TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4462
miRNA Sequence: UGACACGGAGGGUGGCUUGGGAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000176chr563616 3310 3016 1377 667 330 13557 ----
NM_000212chr173233 179 157 1817 --11786
NM_000240chrX----1309 180
NM_000259chr1555850 4775 2442 298 194 36353 2323 545 --15137
NM_000314chr1023140 925 32933 233 98 --1212
NM_000362chr2213625 12509 2570 560 12760
NM_000430chr1793731 3698 3086 2908 2722 2517 1014 940 804 1852 ----
NM_000439chr532226 998 980 --2658 67 --
NM_000618chr1225280 1235 --16121 11218
NM_000618chr1225280 1235 --16121 11218
NM_000668chr421344 1121 ----1266
NM_000831chr156171 4899 4181 2420 1948 --11954 --
NM_000875chr1566837 5747 5526 4901 2406 638 --14396 --
NM_000926chr1169466 9160 5984 2611 2103 1505 21948 406 ----
NM_001001419chr513506 23899 3197 --12045
NM_001001420chr513506 23899 3197 --12045
NM_001001669chr552444 1847 749 698 385 --12491 --
NM_001003407chr1073990 3838 3391 3287 1933 1784 1250 1510 24926 3948 --
NM_001003408chr1073990 3838 3391 3287 1933 1784 1250 1510 24926 3948 --
NM_001003674chr1876382 6368 4716 2118 1840 1236 501 --35609 4542 2341 15538
NM_001003675chr1876382 6368 4716 2118 1840 1236 501 --35609 4542 2341 15538
NM_001004051chrX1317 ----1256
NM_001004065chr953898 3863 3439 2821 726 --13330 --
NM_001007024chr1743638 3169 296 187 --21574 1444 --
NM_001007025chr1743638 3169 296 187 --21574 1444 --
NM_001008220chr542824 1521 1377 1242 23832 1352 --13803
NM_001008408chr7106302 6120 6029 5735 5129 2230 2050 1761 1554 635 16419 --24743 1050
NM_001009554chr414777 ----13318
NM_001009554chr414777 ----13318
NM_001009899chr365333 4867 1452 1182 645 104 --16248 11530
NM_001009909chr1143853 3469 2960 2737 --13399 --
NM_001010867chr152497 1958 743 717 237 --22236 1969 11634
NM_001012393chr1154827 4808 1240 1130 238 23506 3274 --14898
NM_001014380chr1345861 1336 924 806 1422 --1794
NM_001018065chr945669 2112 409 334 ----132
NM_001018066chr945669 2112 409 334 ----132
NM_001018074chr563616 3310 3016 1377 667 330 13557 ----
NM_001018075chr563616 3310 3016 1377 667 330 13557 ----
NM_001018076chr563616 3310 3016 1377 667 330 13557 ----
NM_001018077chr563616 3310 3016 1377 667 330 13557 ----
NM_001024094chr563616 3310 3016 1377 667 330 13557 ----
NM_001025076chr1076050 5912 5622 3969 3855 777 423 1671 ----
NM_001025077chr1087408 7270 6980 5327 5213 2135 1781 1371 12029 ----
NM_001025079chr343823 2566 1588 853 23315 1023 ----
NM_001031804chr1664440 4296 3118 3065 542 480 ------
NM_001032296chr1372363 2269 1939 1855 1101 1067 489 12888 12623 --
NM_001033117chr354489 1781 1538 398 129 1205 --11110
NM_001039547chr356232 5932 2060 1812 1050 ------
NM_001039840chrX45496 4332 91 26 14214 14320 --
NM_001040057chr721498 154 --11142 11260
NM_001040167chr751086 1032 981 769 276 ----1442
NM_001040665chr724867 4447 ----13696
NM_001042355chr1674860 3968 3927 3434 553 363 164 11969 ----
NM_001042412chr1674860 3968 3927 3434 553 363 164 11969 ----
NM_001042494chr152156 104 ----1632
NM_001042495chr152156 104 ----1632
NM_001042496chr152156 104 ----1632
NM_001042497chr152156 104 ----1632
NM_001100108chr168095 7687 6890 5228 978 70 18160 26970 2533 --
NM_001106chr379715 8990 7605 7565 7183 2075 561 27013 2884 ----
NM_001315chr642011 1738 900 167 22083 146 ----
NM_001386chr882424 2399 2140 2106 1670 835 813 604 ----1978
NM_001396chr2142557 2523 2422 1734 11021 11096 --
NM_001419chr1944698 3524 1773 646 14841 11823 --
NM_001497chr962688 2671 2504 2480 2136 53 --12729 --
NM_001543chr564590 4058 3487 3272 1003 310 --11165 --
NM_001616chr24911 683 517 88 ------
NM_001635chr71729 ----11074
NM_001777chr343823 2566 1588 853 23315 1023 ----
NM_001830chrX63990 3962 2690 1316 735 222 ----143
NM_002025chrX99170 9098 8296 7935 7081 5654 2616 1145 781 ------
NM_002111chr463172 2897 2778 1116 618 143 --32420 988 464 --
NM_002264chr331353 932 779 --14361 131
NM_002313chr1073990 3838 3391 3287 1933 1784 1250 1510 24926 3948 --
NM_002359chr1784131 3922 3806 3733 3588 1244 355 192 --33625 1443 1258 1679
NM_002481chr167999 7914 7656 6972 6251 5742 11391 ----
NM_002522chr1752631 785 325 311 302 --23353 1031 --
NM_002545chr1154827 4808 1240 1130 238 23506 3274 --14898
NM_002613chr16115127 4754 3719 3478 1895 1728 1565 918 631 385 254 --34194 1985 1510 --
NM_002655chr865027 3894 3845 3351 3310 734 1689 --14090
NM_002745chr2253913 1707 1267 1210 212 1218 ----
NM_002829chr92995 160 1409 --11249
NM_002843chr1143242 3231 1173 1026 --21032 419 --
NM_003199chr1835670 2159 1177 15200 13512 --
NM_003200chr1921798 750 12303 21535 661 1255
NM_003320chr1154348 3607 2832 2819 2808 --32799 1459 695 --
NM_003392chr353578 2816 1685 1286 309 --23968 1054 --
NM_003574chr1844990 1504 1440 628 1638 11984 --
NM_003576chr1372363 2269 1939 1855 1101 1067 489 12888 12623 --
NM_003583chr1243741 3701 2710 863 13312 ----
NM_003671chr923219 312 12403 --1415
NM_003822chr142072 1137 701 552 --1614 12189
NM_003924chr441427 1330 376 356 21355 347 1338 --
NM_004171chr1168902 8384 8327 6802 2623 659 1400 1180 --
NM_004338chr1876382 6368 4716 2118 1840 1236 501 --35609 4542 2341 15538
NM_004514chr1752961 2621 2090 2048 294 ----1645
NM_004703chr1712544 1910 --11999
NM_004726chrX24725 4265 ----1101
NM_004745chr845931 1294 1160 286 26857 580 --12586
NM_004775chr1821875 887 1836 --190
NM_004776chr2053176 2967 2833 2771 1042 --32727 1196 111 --
NM_004796chr1411811 ----11544
NM_004798chr2062845 2492 1402 1392 1378 1186 ------
NM_004815chr184238 4031 3373 3234 3154 1667 1574 1225 13603 ----
NM_004871chr1743638 3169 296 187 --21574 1444 --
NM_004985chr1243994 3867 1011 364 --11056 1858
NM_004992chrX67166 6963 6936 6633 2447 2055 15298 23259 2359 --
NM_004992chrX67166 6963 6936 6633 2447 2055 15298 23259 2359 --
NM_005069chr2121711 627 ----21389 441
NM_005135chr152156 104 ----1632
NM_005188chr11157559 7351 6890 6498 6433 5748 2369 2325 2282 1888 1421 426 397 377 366 28082 6776 36255 5925 5592 --
NM_005197chr1455690 5182 4525 4039 1730 --1900 15626
NM_005359chr1844219 2112 650 509 ----15838
NM_005400chr262756 2559 1220 1054 638 62 --21905 260 --
NM_005502chr952794 2541 2427 2389 331 22850 540 ----
NM_005596chr955943 5257 4607 4473 1710 --15090 --
NM_005715chr652870 2333 2241 906 186 --1976 --
NM_005759chr264779 4533 4389 3042 2923 274 13193 ----
NM_005786chr1811031 ----1491
NM_005822chr622019 321 ----12091
NM_005828chr1754555 4113 3977 653 193 1406 24697 330 --
NM_005840chrX47388 7087 5892 2792 13019 25666 5099 --
NM_005903chr513506 23899 3197 --12045
NM_005909chr534130 2934 1122 14116 --1135
NM_005941chr834175 3707 1007 ----12877
NM_005996chr1211006 --1577 1385
NM_006007chr934461 4337 1165 ----13848
NM_006011chr1524255 190 --13581 11186
NM_006037chr274447 4351 4211 3586 2967 1823 452 14889 --175
NM_006095chr464392 3686 3279 1014 741 504 24444 767 11042 --
NM_006203chr565415 5331 3895 1301 1038 1003 ----11143
NM_006226chr241373 424 328 225 1213 ----
NM_006251chr523116 2454 32577 355 341 ----
NM_006252chr176851 1827 1565 1545 1351 918 411 27116 1607 12966 --
NM_006256chr142621 2427 1866 898 ------
NM_006320chr431088 854 428 ----1418
NM_006454chr453057 2108 2057 1147 336 150 33072 2749 2482 --
NM_006482chr1243741 3701 2710 863 13312 ----
NM_006504chr1032957 2672 2538 --2641 621 --
NM_006534chr2041096 467 214 191 2809 313 ----
NM_006561chr1076050 5912 5622 3969 3855 777 423 1671 ----
NM_006572chr1753430 2585 1286 1108 584 --1704 --
NM_006650chr542824 1521 1377 1242 23832 1352 --13803
NM_006720chr1073990 3838 3391 3287 1933 1784 1250 1510 24926 3948 --
NM_006823chr861333 1289 1270 479 466 356 ------
NM_007011chr1575911 4650 1392 1159 874 404 318 ------
NM_007203chr953898 3863 3439 2821 726 --13330 --
NM_007249chr1358664 8095 7283 6438 3673 --1263 --
NM_012294chr753952 3916 1520 538 149 ------
NM_012425chr1022143 836 ----12580
NM_013242chr16------1385
NM_013286chr352916 1465 734 645 638 136 11023 --
NM_013381chr123639 606 373 12014 --1962
NM_013449chr12112948 2819 2705 2433 1040 1001 981 948 615 481 431 11019 11203 --
NM_014155chr1155841 5697 5242 2741 1936 --22400 2187 24937 1053
NM_014232chr1761588 1516 664 130 118 107 ------
NM_014232chr1761588 1516 664 130 118 107 ------
NM_014293chr2263752 3275 3149 3113 1005 179 --12887 14092
NM_014372chr112029 1721 --11862
NM_014423chr533861 951 664 ----25585 48
NM_014647chr1651859 817 720 487 131 ----191
NM_014686chr1982453 2351 2315 2115 2023 1882 1837 351 ------
NM_014739chr654168 3861 3095 1199 713 13697 ----
NM_014746chr264341 3705 3671 2890 733 677 11676 ----
NM_014850chr354489 1781 1538 398 129 1205 --11110
NM_014989chr611775 ----1527
NM_014991chr452874 2519 989 621 116 12978 ----
NM_015002chr1252100 2058 460 438 159 ----1232
NM_015040chr232924 2199 93 ----13177
NM_015092chr1663113 3035 1409 472 370 291 14339 --11792
NM_015155chr1043105 2843 893 37 13315 1848 12708
NM_015192chr2032803 2549 334 1182 12567 --
NM_015227chr21103129 2499 1162 1136 1076 401 342 283 233 139 --13297 --
NM_015247chr1674860 3968 3927 3434 553 363 164 11969 ----
NM_015310chr848272 5654 1027 959 ----12284
NM_015336chr1222312 52 --162 12603
NM_015458chr865090 5025 4660 3406 1390 1109 --32068 319 45 --
NM_015460chr331841 1786 1556 11565 ----
NM_015535chr233572 604 306 1116 --13856
NM_015569chr174218 4147 3242 3112 3105 3079 1496 ------
NM_015571chr622040 832 ----2799 757
NM_015575chr263076 3019 2940 2870 1001 153 --1222 --
NM_015576chr362887 2269 1935 1063 872 762 12571 11142 --
NM_015691chrX22334 665 12917 12380 21894 888
NM_015892chr1011639 --1463 12345
NM_016132chr1532949 2905 926 --13281 --
NM_016206chr357326 3322 2349 2117 2076 28869 6306 ----
NM_016248chr1353816 3570 1358 1224 1181 1234 11352 --
NM_016260chr277428 7386 7246 6893 6493 5567 2315 --16782 --
NM_016281chr1231042 790 138 ----1196
NM_016322chr963150 3022 2849 2679 1232 694 12169 ----
NM_016418chr2253415 3347 3337 880 370 --23500 2528 --
NM_016569chr1211006 --1577 1385
NM_016577chr374491 4359 3974 3926 3693 1805 625 ------
NM_016603chr541825 1548 478 62 12085 12215 --
NM_016605chr562725 2690 2499 2461 2257 355 ------
NM_016621chr1174022 3591 1476 1469 1416 833 187 11187 13707 --
NM_016946chr112838 --1596 12424
NM_017415chr5104595 4337 3974 3627 3323 1544 1107 1092 639 413 --1631 --
NM_017551chr1022324 639 ----12578
NM_017594chr951261 1143 1054 759 30 2368 102 ----
NM_017754chr673883 3347 3260 1213 365 279 228 14209 ----
NM_017787chr1052757 1898 1854 978 872 12296 --1997
NM_017813chr854800 4704 4301 643 192 25338 4918 ----
NM_017848chrX53161 1873 1731 836 135 13742 14047 --
NM_017896chr2073301 3148 2827 2638 2349 953 634 ------
NM_017902chr10115144 4706 4698 3992 3879 3714 967 945 868 851 298 12034 11539 15226
NM_018159chrX61654 1412 622 394 250 95 ------
NM_018362chr1133777 3000 1566 ----13371
NM_018489chr122205 792 ----11511
NM_018700chr551709 1190 1135 450 159 ------
NM_018945chr633491 3424 3199 --1308 13591
NM_019106chr2252652 797 297 194 132 --23168 631 --
NM_019843chr222342 107 ----1432
NM_020310chr1742646 2340 2149 358 --12571 --
NM_020338chr1073303 2868 2270 1457 1276 674 199 13049 --12992
NM_020429chr722430 290 1948 --1885
NM_020718chr1676123 5770 5699 1568 401 152 121 16447 26331 1000 21248 651
NM_020728chr763042 3032 447 293 251 186 --1274 --
NM_020772chr1736877 2237 2123 37216 2992 783 --13412
NM_020896chr1121084 1045 --11010 2875 289
NM_020935chr264565 4275 3927 3312 1447 276 ------
NM_020960chr984776 4710 4427 3551 3221 1928 1837 1756 --15010 --
NM_021120chrX2942 873 --13068 11014
NM_021176chr21581 11836 --21579 30
NM_021643chr21557 1691 --11770
NM_021647chr414777 ----13318
NM_021813chr664427 4397 4349 3642 2322 2294 --11770 --
NM_021945chr673515 3424 3340 2201 1266 583 524 13367 ----
NM_021949chrX52894 2750 1775 698 678 ------
NM_021961chr1157131 6570 5866 5380 1312 37373 6878 5269 16869 --
NM_021964chr386216 6088 5260 4799 4706 573 482 70 11000 ----
NM_022080chr2052581 1100 312 149 123 12121 ----
NM_022114chr154800 4420 1560 1544 826 21879 1849 23806 2992 --
NM_022459chr1375254 4823 2461 2383 1953 1575 1013 11535 ----
NM_022648chr274534 4469 4332 1858 1198 586 575 12912 14279 --
NM_022898chr1454775 4102 2958 728 107 --1149 183
NM_024086chr1753496 3439 2480 739 28 --32508 2452 1019 --
NM_024740chr1154137 1463 1437 1399 188 13852 ----
NM_024837chr151480 ----1696
NM_025219chr2061579 802 772 739 442 262 --2784 703 --
NM_025248chr1763147 2912 2699 2386 2357 2336 --12634 --
NM_030647chr765961 5936 2437 2316 1889 1740 12112 12279 --
NM_030806chr158708 2959 2481 264 39 26780 6387 37031 5787 2760 13300
NM_031268chr16115127 4754 3719 3478 1895 1728 1565 918 631 385 254 --34194 1985 1510 --
NM_031476chr1652709 2507 2465 854 603 --21812 1806 --
NM_032116chr1345861 1336 924 806 1422 --1794
NM_032208chr213312 22634 2496 --12710
NM_032228chr1142526 1016 701 190 12210 ----
NM_032316chr332452 638 456 --21908 1835 1165
NM_032711chr1784131 3922 3806 3733 3588 1244 355 192 --33625 1443 1258 1679
NM_032837chr1731701 539 279 ----1678
NM_032968chrX54006 3092 2958 1633 568 13111 ----
NM_032969chrX54006 3092 2958 1633 568 13111 ----
NM_032973chrY43998 3087 2953 568 13106 ----
NM_033088chr11658 --1123 1671
NM_033224chr757481 7433 6569 2189 981 26560 5057 ----
NM_033225chr852480 2147 893 580 323 1166 ----
NM_033331chr923219 312 12403 --1415
NM_033360chr1244115 3988 1132 485 --11177 1979
NM_033426chr1441998 1928 1118 113 ----12131
NM_033505chr244656 2339 1348 962 ------
NM_033512chr883035 2945 2849 2438 2379 670 399 93 ----1733
NM_033624chr1252100 2058 460 438 159 ----1232
NM_052875chr1111607 12099 11601 11420
NM_053043chr7106302 6120 6029 5735 5129 2230 2050 1761 1554 635 16419 --24743 1050
NM_053056chr1162715 2518 2454 2015 693 412 --12372 --
NM_078471chr171431 1784 1992 21006 266
NM_130435chr1032957 2672 2538 --2641 621 --
NM_130436chr2142557 2523 2422 1734 11021 11096 --
NM_133334chr436271 1279 885 14490 15856 16194
NM_133647chr152156 104 ----1632
NM_138286chr1943940 3263 2697 1060 ----13038
NM_138426chr72355 278 1211 22510 272 --
NM_138437chrX1317 ----1256
NM_138576chr1454775 4102 2958 728 107 --1149 183
NM_138970chr1411811 ----11544
NM_139012chr642011 1738 900 167 22083 146 ----
NM_139015chr1231587 121 104 --11340 11609
NM_139316chr71729 ----11074
NM_144571chr466981 5720 4387 2519 1535 1355 ------
NM_144599chr1531577 1264 433 15402 34681 4007 3853 --
NM_144973chr1265131 5098 2078 1993 1482 1008 ------
NM_145638chr1121084 1045 --11010 2875 289
NM_147150chr953898 3863 3439 2821 726 --13330 --
NM_148170chr1113873 15424 --15464
NM_152588chr1211811 1729 --1545
NM_152641chr1252731 2529 1110 1027 516 ------
NM_152724chr1022143 836 ----12580
NM_152734chr644834 4777 1107 818 24372 942 13656 --
NM_152789chr721498 154 --11142 11260
NM_152924chr1575911 4650 1392 1159 874 404 318 ------
NM_152999chr724867 4447 ----13696
NM_173353chr121150 ----191
NM_173470chrX62884 2347 615 484 388 377 1637 ----
NM_173582chr1132342 1774 29 1924 15206 --
NM_173595chr1264818 4540 3516 1859 946 479 --22015 355 --
NM_173602chr1213680 --11028 13658
NM_174911chr863504 2581 2441 920 890 493 ------
NM_177972chr1154348 3607 2832 2819 2808 --32799 1459 695 --
NM_178585chr452874 2519 989 621 116 12978 ----
NM_181349chr722430 290 1948 --1885
NM_181481chr1876382 6368 4716 2118 1840 1236 501 --35609 4542 2341 15538
NM_181482chr1876382 6368 4716 2118 1840 1236 501 --35609 4542 2341 15538
NM_181483chr1876382 6368 4716 2118 1840 1236 501 --35609 4542 2341 15538
NM_181521chr1665936 4911 4813 2687 1451 298 ------
NM_181659chr2041096 467 214 191 2809 313 ----
NM_181659chr2041096 467 214 191 2809 313 ----
NM_181705chr52924 559 --14536 12273
NM_181828chr2253415 3347 3337 880 370 --23500 2528 --
NM_181829chr2253415 3347 3337 880 370 --23500 2528 --
NM_181830chr2253415 3347 3337 880 370 --23500 2528 --
NM_181839chr861333 1289 1270 479 466 356 ------
NM_182757chr663361 2777 2209 861 401 188 12861 1117 --
NM_182798chr54523 439 321 221 --11224 --
NM_182799chr54523 439 321 221 --11224 --
NM_182801chr54523 439 321 221 --11224 --
NM_182970chr2043619 2799 1311 768 ----23863 3770
NM_194282chr442123 1912 1066 973 ----11144
NM_194314chr155504 4893 4234 529 146 --14246 --
NM_194434chr1844990 1504 1440 628 1638 11984 --
NM_198484chr355470 4491 1481 1290 1191 --1458 12244
NM_198793chr343819 2562 1584 849 23311 1019 ----
NM_199324chr443755 2882 2733 1259 --1627 --
NM_199454chr154800 4420 1560 1544 826 21879 1849 23806 2992 --
NM_203318chr171431 1784 1992 21006 266
NM_205848chr132784 318 263 --1668 12799
NM_205860chr142072 1137 701 552 --1614 12189
NM_206853chr662922 1626 1549 1249 790 631 ------
NM_206854chr664183 3731 2051 1892 451 317 ------
NM_206855chr665148 4696 3852 1416 1282 605 ------
NM_206907chr523116 2454 32577 355 341 ----
NM_206909chr848272 5654 1027 959 ----12284
NM_207317chr5----1295 1431
NM_207406chr496536 6260 5947 5791 4981 4783 4472 2219 618 ----14280
NM_207577chr1132043 602 552 12359 11103 1376