
NM_031263chr91784 ------
NM_031292chr1231504 1197 67 ----11762
NM_031296chr442425 2138 302 86 22768 1726 32608 1991 1001 22419 386
NM_031305chr471501 1475 731 637 339 268 237 ----11725
NM_031362chr272681 2548 1901 1104 498 131 90 1852 31119 1067 57 --
NM_031365chr262817 2684 2037 634 267 226 1988 1193 --
NM_031366chr262817 2684 2037 634 267 226 1988 1193 --
NM_031369chr41547 1642 1215 --
NM_031370chr41547 1642 1215 --
NM_031371chr121447 33 --11329 --
NM_031371chr121447 33 --11329 --
NM_031407chrX2495 457 --1415 --
NM_031418chr1162556 2497 2471 1054 257 245 12825 ----
NM_031419chr32342 265 --1247 --
NM_031427chr14115976 4604 4412 3746 3665 2251 2025 995 955 564 109 --42225 1877 691 252 --
NM_031435chr1213254 12160 --13339
NM_031438chr521871 136 --1152 1639
NM_031442chrX62969 2549 2354 2225 324 117 ----22424 1260
NM_031444chr2292260 2198 2171 2143 1929 1820 1645 1582 642 ----12547
NM_031445chr293095 3044 2833 2606 2360 2089 1197 892 212 2640 225 1676 --
NM_031453chr1042492 2361 1919 588 12255 163 12605
NM_031469chr683761 3714 3474 3458 3220 2937 2915 1295 12704 33051 938 280 --
NM_031479chr1221090 788 --1812 1902
NM_031483chr2033026 2580 2513 ------
NM_031844chr163603 3512 3326 2823 2776 563 --1940 --
NM_031845chr283617 3431 3225 2882 2601 2284 516 227 --23648 2689 --
NM_031847chr283617 3431 3225 2882 2601 2284 516 227 --23648 2689 --
NM_031889chr4101945 1678 1538 1456 1195 772 348 318 135 88 1467 ----
NM_031914chr144865 729 714 96 1980 1152 --
NM_031938chr113878 833 804 ------
NM_031957chr17191 --123 1581
NM_031989chr121331 ------
NM_032012chr995138 4581 4339 3724 3494 1741 978 797 441 ------
NM_032042chr572783 2597 2424 1944 549 419 394 --21149 809 --
NM_032047chr362040 811 629 510 373 197 1832 --11520
NM_032102chr1172978 2295 1948 1258 1125 1021 63 23036 1152 ----
NM_032116chr13115152 4424 4230 3790 3751 2196 2177 1235 978 941 874 --34681 1890 1408 --
NM_032121chrX62410 1865 1761 891 215 113 ----1954
NM_032132chr11159 1443 ----
NM_032145chr651550 1233 305 290 181 11924 11530 --
NM_032146chr31441 --135 --
NM_032147chr1221021 837 --1257 1362
NM_032160chr1863006 1645 1621 1551 1301 412 13941 23828 1748 21377 856
NM_032195chr211126 ----1349
NM_032199chr10113770 3214 3173 3124 2716 2664 2472 1394 548 443 367 1471 ----
NM_032208chr273680 3558 2490 2479 1430 281 31 ------
NM_032217chr431305 1022 988 --21107 1065 2965 434
NM_032226chr93783 710 287 --1167 --
NM_032229chr1321149 859 ------
NM_032246chr151374 1327 ----
NM_032250chr93628 590 314 1251 ----
NM_032268chr1642961 1218 403 30 ----12992
NM_032281chr1912971 ------
NM_032291chr141278 795 654 501 --21712 1331 --
NM_032299chr11----135 --
NM_032312chr21693 ----1629
NM_032320chr112715 673 ------
NM_032321chr253209 3109 2451 829 758 12968 13203 --
NM_032329chr264299 4092 3432 2942 1393 211 14123 ----
NM_032352chr14--31061 90 82 ----
NM_032358chr12------1705
NM_032373chr10104915 4695 4201 2045 1533 1329 1003 994 352 232 14813 --25568 1600
NM_032408chr711268 --1957 --
NM_032410chr81236 --1443 1998
NM_032412chr5------1360
NM_032434chr251630 1405 1321 255 120 ----1542
NM_032435chr192263 2151 2110 1920 1686 1495 532 144 96 22437 1696 2959 450 --
NM_032437chr11111 ------
NM_032438chr6--11202 21681 419 1384
NM_032439chr1041560 1413 1057 532 --1201 --
NM_032440chr1062971 2676 2294 1973 1169 339 21998 1061 ----
NM_032445chr1582630 2465 2440 1908 946 506 491 186 11828 12327 --
NM_032449chr172757 2709 2371 2304 2278 1976 1839 1161 12851 --
NM_032457chr463188 3095 2843 1482 693 630 --13472 1721
NM_032458chrX83379 3186 3177 3043 3004 2717 2650 1147 23442 265 ----
NM_032471chr62843 334 ------
NM_032499chr1521314 602 --1354 --
NM_032505chr372678 905 789 735 658 564 503 ----1469
NM_032507chr61262 ------
NM_032509chr882475 2201 1824 1772 547 477 369 67 ------
NM_032521chr2093016 2992 2898 2795 2776 2309 832 569 436 --11082 --
NM_032569chr161377 ----11709
NM_032578chr1021151 166 11227 11406 --
NM_032581chr72779 115 11807 ----
NM_032582chr1771722 1627 1513 1490 668 507 289 --1530 --
NM_032622chr451382 1159 1097 1052 535 1255 --11000
NM_032632chr1441996 1489 762 229 ------
NM_032682chr383498 2905 2770 2719 2656 1437 843 271 ------
NM_032689chr191154 11648 ----
NM_032717chr42942 895 ------
NM_032747chr10292 29 ------
NM_032765chr52905 864 1739 ----
NM_032784chr63934 339 45 --1903 --
NM_032802chr15199 ------
NM_032804chr1032259 2210 1030 12272 12170 --
NM_032810chr1041160 574 285 107 ------
NM_032813chr1331100 847 363 --11087 --
NM_032833chr182355 2087 1952 1852 944 913 800 314 --1479 --
NM_032837chr1751757 1725 379 187 60 1394 11652 1504
NM_032842chr741640 1481 680 296 ------
NM_032846chr1431178 234 59 ------
NM_032858chr11116 ------
NM_032859chr1353615 3113 2493 1520 369 11330 11534 23554 3468
NM_032866chr1552796 2747 2606 2221 137 22351 368 1165 13206
NM_032867chr113654 563 243 2636 607 ----
NM_032869chr881891 1818 1722 761 710 636 522 84 ------
NM_032870chr64519 458 128 98 1430 ----
NM_032871chr1151975 1585 1446 1418 757 ----21488 574
NM_032873chr1143548 1467 759 142 14095 24584 3402 --
NM_032876chr1461986 1772 1709 1437 1369 861 --11658 --
NM_032884chr11325 ------
NM_032892chr151227 ------
NM_032900chr1043818 834 787 299 1580 1715 --
NM_032905chr102296 286 ------
NM_032906chr4------150
NM_032918chr123375 343 62 ------
NM_032924chr75830 429 95 71 42 ------
NM_032949chr133505 498 404 ------
NM_032967chrX4874 855 130 61 --147 --
NM_032968chrX83699 3450 3369 3079 2933 1455 1396 1158 1998 13408 1640
NM_032969chrX83699 3450 3369 3079 2933 1455 1396 1158 1998 13408 1640
NM_032971chrY3882 157 88 --174 --
NM_032972chrY3882 157 88 --174 --
NM_032973chrY73691 3446 3364 3074 2928 1396 1158 1998 13404 1640
NM_032975chr1861243 884 759 262 234 31 32231 1427 581 ----
NM_032978chr185999 891 309 284 265 --1115 --
NM_032979chr185999 891 309 284 265 --1115 --
NM_032980chr1861243 884 759 262 234 31 32231 1427 581 ----
NM_032981chr185999 891 309 284 265 --1115 --
NM_032998chr11380 --11106 --
NM_033012chr132957 811 1128 ----
NM_033014chr931078 351 56 --11578 --
NM_033020chr1104866 4580 4275 3591 3049 1763 1158 817 665 221 14570 54497 4294 3540 3520 1885 --
NM_033030chr241602 1436 1253 139 --11456 --
NM_033048chrX--1441 --1147
NM_033055chr141108 1063 358 109 ------
NM_033056chr103553 541 110 ------
NM_033083chr353417 3343 2821 2300 209 12885 ----
NM_033105chr81485 1465 139 1160
NM_033127chr13523 188 163 --164 --
NM_033128chr71574 ------
NM_033132chr1352031 2020 902 459 211 2742 668 22139 1887 --
NM_033135chr1192285 1835 1699 1677 858 743 472 354 139 ----12047
NM_033138chr731548 685 47 --21578 882 1124
NM_033139chr731548 685 47 --21578 882 1124
NM_033140chr731548 685 47 --21578 882 1124
NM_033143chr4134419 4118 3899 3865 3351 1867 1688 1617 1579 1459 763 300 25 --34585 2874 469 23726 3320
NM_033157chr731548 685 47 --21578 882 1124
NM_033181chr663618 3510 2633 2457 887 110 1605 33885 909 249 11498
NM_033211chr511932 22093 580 11493 1680
NM_033224chr7247425 6811 6659 6320 6293 5571 5558 5453 5447 5353 2883 2442 2358 2291 1781 1652 1472 1450 1412 795 775 605 280 263 26246 5922 27027 1151 12162
NM_033225chr831220 875 298 11005 1342 --
NM_033227chr5------183
NM_033285chr8104185 4084 3696 3234 3199 2831 2770 1623 397 368 --24476 4174 11669
NM_033290chrX73711 3224 3212 3046 2649 708 447 11086 11435 13144
NM_033300chr111027 ------
NM_033305chr961303 1217 456 415 297 99 11113 --11440
NM_033306chr11135 ----195
NM_033326chr1182307 2247 2219 937 922 648 607 271 --2993 120 1592
NM_033331chr973238 3168 2982 1198 484 251 213 --1993 --
NM_033338chr1051359 1249 1046 521 224 1272 ----
NM_033339chr1051359 1249 1046 521 224 1272 ----
NM_033340chr1041475 1365 1162 340 1388 133 --
NM_033360chr1251728 1499 1463 1316 145 --14360 --
NM_033379chr101132 ------
NM_033380chrX31115 805 324 ------
NM_033381chrX31115 805 324 ------
NM_033389chr1764860 4756 4314 3864 1507 489 --34267 3368 348 --
NM_033394chr2----1992 --
NM_033407chr11544 ------
NM_033419chr17195 11663 ----
NM_033425chr1183372 3000 2634 2178 1363 981 656 395 ------
NM_033427chr72237 135 2760 212 ----
NM_033429chr1552965 2364 2231 593 237 23152 2613 ----
NM_033430chr461499 1342 1175 862 400 373 11285 23767 2904 13889
NM_033437chr461499 1342 1175 862 400 373 11285 23767 2904 13889
NM_033480chr682817 2790 1970 1913 1138 915 538 326 1301 1391 --
NM_033481chr682817 2790 1970 1913 1138 915 538 326 1301 1391 --
NM_033505chr286647 5842 5493 5291 4906 4649 1297 543 --16241 1107
NM_033637chr1094035 3897 3621 3320 2725 2615 1339 1100 855 ------
NM_033644chr531860 463 275 32419 1963 1558 --12559
NM_033645chr531860 463 275 32419 1963 1558 --12559
NM_033656chr21145870 5690 5223 5161 4830 4796 4318 4102 3706 2279 1947 1921 1772 622 ------
NM_052818chr1312061 31710 1637 637 ----
NM_052832chr822865 2076 --22959 1102 --
NM_052834chr1852278 1634 553 378 157 12522 12508 --
NM_052840chr152571 317 ----11082
NM_052862chr131451 1375 459 --21255 565 --
NM_052875chr1162007 1897 1847 1479 536 95 --22109 2093 11387
NM_052876chr1941693 992 791 429 ------
NM_052879chr1284078 3917 3678 3181 1176 1130 935 777 13300 23017 1351 --
NM_052885chr1284905 4776 4663 3456 1365 1094 449 232 14734 11433 --
NM_052886chr852001 1546 834 390 349 ------
NM_052897chr121571 --1885 --
NM_052898chr821863 737 2757 228 11394 11500
NM_052900chr821556 1386 ------
NM_052901chr931795 1149 102 21667 1417 ----
NM_052904chr671397 957 910 389 365 306 72 31253 460 199 1181 --
NM_052905chr241727 549 163 111 ----1736
NM_052911chr181791 --1316 1343
NM_052917chr272471 2363 1159 913 798 792 626 11044 32957 2396 58 12648
NM_052918chr1042932 2700 2361 1286 --23711 1054 --
NM_052923chr6----1175 --
NM_052927chr552196 1984 1532 736 165 12097 22138 810 --
NM_052932chr1152253 2233 2131 986 583 --2679 447 1917
NM_052937chr81238 1700 ----
NM_052940chr11206 ----1189
NM_052965chr12182 80 --21322 500 --
NM_052997chr101272 ------
NM_053001chr81396 ------
NM_053016chr9157656 7254 7123 7061 6869 2249 2042 1957 1757 1668 1470 1343 1207 836 268 11724 57727 5084 2144 1193 904 14995
NM_053023chr1163255 3125 2644 2576 2162 255 --2674 643 --
NM_053042chr4102997 2857 2715 2424 2381 1272 1235 671 612 495 --12658 --
NM_053043chr7145757 5583 5542 4724 4454 4235 3965 1857 1459 1374 618 470 442 268 34492 2363 1929 --15194
NM_053064chr1473001 2485 2455 2407 2180 1224 1146 32888 2625 962 12689 1879
NM_053281chrX1281 ------
NM_054114chr62790 131 --1634 --
NM_057169chr1262918 2867 1102 625 168 55 1136 22611 580 --
NM_057170chr1262918 2867 1102 625 168 55 1136 22611 580 --
NM_057175chr492648 2372 2117 1887 1855 1844 1064 381 204 1604 21761 696 --
NM_057178chr1772763 2600 2087 1919 900 858 623 22688 2267 --12848
NM_058170chr141591 1183 188 140 ------
NM_058172chr451660 1187 217 115 62 --21649 125 --
NM_058237chr142919 178 --1859 --
NM_058241chr211511 2235 115 1422 --
NM_058241chr211511 2235 115 1422 --
NM_078469chr1041381 313 256 190 ------
NM_078470chr1082366 2319 2218 1982 669 535 389 357 --22309 2195 --
NM_078483chr553274 3218 3204 2847 662 --23353 2908 24101 481
NM_078626chr12357 287 ------
NM_080546chr932199 1555 265 11524 1281 --
NM_080597chr183972 884 47 ------
NM_080617chr203925 740 384 ------
NM_080626chr122318 47 ----195
NM_080629chr151393 1111 1067 601 247 1947 ----
NM_080630chr151393 1111 1067 601 247 1947 ----
NM_080645chr641651 698 621 287 --11743 12203
NM_080676chr2043082 2120 1326 1072 22955 2374 ----
NM_080717chr122507 214 --2458 449 --
NM_080759chr1352659 2248 994 696 527 --12609 --
NM_080760chr1352659 2248 994 696 527 --12609 --
NM_080764chr2292908 2846 2803 2553 2391 2052 1245 515 35 ------
NM_080792chr2021408 878 --11802 --
NM_080862chr341284 1001 133 125 ------
NM_080867chr14105100 4549 4396 4340 3778 1690 1682 748 292 267 33350 1081 1065 11708 13332
NM_080872chr893634 3575 3472 2961 2860 2665 2516 2487 585 13842 1996 11054
NM_080927chr352143 1062 788 540 211 13261 ----
NM_080928chr73671 312 85 --1760 --
NM_130385chr11102527 2196 2101 1062 903 877 820 609 572 425 ----22062 504
NM_130386chr18142 --1646 --
NM_130391chr952778 2396 1363 734 95 21221 44 11051 --
NM_130392chr952778 2396 1363 734 95 21221 44 11051 --
NM_130393chr952778 2396 1363 734 95 21221 44 11051 --
NM_130395chr61459 ------
NM_130434chr151338 ------
NM_130435chr1032807 1138 159 --42979 1107 500 249 1314
NM_130439chr1031914 1500 69 154 ----
NM_130439chr1031914 1500 69 154 ----
NM_130440chr121239 644 ------
NM_130773chr22603 43 ------
NM_130809chr592629 2604 2277 2130 1021 1000 917 458 315 ----11137
NM_130811chr2031015 415 312 --1332 --
NM_130838chr1521796 1529 --11824 --
NM_130839chr1521796 1529 --11824 --
NM_130846chr121877 --1979 11100
NM_130847chr1184990 4869 4535 4220 4170 4085 2147 576 25934 5842 21209 1105 --
NM_133170chr2087476 6951 6381 5584 3071 2057 1772 222 16899 37913 6642 5018 --
NM_133265chrX33304 1067 948 --33241 2642 298 --
NM_133329chr231829 1658 1243 --1575 --
NM_133330chr452522 2368 1101 692 419 ----1858
NM_133331chr452522 2368 1101 692 419 ----1858
NM_133334chr4135864 5794 5466 5406 5345 5041 4602 2550 2402 1681 1327 253 57 11393 22465 727 --
NM_133335chr452522 2368 1101 692 419 ----1858
NM_133367chr693294 3146 2903 1070 990 576 549 519 470 13074 12891 --
NM_133370chr473706 3676 3650 2802 1432 554 547 ------
NM_133372chr582899 2298 1869 1076 1021 999 649 484 22225 990 22686 1094 --
NM_133378chr23952 386 37 --1151 --
NM_133432chr23952 386 37 --1151 --
NM_133433chr52892 716 --1200 1322
NM_133437chr23952 386 37 --1151 --
NM_133445chr973603 2825 2376 1269 1221 171 121 --23291 27 --
NM_133473chr1961527 1497 623 392 386 316 1745 --11953
NM_133493chr6114380 3336 3012 1659 1638 1276 1099 680 511 344 237 14639 --1499
NM_133496chr184533 4292 3270 3015 2967 1212 741 596 ------
NM_133503chr123636 628 552 --1761 --
NM_133504chr123636 628 552 --1761 --
NM_133505chr123636 628 552 --1761 --
NM_133506chr123636 628 552 --1761 --
NM_133507chr124814 806 730 185 1641 1939 --
NM_133510chr141296 ------
NM_133631chr331669 494 427 --21273 639 --
NM_133638chr51914 ----11097
NM_133646chr2135252 5080 4264 4065 3620 1990 1743 1400 1311 990 929 677 392 23762 1244 55357 4987 3569 3505 67 1841
NM_133647chr15143746 3367 3234 2827 2732 2383 1229 965 756 663 390 375 238 37 13353 11264 --
NM_134265chr1731213 932 75 ------
NM_134269chr221326 ------
NM_134270chr221155 ------
NM_134442chr251430 626 339 249 215 21410 601 1678 11369
NM_134447chr191395 ------
NM_138270chrX83357 3281 2832 2449 826 597 453 236 --11268 --
NM_138286chr1973180 2802 1512 1324 872 497 166 1238 23774 1726 --
NM_138288chr1451734 1592 1443 264 189 --31890 603 310 22257 284
NM_138292chr1173490 3469 2304 620 580 523 181 ------
NM_138316chr1031190 1101 450 --11107 --
NM_138326chr2129 ------
NM_138333chr992218 1955 1920 1840 1699 959 856 607 357 --1922 --
NM_138357chr1041865 1157 641 220 --1234 1632
NM_138370chr2----1684 --
NM_138394chr2149 ------
NM_138396chr121884 ------
NM_138423chr1542176 2074 1742 1718 ------
NM_138426chr771957 1878 1534 957 802 681 132 1847 11764 --
NM_138437chrX----1245 1325
NM_138444chr1394962 3915 3788 3565 3424 3290 1488 696 425 --23485 951 13716
NM_138448chr22180 51 ------
NM_138473chr12104842 4369 3788 3440 3205 1954 1633 1047 1023 311 --25155 665 14893
NM_138494chr742389 2085 2071 1954 --1206 1534
NM_138558chr12893 777 --21114 450 1233
NM_138576chr1454825 4748 1587 1086 651 ----14679
NM_138621chr284208 3118 2777 2768 1568 1512 414 336 1325 33059 2894 2628 --
NM_138633chr631685 1457 703 --11124 11788
NM_138694chr6123707 3633 3318 3302 3050 2970 2823 1170 1045 575 221 134 13240 ----
NM_138701chr7----1288 --
NM_138713chr16157966 7924 7696 7072 6199 6185 5883 5505 5270 3310 3235 2564 1192 819 331 37296 3111 440 11905 36495 5797 468
NM_138714chr16157966 7924 7696 7072 6199 6185 5883 5505 5270 3310 3235 2564 1192 819 331 37296 3111 440 11905 36495 5797 468
NM_138731chr1473845 3367 3333 2635 801 506 462 1904 33159 2740 1326 44109 660 445 273
NM_138771chr72206 122 ----1417
NM_138782chr541746 615 481 100 --22179 838 22412 245
NM_138799chr261664 756 703 571 429 68 ----1553
NM_138812chr10250 43 ------
NM_138819chrX2467 121 ------
NM_138927chr2111020 ------
NM_138959chr1176325 6179 5548 5450 4973 4930 4445 4417 4324 2687 2619 2328 2058 1884 1685 979 232 --35921 5140 2443 15415
NM_138970chr1411938 --32219 2143 2024 --
NM_138971chr1132615 814 708 13858 22535 729 13344
NM_138971chr1132615 814 708 13858 22535 729 13344
NM_138972chr1132615 814 708 13858 22535 729 13344
NM_138972chr1132615 814 708 13858 22535 729 13344
NM_138973chr1132615 814 708 13858 22535 729 13344
NM_138973chr1132615 814 708 13858 22535 729 13344
NM_138991chr214346 180 172 114 ------
NM_138992chr214377 369 311 24 --1100 --
NM_139012chr662307 1900 1589 568 493 323 --11781 --
NM_139014chr662387 1980 1669 648 573 403 --11861 --
NM_139045chr92761 614 ------
NM_139046chr102237 55 ------
NM_139047chr101103 ------
NM_139048chr341251 341 97 90 --1109 --
NM_139049chr101103 ------
NM_139072chr2123 ------
NM_139076chr451410 1131 946 434 178 --11458 --
NM_139135chr131269 1214 1056 ------
NM_139136chr1251045 948 762 709 375 ------
NM_139167chr8--1526 ----
NM_139168chr561704 1590 1517 658 63 28 ----1418
NM_139169chr1041897 892 651 196 --32287 1996 1832 1145
NM_139207chr1231894 827 771 22231 596 1862 11719
NM_139245chr32323 43 1526 ----
NM_139283chr1232425 973 303 --52487 2057 1636 246 103 --
NM_139312chr1021280 1093 11430 11306 --
NM_139318chr14195 ------
NM_144498chr2022297 240 1570 1317 --
NM_144567chr161002 963 869 554 68 50 1684 12594 --
NM_144570chr1642556 2278 935 554 ------
NM_144571chr4146145 6090 5773 5696 5426 5360 5286 5029 2500 2088 1646 1613 1457 732 15875 15560 --
NM_144574chr142643 580 --3465 113 101 --
NM_144576chr12----1126 1632
NM_144578chr1495103 4416 4363 3729 3626 3371 1496 369 130 25495 559 13851 --
NM_144582chr252431 2039 1797 628 256 22641 497 ----
NM_144583chr271705 1545 1358 1261 1187 283 176 1351 ----
NM_144590chr1062908 2778 2733 418 376 177 12083 --1670
NM_144595chr132339 202 2949 763 1137 1803
NM_144599chr15135255 4582 4565 4127 3945 3759 2050 1886 1739 1581 814 688 89 21836 1384 33342 2061 700 2758 641
NM_144600chr16129 --11690 1585
NM_144607chr1741987 1857 1026 757 12651 1987 1969
NM_144611chr172517 221 ------
NM_144632chr242098 1608 910 635 1306 12366 1331
NM_144642chr321058 1037 --180 --
NM_144643chr41305 ------
NM_144660chr101406 ------
NM_144664chr1161806 1791 1710 1581 981 800 --1400 11628
NM_144767chr1594653 4560 3169 3145 3057 2981 1435 715 232 13239 33875 2922 2907 --
NM_144777chr13--1163 --169
NM_144778chr1362445 1877 1104 927 886 388 189 ----
NM_144949chr242473 2336 622 355 --21903 1020 --
NM_144963chr8122572 2284 2143 2117 2003 1085 1043 953 937 830 611 50 ------
NM_144973chr1264826 3606 3398 1898 902 701 --124 --
NM_144974chr131807 --2636 118 186
NM_145055chr1873649 3476 3423 3397 2966 2556 2431 1222 12682 --
NM_145115chr752323 2187 2099 1932 554 ----11579
NM_145175chr271332 1280 1164 913 389 181 89 ----11307
NM_145176chr673298 3282 3163 3014 2599 2394 2164 --12457 --
NM_145203chr13------1143
NM_145206chr1063123 2957 2622 2431 1284 952 ----12053
NM_145251chr1431018 562 478 1555 31462 1147 106 --
NM_145259chr2136889 6755 6582 6404 6378 5974 5009 4860 4492 2676 1391 1143 888 --12589 --
NM_145261chr33311 279 120 ----1863
NM_145266chr52123 51 1373 ----
NM_145274chr173662 234 153 ------
NM_145284chrX52090 911 436 235 163 --11670 --
NM_145306chr10------1519
NM_145307chr10104444 4315 4098 3538 3499 2923 1208 721 412 52 14257 14615 11688
NM_145320chr763325 2704 2262 983 174 154 ----11014
NM_145321chr763325 2704 2262 983 174 154 ----11014
NM_145322chr763325 2704 2262 983 174 154 ----11014
NM_145341chr1081710 1413 1352 691 539 473 327 228 ------
NM_145686chr242419 2363 851 692 --21249 979 11046
NM_145687chr242419 2363 851 692 --21249 979 11046
NM_145716chr13450 242 229 ------
NM_145725chr141477 ------
NM_145726chr141477 ------
NM_145753chr341639 1166 607 505 11056 ----
NM_145793chr103865 715 101 1708 ----
NM_145800chrX1129 ----11040
NM_145802chrX178 ----1989
NM_145805chr151224 ----1623
NM_145808chr782841 2446 2333 2171 2002 966 786 695 ------
NM_145909chr621385 143 ----11233
NM_145913chr123999 816 327 --140 --
NM_147128chr751392 574 513 470 209 1270 11542 --
NM_147150chr933960 2902 233 ------
NM_147156chr1041056 1028 1014 574 --1104 --
NM_147171chr7193 ------
NM_147175chrX52117 782 723 602 293 --21877 153 1192
NM_147181chr421436 1416 ------
NM_147182chr421436 1416 ------
NM_147183chr421436 1416 ------
NM_147185chr7193 ------
NM_147188chr152968 82 2922 420 ----
NM_147189chr832173 1697 124 12351 31666 1594 337 --
NM_148174chr811562 21580 1489 32100 2038 100 --
NM_148571chr172654 271 --1335 --
NM_148898chr72902 312 ------
NM_148899chr72902 312 ------
NM_148977chr1031190 1101 450 --11107 --
NM_148978chr1031190 1101 450 --11107 --
NM_152133chr62790 131 --1634 --
NM_152222chr1151975 1585 1446 1418 757 ----21488 574
NM_152240chr34990 965 476 106 ------
NM_152261chr1252049 999 931 807 711 ----12008
NM_152263chr1115772 5753 5310 4416 4287 2201 1934 1752 1237 841 468 15222 35984 5866 5326 21288 558
NM_152265chr121549 463 ------
NM_152275chr262185 1452 671 487 452 26 12315 1417 11623
NM_152277chr562181 1904 1859 752 740 550 --11469 --
NM_152278chrX122 1525 --1536
NM_152280chr162994 2899 2624 1360 442 291 ----13237
NM_152282chr321166 1027 ------
NM_152289chr1931662 1609 1417 ------
NM_152291chr421108 817 --1137 --
NM_152298chr11734 191 1136 --
NM_152300chr1751666 1566 1471 1182 453 --31464 618 171 --
NM_152305chr342065 814 274 45 --1694 1740
NM_152332chr1432918 998 503 22006 975 32091 1121 62 --
NM_152355chr192535 230 ------
NM_152360chr192179 142 ------
NM_152366chr1----1111 --
NM_152384chr22680 390 11999 ----
NM_152387chr2148 --3243 168 82 --
NM_152388chr273671 3068 3056 2711 2603 1007 267 --21292 206 22627 134
NM_152409chr552868 2300 2260 1267 1175 ------
NM_152410chr6--1490 ----
NM_152417chr81271 2970 915 11192 --
NM_152422chr951763 1584 735 578 460 ----11690
NM_152423chrX31161 609 32 ----1987
NM_152424chrX84760 4108 3993 3619 1832 1306 1199 1178 --11171 --
NM_152437chr1242269 2246 221 29 --1915 --
NM_152447chr14----179 --
NM_152448chr153584 371 126 --1216 --
NM_152450chr1541850 1504 308 229 1663 ----
NM_152455chr1562865 2670 2441 782 641 491 2274 35 1253 --
NM_152463chr17------1501
NM_152487chr141361 930 536 432 --191 --
NM_152519chr241951 1697 1357 840 11363 ----
NM_152520chr22268 255 ----11250
NM_152527chr251818 1515 433 358 200 11661 ----
NM_152529chr284181 3963 2779 1494 1221 991 628 110 --34189 3953 2887 24227 3857
NM_152553chr61550 --1576 --
NM_152556chr762421 1888 1692 942 764 320 2822 82 21017 152 --
NM_152588chr1231265 334 274 --11200 --
NM_152589chr121182 ------
NM_152594chr1511991 --22289 400 --
NM_152603chr191508 --1445 --
NM_152608chr132073 1923 1895 --32368 821 698 --
NM_152613chr2231238 1197 198 ----1425
NM_152622chr593154 3092 2524 1178 1171 938 847 697 485 12356 32511 1364 170 1516
NM_152624chr5147285 7102 6578 6056 5776 5550 5464 4698 2769 2725 2297 2017 390 84 16242 25236 2319 26418 1955
NM_152629chr951432 1210 496 388 242 1573 33233 2882 559 --
NM_152630chrX81439 1229 547 505 302 276 246 216 --1118 --
NM_152636chr1172910 2570 2269 1025 947 614 140 22891 2188 1315 --
NM_152637chr122530 179 ------
NM_152638chr1261264 1151 486 448 368 196 --1470 --
NM_152640chr12129 ------
NM_152641chr1252419 2247 1982 1878 483 22862 2766 183 11167
NM_152653chr31539 1726 ----
NM_152660chr15786 756 338 207 96 ------
NM_152665chr141149 1017 434 114 1476 ----
NM_152666chr12804 730 ------
NM_152673chr3114298 3543 3330 3210 1743 1592 1037 722 624 603 325 24349 2968 44371 1465 1458 1334 1527
NM_152678chr382337 2220 1940 1708 1054 674 410 61 --22467 88 --
NM_152682chr461332 458 433 384 353 331 1202 11732 --
NM_152699chr373208 3176 1394 931 850 802 361 11091 1696 --
NM_152704chr132243 217 1922 ----
NM_152705chr1331284 349 277 ------
NM_152709chr101304 --165 --
NM_152723chr1171041 970 958 709 284 238 101 ------
NM_152724chr1042128 1693 1018 76 ------
NM_152725chr10124 --1124 --
NM_152729chr651427 1402 514 311 64 --1623 1188
NM_152731chr631207 1127 43 1208 ----
NM_152734chr684576 3866 3809 3717 1988 1449 1032 738 --23762 1634 --
NM_152745chr711055 2875 191 11193 --
NM_152754chr743304 2684 2647 1492 1736 21503 503 --
NM_152755chr73579 539 238 ------
NM_152756chr564031 4024 3809 3353 2710 1056 --33846 3516 533 --
NM_152758chr8142770 2633 2597 2437 2325 2300 2176 2126 1965 832 784 760 751 364 ----13065
NM_152763chr12243 189 ------
NM_152774chr731938 485 215 22106 450 ----
NM_152780chrX11090 11300 21059 820 11208
NM_152787chrX73674 3208 2572 2559 942 800 192 21374 1070 13102 --
NM_152789chr731000 409 58 ------
NM_152793chr795210 5021 4824 4721 1636 1466 1036 666 288 --14863 --
NM_152835chr142955 2506 185 152 12420 12483 --
NM_152836chr831515 1422 264 --11748 --
NM_152837chr831515 1422 264 --11748 --
NM_152838chr2033088 531 401 13550 22657 105 --
NM_152857chr63723 704 341 ------
NM_152858chr63723 704 341 ------
NM_152890chr141159 226 130 120 11193 ----
NM_152903chr1362766 2693 2215 1804 803 78 12585 --12603
NM_152910chr131460 183 1596 --
NM_152924chr15136898 5983 5811 1834 1810 1424 1399 1059 1047 976 895 513 88 --11963 --
NM_152989chr1221755 122 ------
NM_152991chr111644 ------
NM_152995chr45865 775 749 577 123 --1162 --
NM_152996chr16637 415 398 313 134 34 11907 ----
NM_152998chr71235 ------
NM_152999chr7104029 3941 3849 3507 3370 3151 1427 1054 369 126 ------
NM_153013chr562294 1991 1964 1873 578 452 12487 ----
NM_153020chr631499 536 507 11089 ----
NM_153035chr152364 2313 2268 447 387 --1667 --
NM_153047chr6----166 --
NM_153048chr6----166 --
NM_153050chr2295043 4825 4100 3536 3448 3064 3053 1540 1246 --21609 248 --
NM_153051chr2295043 4825 4100 3536 3448 3064 3053 1540 1246 --21609 248 --
NM_153186chr92847 542 ------
NM_153188chr585463 4014 3784 3752 3574 2081 2072 1434 35283 5208 1005 54628 3718 1862 1370 765 --
NM_153207chr1263720 3633 3379 782 582 291 --33692 877 512 13519
NM_153212chr1------1254
NM_153223chr571498 1186 1051 609 591 413 274 --21467 104 --
NM_153234chr53333 189 27 --22018 63 1214
NM_153235chr631665 907 590 12214 22030 604 --
NM_153251chr131214 --126 --
NM_153252chrX3333 149 36 ----1360
NM_153255chr63829 197 73 ------
NM_153261chr1611535 11408 ----
NM_153262chr151039 936 830 578 569 12796 11075 23202 2817
NM_153267chr9290 50 --1241 --
NM_153332chr8102354 2028 1301 987 762 756 553 472 445 396 ------
NM_153333chrX----1183 --
NM_153346chrX71400 1289 671 473 459 348 62 2612 327 ----
NM_153347chr1172642 2013 1857 1741 1031 651 271 12697 1562 --
NM_153362chr68894 727 339 325 266 198 129 119 ------
NM_153365chr442765 2587 2222 440 --32147 2123 534 11989
NM_153371chr132792 532 --1685 2902 850
NM_153374chr152537 112 ------
NM_153456chr1396223 6177 6037 5834 4738 4430 1564 1258 23 14576 1807 --
NM_153499chr1252911 2359 962 598 212 21911 626 ----
NM_153500chr1252911 2359 962 598 212 21911 626 ----
NM_153605chr351585 1295 642 195 157 ------
NM_153607chr532484 2324 2053 ------
NM_153616chr1552156 2018 494 449 341 ------
NM_153617chr1552156 2018 494 449 341 ------
NM_153618chr1552156 2018 494 449 341 ------
NM_153619chr1583394 3256 2651 2625 739 656 543 438 ------
NM_153620chr721630 1276 ------
NM_153634chr1241589 617 584 427 1604 1104 1408
NM_153640chr202492 79 ------
NM_153649chr172014 1831 1794 1612 1456 768 405 --1898 --
NM_153685chr1231226 1217 397 ------
NM_153689chr252061 1646 1600 1466 950 11459 ----
NM_153697chr21553 153 ----
NM_153706chr52197 110 ------
NM_153712chr263822 3611 2705 1120 762 202 1722 1771 --
NM_153748chr1251045 948 762 709 375 ------
NM_153757chr441285 409 403 175 --1396 --
NM_153759chr21873 --1210 --
NM_153810chr1021617 271 --44637 1781 1281 1264 14098
NM_153828chr22703 194 ------
NM_153834chrX------1246
NM_170601chr113912 340 259 --11064 171
NM_170662chr32549 146 ------
NM_170665chr1284204 4058 3194 3063 1773 695 499 36 --11013 14485
NM_170674chr1561321 1239 1058 907 145 72 1409 ----
NM_170677chr1561321 1239 1058 907 145 72 1409 ----
NM_170679chr511051 ----1840
NM_170695chr183405 145 27 ------
NM_170696chr1551468 482 346 207 76 ------
NM_170697chr1551468 482 346 207 76 ------
NM_170706chr193573 3558 3539 3522 3376 2683 888 858 625 13624 14374 --
NM_170709chr822389 174 11656 ----
NM_170710chr441133 881 390 70 12455 23061 2095 --
NM_170725chr11724 --1522 --
NM_170731chr1122917 1802 --12167 --
NM_170732chr1122917 1802 --12167 --
NM_170733chr1122917 1802 --12167 --
NM_170734chr1122917 1802 --12167 --
NM_170735chr1122917 1802 --12167 --
NM_170750chrX2783 573 ------
NM_170751chr621484 1019 ------
NM_170752chr621484 1019 ------
NM_172037chr82589 413 ------
NM_172069chr262138 2061 1943 1535 1507 154 --11845 --
NM_172070chr23601 75 56 ------
NM_172071chr1117118 5199 2571 1484 1449 1245 1050 900 697 689 93 --37246 5122 361 35374 4532 759
NM_172103chr6102134 1955 992 794 786 756 537 381 68 39 11775 1101 1882
NM_172105chr6102134 1955 992 794 786 756 537 381 68 39 11775 1101 1882
NM_172127chr441451 759 81 51 ------
NM_172159chr351854 1748 914 658 349 1619 ----
NM_172160chr351854 1748 914 658 349 1619 ----
NM_172164chr11734 191 1136 --
NM_172169chr101119 ------
NM_172170chr101119 ------
NM_172171chr101119 ------
NM_172173chr101119 ------
NM_172216chr1252813 2261 864 500 114 21813 528 ----
NM_172217chr1593881 3718 2965 2431 1426 1347 329 247 70 13628 ----
NM_172218chr81332 --1877 --
NM_172226chr1252911 2359 962 598 212 21911 626 ----
NM_172240chr1231303 1200 127 --11212 --
NM_172315chr1561321 1239 1058 907 145 72 1409 ----
NM_172316chr1561321 1239 1058 907 145 72 1409 ----
NM_172344chr231829 1658 1243 --1575 --
NM_172350chr141657 1513 1190 380 154 ----
NM_172359chr151661 1517 1194 1156 384 158 ----
NM_172373chr1341166 988 416 198 --151 --
NM_172375chr1431029 890 354 ------
NM_173075chr42727 428 --11431 11406
NM_173076chr221060 24 --1295 2953 310
NM_173082chr611508 --2465 132 --
NM_173083chr121058 155 --1462 11309
NM_173156chr141411 792 454 260 --1371 1482
NM_173198chr932173 1202 429 --22813 2709 --
NM_173200chr932173 1202 429 --22813 2709 --
NM_173207chr183405 145 27 ------
NM_173208chr183405 145 27 ------
NM_173209chr183405 145 27 ------
NM_173210chr183405 145 27 ------
NM_173211chr183405 145 27 ------
NM_173214chr16157966 7924 7696 7072 6199 6185 5883 5505 5270 3310 3235 2564 1192 819 331 37296 3111 440 11905 36495 5797 468
NM_173354chr2121634 1410 ------
NM_173355chr21144 --1944 1754
NM_173359chr361619 1572 1342 766 565 57 ------
NM_173463chr4123902 3808 3760 3080 2928 1375 1315 1278 1184 1140 1075 339 ------
NM_173468chr4136067 5350 4975 4711 4669 4592 4509 4012 3998 3684 2148 2053 1955 11601 34104 3780 603 15210
NM_173469chr1511103 1418 1583 --
NM_173470chrX42440 2251 429 423 12662 12777 1956
NM_173471chr311028 11051 11069 1253
NM_173473chr1082422 2336 2036 1895 1865 742 734 452 --1879 --
NM_173478chr174933 822 746 273 --1923 1841
NM_173487chr43547 221 99 1845 ----
NM_173491chr51355 --11133 --
NM_173495chrX42538 2419 1817 290 ------
NM_173496chr1052770 2312 565 344 163 1252 13068 12873
NM_173505chr1851130 1095 395 283 68 ----1337
NM_173508chr1165 1191 41219 446 430 218 --
NM_173510chr2252959 1034 793 413 197 1547 11839 22948 2849
NM_173511chr283865 3625 3314 3300 2997 2530 533 190 13340 1588 12907
NM_173517chr73347 122 31 ------
NM_173518chr82264 40 ------
NM_173519chr811529 12067 31811 1417 1390 --
NM_173527chr141558 ----1751
NM_173536chr473832 3673 3433 3317 1982 1308 984 --35134 4977 3518 --
NM_173552chr341950 1819 1586 1571 --1136 12506
NM_173557chr184777 283 259 175 ------
NM_173560chr64522 486 398 230 ------
NM_173563chr61232 --124 --
NM_173576chr104919 742 686 504 1418 ----
NM_173582chr11155765 5532 5374 5007 4162 3904 2521 2489 2162 1815 1787 1729 1514 891 713 15885 35700 2148 703 1877
NM_173595chr1294619 3597 2108 2050 1963 1897 1881 918 465 33315 3292 1460 ----
NM_173602chr1263243 2973 2807 2446 2355 1391 --42922 2333 860 669 1659
NM_173607chr1431444 608 32 2276 87 11522 --
NM_173642chr1228869 8846 8490 8083 7997 7837 7796 7471 7305 7209 6615 6031 5889 5688 3389 3277 3048 2963 2735 786 775 756 --25566 827 --
NM_173667chr552124 1681 1660 482 178 --41989 1834 999 907 --
NM_173672chr652462 2354 1894 637 197 12577 1817 --
NM_173683chr821727 1269 --11775 --
NM_173694chrX52145 1952 1003 195 110 --1483 --
NM_173791chr10125 ------
NM_173797chr531181 1000 310 ------
NM_173808chr194270 4126 3874 3698 3149 1405 1164 815 294 11275 13012 33538 3448 409
NM_173809chr1051096 1050 536 356 135 ------
NM_173822chr241470 628 456 310 --1713 --
NM_173825chr382737 1078 716 585 479 375 106 70 --13140 --
NM_173829chr5116203 5213 5016 4806 3860 1671 1633 1549 1388 1195 550 35557 1519 1262 56160 5301 5010 4172 525 14561
NM_173848chr83261 148 104 ----1910
NM_173851chr863704 3141 3057 2572 635 218 13490 ----
NM_173854chr142348 1658 840 640 --2616 139 --
NM_174858chr141193 1139 962 74 ------
NM_174886chr183405 145 27 ------
NM_174887chr172392 123 ------
NM_174890chr101834 ------
NM_174911chr863971 1577 1534 1518 1498 331 --21192 798 23486 2627
NM_174916chr1541975 1789 801 566 11767 31915 166 149 --
NM_174938chr9136 ------
NM_175058chr1131422 1368 1314 ------
NM_175061chr751932 1525 766 396 370 --11924 --
NM_175566chr111381 --1465 --
NM_175607chr371526 1430 1373 1196 1065 681 672 ------
NM_175610chr1531406 367 49 ------