TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4467
miRNA Sequence: UGGCGGCGGUAGUUAUGGGCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000034chr16271 22 ------
NM_000068chr193302 276 62 ----166
NM_000075chr12--139 ----
NM_000080chr17165 2312 69 ----
NM_000084chrX11516 26944 1660 ----
NM_000088chr1721108 353 ------
NM_000125chr613745 13855 ----
NM_000135chr162752 353 ------
NM_000138chr1512002 ------
NM_000147chr1131 ------
NM_000210chr21561 ------
NM_000211chr21--127 ----
NM_000214chr202182 21 ----125
NM_000217chr12--1727 ----
NM_000228chr1139 ------
NM_000232chr4--12319 ----
NM_000238chr7259 50 ------
NM_000259chr1534901 4868 4232 ------
NM_000264chr9--1857 ----
NM_000267chr1722272 184 ------
NM_000280chr111114 ------
NM_000314chr1021040 635 ------
NM_000319chr121132 1327 ----
NM_000335chr321519 161 11957 ----
NM_000337chr5--167 ----
NM_000362chr2212808 22570 535 ----
NM_000403chr1141 ------
NM_000408chr21106 ------
NM_000425chrX2184 108 --2642 595 --
NM_000428chr1412374 1813 ----
NM_000430chr1722994 1359 ----13047
NM_000435chr191847 ------
NM_000449chr11164 1511 ----
NM_000461chr344026 3293 3131 579 ------
NM_000480chr111417 ------
NM_000495chrX--1104 ----
NM_000523chr21170 ------
NM_000552chr12134 ------
NM_000555chrX25491 4980 ------
NM_000599chr213155 24089 3593 ----
NM_000609chr1032330 1070 901 ----12385
NM_000615chr111783 11029 ----
NM_000618chr1216058 ------
NM_000618chr1216058 ------
NM_000625chr17127 ------
NM_000724chr10--1269 ----
NM_000725chr123885 282 144 ------
NM_000726chr211326 ------
NM_000756chr8182 ------
NM_000812chr41410 ------
NM_000817chr2--1351 ----
NM_000818chr10--1167 ----
NM_000831chr121257 319 64797 4372 670 460 225 109 1568 --
NM_000833chr1611362 ------
NM_000875chr1524819 133 16127 1580 --
NM_000901chr41535 ------
NM_000918chr17--1591 3315 106 27 --
NM_000937chr171378 ------
NM_000939chr2178 1219 ----
NM_000960chr192506 154 ------
NM_001001331chr3------148
NM_001001342chr10--11084 ----
NM_001001395chr1212686 1592 ----
NM_001001549chr731108 291 201 ------
NM_001001550chr731108 291 201 ------
NM_001001555chr731108 291 201 ------
NM_001001890chr2134163 3108 38 --4205 202 199 41 --
NM_001001933chr11131 ------
NM_001002762chr1052335 1154 1040 774 48 32599 2469 667 12570 --
NM_001002909chr1712106 ------
NM_001003407chr1045021 430 371 107 ------
NM_001003408chr1045021 430 371 107 ------
NM_001003652chr1827356 394 ------
NM_001003800chr9124 ------
NM_001003809chr184240 72 57 21 --3331 243 24 128
NM_001003940chr1523717 1232 ------
NM_001003942chr1523717 1232 ------
NM_001003943chr1523721 1236 ------
NM_001004051chrX121 ------
NM_001004065chr912927 13772 ----
NM_001004105chr5135 ------
NM_001004304chr1212674 12006 --1865
NM_001004317chr613048 1529 ----
NM_001004354chr9----3419 416 250 --
NM_001005271chr1721072 1053 178 ----
NM_001005273chr1721072 1053 178 ----
NM_001005360chr191851 1567 181 --
NM_001005361chr191851 1567 181 --
NM_001005362chr191851 1567 181 --
NM_001005366chr121242 ------
NM_001005404chr1722795 330 --1453 --
NM_001005463chr1011827 ------
NM_001005505chr341655 337 318 180 ------
NM_001005743chr141200 1477 ----
NM_001005744chr141200 1477 ----
NM_001005745chr141200 1477 ----
NM_001005746chr211326 ------
NM_001005747chr211326 ------
NM_001005753chr21409 22053 49 ----
NM_001006115chr342691 2425 1915 243 22820 1103 12773 --
NM_001006617chr92989 269 ------
NM_001006619chr92989 269 ------
NM_001006620chr92989 269 ------
NM_001006621chr92989 269 ------
NM_001007024chr1771283 1269 1228 1178 1129 1048 893 5854 814 774 513 399 1932 1593
NM_001007025chr1771283 1269 1228 1178 1129 1048 893 5854 814 774 513 399 1932 1593
NM_001007098chr11109 ------
NM_001007156chr1511314 --1468 --
NM_001007226chr171984 160 ----
NM_001007227chr171984 160 ----
NM_001007228chr171984 160 ----
NM_001007229chr171984 160 ----
NM_001007230chr171984 160 ----
NM_001007271chr103741 402 385 1432 ----
NM_001007277chr11----191 --
NM_001007533chr17138 --162 --
NM_001007553chr11908 ------
NM_001007559chr1811655 ------
NM_001008216chr1141 ------
NM_001008220chr522505 860 23171 778 ----
NM_001008392chr313324 ----11010
NM_001008407chr711179 1518 ----
NM_001008660chr111350 ------
NM_001008701chr1942644 2410 1038 455 21916 1106 ----
NM_001008925chr412952 ------
NM_001008938chr111396 ------
NM_001009566chr121400 135 2232 49 ----
NM_001009880chr2233547 1014 208 156 13550 --
NM_001009993chr232956 2869 160 13564 ----
NM_001010854chr14128 ------
NM_001010924chr102480 207 1877 ----
NM_001010926chr1--1696 185 --
NM_001012329chr132208 710 605 11656 ----
NM_001012420chr15--1349 ----
NM_001012423chr15--1349 ----
NM_001012426chr652525 2458 2159 1055 715 13366 22488 971 --
NM_001012427chr652525 2458 2159 1055 715 13366 22488 971 --
NM_001012614chr41692 --1631 --
NM_001012755chrX13455 ------
NM_001013622chr48866 465 404 280 221 157 95 33 1343 ----
NM_001013690chr1221986 200 --150 --
NM_001013693chr122216 614 12709 --11938
NM_001013693chr122216 614 12709 --11938
NM_001013839chr1742088 1668 1011 720 12423 ----
NM_001014283chr1351539 1519 1474 1382 424 --1302 --
NM_001014435chr163409 237 187 1529 ----
NM_001014809chr41797 ------
NM_001017395chr353630 3277 2643 1018 1009 ------
NM_001017402chr1139 ------
NM_001017405chr42678 90 ------
NM_001017440chr756306 5112 3058 1936 747 1758 13135 12458
NM_001017523chr122118 51 ------
NM_001017999chr1125 ----1195
NM_001017999chr1125 ----1195
NM_001018000chr1125 ----1195
NM_001018000chr1125 ----1195
NM_001018001chr1125 ----1195
NM_001018004chr151524 1219 ----
NM_001018006chr151524 1219 ----
NM_001018007chr151524 1219 ----
NM_001018020chr151524 1219 ----
NM_001018050chr2233271 2145 1222 ------
NM_001018052chr2233271 2145 1222 ------
NM_001018064chr9177 ------
NM_001018070chr11189 --138 --
NM_001018072chr122118 51 ------
NM_001024226chr12768 91 ------
NM_001024227chr12768 91 ------
NM_001024228chr12768 91 ------
NM_001024455chrX22245 226 21983 69 ----
NM_001024463chr152442 38 ------
NM_001024666chrX1474 ------
NM_001024668chr122788 744 ------
NM_001024808chr1232389 1026 995 1518 12392 --
NM_001024858chr142153 138 1615 3407 81 78 --
NM_001024937chr17171 ------
NM_001024948chr132285 2278 2166 ------
NM_001025076chr1015136 12112 15697 --
NM_001025077chr1026494 1355 --17055 --
NM_001025105chr521521 1170 ------
NM_001025108chr21184 ------
NM_001025205chr32108 60 ------
NM_001025389chr111417 ------
NM_001025390chr111417 ------
NM_001025579chr173876 298 73 ------
NM_001025603chr11164 1511 ----
NM_001029875chr512582 1181 ----
NM_001029998chr411324 ------
NM_001031690chr72571 534 1911 ----
NM_001031702chr31116 1276 ----
NM_001031740chr111191 1484 1300 --
NM_001031804chr1614177 ------
NM_001032280chr61121 --6142 139 136 133 130 127 --
NM_001032289chrX194 ------
NM_001032296chr1332532 2093 1159 32640 2367 2149 ----
NM_001032363chr1--186 ----
NM_001032363chr1--186 ----
NM_001033059chr6--1434 ----
NM_001033112chr5--1823 ----
NM_001033117chr334348 1553 1196 13414 24464 23 --
NM_001033557chr2--1580 ----
NM_001033578chr8--12323 ----
NM_001033723chr8139 ------
NM_001034837chr52733 274 ------
NM_001034838chr52733 274 ------
NM_001034954chr103462 341 239 --12449 --
NM_001034955chr103462 341 239 --12449 --
NM_001034956chr103462 341 239 --12449 --
NM_001034957chr103462 341 239 --12449 --
NM_001035003chr411334 ------
NM_001035004chr411334 ------
NM_001035254chr93981 822 312 --1668 --
NM_001035256chr2178 1219 ----
NM_001035260chr101320 ------
NM_001037334chr182321 201 ------
NM_001037639chr3141 ------
NM_001038493chr2150 ------
NM_001038707chr1169 ------
NM_001038707chr1169 ------
NM_001039467chr20----130 --
NM_001039550chr23714 676 28 ------
NM_001039690chr16------159
NM_001039762chr10131 ------
NM_001039771chr141877 ------
NM_001039772chr11--125 ----
NM_001039840chrX1318 ------
NM_001039877chr193581 266 175 128 1699 --
NM_001039960chr1211064 ------
NM_001040101chr41158 1476 ----
NM_001040110chr71571 ------
NM_001040113chr162909 749 ------
NM_001040118chr11----138 --
NM_001040144chr16------159
NM_001040146chr16------159
NM_001040152chr731711 1099 952 21505 436 31126 1123 1102 11091
NM_001040167chr71754 11040 171 --
NM_001040284chr1612069 ------
NM_001040424chr2132768 917 865 ------
NM_001040446chr52924 782 1670 1711 --
NM_001040450chr15--12332 ----
NM_001040453chr15--12332 ----
NM_001040633chr72746 389 1799 ----
NM_001042404chr11235 ------
NM_001042424chr421020 181 1107 1426 1430
NM_001042425chr61121 --6142 139 136 133 130 127 --
NM_001042478chr12332 45 ------
NM_001042486chr2011477 --41480 987 984 981 --
NM_001042492chr1722272 184 ------
NM_001042498chrX1231 179 ----
NM_001042506chrX1278 ------
NM_001042510chr81542 ------
NM_001042511chr81542 ------
NM_001042537chrX1465 ------
NM_001042555chr1211249 13142 ----
NM_001042599chr237156 1738 288 ------
NM_001042632chr203259 170 47 1111 ----
NM_001042633chr203259 170 47 1111 ----
NM_001042681chr112217 ------
NM_001042682chr112217 ------
NM_001042682chr112217 ------
NM_001043318chr1453933 3445 2642 779 392 23380 1312 3410 407 404 1514
NM_001044385chr211189 11427 ----
NM_001065chr123206 157 112 --1168 --
NM_001079874chr1--11766 ----
NM_001080418chr1190 ------
NM_001092chr1771808 1681 663 607 598 571 181 22376 414 1611 --
NM_001094chr173536 193 142 ------
NM_001095chr123272 252 69 1346 ----
NM_001106chr326643 1833 27387 6592 ----
NM_001113490chrX11282 ------
NM_001116chr1652407 1233 1117 1020 763 1297 1213 --
NM_001117chr18--11929 ----
NM_001122631chr112635 107 1525 ----
NM_001144chr163298 111 25 ------
NM_001148chr41178 ------
NM_001149chr1021064 113 ------
NM_001153chr21123 ------
NM_001177chr1221923 1851 ------
NM_001188chr61232 ------
NM_001191chr20--21077 71 ----
NM_001194chr191183 290 50 3575 423 80 --
NM_001206chr912080 --12134 --
NM_001221chr4198 ------
NM_001241chr2--1204 ----
NM_001241chr2--1204 ----
NM_001249chr141152 ------
NM_001253chr61291 ------
NM_001259chr71375 2317 288 16243 --
NM_001292chr152965 38 11081 ----
NM_001313chr41797 ------
NM_001328chr41692 --1631 --
NM_001331chr113708 143 114 ------
NM_001332chr51560 ------
NM_001345chr12--186 ----
NM_001346chr322013 721 --1636 --
NM_001364chr1113442 ------
NM_001365chr171754 ------
NM_001386chr81394 ------
NM_001387chr522969 529 ------
NM_001389chr21--1506 ----
NM_001396chr21----11749 --
NM_001404chr11126 ------
NM_001406chr17--11717 ----
NM_001417chr12--1512 ----
NM_001418chr11--1302 ----
NM_001418chr11--1302 ----
NM_001426chr2----251 48 1701
NM_001429chr22--1737 ----
NM_001438chr1--11366 ----
NM_001453chr611682 ------
NM_001456chrX4215 120 100 91 ------
NM_001463chr21680 ------
NM_001500chr62121 69 ------
NM_001508chr21643 ------
NM_001518chr71817 ------
NM_001523chr19121 ------
NM_001543chr574403 4349 4204 2936 1422 1381 262 ----1381
NM_001604chr111114 ------
NM_001614chr171711 ------
NM_001614chr171711 ------
NM_001618chr1--183 ----
NM_001626chr1983482 3348 2302 1284 651 432 392 371 ----137
NM_001634chr6--1434 ----
NM_001635chr72829 349 ------
NM_001642chr112967 88 ----192
NM_001654chrX196 ------
NM_001658chr12768 91 ------
NM_001665chr112393 26 ------
NM_001668chr11485 ------
NM_001677chr11315 ------
NM_001679chr31196 1220 ----
NM_001681chr121747 1309 ----
NM_001683chr3------148
NM_001701chr9--192 ----
NM_001707chr72615 67 --1618 --
NM_001722chr8146 ------
NM_001753chr711379 ------
NM_001754chr2134163 3108 38 --4205 202 199 41 --
NM_001759chr1245201 3948 3243 1697 ------
NM_001773chr111382 ------
NM_001783chr19124 --2297 247 --
NM_001842chr92176 160 ------
NM_001854chr11110 1616 ----
NM_001892chr521521 1170 ------
NM_001893chr171314 ------
NM_001894chr22--1242 1223 1783
NM_001896chr161327 ------
NM_001903chr51589 ------
NM_001914chr18196 --199 --
NM_001918chr116408 ------
NM_001923chr112116 54 ------
NM_001939chrX23400 320 ------
NM_001945chr51126 ------
NM_001949chr612123 1828 ----
NM_001954chr61237 1717 ----
NM_001958chr20141 ------
NM_001961chr192135 26 ------
NM_001964chr51221 ------
NM_001965chr21149 --133 --
NM_001980chr121179 ------
NM_001986chr17240 26 ------
NM_002010chr131203 1429 ----
NM_002028chr1421266 1079 ------
NM_002037chr6141 ------
NM_002040chr21--12990 ----
NM_002047chr71130 ------
NM_002076chr1212369 1733 ----
NM_002086chr172472 74 ------
NM_002088chr192211 125 ------
NM_002105chr114384 350 213 97 127 3892 244 163 --
NM_002115chr5132 ------
NM_002126chr1743146 2912 2794 757 ------
NM_002141chr7--1249 ----
NM_002145chr17148 ------
NM_002147chr172644 80 --184 --
NM_002157chr2139 ------
NM_002205chr121916 ------
NM_002206chr12132 1434 ----
NM_002221chr121018 369 1401 ----
NM_002222chr3--1485 ----
NM_002226chr143876 676 54 --1855 --
NM_002227chr11894 1393 ----
NM_002229chr191113 --1309 --
NM_002234chr121191 ------
NM_002249chr11498 ------
NM_002254chr25893 330 239 76 21 12311 ----
NM_002264chr323231 1253 ------
NM_002265chr17--1178 ----
NM_002267chr131333 ------
NM_002268chr31411 ------
NM_002285chr21184 ------
NM_002296chr1--147 ----
NM_002305chr22138 ------
NM_002313chr1045021 430 371 107 ------
NM_002315chr111102 ------
NM_002332chr121220 ------
NM_002359chr1793914 3317 1652 1644 1609 1509 1075 239 63 --11672 --
NM_002373chr151973 ------
NM_002375chr372324 1996 1804 1561 716 688 263 ------
NM_002390chr1731973 687 62 --11716 --
NM_002397chr512112 ------
NM_002401chr175975 592 517 30 23 22259 678 ----
NM_002419chr113459 91 34 ------
NM_002442chr124604 318 170 94 --197 --
NM_002479chr12205 93 1583 ----
NM_002499chr1532345 2298 1881 ------
NM_002501chr1953780 3482 1084 935 490 --21090 1087 --
NM_002515chr14--12022 ----
NM_002521chr1170 ------
NM_002522chr172648 110 11279 1113 --
NM_002537chr151914 ------
NM_002539chr2--1114 ----
NM_002586chr611045 ------
NM_002607chr721066 350 11126 1958 --
NM_002616chr172488 165 ------
NM_002632chr141689 ------
NM_002650chr22--188 ----
NM_002653chr53859 257 110 ------
NM_002660chr2041166 738 328 56 1964 ----
NM_002673chr32528 424 2518 446 ----
NM_002687chr14190 ------
NM_002697chr11104 122 ----
NM_002698chr1932709 517 96 --172 --
NM_002699chr12933 32 --2263 195 --
NM_002707chr21337 ------
NM_002710chr121733 ------
NM_002717chr81657 ------
NM_002721chr91112 ------
NM_002747chr18298 76 ------
NM_002753chr41140 ------
NM_002761chr161127 ------
NM_002821chr61808 ------
NM_002823chr2143 ------
NM_002824chr121452 1120 ----
NM_002835chr71241 ------
NM_002845chr181187 ------
NM_002850chr1941036 911 210 183 --1213 --
NM_002855chr1123593 114 53544 3395 3386 2386 1270 ----
NM_002865chr8124 ------
NM_002868chr1222229 125 ------
NM_002869chr111134 12228 ----
NM_002871chr1----190 --
NM_002874chr92937 196 ------
NM_002880chr31690 129 ----
NM_002885chr12190 127 ------
NM_002892chr14--137 ----
NM_002897chr2--1529 ----
NM_002911chr1931562 1242 1078 --1496 --
NM_002918chr192277 231 --2835 726 --
NM_002931chr61207 ------
NM_002941chr31329 ------
NM_002945chr171678 ------
NM_002959chr124168 1009 ------
NM_003010chr17--1807 ----
NM_003011chr91114 ------
NM_003021chr1961147 1130 1075 1016 754 317 ------
NM_003030chr321927 70 ------
NM_003045chr134797 640 304 211 1899 ----
NM_003072chr191301 ------
NM_003075chr121249 ------
NM_003076chr1221485 59 ------
NM_003081chr201426 ------
NM_003099chr1515208 --139 --
NM_003108chr275750 2823 2798 2739 2620 2145 2043 --12190 --
NM_003112chr71509 ------
NM_003113chr2149 ------
NM_003139chr111351 1168 131 --
NM_003149chr3188 1197 ----
NM_003155chr811923 ------
NM_003161chr1713512 ------
NM_003164chr111480 171 ----
NM_003165chr941675 1525 230 113 --11399 --
NM_003173chrX41189 1087 398 68 ------
NM_003178chr321393 794 ------
NM_003185chr201297 ------
NM_003199chr181527 ------
NM_003200chr1942012 1811 923 583 ------
NM_003202chr541389 463 241 52 ------
NM_003204chr1721580 1493 ------
NM_003220chr61121 --6142 139 136 133 130 127 --
NM_003253chr2111731 ------
NM_003255chr1732474 2262 822 ------
NM_003269chr61170 1244 ----
NM_003298chr311146 15670 1906 --
NM_003317chr142560 83 ------
NM_003325chr221295 --153 --
NM_003344chr731515 640 308 ------
NM_003345chr162410 140 ------
NM_003347chr2222339 2212 ------
NM_003371chr93717 580 274 ----1800
NM_003378chr7138 ------
NM_003410chrX12015 ------
NM_003412chr311058 1283 ----
NM_003459chr22709 67 ------
NM_003470chr1651665 712 553 350 112 ------
NM_003474chr10--1142 ----
NM_003482chr1232094 625 113 ------
NM_003485chr143208 88 69 1343 ----
NM_003486chr1652244 1107 468 104 21 12198 1124 --
NM_003498chr163797 199 79 1766 ----
NM_003502chr163589 509 21 ------
NM_003508chr7294 32 ------
NM_003521chr6163 ------
NM_003528chr1139 ------
NM_003538chr6158 ------
NM_003542chr6176 ------
NM_003545chr6163 ------
NM_003557chr111383 11397 ----
NM_003563chr171984 160 ----
NM_003564chr12623 485 ------
NM_003576chr1332532 2093 1159 32640 2367 2149 ----
NM_003583chr12--23783 2439 ----
NM_003586chr162455 94 ------
NM_003603chr42156 30 --1159 1115
NM_003624chr1911251 21269 330 ----
NM_003629chr11201 13134 ----
NM_003632chr171591 ------
NM_003654chr111639 ------
NM_003659chr2--1292 ----
NM_003660chr193685 500 489 ------
NM_003664chr5166 ------
NM_003673chr171420 ------
NM_003685chr191103 ------
NM_003701chr131931 ------
NM_003704chr42166 125 ------
NM_003713chr11420 ------
NM_003741chr31344 ------
NM_003744chr141200 1477 ----
NM_003758chr1511120 1186 ----
NM_003758chr1511120 1186 ----
NM_003791chr16--1227 ----
NM_003822chr113033 ------
NM_003827chr192424 108 ------
NM_003831chr18--151 ----
NM_003835chr171258 ------
NM_003872chr21509 1593 ----
NM_003876chr17----1264 --
NM_003893chr10--1471 ----
NM_003897chr61625 ------
NM_003916chrX1126 ------
NM_003924chr42685 100 1108 1169 --
NM_003938chr1941131 462 404 135 1469 ----
NM_003971chr17135 ------
NM_003988chr1071911 1810 1466 357 324 49 25 --41469 612 306 62 --
NM_004036chr22684 262 ------
NM_004050chr142786 506 ------
NM_004068chr32108 60 ------
NM_004093chr1351022 772 605 253 147 ------
NM_004169chr17148 1281 ----
NM_004185chr11689 ------
NM_004186chr32917 902 ------
NM_004200chr111758 ------
NM_004202chrY1125 ------
NM_004205chr113485 409 128 ------
NM_004227chr752673 1973 1190 190 97 22433 2183 ----
NM_004228chr19139 ------
NM_004232chr18--197 ----
NM_004302chr123532 375 54 --1500 12766
NM_004309chr1751044 923 458 443 274 ------
NM_004311chr1032850 968 907 ------
NM_004319chr122297 435 22849 27 ----
NM_004321chr293474 2958 2853 2698 2628 2437 1242 282 76 11082 12197 --
NM_004327chr221421 ------
NM_004329chr10--1562 ----
NM_004349chr81890 ------
NM_004356chr11----1468 --
NM_004370chr621376 482 ------
NM_004377chr22123 ------
NM_004380chr16--12170 ----
NM_004393chr311746 --12101 --
NM_004395chr53143 74 39 ------
NM_004405chr21438 196 192 --
NM_004411chr71261 ------
NM_004414chr211424 ------
NM_004416chr12--1987 ----
NM_004420chr1142353 1523 864 332 --2590 28 --
NM_004421chr1154 1644 ----
NM_004422chr171459 2109 62 ----
NM_004429chrX21287 1125 ------
NM_004430chr86760 742 644 466 460 300 --1766 --
NM_004438chr242672 2237 1276 559 1319 ----
NM_004451chr111221 ------
NM_004454chr311479 1638 ----
NM_004456chr7139 ------
NM_004459chr171430 ------
NM_004468chr11515 1528 ----
NM_004472chr5----1130 --
NM_004484chrX128 ------
NM_004491chr1953439 3409 1590 993 196 23886 174 ----
NM_004500chr1411444 ------
NM_004501chr113940 ------
NM_004515chr1154 ------
NM_004529chr9--11042 ----
NM_004530chr162478 297 1309 ----
NM_004543chr2197 ------
NM_004550chr11182 ------
NM_004554chr141189 ------
NM_004571chr2112367 ----1316
NM_004583chr17----123 --
NM_004586chrX11393 15256 ----
NM_004588chr1122967 336 22481 1041 12508 --
NM_004602chr202265 245 ------
NM_004603chr721154 78 2280 63 ----
NM_004625chr3129 ------
NM_004630chr111918 1298 ----
NM_004637chr3--1121 ----
NM_004643chr141279 ------
NM_004655chr1731182 848 263 ------
NM_004656chr311192 ------
NM_004667chr15278 58 ------
NM_004700chr11139 ------
NM_004703chr17--12583 ----
NM_004709chrX1419 11229 ----
NM_004725chr101486 ------
NM_004732chr17269 38 --1270 --
NM_004737chr221140 ------
NM_004742chr311615 ------
NM_004746chr184240 72 57 21 --3331 243 24 128
NM_004747chr10137 ------
NM_004748chr1523768 731 ------
NM_004758chr1711068 ------
NM_004776chr2031011 265 184 ------
NM_004783chr162510 202 ------
NM_004788chr1111839 ------
NM_004801chr21494 ------
NM_004818chr12143 ------
NM_004831chr19189 ------
NM_004840chrX32345 574 408 12282 ----
NM_004860chr17144 ------
NM_004861chr22179 --166 --
NM_004862chr162148 34 ------
NM_004871chr1771283 1269 1228 1178 1129 1048 893 5854 814 774 513 399 1932 1593
NM_004896chr101235 ------
NM_004899chr22161 147 ------
NM_004906chr61198 ------
NM_004924chr192969 837 ------
NM_004925chr9----132 --
NM_004926chr1411767 ------
NM_004945chr191851 1567 181 --
NM_004953chr34345 337 165 60 ------
NM_004962chr10143 ------
NM_004968chr7134 ------
NM_004973chr611662 ------
NM_004991chr3245 37 ------
NM_004992chrX56844 6582 5867 3187 3121 33029 2180 1386 ----
NM_004992chrX56844 6582 5867 3187 3121 33029 2180 1386 ----
NM_004998chr151371 ------
NM_005011chr71571 ------
NM_005026chr121473 123 ------
NM_005032chrX1271 ------
NM_005076chr153497 929 268 171 26 174 ----
NM_005097chr10--123 ----
NM_005099chr1179 ------
NM_005103chr112253 27 ------
NM_005105chr111664 12116 ----
NM_005110chr5--1199 ----
NM_005116chr2023897 3798 21262 856 ----
NM_005117chr111226 134 ----
NM_005121chr1723736 57 ------
NM_005137chr2242185 827 444 113 1423 --12201
NM_005151chr182321 201 ------
NM_005153chr161810 ------
NM_005174chr10147 ------
NM_005182chr163409 237 187 1529 ----
NM_005197chr1414426 ------
NM_005202chr12732 23 ------
NM_005219chr52271 174 ------
NM_005229chrX2935 229 ----1815
NM_005235chr237156 1738 288 ------
NM_005249chr141787 1300 ----
NM_005273chr71228 ------
NM_005311chr731108 291 201 ------
NM_005316chr111779 ------
NM_005334chrX1116 --1255 --
NM_005339chr413302 ------
NM_005342chrX151 1600 ----
NM_005354chr191266 --1245 --
NM_005359chr181136 ------
NM_005386chr202563 78 ------
NM_005406chr181276 ------
NM_005424chr1198 ------
NM_005436chr1022620 51 ------
NM_005458chr9--1510 ----
NM_005461chr2041851 1684 394 94 --1222 --
NM_005477chr1522586 430 2905 376 12198 --
NM_005477chr1522586 430 2905 376 12198 --
NM_005491chrX3807 603 49 3880 830 800 ----
NM_005505chr123768 600 39 1135 ----
NM_005515chr7--1436 1118 --
NM_005539chr1041335 1323 1283 521 ------
NM_005540chr1--135 ----
NM_005574chr11----149 --
NM_005575chr5163 ----1100
NM_005578chr313764 ------
NM_005596chr935896 4909 1721 ------
NM_005599chr12114 26 --171 --
NM_005607chr8--195 ----
NM_005613chr11124 ------
NM_005618chr61191 --1218 --
NM_005627chr61255 177 ----
NM_005634chrX----2550 231 --
NM_005637chr1811655 ------
NM_005668chr51324 ------
NM_005688chr321291 1038 ------
NM_005692chr7156 ------
NM_005717chr11868 --180 --
NM_005736chr101432 --11431 --
NM_005737chr21414 ------
NM_005756chrX1977 ------
NM_005768chr12--2608 140 ----
NM_005785chr1211723 ------
NM_005795chr2--11974 ----
NM_005796chr161327 1137 ----
NM_005801chr171708 ------
NM_005804chr19235 21 ------
NM_005808chr313324 ----11010
NM_005822chr6130 ------
NM_005826chr1--1113 ----
NM_005828chr1724801 363 13786 ----
NM_005841chr41842 ------
NM_005852chr1721072 1053 178 ----
NM_005873chr20----130 --
NM_005875chr3164 ------
NM_005882chr42678 90 ------
NM_005895chr1243389 2896 2731 2691 --232 29 --
NM_005898chr111732 ------
NM_005901chr1827356 394 ------
NM_005909chr513968 ------
NM_005920chr123502 1496 ------
NM_005923chr6199 ------
NM_005934chr19102358 2267 1924 1619 907 762 518 351 221 138 --2766 355 --
NM_005935chr435102 668 638 ----1793
NM_005964chr171350 ------
NM_005986chr131435 ------
NM_005996chr122611 46 ------
NM_006007chr9----13664 --
NM_006015chr1------1849
NM_006022chr131106 ------
NM_006030chr341655 337 318 180 ------
NM_006037chr264642 3329 3251 337 298 156 1851 14129 --
NM_006038chr2031451 509 354 ------
NM_006041chr173424 344 131 ------
NM_006047chr20--11171 ----
NM_006079chr6--1173 1613 --
NM_006091chr1521789 1561 1384 ----
NM_006096chr841540 394 347 21 11347 ----
NM_006100chr31118 ------
NM_006113chr1--11766 ----
NM_006133chr115697 667 601 343 134 ------
NM_006136chr7182 ------
NM_006141chr161701 ------
NM_006160chr172432 129 ------
NM_006161chr53152 140 68 ------
NM_006180chr9177 ------
NM_006186chr21110 ------
NM_006252chr116896 ------
NM_006258chr10--161 ----
NM_006270chr19148 ------
NM_006283chr824614 138 1156 ----
NM_006285chr91287 ------
NM_006293chr152397 366 ------
NM_006312chr122627 80 1919 ----
NM_006313chr121432 ------
NM_006320chr411008 1178 ----
NM_006329chr14----128 --
NM_006336chr921049 1012 124 1940 --
NM_006359chrX1465 ------
NM_006362chr112132 100 ------
NM_006369chr1167 ------
NM_006372chr6--177 ----
NM_006378chr911092 ------
NM_006387chr193811 224 168 --1791 --
NM_006390chr12136 ------
NM_006403chr611810 ------
NM_006430chr21425 ------
NM_006434chr103462 341 239 --12449 --
NM_006459chr1041926 1840 790 504 ------
NM_006482chr12--23783 2439 ----
NM_006489chr14--12022 ----
NM_006494chr193856 597 55 ------
NM_006496chr1--1807 ----
NM_006497chr173804 318 31 ----1114
NM_006516chr121392 625 ------
NM_006517chrX12064 ------
NM_006526chr201332 ------
NM_006538chr233075 2938 468 ------
NM_006540chr821501 182 ------
NM_006544chr1414383 ------
NM_006547chr711478 ------
NM_006549chr122207 34 22482 2236 140 --
NM_006555chr721952 1535 ------
NM_006561chr1015136 12112 15697 --
NM_006562chr101238 1203 2221 25 --
NM_006595chr111155 ------
NM_006618chr111167 ------
NM_006640chr171609 1134 ----
NM_006646chr131352 ------
NM_006650chr522505 860 23171 778 ----
NM_006654chr1211249 13142 ----
NM_006690chr2011576 1215 ----
NM_006698chr201314 11029 ----
NM_006709chr6151 197 ----
NM_006717chr9--22594 335 ----
NM_006720chr1045021 430 371 107 ------
NM_006729chrX11585 24841 1217 ----
NM_006734chr611078 ------
NM_006736chr231724 1686 585 ------
NM_006742chr1622005 1505 12024 ----
NM_006749chr82821 77 ------
NM_006763chr1143 --129 --
NM_006766chr8--11898 ----
NM_006772chr62219 191 ------
NM_006775chr611246 ------
NM_006791chr15--1208 ----
NM_006802chr111026 ------
NM_006815chr121218 1515 ----
NM_006852chr17--11774 ----
NM_006854chr711719 ------
NM_006884chr321927 70 ------
NM_006885chr1622863 1143 ------
NM_006887chr2--1518 ----
NM_006896chr71220 ------
NM_006899chr201294 ------
NM_006927chr164528 464 283 170 ------
NM_006936chr21126 ------
NM_006939chr14--1230 ----
NM_006943chr2053027 2617 1299 815 688 --2692 231 --
NM_006946chr11--1519 ----
NM_007006chr16134 ------
NM_007008chr21312 ------
NM_007011chr1556613 6358 4565 4553 867 ------
NM_007038chr2115784 ------
NM_007084chr13166 ------
NM_007106chr1312227 1308 ----
NM_007108chr162539 62 ------
NM_007118chr5197 1762 ----
NM_007126chr91365 ------
NM_007144chr172804 522 --11113 --
NM_007146chr1712750 ------
NM_007158chr11908 ------
NM_007162chr61576 1540 ----
NM_007166chr111350 ------
NM_007184chr31547 1523 ----
NM_007185chr11120 ----1745
NM_007198chr8--11512 ----
NM_007203chr912927 13772 ----
NM_007232chr205992 931 278 110 71 --1998 --
NM_007245chr162359 90 --193 197
NM_007249chr1327608 932 ------
NM_007260chr11298 ------
NM_007271chr611189 11285 ----
NM_007284chr3143 ------
NM_007368chr1331280 950 38 --1113 1165
NM_009588chr63600 198 186 ------
NM_012074chr141754 ------
NM_012083chr1031161 175 34 ----191
NM_012090chr11129 ------
NM_012102chr112217 ------
NM_012129chr712222 11762 ----
NM_012134chr1--21361 1297 ----
NM_012168chr1131 ------
NM_012207chr101269 ------
NM_012210chr9--11556 ----
NM_012214chr226145 1711 ------
NM_012234chr3--1122 ----
NM_012247chr101286 ------
NM_012281chr71253 ------
NM_012298chr3--1200 ----
NM_012306chr1243206 2581 212 155 43469 938 859 100 ----
NM_012309chr1153876 3770 3709 3496 271 21350 1032 ----
NM_012316chr144417 1562 644 116 12192 ----
NM_012326chr21260 1286 1683 --
NM_012330chr1011632 1458 ----
NM_012334chr531072 164 103 ----1277
NM_012384chr2032311 1746 1505 ------
NM_012398chr1941914 1146 633 52 1745 31005 112 67 --
NM_012399chr22--11268 ----
NM_012405chr133259 1309 75 13095 --179
NM_012412chr7--1662 ----
NM_012425chr1012330 ------
NM_012428chr15--1364 ----
NM_012434chr611202 2511 452 ----
NM_012465chr1012331 ------
NM_012479chr711834 1961 ----
NM_013257chr8--12323 ----
NM_013261chr41605 ------
NM_013275chr163742 207 46 ------
NM_013283chr5--1690 ----
NM_013286chr333369 3006 2550 --13372 1541
NM_013372chr151117 ------
NM_013399chr162637 158 ------
NM_013403chr193581 266 175 128 1699 --
NM_013433chr193671 464 67 ------
NM_013446chr711421 ------
NM_013449chr12184 12939 ----
NM_013960chr81605 ------
NM_013993chr61237 1717 ----
NM_013994chr61237 1717 ----
NM_014001chr1721626 46 21200 480 ----
NM_014015chr16276 63 ------
NM_014021chr111340 --13068 --
NM_014023chr1032262 818 421 ------
NM_014043chr3--1462 ----
NM_014079chr31296 --1161 --
NM_014112chr813919 ------
NM_014190chr441650 695 244 217 144 11600 --
NM_014191chr121306 ------
NM_014226chr145409 366 178 156 142 ------
NM_014231chr121344 ------
NM_014233chr1731574 660 552 ------
NM_014235chrX31711 281 45 ------
NM_014240chr343682 2791 930 840 1391 --12991
NM_014251chr71796 ------
NM_014279chr9--167 ----
NM_014299chr1952020 1694 1507 217 201 ------
NM_014319chr1211749 ------
NM_014342chr1121467 1250 ------
NM_014351chr2221216 1011 ------
NM_014368chr9257 46 ------
NM_014392chr41158 1476 ----
NM_014393chr81208 ------
NM_014417chr194879 747 302 290 ------
NM_014426chr201677 ------
NM_014449chr12180 ------
NM_014482chr21105 ------
NM_014494chr16189 --172 --
NM_014515chr122870 185 ------
NM_014516chr191188 ------
NM_014517chr31259 ------
NM_014520chr171136 ----1113
NM_014564chr9143 ------
NM_014572chr13----132 --
NM_014573chr1711779 ------
NM_014574chr141374 ------
NM_014592chr52733 274 ------
NM_014613chr522284 181 12112 ----
NM_014630chr153824 365 235 22636 143 ----
NM_014634chr2243247 2438 2296 1454 22914 2889 11122 --
NM_014636chr923355 441 ------
NM_014655chr131921 1507 468 ------
NM_014659chr152442 38 ------
NM_014661chr1063884 3379 3277 2942 1282 153 12552 ----
NM_014665chr8112537 1442 1365 1327 1315 1290 1188 1151 651 278 31 --23058 1389 --
NM_014667chr31292 --12328 --
NM_014670chr211197 ------
NM_014671chr72503 433 ------
NM_014686chr1921899 807 ------
NM_014690chr72571 534 1911 ----
NM_014699chr161393 ------
NM_014727chr19142 ----152
NM_014730chr1244886 4334 4264 2103 11003 ----
NM_014730chr1244886 4334 4264 2103 11003 ----
NM_014732chr1695554 4763 4627 4529 4332 1984 1680 1248 126 31705 1603 72 24866 1279 1422
NM_014743chr41948 ------
NM_014746chr243942 2759 902 140 ------
NM_014748chr23407 305 268 ------
NM_014751chr821802 824 ------
NM_014755chr223509 537 ------
NM_014756chr111396 ------
NM_014757chr521967 1825 ------
NM_014761chr161829 ------
NM_014764chr121250 ------
NM_014765chr111856 ------
NM_014767chr1042850 1382 1242 22 ------
NM_014772chr1843547 3470 1452 540 33217 1265 472 ----
NM_014782chrX--1122 ----
NM_014788chr93211 44 37 22898 795 ----
NM_014812chr11235 ------
NM_014820chr311761 ------
NM_014830chr12----13689 --
NM_014835chr202854 193 --1777 --
NM_014847chr1----1105 --
NM_014848chr15--12425 ----
NM_014849chr121215 964 ------
NM_014850chr334348 1553 1196 13414 24464 23 --
NM_014871chr121527 ------
NM_014891chr7--11062 189 146
NM_014901chr51237 ------
NM_014902chr2011477 --41480 987 984 981 --
NM_014912chr101804 1324 ----
NM_014913chr1811534 ------
NM_014916chr72610 276 ------
NM_014921chr1942644 2410 1038 455 21916 1106 ----
NM_014944chr121400 135 2232 49 ----
NM_014946chr212911 ------
NM_014947chr11216 13111 ----
NM_014952chr1511823 11753 1443 --
NM_014956chr114967 890 312 68 ------
NM_014974chr1011494 ------
NM_014982chr1424382 225 ------
NM_015008chr353630 3277 2643 1018 1009 ------
NM_015024chr81193 ------
NM_015025chr232157 2132 443 12075 ----
NM_015035chr2025007 2411 2163 84 ----
NM_015042chr1534239 3630 694 ------
NM_015044chr1611127 32764 2747 615 ----
NM_015045chr1011420 ------
NM_015063chr191480 11052 ----
NM_015068chr71563 21345 357 ----
NM_015069chr163248 139 51 ------
NM_015071chr535172 4807 1036 22383 693 ----
NM_015075chrX2869 258 1561 11982 152
NM_015076chr624385 3600 ------
NM_015080chr115699 650 183 106 32 ------
NM_015082chr522140 165 ------
NM_015090chr176144 5773 5660 5129 2501 2001 1547 45512 1750 1713 1054 ----
NM_015091chr141741 ------
NM_015092chr161326 ------
NM_015093chr61455 ------
NM_015101chr142753 1974 1936 850 ------
NM_015103chr31816 2375 321 ----
NM_015104chr11133 ------
NM_015143chr421112 296 ------
NM_015144chr1623629 3337 13403 ----
NM_015149chr1--12228 ----
NM_015155chr1022476 84 23193 2458 ----
NM_015157chr112994 148 2752 311 1998 --
NM_015162chr152542 398 ------
NM_015163chr14127 11325 ----
NM_015171chr162159 141 140 2163 129 --
NM_015194chr1721572 68 2844 512 ----
NM_015197chr1463194 3168 2914 2247 453 409 1581 ----
NM_015200chr41353 ------
NM_015209chr1125 ----1195
NM_015213chr112269 238 ------
NM_015215chr1--11957 ----
NM_015219chr1742088 1668 1011 720 12423 ----
NM_015221chr10132 ------
NM_015229chr1731052 930 774 1457 1290 --
NM_015238chr51568 ------
NM_015242chr11----138 --
NM_015246chr1651990 1451 610 511 298 ------
NM_015250chr9--1262 ----
NM_015264chr2233547 1014 208 156 13550 --
NM_015267chr121656 ------
NM_015282chr262499 2448 2332 2320 2228 84 12257 22336 2293 --
NM_015284chr121366 159 ------
NM_015288chr533767 2616 1044 3753 222 112 11142 --
NM_015294chr17--1347 ----
NM_015299chr1443646 2919 45 24 ------
NM_015310chr827991 5279 27165 7000 12766 --
NM_015315chr51690 22327 1168 ----
NM_015317chr212216 ------
NM_015321chr1984862 3711 1979 1511 307 195 33 24 1120 1508 --
NM_015327chr111187 ------
NM_015328chr722147 106 ------
NM_015332chr743479 2848 210 59 11238 ----
NM_015338chr2031917 728 214 11292 ----
NM_015339chr201128 ------
NM_015345chr622716 244 ------
NM_015349chr6--21995 588 ----
NM_015374chr2251404 1029 992 504 402 125 160 --
NM_015385chr103462 341 239 --12449 --
NM_015388chr6--1110 ----
NM_015416chr122788 744 ------
NM_015447chr91238 ------
NM_015470chr221188 48 --1477 --
NM_015481chr122976 251 ------
NM_015483chr711011 ----11057
NM_015508chr3--11415 ----
NM_015520chr312064 1255 ----
NM_015530chr2--1254 ----
NM_015535chr243691 3536 2738 1615 --13549 172
NM_015542chr1011214 ------
NM_015545chr71304 ------
NM_015550chr712572 ------
NM_015554chr1512924 ------
NM_015564chr512812 ------
NM_015568chr2022996 152 24293 3075 ----
NM_015577chr5173 ----177
NM_015584chr172423 407 21303 262 ----
NM_015609chr142914 2413 670 23 2701 37 ----
NM_015686chrX22239 895 ------
NM_015694chr71303 --123 --
NM_015716chr17171 ------
NM_015726chr1--136 ----
NM_015872chr121491 702 ------
NM_015879chr18--28387 5668 13288 --
NM_015892chr1042185 1518 829 460 21703 44 ----
NM_015902chr81325 ------
NM_015906chr114735 ------
NM_015964chr16135 ------
NM_015980chr5----1216 --
NM_015981chr541986 1254 35 22 12097 ----
NM_015982chr17--135 ----
NM_015995chr1545188 4875 298 26 22076 1897 14406 --
NM_016037chr11809 ------
NM_016076chr11201 ------
NM_016079chr21409 22053 49 ----
NM_016081chr4--11475 ----
NM_016083chr623101 2938 ------
NM_016096chr81542 ------
NM_016098chr61171 ------
NM_016140chr16135 ------
NM_016147chr112954 52 ------
NM_016201chr341779 828 404 91 ------
NM_016203chr72746 389 1799 ----
NM_016217chr633417 1238 149 12294 ----
NM_016235chr161104 --11012 --
NM_016243chr1133 ------
NM_016281chr121226 ------
NM_016284chr161648 ------
NM_016306chr31245 ------
NM_016319chr12144 ----1240
NM_016320chr11--1129 ----
NM_016338chr52388 22 ------
NM_016358chr5--1108 --1172
NM_016396chr151945 ------
NM_016399chr121329 ------
NM_016423chr141386 ------
NM_016424chr17--1287 ----
NM_016463chr5123 ------
NM_016480chr5--1823 ----
NM_016525chr9127 ------
NM_016532chr172371 192 ------
NM_016547chr14681 521 290 261 --4524 183 47 44 --
NM_016569chr122611 46 ------
NM_016577chr323920 3318 14467 ----
NM_016603chr51722 ------
NM_016604chr5----1154 --
NM_016605chr512574 12595 ----
NM_016607chrX--193 1225 --
NM_016609chr14189 ------
NM_016621chr1194192 3742 3562 3398 3341 3286 3237 3145 2821 ------
NM_016626chr1821416 426 ------
NM_016831chr111503 ------
NM_016836chr2--1529 ----
NM_016839chr2--1529 ----
NM_016848chr9190 ------
NM_016929chr63680 634 29 ------
NM_016946chr11677 ------
NM_016953chr21361 14874 ----
NM_017410chr1221051 75 --1126 --
NM_017415chr5146 ------
NM_017423chr4--21995 664 ----
NM_017450chr174935 550 337 24 ------
NM_017452chr202265 245 ------
NM_017453chr202265 245 ------
NM_017454chr202265 245 ------
NM_017455chr15--1364 ----
NM_017457chr19139 ------
NM_017530chr16--2109 83 ----
NM_017550chr192301 250 --2253 49 1217
NM_017558chr161365 ------
NM_017563chr3141 ------
NM_017582chr111283 --182 --
NM_017590chr2231843 224 103 --1889 --
NM_017602chrX1177 1839 --1182
NM_017628chr434498 4206 2019 14267 ----
NM_017633chr613135 ------
NM_017637chr949116 8486 6358 5976 ------
NM_017668chr16142 ------
NM_017670chr116866 664 210 186 32 24 ------
NM_017679chr172694 136 ------
NM_017686chr111021 ------
NM_017693chr13--11291 ----
NM_017715chr71476 ------
NM_017724chr31288 ------
NM_017728chr1762659 2043 908 758 704 453 12479 1767 --
NM_017737chr11875 ------
NM_017739chr11389 ------
NM_017753chr91378 ------
NM_017780chr8--1920 ----
NM_017789chr2--1256 ----
NM_017798chr201785 ------
NM_017799chr14--21436 741 ----
NM_017813chr8--15306 ----
NM_017831chr1814183 11300 ----
NM_017847chr11163 1115 ----
NM_017849chr222181 1214 ------
NM_017902chr1034634 4462 100 ------
NM_017944chr11--1336 ----
NM_018014chr2141 ------
NM_018027chr10--2952 696 ----
NM_018061chr1--1476 ----
NM_018064chr6128 ------
NM_018092chr161305 ------
NM_018103chr11289 1293 ----
NM_018110chr162122 40 1407 ----
NM_018115chr41744 ------
NM_018133chr31426 1889 ----
NM_018172chr115569 517 465 413 361 6629 577 525 473 421 369 ----
NM_018198chr121418 1134 --1322 --
NM_018211chr11739 --163 --
NM_018364chr1--1880 ----
NM_018412chr7----136 140
NM_018416chr121156 ------
NM_018419chr20170 --174 --
NM_018425chr1042221 1896 1052 460 ------
NM_018440chr817630 25748 5679 1978 --
NM_018469chr17--165 ----
NM_018482chr8151 ------
NM_018489chr11597 12118 ----
NM_018490chr11--11495 ----
NM_018509chr17123 ------
NM_018584chr111056 ------
NM_018622chr3141 ------
NM_018640chr1212686 1592 ----
NM_018650chr11844 ------
NM_018652chr15--1417 ----
NM_018657chr31265 ------
NM_018667chr1652320 2204 2016 217 153 1369 1409 --
NM_018670chr15----121 --
NM_018689chr1531011 979 105 1169 1983 --
NM_018698chrX--1151 ----
NM_018836chr1145 ------
NM_018847chr91345 ------
NM_018898chr51269 ------
NM_018899chr51269 ------
NM_018900chr51269 ------
NM_018901chr51269 ------
NM_018902chr51269 ------
NM_018903chr51269 ------
NM_018904chr51269 ------
NM_018905chr51269 ------
NM_018906chr51269 ------
NM_018907chr51269 ------
NM_018908chr51269 ------
NM_018909chr51269 ------
NM_018910chr51269 ------
NM_018911chr51269 ------
NM_018945chr622629 998 --1204 --
NM_018951chr7--1444 ----
NM_018970chr712371 ------
NM_019009chr1152442 1018 736 133 109 21956 1855 ----
NM_019046chr10--1851 ----
NM_019063chr21624 ------
NM_019096chr6168 ------
NM_019105chr6156 ------
NM_019106chr2222351 2230 22101 706 ----
NM_019116chr1662701 1348 1124 898 665 653 ------
NM_019557chr1157 ------
NM_019593chr20--22605 559 13043 --
NM_019594chr951307 1230 478 447 133 21042 311 140 --
NM_019606chr73148 43 35 --1152 --
NM_019613chr173290 105 38 ------
NM_019858chr12180 ------
NM_020039chr123272 252 69 1346 ----
NM_020063chr1163 ------
NM_020121chr13150 ------
NM_020134chr21805 ----141
NM_020155chr11--126 ----
NM_020180chr1831317 1262 370 1470 71332 1329 1326 1323 1320 1308 1286 11336
NM_020182chr2043523 2571 1192 714 ------
NM_020185chr6--156 ----
NM_020198chr1711285 ------
NM_020211chr1521058 536 1135 ----
NM_020214chr15186 ------
NM_020235chr31303 ------
NM_020239chr1169 ------
NM_020248chr132208 710 605 11656 ----
NM_020310chr1722840 270 --12026 --
NM_020336chr2011145 ------
NM_020337chr421091 168 12042 ----
NM_020357chr3195 ------
NM_020372chr14189 ------
NM_020373chr121498 1448 ----
NM_020374chr1211557 ------
NM_020382chr1221128 622 11135 1428 --
NM_020418chr3152 ----1105
NM_020432chr722171 60 ------
NM_020441chr11189 --138 --
NM_020443chr142505 2115 1907 653 1702 ----
NM_020532chr21312 ------
NM_020640chr31210 ------
NM_020647chr81413 172 ----
NM_020692chr141100 ------
NM_020693chr112533 38 ------
NM_020699chr123473 220 21581 532 ----
NM_020703chr1188 1172 ----
NM_020708chr2072374 463 407 377 277 184 62 --4472 235 130 75 --
NM_020713chr2022809 2797 3780 183 37 ----
NM_020717chrX21515 451 11842 ----
NM_020718chr1645877 5545 1976 1147 --1184 --
NM_020739chr1523768 731 ------
NM_020742chrX11884 ------
NM_020747chr51303 1297 ----
NM_020753chr171214 ------
NM_020760chr2150 ------
NM_020766chrX13765 1531 ----
NM_020772chr1726125 2268 ------
NM_020791chr171190 ------
NM_020804chr652518 2497 2143 363 44 11816 12512 --
NM_020807chr1641183 173 87 45 ------
NM_020809chr111747 ------
NM_020834chr142693 448 ------
NM_020845chr1242413 1753 761 729 11905 ----
NM_020850chr1623098 57 ------
NM_020861chr6--1861 ----
NM_020886chr112849 40 ------
NM_020899chr1712424 ------
NM_020918chr1013395 ------
NM_020925chr1--11112 ----
NM_020935chr2151 ------
NM_020946chr931702 648 132 11381 ----
NM_020947chr1611925 ------
NM_020949chr31206 ------
NM_020956chr19174518 4316 4206 4131 3165 2937 2931 1851 1695 1458 1425 1098 976 832 777 751 411 23560 931 2838 835 --
NM_020964chr182753 655 13149 ----
NM_020971chr193819 806 184 --1546 --
NM_020972chr44854 250 98 66 --1101 --
NM_020977chr41178 ------
NM_020987chr1021064 113 ------
NM_020988chr1641039 496 485 397 ------
NM_020993chr1232389 1026 995 1518 12392 --
NM_021019chr12--1175 ----
NM_021025chr53423 396 110 --136 124
NM_021033chr1312358 ------
NM_021064chr621191 495 --1526 1423
NM_021069chr42156 30 --1159 1115
NM_021072chr511821 ------
NM_021109chrX1125 ------
NM_021109chrX1125 ------
NM_021132chr10------1205
NM_021140chrX11187 ------
NM_021168chr1671574 1086 497 481 259 109 81 11482 ----
NM_021189chr12825 96 159 ----
NM_021198chr2199 2308 292 --1103
NM_021224chr91447 ------
NM_021249chr142194 34 1322 ----
NM_021255chr1412817 ------
NM_021260chr141508 ------
NM_021267chr19171429 1383 1300 1265 1253 1207 1183 1134 975 946 563 380 334 282 229 110 73 11387 41177 875 383 343 1114
NM_021574chr221421 ------
NM_021627chr3--1472 ----
NM_021638chr441906 1900 1095 412 1649 1904 --
NM_021644chr101269 ------
NM_021724chr17124 --128 --
NM_021784chr201173 ------
NM_021800chr10--153 ----
NM_021813chr614070 14733 ----
NM_021943chr621657 1417 ------
NM_021945chr662756 2245 944 610 423 98 11016 11235 --
NM_021946chrX21417 125 ------
NM_021956chr61117 ------
NM_021961chr1114551 35040 4684 4636 ----
NM_021962chr1771808 1681 663 607 598 571 181 22376 414 1611 --
NM_021964chr3--11908 ----
NM_021973chr4185 1483 ----
NM_021980chr1011036 ------
NM_021998chrX--11032 ----
NM_022006chr192141 115 --126 --
NM_022037chr2--1274 ----
NM_022048chr151256 11184 ----
NM_022055chr2149 ------
NM_022060chr1411368 ------
NM_022062chr11149 ------
NM_022066chr174336 297 175 48 --151 --
NM_022121chr6131 ------
NM_022129chr1031343 75 23 ------
NM_022166chr1644356 2375 1670 1465 25241 827 ----
NM_022173chr2--1274 ----
NM_022307chr7134 ------
NM_022356chr11467 ------
NM_022455chr5134 ------
NM_022465chr1221119 1079 11982 ----
NM_022574chr732045 1800 654 2818 707 ----
NM_022644chr172376 28 ------
NM_022648chr234524 4002 1343 23047 813 11426 14528
NM_022719chr2232900 2511 1100 --22824 2821 --
NM_022733chr111176 125 ----
NM_022735chr11345 ------
NM_022737chr191202 --146 --
NM_022758chr623126 3078 ------
NM_022763chr31635 ------
NM_022824chr5--1333 ----
NM_022844chr162909 749 ------
NM_022893chr2--22586 2382 ----
NM_022894chr211119 ------
NM_022896chr2011663 ------
NM_022898chr1411879 ----1808
NM_022912chr21997 1557 ----
NM_022917chr91837 1400 ----
NM_023000chr14--137 ----
NM_023001chr14--137 ----
NM_023004chr22----1205 171
NM_023009chr1188 ------
NM_023010chrX1108 ------
NM_023018chr151486 1248 1122 1043 279 1406 137 --
NM_023037chr13--146 ----
NM_023067chr321092 257 --2485 83 187
NM_023076chr1622736 793 ----12471
NM_024003chrX2184 108 --2642 595 --
NM_024016chr172145 33 --266 63 --
NM_024040chr101146 ------
NM_024052chr1741052 596 553 496 ------
NM_024085chr22694 330 1347 2994 49 --
NM_024117chr92989 269 ------
NM_024294chr623126 3078 ------
NM_024295chr821788 23 ------
NM_024320chr17--1164 ----
NM_024328chr142602 211 1229 1120 --
NM_024337chr51140 ------
NM_024348chr9--1101 ----
NM_024429chr72746 389 1799 ----
NM_024494chr11689 ------
NM_024524chr311034 ------
NM_024545chr21192 1514 ----
NM_024554chr12223 110 ------
NM_024599chr17262 21 ------
NM_024627chr2264269 1304 953 515 260 28 1755 ----
NM_024631chr11188 ----193
NM_024639chr61161 ------
NM_024665chr3--12978 ----
NM_024676chr131016 196 148 --11085 --
NM_024692chr2----11444 --
NM_024721chr81589 12002 ----
NM_024742chr1651526 1328 1270 691 426 ------
NM_024745chr16150 169 ----
NM_024787chr81363 ------
NM_024811chr11184 --1665 --
NM_024871chr341369 258 70 28 1494 ----
NM_024922chr1672053 2009 1604 1408 726 170 127 --11511 --
NM_024991chr103462 341 239 --12449 --
NM_025054chr81181 12663 ----
NM_025072chr9--149 ----
NM_025073chr113586 ------
NM_025080chr11--11107 ----
NM_025133chr21365 ------
NM_025146chr312028 140 ----
NM_025154chr7--11513 ----
NM_025160chr113750 ------
NM_025191chr11468 ------
NM_025221chr411334 ------
NM_025222chr322597 429 ------
NM_025224chr2031496 832 30 1778 ----
NM_025237chr171266 --1409 --
NM_025245chr19279 30 141 ----
NM_025248chr1732817 1243 743 ------
NM_025251chr84802 381 335 36 --1316 --
NM_025256chr6151 197 ----
NM_030629chr1621192 343 ------
NM_030661chr731176 1130 1108 ------
NM_030761chr152646 2090 2074 250 242 42066 739 265 214 ----
NM_030762chr121497 ------
NM_030766chr121213 ------
NM_030780chr81530 1222 ----
NM_030806chr135943 2787 1509 17612 ----
NM_030808chr172790 212 ------
NM_030884chr372324 1996 1804 1561 716 688 263 ------
NM_030918chr135168 1861 237 15054 ----
NM_030923chr21176 ------
NM_030935chr7255 36 ------
NM_030937chr141136 346 81 60 ------
NM_030957chr19------147
NM_030958chr8--1147 ----
NM_030962chr11--2506 48 ----
NM_030981chr1121104 159 1891 ----
NM_031216chr18194 ------
NM_031291chr4--165 ----
NM_031297chr92136 45 ------
NM_031309chr852109 1997 1442 621 370 --22234 852 --
NM_031314chr1411444 ------
NM_031372chr4--1154 ----
NM_031407chrX1139 --1190 --
NM_031411chr51269 ------
NM_031417chr196826 436 317 206 172 65 182 278 72 --
NM_031418chr11--1480 ----
NM_031434chr75335 293 137 75 59 --2115 29 --
NM_031438chr5--1577 ----
NM_031439chr82172 72 ------
NM_031445chr212576 ------
NM_031468chr756306 5112 3058 1936 747 1758 13135 12458
NM_031477chr16--146 ----
NM_031844chr113940 ------
NM_031849chr51269 ------
NM_031857chr51269 ------
NM_031860chr51269 ------
NM_031890chr2222328 643 12461 ----
NM_031908chr51999 ------
NM_031922chr61500 ------
NM_031954chr1231966 79 22 ------
NM_032017chr181887 1846 1798 1499 1375 743 411 372 133 ----
NM_032042chr54374 362 324 29 ----1236
NM_032102chr11198 ------
NM_032109chr531147 235 51 --1418 --
NM_032153chr342758 627 587 385 --1397 --
NM_032174chr1--1162 ----
NM_032193chr1161814 1803 1282 675 572 353 ------
NM_032195chr211385 ------
NM_032199chr1011071 ------
NM_032211chr10130 ------
NM_032268chr1622092 384 ----1435
NM_032294chr1721383 80 1424 ----
NM_032316chr352257 2162 1970 1902 529 1405 12362 --
NM_032320chr111498 ------
NM_032379chr111278 ------
NM_032389chr111996 ------
NM_032420chr52765 39 ------
NM_032452chr1421335 372 11523 ----
NM_032457chr413256 ------
NM_032470chr6156 ------
NM_032499chr151119 ------
NM_032505chr311951 ------
NM_032569chr162343 329 ------
NM_032588chr12419 179 ------
NM_032590chr121414 ------
NM_032595chr1751490 1450 1075 489 265 ------
NM_032603chr2--159 ----
NM_032638chr331361 1066 187 --1206 --
NM_032682chr311279 ------
NM_032689chr1911415 1647 ----
NM_032711chr1793914 3317 1652 1644 1609 1509 1075 239 63 --11672 --
NM_032737chr1922195 477 --62525 2522 1927 575 198 195 1185
NM_032758chr22--150 ----
NM_032765chr5--2813 400 ----
NM_032804chr102158 113 ------
NM_032808chr151146 2691 60 ----
NM_032837chr17------12144
NM_032883chr201335 1630 ----
NM_032943chr111278 ------
NM_032951chr7133 ------
NM_032953chr7133 ------
NM_032982chr7--22506 970 ----
NM_032999chr71817 ------
NM_033000chr71817 ------
NM_033001chr71817 ------
NM_033008chr3152 ----1105
NM_033009chr3152 ----1105
NM_033010chr3152 ----1105
NM_033012chr131931 ------
NM_033020chr114735 ------
NM_033023chr721042 326 11102 1934 --
NM_033044chr11129 ------
NM_033058chr81132 ------
NM_033089chr201371 ------
NM_033102chr12213 80 3133 109 93 ----
NM_033102chr12213 80 3133 109 93 ----
NM_033129chr2041563 747 496 343 21547 1525 ----
NM_033133chr1743629 3273 3236 2593 23356 790 ----
NM_033161chr9--144 ----
NM_033181chr623101 2938 ------
NM_033201chr161202 1959 ----
NM_033225chr822877 278 ------
NM_033259chr32132 75 --3220 139 136 1143
NM_033274chr542321 1190 771 93 ------
NM_033345chr1--153 ----
NM_033375chr1731455 1447 973 ------
NM_033380chrX--1104 ----
NM_033381chrX--1104 ----
NM_033387chr962184 1920 1860 838 616 421 ------
NM_033389chr1744355 4063 1025 755 1303 ----
NM_033419chr1731029 339 297 11232 ----
NM_033420chr192275 28 --1109 2312 80
NM_033421chr201619 ------
NM_033455chr111300 --1111 --
NM_033503chr1523717 1232 ------
NM_033506chr71149 ------
NM_033515chr6--1165 ----
NM_033518chrX157 ------
NM_033551chr51690 22327 1168 ----
NM_033656chr21--15460 ----
NM_052840chr151469 ------
NM_052851chr1312189 ------
NM_052854chr112581 572 ------
NM_052879chr12--1299 ----
NM_052896chr1--1167 ----
NM_052897chr121781 ------
NM_052900chr811471 ------
NM_052906chr2254332 4229 3842 1141 272 24803 1666 ----
NM_052910chr1321521 337 ------
NM_052932chr11142 ------
NM_052934chr13616 508 25 11629 ----
NM_053016chr922799 542 12812 ----
NM_053023chr112721 417 ------
NM_053024chr3--11128 ----
NM_053046chr192177 91 1481 ----
NM_053056chr1132766 2739 1965 ------
NM_058004chr22--188 ----
NM_058164chr19127 ------
NM_058238chr221768 188 ----
NM_058241chr2--1104 ----
NM_058241chr2--1104 ----
NM_058243chr191576 1873 ----
NM_078469chr10--1533 ----
NM_078471chr1721158 48 ------
NM_080599chr1011214 ------
NM_080607chr203973 116 61 ------
NM_080616chr20--2660 618 ----
NM_080629chr11110 1616 ----
NM_080630chr11110 1616 ----
NM_080632chrX1108 ------
NM_080645chr621376 482 ------
NM_080669chr1743726 1987 1554 734 ------
NM_080679chr61631 ------
NM_080680chr61631 ------
NM_080681chr61631 ------
NM_080732chr192177 91 1481 ----
NM_080743chr6----128 --
NM_080881chr53143 74 39 ------
NM_130385chr1132861 2661 97 13060 ----
NM_130436chr21----11749 --
NM_130438chr21----12326 --
NM_130766chr172371 192 ------
NM_130811chr201426 ------
NM_133171chr201396 ------
NM_133265chrX11282 ------
NM_133330chr421020 181 1107 1426 1430
NM_133331chr421020 181 1107 1426 1430
NM_133335chr421020 181 1107 1426 1430
NM_133369chr52952 682 ------
NM_133445chr921471 278 ------
NM_133499chrX1887 ------
NM_133631chr31329 ------
NM_133642chr221140 ------
NM_134325chr12151 43 11164 ----
NM_138333chr91249 ------
NM_138338chr2233271 2145 1222 ------
NM_138350chr121395 580 2498 248 ----
NM_138385chr42191 86 21343 133 ----
NM_138415chr2241779 737 677 278 21468 1220 1566 --
NM_138430chr131383 ------
NM_138437chrX121 ------
NM_138440chr16--170 ----
NM_138444chr1331525 870 99 --1831 --
NM_138457chr652525 2458 2159 1055 715 13366 22488 971 --
NM_138473chr1234742 3698 725 ------
NM_138559chr2131 ------
NM_138576chr1411879 ----1808
NM_138578chr20--21077 71 ----
NM_138619chr1721626 46 21200 480 ----
NM_138621chr233075 2938 468 ------
NM_138689chr11----148 --
NM_138729chr1--1103 ----
NM_138732chr115699 650 183 106 32 ------
NM_138734chr115699 650 183 106 32 ------
NM_138735chr21494 ------
NM_138736chr1664219 4113 4067 3464 3254 45 24199 2756 23962 2555 --
NM_138775chr111541 ------
NM_138782chr512239 ------
NM_138795chr131599 1210 560 11312 1228 --
NM_138966chr181168 ------
NM_138967chr1522447 2394 ------
NM_138981chr41140 ------
NM_139057chr15--199 ----
NM_139062chr171396 ------
NM_139067chr121249 ------
NM_139071chr1221485 59 ------
NM_139132chr11--1129 ----
NM_139135chr1------1849
NM_139155chr1031184 365 223 ------
NM_139161chr191339 172 ----
NM_139170chr162551 418 3491 246 157 1519 --
NM_139181chr11----138 --
NM_139245chr321597 23 ------
NM_139316chr72829 349 ------
NM_144498chr202854 193 --1777 --
NM_144564chr19125 ------
NM_144568chr142493 116 ------
NM_144578chr14--11597 ----
NM_144582chr222225 1871 ------
NM_144583chr221688 1643 ------
NM_144667chr12--11035 ----
NM_144994chr22125 22 --11066 --
NM_145008chr11--1819 ----
NM_145053chr11--1208 ----
NM_145065chr114449 440 411 289 ------
NM_145159chr143876 676 54 --1855 --
NM_145173chr1911794 --3152 50 27 --
NM_145185chr1941970 1720 1498 79 11962 1403 --
NM_145201chr8184 ------
NM_145206chr1022695 126 13203 ----
NM_145239chr163972 408 48 ------
NM_145245chr1941233 1122 1020 84 ------
NM_145253chr162666 176 --1536 --
NM_145285chr102745 48 1201 --1762
NM_145307chr1011268 ------
NM_145313chr10----11307 --
NM_145320chr712572 ------
NM_145321chr712572 ------
NM_145322chr712572 ------
NM_145808chr7159 --1513 --
NM_145891chr16--11524 ----
NM_145892chr16--11524 ----
NM_145893chr16--11646 ----
NM_147150chr912927 13772 ----
NM_147161chr11278 1247 ----
NM_147164chr92176 160 ------
NM_147181chr411334 ------
NM_147182chr411334 ------
NM_147183chr411334 ------
NM_147190chr12--1603 ----
NM_147202chr932298 560 23 32614 118 38 ----
NM_147223chr211578 --1564 --
NM_148894chr41335 ------
NM_148918chr17148 1281 ----
NM_148955chr1515208 --139 --
NM_152221chr22--1242 1223 1783
NM_152227chr201677 ------
NM_152233chr142194 34 1322 ----
NM_152237chr2231220 477 299 --11414 1501
NM_152245chr22123 ------
NM_152253chr2263977 3363 2887 2864 171 71 ------
NM_152264chr112402 269 1690 ----
NM_152271chr821053 69 ------
NM_152335chr152406 125 173 ----
NM_152346chr172233 215 2903 358 1102 1730
NM_152348chr171845 ------
NM_152384chr2101664 1627 1578 1529 1488 1451 1403 1313 1276 744 2793 447 --1528
NM_152388chr211189 11427 ----
NM_152424chrX12938 23293 632 ----
NM_152440chr1211082 ------
NM_152441chr121130 ------
NM_152499chr12323 54 --158 --
NM_152556chr71928 ------
NM_152563chr115569 517 465 413 361 6629 577 525 473 421 369 ----
NM_152570chr91103 ------
NM_152572chr9----125 --
NM_152588chr122474 457 ------
NM_152589chr12--1216 ----
NM_152594chr1512324 ------
NM_152600chr19----126 --
NM_152624chr512085 ------
NM_152682chr4--11700 ----
NM_152694chrX1187 ------
NM_152699chr323379 3057 13232 ----
NM_152716chr11--255 40 ----
NM_152724chr1012330 ------
NM_152739chr71191 ------
NM_152744chr762206 1133 1126 1059 392 200 43473 2962 1336 637 ----
NM_152748chr71125 ------
NM_152753chr611285 ------
NM_152756chr514079 ------
NM_152793chr753189 1797 856 819 766 13946 ----
NM_152826chr1515208 --139 --
NM_152838chr20--11171 ----
NM_152860chr1241477 1396 610 33 11101 ----
NM_152924chr1556613 6358 4565 4553 867 ------
NM_152988chr1971684 1333 1141 507 189 116 55 21559 229 124 --
NM_152998chr7139 ------
NM_153029chr1644060 3646 2670 1280 14036 23636 721 --
NM_153033chr7--1630 ----
NM_153035chr11210 --1397 --
NM_153047chr6141 ------
NM_153048chr6141 ------
NM_153181chr181168 ------
NM_153207chr12--11223 ----
NM_153215chr32327 155 192 ----
NM_153260chr151323 ------
NM_153261chr16--11441 ----
NM_153262chr113039 12370 ----
NM_153273chr342691 2425 1915 243 22820 1103 12773 --
NM_153334chr222643 156 --149 --
NM_153340chr1--135 ----
NM_153350chr162668 309 --3595 282 65 1313
NM_153354chr51390 ------
NM_153367chr1063767 896 409 189 88 54 --13500 --
NM_153449chr121313 ------
NM_153450chr111651 ------
NM_153487chr643787 1874 1771 1566 ------
NM_153499chr123305 132 103 22580 2334 1138 --
NM_153500chr123305 132 103 22580 2334 1138 --
NM_153619chr15----11156 --
NM_153631chr731176 1130 1108 ------
NM_153632chr731176 1130 1108 ------
NM_153675chr201173 ------
NM_153715chr7--1444 ----
NM_153756chr1--11568 ----
NM_153827chr17171 ------
NM_153828chr21312 ------
NM_153831chr8--195 ----
NM_153832chr1174 ------
NM_170606chr71380 ------
NM_170663chr17171 ------
NM_170665chr1264582 3528 3312 2825 1543 1413 34156 4144 1670 ----
NM_170675chr151302 ------
NM_170676chr151302 ------
NM_170709chr8--12323 ----
NM_170724chr6--11012 ----
NM_170743chr121894 42 ------
NM_170768chr11130 --1326 --
NM_170782chr11498 ------
NM_171825chr541986 1254 35 22 12097 ----
NM_171999chr182151 127 ------
NM_172020chr73772 762 357 21290 129 1292 --
NM_172057chr7259 50 ------
NM_172127chr41109 ------
NM_172128chr4165 ------
NM_172163chr11139 ------
NM_172206chr1721383 80 1424 ----
NM_172216chr122207 34 22482 2236 140 --
NM_172226chr123305 132 103 22580 2334 1138 --
NM_172349chr5134 ------
NM_172375chr141185 ------
NM_173064chr121894 42 ------
NM_173075chr421691 328 ------
NM_173171chr21110 ------
NM_173172chr22418 35 ------
NM_173173chr21110 ------
NM_173475chr1621431 42 11619 ----
NM_173500chr151281 11421 ----
NM_173511chr213943 ------
NM_173552chr31426 ------
NM_173559chr6--1132 ----
NM_173595chr1214535 31547 1007 317 14320 --
NM_173618chr16--1105 ----
NM_173642chr138806 7811 727 ------
NM_173683chr811549 ------
NM_173809chr10--11084 ----
NM_173814chr15--1109 ----
NM_173849chr141197 --187 --
NM_174856chr201294 ------
NM_174911chr831557 818 54 1440 ----
NM_175634chr81890 ------
NM_175635chr81890 ------
NM_175636chr81890 ------
NM_175736chr1225319 5250 --21666 1663 --
NM_175747chr61272 2871 23 ----
NM_175748chr141802 ------
NM_175854chr13--1194 ----
NM_175898chr1531567 165 35 --4411 348 339 115 2459 49
NM_175920chr5163 ----1100
NM_176792chr10--1295 --11383
NM_176801chr441650 695 244 217 144 11600 --
NM_176871chr852608 642 329 218 30 12676 ----
NM_177414chr11420 ------
NM_177947chrX--193 1225 --
NM_177948chrX--193 1225 --
NM_177949chrX--1122 ----
NM_177983chr21337 ------
NM_177999chr963592 3111 3098 3019 325 155 23634 2838 ----
NM_178006chr1312189 ------
NM_178007chr1312189 ------
NM_178011chr10--1923 ----
NM_178013chr1442999 2930 2631 2245 11022 ----
NM_178014chr6292 45 ------
NM_178127chr111519 ------
NM_178138chr9143 ------
NM_178151chrX25491 4980 ------
NM_178152chrX25491 4980 ------
NM_178153chrX25491 4980 ------
NM_178167chr16--166 ----
NM_178423chr7190 ------
NM_178425chr7190 ------
NM_178426chr11585 ------
NM_178427chr11485 ------
NM_178441chr141508 ------
NM_178493chr171116 --152 --
NM_178500chr172201 169 ------
NM_178502chr12------1602
NM_178554chr362591 2583 2536 1277 1246 553 ------
NM_178830chr194634 548 185 56 ------
NM_178835chr4------179
NM_178864chr112473 60 2627 574 ----
NM_181050chr163589 509 21 ------
NM_181291chr143487 171 160 ------
NM_181310chr611256 ------
NM_181332chrX11884 ------
NM_181351chr111783 11029 ----
NM_181442chr201128 ------
NM_181504chr513730 ------
NM_181523chr513730 ------
NM_181524chr513730 ------
NM_181532chrX1247 ------
NM_181671chr171106 ------
NM_181672chrX21885 319 ------
NM_181673chrX21885 319 ------
NM_181689chr202563 78 ------
NM_181784chr21191 --1164 --
NM_182485chr412722 13698 ----
NM_182507chr121705 21837 161 ----
NM_182509chr1451646 1086 393 242 63 11438 ----
NM_182553chr111545 ------
NM_182557chr1122220 591 ------
NM_182580chr142118 1963 1875 845 ------
NM_182641chr171430 ------
NM_182646chr412722 13698 ----
NM_182697chr731515 640 308 ------
NM_182700chr72747 528 --2496 242 --
NM_182717chr10--1268 ----
NM_182720chr10--1268 ----
NM_182721chr10--1268 ----
NM_182722chr10--1268 ----
NM_182723chr10--1268 ----
NM_182779chr1154 1644 ----
NM_182796chr5--1690 ----
NM_182798chr5--1264 ----
NM_182799chr5--1264 ----
NM_182801chr5--1264 ----
NM_182811chr2041166 738 328 56 1964 ----
NM_182853chr10--1268 ----
NM_182895chr222643 156 --149 --
NM_182917chr34345 337 165 60 ------
NM_182920chr321104 578 ------
NM_182970chr2054213 1698 1557 1161 568 23552 2881 1354 --
NM_182972chr11289 11097 ----
NM_183006chr2011477 --41480 987 984 981 --
NM_183011chr10--1268 ----
NM_183012chr10--1268 ----
NM_183013chr10--1268 ----
NM_183049chr41125 ------
NM_183057chr81194 ------
NM_183373chr6190 1794 ----
NM_183377chr173536 193 142 ------
NM_183397chr2084989 4753 4266 4056 3237 213 132 60 13188 ----
NM_183422chr131106 ------
NM_183425chr2061204 685 273 208 72 59 2358 180 1161 --
NM_184041chr16271 22 ------
NM_184043chr16271 22 ------
NM_194247chr233636 3315 3084 1869 ----
NM_194248chr26952 758 632 350 238 223 1207 ----
NM_194259chr162410 140 ------
NM_194260chr162410 140 ------
NM_194261chr162410 140 ------
NM_194272chr151107 --1697 --
NM_194278chr1453933 3445 2642 779 392 23380 1312 3410 407 404 1514
NM_194282chr411226 ------
NM_194301chr14--1218 ----
NM_194322chr26952 758 632 350 238 223 1207 ----
NM_194323chr25754 560 152 40 25 ------
NM_194358chr1211723 ------
NM_194359chr1211723 ------
NM_194442chr1--147 ----
NM_194449chr181360 1881 ----
NM_197941chr511989 1871 ----
NM_198056chr321519 161 11957 ----
NM_198066chr1412203 ------
NM_198123chr811471 ------
NM_198124chr811471 ------
NM_198181chr15--1435 ----
NM_198241chr34345 337 165 60 ------
NM_198242chr34345 337 165 60 ------
NM_198244chr34345 337 165 60 ------
NM_198270chrX22867 325 ------
NM_198390chr1621192 343 ------
NM_198516chr11125 ------
NM_198521chr12133 ------
NM_198560chr31369 12716 ----
NM_198563chr3144 ------
NM_198595chr441906 1900 1095 412 1649 1904 --
NM_198834chr1731677 323 55 ------
NM_198836chr1731677 323 55 ------
NM_198837chr1731677 323 55 ------
NM_198838chr1731677 323 55 ------
NM_198839chr1731677 323 55 ------
NM_198896chr111134 12228 ----
NM_198900chr1225319 5250 --21666 1663 --
NM_198904chr5--11800 ----
NM_198938chr9--149 ----
NM_198940chr9--149 ----
NM_198956chr72747 528 --2496 242 --
NM_198993chr1711185 11629 ----
NM_199054chr1951704 1467 538 339 94 --2754 751 --
NM_199131chr1031124 793 569 ------
NM_199141chr191160 --2164 58 1210
NM_199169chr2043523 2571 1192 714 ------
NM_199170chr2043523 2571 1192 714 ------
NM_199171chr2043523 2571 1192 714 ------
NM_199188chr12--1299 ----
NM_199190chr12--1299 ----
NM_199191chr2283 69 ------
NM_199194chr2283 69 ------
NM_199245chr1231628 750 105 ------
NM_199262chr1722251 446 1673 ----
NM_199327chr41842 ------
NM_199355chr162112 68 ------
NM_199436chr212911 ------
NM_201266chr21509 1593 ----
NM_201279chr21509 1593 ----
NM_201280chr61575 ------
NM_201412chr161202 ------
NM_201434chr17----123 --
NM_201436chr7--1662 ----
NM_201444chr12--186 ----
NM_201445chr12--186 ----
NM_201516chr7--1718 ----
NM_201517chr7--1662 ----
NM_201520chr1761506 1199 1116 727 555 402 11625 ----
NM_201521chr63345 331 137 ------
NM_201522chr63345 331 137 ------
NM_201523chr63345 331 137 ------
NM_201554chr12--186 ----
NM_201570chr10--1269 ----
NM_201571chr10--1269 ----
NM_201572chr10--1269 ----
NM_201590chr10--1269 ----
NM_201593chr10--1269 ----
NM_201596chr10--1269 ----
NM_201597chr10--1269 ----
NM_201632chr541389 463 241 52 ------
NM_201634chr561488 562 340 151 105 63 --166 --
NM_203304chr191168 ------
NM_203305chr93981 822 312 --1668 --
NM_203318chr1721158 48 ------
NM_203327chr2023897 3798 21262 856 ----
NM_203351chr175975 592 517 30 23 22259 678 ----
NM_203390chr811345 ------
NM_203403chr9162 ------
NM_203417chr211424 ------
NM_203418chr211424 ------
NM_203434chr92369 320 ------
NM_203446chr21--1693 ----
NM_203458chr11149 11544 ----
NM_203506chr172472 74 ------
NM_205860chr113033 ------
NM_206594chr1--11366 ----
NM_206595chr1--11366 ----
NM_206839chr15--1208 ----
NM_206909chr827991 5279 27165 7000 12766 --
NM_206927chr111278 ------
NM_206928chr111278 ------
NM_206929chr111278 ------
NM_206930chr111278 ------
NM_207009chr101383 ------
NM_207299chr91378 ------
NM_207306chr144367 4044 240 143 11508 --177
NM_207371chr101978 ------
NM_207380chr151295 23099 2501 ----
NM_207406chr414002 32604 1113 125 ----
NM_207442chr14----1299 --
NM_207520chr21312 ------
NM_207521chr21312 ------
NM_207577chr111238 ------
NM_213648chr541389 463 241 52 ------