TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4470
miRNA Sequence: UGGCAAACGUGGAAGCCGAGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531256 1060 860 1974 ----
NM_000038chr54519 424 233 164 32033 1412 728 ----
NM_000044chrX1154 ------
NM_000068chr1911498 ------
NM_000084chrX125844 5558 5280 5157 2231 2093 1925 887 784 565 447 270 25117 1638 25019 2330 --
NM_000090chr21171 1866 ----
NM_000092chr243642 2989 1037 127 63937 3633 2818 1693 1417 1262 ----
NM_000093chr922104 946 --1771 --
NM_000097chr331141 1073 995 2473 77 ----
NM_000109chrX22121 1882 12488 ----
NM_000110chr11770 11180 ----
NM_000112chr5125560 5185 4925 4575 4197 3552 1713 1694 1085 836 520 490 1873 ----
NM_000117chrX1115 2243 213 ----
NM_000125chr664185 4174 4139 1569 371 147 ------
NM_000129chr61341 21454 1412 ----
NM_000138chr1542079 1952 668 372 12474 ----
NM_000151chr17--11786 ----
NM_000161chr1441812 755 330 75 ------
NM_000163chr522095 837 ------
NM_000167chrX1442 1592 ----
NM_000168chr763301 2367 2234 950 762 371 ------
NM_000176chr573845 3452 2878 2817 1265 1018 992 --173 --
NM_000189chr262241 1906 739 566 138 104 1588 11890 --
NM_000192chr1251476 1357 1309 639 210 ------
NM_000208chr1944520 3377 400 358 ------
NM_000217chr1244659 3897 1756 1274 ----15165
NM_000222chr431848 1743 1545 1163 --21734 624
NM_000240chrX32279 2257 1459 22239 206 12196 11717
NM_000245chr741474 520 89 38 1695 --12086
NM_000248chr322551 838 22701 2484 ----
NM_000252chrX2364 93 11126 11064 --
NM_000253chr43761 300 32 ------
NM_000264chr993100 2995 2732 2579 2295 2253 2241 1256 667 12346 ----
NM_000267chr1783323 3131 3060 2869 2634 2578 2135 977 1799 --1134
NM_000282chr131265 ------
NM_000284chrX3678 660 158 ------
NM_000288chr6--1343 ----
NM_000291chrX1266 2916 336 ----
NM_000304chr1721070 338 --1230 --
NM_000314chr1043237 2752 654 439 1474 --12706
NM_000321chr1331402 616 346 11617 21785 376 --
NM_000332chr676178 5600 5231 4757 1485 988 974 15293 16183 --
NM_000340chr331488 1156 518 --11409 --
NM_000345chr421021 987 1349 1889 --
NM_000346chr1761905 1888 1865 1366 696 605 ------
NM_000354chrX2273 234 1250 ----
NM_000358chr51569 ------
NM_000362chr2243377 1001 770 406 12497 ----
NM_000368chr953970 3878 1776 450 423 14533 34804 4051 746 --
NM_000378chr1121256 1144 1433 ----
NM_000389chr6183 ------
NM_000390chrX93345 3208 3130 3064 2432 618 516 510 331 12081 --1910
NM_000397chrX12429 21768 484 ----
NM_000399chr1021178 53 1319 ----
NM_000405chr52522 463 1380 --169
NM_000408chr252892 2715 2618 705 171 43245 1279 192 159 ----
NM_000428chr1432575 2345 2089 22480 547 ----
NM_000430chr1721106 978 32647 571 557 ----
NM_000437chr1--2803 710 11426 --
NM_000439chr562489 1794 1718 1632 644 61 22206 86 11626 --
NM_000448chr1142693 2317 1321 1263 1949 ----
NM_000449chr131314 1040 47 ------
NM_000451chrX1790 --12126 --
NM_000459chr91234 ------
NM_000461chr3104064 3975 3811 3623 3466 3044 1461 916 504 80 ------
NM_000462chr1551607 1498 519 471 338 11396 ----
NM_000465chr22115 45 ------
NM_000486chr1221003 436 23269 2568 1482 --
NM_000489chrX52869 2330 2301 2241 1157 1184 ----
NM_000495chrX4774 448 368 292 1782 ----
NM_000503chr811724 11451 ----
NM_000522chr72932 61 1922 ----
NM_000525chr111193 11465 ----
NM_000530chr12693 276 ------
NM_000533chrX2205 86 193 1533 --
NM_000555chrX116302 5896 5709 5489 4764 1951 1028 534 384 327 312 12681 27559 1504 17724
NM_000565chr121551 707 1678 ----
NM_000594chr6----1788 --
NM_000598chr721047 110 --11450 --
NM_000599chr254599 4411 1148 1040 311 14607 ----
NM_000601chr72279 125 ----1174
NM_000615chr1141932 967 919 148 12219 12438 --
NM_000618chr12106277 5905 5532 4912 2559 1960 921 518 452 52 14602 ----
NM_000618chr12106277 5905 5532 4912 2559 1960 921 518 452 52 14602 ----
NM_000627chr21619 ------
NM_000683chr41200 ----1477
NM_000684chr1031210 504 264 ----1485
NM_000685chr32729 314 ------
NM_000685chr32729 314 ------
NM_000686chrX21142 190 11000 ----
NM_000702chr131871 1657 1505 ------
NM_000719chr1276514 5442 1944 1808 1698 1512 785 1862 21932 1898 --
NM_000721chr142477 2104 295 229 11973 ----
NM_000723chr1741421 1336 1063 126 11365 ----
NM_000724chr1051723 1425 1236 674 566 --11785 --
NM_000726chr21512 142 ----
NM_000800chr51417 ------
NM_000801chr2041020 847 391 166 ------
NM_000806chr521634 501 21369 600 ----
NM_000807chr4152 2163 59 ----
NM_000809chr459079 8585 8144 7758 6205 22178 1508 12521 26389 24
NM_000811chr52575 279 1270 ----
NM_000813chr5115115 4942 4621 4516 4480 4313 1957 1659 1183 1086 596 34244 1741 696 ----
NM_000814chr1554119 3082 2567 759 575 13970 33978 3547 2663 --
NM_000817chr21156 ------
NM_000818chr101123 ------
NM_000826chr42882 601 ------
NM_000827chr562447 2217 2143 982 401 170 ----1216
NM_000829chr112788 367 192 1741 --
NM_000833chr16--11349 ----
NM_000838chr631828 1752 950 12759 ----
NM_000844chr33979 439 388 2409 53 ----
NM_000859chr51500 ------
NM_000872chr1031483 502 36 ------
NM_000875chr15116683 6251 5888 5765 5697 4876 4597 2355 2114 1737 1042 21437 591 26661 2370 16652
NM_000877chr232957 2819 2260 ------
NM_000882chr31284 ------
NM_000891chr1763607 3216 3011 2841 2421 915 12779 --1566
NM_000899chr1254198 3802 3374 1637 846 --160 21223 1197
NM_000901chr472320 1671 870 843 699 403 27 ------
NM_000902chr3--1544 1294 11086
NM_000908chr52762 502 ------
NM_000910chr421763 1740 1578 ----
NM_000921chr122493 185 ------
NM_000922chr113878 391 297 1282 ----
NM_000926chr1188217 8208 7013 5864 3732 1437 1152 454 49131 7935 5890 2926 11269 --
NM_000933chr2021519 1489 11172 --1269
NM_000935chr341008 969 962 808 ------
NM_000937chr171385 ------
NM_000944chr442024 766 390 119 1504 ----
NM_000945chr221974 34 ------
NM_000949chr51216 ------
NM_000950chrX63238 3124 3092 2981 2235 1008 23035 189 13441 --
NM_000965chr331233 1216 390 ------
NM_000973chr8125 ------
NM_000989chr8169 ------
NM_001001132chr2121118 501 1395 11153 --
NM_001001323chr1253181 3160 1270 889 747 12295 ----
NM_001001331chr352374 1086 948 727 395 --11723 12573
NM_001001394chr2--2536 494 2615 457 --
NM_001001395chr1262752 2185 808 363 237 58 ------
NM_001001396chr194452 3914 3876 3685 3232 856 849 635 485 21643 1539 ----
NM_001001419chr564973 4537 3846 1970 434 170 13709 1791 15223
NM_001001420chr564973 4537 3846 1970 434 170 13709 1791 15223
NM_001001433chr2023138 1149 ------
NM_001001481chr842778 1276 1214 977 ----12749
NM_001001483chr112425 370 1359 ----
NM_001001484chr1032060 669 653 21994 642 2829 142 --
NM_001001549chr762760 2564 1148 178 156 123 ----12524
NM_001001550chr762760 2564 1148 178 156 123 ----12524
NM_001001555chr762760 2564 1148 178 156 123 ----12524
NM_001001664chr283792 2979 2960 1560 1401 973 891 105 12654 2618 402 --
NM_001001787chr11161 ------
NM_001001791chr1011160 --11542 --
NM_001001852chr221831 ------
NM_001001890chr2133411 1376 1207 ----23617 2971
NM_001001924chr832070 1319 185 --11722 11822
NM_001001925chr832070 1319 185 --11722 11822
NM_001001928chr2258338 6276 5833 5752 989 26419 6214 15304 26649 1581
NM_001001931chr832070 1319 185 --11722 11822
NM_001001933chr12545 128 2477 44 ----
NM_001001937chr18--141 ----
NM_001001938chr933361 3131 3041 --12878 --
NM_001001971chr1021114 995 --1957 --
NM_001001974chr1022266 1521 21571 871 ----
NM_001001995chrX1760 11744 ----
NM_001002006chr23916 346 113 ------
NM_001002233chr8--1827 12016 --
NM_001002255chr61351 ------
NM_001002295chr101803 ----1141
NM_001002759chr10--1436 ----
NM_001002762chr1042449 2176 2065 971 11805 --1878
NM_001002811chr131217 1177 446 11619 ----
NM_001002812chr131217 1177 446 11619 ----
NM_001002812chr131217 1177 446 11619 ----
NM_001002860chr1473956 3817 3615 3419 3361 1297 210 --1653 --
NM_001002909chr1762114 2020 1634 1526 1383 216 --1166 --
NM_001002919chr23581 498 165 ------
NM_001003406chr2223057 370 --12990 --
NM_001003652chr18157538 7143 7093 6636 6258 5680 5318 2882 2237 1833 1769 1508 872 756 368 17568 28643 3355 16346
NM_001003674chr18107011 6807 6159 6087 5293 5129 4593 1986 1837 788 15865 ----
NM_001003675chr18107011 6807 6159 6087 5293 5129 4593 1986 1837 788 15865 ----
NM_001003681chr2251903 1383 407 178 51 ------
NM_001003688chr41763 11013 ----
NM_001003694chr32608 57 ------
NM_001003698chr61402 ------
NM_001003699chr61402 ------
NM_001003712chr1244005 1398 1202 791 32810 2707 1273 12948 --
NM_001003792chr34994 779 80 34 1214 ----
NM_001003793chr34994 779 80 34 1214 ----
NM_001003794chr3------13009
NM_001003800chr933024 2441 1478 --13226 --
NM_001003810chr43637 561 194 ------
NM_001003891chr22------1920
NM_001003940chr151934 31096 853 214 ----
NM_001003942chr151934 31096 853 214 ----
NM_001003943chr151938 31100 857 218 ----
NM_001003954chr8--145 ----
NM_001004019chr31116 ------
NM_001004051chrX--1124 ----
NM_001004065chr943212 1292 1153 527 12911 11396 --
NM_001004106chr511051 ------
NM_001004196chr341101 939 814 500 ------
NM_001004303chr13721 691 587 ------
NM_001004303chr13721 691 587 ------
NM_001004304chr1243024 2891 1247 370 13119 12002 --
NM_001004317chr633583 2935 314 13313 14425 --
NM_001004329chr1231353 1155 999 --1286 --
NM_001004342chr185984 5709 4362 4246 2046 1547 755 603 11504 --13941
NM_001004360chr232005 1831 300 ----11255
NM_001004419chr1224275 1629 ----14462
NM_001004441chr521370 679 1271 ----
NM_001005242chr1211329 1390 --1190
NM_001005366chr123805 763 757 ------
NM_001005375chrY21737 1573 11161 11215 --
NM_001005386chr211644 1630 21967 1677 --
NM_001005404chr1784420 4384 3806 1410 794 753 203 189 --13747 --
NM_001005417chr11671 ------
NM_001005463chr1012453 2914 773 --11673
NM_001005473chr536403 4328 2628 25647 2638 12612 --
NM_001005474chr331338 536 80 ------
NM_001005502chr1244662 1970 1797 621 13177 ----
NM_001005527chr32406 58 ------
NM_001005609chrX53807 3607 3059 3018 313 12832 21187 656 --
NM_001005743chr1431072 439 81 ------
NM_001005744chr1431072 439 81 ------
NM_001005745chr1431072 439 81 ------
NM_001005746chr21512 142 ----
NM_001005747chr21512 142 ----
NM_001005782chr21160 ------
NM_001005861chr32916 108 ------
NM_001005862chr171588 ------
NM_001005910chr33480 457 160 1432 1467 --
NM_001005911chr33480 457 160 1432 1467 --
NM_001006115chr352582 2512 2009 1058 996 --22704 1086 --
NM_001006600chr522446 2016 2746 483 ----
NM_001006605chr13942 425 360 ------
NM_001006605chr13942 425 360 ------
NM_001006610chr163989 325 293 ------
NM_001006612chrX3395 388 77 ------
NM_001006613chrX3395 388 77 ------
NM_001006614chrX3395 388 77 ------
NM_001006636chr21967 ------
NM_001006657chr232734 2343 1059 13190 ----
NM_001006681chrX1142 1122 ----
NM_001006682chrX1142 1122 ----
NM_001006683chrX1142 1122 ----
NM_001006684chrX1423 ------
NM_001006946chr231435 1189 715 --1736 --
NM_001007024chr1754304 3745 3401 2693 251 13196 ----
NM_001007025chr1754304 3745 3401 2693 251 13196 ----
NM_001007075chr451090 1012 963 838 437 1923 1430 --
NM_001007097chr954900 4443 4135 954 887 --13628 --
NM_001007098chr1163 ------
NM_001007099chr11327 --1688 --
NM_001007100chr11327 --1688 --
NM_001007102chr641389 1312 1196 1058 11511 ----
NM_001007226chr173970 587 450 ------
NM_001007227chr173970 587 450 ------
NM_001007228chr173970 587 450 ------
NM_001007229chr173970 587 450 ------
NM_001007230chr173970 587 450 ------
NM_001007246chr2131695 1311 776 1484 ----
NM_001007257chr131400 1233 388 ------
NM_001007267chr21171 ------
NM_001007278chr1345016 4751 4632 4477 15254 15057 --
NM_001007466chr665089 5023 4929 4063 1437 710 --15111 1890
NM_001007553chr131185 1060 303 ------
NM_001007559chr1811570 ------
NM_001007565chr31155 ------
NM_001007793chr10----143 --
NM_001007794chr1--1634 ----
NM_001008222chrX128 ------
NM_001008225chr7184 ------
NM_001008239chr18103506 3315 3180 3122 3016 2391 2367 1382 1333 103 --1579 --
NM_001008388chr441112 279 137 122 ------
NM_001008392chr343561 3217 2933 2786 11052 2780 229 --
NM_001008407chr731823 1491 1176 ------
NM_001008408chr776043 5765 5512 5274 4874 4585 4425 --35416 4676 1550 --
NM_001008495chr872031 2001 1857 1489 1392 424 348 ------
NM_001008529chr172943 453 --11245 --
NM_001008539chr874531 4512 1614 1348 1265 1111 725 14213 34605 629 102 --
NM_001008540chr22382 118 ------
NM_001008541chr1042265 2100 1779 825 --22018 339 --
NM_001008541chr1042265 2100 1779 825 --22018 339 --
NM_001008563chr951343 282 204 121 51 ------
NM_001008564chr1322231 837 ----1155
NM_001008660chr1131598 1497 518 ------
NM_001008701chr1912003 --22776 2096 --
NM_001008707chr1431578 1559 1375 1765 --11798
NM_001008738chr512270 ------
NM_001008783chr6--2916 281 1647 --
NM_001008801chr1932098 620 267 ------
NM_001008925chr433434 3185 495 12336 --1450
NM_001009554chr4114767 4549 3450 3339 2930 1862 1406 735 691 522 448 1612 ----
NM_001009554chr4114767 4549 3450 3339 2930 1862 1406 735 691 522 448 1612 ----
NM_001009555chr421652 614 ------
NM_001009566chr131201 1140 278 ------
NM_001009571chr73625 200 92 1501 ----
NM_001009881chr11606 ------
NM_001009882chr11606 ------
NM_001009909chr1122906 537 33682 575 36 ----
NM_001009993chr234192 3070 1671 --23925 1389 --
NM_001010853chr622548 1045 12312 ----
NM_001010861chr132558 1792 75 ------
NM_001010862chrX73297 2522 978 526 169 112 78 1831 ----
NM_001010888chrX44503 4316 3208 2851 --24342 4113 --
NM_001010891chr5116672 6592 6348 4716 4496 4480 4282 1558 1113 666 291 25462 4896 --14542
NM_001010924chr1031037 859 499 --1141 --
NM_001010927chr62388 377 ------
NM_001010932chr72279 125 ----1174
NM_001010942chr123907 224 159 ------
NM_001010971chr11776 1229 ----
NM_001010984chr152320 2269 993 944 151 1479 --11664
NM_001010986chrX31655 1598 356 1339 ----
NM_001010989chr161551 ------
NM_001010990chr161551 ------
NM_001011513chr494050 3935 3330 2767 2531 2516 981 836 819 13356 --13846
NM_001011515chr42783 92 ------
NM_001011516chr42783 92 ------
NM_001011537chr352273 2053 1854 726 344 1363 11836 --
NM_001011553chr72974 65 ------
NM_001011645chrX1154 ------
NM_001011658chrX12094 --12159 --
NM_001011663chr103930 285 98 ------
NM_001011666chr776330 4755 4507 2549 1174 447 321 --26335 4226 --
NM_001011708chr252585 853 746 614 209 11065 12708 --
NM_001011713chr1451580 1541 1155 599 567 ------
NM_001012267chr9--177 ----
NM_001012393chr1153682 3582 2075 1805 149 24997 799 1154 --
NM_001012418chr684224 4071 3918 3656 3402 3203 3167 2858 23065 856 23720 578 --
NM_001012420chr1552891 2381 2233 1829 1809 12811 2478 270 --
NM_001012423chr1552891 2381 1829 1809 408 22811 2234 2478 270 --
NM_001012426chr643099 3066 2625 1052 --1696 --
NM_001012427chr643099 3066 2625 1052 --1696 --
NM_001012478chr191619 1606 ----
NM_001012513chr18----1192 --
NM_001012614chr41739 --1296 --
NM_001012732chr411214 --1512 --
NM_001012751chr1041524 724 704 448 ------
NM_001012754chr1342017 1765 1661 271 11927 ----
NM_001012761chr552561 2132 1018 377 35 32262 2198 429 1124 --
NM_001012968chrX82548 2417 974 957 911 892 252 164 22341 181 ----
NM_001012977chrX31350 1116 503 ------
NM_001012989chrX2584 63 ------
NM_001012990chrX1317 ------
NM_001013031chr1053325 3134 1361 1060 276 1971 13024 1772
NM_001013398chr721047 110 --11450 --
NM_001013406chr731736 1365 1180 ------
NM_001013415chr421448 23 1560 21348 989 --
NM_001013437chr181163 ------
NM_001013438chr311021 ------
NM_001013439chr31867 ------
NM_001013843chr154768 704 656 296 ------
NM_001014286chr131316 ------
NM_001014380chr1395865 5332 4661 4207 2142 1844 1169 756 672 35840 5590 641 15746 1185
NM_001014434chr11208 ------
NM_001014794chr11--1189 ----
NM_001014795chr11--1189 ----
NM_001014797chr10138198 7411 7032 6810 5598 5285 5268 5081 3048 2064 1864 1089 280 12082 2943 853 17052
NM_001015045chr442466 2312 1760 505 --11638 --
NM_001015053chr1731538 1396 1063 ------
NM_001015508chr81747 1263 ----
NM_001015877chrX53062 341 214 153 93 1632 ----
NM_001015881chrX21279 64 --2810 335 --
NM_001017371chr221080 1033 1506 ----
NM_001017395chr372845 2697 2640 2628 2600 2394 1205 ------
NM_001017405chr42880 175 ------
NM_001017415chr1----1304 --
NM_001017416chr1----1304 --
NM_001017424chr111934 --11372 --
NM_001017425chr111934 --11372 --
NM_001017916chr1722027 1602 ----11952
NM_001017917chr1722027 1602 ----11952
NM_001017922chr111125 --11717 11175
NM_001017923chr1441645 528 436 182 1327 ----
NM_001017926chr82706 69 ----11775
NM_001017930chrX41331 1219 106 99 ------
NM_001017973chr51334 --1118 --
NM_001017974chr51334 --1118 --
NM_001017977chr11365 ------
NM_001017979chr41596 ------
NM_001018009chr321030 373 ------
NM_001018037chr931469 1092 306 1511 1976 --
NM_001018050chr2242575 2447 2218 1115 ------
NM_001018052chr2242575 2447 2218 1115 ------
NM_001018057chr112295 268 ----1239
NM_001018064chr922135 1936 21820 491 1404 --
NM_001018067chr165316 5187 4834 4824 3975 2059 1491 13937 11426
NM_001018068chr165316 5187 4834 4824 3975 2059 1491 13937 11426
NM_001018069chr165316 5187 4834 4824 3975 2059 1491 13937 11426
NM_001018074chr573845 3452 2878 2817 1265 1018 992 --173 --
NM_001018075chr573845 3452 2878 2817 1265 1018 992 --173 --
NM_001018076chr573845 3452 2878 2817 1265 1018 992 --173 --
NM_001018077chr573845 3452 2878 2817 1265 1018 992 --173 --
NM_001018090chr1572842 2124 2033 1073 647 468 313 22109 2077 1146 --
NM_001018091chr1572952 2234 2143 1183 757 578 423 22219 2187 1256 --
NM_001018102chr1572842 2124 2033 1073 647 468 313 22109 2077 1146 --
NM_001018108chr1561921 1768 802 722 605 121 ------
NM_001018111chr763952 3850 3175 3112 720 626 13769 13875 --
NM_001020658chr131449 609 410 11219 ----
NM_001020658chr131449 609 410 11219 ----
NM_001020825chr541320 927 353 292 ------
NM_001023567chr1532364 2283 1850 21831 409 2480 270 12203
NM_001024094chr573845 3452 2878 2817 1265 1018 992 --173 --
NM_001024372chr832284 1719 915 --1361 --
NM_001024455chrX42110 1893 654 86 --12218 --
NM_001024463chr1511047 ------
NM_001024647chr1257313 6146 1726 1027 859 14836 36378 6180 173 --
NM_001024649chr552930 2871 2000 654 357 22239 314 1524 --
NM_001024660chr331493 1406 368 ------
NM_001024666chrX2486 457 --1101 --
NM_001024808chr1252832 1832 1033 605 72 ------
NM_001024847chr311562 --12454 --
NM_001024934chr62587 93 ------
NM_001024935chr62587 93 ------
NM_001024936chr62587 93 ------
NM_001024937chr172747 98 ------
NM_001024947chr52812 217 1861 ----
NM_001024948chr153272 3250 2793 1138 228 --13142 --
NM_001024956chr11115829 5747 5592 5405 4780 4625 1651 1570 1066 342 271 13839 11951 --
NM_001025068chr351689 1563 1137 650 386 --1484 --
NM_001025069chr351689 1563 1137 650 386 --1484 --
NM_001025076chr1095908 5867 3915 3800 1498 1279 1232 1028 680 14225 44898 3792 912 76 --
NM_001025077chr10167266 7225 5273 5158 5022 4998 4707 4594 2856 2637 2590 2386 2038 1084 1061 304 15583 46256 5150 2270 1434 1178
NM_001025079chr352581 2521 1518 1273 1259 43904 3771 1463 432 21644 220 --
NM_001025105chr531508 1058 470 ------
NM_001025108chr263694 3250 1639 1334 233 159 21061 925 ----
NM_001025201chr2168 ------
NM_001025252chr893204 3167 2967 2824 2818 2403 678 353 140 12805 ----
NM_001025253chr893204 3167 2967 2824 2818 2403 678 353 140 12805 ----
NM_001025266chr354393 4246 1951 584 56 --11200 --
NM_001025356chr1232919 2347 658 21089 45 ----
NM_001025366chr631801 1351 578 11467 ----
NM_001025366chr631801 1351 578 11467 ----
NM_001025367chr631801 1351 578 11467 ----
NM_001025367chr631801 1351 578 11467 ----
NM_001025368chr631801 1351 578 11467 ----
NM_001025368chr631801 1351 578 11467 ----
NM_001025369chr631817 1367 594 11483 ----
NM_001025369chr631817 1367 594 11483 ----
NM_001025370chr631801 1351 578 11467 ----
NM_001025370chr631801 1351 578 11467 ----
NM_001025579chr1711028 ------
NM_001025580chrX103786 3338 3050 2712 2613 1710 1057 549 341 282 33555 1184 566 --11205
NM_001025595chr41662 11335 21685 1095 --
NM_001025596chr113425 196 54 ------
NM_001025603chr131314 1040 47 ------
NM_001025616chr451457 1180 643 522 432 21871 539 ----
NM_001029858chr663143 2522 2420 2241 2166 51 12108 12597 --
NM_001029863chr633261 982 530 2636 597 32363 2080 60 --
NM_001029875chr532738 2344 2322 ------
NM_001029882chr11654 ------
NM_001029882chr11654 ------
NM_001029884chr652755 2528 2481 1830 42 ------
NM_001030001chr141437 ------
NM_001030007chr1641554 1009 628 368 --13021 --
NM_001030055chr1464640 4596 4379 3567 2881 1447 24054 3021 14435 --
NM_001031623chr631355 125 67 ------
NM_001031679chr1223452 138 12586 ----
NM_001031695chr2263721 2185 2179 2068 1716 1705 23797 3575 ----
NM_001031700chr432317 2205 2138 1310 ----
NM_001031711chr521361 1244 1551 ----
NM_001031716chr24463 377 145 128 ------
NM_001031732chr452992 883 817 368 321 23166 2570 ----
NM_001031804chr16104191 3566 3246 2880 2851 2840 1642 1402 909 221 11723 ----
NM_001031812chr552126 2099 1826 1733 234 1216 ----
NM_001032280chr621653 317 ------
NM_001032282chr82446 328 ------
NM_001032283chr123940 926 840 ----1804
NM_001032284chr123940 926 840 ----1804
NM_001032288chr2021090 176 ------
NM_001032293chr171635 ------
NM_001032367chr152677 426 ------
NM_001032393chrX2682 557 ------
NM_001032394chr642568 2150 1727 939 12819 ----
NM_001032395chr632435 2017 806 12686 ----
NM_001032999chr2075348 4539 4120 3805 3792 724 252 15249 ----
NM_001033025chr131508 1484 302 11551 ----
NM_001033044chr141789 1751 1529 332 21401 722 11183 --
NM_001033045chr224332 3640 --24364 1549 --
NM_001033056chr141789 1751 1529 332 21401 722 11183 --
NM_001033057chr331825 799 656 1242 21333 528 --
NM_001033085chr2198 ------
NM_001033087chr2093219 3006 2919 2609 2441 2294 1311 1001 282 22300 815 ----
NM_001033117chr374376 3831 3295 3238 1817 1422 900 ----11704
NM_001033503chr5194 ------
NM_001033518chr761955 1892 1075 830 748 229 21942 248 12243 --
NM_001033519chr761955 1892 1075 830 748 229 21942 248 12243 --
NM_001033520chr761955 1892 1075 830 748 229 21942 248 12243 --
NM_001033557chr231362 339 216 --1378 --
NM_001033561chr172768 752 ------
NM_001033578chr8--2397 284 ----
NM_001033602chr1352687 2254 2191 1879 827 ------
NM_001033756chr631735 1285 512 11401 ----
NM_001033756chr631735 1285 512 11401 ----
NM_001033925chr1041484 1406 732 141 --11446 --
NM_001034837chr51240 ------
NM_001034838chr51240 ------
NM_001034841chr1685535 5198 4400 3834 3820 3517 1135 984 ------
NM_001034845chr441403 1081 1069 895 ------
NM_001034954chr1033245 2500 2406 --21006 666 --
NM_001034955chr1033245 2500 2406 --21006 666 --
NM_001034956chr1033245 2500 2406 --21006 666 --
NM_001034957chr1033245 2500 2406 --21006 666 --
NM_001035chr121031 87 ------
NM_001035003chr411405 21393 346 ----
NM_001035004chr411405 21393 346 ----
NM_001035260chr101422 ------
NM_001035507chr2159 ------
NM_001037131chr221335 1009 ----1487
NM_001037132chr731782 1711 540 21996 1462 11950 163
NM_001037133chr731782 1711 540 21996 1462 11950 163
NM_001037164chr721670 771 11407 21899 86 --
NM_001037172chr371377 1032 923 905 302 124 73 11216 ----
NM_001037174chr231896 1714 447 --1179 --
NM_001037317chr132558 1792 75 ------
NM_001037332chr5--12492 ----
NM_001037333chr5--12492 ----
NM_001037334chr185903 788 540 429 381 ------
NM_001037339chr141668 1445 714 386 --1684 --
NM_001037340chr141668 1445 714 386 --1684 --
NM_001037341chr141668 1445 714 386 --1684 --
NM_001037341chr141668 1445 714 386 --1684 --
NM_001037535chrX31486 1318 1107 11000 ----
NM_001037536chrX31486 1318 1107 11000 ----
NM_001037540chrX31486 1318 1107 11000 ----
NM_001037553chr2123290 756 14477 14596 --
NM_001037872chr22642 227 1160 ----
NM_001037954chr1143540 682 425 104 ------
NM_001039029chr1221993 1382 ------
NM_001039091chrX11236 1247 ----
NM_001039199chr2054949 992 660 459 278 --14547 --
NM_001039350chr72660 153 ----11665
NM_001039395chr952403 983 869 471 243 --1186 --
NM_001039457chr12281 260 ------
NM_001039465chr142517 421 ------
NM_001039479chr1432074 1550 818 1143 ----
NM_001039523chr23407 351 74 ------
NM_001039538chr242520 1086 1066 245 11250 11349 --
NM_001039569chr211019 12744 ----
NM_001039574chr14701 694 659 115 --1279 --
NM_001039585chr1103638 3441 2851 1684 1574 1456 1449 775 711 44 41354 585 455 414 13234 --
NM_001039590chrX123817 3782 3473 3059 2924 2710 2643 1520 1477 1436 1409 155 3934 506 488 ----
NM_001039591chrX123817 3782 3473 3059 2924 2710 2643 1520 1477 1436 1409 155 3934 506 488 ----
NM_001039618chr11115814 5044 5038 4910 4687 3665 2050 1128 755 362 334 --15212 --
NM_001039693chr253777 3311 3278 758 125 ------
NM_001039709chr2075348 4539 4120 3805 3792 724 252 15249 ----
NM_001039711chr13834 388 73 ------
NM_001039712chr13834 388 73 ------
NM_001039802chr12871 463 ------
NM_001039840chrX145679 5328 5282 5056 4327 4197 2090 1652 1390 672 508 496 174 87 45801 3939 2201 1454 11761 --
NM_001039916chr1221063 1008 1294 ----
NM_001039917chr1221063 1008 1294 ----
NM_001039918chr1221063 1008 1294 ----
NM_001039919chr1221063 1008 1294 ----
NM_001039920chr1221063 1008 1294 ----
NM_001039935chr53378 339 76 ------
NM_001039937chr1343316 3105 1085 650 1351 ----
NM_001040001chr621598 58 11987 ----
NM_001040057chr721399 1185 ----1507
NM_001040092chr81358 ------
NM_001040101chr4------1129
NM_001040110chr721578 59 --11215 --
NM_001040135chr71753 1602 --1613
NM_001040142chr241934 1800 479 65 ------
NM_001040143chr241934 1800 479 65 ------
NM_001040152chr734328 4208 1513 45105 3550 3458 1370 ----
NM_001040153chr131180 1310 --1779
NM_001040158chr52480 114 ------
NM_001040159chr421113 182 ------
NM_001040167chr721191 854 ------
NM_001040181chr31424 ------
NM_001040182chr31424 ------
NM_001040183chr31424 ------
NM_001040199chr31424 ------
NM_001040200chr31424 ------
NM_001040214chr611629 --21764 532 --
NM_001040260chr441142 1034 480 282 ------
NM_001040261chr441142 1034 480 282 ------
NM_001040272chr952268 1445 450 442 363 ------
NM_001040284chr1655866 5364 5240 3623 2147 --1928 11951
NM_001040402chr482860 2680 1229 1023 890 773 202 74 41262 839 231 48 --1138
NM_001040429chr1343611 3120 2208 699 12446 ----
NM_001040440chr5--1160 --1478
NM_001040441chr133466 1557 728 14330 13686 --
NM_001040446chr562576 1846 1807 1705 801 624 12268 ----
NM_001040450chr1512119 --12554 --
NM_001040453chr1512119 --12554 --
NM_001040633chr741012 871 216 63 ------
NM_001040653chr342519 2088 875 315 ------
NM_001040665chr744317 1630 858 828 11673 --1182
NM_001040708chr84452 328 282 146 ------
NM_001040709chr132392 1836 1705 ------
NM_001040712chr953573 3388 3198 2357 1190 13338 ----
NM_001040876chr421479 485 163 --1383
NM_001042355chr1644828 3987 3354 213 24176 1360 ----
NM_001042357chr1051199 1107 486 71 46 193 ----
NM_001042358chr1051199 1107 486 71 46 193 ----
NM_001042360chr1051199 1107 486 71 46 193 ----
NM_001042361chr1051230 1138 517 102 77 1124 ----
NM_001042363chr1051199 1107 486 71 46 193 ----
NM_001042364chr1051230 1138 517 102 77 1124 ----
NM_001042365chr1051230 1138 517 102 77 1124 ----
NM_001042383chr343268 2632 2579 181 43414 2943 435 230 22781 1048 --
NM_001042387chr1051230 1138 517 102 77 1124 ----
NM_001042389chr1051199 1107 486 71 46 193 ----
NM_001042390chr1051199 1107 486 71 46 193 ----
NM_001042392chr1051199 1107 486 71 46 193 ----
NM_001042393chr1051230 1138 517 102 77 1124 ----
NM_001042395chr1051199 1107 486 71 46 193 ----
NM_001042396chr1051230 1138 517 102 77 1124 ----
NM_001042397chr1051230 1138 517 102 77 1124 ----
NM_001042399chr12------1100
NM_001042403chr121691 --1711 --
NM_001042404chr13642 629 439 ------
NM_001042406chr63989 921 255 1459 ----
NM_001042412chr1644828 3987 3354 213 24176 1360 ----
NM_001042414chr131222 ------
NM_001042424chr412944 1869 12791 --
NM_001042425chr621653 317 ------
NM_001042453chrX1255 ------
NM_001042459chr31115 ------
NM_001042473chr1031761 132 91 --11630 --
NM_001042476chr1621414 857 11975 11630 --
NM_001042481chr1452692 2329 2215 2027 1852 --2379 303 143
NM_001042492chr1783323 3131 3060 2869 2634 2578 2135 977 1799 --1134
NM_001042493chr61155 31498 1363 384 ----
NM_001042506chrX21126 503 ------
NM_001042537chrX32181 930 471 ------
NM_001042539chr16----140 --
NM_001042552chr1--1945 ----
NM_001042555chr1284055 3152 1105 967 921 603 557 25 44408 4308 2943 977 --13389
NM_001042576chr201182 ------
NM_001042599chr2147771 6288 6145 5915 5628 5482 5102 4886 4793 2977 2433 1083 687 663 25896 1308 ----
NM_001042601chr333245 482 147 ------
NM_001042603chr12134115 3514 3456 3398 3340 2076 2028 1797 1402 1313 966 585 346 34538 2147 1668 ----
NM_001042604chr374421 4389 1780 989 863 601 206 23722 3653 ----
NM_001042616chr44585 499 104 87 ------
NM_001042632chr2032591 2211 499 ------
NM_001042633chr2032591 2211 499 ------
NM_001042635chr141141 133 ----
NM_001042669chr451457 1180 643 522 432 21871 539 ----
NM_001042681chr162332 2242 1937 1902 1831 770 12513 1171 12560
NM_001042682chr162332 2242 1937 1902 1831 770 12513 1171 12560
NM_001042682chr162332 2242 1937 1902 1831 770 12513 1171 12560
NM_001042749chrX31956 814 780 --2717 165 --
NM_001042750chrX31956 814 780 --2717 165 --
NM_001042751chrX31956 814 780 --2717 165 --
NM_001043318chr1454005 3778 3738 1101 804 23724 2562 13930 --
NM_001043351chr132250 2025 698 1820 ----
NM_001044305chr631514 311 214 ------
NM_001044385chr273687 3596 1231 1174 1168 188 41 1849 2445 163 --
NM_001044722chr552126 2099 1826 1733 234 1216 ----
NM_001044723chr552126 2099 1826 1733 234 1216 ----
NM_001046chr542027 1173 401 238 1259 ----
NM_001049chr1452269 2206 2073 418 209 --11517 --
NM_001068chr3154 ------
NM_001071775chr131611 11682 --11192
NM_001079874chr152069 1972 1755 604 369 11602 ----
NM_001081472chr11402 ------
NM_001083620chr42881 600 ------
NM_001084chr71295 ------
NM_001094chr171754 --2800 729 --
NM_001096chr172748 244 ------
NM_001099678chr335173 1850 240 15486 --14123
NM_001100108chr187979 7684 7189 7163 5225 1854 1397 818 33332 2606 1292 --18342
NM_001106chr3149653 9180 8721 8666 8095 7923 6605 6321 3078 2269 2244 2095 1707 1594 28841 6333 23103 350 17822
NM_001113490chrX43502 3416 2305 847 12510 1611 11046
NM_001116chr1623018 2184 --22083 38 --
NM_001121chr1021512 749 11802 --1588
NM_001122679chr531256 1060 860 1974 ----
NM_001124chr112631 464 ----1252
NM_001128chr1641554 1009 628 368 --13021 --
NM_001135chr151197 1100 ----
NM_001146chr832284 1991 1862 ------
NM_001148chr442058 1449 445 309 --11454 --
NM_001149chr101487 ------
NM_001156chr103476 244 146 ------
NM_001160chr1242793 2640 481 134 --1220 --
NM_001166chr111455 ------
NM_001167chrX46371 2685 1307 914 2567 105 ----
NM_001173chr1464640 4596 4379 3567 2881 1447 24054 3021 14435 --
NM_001191chr202418 274 ------
NM_001198chr652165 1652 461 299 263 22351 1824 ----
NM_001200chr2031007 787 389 ------
NM_001204chr2107489 7431 7188 6664 6416 6039 5020 1465 824 241 35647 1853 1356 ----
NM_001206chr943068 2921 1179 523 12288 --12915
NM_001215chr1--1380 ----
NM_001219chr752128 860 600 217 73 1672 ----
NM_001222chr1031933 1716 97 ------
NM_001241chr231484 945 832 31887 1780 1737 ----
NM_001241chr231484 945 832 31887 1780 1737 ----
NM_001254chr1731013 927 350 --1321 --
NM_001256chr1732896 2861 457 12382 22273 986 11184
NM_001257chr1651387 1080 998 546 337 ------
NM_001259chr776195 6163 5587 2337 950 231 215 32240 986 642 21207 224 --
NM_001260chr132339 221 1236 ----
NM_001262chr11339 1280 1325 --
NM_001270chr531022 879 742 ------
NM_001278chr1041162 970 902 288 ------
NM_001284chr51105 --1511 --
NM_001286chr142767 2758 2523 1900 1356 ----
NM_001290chr41305 ------
NM_001304chr1772813 2712 2641 2478 2462 2415 1117 12726 ----
NM_001310chr12--21883 727 12724 --
NM_001316chr202385 174 ------
NM_001319chr1921033 324 ------
NM_001326chr112419 48 --1392 --
NM_001328chr41739 --1296 --
NM_001329chr101660 21552 444 1489 --
NM_001331chr1142723 1788 1127 1064 1291 ----
NM_001332chr541530 1134 1077 97 ------
NM_001351chr321710 1547 21162 1131 11184 --
NM_001356chrX62156 1776 1644 1547 619 299 ------
NM_001357chr12250 221 190 ----
NM_001364chr1154386 3254 1587 1083 350 1665 1226 --
NM_001379chr191112 ------
NM_001380chr101738 ------
NM_001385chr81281 ------
NM_001386chr841907 1798 709 196 ----1956
NM_001391chr1831054 104 49 ------
NM_001395chrX2950 700 ----1392
NM_001396chr2162643 1125 414 284 236 22 1335 11070 1602
NM_001399chrX53807 3607 3059 3018 313 12832 21187 656 --
NM_001401chr91448 ------
NM_001402chr631768 1715 68 31731 694 257 ----
NM_001406chr1721598 1230 ------
NM_001407chr321077 488 11070 ----
NM_001412chrX73539 3145 3043 2944 2369 1156 333 1556 12516 1485
NM_001415chrX41814 1562 627 297 1612 ----
NM_001416chr171342 ------
NM_001419chr1974252 3385 1206 1161 1141 987 114 24571 2975 23364 108 --
NM_001420chr1942413 2245 2199 2093 --12664 --
NM_001427chr731757 1461 456 ------
NM_001429chr222893 143 ------
NM_001431chr641245 1214 1140 934 ------
NM_001432chr453791 3405 3180 2830 891 1171 --12614
NM_001438chr143093 2687 1398 281 ------
NM_001439chr131508 1484 302 11551 ----
NM_001444chr81203 ------
NM_001448chrX41613 322 298 82 ------
NM_001452chr62639 162 ----1693
NM_001453chr641648 1370 687 227 ------
NM_001457chr351482 1273 1163 92 57 ------
NM_001463chr23809 646 306 ------
NM_001482chr15----1143 --
NM_001483chr72897 51 1436 ----
NM_001490chr92769 611 21445 1395 ----
NM_001497chr952765 2277 719 585 170 11698 12348 --
NM_001498chr651372 1327 1319 1264 1096 2884 448 ----
NM_001530chr1431104 967 934 2757 439 ----
NM_001543chr544878 3746 868 32 23663 3250 13674 --
NM_001546chr62979 229 ------
NM_001554chr11217 ------
NM_001564chr4134 --154 --
NM_001609chr1014401 13628 ----
NM_001614chr173546 59 29 ------
NM_001614chr173546 59 29 ------
NM_001621chr743011 2403 155 46 --12719 --
NM_001621chr743011 2403 155 46 --12719 --
NM_001650chr1853331 1336 933 890 108 11344 --12765
NM_001655chr111710 11360 12033 --
NM_001656chr531760 1499 157 11671 ----
NM_001659chr1262201 2134 2059 2035 1934 455 1407 22595 395 --
NM_001660chr32704 73 ------
NM_001662chr71391 ------
NM_001663chr143857 406 173 --1520 --
NM_001664chr3--1736 ----
NM_001668chr171783 1511 738 640 622 482 49 --1344 --
NM_001677chr11799 --1420 --
NM_001678chr1741604 1482 644 419 ------
NM_001681chr122716 259 ------
NM_001682chr1262895 2874 1146 984 603 461 12009 ----
NM_001683chr352374 1086 948 727 395 --11723 12573
NM_001684chr1104169 3631 3593 3402 2949 1580 573 566 352 202 31531 1360 1256 ----
NM_001690chr341991 566 296 90 --12030 --
NM_001695chr883511 3252 1506 1361 1037 841 99 40 13797 13740 --
NM_001701chr911578 11041 11002 --
NM_001704chr62611 435 1419 ----
NM_001706chr32803 667 --1949 --
NM_001709chr1151837 685 579 557 246 --1841 --
NM_001714chr121512 1437 --1408
NM_001718chr641149 1087 343 170 ------
NM_001730chr1321504 1377 1539 ----
NM_001730chr1321504 1377 1539 ----
NM_001731chr122738 54 2677 241 ----
NM_001735chr92346 31 --2398 291 --
NM_001742chr72635 131 11386 ----
NM_001743chr23553 65 51 ------
NM_001744chr5152 ------
NM_001745chr52372 181 ------
NM_001746chr552930 2871 2000 654 357 22239 314 1524 --
NM_001753chr731504 1305 1253 ------
NM_001754chr2133411 1376 1207 ----23617 2971
NM_001755chr1622284 571 12260 1513 --
NM_001759chr1275005 3513 3318 1880 1528 1051 548 1653 ----
NM_001762chr72239 75 ------
NM_001769chr125342 95 88 81 63 2301 105 1164 --
NM_001777chr352581 2521 1518 1273 1259 43904 3771 1463 432 21644 220 --
NM_001788chr72974 65 ------
NM_001791chr12871 463 ------
NM_001792chr1821110 399 ------
NM_001797chr161562 ------
NM_001798chr1231128 1070 311 ------
NM_001799chr51101 ------
NM_001800chr191123 ------
NM_001802chr163121 72 30 --1108 --
NM_001806chr1912916 ------
NM_001822chr2168 ------
NM_001826chr11155 ------
NM_001827chr91266 ------
NM_001830chrX83591 3046 1579 1358 837 815 449 358 13875 --1240
NM_001839chr12668 656 ----1504
NM_001854chr111489 11454 ----
NM_001858chr6105003 4582 4070 4026 3610 3395 2061 1570 1466 217 24719 1992 --12070
NM_001859chr911082 --11100 --
NM_001874chr1244662 1970 1797 621 13177 ----
NM_001880chr22301 206 ------
NM_001892chr531508 1058 470 ------
NM_001893chr17--1387 ----
NM_001894chr2221048 141 1160 129 --
NM_001895chr2021200 854 ------
NM_001901chr631047 836 669 ------
NM_001903chr5--178 --1772
NM_001904chr31278 1238 ----
NM_001915chr1722027 1602 ----11952
NM_001918chr169073 8789 8707 7268 1897 926 38900 8402 142 16506 19205
NM_001921chr411214 --1512 --
NM_001933chr143516 386 311 ------
NM_001936chr72660 153 ----11665
NM_001938chr121575 482 ------
NM_001939chrX42814 1361 821 728 ------
NM_001942chr1831825 1678 328 11384 --11509
NM_001946chr122830 176 --1231 --
NM_001949chr642380 992 749 228 12156 ----
NM_001951chr81589 ------
NM_001954chr61749 ------
NM_001955chr631080 861 362 ------
NM_001964chr5----11119 --
NM_001967chr3------1398
NM_001968chr43872 739 158 1698 ----
NM_001969chr1443131 2587 977 889 13616 22446 209 --
NM_001977chr41587 ------
NM_001981chr152052 867 755 400 266 ----1719
NM_001994chr11187 ------
NM_001995chr4--31413 1229 354 11436 --
NM_001998chr31116 ------
NM_001999chr531486 1453 1160 1360 11185 --
NM_002006chr4115824 5602 4038 2188 1862 1814 1611 1571 1516 973 266 24513 546 --11591
NM_002009chr1532338 2153 162 21872 446 ----
NM_002010chr131118 ------
NM_002014chr121274 ------
NM_002015chr1352601 1337 1218 950 469 23244 1264 1197 --
NM_002017chr112540 167 ------
NM_002024chrX11399 1513 ----
NM_002025chrX117190 6968 6822 6331 6253 6105 3369 2932 2692 986 113 26568 2993 27903 6714 --
NM_002028chr1431283 1263 28 11289 ----
NM_002035chr1831612 935 334 13604 11122 13953
NM_002039chr4--1361 ----
NM_002040chr2142415 2298 838 828 ------
NM_002051chr101803 ----1141
NM_002054chr21423 ------
NM_002063chrX21198 846 --1347 --
NM_002065chr141789 1751 1529 332 21401 722 11183 --
NM_002069chr7------1417
NM_002072chr92798 145 11019 ----
NM_002074chr12458 261 ------
NM_002082chr511014 ------
NM_002086chr173556 485 259 --11985 --
NM_002087chr172296 263 ------
NM_002089chr41175 ------
NM_002092chr4124936 4861 4391 1645 1222 1153 887 770 634 527 390 291 14025 ----
NM_002107chr11382 ----1503
NM_002126chr1753264 3163 352 216 45 12937 11257 --
NM_002128chr1342443 599 530 524 11690 12522 --
NM_002129chr41396 161 ----
NM_002130chr541398 1300 185 176 ------
NM_002137chr712108 ------
NM_002138chr43637 561 194 ------
NM_002140chr941111 988 755 176 ------
NM_002145chr17--1105 ----
NM_002148chr21119 ------
NM_002149chr22644 61 ------
NM_002158chr263712 2608 1490 882 482 410 23088 2960 ----
NM_002163chr1631124 421 409 --11166 --
NM_002193chr241896 1461 1426 697 ------
NM_002199chr4156 ------
NM_002202chr511022 1722 2952 865 --
NM_002210chr223044 2900 43515 3427 3165 151 ----
NM_002211chr104938 875 774 402 ------
NM_002214chr765623 5361 3688 2055 1992 653 11358 1606 --
NM_002222chr311233 ------
NM_002223chr1263970 2546 1157 610 421 349 --21422 941 11411
NM_002229chr193451 441 435 ------
NM_002239chr211071 ------
NM_002242chr221566 198 ------
NM_002247chr1031956 1772 647 ------
NM_002252chr2------1305
NM_002264chr374299 3241 1897 759 703 128 117 23285 3078 13577 --
NM_002266chr17294 51 ------
NM_002268chr3------11659
NM_002270chr584748 4287 4142 3958 3810 3744 1200 983 24878 4119 --11927
NM_002285chr263694 3250 1639 1334 233 159 21061 925 ----
NM_002293chr122404 1695 --22684 1878 --
NM_002294chrX181 ------
NM_002296chr121727 1558 1359 11468 --
NM_002298chr1331507 503 232 1294 ----
NM_002314chr721029 933 11022 ----
NM_002332chr121736 ------
NM_002333chr192420 314 11254 ----
NM_002336chr1274527 4323 3610 1247 1144 225 204 23375 772 14486 --
NM_002349chr21239 ------
NM_002355chr1221362 328 --1128 --
NM_002356chr662805 2511 2058 1138 855 49 21957 352 ----
NM_002359chr1744282 3509 3063 1287 1893 ----
NM_002374chr242520 1086 1066 245 11250 11349 --
NM_002375chr352250 1546 1480 1445 771 11893 ----
NM_002376chr141489 ------
NM_002381chr231035 960 711 1106 ----
NM_002382chr1421197 1168 ------
NM_002389chr111873 21933 1826 127 1139
NM_002395chr63986 193 183 31187 607 434 ----
NM_002397chr52727 695 31608 884 360 ----
NM_002398chr211550 ------
NM_002399chr15143 41369 1265 449 180 ----
NM_002408chr14146 ------
NM_002430chr2241602 646 471 279 12139 ----
NM_002439chr5--1914 ----
NM_002444chrX1493 11550 11659 --
NM_002449chr5----11302 --
NM_002460chr643686 2561 1106 901 ------
NM_002467chr81399 ------
NM_002480chr122489 193 1952 ----
NM_002481chr157576 7217 2739 323 44 26357 5849 ----
NM_002486chr961986 964 778 606 256 54 12542 ----
NM_002493chr92265 42 ------
NM_002499chr1542012 760 640 221 11782 ----
NM_002500chr211248 ----11028
NM_002505chr61193 ------
NM_002515chr1431624 718 221 1236 11329 --
NM_002520chr51200 ------
NM_002522chr1783656 2823 2650 1326 746 501 492 148 43775 3666 3184 434 12817 1564
NM_002526chr611434 ------
NM_002536chrX2286 255 21615 52 11356 --
NM_002543chr1221378 1049 170 11123 --
NM_002545chr1153682 3582 2075 1805 149 24997 799 1154 --
NM_002553chr72327 111 ------
NM_002556chr1132121 1537 816 --1107 --
NM_002563chr33837 374 262 --1180 --
NM_002567chr121595 --1749 --
NM_002577chr363934 3253 1558 960 788 300 12827 ----
NM_002578chrX1345 ------
NM_002581chr935527 5343 836 35643 4131 281 14240 --
NM_002583chr122453 140 ------
NM_002585chr11388 ------
NM_002592chr201223 ------
NM_002595chr1241833 1819 1237 491 11893 1106 --
NM_002600chr141668 1445 714 386 --1684 --
NM_002607chr741234 1211 988 421 ------
NM_002608chr2221547 51 ------
NM_002612chr742079 1765 835 69 11781 ----
NM_002613chr1675096 3920 3396 1357 1350 647 223 11197 ----
NM_002618chr21124 ------
NM_002620chr4160 ------
NM_002628chr341131 1068 857 263 --2486 129 --
NM_002636chr6----185 --
NM_002641chrX51858 1736 1654 1411 812 ------
NM_002655chr8105221 4679 4068 3360 1391 730 522 417 337 209 34583 3821 590 15275 --
NM_002656chr63899 846 754 ----1288
NM_002657chr2063358 3321 3272 3134 2570 1197 ------
NM_002660chr201764 11155 ----
NM_002668chrX1144 ------
NM_002687chr1441202 828 509 141 ------
NM_002698chr1922336 2251 11171 12818 --
NM_002706chr21645 ------
NM_002707chr2168 ------
NM_002709chr283073 2975 2643 2606 2303 960 685 403 11085 ----
NM_002710chr122153 109 ------
NM_002713chr111107 11082 --11149
NM_002715chr541200 933 511 273 1883 ----
NM_002716chr1162649 2589 2337 775 603 593 13005 33566 1475 986 --
NM_002718chr342636 628 190 74 ------
NM_002719chr1451996 1925 1892 509 479 ------
NM_002720chr161254 ------
NM_002721chr92161 98 ------
NM_002732chr9------1485
NM_002734chr1722098 225 1549 --1606
NM_002736chr721954 73 --11379 --
NM_002737chr1756634 6612 5931 4302 901 26387 6147 22203 1908 --
NM_002738chr1641105 1002 791 434 ------
NM_002740chr3--32753 370 98 12203 --
NM_002745chr2264031 3314 3111 1769 1350 796 ------
NM_002747chr1831796 718 640 ------
NM_002748chr152776 50 ------
NM_002753chr41752 ------
NM_002756chr172670 160 --1875 --
NM_002758chr17----1373 --
NM_002765chrX11236 1247 ----
NM_002787chr7----1580 --
NM_002788chr141103 ------
NM_002806chr141241 ------
NM_002810chr11131 ------
NM_002813chr1221281 1119 --11468 --
NM_002816chr172290 100 ------
NM_002821chr61768 ------
NM_002822chr1211324 1228 ----
NM_002823chr24674 587 531 267 ------
NM_002827chr2031476 715 196 1558 ----
NM_002828chr181233 --170 --
NM_002829chr91397 ------
NM_002833chr1521149 406 1278 11304 --
NM_002835chr71131 ------
NM_002838chr13341 286 182 1171 ----
NM_002839chr953573 3388 3198 2357 1190 13338 ----
NM_002843chr1153363 3193 2905 1376 686 --1637 --
NM_002844chr631334 904 275 ------
NM_002845chr181105 ------
NM_002849chr122400 276 1831 ----
NM_002869chr1142224 1592 1403 893 ------
NM_002874chr922396 2244 --1807 --
NM_002882chr22181 ------
NM_002886chr375202 4663 3893 3358 3189 1499 1264 13851 --13879
NM_002890chr52349 78 ------
NM_002892chr1431399 1271 256 21180 222 133 11198
NM_002894chr181149 ------
NM_002897chr21609 1161 ----
NM_002906chr1132119 1753 736 ------
NM_002912chr62737 252 1823 ----
NM_002926chr41389 --2818 83 --
NM_002940chr421479 485 163 --1383
NM_002941chr351206 1088 1026 521 327 21644 1323 ----
NM_002948chr361125 1024 315 206 200 76 1117 ----
NM_002950chr3146 --2172 165 --
NM_002955chr61402 ------
NM_002956chr121878 ------
NM_002958chr32916 108 ------
NM_002968chr163965 955 755 ------
NM_002970chrX178 ------
NM_002971chr331222 1007 451 ------
NM_002977chr262979 2469 2350 2229 1303 419 2915 844 --13401
NM_002979chr11327 --1688 --
NM_002994chr451961 1656 1634 243 110 --1186 --
NM_002997chr231435 1189 715 --1736 --
NM_002998chr81476 12163 ----
NM_002999chr2031248 781 662 --11361 --
NM_003002chr112288 46 158 ----
NM_003010chr1732436 2296 1532 21988 359 ----
NM_003016chr1711970 --1396 --
NM_003017chr62571 254 --1138 --
NM_003020chr15--1177 ----
NM_003022chrX2892 77 21228 869 ----
NM_003028chr973792 3460 2929 2881 2770 1140 102 ------
NM_003030chr341713 1631 1591 1468 ------
NM_003031chr163989 325 293 ------
NM_003034chr1287271 6682 6384 1451 836 779 476 95 25376 642 18021 11999
NM_003036chr12980 140 ------
NM_003042chr321971 1832 ------
NM_003043chr344296 4278 4234 3099 ------
NM_003046chr874531 4512 1614 1348 1265 1111 725 14213 34605 629 102 --
NM_003051chr131714 706 338 ------
NM_003054chr101198 ------
NM_003060chr551207 936 888 858 102 --1109 --
NM_003068chr831116 1049 236 ------
NM_003069chrX1604 ------
NM_003070chr92768 623 2703 79 ----
NM_003071chr331898 1760 418 ------
NM_003072chr191167 ------
NM_003074chr331651 354 336 1580 11672 --
NM_003079chr172966 81 ------
NM_003081chr2041167 988 877 284 --1882 --
NM_003090chr15179 ------
NM_003091chr20182 ------
NM_003092chr20150 ------
NM_003094chr13143 63 45 ------
NM_003099chr1596512 6154 5398 2256 2213 1869 1737 917 420 22104 848 ----
NM_003101chr111034 1493 11613 --
NM_003107chr632499 485 349 12463 1339 --
NM_003108chr266901 6876 6560 5573 4874 266 ------
NM_003111chr221080 1033 1506 ----
NM_003112chr742882 2198 2002 326 12987 ----
NM_003115chr12399 121 ----125
NM_003128chr262597 2218 1964 1061 870 686 ------
NM_003130chr7269 56 --11206 --
NM_003131chr611673 --1923 1289
NM_003133chr1124 21012 386 ----
NM_003136chr14147 ------
NM_003137chr612165 11561 1153 --
NM_003144chr632063 1697 556 22160 1926 ----
NM_003150chr1722343 1803 ------
NM_003155chr852751 2517 2414 2145 1929 --12481 --
NM_003156chr111523 11195 1487 --
NM_003161chr1723435 2768 23305 2209 13442 --
NM_003162chr21180 21005 941 ----
NM_003168chr1741065 772 390 29 ------
NM_003174chr10----1734 --
NM_003178chr311840 1605 --1243
NM_003179chrX21339 120 ------
NM_003185chr2011209 2933 868 ----
NM_003188chr61131 ------
NM_003194chr6165 ------
NM_003199chr1885575 4203 4123 3684 3670 1700 1032 817 43941 3756 1858 1687 23925 1010 --
NM_003202chr521912 1365 ----1647
NM_003206chr6--1420 ----
NM_003211chr122552 535 21198 692 --175
NM_003217chr1241763 796 593 543 1228 ----
NM_003220chr621653 317 ------
NM_003221chr623978 1006 23907 3667 12997 --
NM_003223chr162856 662 --2692 526 --
NM_003234chr3------32001 1734 790
NM_003238chr11175 ------
NM_003242chr311562 --12454 --
NM_003246chr1521935 1867 21963 309 ----
NM_003247chr651663 1415 1406 1373 296 11911 ----
NM_003253chr21--21603 163 ----
NM_003257chr1551389 984 245 197 108 ------
NM_003270chrX2946 753 2450 401 --1237
NM_003274chr2142633 1132 1011 353 ------
NM_003275chr931223 602 422 ------
NM_003285chr1147 2454 388 ----
NM_003286chr20--21041 284 ----
NM_003288chr202210 158 11570 ----
NM_003290chr191102 ------
NM_003298chr396133 5920 4225 2416 2105 1626 1576 1569 501 25951 2008 11003 --
NM_003304chr321459 1353 ------
NM_003317chr141599 ------
NM_003319chr2--1192 ----
NM_003326chr141795 647 521 378 1883 12014 --
NM_003336chrX11045 ----159
NM_003337chr51230 1438 ----
NM_003338chr1021807 312 11605 ----
NM_003339chr511149 ----11455
NM_003340chr41911 1966 ----
NM_003341chr3132 ------
NM_003342chr1763075 2931 2657 2253 684 565 11328 --1932
NM_003345chr161519 ------
NM_003347chr2231788 1652 1481 ------
NM_003348chr1241329 1189 1086 66 ------
NM_003349chr2021090 176 ------
NM_003352chr21160 ------
NM_003362chr1261015 1001 964 703 403 363 150 ----
NM_003368chr1----1304 --
NM_003369chr1162146 1122 383 286 204 191 --12432 --
NM_003373chr101542 --11746 --
NM_003375chr101307 ------
NM_003376chr631801 1351 578 11467 ----
NM_003376chr631801 1351 578 11467 ----
NM_003379chr62991 175 1924 1982 --
NM_003385chr2--2334 185 ----
NM_003387chr232336 2100 261 12877 ----
NM_003388chr71117 ----1280
NM_003390chr1141088 1055 876 78 --1282 --
NM_003392chr334299 3144 1728 13624 ----
NM_003403chr141756 ----1567
NM_003404chr20----21894 1667 --
NM_003406chr811599 31462 641 58 1355 --
NM_003410chrX52095 570 194 162 23 22084 654 ----
NM_003411chrY21618 689 2617 464 ----
NM_003412chr373109 2930 2799 2365 2349 1944 539 12324 ----
NM_003413chrX41805 1260 633 486 --21646 1450 --
NM_003418chr31776 ------
NM_003420chr32322 71 1712 ----
NM_003442chr112835 685 ------
NM_003453chr131251 ------
NM_003455chr111483 1501 11232 --
NM_003457chr171635 ------
NM_003463chr663299 3149 2285 806 720 489 11208 21298 544 12857
NM_003467chr22382 118 ------
NM_003468chr231113 1058 305 21544 69 21563 1465 --
NM_003470chr1611182 --11787 --
NM_003471chr331823 1692 644 ------
NM_003472chr631400 1226 964 --1167 --
NM_003473chr101266 ------
NM_003478chr1133094 2327 70 43013 2992 2285 153 ----
NM_003482chr1252766 2752 2426 1919 703 --11013 --
NM_003483chr1232733 2662 314 22143 972 ----
NM_003488chr171879 ------
NM_003489chr213363 336 169 23341 527 ----
NM_003490chr2211050 ------
NM_003498chr1642697 2678 374 31 --11948 --
NM_003506chr831192 996 360 ------
NM_003507chr211319 1742 ----
NM_003557chr131580 1393 282 ------
NM_003558chr91211 ------
NM_003562chr17--1297 ----
NM_003563chr173970 587 450 ------
NM_003565chr1231702 1518 556 1465 ----
NM_003566chr122917 740 22349 2220 22331 948 --
NM_003574chr18105623 4987 4734 4693 4576 4041 3539 815 625 136 21517 488 23811 1229 --
NM_003580chr82547 398 ------
NM_003583chr12194 --1845 --
NM_003590chr253591 3502 2947 1563 750 ------
NM_003597chr262173 2005 1422 915 844 603 1890 ----
NM_003603chr452094 1883 674 625 434 --31533 540 483 --
NM_003607chr174376 3729 3621 3143 1558 814 346 13187 ----
NM_003613chr153146 120 113 1510 ----
NM_003615chr352801 1285 835 733 139 12881 ----
NM_003617chr144173 3197 151 98 64736 4703 3802 3756 3530 1752 ----
NM_003620chr1711045 --2783 693 --
NM_003624chr19140 ------
NM_003626chr1111034 11296 ----
NM_003629chr151333 1112 956 669 420 12960 ----
NM_003631chr101267 1949 ----
NM_003633chr541720 1623 786 656 --11789 12523
NM_003642chr2198 ------
NM_003645chr151211 ------
NM_003651chr121528 ------
NM_003654chr111157 ----1749
NM_003658chr112658 560 ------
NM_003659chr22148 130 ------
NM_003663chr353420 3374 2947 991 285 13159 ----
NM_003672chr131938 1406 480 ----1433
NM_003676chr11648 ------
NM_003692chr93843 759 724 ------
NM_003704chr41487 ------
NM_003710chr152677 426 ------
NM_003713chr11105 --2520 174 --
NM_003714chr522224 261 12340 ----
NM_003716chr32984 736 --1934 --
NM_003718chr71171 ------
NM_003722chr322135 918 1984 --12728
NM_003728chr42593 459 1509 ----
NM_003743chr262069 1872 1464 558 425 166 --1160 --
NM_003744chr1431072 439 81 ------
NM_003749chr1332150 1835 227 12183 --12111
NM_003758chr152454 410 11075 ----
NM_003758chr152454 410 11075 ----
NM_003759chr473921 3592 3283 1292 542 431 207 1868 1152 --
NM_003763chr2023138 1149 ------
NM_003766chr173611 381 55 --126 --
NM_003768chr131530 552 504 --1169 --
NM_003772chr1141046 349 171 38 ------
NM_003774chr1253218 3054 2590 2181 753 1237 ----
NM_003780chr11671 ------
NM_003787chr1821319 613 1358 11655 --
NM_003791chr161118 1449 ----
NM_003794chr32932 320 1969 --21094 265
NM_003795chr62584 171 ------
NM_003799chr1874484 1825 1376 1307 332 255 154 13624 13378 --
NM_003800chr642360 2307 2275 668 11901 ----
NM_003812chr2189 ------
NM_003816chr811245 21429 339 ----
NM_003822chr142981 2913 932 695 1970 ----
NM_003825chr152372 291 11477 ----
NM_003846chr11673 --1805 --
NM_003850chr133239 220 181 1270 1634 --
NM_003861chr1452794 2511 1948 1885 732 1413 12835 --
NM_003870chr152663 333 ------
NM_003872chr282907 2716 2626 1988 1162 862 304 296 ------
NM_003873chr1032056 1990 763 ------
NM_003884chr321631 748 ------
NM_003885chr1742585 2555 945 584 12094 ----
NM_003887chr241938 788 317 93 ------
NM_003902chr12212 27 ------
NM_003909chr852435 866 686 369 189 1532 --1330
NM_003913chr653259 3128 1655 1319 697 13599 ----
NM_003914chr131160 ------
NM_003916chrX--1119 --11294
NM_003924chr441563 1133 1115 353 ------
NM_003930chr742595 2503 2491 1865 12037 12404 --
NM_003931chr62587 93 ------
NM_003932chr2231651 1540 430 ----1180
NM_003934chr9--1930 1896 --
NM_003939chr1043335 3070 1517 822 31235 381 361 ----
NM_003941chr731804 130 105 12080 1176 --
NM_003943chr421056 138 1126 ----
NM_003953chr14814 763 633 502 12067 1332 --
NM_003955chr1711407 --1386 --
NM_003966chr566881 6230 5811 2666 2065 277 --27816 2432 --
NM_003968chr31104 ------
NM_003972chr1031196 1084 355 11309 ----
NM_003980chr621071 938 11110 ----
NM_003983chr1623104 1661 24320 4292 ----
NM_003992chr151233 ------
NM_003994chr1254198 3802 3374 1637 846 --160 21223 1197
NM_004006chrX22121 1882 12488 ----
NM_004007chrX22121 1882 12488 ----
NM_004009chrX22121 1882 12488 ----
NM_004010chrX22121 1882 12488 ----
NM_004011chrX22121 1882 12488 ----
NM_004012chrX22121 1882 12488 ----
NM_004013chrX22121 1882 12488 ----
NM_004014chrX22121 1882 12488 ----
NM_004015chrX22121 1882 12488 ----
NM_004016chrX22035 1796 12402 ----
NM_004017chrX22121 1882 12488 ----
NM_004018chrX22035 1796 12402 ----
NM_004020chrX22121 1882 12488 ----
NM_004021chrX22035 1796 12402 ----
NM_004022chrX22035 1796 12402 ----
NM_004023chrX22035 1796 12402 ----
NM_004028chr1853331 1336 933 890 108 11344 --12765
NM_004034chr103476 244 146 ------
NM_004037chr12833 52 ------
NM_004046chr18--141 ----
NM_004047chr12281 260 ------
NM_004063chr811075 2690 133 ----
NM_004065chrX1208 ------
NM_004067chr731454 521 223 --1250 --
NM_004071chr21250 ------
NM_004075chr121215 ------
NM_004077chr1211255 ------
NM_004081chrY21737 1573 11161 11215 --
NM_004085chrX1531 --1185 --
NM_004089chrX21279 64 --2810 335 --
NM_004093chr1332072 840 331 ----1659
NM_004096chr1092115 1923 1890 1586 1572 1506 854 773 343 ------
NM_004098chr10--11289 ----
NM_004109chr111264 1153 ----
NM_004114chrX2419 329 197 ----
NM_004115chr131123 ------
NM_004116chr21398 ------
NM_004124chr141106 ------
NM_004126chr72291 44 ------
NM_004133chr832699 541 161 ------
NM_004134chr51484 ------
NM_004136chr1563122 2913 2833 2321 788 379 12567 --2728 527
NM_004152chr19----195 --
NM_004157chr34917 875 814 200 ------
NM_004171chr11118509 7388 7000 6337 3859 3475 2836 2504 1833 1764 889 46366 3100 2397 187 1839 16909
NM_004175chr22126 197 1214 --
NM_004181chr4123 --1321 --
NM_004199chr51334 --1118 --
NM_004229chrX52118 1978 1535 1522 1371 ----1248
NM_004232chr1853817 1295 305 138 93 32746 2413 1520 1683 --
NM_004236chr152158 150 --1453 --
NM_004237chr55862 824 725 282 227 --1251 --
NM_004238chr21278 ------
NM_004241chr101255 ------
NM_004261chr151026 915 780 284 82 ------
NM_004263chr231278 338 183 21701 1149 ----
NM_004272chr521634 1461 ------
NM_004274chr1442710 2396 913 324 ----1117
NM_004279chr72706 352 ------
NM_004301chr31249 135 ----
NM_004302chr1222805 538 ------
NM_004304chr21274 ------
NM_004306chr8--145 ----
NM_004311chr1042360 2083 387 67 --32929 1109 457 --
NM_004319chr132476 2216 1055 22231 264 1258 --
NM_004323chr952551 2303 557 382 321 1116 ----
NM_004326chr121120 773 ------
NM_004329chr102428 400 --1499 --
NM_004330chr1561198 1138 1049 814 745 177 ------
NM_004331chr832423 1786 602 1299 ----
NM_004336chr2199 ------
NM_004337chr8--11985 --137
NM_004338chr18107011 6807 6159 6087 5293 5129 4593 1986 1837 788 15865 ----
NM_004346chr4134 21425 388 1534 --
NM_004349chr8193 ------
NM_004359chr191505 ------
NM_004362chr42507 288 --1538 --
NM_004370chr672025 1561 1555 702 658 582 69 11729 ----
NM_004374chr8------150
NM_004379chr22614 346 11304 ----
NM_004380chr161293 --12504 --
NM_004384chr552126 2099 1826 1733 234 1216 ----
NM_004385chr52669 258 --1596 --
NM_004386chr1932230 1981 351 --32121 2057 1891 1304
NM_004392chr1342056 1890 962 216 1901 ----
NM_004393chr341464 374 239 221 1562 1733 --
NM_004397chr1143387 3033 1347 204 23543 3230 11240 --
NM_004414chr2131385 508 229 ----11300
NM_004415chr62704 623 ----1667
NM_004417chr52493 177 --1560 --
NM_004420chr1122285 1738 1396 ----
NM_004423chr33498 263 85 ------
NM_004430chr832603 2088 1103 22612 1111 22740 932 12026
NM_004432chr911522 ------
NM_004433chr121349 690 ------
NM_004434chr1431578 1559 1375 1765 --11798
NM_004436chr11591 ------
NM_004438chr253304 3266 2887 388 315 13187 ----
NM_004440chr621894 287 1340 --1643
NM_004441chr33943 815 471 ------
NM_004447chr1241146 784 383 156 1987 ----
NM_004448chr171588 ------
NM_004449chr2111476 ----21136 943
NM_004451chr111709 ------
NM_004454chr332158 742 78 --22309 2167 --
NM_004457chr21336 ----127
NM_004458chrX52656 2638 2254 1061 1036 --11004 --
NM_004459chr1751786 1743 1462 770 166 3782 715 441 ----
NM_004460chr21229 --167 --
NM_004464chr463173 2874 1491 850 424 241 14301 14146 --
NM_004470chr111126 ------
NM_004481chr142678 2598 2113 760 ------
NM_004482chr22807 287 ------
NM_004483chr161478 ------
NM_004487chr33927 406 251 --1415 --
NM_004491chr1933774 3000 367 24291 3065 14143 --
NM_004496chr1441158 398 383 338 --123 --
NM_004501chr174146 4091 2803 1659 1529 1038 763 13628 1500 --
NM_004503chr121740 ------
NM_004504chr232216 1108 598 1590 ----
NM_004506chr62689 138 ------
NM_004514chr1772712 2664 2241 1007 850 830 591 ------
NM_004516chr195930 868 382 318 187 ------
NM_004517chr11--1189 ----
NM_004520chr52161 117 ------
NM_004521chr10----1279 --
NM_004523chr1011200 ------
NM_004525chr2--1296 1120 --
NM_004529chr911094 ------
NM_004535chr2041767 1594 350 330 11118 --11164
NM_004537chr1241434 1236 1135 113 --1118 --
NM_004566chr1052478 2187 1955 1786 697 ------
NM_004571chr2162786 1258 1252 768 139 37 1548 ----
NM_004575chr441446 1271 293 222 11146 11159 --
NM_004586chrX44834 4046 1995 705 34466 1386 930 13698 --
NM_004587chr201182 ------
NM_004591chr21394 --1170 --
NM_004593chr34899 862 609 48 ------
NM_004595chrX1365 ------
NM_004598chr563351 3181 3123 2221 1166 180 12838 12555 --
NM_004602chr201196 ----11334
NM_004612chr923942 3636 13923 ----
NM_004622chr231880 912 340 22300 528 12465 --
NM_004634chr32608 57 ------
NM_004635chr3--1130 ----
NM_004640chr6--1160 ----
NM_004642chr122681 483 --1286 --
NM_004645chr17142 1200 ----
NM_004654chrY21397 990 2442 162 ----
NM_004655chr17--11286 --11056
NM_004660chrY21708 293 ------
NM_004663chr1521387 1239 1381 ----
NM_004685chr1342102 580 434 88 22653 1198 ----
NM_004687chr1711546 ------
NM_004690chr6------1581
NM_004694chr171197 ------
NM_004698chr1140 ------
NM_004703chr1721706 391 ------
NM_004709chrX21342 1144 11381 11406 --
NM_004717chr7--11303 ----
NM_004718chr25519 231 221 148 25 ------
NM_004725chr102400 313 --21264 204 --
NM_004726chrX75326 4596 3883 3794 1686 1423 232 35586 3993 2025 ----
NM_004729chrX32221 1846 57 ------
NM_004730chr541758 1736 705 406 11817 --1189
NM_004733chr32501 182 ------
NM_004734chr1343172 2688 752 312 --1592 --
NM_004736chr111406 2429 235 ----
NM_004737chr2231284 461 107 ------
NM_004739chr111596 ------
NM_004742chr351868 239 209 131 91 2660 424 ----
NM_004745chr835443 2300 1116 --36117 4709 990 --
NM_004748chr15104258 3765 3636 2723 2715 2685 1268 1060 759 246 32876 1672 920 ----
NM_004757chr41536 166 ----
NM_004760chr741853 885 580 399 1134 11999 --
NM_004762chr1721988 1977 21897 143 ----
NM_004772chr511156 ------
NM_004774chr1721073 617 ----11966
NM_004775chr1852333 2302 2292 2228 1711 1707 12282 12257
NM_004776chr2043304 2991 2394 2107 33279 2504 1227 122 --
NM_004779chr51524 --1192 --
NM_004781chr131200 1080 542 21261 680 ----
NM_004781chr131200 1080 542 21261 680 ----
NM_004785chr162363 319 ------
NM_004788chr1162732 2235 2161 1852 543 58 ------
NM_004789chr91434 ------
NM_004796chr1441602 779 759 411 11529 ----
NM_004798chr2043621 1247 685 40 1809 ----
NM_004808chr1053336 2505 627 416 266 23229 362 ----
NM_004817chr94716 600 294 188 ------
NM_004822chr1723022 2939 --11157 --
NM_004824chr62377 208 ------
NM_004831chr19--21046 955 1939 --
NM_004834chr252682 2622 2118 961 824 23265 3250 ----
NM_004835chr32729 314 ------
NM_004835chr32729 314 ------
NM_004836chr22275 94 1191 ----
NM_004839chr151596 --1113 --
NM_004840chrX2913 196 --178 --
NM_004844chr321030 373 ------
NM_004849chr6169 2639 616 11102 --
NM_004857chr1433696 3421 3244 ------
NM_004859chr173866 777 644 ------
NM_004863chr1485064 3624 3452 3305 3254 1949 1905 232 25100 195 11434 --
NM_004871chr1754304 3745 3401 2693 251 13196 ----
NM_004884chr151434 11736 ----
NM_004893chr52480 114 ------
NM_004896chr101337 ------
NM_004897chr10--1884 ----
NM_004898chr442730 1991 1965 780 --1411 --
NM_004902chr202723 702 ------
NM_004904chr776330 4755 4507 2549 1174 447 321 --26335 4226 --
NM_004906chr62182 90 181 1454 --
NM_004912chr731736 1365 1180 ------
NM_004921chr1--22501 274 ----
NM_004926chr1421132 719 3392 285 202 ----
NM_004929chr821488 167 21441 355 ----
NM_004947chr332076 715 432 1341 ----
NM_004949chr1842088 1985 1877 1441 21703 836 ----
NM_004952chr12773 331 ------
NM_004956chr783961 3892 1509 585 571 565 427 95 23858 3724 13436 --
NM_004960chr16138 ------
NM_004961chrX1159 11529 1153 --
NM_004965chr212645 191 ------
NM_004966chr102389 112 ------
NM_004968chr71638 ------
NM_004969chr101440 ------
NM_004973chr621734 476 ------
NM_004976chr1165164 5070 2037 1918 1459 1005 15102 ----
NM_004978chr141364 1357 1322 514 ------
NM_004985chr1243644 3596 3444 547 44497 3775 2776 1677 --1504
NM_004992chrX147456 6991 6199 5520 5415 5402 5375 5292 5170 3299 2410 1854 1848 1374 27148 6820 58544 6968 2397 2363 1182 --
NM_004992chrX147456 6991 6199 5520 5415 5402 5375 5292 5170 3299 2410 1854 1848 1374 27148 6820 58544 6968 2397 2363 1182 --
NM_004998chr152689 643 ------
NM_005003chr16124 ------
NM_005010chr731782 1711 540 21996 1462 11950 163
NM_005011chr721578 59 --11215 --
NM_005016chr121105 ----1266
NM_005023chr53511 431 211 ----11501
NM_005032chrX3759 394 322 21008 211 --11020
NM_005036chr2258338 6276 5833 5752 989 26419 6214 15304 26649 1581
NM_005045chr72793 188 ------
NM_005054chr231406 1387 141 1119 ----
NM_005056chr12124359 3758 3700 3642 3584 2041 1646 1557 1210 829 590 91 24782 1912 ----
NM_005063chr1053867 2371 779 366 305 1485 --13255
NM_005066chr1131 ------
NM_005068chr621306 1156 ------
NM_005078chr1541438 417 340 321 ------
NM_005079chr893204 3167 2967 2824 2818 2403 678 353 140 12805 ----
NM_005087chr31867 ------
NM_005088chrX1885 1741 1807 --
NM_005093chr2075348 4539 4120 3805 3792 724 252 15249 ----
NM_005095chr121814 780 1582 --11676
NM_005104chr63749 617 84 ------
NM_005109chr332386 2141 592 1775 12060 --
NM_005116chr2044368 3275 2807 86 24013 1833 ----
NM_005119chr121182 1005 11219 ----
NM_005121chr1723319 1535 33179 2671 986 13276 --
NM_005124chr62754 326 ------
NM_005126chr322178 2022 ------
NM_005149chr141416 1274 1246 264 ------
NM_005151chr185903 788 540 429 381 ------
NM_005156chr995321 5312 4368 4241 3801 1967 1680 1395 89 41661 1614 796 512 ----
NM_005159chr1552144 1566 200 130 107 --32225 872 236 --
NM_005160chr22146435 5979 5659 5605 5288 4946 4380 4346 2108 1528 1264 1143 408 173 1218 11399 --
NM_005164chr1242585 1769 978 800 ------
NM_005168chr231788 1712 1485 ------
NM_005171chr121356 --1367 --
NM_005180chr1051492 1422 1340 331 109 ------
NM_005184chr194456 343 220 148 ----1359
NM_005188chr11157622 7609 6502 6184 6003 5580 5356 2659 2235 1897 1708 1493 1231 739 314 48220 5813 5465 2708 15385 12411
NM_005189chr1742534 2389 1742 246 ------
NM_005191chr31443 11451 ----
NM_005194chr201182 ------
NM_005197chr1453771 2163 1479 1164 160 24702 4498 ----
NM_005203chr10137 1373 ----
NM_005204chr103994 950 295 ------
NM_005207chr2241165 570 311 177 33282 1180 1046 23229 380 --
NM_005217chr8136 ------
NM_005219chr521790 1370 11681 1268 --
NM_005221chr7148 ------
NM_005226chr952630 2238 1861 972 703 12431 --1446
NM_005227chr11501 ------
NM_005229chrX21220 479 ------
NM_005231chr1121260 167 3979 283 204 ----
NM_005233chr31545 ------
NM_005235chr2147771 6288 6145 5915 5628 5482 5102 4886 4793 2977 2433 1083 687 663 25896 1308 ----
NM_005238chr1193513 3477 2664 2634 2410 2293 673 662 408 ----12563
NM_005241chr331274 1236 966 ------
NM_005242chr531391 1080 153 21270 1251 ----
NM_005249chr142655 120 1260 --1863
NM_005252chr14----1760 --
NM_005256chr11--1832 ----
NM_005257chr1841247 1152 507 332 ------
NM_005275chr6141 --1103 --
NM_005276chr1251765 1706 1167 543 497 1210 ----
NM_005276chr1251765 1706 1167 543 497 1210 ----
NM_005277chr451817 1738 1597 1265 507 ------
NM_005284chr62457 435 ----1318
NM_005295chr71198 1227 ----
NM_005311chr762760 2564 1148 178 156 123 ----12524
NM_005312chr911810 ------
NM_005313chr152985 203 ------
NM_005316chr11--1762 ----
NM_005318chr2251257 1084 897 345 99 21041 238 --1303
NM_005329chr16--22366 1854 --1675
NM_005336chr221600 455 12337 3820 397 64 --
NM_005338chr733422 3383 384 ----11265
NM_005339chr464221 3731 3007 2853 956 569 --31691 1424 319 13783
NM_005342chrX41035 680 405 285 --22095 2029 --
NM_005349chr42509 84 ------
NM_005358chr1361847 656 558 414 128 95 ------
NM_005359chr1866484 4981 2274 1818 1635 705 21171 626 35185 1767 133 --
NM_005370chr191337 1215 ----
NM_005376chr121144 227 ------
NM_005381chr21400 ------
NM_005391chrX140 ------
NM_005392chr921520 1454 ------
NM_005397chr763952 3850 3175 3112 720 626 13769 13875 --
NM_005399chr1113776 3766 3575 3092 3057 3013 1675 875 744 736 96 14360 ----
NM_005402chr721731 1560 ------
NM_005406chr1821601 1065 --1186 --
NM_005407chr1431310 91 31 21479 1341 ----
NM_005415chr21759 ------
NM_005417chr2011475 ------
NM_005418chr112475 163 ------
NM_005430chr1231022 769 393 --1877 --
NM_005436chr1063937 3439 1515 1273 339 302 ----1153
NM_005442chr33455 409 76 --2578 100 --
NM_005455chr161857 1538 1192 679 378 339 1403 ----
NM_005458chr921560 660 ------
NM_005461chr2041996 1790 1709 391 ------
NM_005467chr111160 ------
NM_005474chr1731538 1396 1063 ------
NM_005475chr12--13273 ----
NM_005483chr19193 ------
NM_005487chr2251903 1383 407 178 51 ------
NM_005493chr62552 118 ------
NM_005494chr73612 244 208 2606 154 ----
NM_005497chr1764724 4673 2322 1962 1310 916 16153 --11226
NM_005499chr191534 1145 ----
NM_005504chr1286650 6554 4895 4850 4127 2237 758 117 12155 ----
NM_005520chr52674 553 ------
NM_005522chr71526 1319 1508 --
NM_005530chr151556 1274 193 --
NM_005537chr132892 842 --1158 --
NM_005539chr1011241 --2983 898 --
NM_005542chr751829 1446 1433 1296 652 11786 ----
NM_005544chr23997 709 156 ------
NM_005561chr131927 2210 189 ----
NM_005562chr131221 1209 404 --1298 11174
NM_005578chr354555 1860 1025 430 346 11867 1300 --
NM_005581chr19------1489
NM_005586chr61662 ------
NM_005593chr121214 ------
NM_005595chr11943 ------
NM_005596chr976048 5022 4033 1948 1862 1570 1403 ------
NM_005599chr131237 1082 974 ------
NM_005602chr331081 897 272 --162 --
NM_005604chr642284 1951 718 628 ------
NM_005614chr721102 283 ------
NM_005634chrX2144 92 ------
NM_005637chr1811570 ------
NM_005638chrX2255 164 1572 ----
NM_005639chr1241774 1273 310 29 11678 11847 --
NM_005644chr11413 ------
NM_005647chrX22301 488 13107 ----
NM_005648chr8------1176
NM_005650chr2211096 ------
NM_005655chr82446 328 ------
NM_005656chr2131264 476 59 11002 11504 --
NM_005657chr151123 ------
NM_005662chr82307 29 ------
NM_005664chr151430 1241 ----
NM_005668chr544576 1329 681 530 22826 1213 ----
NM_005688chr31960 1449 21305 426 --
NM_005704chr111102 ------
NM_005715chr632521 2426 2037 --1902 --
NM_005717chr121249 113 ------
NM_005721chr2169 ------
NM_005722chr211644 1630 21967 1677 --
NM_005725chr121750 113 11531 1262 --
NM_005730chr1263429 2915 2508 2453 822 247 21217 262 ----
NM_005734chr111255 ----1734
NM_005737chr242062 913 595 257 ------
NM_005738chr721670 771 11407 21899 86 --
NM_005740chr221118 ------
NM_005742chr21619 ------
NM_005746chr73540 497 70 1228 --12616
NM_005748chr1223355 1268 22651 551 23140 633 --
NM_005749chr171733 2593 158 ----
NM_005754chr521109 118 ------
NM_005759chr243677 3037 1785 626 23351 1495 13548 11029
NM_005765chrX2769 585 ------
NM_005776chr141159 ------
NM_005789chr1731550 258 63 ------
NM_005795chr283009 2646 2468 2092 812 626 498 197 12577 12285 1208
NM_005798chr1345016 4751 4632 4477 15254 15057 --
NM_005808chr343561 3217 2933 2786 11052 2780 229 --
NM_005813chr272322 2306 2138 1924 348 299 55 ----12144
NM_005819chr143502 3431 538 336 --1301 12780
NM_005822chr621700 328 ----167
NM_005826chr12406 109 ------
NM_005828chr1753683 1725 1597 547 437 11865 2632 360 1291
NM_005839chr13793 337 40 1989 --1601
NM_005840chrX66892 6248 2172 1626 1596 656 1739 35376 4694 2544 --
NM_005842chr136688 497 281 147 129 123 ------
NM_005843chr251974 620 602 247 191 11551 --1384
NM_005845chr1361586 1354 1331 1316 528 421 ------
NM_005851chr111302 1399 ----
NM_005855chr21301 ------
NM_005859chr531501 1461 398 11150 ----
NM_005862chr31425 --1880 --
NM_005863chr1051128 1119 999 553 40 1390 ----
NM_005871chr102910 217 ------
NM_005880chr1641636 369 359 46 ------
NM_005882chr42880 175 ------
NM_005885chr541364 1158 640 565 ------
NM_005898chr1132758 1269 872 12018 ----
NM_005900chr41763 11013 ----
NM_005901chr18157538 7143 7093 6636 6258 5680 5318 2882 2237 1833 1769 1508 872 756 368 17568 28643 3355 16346
NM_005902chr1533251 1494 586 --1705 --
NM_005903chr564973 4537 3846 1970 434 170 13709 1791 15223
NM_005904chr1851375 452 156 124 58 ------
NM_005907chr611034 21069 395 21317 467 --
NM_005909chr584112 3579 2637 1297 940 824 312 171 43498 2953 2748 575 ----
NM_005910chr17--23482 148 --23962 3354
NM_005911chr2--1533 ----
NM_005917chr21148 ------
NM_005922chr62440 379 --1159 --
NM_005924chr73433 427 280 --1274 --
NM_005930chr14189 ------
NM_005933chr1132429 2282 2269 --12786 1450
NM_005934chr1932551 2388 746 1992 ----
NM_005935chr474806 4514 3514 2129 1675 1537 135 23778 3753 ----
NM_005937chr1763799 3312 2812 2786 1617 697 ------
NM_005941chr871629 1582 1376 535 451 224 41 32852 592 235 12783 --
NM_005944chr341101 939 814 500 ------
NM_005955chr195146 3675 3536 1874 1574 931 834 454 264 --15433 --
NM_005962chr1042265 2100 1779 825 --22018 339 --
NM_005962chr1042265 2100 1779 825 --22018 339 --
NM_005964chr1711363 ----1959
NM_005966chr221933 1692 11511 ----
NM_005977chr13163 1268 ----
NM_005984chr22161 ------
NM_005986chr1331948 515 301 ------
NM_005999chr151544 1408 238 213 199 1298 ----
NM_006007chr9104156 4143 4083 3986 3642 2982 1352 876 321 161 23173 1597 ----
NM_006023chr10--1171 ----
NM_006024chr72737 263 1592 ----
NM_006036chr252568 2532 1571 893 144 22017 344 --12235
NM_006037chr2124736 4443 4433 4373 4090 3849 3418 1524 1423 1302 894 671 23926 3375 ----
NM_006038chr2041602 1490 721 660 1243 ----
NM_006042chr171439 ------
NM_006043chr162697 60 ------
NM_006047chr2072614 2581 2370 2295 661 453 430 1726 1583 --
NM_006048chr11401 ------
NM_006063chr2139 ------
NM_006070chr31155 ------
NM_006080chr752406 713 471 452 294 42881 2674 2460 319 1281 --
NM_006086chr161243 ------
NM_006090chr1--1634 ----
NM_006094chr862000 962 472 446 171 42 22443 59 ----
NM_006095chr494497 4366 4005 3708 3567 3082 1461 1008 899 31330 682 220 1737 1531
NM_006106chr1193447 2528 1387 1359 781 425 395 315 148 32974 2265 243 ----
NM_006113chr152069 1972 1755 604 369 11602 ----
NM_006134chr2161568 1338 1307 1284 559 45 11533 ----
NM_006135chr131407 1338 1293 199 ----
NM_006136chr721031 181 ------
NM_006139chr222773 1167 ------
NM_006145chr194877 450 431 348 ------
NM_006148chr1722757 642 21856 143 11888 --
NM_006152chr121238 ------
NM_006153chr32250 236 2510 43 ----
NM_006154chr1542752 2353 1804 317 12329 ----
NM_006157chr11193 ------
NM_006158chr82695 444 11425 1194 --
NM_006162chr1821790 1278 1454 ----
NM_006166chr122502 246 12383 2455 385 --
NM_006178chr1741570 1299 1100 531 ------
NM_006180chr922135 1936 21820 491 1404 --
NM_006183chr121567 ------
NM_006186chr23916 890 306 ------
NM_006190chr22381 369 ----1437
NM_006191chr1231014 890 327 ------
NM_006195chr921442 527 --2946 477 --
NM_006196chr2----1258 --
NM_006201chrX1484 ------
NM_006202chr1921600 1498 --1589 --
NM_006203chr575474 5418 3500 1137 798 357 114 14757 14971 23694 1323
NM_006209chr81358 ------
NM_006210chr1931142 933 798 --1297 --
NM_006218chr31280 ------
NM_006224chr1732512 2501 427 ------
NM_006226chr211195 ------
NM_006237chr1331840 1663 173 11962 ----
NM_006238chr611392 12016 --1781
NM_006241chr352294 923 693 487 31 --11719 --
NM_006243chr131090 1082 196 ------
NM_006245chr61839 ------
NM_006246chr141456 ------
NM_006251chr562737 2616 2415 2107 1342 380 52834 2771 1272 1019 528 ----
NM_006252chr1137510 7429 7385 6289 5658 2731 1923 1598 1242 1232 806 740 354 37046 6070 1485 --16492
NM_006255chr1431114 792 747 ------
NM_006256chr142556 2483 514 70 22173 338 ----
NM_006257chr102925 34 ----1651
NM_006258chr101289 ------
NM_006259chr42834 221 ------
NM_006264chr42554 535 ------
NM_006265chr841395 202 119 102 1160 ----
NM_006275chr2031857 1529 734 1657 1362 2895 484
NM_006277chr21245 ------
NM_006281chr82423 95 ------
NM_006281chr82423 95 ------
NM_006282chr20104748 4621 4513 4410 4359 3418 3031 1606 728 74 14486 1451 --
NM_006283chr864134 3792 1957 299 281 152 1723 --14698
NM_006287chr232212 996 147 ------
NM_006306chrX74039 3990 3981 2137 1667 1549 374 21816 591 ----
NM_006309chr3--1106 ----
NM_006313chr1241663 1537 1213 360 --1270 --
NM_006315chr454504 4265 1007 934 872 54332 3967 3897 2878 1207 14372 --
NM_006317chr51330 ------
NM_006320chr41202 1370 ----
NM_006321chr342073 1641 892 836 ------
NM_006323chr4--1643 ----
NM_006325chr122698 294 --1614 --
NM_006330chr821103 670 ------
NM_006345chr421400 1261 --149 --
NM_006352chr131491 836 827 1303 21548 623 --
NM_006357chr21452 1446 ----
NM_006359chrX32181 930 471 ------
NM_006364chr142429 205 --1967 --
NM_006366chr621254 198 11241 ----
NM_006370chr14122 ------
NM_006371chr384853 4547 4038 3520 1733 920 749 56 1406 ----
NM_006375chrX1557 1111 ----
NM_006377chr911231 1969 ----
NM_006379chr722209 809 --11743 --
NM_006380chr1784347 3944 3892 3811 3666 3378 3240 1347 33994 2924 697 ----
NM_006382chr171308 ------
NM_006386chr2252427 2293 1795 1682 147 ------
NM_006389chr1131360 1210 293 11236 ----
NM_006393chr1044185 3829 1249 427 --24399 3477 --
NM_006401chr91405 ------
NM_006403chr621807 284 --1299 --
NM_006415chr931279 1197 1031 --1857 --
NM_006420chr2022918 377 1488 ----
NM_006434chr1033245 2500 2406 --21006 666 --
NM_006451chr511051 2789 287 ----
NM_006457chr494050 3935 3330 2767 2531 2516 981 836 819 13356 --13846
NM_006459chr1041593 1475 1361 724 1617 ----
NM_006460chr1721279 488 2528 482 ----
NM_006472chr12222 47 ------
NM_006480chr5----1477 --
NM_006482chr12194 --1845 --
NM_006489chr1431624 718 221 1236 11329 --
NM_006496chr151418 1279 1252 730 62 ------
NM_006497chr171765 ------
NM_006504chr1042964 2739 1049 755 ----11888
NM_006517chrX11513 21555 77 1407 --
NM_006519chr6135 ------
NM_006520chrX--31442 1070 46 ----
NM_006526chr2021711 266 ------
NM_006529chr4--21658 1325 ----
NM_006534chr2073412 2728 1055 858 794 548 479 1583 12119 --
NM_006537chr152510 210 1127 ----
NM_006544chr1485585 5303 3887 3710 2308 1620 505 202 55809 5714 5507 4656 377 11027 --
NM_006546chr1766659 6583 5425 4785 1198 537 14426 35032 4449 128 12374
NM_006547chr721509 1409 11732 ----
NM_006548chr311148 ----1206
NM_006557chr931586 536 433 21560 1290 ----
NM_006559chr11909 ----11226
NM_006560chr113425 196 54 ------
NM_006561chr1095908 5867 3915 3800 1498 1279 1232 1028 680 14225 44898 3792 912 76 --
NM_006565chr166855 847 516 452 432 426 ------
NM_006572chr1793411 2930 1348 967 738 569 199 160 57 12738 --11037
NM_006575chr1431141 288 94 11154 1214 --
NM_006585chr211106 ------
NM_006587chr451515 1333 663 244 145 2253 28 ----
NM_006591chr1121672 1333 11653 ----
NM_006593chr22636 220 ------
NM_006595chr1151951 1807 1431 1258 266 ----11367
NM_006599chr16128225 8147 8018 7590 6795 5634 5260 3124 2484 2379 2159 1728 22074 1997 22284 2105 --
NM_006603chrX31956 814 780 --2717 165 --
NM_006609chr243001 2588 2185 561 ------
NM_006614chr3123612 3594 3396 3166 2486 1252 981 585 411 331 306 201 33053 2791 2239 ----
NM_006618chr131562 1446 494 ------
NM_006621chr11670 ------
NM_006624chr103742 726 91 ----11398
NM_006626chr962453 2348 2146 1002 116 32 ------
NM_006628chr1574588 4417 4008 2944 1212 1006 567 14637 11628 --
NM_006633chr5--1164 ----
NM_006640chr1711867 41845 1640 1621 105 ----
NM_006644chr131486 148 ----
NM_006646chr1363094 3023 2683 2245 660 343 ------
NM_006654chr1284055 3152 1105 967 921 603 557 25 44408 4308 2943 977 --13389
NM_006658chr73773 360 170 196 ----
NM_006670chr61137 ------
NM_006675chr1263104 2677 2352 2148 1177 337 32609 2313 246 --1873
NM_006676chr951520 459 381 298 228 ------
NM_006690chr2021736 918 1440 12220 --
NM_006691chr1121030 869 ------
NM_006696chr51238 ------
NM_006700chr122801 627 ------
NM_006703chr61423 --1328 --
NM_006711chr162787 708 158 ----
NM_006713chr52706 204 ------
NM_006717chr952756 2264 1324 1284 977 ------
NM_006718chr63899 846 754 ----1288
NM_006722chr322551 838 22701 2484 ----
NM_006724chr62440 379 --1159 --
NM_006726chr441230 838 154 96 --1770 --
NM_006729chrX64857 3908 3462 2193 2048 1591 35275 4416 4251 15185 --
NM_006731chr995758 5596 4452 4374 3565 1918 1405 1171 1162 45494 1991 1781 80 24563 4478 --
NM_006732chr191187 ------
NM_006734chr631577 260 241 ----1117
NM_006738chr1574417 3199 1637 1631 1450 1289 1283 24569 3066 ----
NM_006742chr1611971 ------
NM_006746chrX31486 1318 1107 11000 ----
NM_006747chr111152 ------
NM_006750chr16107477 6078 5335 2787 2717 2683 743 664 567 87 1626 11512 --
NM_006751chr221078 713 187 ----
NM_006754chr741124 424 393 131 1104 1275 --
NM_006756chr841296 1105 1010 994 11409 ----
NM_006763chr152039 1817 1361 747 388 1753 ----
NM_006764chr31179 193 ----
NM_006766chr872500 2069 2047 1724 1042 823 382 ------
NM_006769chr13740 687 565 ------
NM_006772chr611484 ------
NM_006773chr231179 1005 35 ------
NM_006775chr673104 3035 2670 2174 1105 863 89 ------
NM_006777chrX32467 2111 425 12227 --12008
NM_006788chr1831911 1528 328 11618 12130 --
NM_006791chr151115 ------
NM_006803chr831830 1584 1387 11550 11674 --
NM_006805chr531218 168 113 11179 ----
NM_006807chr1731353 245 181 ------
NM_006809chr202320 159 ------
NM_006820chr132747 109 94 23949 2828 ----
NM_006822chr172507 215 1538 ----
NM_006823chr811182 11368 ----
NM_006826chr2----2881 176 --
NM_006827chr1443318 3137 1159 298 1844 11110 --
NM_006832chr142124 63 2896 206 ----
NM_006838chr1211260 176 11817 --
NM_006846chr51341 2317 109 ----
NM_006851chr1232552 2482 921 12914 ----
NM_006852chr1732392 1971 712 1779 ----
NM_006856chr121732 ------
NM_006861chr121341 ----12071
NM_006874chr421030 825 ------
NM_006884chr341713 1631 1591 1468 ------
NM_006885chr1683855 3800 3313 3239 2860 2592 1501 339 24156 2628 ----
NM_006888chr1423240 2505 1277 ----
NM_006892chr2011451 11384 ----
NM_006892chr2011451 11384 ----
NM_006897chr121614 ------
NM_006898chr21644 ------
NM_006908chr741293 1047 193 55 11468 ----
NM_006910chr161352 ------
NM_006912chr122553 562 12463 ----
NM_006914chr91193 ------
NM_006915chrX22504 2256 ------
NM_006918chr11115829 5747 5592 5405 4780 4625 1651 1570 1066 342 271 13839 11951 --
NM_006920chr231284 561 358 31623 1561 380 ----
NM_006922chr232054 624 528 2859 509 ----
NM_006924chr17114234 4147 2894 2791 1787 1394 1374 690 629 305 278 1750 ----
NM_006925chr142517 421 ------
NM_006930chr541991 1326 451 416 --21969 1570 --
NM_006931chr1241537 1492 555 159 2614 280 ----
NM_006938chr183917 748 62 ------
NM_006939chr1421143 1081 11043 ----
NM_006940chr121332 11700 --11279
NM_006948chr2132494 1653 153 ------
NM_006951chr102767 104 ------
NM_006954chr1043424 993 544 253 13221 ----
NM_006965chr181907 --11125 --
NM_006974chr1043424 993 544 253 13221 ----
NM_006981chr922704 2435 --1593 --
NM_006997chr101402 ------
NM_007005chr941557 1261 993 49 ------
NM_007007chr1284723 4690 4622 4480 4112 723 625 341 --23754 78 --
NM_007008chr22819 376 1774 ----
NM_007010chr1721368 1258 11436 ----
NM_007011chr15126640 6039 5964 5824 5341 5173 5158 4235 2372 1251 589 335 1341 22555 1142 --
NM_007013chr82726 357 ------
NM_007017chr5----1652 --
NM_007018chr92383 139 ------
NM_007019chr202177 123 ------
NM_007023chr22268 227 2947 704 131 --
NM_007034chr11247 ------
NM_007043chr1212131 ------
NM_007045chr61559 ------
NM_007050chr2068060 5811 2410 2250 698 320 27256 1306 --16847
NM_007054chr573875 3574 3047 2784 946 787 145 22413 656 13393 --
NM_007064chr331493 1406 368 ------
NM_007078chr1053040 2888 1224 1170 796 22258 1867 ----
NM_007084chr1341367 1104 571 108 --1286 --
NM_007106chr1352646 990 717 304 38 ----12184
NM_007107chr322399 1880 ------
NM_007111chr135757 660 605 303 286 1255 1312 --
NM_007118chr51564 ------
NM_007124chr61683 1280 ----
NM_007125chrY--11429 11039 --
NM_007129chr13----1416 --
NM_007137chrX63511 3482 2204 1171 779 462 24531 3768 33961 3572 1477 --
NM_007144chr1731277 1232 292 1932 ----
NM_007146chr1731957 1857 1824 1760 22766 1876 --
NM_007150chrX42121 726 134 70 1477 ----
NM_007158chr131185 1060 303 ------
NM_007159chr321382 217 ------
NM_007166chr1131598 1497 518 ------
NM_007172chr2253033 2893 2061 991 313 12910 23210 503 --
NM_007173chr1142197 1799 1792 189 175 ----
NM_007175chr833290 2319 613 ----1462
NM_007185chr12815 329 ------
NM_007187chr1321033 74 ------
NM_007191chr122688 437 ------
NM_007192chr1431188 1100 924 1108 ----
NM_007197chr121929 2665 346 11048 --
NM_007200chr1574417 3199 1637 1631 1450 1289 1283 24569 3066 ----
NM_007203chr943212 1292 1153 527 12911 11396 --
NM_007212chr111775 ------
NM_007214chr63930 51 30 ------
NM_007216chr111738 21059 136 1262 --
NM_007217chr31307 ------
NM_007222chr82706 69 ----11775
NM_007229chr221290 ------
NM_007246chr411081 ------
NM_007249chr1389133 8760 7943 3120 3032 1617 1156 286 --28359 652 --
NM_007269chr1--2536 163 ----
NM_007275chr321029 180 --1338 --
NM_007276chr71121 --11017 --
NM_007278chr171131 ------
NM_007279chr191619 1606 ----
NM_007283chr3------13009
NM_007287chr3--1544 1294 11086
NM_007288chr3--1544 1294 11086
NM_007289chr3--1544 1294 11086
NM_007294chr1721198 1157 1922 ----
NM_007295chr1721198 1157 1922 ----
NM_007296chr1721198 1157 1922 ----
NM_007297chr1721198 1157 1922 ----
NM_007298chr1721198 1157 1922 ----
NM_007299chr1721198 1157 1922 ----
NM_007300chr1721198 1157 1922 ----
NM_007302chr1721198 1157 1922 ----
NM_007303chr1721198 1157 1922 ----
NM_007304chr1721198 1157 1922 ----
NM_007305chr1721198 1157 1922 ----
NM_007308chr41527 ------
NM_007347chr1553105 3043 2655 641 486 ------
NM_007350chr12104189 4019 3920 3503 3242 3101 1179 1139 868 584 14205 23699 601 --
NM_007351chr4165 ------
NM_007353chr743066 2480 458 283 --21941 23 --
NM_007358chr141983 1740 1720 392 11370 ----
NM_007363chrX31014 346 328 ------
NM_007365chr11679 --125 11775
NM_007372chr171777 ------
NM_007373chr1061335 677 610 526 515 202 1265 1251 --
NM_007375chr122035 113 11095 1244 12279
NM_009585chr32729 314 ------
NM_009585chr32729 314 ------
NM_012062chr121944 --1307 --
NM_012064chr121157 ------
NM_012081chr553301 457 305 222 156 --11462 31427 957 651
NM_012082chr82706 313 ------
NM_012089chr121127 300 11099 ----
NM_012090chr11192 1834 1975 --
NM_012093chr131168 998 970 2819 485 1140 --
NM_012095chr1031344 1035 32 23423 872 1493 --
NM_012096chr373353 2522 467 401 270 169 114 23684 2654 ----
NM_012097chr231896 1714 447 --1179 --
NM_012102chr162332 2242 1937 1902 1831 770 12513 1171 12560
NM_012104chr112478 299 22992 2681 --1472
NM_012104chr112478 299 22992 2681 --1472
NM_012111chr141142 ------
NM_012115chr63531 388 199 --1581 --
NM_012120chr632639 2370 1997 1179 2560 250 --
NM_012123chr62326 307 ----1121
NM_012124chr112872 737 --1156 --
NM_012129chr742469 1950 830 200 12198 ----
NM_012141chr1343316 3105 1085 650 1351 ----
NM_012153chr1152585 2387 1964 1920 779 12515 1843 --
NM_012154chr82875 748 ----1228
NM_012156chr2032325 1159 919 13124 12861 --
NM_012158chr1321504 64 11790 1683 --
NM_012161chr441077 928 794 22 ------
NM_012164chr997248 6067 5701 5667 5385 5326 4699 1152 902 37056 1372 146 15973 17321
NM_012175chr11----1175 --
NM_012193chr1165461 5028 4467 4381 3913 182 1603 ----
NM_012199chr184538 4509 3694 2942 2917 1699 1600 567 ------
NM_012213chr162677 538 ------
NM_012214chr276308 5829 5704 4977 4860 4641 903 22056 695 35872 5052 2313 --
NM_012215chr1021601 627 --11763 --
NM_012216chrX1102 ------
NM_012218chr192235 213 --1314 --
NM_012233chr21940 ------
NM_012234chr383629 3523 3445 3349 3194 2460 1130 893 --11115 --
NM_012238chr1031591 1556 325 ------
NM_012247chr102946 128 ------
NM_012249chr253500 3055 2805 2182 390 32879 2728 801 ----
NM_012250chr112917 422 1858 --1318
NM_012252chr744947 4790 4418 1982 ------
NM_012257chr73920 165 90 1801 ----
NM_012262chr165034 4685 3459 1275 544 382 35260 4369 514 13687 --
NM_012281chr711823 ------
NM_012286chrX3489 126 29 ------
NM_012287chr363176 1537 1228 927 907 559 44123 3661 3517 315 13018 14460
NM_012290chr251287 581 139 79 38 21039 575 ----
NM_012293chr222264 335 --2781 28 --
NM_012297chr442399 2345 568 52 ----11757
NM_012300chr552445 1778 1710 1574 978 12226 --12318
NM_012301chr711940 ----21801 758
NM_012307chr18----1693 --
NM_012308chr1142190 1758 817 312 11681 ----
NM_012309chr1184223 3264 3064 1129 689 618 538 298 11919 1117 --
NM_012311chr102639 204 ------
NM_012316chr155437 4290 3863 2047 717 --11506 --
NM_012327chr1831569 1053 510 1522 ----
NM_012329chr1711490 ------
NM_012330chr1021783 539 ------
NM_012331chr82547 525 ------
NM_012333chr161494 1176 672 517 478 58 1507 ----
NM_012342chr103443 363 196 ------
NM_012343chr5--11116 ----
NM_012345chr1341695 1287 672 231 ------
NM_012347chr622467 1092 12392 ----
NM_012383chr9161 268 46 --1172
NM_012388chr1542033 2027 633 211 ------
NM_012395chr743366 2653 1246 251 --1985 13395
NM_012397chr1811714 ------
NM_012399chr2211496 11720 1715 --
NM_012402chr112411 145 2907 90 ----
NM_012414chr11709 2717 296 ----
NM_012416chr911264 ----1239
NM_012417chr17--194 ----
NM_012419chr64582 439 218 141 ------
NM_012430chr31539 ------
NM_012431chr743234 1111 760 620 13256 ----
NM_012432chr12333 264 ------
NM_012434chr651377 1352 1199 1170 327 ------
NM_012448chr1751554 814 681 222 186 --11620 --
NM_012449chr7165 ------
NM_012454chr62388 377 ------
NM_012479chr721832 704 32600 653 163 12387 12525
NM_012482chr11169 ------
NM_013227chr151197 1100 ----
NM_013229chr1242793 2640 481 134 --1220 --
NM_013231chr1464262 3681 3607 2782 343 222 11636 ----
NM_013236chr221221 --2347 215 --
NM_013253chr112295 268 ----1239
NM_013257chr8--2397 284 ----
NM_013261chr432781 2736 262 23268 793 12398 --
NM_013262chr621093 928 11329 ----
NM_013269chr1224202 1556 ----14389
NM_013272chr151149 ------
NM_013281chr201600 1131 ----
NM_013282chr1941310 1140 1112 31 1446 1130 --
NM_013286chr363041 1245 966 955 677 32 23418 1429 ----
NM_013293chr71276 1142 ----
NM_013316chr72952 38 --1306 --
NM_013320chr122146 121 168 ----
NM_013323chr1741079 450 426 201 ------
NM_013336chr32632 171 --1789 --
NM_013341chr252585 853 746 614 209 11065 12708 --
NM_013351chr172719 609 ------
NM_013354chr8----11350 --
NM_013372chr151944 13388 --1538
NM_013374chr342810 2648 2498 189 ----12716
NM_013377chr121576 ------
NM_013386chr121695 1404 11606 ----
NM_013388chr22428 77 ------
NM_013390chr931566 547 206 ------
NM_013392chr21443 ------
NM_013396chr2141352 500 445 290 1264 177 --
NM_013411chr121961 1807 --11966 11890
NM_013436chr21300 ------
NM_013437chr851343 1301 1016 490 343 31276 939 392 ----
NM_013438chr941686 669 303 279 --11319 --
NM_013443chr91955 --11099 --
NM_013446chr741170 1084 1067 1028 --11327 --
NM_013448chr14--1177 ----
NM_013449chr1232370 1851 1158 22613 284 ----
NM_013450chr231090 1058 202 ------
NM_013937chr641050 432 197 86 11016 ----
NM_013943chr162366 2013 1195 793 778 622 1590 --1994
NM_013958chr8--1436 ----
NM_013959chr8--1436 ----
NM_013961chr8--1436 ----
NM_013962chr8--1436 ----
NM_013993chr61749 ------
NM_013994chr61749 ------
NM_013995chrX32592 473 416 --12604 --
NM_014000chr101542 --11746 --
NM_014010chr92538 520 ------
NM_014011chr242469 2429 427 230 ------
NM_014021chr162964 2469 2241 1362 341 118 ----13291
NM_014023chr1042877 2454 401 194 ----134
NM_014034chr631491 1297 594 11370 ----
NM_014043chr3125 1164 ----
NM_014048chr1665121 5115 4326 1974 1555 1547 24667 3393 ----
NM_014057chr921308 360 11363 ----
NM_014079chr32847 79 11070 ----
NM_014089chr1322231 837 ----1155
NM_014109chr82919 330 3425 209 58 ----
NM_014110chr111107 11082 --11149
NM_014112chr874888 4036 1915 843 737 718 680 11385 ----
NM_014117chr161394 12222 ----
NM_014141chr754258 1623 1539 987 438 25103 550 1903 --
NM_014153chr161627 ------
NM_014154chr31107 1392 ----
NM_014155chr1176701 6539 5169 4732 4697 2639 2261 27369 815 17271 --
NM_014157chr1651322 1310 1062 854 691 --13025 --
NM_014160chr3--11418 ----
NM_014170chr31328 ------
NM_014178chr143566 238 49 ------
NM_014184chr11135 ------
NM_014191chr121401 ------
NM_014217chr111934 --11372 --
NM_014231chr1212099 --166 12051
NM_014232chr171193 ------
NM_014232chr171193 ------
NM_014239chr141344 ------
NM_014240chr382648 2602 1351 1115 792 781 716 588 ------
NM_014243chr422125 325 ------
NM_014245chr3--1166 ----
NM_014246chr2222196 2151 12230 21655 785 --
NM_014248chr22----1121 --
NM_014250chr2251903 1383 407 178 51 ------
NM_014253chrX62413 2378 2240 671 285 167 11616 ----
NM_014264chr41219 ------
NM_014267chr112756 301 --1137 --
NM_014271chrX1301 ------
NM_014278chr4--1110 ----
NM_014280chr12335 107 1855 ----
NM_014283chr141315 1283 1073 375 --11005 1952
NM_014285chr93786 309 106 ------
NM_014294chr811259 21421 116 ----
NM_014299chr1921361 390 ----11486
NM_014305chr131699 ------
NM_014309chr2273711 2181 2175 2169 2058 1706 1695 23787 3565 ----
NM_014310chr2211961 ------
NM_014316chr1621414 857 11975 11630 --
NM_014317chr10----177 --
NM_014319chr1231405 297 65 1489 ----
NM_014325chr1282153 2068 1933 1486 858 791 772 172 2458 132 ----
NM_014331chr4107634 6795 6288 4970 2328 2165 2006 1865 1300 1032 21323 1209 ----
NM_014332chrX1137 ------
NM_014333chr115625 410 312 211 143 --1701 --
NM_014335chr1521233 1219 11024 1318 --
NM_014342chr1121389 221 1292 11464 --
NM_014345chr6180 1284 ----
NM_014352chr1111423 ------
NM_014361chr11121 --2415 31 --
NM_014363chr1321207 293 --11034 --
NM_014368chr931806 486 464 ------
NM_014372chr12628 491 161 ----
NM_014376chr5--12492 ----
NM_014386chr5----1107 --
NM_014392chr4------1129
NM_014393chr821568 205 11602 1920 --
NM_014394chr103356 274 75 ------
NM_014395chr451952 1827 1446 1396 612 11972 ----
NM_014410chr18----1355 --
NM_014415chr33623 437 148 ------
NM_014423chr534758 4171 3858 21340 1087 11650 13564
NM_014426chr202718 486 ------
NM_014445chr341733 1661 981 771 22213 528 ----
NM_014447chr41662 11334 21684 1094 --
NM_014452chr661231 1156 918 908 306 108 2771 241 ----
NM_014455chr11435 ------
NM_014456chr101469 11746 ----
NM_014482chr21131 ------
NM_014491chr731081 787 289 ------
NM_014494chr1621516 768 11485 ----
NM_014500chrX2287 46 1233 ----
NM_014504chr721878 236 --2562 536 --
NM_014506chr93623 104 97 1344 --11693
NM_014515chr122867 426 1262 1781 --
NM_014517chr361714 1699 1636 1361 724 310 21535 698 11883 --
NM_014522chrX1203 ------
NM_014548chr152359 197 ------
NM_014552chr211492 ------
NM_014554chr1221653 712 --11987 --
NM_014563chrX12094 --12159 --
NM_014570chr22--1108 ----
NM_014572chr1311445 ------
NM_014573chr1741830 1445 1357 1287 1378 ----
NM_014574chr1441384 1317 500 34 ------
NM_014575chr32148 44 ------
NM_014577chr222590 57 ------
NM_014585chr251200 1117 1087 1051 96 11234 ----
NM_014592chr51240 ------
NM_014602chr3188 1349 ----
NM_014606chr421414 1180 ------
NM_014607chr25852 769 751 541 339 --11875 11760
NM_014615chr1663073 2834 974 919 893 418 --1412 --
NM_014616chr353308 2522 2512 865 243 --2425 252 --
NM_014630chr1553346 3271 2672 2653 210 12976 1991 --
NM_014635chr231374 1355 105 183 ----
NM_014647chr1642172 1704 413 349 ------
NM_014659chr1511047 ------
NM_014660chr751075 270 232 202 166 ------
NM_014661chr1063905 2492 1481 1475 1264 277 12745 21247 1036 --
NM_014666chr51497 --1948 --
NM_014667chr362036 1971 1960 765 600 379 22128 919 144 --
NM_014669chr16--1130 ----
NM_014670chr21392 11011 --11409
NM_014671chr721144 325 ------
NM_014674chr373344 2693 2588 2576 1238 739 337 --1704 12867
NM_014676chr131449 609 410 11219 ----
NM_014682chr872254 2113 2102 2066 1971 817 810 32037 1952 1887 ----
NM_014683chr1742155 1694 1447 451 --1388 --
NM_014685chr161551 ------
NM_014686chr1942327 2257 1919 558 ------
NM_014699chr16--1320 ----
NM_014701chr1563085 2728 2658 1349 1223 721 22155 1269 43295 3101 2663 356 --
NM_014702chr663429 2703 2677 1286 1188 306 1838 --11110
NM_014705chr771979 1789 1767 1325 695 583 36 1796 ----
NM_014707chr722251 1570 21801 1516 ----
NM_014709chr2270 58 --196 --
NM_014710chrX3321 205 126 --1632 --
NM_014711chr1632096 2020 1983 ------
NM_014713chr23502 336 47 ------
NM_014720chr1051637 1382 1287 730 467 1561 --11525
NM_014721chr677152 7027 5962 5524 5075 1884 1831 ------
NM_014723chr2013208 ------
NM_014729chr842181 647 410 260 11607 12023 --
NM_014730chr1254341 3754 2122 2114 771 25087 614 11664 --
NM_014730chr1254341 3754 2122 2114 771 25087 614 11664 --
NM_014732chr1665271 5016 4806 3650 2295 1396 --15825 --
NM_014733chr541803 684 575 126 ------
NM_014735chrX82071 1805 1533 1501 1494 254 39 33 12012 --1217
NM_014736chr152312 80 --1663 --
NM_014738chr172728 77 --1101 --
NM_014739chr652684 960 790 283 111 1582 14173 1345
NM_014743chr442680 2409 2362 1079 12571 ----
NM_014747chr143833 2275 1529 221 --35399 5137 991 --
NM_014751chr832072 730 59 ------
NM_014752chr1151220 634 555 239 122 1262 11253 --
NM_014755chr261056 998 643 443 346 143 14101 ----
NM_014757chr522100 2023 32397 1592 578 ----
NM_014761chr1621163 1097 ------
NM_014764chr121306 1946 ----
NM_014765chr162504 1921 1040 438 401 154 ------
NM_014774chr143089 2604 441 371 22263 119 22977 623 --
NM_014781chr831150 383 48 --1511 --
NM_014783chr1541568 1142 115 82 --11525 --
NM_014786chr1111162 ------
NM_014795chr2--1899 ----
NM_014802chr122713 130 160 1181 --
NM_014803chr1042235 1955 976 729 --22685 828 --
NM_014804chr1711381 1175 ----
NM_014810chr133595 972 177 1254 ----
NM_014812chr13642 629 439 ------
NM_014813chr13573 392 96 ------
NM_014814chr3127 ------
NM_014819chr591924 1820 1659 1528 860 361 316 235 164 1465 ----
NM_014820chr341616 1429 182 114 ------
NM_014824chr1132002 1312 421 ----11674
NM_014826chr174376 3729 3621 3143 1558 814 346 13187 ----
NM_014827chr161696 1669 1586 1204 197 108 ----1330
NM_014828chr1431684 825 182 ------
NM_014829chr542370 2225 2115 2088 ------
NM_014830chr1232688 1286 99 33384 2410 1114 13331 --
NM_014835chr2032010 1999 626 12242 ----
NM_014838chr2232696 2298 1131 --12255 --
NM_014839chr142474 1875 1868 866 12300 ----
NM_014840chr1273372 3192 2971 2421 232 140 85 42324 2206 1302 723 21188 384 --
NM_014848chr1542757 705 657 166 11018 ----
NM_014850chr374376 3831 3295 3238 1817 1422 900 ----11704
NM_014859chr1751331 962 363 236 194 1526 ----
NM_014860chr262587 851 811 672 602 25 21752 552 --1374
NM_014862chr1534227 2828 2660 ------
NM_014864chr174232 3649 3467 3419 1649 1036 413 2996 865 ----
NM_014872chr922000 257 12400 1820 --
NM_014873chr184006 3992 3725 3697 3445 1574 840 484 ------
NM_014874chr141880 1818 755 178 ------
NM_014877chr17117610 6949 6885 6421 3076 2951 888 455 264 137 46 36394 1951 1034 36635 5663 330 11083
NM_014883chr442466 2312 1760 505 --11638 --
NM_014890chr31115 ------
NM_014891chr731559 328 260 ----1391
NM_014892chr62540 93 ------
NM_014893chrY42213 1672 1619 1570 12052 ----
NM_014898chr19193 ------
NM_014900chr23997 403 201 ------
NM_014901chr522127 1769 1181 ----
NM_014903chr1252222 2210 473 358 33 12468 11546 --
NM_014904chr1073805 2933 2614 1553 861 655 389 12964 ----
NM_014905chr21819 2813 108 ----
NM_014906chr1723503 916 24114 1243 12768 --
NM_014912chr1072973 2964 2678 692 634 352 245 23185 281 ----
NM_014914chr221335 1009 ----1487
NM_014917chr11828 168 ----
NM_014918chr1531598 573 287 --1172 --
NM_014921chr1912003 --22776 2096 --
NM_014923chr132481 356 32237 130 44 ----
NM_014932chr342009 1808 1773 1386 1511 ----
NM_014934chr1333749 3574 69 33434 1088 710 ----
NM_014935chr153934 3898 3094 2530 554 23610 3030 13817 --
NM_014936chr682613 2442 2124 1759 987 786 762 491 1172 ----
NM_014939chr1821080 45 ------
NM_014944chr131201 1140 278 ------
NM_014946chr232847 1172 379 1789 1384 --
NM_014947chr123028 326 13006 22229 201 --
NM_014951chr1072439 2325 2298 1934 1010 621 461 ------
NM_014961chr421866 600 ----1742
NM_014962chr2052569 2057 1118 458 304 --1904 12171
NM_014969chr12450 332 ------
NM_014974chr101238 31789 1761 564 11492 --
NM_014978chr1011271 ------
NM_014982chr1454346 3941 1986 1122 156 43891 3799 389 366 14485 --
NM_014988chr412432 --11777 --
NM_014989chr63784 451 115 --11546 --
NM_014991chr463209 2999 2831 2635 2432 2152 11197 1524 --
NM_014994chr1542416 2378 2259 2131 1256 ----
NM_014996chr32661 162 1692 ----
NM_014997chr742921 2869 1998 198 ----1692
NM_014999chr1251196 1162 1143 1104 177 ------
NM_015000chr1213023 23133 1935 ----
NM_015001chr12382 318 --1131 --
NM_015002chr1241427 360 272 28 --1918 --
NM_015005chr1421640 321 11749 11662 --
NM_015008chr372845 2697 2640 2628 2600 2394 1205 ------
NM_015009chr33768 733 670 ------
NM_015017chr121158 94 2910 257 ----
NM_015020chr1663902 3573 3001 633 112 93 --13640 --
NM_015023chr121642 128 --186 --
NM_015025chr242594 595 465 56 32683 2613 2227 ----
NM_015026chr1243287 771 635 305 24728 971 2612 50 --
NM_015027chr1641348 648 428 107 11588 1208 --
NM_015032chr1332804 683 413 12035 ----
NM_015035chr2036317 1804 630 --25778 4418 --
NM_015039chr144246 3118 1556 556 53315 2978 1548 1179 46 ----
NM_015042chr1533984 3527 3182 --23619 117 --
NM_015045chr1042213 1590 482 476 1171 ----
NM_015046chr942491 2467 2015 102 32625 2366 2249 21819 1695 --
NM_015049chr212438 33295 3261 2577 ----
NM_015051chr922691 2153 --1666 --
NM_015055chr1151808 994 583 544 414 12897 ----
NM_015059chr1523832 566 23997 2807 ----
NM_015061chr92795 90 ------
NM_015064chr1242923 2393 1428 1282 ----1285
NM_015068chr743180 3060 976 365 33957 1547 222 ----
NM_015071chr566361 6130 2078 1369 1013 515 185 14751 12423
NM_015072chr142390 106 ------
NM_015074chr144902 4324 1551 463 33614 1872 578 14166 --
NM_015076chr674372 4242 4124 3539 3332 1242 1179 ------
NM_015087chr132591 367 ------
NM_015090chr165526 5353 5029 4168 4049 1094 46071 5735 4192 1815 ----
NM_015091chr141539 ------
NM_015092chr1654169 3996 3243 2939 950 --14129 13087
NM_015093chr631546 519 452 197 ----
NM_015094chr2224562 3368 11160 ----
NM_015097chr361898 785 526 395 288 280 21463 307 ----
NM_015100chr151779 1731 1590 729 405 ------
NM_015101chr152883 2498 2369 843 705 --2425 74 1670
NM_015107chrX62385 1982 1811 1683 1552 787 --1454 --
NM_015110chr931894 1740 1591 --12322 --
NM_015115chr482860 2680 1229 1023 890 773 202 74 41262 839 231 48 --1138
NM_015116chr1321136 78 11487 --11264
NM_015124chr2232469 831 560 ------
NM_015134chr171643 ------
NM_015137chr872575 2308 1921 1642 788 481 215 ------
NM_015138chr1552802 2527 1028 171 153 12316 22733 271 --
NM_015141chr332196 2045 2014 ------
NM_015153chr6--1672 ----
NM_015156chr14104015 3869 3756 2977 2738 2564 1562 1450 1107 167 33693 3223 928 ----
NM_015161chr162628 352 ------
NM_015163chr141282 ----11479
NM_015176chr131759 1205 467 ------
NM_015180chr143859 788 306 ------
NM_015184chr3170 ------
NM_015185chrX32656 427 322 22913 2674 ----
NM_015186chr9--1471 ----
NM_015192chr2072816 2763 2494 2482 2275 899 506 ----1536
NM_015199chr311179 --12792 --
NM_015200chr462402 2129 1984 1012 1006 759 ----1870
NM_015206chr1543725 3065 2723 2661 1554 ----
NM_015208chr1833396 658 626 ------
NM_015213chr112182 174 1544 ----
NM_015215chr152500 1171 1136 812 570 1929 ----
NM_015216chr521484 172 ------
NM_015221chr1031348 1271 38 --1485 --
NM_015225chr972980 2945 2776 2362 2077 292 150 22091 199 ----
NM_015233chr1352687 2254 2191 1879 827 ------
NM_015234chr631328 904 192 ------
NM_015236chr41599 ----11504
NM_015238chr51254 ------
NM_015245chr632620 2545 923 ------
NM_015247chr1644828 3987 3354 213 24176 1360 ----
NM_015250chr931326 743 373 --21528 464 --
NM_015251chr1632132 233 137 11825 ----
NM_015263chr152939 434 ------
NM_015265chr252336 2041 937 124 82 22204 860 1633 --
NM_015268chr31468 ------
NM_015269chr11606 ------
NM_015270chr1231780 1764 1653 ------
NM_015271chr444191 4002 3878 3752 32794 2699 1326 --13024
NM_015272chr1641941 1753 1310 650 ------
NM_015275chr1242110 2008 323 219 159 ----
NM_015277chr1831661 564 63 ------
NM_015278chr621011 594 11216 13042 --
NM_015286chr1532418 1852 392 12466 ----
NM_015288chr543230 3047 2661 1530 --1926 --
NM_015294chr1721144 52 2928 75 1286 --
NM_015299chr1433667 750 230 --13059 --
NM_015308chr11138 ------
NM_015310chr898014 7427 5367 2578 2380 704 295 185 169 23102 1802 22956 2134 1750
NM_015313chr1184699 4504 4163 3994 3453 433 390 198 24295 1507 ----
NM_015314chr782474 2401 2307 1956 1927 1041 658 627 12271 ----
NM_015317chr262493 2185 998 884 838 802 --12738 --
NM_015319chr121462 ------
NM_015321chr1944895 3061 1897 739 --1418 --
NM_015323chr631574 1498 294 21595 22 ----
NM_015326chr122642 872 11082 1771 --
NM_015328chr742832 2611 2457 2165 2691 551 ----
NM_015329chr1942925 2799 2295 1817 ------
NM_015331chr11614 183 ----
NM_015332chr7123294 3092 2809 2752 2447 2400 1449 1442 1257 619 572 285 ------
NM_015335chr12--22230 622 11052 --
NM_015336chr1212100 22591 1848 ----
NM_015343chr171278 ------
NM_015344chr811520 ------
NM_015346chr141426 --1219 --
NM_015347chr122779 599 12099 ----
NM_015349chr622863 969 12243 ----
NM_015353chr1742770 1882 674 235 --1510 --
NM_015355chr1731743 1566 770 31612 1430 540 ----
NM_015358chr2121225 31 ------
NM_015359chr892624 2399 2347 2067 1980 1899 1131 1047 153 ------
NM_015361chr22836 823 1767 ----
NM_015365chrX103786 3338 3050 2712 2613 1710 1057 549 341 282 33555 1184 566 --11205
NM_015378chr132840 374 322 11863 ----
NM_015385chr1033245 2500 2406 --21006 666 --
NM_015387chr221983 442 --1133 --
NM_015393chr433602 1278 1155 12628 33497 3162 963 --
NM_015397chr921270 182 11934 1123 --
NM_015407chr31167 ------
NM_015415chr11227 ------
NM_015419chrX21049 52 ------
NM_015423chr1151747 661 655 636 39 11252 ----
NM_015429chr3--1732 ----
NM_015435chr821423 1106 1547 --1256
NM_015436chr433253 3004 314 12155 --1269
NM_015439chr6--1486 ----
NM_015455chr593791 3388 2698 1445 1228 1142 421 223 93 23996 242 ----
NM_015458chr895110 4974 4682 3512 1829 1623 1207 1042 1023 --14665 25183 574
NM_015460chr331452 473 376 31950 1369 305 1299 --
NM_015464chr7--1663 ----
NM_015466chr3--1222 ----
NM_015475chr21436 3914 775 25 1850 --
NM_015483chr7--256 44 ----
NM_015488chr2--11625 11679 --
NM_015507chrX2404 166 ------
NM_015508chr321389 1255 1993 21411 591 --
NM_015511chr2011120 ------
NM_015514chr143599 412 144 2491 66 1556 --
NM_015523chr111238 ------
NM_015525chr63945 155 44 1365 ----
NM_015530chr2191 --1913 --
NM_015532chr1572842 2124 2033 1073 647 468 313 22109 2077 1146 --
NM_015534chr1--11088 ----
NM_015535chr264210 3654 2891 2690 2649 187 1913 ----
NM_015542chr1021249 927 --11039 --
NM_015548chr63728 671 141 1173 ----
NM_015550chr743593 3288 840 467 13262 ----
NM_015554chr1562906 2420 2395 2269 1823 249 1783 ----
NM_015555chr631355 125 67 ------
NM_015564chr522709 2572 12254 ----
NM_015565chr2132262 658 362 12254 11393 --
NM_015567chr1331016 374 271 ------
NM_015568chr2043071 2839 1640 1250 22920 1283 13598 --
NM_015569chr194625 4575 4486 3758 1923 639 579 273 241 --24288 604 --
NM_015571chr622154 940 21705 884 ----
NM_015575chr252316 2272 1390 949 869 --11058 --
NM_015576chr32550 336 12130 11819 --
NM_015577chr521797 418 11604 ----
NM_015578chr1922001 138 2542 109 11570 --
NM_015584chr171404 --11146 --
NM_015605chr1051230 1138 517 102 77 1124 ----
NM_015607chr11196 ------
NM_015610chr761955 1892 1075 830 748 229 21942 248 12243 --
NM_015626chr1731153 351 287 ------
NM_015640chr165316 5187 4834 4824 3975 2059 1491 13937 11426
NM_015646chr123907 224 159 ------
NM_015652chr101500 1648 ----
NM_015678chr1341555 1471 675 106 ------
NM_015684chr14276 53 1230 --1216
NM_015687chr64470 448 144 70 ------
NM_015690chr21584 ------
NM_015691chrX176 22894 504 --12340
NM_015695chr632028 1768 819 ------
NM_015702chr2122 ------
NM_015713chr853430 2828 2641 2285 199 --1110 --
NM_015716chr172747 98 ------
NM_015726chr131570 1556 111 ------
NM_015832chr18----143 --
NM_015850chr852238 1989 825 373 225 21632 817 1524 --
NM_015853chr111139 ------
NM_015866chr131400 1233 388 ------
NM_015874chr42509 84 ------
NM_015878chr8--11894 1227 12006
NM_015879chr18148646 8535 8513 7959 7817 6732 6455 2543 2264 1919 1181 575 443 397 36227 2799 550 ----
NM_015881chr112295 268 ----1239
NM_015885chr11--1308 1802 --
NM_015886chr855343 3730 3706 1711 161 33754 2200 838 1149 --
NM_015889chr22------1920
NM_015902chr83612 283 66 ----1204
NM_015905chr7197 163 ----
NM_015906chr184679 3750 1602 1551 1019 969 812 212 14123 14041 --
NM_015912chr841827 780 656 207 ------
NM_015915chr141252 ------
NM_015934chr21146 ------
NM_015957chr112264 167 1112 ----
NM_015980chr521116 1085 21590 1517 ----
NM_015981chr553170 2925 1186 710 91 1964 --13004
NM_015990chr451090 1012 963 838 437 1923 1430 --
NM_015995chr1534994 4162 453 15256 1936 --
NM_015999chr1163 ------
NM_016003chr761955 1892 1075 830 748 229 21942 248 12243 --
NM_016006chr31261 ------
NM_016018chr822687 2302 22602 1960 1902 --
NM_016019chr731018 868 319 ------
NM_016021chr622263 2105 32714 2054 595 ----
NM_016023chr852171 2039 1348 852 383 1412 --12192
NM_016025chr1611595 ------
NM_016027chr82449 34 ------
NM_016032chrX128 ------
NM_016037chr121123 101 1410 ----
NM_016040chr132551 2370 623 --12480 --
NM_016045chr201620 11266 ----
NM_016057chr123381 320 137 ------
NM_016061chr251685 1662 1380 1363 1271 31459 599 431 ----
NM_016066chr1------123
NM_016072chr122797 377 1673 ----
NM_016073chr1521016 127 ------
NM_016075chr1353053 2675 2157 908 28 ------
NM_016076chr11486 13169 12505 11038
NM_016081chr452097 2089 1516 1487 1404 32128 1689 272 ----
NM_016083chr623702 3098 ----1150
NM_016097chr18----1989 1919
NM_016101chr1621263 63 194 ----
NM_016103chr5194 ------
NM_016107chr521369 506 --1401 --
NM_016120chrX1482 ------
NM_016122chr12------1100
NM_016131chr262251 2233 1524 789 609 505 --2685 617 21564 853
NM_016132chr1563270 3130 3067 2716 294 40 42979 2843 2639 317 ----
NM_016141chr34770 745 713 214 ------
NM_016152chr331233 1216 390 ------
NM_016179chr132209 196 ------
NM_016201chr342284 2202 1470 641 ------
NM_016203chr741012 871 216 63 ------
NM_016205chr421375 467 --1103 --
NM_016206chr3188469 8238 8105 7866 7199 6399 3588 3370 3271 3103 2701 2343 2140 2069 2020 1839 1220 378 36005 5970 227 1854 --
NM_016217chr623657 2491 23222 570 13303 --
NM_016224chr61459 ------
NM_016227chr141315 1283 1073 375 --11005 1952
NM_016231chr1721477 639 ------
NM_016239chr17--1898 --1778
NM_016248chr1383836 3027 1461 1235 1178 1050 751 386 23678 651 ----
NM_016255chr653354 2742 2125 1229 298 --13199 --
NM_016257chr153292 2677 1117 1008 275 ------
NM_016258chr11295 ------
NM_016260chr2117569 7504 6480 6142 5629 5276 2925 2914 2806 2253 161 32530 1891 338 15931 27670 7156
NM_016269chr431111 926 406 ----11137
NM_016271chr1812070 12129 --1945
NM_016275chr332495 2090 989 --11997 --
NM_016277chr641214 1017 242 99 21642 1312 ----
NM_016279chr51143 ------
NM_016284chr162271 114 ------
NM_016287chr131912 1889 308 1160 11487 --
NM_016289chr22344 43 11554 --11497
NM_016297chr233544 3127 382 1100 ----
NM_016303chrX3395 388 77 ------
NM_016307chr92287 262 ------
NM_016308chr172093 1846 1765 1329 606 530 282 11932 11857 --
NM_016315chr2142 1699 --11541
NM_016316chr22642 227 1160 ----
NM_016320chr111760 1927 --185
NM_016322chr942841 759 536 339 13074 ----
NM_016351chr7--1175 ----
NM_016352chr771407 1264 1222 1088 576 237 110 ------
NM_016357chr121443 163 ----
NM_016374chr111620 ------
NM_016374chr111620 ------
NM_016396chr1542512 1874 613 390 --11965 --
NM_016401chr11--140 ----
NM_016418chr2252863 2857 1107 319 309 23549 1533 --13171
NM_016422chr1143098 2711 612 141 4628 276 196 126 ----
NM_016424chr173550 521 206 1499 ----
NM_016436chr2032481 1007 601 11886 ----
NM_016441chr282352 1950 1905 1608 1477 857 676 250 ------
NM_016475chr143885 878 400 --1135 --
NM_016485chr622067 689 1383 ----
NM_016507chr172763 575 2505 85 ----
NM_016519chr4152 174 ----
NM_016525chr91865 1939 ----
NM_016529chr1341040 199 141 45 173 ----
NM_016530chr1563968 3836 1522 1011 729 604 1737 ----
NM_016531chr443077 2773 965 581 23676 619 ----
NM_016542chrX1255 ------
NM_016545chr13622 275 226 --1251 --
NM_016559chr34998 595 561 322 ------
NM_016587chr71121 --11017 --
NM_016588chr6--2936 186 ----
NM_016603chr51785 194 ----
NM_016604chr5180 1889 ----
NM_016605chr542224 840 456 337 --1549 --
NM_016607chrX21652 206 1245 ----
NM_016613chr452690 2591 2317 2205 2138 1310 --12636
NM_016618chr21356 ------
NM_016620chr121351 406 ------
NM_016621chr1164546 4016 2815 1465 415 335 1246 --1165
NM_016626chr1821725 462 11582 ----
NM_016628chr101735 ------
NM_016630chr15----2490 386 --
NM_016631chr21128 ------
NM_016644chr5------1445
NM_016651chr1421151 27 1199 ----
NM_016824chr1021512 749 11802 --1588
NM_016830chr121461 ----1413
NM_016831chr131875 1654 1620 11736 1957 --
NM_016834chr17--23482 148 --23962 3354
NM_016835chr17--23482 148 --23962 3354
NM_016836chr21609 1161 ----
NM_016839chr21609 1161 ----
NM_016841chr17--23482 148 --23962 3354
NM_016936chr1611647 --11481 --
NM_016946chr162994 2683 1390 1132 100 36 ----11172
NM_016950chr421113 182 ------
NM_016953chr265689 4502 1550 1087 418 390 25889 1235 13789 25496 1753
NM_016954chrX2649 497 --1477 --
NM_017412chr831039 253 59 ------
NM_017413chrX12064 32270 800 640 32527 1657 596 --
NM_017420chr1432324 1357 543 12738 ----
NM_017423chr421795 1534 21669 671 ----
NM_017426chr4128 ------
NM_017437chr1442326 2017 1795 371 --12369 --
NM_017447chr2144297 3817 1398 768 3447 144 114 ----
NM_017450chr1721228 92 ------
NM_017451chr1721000 440 ------
NM_017452chr201196 ----11334
NM_017453chr201196 ----11334
NM_017454chr201196 ----11334
NM_017456chr1721988 1977 21897 143 ----
NM_017488chr211402 ------
NM_017519chr631069 189 111 ------
NM_017544chrX2706 205 ------
NM_017548chr32830 346 11539 ----
NM_017551chr1042610 2336 2314 444 ------
NM_017563chr335088 1442 367 --16220 1376
NM_017580chr1051705 1634 1548 957 210 --11674 --
NM_017582chr131297 581 446 --11546 --
NM_017590chr2222646 2172 ------
NM_017594chr922979 2371 12222 ----
NM_017599chr1221313 434 21322 318 ----
NM_017612chr12----192 --
NM_017629chr121670 1255 2499 318 21877 1721 --
NM_017633chr623029 2387 2555 347 23322 323 --
NM_017634chr841882 1828 1561 306 ------
NM_017635chr111529 31062 492 466 1509 --
NM_017637chr9149417 9312 9265 8458 8369 8247 7547 6456 3434 3416 3198 2935 2576 2545 66757 3114 3055 2081 1894 1587 1644 --
NM_017641chr1221145 883 --1442 --
NM_017643chr1753119 2609 2459 577 467 1102 11232 --
NM_017644chr335022 3227 1340 23477 371 ----
NM_017650chr7105178 4767 4520 4303 4296 2061 1374 1173 504 255 32053 1748 303 ----
NM_017658chr1434347 1562 897 24238 239 24295 1384 13371
NM_017660chr1931133 437 264 --1275 13347
NM_017664chr132920 165 ------
NM_017666chrX72183 2152 1775 1729 1709 568 331 ------
NM_017672chr153965 119 30 ------
NM_017693chr1321562 1486 ------
NM_017694chr222018 255 ------
NM_017704chr112743 209 ------
NM_017709chr133953 3912 3155 ------
NM_017714chr201662 --1254 --
NM_017719chr311704 --1582 --
NM_017724chr3164 2840 106 ----
NM_017737chr131981 1959 1502 1557 11851 --
NM_017739chr11530 ------
NM_017742chr182397 91 ------
NM_017745chrX1252 ------
NM_017746chr9--185 ----
NM_017752chrX41774 1631 842 832 11787 ----
NM_017754chr634095 1111 347 34588 4444 3827 ----
NM_017757chr182851 832 ------
NM_017762chr1531942 625 271 22336 1579 1566 --
NM_017769chr141889 12265 ----
NM_017772chr621739 1138 11526 ----
NM_017778chr82927 64 11486 --1342
NM_017784chr321182 1083 1362 ----
NM_017786chr84620 560 514 105 ------
NM_017787chr104809 712 381 123 12778 --11904
NM_017789chr21316 --1295 --
NM_017798chr203951 139 117 3473 395 222 ----
NM_017799chr1431696 1421 550 --1615 --
NM_017811chr943099 3027 2556 2486 22152 491 22334 158 --
NM_017813chr865751 5719 5650 1501 996 689 65818 5193 3959 1393 1045 989 ----
NM_017822chr121776 ------
NM_017824chr1032672 2352 202 ------
NM_017826chr131747 ------
NM_017831chr1821481 294 24154 2950 23428 124 --
NM_017836chr32589 25 ------
NM_017845chr41251 1542 ----
NM_017848chrX54041 3342 2969 1655 729 ------
NM_017849chr222229 2219 --1425 12074
NM_017866chr83980 449 144 ------
NM_017880chr2127 1316 ----
NM_017902chr1045723 4672 2075 857 11635 --13516
NM_017907chr112447 403 ----1502
NM_017919chr984803 4586 4119 1398 1120 825 398 54 15797 24040 162 --
NM_017922chr144541 504 438 424 ------
NM_017925chr92734 370 11779 11527 --
NM_017938chrX31992 1965 1509 31719 1387 781 1506 --
NM_017944chr1111187 22986 1193 13128 --
NM_017954chr73625 200 92 1501 ----
NM_017955chr144800 793 471 376 ------
NM_017958chr242761 2202 1092 78 ------
NM_017987chr1051388 890 530 500 474 11877 ----
NM_017994chr752743 1005 531 482 206 11116 22561 884 --
NM_018000chr232106 1955 1476 --1103 --
NM_018011chr131645 ------
NM_018014chr2181 --1430 11234
NM_018015chrX31068 886 68 11014 ----
NM_018030chr182945 890 1203 ----
NM_018037chr14302 221 35 24 ------
NM_018046chr541824 1562 629 141 ------
NM_018061chr131618 379 239 11380 ----
NM_018062chr21449 --1153 --
NM_018064chr61236 ------
NM_018078chr42651 77 ------
NM_018084chr223245 2599 1941 1394 --
NM_018086chr211360 1489 1381 --
NM_018094chrX1367 1144 ----
NM_018098chr32953 825 11176 --11077
NM_018103chr11274 ------
NM_018105chr81173 ------
NM_018119chr161262 ------
NM_018121chr1042654 2233 1157 721 22637 348 22939 2487 --
NM_018126chr411476 ------
NM_018131chr10----1815 --
NM_018133chr331805 1727 163 ------
NM_018155chr322596 2550 2975 813 32820 2401 1270 --
NM_018156chr132840 374 322 11863 ----
NM_018164chr121198 ------
NM_018177chr4136 ------
NM_018178chr131278 424 388 ------
NM_018181chr1871925 1871 1729 584 244 198 71 11640 ----
NM_018184chr331983 1832 1798 12126 ----
NM_018191chr1351660 1322 531 141 64 ------
NM_018200chr1552616 1030 836 450 117 ------
NM_018202chr13929 354 278 ------
NM_018208chr11732 ------
NM_018211chr122113 1484 11463 ----
NM_018214chr62278 232 ------
NM_018222chr1131841 1175 581 ------
NM_018227chr442899 2296 2245 577 --13209 --
NM_018230chr12481 86 ------
NM_018243chr4123914 3813 3747 3683 3573 3170 1576 1213 858 406 243 148 23579 976 ----
NM_018246chr822008 167 32043 1891 242 ----
NM_018257chr2062285 2220 2198 2184 1850 832 ----1983
NM_018270chr203760 741 596 ------
NM_018293chr352497 2264 890 513 433 1668 --180
NM_018299chr842778 1276 1214 977 ----12749
NM_018300chr191601 ------
NM_018312chr1122002 818 11798 1715 --
NM_018313chr352689 620 501 328 177 --1461 12400
NM_018315chr421448 23 1560 21348 989 --
NM_018318chr12186 ------
NM_018323chr431275 1266 161 ------
NM_018348chr16146 21261 1016 ----
NM_018351chr1254689 4678 4306 1022 171 11795 ----
NM_018361chr894019 3049 2679 2504 1473 1179 940 775 448 11232 12892 --
NM_018362chr1193669 3528 3003 2975 2703 2664 1447 1182 406 1265 --13822
NM_018364chr174143 3933 3898 3612 2993 817 366 13371 ----
NM_018367chr1142436 1702 307 202 1345 ----
NM_018368chr61240 186 ----
NM_018374chr753772 1858 1786 1278 1233 1557 24277 3705 --
NM_018375chr1421610 1203 31935 1674 1466 --138
NM_018383chr221425 620 ----1349
NM_018388chrX1518 1985 ----
NM_018394chr311592 ------
NM_018398chr3------1228
NM_018403chr344103 4041 3136 801 --13476 --
NM_018407chr831098 173 104 181 11117 --
NM_018413chr12--156 ----
NM_018416chr1211914 1313 21004 986 --
NM_018427chr1631625 512 263 1377 ----
NM_018429chr541986 763 686 451 22142 1881 21123 918 --
NM_018433chr2--1554 ----
NM_018440chr877993 7801 7555 7015 6776 2157 508 35811 5799 3167 26546 5550 --
NM_018442chr11365 ------
NM_018448chr1221039 138 1821 ----
NM_018464chr101148 ------
NM_018469chr1721067 303 --1971 --
NM_018486chrX2373 79 ------
NM_018557chr251684 1580 1218 1062 159 11528 ----
NM_018566chr194979 4765 4077 3782 3493 3244 1695 1312 1147 65067 4988 4635 4417 2063 851 11075 --
NM_018569chr431498 1105 256 ------
NM_018571chr23567 466 163 ------
NM_018590chr101242 11215 ----
NM_018602chr1521432 1085 21701 312 ----
NM_018638chr1274867 3833 1928 1846 1756 1650 1250 15307 15562 --
NM_018640chr1262752 2185 808 363 237 58 ------
NM_018650chr162180 2044 1760 1604 568 116 --1841 --
NM_018657chr31161 ------
NM_018660chr832884 2205 382 --32990 1041 524 --
NM_018662chr154321 3664 2713 364 210 34232 3313 2869 ----
NM_018667chr1642543 713 361 278 ------
NM_018682chr71148 ------
NM_018685chr74868 836 718 111 1224 ----
NM_018686chr122262 114 --154 --
NM_018689chr1552620 2504 1080 1018 924 ------
NM_018695chr522446 2016 2746 483 ----
NM_018696chr1831030 410 395 1231 ----
NM_018697chr731661 245 227 --11474 --
NM_018698chrX31991 1469 1432 ------
NM_018703chr161352 ------
NM_018710chr82444 184 ------
NM_018712chr1131495 1189 1162 ------
NM_018715chr111674 11657 ----
NM_018718chr722135 1421 42262 1835 1723 933 ----
NM_018841chr163955 3577 2631 2524 1062 452 ------
NM_018890chr741293 1047 193 55 11468 ----
NM_018896chr171272 ------
NM_018898chr552165 1891 888 397 170 ------
NM_018899chr552165 1891 888 397 170 ------
NM_018900chr552165 1891 888 397 170 ------
NM_018901chr552165 1891 888 397 170 ------
NM_018902chr552165 1891 888 397 170 ------
NM_018903chr552165 1891 888 397 170 ------
NM_018904chr552165 1891 888 397 170 ------
NM_018905chr552165 1891 888 397 170 ------
NM_018906chr552165 1891 888 397 170 ------
NM_018907chr552165 1891 888 397 170 ------
NM_018908chr552165 1891 888 397 170 ------
NM_018909chr552165 1891 888 397 170 ------
NM_018910chr552165 1891 888 397 170 ------
NM_018911chr552165 1891 888 397 170 ------
NM_018934chr51246 ------
NM_018939chr52633 555 ------
NM_018945chr643659 3437 1390 951 2619 187 --1375
NM_018947chr774583 3818 3119 3060 1769 1075 436 33768 1950 778 ----
NM_018951chr73949 942 159 1834 2296 187 --
NM_018953chr121741 1841 ----
NM_018970chr743188 2839 1961 206 ------
NM_018976chr1242886 1774 1134 817 --1590 --
NM_018979chr1222602 500 2659 225 ----
NM_018999chr1094888 4616 4472 3643 3369 1911 1560 1460 1053 --1948 --
NM_019001chr374421 4389 1780 989 863 601 206 23722 3653 ----
NM_019003chrX1142 1122 ----
NM_019004chr731558 494 222 11509 ----
NM_019006chr152663 570 1535 ----
NM_019018chr52638 232 ------
NM_019022chr1832879 2466 2150 22418 117 32265 2087 192 --
NM_019028chr112425 370 1359 ----
NM_019036chr63989 921 255 1459 ----
NM_019041chr652465 2387 2117 994 510 ----11002
NM_019042chr721004 70 21083 317 145 --
NM_019045chrX2694 234 1626 ----
NM_019050chr481977 1926 1825 1727 1709 732 717 386 2506 354 ----
NM_019054chr103193 87 55 --1276 --
NM_019058chr101841 ------
NM_019072chr523561 3171 23480 1366 --11697
NM_019080chr1331573 1176 155 1525 1982 --
NM_019087chr531735 1637 1382 ------
NM_019088chr194308 115 93 74 ------
NM_019091chr23868 767 181 --11031 --
NM_019094chr1243813 588 575 300 61270 1047 559 542 332 108 ----
NM_019106chr2253189 3134 1283 1179 738 --1317 --
NM_019114chr92779 392 --11641 --
NM_019116chr1623381 2748 13231 11334 --
NM_019555chr321167 147 ----11738
NM_019590chr1011054 2524 489 ----
NM_019593chr2062831 2809 2493 2304 952 882 ------
NM_019595chr21245 ------
NM_019596chr2162795 2502 1995 1087 998 862 ------
NM_019597chrX2682 557 ------
NM_019610chr131948 1522 572 ------
NM_019845chr21557 2637 50 2612 562 --
NM_019857chrX51734 1643 548 353 297 ------
NM_019859chr1031514 533 67 ------
NM_019860chr1031562 581 115 ------
NM_019891chr1--1942 ----
NM_019895chr31424 ------
NM_019903chr1021512 749 11802 --1588
NM_020066chr12804 767 ------
NM_020122chr295744 5229 4373 4240 1172 997 947 770 77 21012 45 1959 --
NM_020132chr2123290 756 14477 14596 --
NM_020145chr9177 --1616 --
NM_020147chr15--2357 71 1149 --
NM_020148chr1842499 575 209 129 ----32918 2048 800
NM_020150chr1031928 786 251 ------
NM_020152chr213713 672 606 1625 ----
NM_020154chr151192 ------
NM_020156chr71510 ------
NM_020159chr42424 281 1151 ----
NM_020164chr82403 52 ------
NM_020177chr563232 947 711 623 339 202 43273 2506 2083 1235 2424 277 --
NM_020178chr1721113 947 1970 ----
NM_020184chr21940 22303 2283 12017 --
NM_020189chr8----1197 --
NM_020193chr1131047 296 93 ------
NM_020199chr54907 118 40 22 ----175
NM_020200chr10----180 --
NM_020204chr11208 ------
NM_020205chr183040 2954 2948 2693 2348 1106 604 108 1477 12731 --
NM_020214chr151237 ------
NM_020226chr41513 ------
NM_020227chr53304 282 273 ------
NM_020228chr1142589 775 258 128 2205 159 ----
NM_020235chr31251 ------
NM_020245chr674995 4929 4835 3969 2010 1343 616 --15017 1796
NM_020311chr21649 ------
NM_020336chr2093821 3797 3626 3604 2674 2450 933 729 555 42955 2406 1491 1096 --11541
NM_020337chr453055 3025 2827 962 85 1776 ----
NM_020338chr1043732 1408 1092 902 ------
NM_020340chr641494 810 292 186 --11653 --
NM_020341chr2021675 1360 --12068 --
NM_020342chr222258 658 12089 ----
NM_020346chr1171639 1586 1504 1368 1266 1063 35 ------
NM_020347chr322329 360 21661 85 --11922
NM_020354chr104822 756 247 113 ------
NM_020357chr331553 1538 1170 21677 203 ----
NM_020362chr11122 ------
NM_020374chr1221543 1370 31574 1330 415 11244 --
NM_020379chr14352 342 311 284 1377 ----
NM_020382chr1221559 269 11609 --11046
NM_020390chr364895 4602 1590 800 788 287 14243 ----
NM_020403chr1331701 1694 1277 21766 398 --11569
NM_020416chr421836 726 12035 1683 --
NM_020420chrY21737 1573 11161 11215 --
NM_020425chr61155 31498 1363 384 ----
NM_020432chr751715 1601 1504 684 86 12290 ----
NM_020437chr221377 ------
NM_020440chr163280 2939 1340 1292 1254 626 12996 ----
NM_020443chr176483 5929 5735 5221 4248 1476 864 15769 11975 16152
NM_020445chr71753 1602 --1613
NM_020452chr121327 507 --11977 --
NM_020455chr642568 2150 1727 939 12819 ----
NM_020456chr1352278 2061 909 567 411 1356 --12355
NM_020457chr162660 223 ----1601
NM_020463chr2----21147 209 --
NM_020465chr1621556 1243 ------
NM_020466chr653961 3283 3200 3187 3063 ------
NM_020473chrX51858 1736 1654 1411 812 ------
NM_020474chr181766 11611 1341 --
NM_020482chr63823 566 35 ------
NM_020532chr22819 376 1774 ----
NM_020546chr542895 2098 731 621 32820 1263 1016 1714 --
NM_020630chr101728 ------
NM_020640chr3------12090
NM_020644chr112375 70 2853 697 ----
NM_020647chr821782 653 11637 1627 --
NM_020651chr231213 656 365 ------
NM_020654chr321537 404 ------
NM_020655chr1621383 208 --1161 11218
NM_020661chr1251984 1743 1588 1568 607 ------
NM_020666chr51599 --1583 --
NM_020673chr2077651 5850 5699 5437 2558 2275 1813 17671 1630 27472 5241
NM_020692chr1441041 972 722 67 ------
NM_020697chr831141 907 459 1266 ----
NM_020699chr194903 4698 3641 3470 2145 1641 1458 1357 1151 --11040 --
NM_020713chr2062694 2319 2217 2102 1171 729 1647 ----
NM_020715chr1422159 2088 ----12272
NM_020717chrX34957 1694 106 23087 1681 11826 --
NM_020718chr1676126 5726 5566 5372 4410 2235 1692 21443 1435 ----
NM_020727chr2154060 3164 1457 1266 446 13867 14008 --
NM_020732chr631069 189 111 ------
NM_020734chr1263327 2341 1322 1131 634 502 2405 358 ----
NM_020737chr6174 ------
NM_020739chr15104258 3765 3636 2723 2715 2685 1268 1060 759 246 32876 1672 920 ----
NM_020742chrX32683 477 120 1586 ----
NM_020744chr2162 ------
NM_020747chr5--1341 ----
NM_020748chr1731641 641 206 12102 133 11375
NM_020749chr832070 1319 185 --11722 11822
NM_020752chr1032702 1988 803 22496 92 11155 --
NM_020754chr3--1166 ----
NM_020760chr211985 ----11625
NM_020761chr1721733 162 ------
NM_020766chrX51763 1481 1388 538 341 1571 13530 --
NM_020771chr621094 182 31506 1179 491 --11141
NM_020772chr17158396 8390 7659 7554 7253 7239 7139 7095 6830 6398 6101 6070 2377 2319 2210 58478 8459 7844 7527 5476 15554 --
NM_020774chr1895377 4944 4648 4014 3885 3817 2248 1600 555 ----15068
NM_020778chr1554139 3310 867 759 428 1298 ----
NM_020779chr232734 2343 1059 13190 ----
NM_020783chr1872446 2418 2404 1484 914 539 467 --12236 --
NM_020791chr1731273 1016 198 ------
NM_020796chr5102820 2617 2332 2178 2137 2016 1107 441 406 194 ------
NM_020801chr552527 906 648 432 112 1403 12499 --
NM_020803chr441907 1881 360 348 2926 919 ----
NM_020804chr632446 1634 925 ------
NM_020805chr1821761 752 ------
NM_020808chr131125 1074 108 ------
NM_020809chr1162151 2031 1611 1448 672 665 1192 ----
NM_020815chr41361 ------
NM_020825chr1663096 2867 2784 2343 1215 1018 13077 ----
NM_020832chr11683 ------
NM_020839chr32522 293 ----1463
NM_020841chr1244005 1398 1202 791 32810 2707 1273 12948 --
NM_020850chr1663194 3188 2508 1279 611 352 --12730 --
NM_020856chr1921183 1167 11599 134 --
NM_020858chr1522142 1486 ----1484
NM_020859chr453100 3076 1065 512 111 12650 12726 --
NM_020860chr41922 ------
NM_020866chr1331008 764 710 ------
NM_020868chr232005 1831 300 ----11255
NM_020870chr441382 518 319 178 ------
NM_020872chr31662 2715 595 ----
NM_020873chr33751 109 51 1103 1562 --
NM_020888chr111858 ------
NM_020890chr3----1480 --
NM_020909chr2104153 3959 3784 3663 3136 2884 2871 2651 1620 1387 ------
NM_020921chr1453484 3402 3098 3041 991 --12636 --
NM_020927chr162823 417 11739 1116 --
NM_020932chrX1492 ------
NM_020935chr2124432 3923 3824 3723 3408 2989 1857 1834 1135 674 576 243 1851 ----
NM_020940chr1042931 2504 2439 746 ----21169 767
NM_020947chr1652338 2220 2203 1945 1667 ------
NM_020948chr1103716 3660 2968 2772 2604 2401 1006 854 582 375 63606 3143 3126 2984 1019 823 ----
NM_020960chr944859 4767 1985 578 ------
NM_020961chr41107 1410 ----
NM_020975chr1031754 745 142 ------
NM_020977chr442058 1449 445 309 --11454 --
NM_020981chr22720 119 1765 ----
NM_020983chr1231780 1764 1653 ------
NM_020987chr101487 ------
NM_020988chr1641132 934 825 50 --11366 --
NM_020993chr1252832 1832 1033 605 72 ------
NM_021005chr1531039 899 59 --164 1114
NM_021007chr241934 1800 479 65 ------
NM_021033chr13113115 2997 2920 2481 1212 1048 916 533 386 201 34 1700 ----
NM_021035chr2031315 79 27 ------
NM_021038chr353362 3305 2627 2158 1032 1746 11100 12654
NM_021069chr452094 1883 674 625 434 --31533 540 483 --
NM_021072chr542609 2603 664 595 ------
NM_021079chr1733254 2332 857 ------
NM_021090chr2245036 3591 1333 476 21985 1120 ----
NM_021096chr2223057 370 --12990 --
NM_021097chr222795 1035 22555 88 12800 --
NM_021110chr8180 ------
NM_021111chr92972 77 ------
NM_021116chr749063 8975 6771 851 47608 7372 7050 678 12397 --
NM_021120chrX32816 803 182 11078 ----
NM_021127chr1831231 428 319 ------
NM_021132chr101971 ----11318
NM_021145chr721181 898 21091 795 --1823
NM_021148chr752118 1995 829 328 313 11631 ----
NM_021159chr411628 1193 --11130
NM_021183chrX52562 1876 992 898 611 ------
NM_021190chr13870 257 230 ------
NM_021191chr1232020 1805 1765 12168 ----
NM_021194chr1133 ----180
NM_021202chr2022472 566 22636 2516 ----
NM_021205chr162676 2594 1057 945 792 173 1555 ----
NM_021215chr2052341 1895 1735 707 31 --11622 1526
NM_021219chr21176 ------
NM_021237chr3----1217 --
NM_021238chr1241981 1568 1359 105 1677 ----
NM_021239chr1441128 572 533 75 144 ----
NM_021240chr9--1675 ----
NM_021249chr1421481 1290 --31617 1041 586 --
NM_021252chr1061616 1346 1283 338 190 97 1327 1838 --
NM_021253chr631369 1123 1116 11145 ----
NM_021255chr1494141 4013 3847 3792 1498 1479 1066 859 730 155 ----
NM_021622chr1022266 1521 21571 871 ----
NM_021627chr351111 369 340 326 196 ------
NM_021629chr364720 4511 1158 1017 825 325 44179 3482 2029 577 14876 --
NM_021637chrX11202 11073 ----
NM_021639chr12205 158 ------
NM_021643chr251898 1873 1688 639 554 11706 ----
NM_021647chr4114767 4549 3450 3339 2930 1862 1406 735 691 522 448 1612 ----
NM_021648chr642718 2478 2384 776 ------
NM_021705chr61193 ------
NM_021722chr7--1134 ----
NM_021723chr7--1175 ----
NM_021738chr10----1734 --
NM_021785chrX1360 ------
NM_021809chr2072478 2168 1997 1733 1639 526 517 22486 490 ----
NM_021813chr685825 4817 2245 939 796 778 767 571 35257 2137 854 13698 --
NM_021815chr242477 822 795 527 1238 12357 1379
NM_021911chr5115115 4942 4621 4516 4480 4313 1957 1659 1183 1086 596 34244 1741 696 ----
NM_021912chr1554119 3082 2567 759 575 13970 33978 3547 2663 --
NM_021914chr14--12140 ----
NM_021935chr341068 971 936 242 ------
NM_021940chr631514 311 214 ------
NM_021951chr92686 67 ------
NM_021954chr1322448 906 1499 11204 1379
NM_021956chr6----11512 --
NM_021961chr1166827 6188 5245 2683 2618 2100 35794 1459 366 --11280
NM_021964chr355878 5566 4161 1904 1866 25822 4551 ----
NM_021965chr951188 1176 179 120 82 ------
NM_021977chr673573 3561 3087 2494 1533 1418 1344 13534 ----
NM_021979chr144294 177 62 33 ------
NM_021980chr1031315 1106 100 11341 ----
NM_021984chrX1159 11529 1153 --
NM_021987chrX1159 11529 1153 --
NM_021988chr2021090 176 ------
NM_021990chrX1159 11529 1153 --
NM_021998chrX--1369 ----
NM_022037chr241000 765 352 207 ------
NM_022041chr1632595 2061 496 12396 ----
NM_022044chr22179 ------
NM_022048chr1566154 5703 4740 4611 1902 408 14332 16231 --
NM_022058chr231594 720 408 --1843 --
NM_022068chr181105 ------
NM_022072chr32253 225 ------
NM_022073chr141640 21141 200 ----
NM_022130chr521202 546 ------
NM_022133chr82524 296 11689 1746 11553
NM_022138chr63508 472 424 --1498 --
NM_022143chr711017 ------
NM_022169chr112411 233 ------
NM_022170chr73365 208 185 ------
NM_022171chr331452 571 306 --1201 --
NM_022173chr241000 765 352 207 ------
NM_022307chr71638 ------
NM_022336chr222377 377 --21763 749 --
NM_022361chr6--1429 ----
NM_022374chr21346 ------
NM_022442chr2021090 176 ------
NM_022444chr741765 1411 463 238 11549 ----
NM_022456chr1257313 6146 1726 1027 859 14836 36378 6180 173 --
NM_022459chr13105823 5367 5277 5099 4930 4503 2450 2440 2146 670 1360 12393 --
NM_022465chr1241870 277 204 90 ------
NM_022474chr1452596 640 472 269 173 ------
NM_022475chr42721 173 1533 ----
NM_022477chr202499 344 --11664 --
NM_022482chr2042525 2452 1896 1746 1905 1720 1679
NM_022484chr731077 530 129 --21244 265 --
NM_022491chr1243503 3104 475 291 22218 182 12577 --
NM_022496chr12188 ------
NM_022497chr332791 1472 692 ------
NM_022572chr2--11625 11679 --
NM_022650chr52349 78 ------
NM_022652chr122830 176 --1231 --
NM_022658chr1231276 1065 94 11270 ----
NM_022659chr8----1524 --
NM_022716chr163166 2334 2207 1017 806 267 ------
NM_022719chr2253731 3482 3225 3184 1546 --1213 --
NM_022726chr621516 491 11301 ----
NM_022728chr72716 200 ------
NM_022730chr221077 318 1334 ----
NM_022733chr111136 ------
NM_022735chr121710 127 11546 ----
NM_022737chr1911312 ----2827 291
NM_022739chr1721078 902 1210 ----
NM_022745chr172845 2217 2066 1025 872 748 640 --11936 1359
NM_022749chr831110 1073 477 ------
NM_022753chr162152 1855 987 772 89 74 22833 2233 ----
NM_022755chr932094 681 104 --1903 --
NM_022758chr653174 2803 2000 908 354 11145 ----
NM_022763chr342783 2667 970 790 32676 2131 530 21119 795 --
NM_022777chr731430 1409 296 1543 ----
NM_022778chr131475 1262 1035 11181 1193 --
NM_022780chr261705 1539 732 714 502 394 31760 359 132 ----
NM_022781chr963225 3106 3058 3019 2730 718 --23024 618 --
NM_022784chr15----1238 --
NM_022802chr101660 21552 444 1489 --
NM_022817chr252216 675 648 623 421 --12294 --
NM_022826chr231184 481 355 --11170 --
NM_022828chr531714 1448 209 11110 ----
NM_022831chr131523 1513 393 --11277 --
NM_022841chr15157 --22211 119 --
NM_022843chr1331460 1064 258 ------
NM_022845chr1622238 525 12214 1467 --
NM_022893chr263176 2645 2625 1108 998 962 --12917 --
NM_022894chr231741 708 382 ------
NM_022898chr1494814 4563 4478 4133 3442 3434 2927 1397 540 ------
NM_022900chr721009 110 --11117 --
NM_022910chr1621556 1243 ------
NM_022912chr262789 2744 2559 2221 2113 247 --11892 --
NM_022918chr1131854 1830 829 ------
NM_022977chrX52656 2638 2254 1061 1036 --11004 --
NM_023000chr1431399 1271 256 21180 222 133 11198
NM_023001chr1431399 1271 256 21180 222 133 11198
NM_023010chrX--1650 1603 --
NM_023012chr12--1717 ----
NM_023016chr252894 2771 859 316 38 12347 --12736
NM_023039chr5------1360
NM_023067chr321329 184 --1518 1834
NM_023074chr1921253 1087 11111 --153
NM_023079chr1721912 457 ------
NM_023105chr852238 1989 825 373 225 21632 817 1524 --
NM_023106chr852238 1989 825 373 225 21632 817 1524 --
NM_023110chr852238 1989 825 373 225 21632 817 1524 --
NM_023111chr852238 1989 825 373 225 21632 817 1524 --
NM_023927chr551125 922 520 230 221 11220 1493 1952
NM_023929chr842756 2417 543 419 1895 1880 --
NM_023934chrX51867 1772 1437 1386 424 11450 ----
NM_024007chr521214 314 ------
NM_024016chr171628 ------
NM_024017chr1731690 1546 166 ------
NM_024052chr1742825 736 420 56 11064 ----
NM_024077chr9--1561 1758 --
NM_024107chr171587 ------
NM_024292chr19175 ------
NM_024294chr653174 2803 2000 908 354 11145 ----
NM_024295chr831912 1544 724 1483 --1630
NM_024312chr1231662 1605 237 21088 397 ----
NM_024315chr72380 176 ------
NM_024320chr171149 ------
NM_024337chr51341 ------
NM_024408chr193623 3326 3087 2733 2724 1068 854 458 223 22881 1473 --23245 1249
NM_024416chr921308 360 11363 ----
NM_024424chr1121256 1144 1433 ----
NM_024425chr1121256 1144 1433 ----
NM_024426chr1121256 1144 1433 ----
NM_024429chr741012 871 216 63 ------
NM_024496chr146709 659 636 583 229 26 --2778 302 --
NM_024501chr22688 277 ------
NM_024523chr71940 ------
NM_024524chr341069 748 422 140 ------
NM_024529chr131205 1111 949 11191 ----
NM_024539chrX11286 --11168 --
NM_024546chr133981 936 32 ------
NM_024565chr521054 379 11573 1518 --
NM_024569chr14891 840 710 579 12144 1409 --
NM_024573chr63917 767 171 ------
NM_024582chr4--1922 ----
NM_024590chr421940 1932 ----11197
NM_024594chr531758 1622 1315 ----181
NM_024595chr11464 ------
NM_024612chr1731139 1027 277 164 ----
NM_024613chr871778 1674 1648 1422 548 285 109 ------
NM_024617chr9------1675
NM_024624chr231144 646 391 1506 --11199
NM_024625chr72478 108 --123 --
NM_024639chr672087 1180 1111 577 531 149 86 --12924 --
NM_024645chr811500 11581 ----
NM_024646chr143872 1420 297 168 1980 ----
NM_024652chr1541203 1160 814 298 31087 928 775 ----
NM_024659chr21967 ------
NM_024665chr384604 3298 3013 1015 1005 768 462 416 43512 1856 1792 186 --11202
NM_024669chr53378 339 76 ------
NM_024674chr133145 1240 615 3921 865 31 ----
NM_024692chr231849 1231 520 1408 11331 --
NM_024700chr121046 184 ------
NM_024721chr832680 2051 664 12593 ----
NM_024745chr16----181 --
NM_024755chr154768 704 656 296 ------
NM_024770chr295431 4788 4558 4529 4482 4065 1749 486 249 1125 ----
NM_024779chr1241417 442 408 199 21155 102 1345 --
NM_024785chr221188 1173 1563 ----
NM_024811chr111302 --11934 1204
NM_024812chr832178 1613 809 --1255 --
NM_024824chr1431413 272 165 ------
NM_024828chr91433 ------
NM_024834chr1041996 1913 1879 207 ------
NM_024841chr1132461 1998 926 ------
NM_024875chr1051806 1774 439 224 214 --11742 --
NM_024881chr1963608 3597 3461 1022 962 734 23635 2496 ----
NM_024887chr13506 115 27 1550 1146 --
NM_024896chr952380 1749 801 575 80 --22514 2145 12493
NM_024900chr422292 1446 12247 21637 871 1798
NM_024900chr422292 1446 12247 21637 871 1798
NM_024911chr1--1149 1156 1675
NM_024915chr882878 2812 2643 2478 2187 1862 954 751 --12374 22193 1076
NM_024920chr411326 ----1647
NM_024927chr171153 ------
NM_024930chr532792 609 481 42679 808 756 446 12536 --
NM_024941chr521395 288 11202 ----
NM_024942chr1031387 303 212 ----11521
NM_024944chr21--1217 11181 --
NM_024945chr931150 800 151 1389 ----
NM_024947chr3119403 8848 8062 3820 3117 2895 2859 2823 1459 1311 1215 12812 --12552
NM_024948chr102681 163 ------
NM_024949chr474724 4411 3884 3207 847 582 369 13498 1782 24761 4339
NM_024953chr1252652 2348 2048 626 482 ------
NM_024954chr101676 ------
NM_024969chr2--1654 ----
NM_024989chr2158122 7775 7116 6249 5170 2825 2416 2175 2165 1744 1618 1229 1100 904 766 25510 415 15762 --
NM_024991chr1033245 2500 2406 --21006 666 --
NM_024993chr22117 104 ------
NM_024997chr1641014 921 173 47 2876 76 11042 --
NM_025004chr112620 267 ------
NM_025054chr863762 3278 1322 1293 1026 588 --11596 --
NM_025057chr1421196 1114 ----1132
NM_025061chr19----1168 --
NM_025065chr1298 30 ------
NM_025073chr144496 4229 1187 629 --14178 13174
NM_025080chr1111082 ------
NM_025106chr121945 1491 11367 ----
NM_025134chr1632482 941 708 --1946 --
NM_025137chr15--187 ----
NM_025146chr332162 688 424 1659 12510 --
NM_025147chr221015 44 ----1955
NM_025151chr8--1827 12016 --
NM_025160chr123505 315 24307 3185 ----
NM_025164chr112764 296 1181 1189 1735
NM_025180chr343267 2632 2579 181 43413 2943 435 230 22781 1048 --
NM_025181chr21533 1186 ----
NM_025187chr1621403 1186 ------
NM_025191chr131354 1282 538 ------
NM_025205chr43455 290 230 199 ----
NM_025221chr411405 21393 346 ----
NM_025222chr321066 824 ----22889 2746
NM_025235chr1042143 2052 616 79 ------
NM_025244chr2--168 ----
NM_025250chr712560 1811 ----
NM_030567chr51121 ------
NM_030579chr16103708 3672 3498 2458 2298 2265 1245 1064 1026 628 13441 11131 13522
NM_030594chr151553 1186 ----
NM_030621chr1493263 3143 3086 3065 1547 1315 1199 981 346 --11537 --
NM_030622chr1911034 ------
NM_030623chr2163 ------
NM_030625chr102780 686 132 ----
NM_030627chr564090 3606 980 495 456 246 ------
NM_030629chr1631519 325 31 11535 ----
NM_030637chr141193 --1603 --
NM_030647chr7106268 6053 6023 5905 4794 4398 2017 1599 1414 95 35807 5674 656 13997 --
NM_030648chr484087 4069 3691 3417 1363 797 761 472 44623 3977 3817 1212 15453 11571
NM_030650chr2103931 3778 3208 3089 3031 2630 812 378 261 87 23556 861 --12597
NM_030652chr61288 ------
NM_030664chr1032060 669 653 21994 642 2829 142 --
NM_030674chr1254260 2104 1438 487 453 15775 15550 --
NM_030751chr1021435 264 ------
NM_030751chr1021435 264 ------
NM_030755chr1452987 2374 1045 992 927 --1435 --
NM_030758chr2221029 973 ------
NM_030762chr1261981 1558 1370 1253 309 191 21924 774 11392 --
NM_030773chr2031749 1333 188 --11779 1293
NM_030777chr2052500 2078 1937 1861 139 22193 1509 ----
NM_030780chr831160 527 174 1309 ----
NM_030784chr61101 ------
NM_030786chr11206 ------
NM_030797chr2--1256 ----
NM_030799chr552040 1790 1772 812 217 1861 ----
NM_030802chr171789 1339 ----
NM_030806chr1108422 8160 6986 6082 2962 2536 2485 1974 1551 678 --38283 1427 1107 --
NM_030808chr171942 ------
NM_030809chr1221911 1691 --11937 --
NM_030816chr173327 3077 2444 917 721 531 196 13623 ----
NM_030817chr1243345 1490 1458 1399 1810 1433 --
NM_030881chr2252427 2293 1795 1682 147 ------
NM_030884chr352250 1546 1480 1445 771 11893 ----
NM_030885chr332308 2276 99 ------
NM_030911chr1331557 548 169 --11089 --
NM_030915chr252083 2052 792 565 192 12369 ----
NM_030917chr41180 ------
NM_030918chr185050 4190 3674 3397 1444 1090 705 287 14692 1306 --
NM_030920chr11142 31411 700 516 --1376
NM_030925chr1342055 391 50 42 ------
NM_030934chr12390 171 21576 653 ----
NM_030937chr131460 1026 410 ------
NM_030938chr1731147 902 274 ------
NM_030939chr631091 361 233 1447 ----
NM_030940chr921392 1006 11203 ----
NM_030949chr611431 ------
NM_030958chr81446 ------
NM_030963chr62577 544 ------
NM_030978chr91381 ------
NM_031216chr1871994 1968 628 508 394 35 27 ------
NM_031243chr712108 ------
NM_031244chr631135 1039 748 ------
NM_031262chr931054 931 119 ------
NM_031263chr941111 988 755 176 ------
NM_031267chr71171 ------
NM_031268chr1675096 3920 3396 1357 1350 647 223 11197 ----
NM_031271chr831738 493 96 ------
NM_031283chr21148 ------
NM_031284chr15--1896 ----
NM_031291chr41683 ------
NM_031296chr43407 310 114 ----2162 122
NM_031305chr451457 1180 643 522 432 21871 539 ----
NM_031369chr43637 561 194 ------
NM_031370chr43637 561 194 ------
NM_031371chr111620 ------
NM_031371chr111620 ------
NM_031372chr421459 181 21471 189 ----
NM_031411chr552165 1891 888 397 170 ------
NM_031419chr331338 536 80 ------
NM_031426chr932696 937 116 --12721 --
NM_031427chr1465650 3844 2171 2032 342 240 ------
NM_031431chr1321889 748 11427 --21738 396
NM_031435chr1242685 2267 1392 264 23369 226 11358 --
NM_031442chrX83146 2534 2467 1007 875 460 319 136 1762 1113 --
NM_031445chr243109 3056 2790 2167 22456 306 11036 --
NM_031459chr12589 418 11640 ----
NM_031463chr1612338 3624 325 30 11573 1723
NM_031469chr6113631 3539 3022 2887 2829 2764 1043 1031 485 222 118 --12931 --
NM_031476chr1662593 2402 1846 1102 981 54 32699 723 72 1529 --
NM_031477chr161369 ------
NM_031483chr2033385 3375 247 1592 152 --
NM_031492chr113473 128 82 ------
NM_031844chr174146 4091 2803 1659 1529 1038 763 13628 1500 --
NM_031845chr242520 1086 1066 245 11250 11349 --
NM_031847chr242520 1086 1066 245 11250 11349 --
NM_031849chr552165 1891 888 397 170 ------
NM_031850chr32729 314 ------
NM_031850chr32729 314 ------
NM_031857chr552165 1891 888 397 170 ------
NM_031860chr552165 1891 888 397 170 ------
NM_031885chr162326 273 --167 --
NM_031942chr241235 1090 979 191 ------
NM_031946chr71436 ------
NM_031954chr12102587 2287 2207 2189 2172 1165 1081 991 960 323 2688 538 ----
NM_031989chr121105 ----1266
NM_031992chr73365 208 185 ------
NM_032013chr202499 344 --11664 --
NM_032042chr532394 1781 910 1701 ----
NM_032047chr362382 2317 2009 1970 1842 853 ------
NM_032049chr32729 314 ------
NM_032049chr32729 314 ------
NM_032102chr1123031 921 1138 ----
NM_032109chr521114 551 --11119 --
NM_032116chr1395865 5332 4661 4207 2142 1844 1169 756 672 35840 5590 641 15746 1185
NM_032121chrX42560 2217 1961 1885 12524 12822 --
NM_032139chr192995 294 --1949 --
NM_032144chr231449 1260 1176 ------
NM_032145chr671810 1649 1490 1322 1229 468 299 1772 ----
NM_032147chr121691 --1711 --
NM_032153chr352564 2414 1804 688 484 ------
NM_032154chr103930 285 98 ------
NM_032160chr1863131 2955 311 229 132 76 ------
NM_032169chr31655 ----1563
NM_032186chr121351 406 ------
NM_032195chr211503 1201 --1161
NM_032199chr1063162 2732 954 736 673 542 13085 23422 571 --
NM_032208chr243333 2959 992 485 ------
NM_032221chr2031963 1812 60 11441 ----
NM_032228chr1153542 3431 3397 2685 2623 33503 3471 89 ----
NM_032229chr13----1841 --
NM_032236chr12761 695 ------
NM_032239chr41940 31172 929 157 ----
NM_032242chr313368 ------
NM_032246chr1511243 1210 ----
NM_032268chr1643019 2577 559 520 23219 2138 1381 --
NM_032271chr1611395 ------
NM_032281chr1942413 2245 2199 2093 --12664 --
NM_032288chr352273 2053 1854 726 344 1363 11836 --
NM_032289chr531613 1211 160 11269 ----
NM_032291chr1--1391 ----
NM_032295chr73288 243 61 ------
NM_032312chr21676 ------
NM_032320chr111236 --2747 495 --
NM_032321chr22472 371 12897 13105 1478
NM_032352chr1451220 421 383 304 209 1367 ----
NM_032373chr101299 35548 1918 554 --14530
NM_032389chr1131116 381 77 ------
NM_032408chr711190 --1507 --
NM_032410chr81914 ------
NM_032412chr51368 ------
NM_032413chr15----1120 --
NM_032421chr71117 ----1280
NM_032427chr112502 410 ------
NM_032429chr101543 ------
NM_032434chr2199 1428 1533 --
NM_032435chr162432 2184 2046 2007 1639 317 ------
NM_032436chr132795 38 11000 ----
NM_032438chr641389 1312 1196 1058 11511 ----
NM_032440chr1021101 730 32430 2171 2027 12109 --
NM_032446chr511234 178 23580 2977 --
NM_032457chr473917 3875 3705 2810 2764 2546 121 ------
NM_032458chrX53392 671 544 483 423 1962 ----
NM_032466chr811539 11103 ----
NM_032467chr82403 52 ------
NM_032482chr191178 ------
NM_032491chr1231083 405 308 ------
NM_032505chr31938 42754 2483 2258 1753 ----
NM_032523chr22198 117 ------
NM_032524chr172451 414 ------
NM_032536chr92623 264 --1712 --
NM_032539chrX2158 82 --1685 --
NM_032547chr431424 416 168 ------
NM_032557chr41210 ------
NM_032558chr911167 ------
NM_032564chr112346 55 1120 ----
NM_032569chr1641926 1904 1703 1288 ------
NM_032582chr1751750 1216 1169 588 566 ------
NM_032590chr123977 935 929 ------
NM_032594chr142923 407 ------
NM_032622chr421555 1532 ------
NM_032626chr161285 ------
NM_032632chr1421632 756 11844 11960 --
NM_032682chr373135 3042 2297 1237 758 512 408 1300 --13122
NM_032711chr1744282 3509 3063 1287 1893 ----
NM_032727chr102482 324 11123 ----
NM_032731chr1741473 1437 1385 503 --1162 --
NM_032765chr5----1191 --
NM_032801chr1112071 21587 761 1312 --
NM_032810chr1021282 369 1564 ----
NM_032839chr3164 ------
NM_032846chr1461525 1413 1293 987 119 25 ------
NM_032859chr1323034 621 43836 3575 2886 1562 ----
NM_032866chr1532911 2501 485 --11070 --
NM_032870chr62210 23 ------
NM_032873chr1163914 1142 977 865 855 699 ------
NM_032875chr173793 772 212 ------
NM_032876chr141312 21420 1359 ----
NM_032884chr11339 ------
NM_032900chr1073776 2610 2489 1371 812 462 178 22375 1209 11470 1933
NM_032906chr45899 813 645 638 222 ------
NM_032932chr1776376 6253 6209 5399 5354 4177 2285 11780 16474 --
NM_032968chrX44068 3470 565 487 ------
NM_032969chrX44068 3470 565 487 ------
NM_032973chrY44060 3466 565 487 ------
NM_032978chr1831054 104 49 ------
NM_032979chr1831054 104 49 ------
NM_032981chr1831054 104 49 ------
NM_032982chr772492 2354 2234 2175 676 443 201 --11594 --
NM_032991chr4134 21425 388 1534 --
NM_032998chr13834 388 73 ------
NM_033014chr921308 360 11363 ----
NM_033016chr2221547 51 ------
NM_033018chrX1484 ------
NM_033020chr184679 3750 1602 1551 1019 969 812 212 14123 14041 --
NM_033023chr741210 1187 964 397 ------
NM_033030chr23529 498 178 1512 --11373
NM_033031chrX163 ------
NM_033044chr11192 1834 1975 --
NM_033081chr2021304 354 1513 ----
NM_033083chr353387 3339 2905 2359 499 ------
NM_033089chr201521 21444 1432 21420 441 --
NM_033116chr14--1237 ----
NM_033121chr1231719 1591 324 21530 1223 ----
NM_033127chr11108 ------
NM_033128chr7293 85 1611 ----
NM_033132chr1332149 1492 158 12241 ----
NM_033133chr1753071 2907 2653 1328 1199 ------
NM_033141chr1441953 1840 1579 1545 1386 ----
NM_033143chr463504 3205 1822 1181 755 572 14632 14477 --
NM_033161chr932025 1915 1451 ------
NM_033181chr623702 3098 ----1150
NM_033211chr51242 ------
NM_033222chr931283 430 41 ------
NM_033224chr788084 7173 6677 6389 4981 2901 2271 2210 25530 1429 16211 --
NM_033225chr842024 1150 1018 602 23136 2030 --11036
NM_033227chr5129 1201 ----
NM_033228chr5169 1241 ----
NM_033253chr23916 346 113 ------
NM_033261chr101238 1158 ----
NM_033280chr181119 ------
NM_033281chr5------122
NM_033285chr884002 3898 3888 3438 3150 2777 1466 38 14377 ----
NM_033301chr8125 ------
NM_033305chr931469 1092 306 1511 1976 --
NM_033326chr1162550 2470 2350 2344 898 305 12020 1770 --
NM_033360chr1243765 3717 3565 668 44618 3896 2897 1798 --1625
NM_033364chr332001 1603 286 ------
NM_033375chr172286 42 ----11539
NM_033380chrX4774 448 368 292 1782 ----
NM_033381chrX4774 448 368 292 1782 ----
NM_033389chr1784637 4060 3934 1769 1168 545 321 41 11636 14514 21498 1152
NM_033394chr221530 1461 2307 286 ----
NM_033420chr1911205 ------
NM_033425chr1143540 682 425 104 ------
NM_033427chr72633 544 ------
NM_033430chr452636 1555 1390 318 262 34166 639 110 ----
NM_033437chr452636 1555 1390 318 262 34166 639 110 ----
NM_033480chr622467 1092 12392 ----
NM_033481chr622467 1092 12392 ----
NM_033495chrX21037 939 2888 312 ----
NM_033503chr151934 31096 853 214 ----
NM_033505chr266663 4241 2250 1669 1273 1204 24857 4364 25886 912 --
NM_033512chr883066 2636 2373 2275 2138 1120 756 154 ------
NM_033515chr63985 545 244 --1418 --
NM_033516chr971620 1368 1287 1134 559 372 315 ------
NM_033535chr441077 928 794 22 ------
NM_033549chr511028 ------
NM_033624chr1241427 360 272 28 --1918 --
NM_033631chr153107 2535 2495 1549 439 23047 157 ----
NM_033632chr421448 23 1560 21348 989 --
NM_033637chr1043335 3070 1517 822 31235 381 361 ----
NM_033642chrX2419 329 197 ----
NM_033644chr552445 1778 1710 1574 978 12226 --12318
NM_033645chr552445 1778 1710 1574 978 12226 --12318
NM_033656chr2145625 1283 1093 82 44788 3896 1865 360 --15054
NM_044472chr13770 652 26 1545 ----
NM_052811chr1345016 4751 4632 4477 15254 15057 --
NM_052827chr1231128 1070 311 ------
NM_052832chr852852 2560 2537 1948 676 1350 ----
NM_052840chr1511285 11149 --11043
NM_052845chr1262587 2412 2238 1245 1213 124 ------
NM_052854chr111511 ------
NM_052867chr1311227 ------
NM_052879chr1273964 3030 2545 1516 1092 946 295 22941 2879 13166 --
NM_052900chr81239 ------
NM_052904chr611466 --11217 --
NM_052905chr231636 486 385 11338 11809 --
NM_052907chr1223514 2941 2607 455 ----
NM_052917chr223305 81 23134 1224 33040 261 156 11094
NM_052918chr1043524 3333 1259 475 21170 133 13223 1971
NM_052923chr61222 173 ----
NM_052937chr852450 2238 1020 598 388 ------
NM_052940chr11221 ------
NM_052951chr201213 ------
NM_053001chr81418 --1323 --
NM_053002chr351207 1166 1007 980 37 ------
NM_053016chr941660 1486 539 423 --15494 --
NM_053023chr1173249 3139 2487 2461 2236 1328 1260 12221 ----
NM_053024chr341453 1390 1179 585 --1451 --
NM_053025chr351805 1493 1458 1304 563 ------
NM_053026chr351805 1493 1458 1304 563 ------
NM_053027chr351805 1493 1458 1304 563 ------
NM_053028chr351805 1493 1458 1304 563 ------
NM_053031chr351805 1493 1458 1304 563 ------
NM_053032chr351805 1493 1458 1304 563 ------
NM_053042chr