TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4469
miRNA Sequence: GCUCCCUCUAGGGUCGCUCGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000599chr2114031 4020 3788 3781 3440 3411 3339 2966 1728 1577 517 32952 1649 1598 33015 1603 917 31507 1481 519
NM_000719chr12104759 4682 4517 4379 4307 2413 2066 1782 801 441 2293 204 42417 2231 644 487 14367
NM_000723chr1781476 568 554 415 225 95 63 47 --156 --
NM_000831chr1145971 5686 5460 5440 4835 3821 2397 2389 1572 1553 1398 1245 1122 481 --21576 744 22110 1851
NM_001008220chr5123775 3728 3585 3381 3098 2982 2482 1124 1117 458 250 220 43686 3421 3025 1576 23846 1137 --
NM_001008701chr19132448 2323 2213 2033 1992 1966 855 823 793 376 270 233 42 42527 2067 1940 560 21941 473 2282 77
NM_001009959chr252280 1622 706 351 280 22308 1653 1105 22414 610
NM_001012393chr1144750 3864 3387 709 21681 1173 1710 23394 3392
NM_001014797chr1087173 6938 6918 6678 6644 6119 2643 2302 46774 6067 5205 2071 --15924
NM_001017440chr7147748 7742 7242 7202 6907 5630 5532 5409 3003 2430 2262 1840 1214 545 17297 66856 5410 1811 938 935 483 16201
NM_001018111chr773889 3706 3556 1341 851 111 91 22744 1579 13728 2242 96
NM_001042498chrX3151 31 21 --1218 136
NM_001042599chr266510 3111 1699 1012 824 174 --36969 6503 6500 27653 3017
NM_001043318chr1443805 1200 737 72 --51152 1075 954 548 53 21499 79
NM_001106chr3148400 6548 6365 3841 3746 3341 3317 3032 2916 2726 2127 1607 750 641 11801 --18499
NM_001148chr43877 240 173 1871 21806 865 --
NM_001283chr76646 639 562 546 502 443 --1652 2657 651
NM_001949chr622940 1290 21237 1194 32011 2001 1022 32006 1021 921
NM_002373chr152409 153 31065 211 101 2222 102 3347 112 86
NM_002545chr1144750 3864 3387 709 21681 1173 1710 23394 3392
NM_002886chr353667 3250 3177 798 353 --25076 178 2809 376
NM_003108chr2156996 6884 2727 2679 2502 2495 2379 2324 2297 1943 1928 1718 1686 707 525 46522 5918 2221 140 32364 416 403 1660
NM_003468chr2123464 3382 3372 2847 2752 1623 990 616 571 139 132 39 --41195 1191 662 45 --
NM_003482chr1252155 792 340 248 28 11970 21890 951 52162 2160 1889 290 70
NM_003714chr5111952 1946 1926 1107 983 947 815 670 655 325 232 12894 52064 599 523 312 89 --
NM_004263chr251131 681 621 614 453 ----1626
NM_004774chr1793010 2903 2750 2309 2269 706 297 277 263 32064 2052 287 2564 267 --
NM_004992chrX118156 7541 7529 6734 3224 2584 1870 914 900 856 475 38216 7574 7295 77824 7266 2391 915 904 669 666 17271
NM_004992chrX118156 7541 7529 6734 3224 2584 1870 914 900 856 475 38216 7574 7295 77824 7266 2391 915 904 669 666 17271
NM_005235chr266510 3111 1699 1012 824 174 --36969 6503 6500 27653 3017
NM_005397chr773889 3706 3556 1341 851 111 91 22744 1579 13728 2242 96
NM_005840chrX56751 2986 2650 2023 2016 47424 7368 6344 1992 37425 6332 82 181
NM_005920chr193637 3457 3433 1028 813 757 409 324 284 2932 923 53615 3611 3560 3556 1064 1210
NM_005937chr17183974 3967 3830 3690 3435 3398 2632 1244 1162 1127 892 661 641 330 175 134 59 39 43676 2689 731 377 22794 1145 1389
NM_005938chrX81241 1208 1167 1137 1005 240 201 187 31158 990 211 11159 1192
NM_006237chr136522 271 263 240 121 37 32197 818 234 3819 256 244 1338
NM_006546chr17106334 6088 5631 4686 4184 2592 1977 1948 1505 634 45743 4709 4409 646 46551 5486 5434 5228 --
NM_006609chr231201 686 119 ----2911 103
NM_006650chr5123775 3728 3585 3381 3098 2982 2482 1124 1117 458 250 220 43686 3421 3025 1576 23846 1137 --
NM_007050chr20107703 6775 5215 2191 1882 1555 1292 954 358 169 25856 3042 45883 2156 962 723 12918
NM_012288chr671876 1791 1689 1083 757 407 50 --55628 5033 3892 143 139 25032 5010
NM_013449chr122804 299 22883 794 22079 2054 32739 2737 304
NM_014586chr2164497 4439 3626 3498 963 295 1407 14307 24631 3958
NM_014921chr19132448 2323 2213 2033 1992 1966 855 823 793 376 270 233 42 42527 2067 1940 560 21941 473 2282 77
NM_014935chr193787 3449 1400 1001 652 368 308 275 142 1631 11211 2832 790
NM_015035chr20136645 6222 6091 5316 4994 4768 4590 4491 4162 2125 1870 1426 1052 25906 5719 22602 2107 --
NM_015039chr193216 2715 1469 1439 415 337 245 225 139 33664 3454 1458 --14188
NM_015686chrX111898 1755 1555 1014 1008 678 624 281 194 122 113 31666 752 391 272 68 1680
NM_016621chr11104577 4174 3531 3053 1752 1739 559 539 532 357 1623 44567 3057 552 376 --
NM_020163chr3131977 1875 1806 1794 1780 1493 815 495 428 417 402 161 89 11786 1875 --
NM_020205chr1113213 3166 3062 2970 2768 2163 889 635 621 451 364 33308 3184 3102 12992 190
NM_020443chr134646 325 145 12563 36264 419 124 21093 409
NM_020699chr1115162 5117 5110 4560 3717 3689 3678 1597 810 723 708 21441 301 44359 3682 2066 2062 14463
NM_020711chr252280 1622 706 351 280 22308 1653 1105 22414 610
NM_020766chrX54307 4247 3190 2903 2876 13279 21835 1831 11816
NM_020977chr43877 240 173 1871 21806 865 --
NM_022648chr2194430 4225 4097 4015 3600 3584 3478 3443 3215 3193 3163 3154 3076 2995 1797 733 370 160 51 23731 139 13115 1167
NM_022719chr2293158 1192 1082 1069 903 885 829 491 357 11247 61248 1223 1203 914 911 907 23010 1310
NM_022755chr952391 2217 2031 1635 621 --12209 31761 712 710
NM_030806chr167584 7000 2672 1764 1381 939 35771 5744 1846 16654 38864 6918 6795
NM_031468chr7147748 7742 7242 7202 6907 5630 5532 5409 3003 2430 2262 1840 1214 545 17297 66856 5410 1811 938 935 483 16201
NM_033224chr744964 319 118 106 16436 198 --
NM_052906chr22274651 4484 4363 4338 4138 4131 4109 3792 3705 3664 3308 3273 3240 3228 3109 2038 1896 1778 1765 1216 1064 1048 700 541 405 83 57 33250 826 430 74210 4089 3244 1904 1466 516 319 14642
NM_057089chr74444 437 360 344 --1450 2455 449
NM_133170chr20107703 6775 5215 2191 1882 1555 1292 954 358 169 25856 3042 45883 2156 962 723 12918
NM_144579chr2112473 2463 2411 2358 1961 1846 603 522 87 52 44 1528 --31898 1896 151
NM_152414chr82434 204 --3219 212 208 3556 427 425
NM_152429chr1031556 374 22 3335 299 100 2318 36 2379 337
NM_152470chr18103110 3061 2913 2559 1616 1203 957 766 272 177 33180 2932 872 52548 1417 683 237 169 31421 781 161
NM_170706chr193216 2715 1469 1439 415 337 245 225 139 33664 3454 1458 --14188
NM_173595chr12164847 4644 4579 4517 4454 4285 3991 3903 3763 3574 1723 1238 1114 197 136 119 24661 3377 84288 1729 1612 1325 979 538 535 111 14061
NM_181336chr67951 547 512 437 410 356 198 2469 258 11116 31115 205 203
NM_181504chr533654 3280 1270 --24041 1318 21317 1275
NM_181521chr1697224 6443 5531 4970 4946 2912 2884 2413 1118 25451 5277 32067 1471 344 15286
NM_181523chr533654 3280 1270 --24041 1318 21317 1275
NM_181524chr533654 3280 1270 --24041 1318 21317 1275
NM_182970chr20124228 4043 3707 3591 3573 3530 3375 2773 1614 1215 982 974 33213 3037 131 34232 1647 849 33337 3198 848
NM_194278chr1443805 1200 737 72 --51152 1075 954 548 53 21499 79
NM_194286chr1294742 3972 3887 2228 1864 1353 1131 463 153 11160 35737 3951 1480 25736 1489
NM_198560chr3153620 2967 2750 2736 2502 2377 1423 1341 1277 949 941 924 602 241 87 33416 2410 319 43338 2654 2381 693 42738 1354 588 176
NM_199262chr1741447 660 117 94 21654 145 32332 730 529 32346 2004 509
NM_203458chr163461 3256 769 634 421 261 13565 23320 637 1452