TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4473
miRNA Sequence: CUAGUGCUCUCCGUUACAAGUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000044chrX177 --1340 --
NM_000052chrX152 143 23162 465 --
NM_000080chr172646 80 ------
NM_000081chr12226 32 --11291 --
NM_000084chrX55888 2020 1756 1514 150 --1556 11067
NM_000089chr73674 603 164 ------
NM_000091chr252484 1917 1846 475 278 12853 ----
NM_000103chr152464 32 ------
NM_000108chr71542 1205 ----
NM_000109chrX12651 ------
NM_000110chr131228 392 377 ------
NM_000114chr2021275 906 ------
NM_000115chr1342066 640 251 230 ------
NM_000125chr674054 3773 3759 3326 1029 884 384 ------
NM_000129chr621407 1016 --1235 11337
NM_000138chr1522120 456 --2391 131 --
NM_000155chr9------1109
NM_000161chr1451836 1607 792 349 51 ------
NM_000163chr531823 766 294 ------
NM_000165chr611190 11386 ----
NM_000170chr9152 ------
NM_000173chr172406 346 ------
NM_000176chr553625 2919 701 429 139 ------
NM_000183chr2170 ------
NM_000188chr10137 --1474 --
NM_000189chr242312 2076 583 562 11944 --1401
NM_000192chr1221543 1203 ------
NM_000194chrX1186 ------
NM_000208chr1944186 3153 1565 866 11513 13654 --
NM_000214chr201720 ------
NM_000217chr1264978 4172 2091 1872 1251 1037 --11114 --
NM_000220chr111699 --161 --
NM_000222chr461831 1656 1336 755 666 634 ------
NM_000232chr432159 1225 546 32697 920 458 1116 --
NM_000248chr333074 2849 2126 --13003 1802
NM_000259chr15106137 5301 4724 1192 1076 677 625 609 314 102 35874 4468 414 --1336
NM_000266chrX1773 1748 1296 --
NM_000276chrX32122 759 733 12013 1375 --
NM_000282chr131261 --181 --
NM_000284chrX2372 339 21473 173 ----
NM_000291chrX275 52 ------
NM_000297chr412051 ----11401
NM_000314chr1032384 2260 276 23158 2968 ----
NM_000321chr1311259 11209 ----
NM_000329chr11832 --1581 1151
NM_000332chr6126936 6755 6667 5550 5466 5107 2449 2130 1389 1178 1120 1004 27195 684 25035 1373 --
NM_000333chr341093 1022 193 70 ------
NM_000338chr1531184 803 66 ------
NM_000340chr331448 1434 78 --1502 11388
NM_000345chr42785 170 ------
NM_000346chr1731768 796 217 ------
NM_000388chr331281 1250 229 ------
NM_000389chr62472 170 21293 1270 ----
NM_000397chrX42367 2334 2320 199 11810 ----
NM_000399chr101769 --1139 --
NM_000401chr1131130 929 68 ------
NM_000408chr253250 3004 2253 825 695 ------
NM_000430chr1733235 2477 907 1296 22940 1452 --
NM_000439chr52654 303 ------
NM_000448chr1132764 2438 2125 22631 2023 ----
NM_000451chrX21733 870 ------
NM_000461chr323522 510 13870 137 --
NM_000462chr1531641 1337 1232 ------
NM_000480chr1141288 1139 233 145 ------
NM_000489chrX42536 2454 903 645 --11032 --
NM_000492chr741500 1243 960 522 ------
NM_000503chr861403 1396 1297 634 322 202 --1584 --
NM_000516chr20------1327
NM_000522chr711077 ------
NM_000527chr1931633 878 90 11978 ----
NM_000530chr131042 840 454 --1868 --
NM_000533chrX11572 ----1605
NM_000555chrX137771 7470 7158 5438 2676 2620 2326 1901 1786 1772 1570 372 243 11207 15908 --
NM_000560chr11691 ------
NM_000565chr122276 672 ------
NM_000596chr71202 ------
NM_000599chr274619 4486 3871 2971 1208 1142 447 11045 ----
NM_000610chr1133021 470 190 --2869 734 --
NM_000612chr1143511 2616 857 495 ----13861
NM_000615chr1132879 2700 63 1430 --12982
NM_000618chr1265324 2629 2199 2123 1727 1586 25918 341 1832 --
NM_000618chr1265324 2629 2199 2123 1727 1586 25918 341 1832 --
NM_000624chr142867 121 1855 ----
NM_000627chr22598 40 ------
NM_000633chr1865182 1933 1725 1717 1429 749 11582 ----
NM_000663chr1632273 344 137 12399 --12899
NM_000684chr1011226 --1392 --
NM_000702chr152221 2094 1861 1812 1703 ------
NM_000719chr1255317 5091 5020 4132 699 11454 14788 16208
NM_000723chr171381 ------
NM_000726chr211284 ------
NM_000767chr1931489 1178 368 ------
NM_000794chr51659 ----1980
NM_000806chr52592 39 --21731 1325 11412
NM_000807chr41191 ------
NM_000808chrX2814 279 --2758 32 --
NM_000810chr151531 --196 --
NM_000813chr585221 4856 4761 4528 3669 3601 1590 330 --24157 1890 --
NM_000814chr1543392 2746 1587 736 ------
NM_000817chr22901 51 ------
NM_000826chr452536 2209 1754 1666 60 --1395 --
NM_000827chr552368 901 653 642 329 ------
NM_000829chr1122188 1486 1334 12001 --
NM_000834chr1211145 ------
NM_000866chr31709 --11707 --
NM_000868chrX12249 --12179 --
NM_000875chr1586497 4937 2216 1996 1602 1377 1106 279 --17053 --
NM_000876chr621071 366 ------
NM_000877chr232961 262 183 ------
NM_000891chr1743184 3029 1378 610 ----1182
NM_000899chr1274010 3906 3196 2975 2819 1132 690 21760 200 ----
NM_000901chr41228 41759 1681 1645 435 1862 --
NM_000908chr5--1708 ----
NM_000919chr52402 103 ------
NM_000921chr121502 --1527 --
NM_000933chr202404 377 11747 ----
NM_000935chr31908 ------
NM_000944chr421808 1502 --11897 1431
NM_000945chr22563 197 ------
NM_000950chrX43333 3071 2586 63 11321 1373 --
NM_000965chr3----11153 --
NM_001001323chr1212170 1880 12693 --
NM_001001344chrX21804 965 1973 12425 --
NM_001001349chr1731215 635 493 ------
NM_001001389chr1133021 470 190 --2869 734 --
NM_001001390chr1133021 470 190 --2869 734 --
NM_001001391chr1133021 470 190 --2869 734 --
NM_001001392chr1133067 516 236 --2915 780 --
NM_001001394chr21566 --1576 --
NM_001001395chr1232490 691 563 --137 12509
NM_001001419chr595046 4080 3686 3406 2003 1665 1330 1190 538 1836 23292 741 --
NM_001001420chr595046 4080 3686 3406 2003 1665 1330 1190 538 1836 23292 741 --
NM_001001433chr2053114 2508 2379 717 316 ------
NM_001001436chr16182 ------
NM_001001483chr111158 --1334 --
NM_001001556chr1531161 378 39 ------
NM_001001557chr811831 ----12001
NM_001001664chr233615 441 304 11246 ----
NM_001001668chr1943483 3169 864 594 ----23754 1350
NM_001001872chr141579 ------
NM_001001890chr2134183 4122 1610 --1851 --
NM_001001924chr831284 263 36 1512 ----
NM_001001925chr831284 263 36 1512 ----
NM_001001928chr2287058 5871 5426 2724 1973 624 420 175 --21815 53 --
NM_001001931chr831284 263 36 1512 ----
NM_001001933chr11111 ------
NM_001001971chr101105 ------
NM_001001974chr1021583 242 ----1334
NM_001001995chrX--11911 --11735
NM_001002033chr172246 111 ------
NM_001002233chr852135 2041 1717 1609 821 ------
NM_001002243chr21135 ------
NM_001002838chrX----1301 --
NM_001002843chr151526 ------
NM_001002860chr1474577 4472 1674 1647 1603 858 260 13465 ----
NM_001002909chr1741931 1394 621 403 1810 11972 --
NM_001003652chr18118340 7737 7680 6789 6254 6089 2557 2025 1130 117 60 28258 5520 12269 18701
NM_001003674chr1876730 4633 4518 4469 1367 867 586 16532 35764 1648 403 --
NM_001003675chr1876730 4633 4518 4469 1367 867 586 16532 35764 1648 403 --
NM_001003681chr2231991 1852 1414 --11507 --
NM_001003688chr431165 1100 351 ----1385
NM_001003694chr32419 258 2526 91 ----
NM_001003698chr6----2687 341 --
NM_001003699chr6----2687 341 --
NM_001003712chr1273212 3166 2662 2525 861 748 521 11033 13830 --
NM_001003760chr663598 3020 2849 1267 1158 282 ----13328
NM_001003792chr31862 --1936 11028
NM_001003793chr31862 --1936 11028
NM_001003800chr953506 3487 3360 2465 1169 --1420 --
NM_001003891chr221873 ------
NM_001003927chr171232 ------
NM_001003940chr1553733 3693 3626 3257 1268 1912 11542 --
NM_001003942chr1553733 3693 3626 3257 1268 1912 11542 --
NM_001003943chr1553737 3697 3630 3261 1272 1916 11546 --
NM_001004023chr1--1209 ----
NM_001004065chr953759 2763 2416 1361 74 1474 ----
NM_001004304chr121221 12377 12730 --
NM_001004317chr644189 4008 2881 1170 23789 544 54419 3104 3074 1539 401 --
NM_001004342chr155410 1510 1063 292 21 15679 ----
NM_001004360chr21149 1257 ----
NM_001004419chr1243079 927 532 26 --12811 --
NM_001005242chr1231572 1250 330 11640 ----
NM_001005386chr252408 2037 1956 1719 665 ----1930
NM_001005404chr1723579 3207 ------
NM_001005463chr1012509 22414 2098 21982 779 --
NM_001005473chr545694 4214 4199 1868 --16103 --
NM_001005474chr321483 408 ------
NM_001005505chr31293 11349 ----
NM_001005526chr2--1121 ----
NM_001005609chrX43379 1295 1109 457 31362 1249 321 ----
NM_001005732chr213607 247 206 ------
NM_001005733chr212564 206 ------
NM_001005743chr143183 146 95 ------
NM_001005744chr143183 146 95 ------
NM_001005745chr143183 146 95 ------
NM_001005746chr211284 ------
NM_001005747chr211284 ------
NM_001005845chr811289 1656 --11543
NM_001005909chr3122 ------
NM_001005910chr3--1608 ----
NM_001005911chr3--1608 ----
NM_001005914chr31427 1406 ----
NM_001006600chr522286 1715 --11860 --
NM_001006605chr11352 ----165
NM_001006605chr11352 ----165
NM_001006612chrX159 ------
NM_001006613chrX159 ------
NM_001006614chrX159 ------
NM_001006617chr921161 175 ------
NM_001006618chr92219 73 ------
NM_001006619chr921161 175 ------
NM_001006620chr921161 175 ------
NM_001006621chr921161 175 ------
NM_001006681chrX------1129
NM_001006682chrX------1129
NM_001006683chrX------1129
NM_001006684chrX154 ------
NM_001007075chr421102 266 1718 ----
NM_001007097chr963856 3195 1746 1394 958 157 11599 --1507
NM_001007099chr11220 ------
NM_001007100chr11220 ------
NM_001007102chr62630 30 ------
NM_001007226chr171577 ----1156
NM_001007227chr171577 ----1156
NM_001007228chr171577 ----1156
NM_001007229chr171577 ----1156
NM_001007230chr171577 ----1156
NM_001007237chr112218 12855 --1637
NM_001007246chr2121818 64 21637 181 ----
NM_001007257chr131421 1097 242 --171 11357
NM_001007277chr111381 ------
NM_001007466chr674895 4727 4443 4087 1088 576 464 15081 --13897
NM_001007471chr91177 ------
NM_001007565chr31111 1354 165 --
NM_001008222chrX31190 521 250 --11095 --
NM_001008225chr72687 551 ----1270
NM_001008239chr1873310 1495 1179 1162 886 422 29 ------
NM_001008388chr41114 ------
NM_001008392chr333080 2924 2852 12243 13494 --
NM_001008405chr721808 1497 --1698 --
NM_001008407chr731210 649 486 ------
NM_001008495chr822193 1955 ------
NM_001008541chr1042205 2131 1705 888 --1686 --
NM_001008541chr1042205 2131 1705 888 --1686 --
NM_001008660chr1131262 1156 432 ------
NM_001008707chr1431596 1253 56 ------
NM_001008738chr542138 2065 246 141 ------
NM_001008895chr1321077 448 ------
NM_001008897chr61170 ------
NM_001008925chr442377 296 275 198 ----23315 2152
NM_001009552chr81171 1129 ----
NM_001009555chr42542 79 --11571 --
NM_001009881chr11621 ------
NM_001009882chr11621 ------
NM_001009909chr1153131 2713 1414 374 313 13383 --13730
NM_001009958chr71606 ------
NM_001009993chr294355 3417 3007 2924 1793 1720 1691 1331 414 23335 577 ----
NM_001010861chr12989 213 --1795 --
NM_001010888chrX84165 3920 3331 3243 2857 471 294 130 34675 2831 1446 12997 --
NM_001010942chr1241270 969 517 69 11082 ----
NM_001010971chr121013 895 ------
NM_001010983chr3128 ------
NM_001010984chr142236 1699 972 484 ------
NM_001010986chrX22075 134 ------
NM_001010989chr161416 ------
NM_001010990chr161416 ------
NM_001011513chr463393 3020 2988 2921 1172 558 --23747 3699 --
NM_001011546chr201334 --1565 --
NM_001011645chrX177 --1340 --
NM_001011663chr101943 ------
NM_001011666chr7106602 6412 6321 5576 4482 2599 1279 1251 1058 689 12500 16226 --
NM_001011708chr232490 995 381 ------
NM_001011724chr131234 ------
NM_001011725chr131234 ------
NM_001012393chr1164754 4546 4220 3962 1649 1621 --23443 1297 --
NM_001012398chr1641073 420 226 183 11082 1332 --
NM_001012420chr1562904 969 889 720 525 492 ------
NM_001012423chr1562904 969 889 720 525 492 ------
NM_001012751chr1021344 656 ------
NM_001012761chr51269 ------
NM_001012968chrX32755 822 605 --12533 --
NM_001012977chrX2929 310 ------
NM_001013031chr1033488 3117 2711 ----1367
NM_001013415chr41430 ------
NM_001013439chr3----1347 --
NM_001013843chr152763 375 ------
NM_001014435chr161421 ------
NM_001014797chr1088059 7721 7225 6736 6152 5889 1759 373 --17521 --
NM_001014809chr45992 660 603 275 162 ------
NM_001015045chr432398 968 884 11006 ----
NM_001015053chr1721443 320 ----1584
NM_001015508chr82550 90 ------
NM_001015877chrX72979 2907 2745 2541 2217 2004 332 12085 ----
NM_001017371chr2----1560 --
NM_001017395chr333647 2351 1376 1333 ----
NM_001017396chr261844 784 578 485 413 146 1425 1355 --
NM_001017405chr42818 242 ------
NM_001017415chr11210 ------
NM_001017416chr11210 ------
NM_001017424chr141779 708 173 78 ------
NM_001017425chr141779 708 173 78 ------
NM_001017923chr141464 ------
NM_001017926chr811543 21498 529 ----
NM_001017930chrX--1960 ----
NM_001017969chr9--1520 ----
NM_001017977chr1122 ------
NM_001018054chr12245 49 11160 ----
NM_001018056chr91390 ------
NM_001018064chr92334 203 --11664 --
NM_001018065chr955753 5732 5659 4741 1370 34688 4316 1868 21537 214 --
NM_001018066chr955753 5732 5659 4741 1370 34688 4316 1868 21537 214 --
NM_001018067chr132032 1699 634 25174 4699 24207 1142 --
NM_001018068chr132032 1699 634 25174 4699 24207 1142 --
NM_001018069chr132032 1699 634 25174 4699 24207 1142 --
NM_001018074chr553625 2919 701 429 139 ------
NM_001018075chr553625 2919 701 429 139 ------
NM_001018076chr553625 2919 701 429 139 ------
NM_001018077chr553625 2919 701 429 139 ------
NM_001018108chr1542299 1911 1869 444 ------
NM_001020658chr11203 ------
NM_001020658chr11203 ------
NM_001020825chr521100 394 ------
NM_001023567chr1562296 1767 892 528 495 217 --1718 --
NM_001024071chr143858 629 111 ------
NM_001024094chr553625 2919 701 429 139 ------
NM_001024218chr142750 589 ------
NM_001024647chr1256209 5168 2121 412 216 24973 1578 ----
NM_001024660chr31641 1686 --11165
NM_001024668chr12168 1824 1946 --
NM_001024847chr352428 642 607 223 181 --1467 --
NM_001024855chr3--1254 ----
NM_001024947chr51427 1974 ----
NM_001024948chr143051 1208 788 180 ------
NM_001024956chr11115189 5107 4809 4263 4051 4039 2263 1421 856 827 140 --33995 3758 506 --
NM_001025068chr331482 718 709 ------
NM_001025069chr331482 718 709 ------
NM_001025076chr1036076 5530 986 ------
NM_001025077chr1077434 6888 5101 2344 1316 855 528 --25012 421 --
NM_001025079chr353522 2607 1241 1224 478 33530 3064 1551 33624 850 373 --
NM_001025100chr1843192 2803 1394 746 12636 ----
NM_001025105chr531136 166 49 ----11217
NM_001025107chr132117 866 67 ------
NM_001025107chr132117 866 67 ------
NM_001025108chr233558 125 93 23602 744 ----
NM_001025201chr23627 539 83 ------
NM_001025233chr1232669 647 553 ------
NM_001025356chr1253013 1886 793 696 24 ------
NM_001025366chr631894 216 181 ------
NM_001025366chr631894 216 181 ------
NM_001025367chr631894 216 181 ------
NM_001025367chr631894 216 181 ------
NM_001025368chr631894 216 181 ------
NM_001025368chr631894 216 181 ------
NM_001025369chr631910 232 197 ------
NM_001025369chr631910 232 197 ------
NM_001025370chr631894 216 181 ------
NM_001025370chr631894 216 181 ------
NM_001025389chr1141288 1139 233 145 ------
NM_001025390chr1141288 1139 233 145 ------
NM_001025580chrX33710 1265 655 13822 ----
NM_001025595chr431404 1241 1222 1300 21018 103 --
NM_001025780chr92428 254 ------
NM_001029863chr632927 2674 1184 ----12873
NM_001029875chr512992 ----1632
NM_001030007chr1673972 3127 2618 1472 566 471 163 11153 ----
NM_001030055chr1414183 11133 --13883
NM_001030272chr112467 46 ------
NM_001030273chr112467 46 ------
NM_001031677chr52536 160 ------
NM_001031679chr1231153 708 667 --13043 --
NM_001031681chr1742174 920 283 28 ------
NM_001031692chr71268 ------
NM_001031695chr22105038 4142 3725 3521 1806 1630 1576 1558 1182 808 --25443 5411 --
NM_001031702chr33924 615 98 ------
NM_001031710chr71240 --1824 --
NM_001031711chr5--11276 ----
NM_001031732chr433002 2393 1422 1935 ----
NM_001031740chr141445 1283 312 71 --1121 --
NM_001031748chr121262 ----1514
NM_001031804chr1653856 3187 2728 890 737 21603 1215 13302 --
NM_001032221chr941810 1763 123 45 21804 1473 ----
NM_001032279chr111395 ------
NM_001032288chr20--11402 ----
NM_001032293chr171441 ------
NM_001032296chr1352789 2675 2218 851 770 12385 --12057
NM_001032380chr1011354 1122 3762 468 69 --
NM_001032393chrX1208 1751 ----
NM_001033045chr283881 3411 3091 1529 1225 1171 925 380 11309 ----
NM_001033047chr422571 1617 12543 ----
NM_001033049chr211246 --11963 --
NM_001033059chr61164 ------
NM_001033081chr1----11470 --
NM_001033082chr1----11470 --
NM_001033117chr341676 1265 1182 255 ------
NM_001033507chr11158 --1221 --
NM_001033551chr1793576 3545 3514 2919 1529 1388 844 537 65 13001 --22765 1016
NM_001033557chr2--175 1912 --
NM_001033561chr17----1699 --
NM_001033578chr842221 2066 1782 629 ----1256
NM_001033756chr631828 150 115 ------
NM_001033756chr631828 150 115 ------
NM_001034841chr1632151 727 677 ------
NM_001034845chr41296 ------
NM_001034954chr1012168 --22078 840 --
NM_001034955chr1012168 --22078 840 --
NM_001034956chr1012168 --22078 840 --
NM_001034957chr1012168 --22078 840 --
NM_001035003chr4------1892
NM_001035004chr4------1892
NM_001035254chr931747 1608 1599 --1424 --
NM_001035260chr1041400 655 357 233 ------
NM_001035521chr21521 ------
NM_001037132chr73854 658 54 ------
NM_001037133chr73854 658 54 ------
NM_001037163chr7--168 ----
NM_001037164chr741622 1556 784 226 ------
NM_001037165chr748936 8552 7826 2584 21876 535 ----
NM_001037174chr222042 575 1626 ----
NM_001037317chr12989 213 --1795 --
NM_001037334chr1821709 255 --12112 --
NM_001037339chr121699 700 1304 ----
NM_001037340chr121699 700 1304 ----
NM_001037341chr121699 700 1304 ----
NM_001037341chr121699 700 1304 ----
NM_001037553chr2174904 4824 4269 3475 3135 1194 1072 14105 ----
NM_001037582chr411601 ------
NM_001037631chr21196 --1302 --
NM_001037954chr1163205 3092 2694 962 948 927 --13253 --
NM_001038640chr1551042 959 790 784 285 ------
NM_001039348chr2----165 --
NM_001039349chr2----165 --
NM_001039479chr1452024 1922 900 623 559 1830 ----
NM_001039538chr233342 3310 608 12411 ----
NM_001039547chr3107711 7409 6669 6402 5512 3170 2298 2090 646 134 16744 ----
NM_001039570chr22104577 3917 3893 3315 3106 2951 1727 1386 1131 1120 --33728 1279 794 --
NM_001039571chr22104577 3917 3893 3315 3106 2951 1727 1386 1131 1120 --33728 1279 794 --
NM_001039577chr174326 2965 2781 1522 1507 626 30 ------
NM_001039580chr433358 1034 166 14879 ----
NM_001039590chrX33831 3588 3152 ----12744
NM_001039591chrX33831 3588 3152 ----12744
NM_001039618chr1165095 4832 4529 3910 2250 1191 11278 ----
NM_001039664chr11227 ------
NM_001039675chr151232 ------
NM_001039802chr111344 --2233 189 --
NM_001039840chrX45455 2196 1398 487 ----14310
NM_001039888chr12188 162 ------
NM_001039916chr1221051 966 ------
NM_001039917chr1221051 966 ------
NM_001039918chr1221051 966 ------
NM_001039919chr1221051 966 ------
NM_001039920chr1221051 966 ------
NM_001039937chr1331447 618 493 --13373 13605
NM_001040001chr621886 457 ------
NM_001040002chr1721241 147 ------
NM_001040033chr11691 ------
NM_001040057chr71249 ------
NM_001040101chr42486 197 ------
NM_001040102chr1032638 814 34 ------
NM_001040103chr1032638 814 34 ------
NM_001040113chr162940 257 ------
NM_001040142chr241969 1739 1679 1663 ----1738
NM_001040143chr241969 1739 1679 1663 ----1738
NM_001040152chr744635 3698 3146 401 ----11981
NM_001040153chr131649 1918 ----
NM_001040157chr412670 --22844 274 --
NM_001040158chr51202 --1218 1190
NM_001040202chr432153 889 520 --12183 --
NM_001040273chr1041998 1745 766 37 --1438 --
NM_001040284chr1675601 5052 5018 4881 1823 812 697 --25411 1613 13890
NM_001040402chr463099 2492 2248 1091 410 104 ------
NM_001040429chr131773 --11275 13068
NM_001040437chr6188 ------
NM_001040438chr6188 ------
NM_001040440chr51446 ------
NM_001040441chr195040 4886 4487 4254 3317 1988 1666 1144 199 --13771 --
NM_001040445chr264268 4103 3740 2088 760 336 --24096 3727 --
NM_001040446chr52902 108 11812 --12079
NM_001040450chr1522679 2153 ------
NM_001040453chr1522679 2153 ------
NM_001040619chr121423 328 --11405 --
NM_001040633chr71255 1193 ----
NM_001040665chr771770 1507 1168 1089 948 498 434 --14980 --
NM_001040666chr7----1682 --
NM_001040709chr132577 1582 772 ------
NM_001040712chr963029 3022 2322 2198 2185 78 --12491 --
NM_001040715chr164409 361 291 129 ------
NM_001042353chr201156 ------
NM_001042355chr1665056 4961 1901 1327 956 189 14700 ----
NM_001042357chr102626 75 ------
NM_001042358chr102626 75 ------
NM_001042360chr102626 75 ------
NM_001042363chr102626 75 ------
NM_001042383chr363342 3272 3163 1371 676 175 1310 ----
NM_001042388chr181305 ------
NM_001042389chr102626 75 ------
NM_001042390chr102626 75 ------
NM_001042392chr102626 75 ------
NM_001042395chr102626 75 ------
NM_001042403chr12------11042
NM_001042404chr141746 776 498 467 1634 ----
NM_001042412chr1665056 4961 1901 1327 956 189 14700 ----
NM_001042414chr131255 ------
NM_001042424chr443217 1243 1105 714 2543 192 ----
NM_001042453chrX21108 602 ------
NM_001042465chr104378 237 150 38 11105 ----
NM_001042466chr104378 237 150 38 11105 ----
NM_001042473chr1032044 1533 163 ------
NM_001042479chrX41697 674 511 156 ------
NM_001042480chrX41697 674 511 156 ------
NM_001042481chr1412626 ------
NM_001042486chr2011048 ------
NM_001042494chr1521391 1245 --33623 2424 1014 1362
NM_001042495chr1521391 1245 --33623 2424 1014 1362
NM_001042496chr1521391 1245 --33623 2424 1014 1362
NM_001042497chr1521391 1245 --33623 2424 1014 1362
NM_001042506chrX2929 310 ------
NM_001042517chr13--1990 ----
NM_001042537chrX32335 751 65 ------
NM_001042543chr4----11242 1565
NM_001042555chr12104713 4480 4039 4000 3786 3682 3186 1219 1206 219 23365 616 ----
NM_001042599chr236527 5501 2573 --27412 1607 --
NM_001042601chr323026 74 12631 12407 --
NM_001042603chr1274327 4133 4074 3893 3664 1362 851 1259 ----
NM_001042604chr363679 1769 680 381 147 91 21911 266 1729 --
NM_001042729chr11539 --1220 --
NM_001042747chr11539 --1220 --
NM_001042749chrX31735 1488 480 21659 372 ----
NM_001042750chrX31735 1488 480 21659 372 ----
NM_001042751chrX31735 1488 480 21659 372 ----
NM_001043318chr1453010 2883 1178 880 367 ------
NM_001044305chr621066 245 --1455 --
NM_001044385chr233745 902 625 --32537 305 196 --
NM_001046chr572534 2483 2350 2148 2021 967 490 ------
NM_001048183chr17759 579 539 533 149 135 82 ------
NM_001068chr31243 ------
NM_001077628chr11179 ------
NM_001078chr11613 1563 1543 --
NM_001083620chr442534 2207 1665 60 --1394 --
NM_001083621chr133383 1163 372 24263 1826 ----
NM_001092chr1731794 356 104 ------
NM_001096chr171286 ------
NM_001099678chr366171 4768 4341 1467 1318 1193 11008 ----
NM_001100108chr198091 6085 5915 5445 3339 3238 2713 852 247 25112 386 16917 21661 863
NM_001106chr389670 9274 9174 8695 7454 7119 6975 2131 --28173 3761 1777
NM_001111chr132117 866 67 ------
NM_001113490chrX2468 145 13185 22434 1122 --
NM_001117chr1812283 --1176 --
NM_001121chr10--1442 21225 485 --
NM_001128chr1673972 3127 2618 1472 566 471 163 11153 ----
NM_001146chr821555 515 ------
NM_001148chr451976 1849 1757 1534 720 --188 --
NM_001149chr1021343 548 ------
NM_001152chrX166 ------
NM_001167chrX55416 2681 2643 2247 100 --16631 15150
NM_001172chr142700 252 --1222 --
NM_001173chr1414183 11133 --13883
NM_001177chr1232476 1970 585 12316 ----
NM_001178chr112467 46 ------
NM_001186chr2112144 --32394 2245 836 12185
NM_001204chr275947 5540 4857 3002 2218 1631 1527 ----16587
NM_001206chr942942 2499 2294 53 ------
NM_001218chr1522677 2271 --12607 --
NM_001219chr7177 11819 12083 --
NM_001222chr1011794 ------
NM_001241chr242367 2357 712 409 1823 ----
NM_001241chr242367 2357 712 409 1823 ----
NM_001259chr7115147 5046 4775 4573 4495 2407 2151 1985 1856 1133 611 12277 12118 --
NM_001260chr132335 28 ------
NM_001265chr131280 ------
NM_001268chr134429 399 185 112 --1903 1945
NM_001270chr52218 198 ------
NM_001271chr1563284 2452 1079 780 255 141 ------
NM_001280chr191245 ------
NM_001281chr19--1143 ----
NM_001283chr71704 ------
NM_001284chr51371 ------
NM_001286chr142762 1066 961 890 22618 476 ----
NM_001289chrX41186 1057 636 547 11395 ----
NM_001304chr1733705 460 184 23501 75 1828 --
NM_001310chr1232764 2331 1158 ------
NM_001313chr45992 660 603 275 162 ------
NM_001319chr19------1247
NM_001321chr121192 --1160 --
NM_001326chr111354 ------
NM_001332chr511026 ------
NM_001343chr511575 ------
NM_001346chr342377 2245 2083 646 --11903 --
NM_001351chr311729 --11537 --
NM_001356chrX42288 1896 1568 509 --22436 717 --
NM_001364chr1173413 1578 1296 1263 1179 372 38 1690 13630 --
NM_001379chr191228 155 ----
NM_001385chr81288 ------
NM_001386chr812338 ------
NM_001387chr522985 2147 ------
NM_001390chr1832329 837 405 13074 12839 23155 2582
NM_001391chr182373 150 --1940 --
NM_001399chrX43379 1295 1109 457 31362 1249 321 ----
NM_001400chr151006 926 284 197 31 1267 11133 --
NM_001401chr9--11102 ----
NM_001412chrX2700 675 --23350 1477 13685
NM_001421chrX31702 542 50 11756 1209 --
NM_001423chr1231975 1952 206 2366 343 ----
NM_001427chr7--138 --196
NM_001430chr221752 1504 11837 --11483
NM_001431chr61770 ------
NM_001438chr123403 2780 1119 22886 1282 --
NM_001449chrX1182 ------
NM_001451chr1641243 1203 927 169 ------
NM_001463chr22700 83 --1751 --
NM_001482chr15------1882
NM_001483chr7------1700
NM_001489chr91107 ------
NM_001494chr102188 119 ------
NM_001497chr922417 906 --11038 --
NM_001498chr6127 11018 ----
NM_001518chr72830 220 ------
NM_001521chr21521 ------
NM_001527chr634716 3706 3645 14628 ----
NM_001530chr14----11026 --
NM_001542chr112218 12855 --1637
NM_001554chr1------1145
NM_001560chrX21071 865 12566 ----
NM_001587chrX32122 759 733 12013 1375 --
NM_001608chr21959 ------
NM_001609chr1084373 4173 3856 1497 1064 982 734 107 ------
NM_001614chr17125 --1155 --
NM_001614chr17125 --1155 --
NM_001616chr233390 2860 758 --22159 565 --
NM_001634chr61164 ------
NM_001650chr1824125 3577 --34088 3418 523 --
NM_001655chr1162206 1826 1703 835 820 796 ------
NM_001656chr542038 624 450 152 --11326 11395
NM_001661chr172725 564 ------
NM_001663chr1412716 ----12759
NM_001677chr1----1344 --
NM_001682chr1211884 1594 12407 --
NM_001695chr823807 2603 2306 225 1494 --
NM_001706chr311022 ------
NM_001709chr111220 22858 2803 1440 --
NM_001721chrX151 ------
NM_001729chr41360 ------
NM_001730chr1311008 ------
NM_001730chr1311008 ------
NM_001731chr121371 ------
NM_001743chr21411 ------
NM_001744chr5189 ------
NM_001754chr2134183 4122 1610 --1851 --
NM_001755chr1691472 789 682 575 548 491 304 212 152 12084 11747 --
NM_001759chr123972 943 189 ------
NM_001760chr61302 1164 ----
NM_001769chr121292 ------
NM_001777chr353522 2607 1241 1224 478 33530 3064 1551 33624 850 373 --
NM_001791chr111344 --2233 189 --
NM_001792chr1821030 66 --1229 --
NM_001795chr1611570 ------
NM_001796chr16136 ------
NM_001806chr1931975 1934 542 ----22881 142
NM_001822chr23627 539 83 ------
NM_001830chrX42599 1205 867 725 ----11180
NM_001833chr91254 ------
NM_001839chr11264 ------
NM_001845chr131227 21348 273 ----
NM_001858chr645072 1749 718 180 21300 133 --14364
NM_001866chrX193 ------
NM_001884chr51399 ------
NM_001892chr531136 166 49 ----11217
NM_001931chr112280 149 ------
NM_001935chr22724 72 ------
NM_001939chrX53289 2810 2697 2602 762 --1416 1694
NM_001944chr1862344 2100 751 455 359 104 --1201 --
NM_001946chr121126 ------
NM_001949chr642043 1989 838 410 12385 12435 12462
NM_001951chr81512 ------
NM_001957chr411967 ----1238
NM_001967chr31442 ------
NM_001977chr451638 1170 410 194 57 --1124 11092
NM_001982chr1241064 827 277 31 11084 ----
NM_001991chr17388 40 25 --3853 831 359 --
NM_001993chr13207 157 42 1924 1178 --
NM_001995chr431039 1002 423 11330 ----
NM_001999chr5158 1289 ----
NM_002006chr434164 3786 658 --22285 915 --
NM_002009chr1521098 486 1180 --1909
NM_002015chr1363046 2151 1011 886 473 32 12161 --1925
NM_002024chrX4660 362 270 235 32055 2016 763 ----
NM_002025chrX97760 7624 7397 7148 6376 1879 1515 330 223 29270 59 ----
NM_002040chr212966 948 ------
NM_002044chr1531161 378 39 ------
NM_002054chr21346 ------
NM_002063chrX31279 830 250 ------
NM_002069chr721424 46 ------
NM_002074chr11478 190 ----
NM_002077chr94789 364 310 225 ------
NM_002083chr14198 ------
NM_002092chr454019 1519 1021 957 43 ----11752
NM_002107chr12388 327 ------
NM_002126chr1733373 711 95 --43699 2570 680 513 --
NM_002130chr5--1349 --11674
NM_002136chr121234 ------
NM_002137chr742383 2018 1614 313 ----11641
NM_002139chrX1242 ------
NM_002140chr9----1831 --
NM_002146chr1711020 --1269 --
NM_002148chr21446 ------
NM_002154chr52216 154 ------
NM_002158chr263187 2975 1519 1195 949 715 ------
NM_002176chr9148 ------
NM_002193chr221252 1218 11466 ----
NM_002199chr41155 --1385 --
NM_002202chr53696 323 261 ------
NM_002203chr593012 2899 2805 2627 2535 1347 1291 1079 438 ------
NM_002214chr7105158 4106 2275 2214 2068 1013 639 400 366 235 --12083 1296
NM_002227chr151007 898 320 258 250 --2849 484 --
NM_002234chr122716 247 ------
NM_002239chr24826 790 778 22 ------
NM_002242chr221754 605 ------
NM_002247chr1042214 1795 549 311 ------
NM_002249chr1--1335 127 --
NM_002253chr431366 534 249 ------
NM_002264chr363570 3388 3166 1349 1246 469 2943 537 ----
NM_002268chr311805 1141 --137
NM_002269chr61344 ------
NM_002270chr534204 2282 1080 25473 2034 25317 4658 --
NM_002271chr1362102 1906 1794 1782 687 151 ----1231
NM_002285chr233558 125 93 23602 744 ----
NM_002293chr131997 433 390 ------
NM_002294chrX1131 ------
NM_002310chr576345 5894 4169 1908 1413 518 277 12029 171 --
NM_002334chr1111787 ----11933
NM_002336chr1274346 4022 3993 1686 1631 1051 803 23852 245 ----
NM_002349chr21452 131 1479 --
NM_002356chr612545 ------
NM_002374chr233342 3310 608 12411 ----
NM_002382chr14--11013 ----
NM_002387chr595001 4487 3974 886 869 729 465 284 124 13764 ----
NM_002397chr55735 539 205 143 88 12242 1852 --
NM_002398chr211200 ------
NM_002401chr1722503 484 ------
NM_002408chr141541 --1800 --
NM_002429chr1241495 1148 1020 514 1532 ----
NM_002430chr2212341 ------
NM_002442chr1211336 ------
NM_002444chrX21629 127 ------
NM_002446chr191195 ----1264
NM_002448chr43709 211 200 ------
NM_002449chr521278 87 ------
NM_002451chr963777 2960 2949 2396 1072 727 --21350 738 --
NM_002480chr1221208 1060 ------
NM_002493chr92288 131 ------
NM_002500chr23906 403 89 ------
NM_002501chr19--23955 1097 13163 13852
NM_002505chr631259 414 299 --11155 11107
NM_002515chr1412015 --3532 420 283 1739
NM_002519chr1121514 1227 --1478 --
NM_002526chr621462 536 --1135 11071
NM_002537chr152973 242 --2908 362 --
NM_002538chr51153 ------
NM_002539chr21259 ------
NM_002544chr17133 ------
NM_002545chr1164754 4546 4220 3962 1649 1621 --23443 1297 --
NM_002546chr83667 575 74 1133 ----
NM_002552chr231200 1129 1031 ----1375
NM_002568chr81304 ------
NM_002569chr1521504 46 11214 --11252
NM_002576chr1141202 1150 163 123 ------
NM_002577chr323682 2913 ----11469
NM_002581chr921862 1439 --13944 11935
NM_002583chr121489 --1184 --
NM_002595chr1221866 298 ------
NM_002600chr121699 700 1304 ----
NM_002605chr151372 --192 --
NM_002612chr73597 559 404 1767 ----
NM_002613chr1654606 4497 3696 2076 133 ------
NM_002618chr2144 1364 ----
NM_002627chr10177 ------
NM_002628chr341042 912 363 354 ------
NM_002629chr10--1874 ----
NM_002635chr121124 ------
NM_002641chrX41862 1271 1258 756 21416 1380 ----
NM_002645chr1153133 2476 2434 2020 645 22720 742 1300 --
NM_002655chr875241 4880 4220 3631 1706 1590 1274 12100 ----
NM_002656chr62347 52 ------
NM_002657chr2033746 3621 142 ------
NM_002660chr2021102 777 1236 ----
NM_002663chr172542 179 ------
NM_002667chr62827 325 --1356 --
NM_002670chr311600 --11197 --
NM_002674chr12145 1171 ----
NM_002687chr1421136 1099 ------
NM_002698chr191973 ------
NM_002706chr2----1195 --
NM_002709chr253173 2245 1439 763 70 ------
NM_002711chr71820 1861 ----
NM_002715chr51802 --21226 255 --
NM_002717chr83460 223 62 1669 ----
NM_002718chr331958 250 125 --1480 --
NM_002719chr1422131 977 --12213 --
NM_002721chr9193 ------
NM_002731chr153108 1142 1115 790 195 --1218 --
NM_002734chr1721479 1413 ----1171
NM_002736chr72392 89 ------
NM_002740chr342485 2381 2063 625 2325 305 ----
NM_002742chr142688 172 1268 1131 --
NM_002745chr22124569 4555 4295 3548 3333 1791 1780 1152 786 698 589 449 --11135 11203
NM_002752chr52365 30 ------
NM_002778chr104378 237 150 38 11105 ----
NM_002787chr71505 ------
NM_002806chr142299 252 ------
NM_002823chr23515 479 246 ------
NM_002825chr71600 ----1567
NM_002827chr2061662 1590 1463 584 538 440 1144 ----
NM_002828chr182930 33 ------
NM_002833chr1521386 402 ------
NM_002837chr1221289 1177 --1798 --
NM_002839chr963029 3022 2322 2198 2185 78 --12491 --
NM_002841chr35494 448 227 174 21 ------
NM_002844chr611350 --11077 --
NM_002858chr121004 885 2904 226 ----
NM_002867chr11682 --1195 --
NM_002869chr1132175 1815 693 --11654 1577
NM_002874chr951602 865 837 310 41 ------
NM_002886chr333783 1847 879 --14286 --
NM_002890chr51207 ------
NM_002892chr1441635 482 279 82 --11542 --
NM_002893chrX1137 ------
NM_002894chr18--174 ----
NM_002902chr153434 265 27 --1611 --
NM_002906chr1122065 103 ------
NM_002912chr61345 ----1322
NM_002923chr11483 ------
NM_002926chr41385 ------
NM_002930chr18167 ----1240
NM_002941chr321261 349 ----11533
NM_002942chr33438 364 103 ------
NM_002945chr171667 ------
NM_002955chr6----2687 341 --
NM_002956chr122513 68 1364 ----
NM_002957chr921465 1438 --13883 12574
NM_002959chr154368 3740 3281 1753 187 --12781 --
NM_002968chr162404 27 1341 ----
NM_002971chr31389 1168 1340 --
NM_002977chr262498 2255 2110 1361 1154 489 1183 1160 --
NM_002979chr11220 ------
NM_002994chr421818 1334 ------
NM_003011chr91445 ------
NM_003012chr852990 2387 1017 145 94 ------
NM_003013chr42679 159 ------
NM_003016chr1751946 1597 1405 554 418 ------
NM_003022chrX11307 ------
NM_003034chr1255371 2881 2212 1260 764 --47552 5735 5024 669 --
NM_003043chr353797 3376 2753 1557 94 ------
NM_003048chr232845 1130 1096 1410 ----
NM_003069chrX1745 ------
NM_003071chr31301 --41586 1549 661 633 --
NM_003072chr191291 ------
NM_003076chr1221520 422 --1529 --
NM_003097chr15--199 ----
NM_003099chr1576516 6193 6150 5480 5164 4476 1607 --26247 2009 --
NM_003106chr31689 1745 ----
NM_003108chr284434 2652 2068 2059 1652 1502 1294 1031 --27110 6991 --
NM_003110chr171789 --11076 --
NM_003111chr2----1560 --
NM_003112chr722224 366 ------
NM_003113chr2140 ------
NM_003115chr12325 185 1391 ----
NM_003128chr232640 801 141 ------
NM_003133chr131026 981 82 ------
NM_003136chr142330 296 ------
NM_003137chr62821 63 --1606 --
NM_003144chr62466 165 11790 ----
NM_003149chr331231 614 509 195 11391 --
NM_003150chr1741487 932 627 162 ------
NM_003155chr832623 2579 188 ------
NM_003161chr1743343 1422 891 802 --22775 2224 12324
NM_003162chr21718 ----11103
NM_003165chr941909 1862 222 144 21903 1572 ----
NM_003174chr101586 --2564 280 --
NM_003182chr7174 ------
NM_003182chr7174 ------
NM_003185chr2021077 327 ------
NM_003189chr133211 2236 1072 --12591 --
NM_003192chr63384 185 110 ------
NM_003194chr62562 179 1191 ----
NM_003199chr1855703 5383 5327 732 161 --21425 984 34294 1798 1455
NM_003223chr162564 300 ------
NM_003234chr321600 128 1870 ----
NM_003236chr223223 2281 13352 21194 74 --
NM_003242chr352428 642 607 223 181 --1467 --
NM_003244chr18172 ------
NM_003246chr1541675 615 362 193 1531 --1462
NM_003255chr1732000 328 224 --12533 --
NM_003262chr363973 3336 1754 663 172 94 ------
NM_003269chr641227 1201 445 149 1228 --11208
NM_003272chr1181 1669 --1184
NM_003274chr2122989 739 ------
NM_003275chr911102 21344 130 11402 11302
NM_003281chr144481 1838 969 783 --34007 3994 1600 13609
NM_003286chr201807 ------
NM_003290chr192960 246 ------
NM_003291chr131113 --1336 --
NM_003298chr3116201 5839 5647 5151 4646 4008 1844 1343 970 430 419 15593 ----
NM_003299chr121200 ------
NM_003304chr331212 1104 448 ------
NM_003305chr41286 ------
NM_003330chr1221195 1182 11858 --11390
NM_003337chr541484 1365 696 365 ------
NM_003338chr1041582 695 193 34 --179 --
NM_003339chr531111 1086 251 11344 ----
NM_003340chr431376 1268 31 --1411 --
NM_003342chr1722951 62 --11308 --
NM_003344chr71126 ------
NM_003345chr161573 ------
NM_003349chr20--11402 ----
NM_003359chr41905 11260 ----
NM_003368chr11210 ------
NM_003369chr112941 379 ------
NM_003376chr631894 216 181 ------
NM_003376chr631894 216 181 ------
NM_003383chr91390 ------
NM_003390chr111334 ------
NM_003392chr353728 3574 3256 3207 1534 --22785 970 --
NM_003406chr831817 431 271 ----11360
NM_003409chr181441 ------
NM_003410chrX11010 ----13062
NM_003412chr31691 ------
NM_003413chrX31604 1370 215 --1464 1736
NM_003420chr33669 158 30 ------
NM_003431chr12170 86 ------
NM_003436chr193709 680 123 ------
NM_003439chr7103576 3453 3222 2587 2275 1112 938 920 783 309 --1746 11430
NM_003442chr112769 603 ------
NM_003453chr13----140 --
NM_003455chr1121481 1149 ------
NM_003457chr171441 ------
NM_003458chr373747 3599 3589 3117 2899 1284 1254 ------
NM_003468chr211584 24361 3179 23126 749 --
NM_003469chr21390 --1412 --
NM_003471chr321841 298 22138 2001 ----
NM_003473chr101351 ------
NM_003474chr1041927 866 770 45 11874 1801 12175
NM_003478chr1122919 455 1400 12945 --
NM_003483chr1242160 849 753 379 ------
NM_003488chr173969 57 37 ------
NM_003489chr2152611 2582 2264 972 955 ------
NM_003496chr71820 ------
NM_003498chr1662553 2350 2145 973 254 212 2428 145 ----
NM_003506chr851218 1188 483 316 63 ------
NM_003507chr21632 ------
NM_003559chr1743716 3157 1016 636 ------
NM_003563chr171577 ----1156
NM_003566chr1223405 2338 ------
NM_003576chr1352789 2675 2218 851 770 12385 --12057
NM_003582chr1--1209 ----
NM_003583chr1283407 3360 3270 2451 1571 1233 603 128 22985 1270 12378 13526
NM_003589chr1321077 448 ------
NM_003590chr263456 2674 2660 1384 993 391 --12738 --
NM_003592chr72342 324 ------
NM_003597chr231441 771 269 1359 ----
NM_003603chr411680 ------
NM_003618chr2----1880 --
NM_003620chr1721102 745 ------
NM_003626chr1141394 1386 471 50 ------
NM_003629chr142711 846 704 166 1209 ----
NM_003633chr531864 1769 351 ------
NM_003659chr211198 ------
NM_003670chr331135 1083 568 ------
NM_003671chr943284 2841 1189 442 ------
NM_003672chr11560 1197 --1135
NM_003692chr91116 ------
NM_003704chr41568 ------
NM_003705chr21714 ------
NM_003713chr111544 --11089 1391
NM_003714chr533085 2578 2480 ------
NM_003716chr31319 ------
NM_003737chr11----1163 --
NM_003743chr232064 1921 119 ------
NM_003744chr143183 146 95 ------
NM_003745chr16------131
NM_003749chr13--11515 171 --
NM_003750chr103757 674 227 ------
NM_003758chr151617 --1540 --
NM_003758chr151617 --1540 --
NM_003759chr464282 4000 3408 3046 1618 266 ------
NM_003760chr11688 --1781 1212
NM_003763chr2053114 2508 2379 717 316 ------
NM_003764chr61686 ----1670
NM_003768chr121433 1150 ----11185
NM_003772chr111331 ------
NM_003774chr1232492 1074 802 --1125 --
NM_003786chr171473 ------
NM_003787chr1821236 192 11199 ----
NM_003794chr321044 805 1830 ----
NM_003799chr1873995 3984 3340 2868 906 430 389 ------
NM_003800chr61536 21676 448 ----
NM_003822chr132533 2032 88 1542 12248 --
NM_003825chr151310 ------
NM_003829chr921203 65 ------
NM_003831chr1821733 172 ------
NM_003861chr1452096 993 835 682 627 12609 ----
NM_003870chr1541972 1659 1394 602 --1311 --
NM_003872chr242102 2095 960 610 ------
NM_003873chr103726 544 530 22142 617 --12041
NM_003884chr321703 124 ------
NM_003887chr221879 540 1322 11577 124
NM_003895chr2151525 1490 845 254 66 1106 1860 --
NM_003899chr1332328 742 695 --1612 --
NM_003901chr1032585 2202 1799 --11983 --
NM_003902chr1--1654 ----
NM_003908chr20--11124 ----
NM_003909chr862347 2308 2083 595 144 97 11206 ----
NM_003913chr623638 518 ------
NM_003919chr71190 ------
NM_003927chr182862 300 --11095 1135
NM_003934chr91972 ------
NM_003941chr732527 2265 913 1996 22277 405 1891
NM_003948chr412653 12639 12569 --
NM_003958chr642872 2609 2568 1407 ------
NM_003966chr5117839 7644 7196 6715 5709 5500 5407 2271 1368 1281 384 13009 27667 290 11083
NM_003968chr32680 188 ------
NM_003971chr171119 ------
NM_003972chr1041356 1296 344 180 1982 ----
NM_003994chr1274010 3906 3196 2975 2819 1132 690 21760 200 ----
NM_004006chrX12651 ------
NM_004007chrX12651 ------
NM_004009chrX12651 ------
NM_004010chrX12651 ------
NM_004011chrX12651 ------
NM_004012chrX12651 ------
NM_004013chrX12651 ------
NM_004014chrX12651 ------
NM_004015chrX12651 ------
NM_004016chrX12565 ------
NM_004017chrX12651 ------
NM_004018chrX12565 ------
NM_004020chrX12651 ------
NM_004021chrX12565 ------
NM_004022chrX12565 ------
NM_004023chrX12565 ------
NM_004024chr121332 237 --11314 --
NM_004028chr1824125 3577 --34088 3418 523 --
NM_004040chr21920 ------
NM_004050chr1422066 770 11926 ----
NM_004063chr8188 ------
NM_004077chr12--21029 115 ----
NM_004080chr711315 11497 --1393
NM_004087chr331615 1430 88 ------
NM_004093chr1362992 2111 1168 907 829 177 ------
NM_004094chr1462994 2924 1907 459 207 45 --12429 --
NM_004100chr632237 2130 673 12149 11999 --
NM_004105chr2----165 --
NM_004114chrX1216 ----1311
NM_004136chr1522699 371 12758 11115 --
NM_004156chr81171 1129 ----
NM_004161chr2197 ----11111
NM_004162chr3170 21170 836 ----
NM_004172chr521742 1520 --12019 --
NM_004202chrY144 ----1672
NM_004208chrX168 ------
NM_004219chr5148 ------
NM_004229chrX12081 ------
NM_004232chr1822879 860 1333 ----
NM_004235chr92662 635 --1105 --
NM_004241chr10----1218 --
NM_004274chr1432775 614 417 ------
NM_004277chr64687 362 242 139 11392 ----
NM_004279chr71328 --22155 582 1478
NM_004296chr1442861 2459 548 437 --1726 --
NM_004302chr12--12293 11890 --
NM_004323chr932501 2275 971 --12606 --
NM_004326chr12419 83 ------
NM_004329chr102887 154 ------
NM_004330chr1521148 969 ------
NM_004331chr832633 1705 1031 ------
NM_004338chr1876730 4633 4518 4469 1367 867 586 16532 35764 1648 403 --
NM_004342chr721864 196 ------
NM_004349chr83862 475 127 ------
NM_004379chr221544 633 2642 163 ----
NM_004385chr51222 ------
NM_004392chr1331618 1073 653 --11767 --
NM_004396chr171199 ------
NM_004397chr1172777 1709 1157 902 717 615 208 23412 236 ----
NM_004411chr71200 ----1534
NM_004417chr52464 458 ----1505
NM_004419chr101960 ------
NM_004426chr1241838 1349 783 320 ------
NM_004430chr842702 2653 2466 806 ------
NM_004432chr932276 2046 447 11783 ----
NM_004433chr131452 1236 468 ------
NM_004434chr1431596 1253 56 ------
NM_004436chr11571 ------
NM_004438chr232975 1085 234 11074 ----
NM_004440chr631654 780 51 --1240 --
NM_004447chr123887 772 40 ------
NM_004454chr331788 1623 878 ------
NM_004456chr7163 ------
NM_004459chr1721904 1826 11445 ----
NM_004480chr141680 ------
NM_004482chr22706 647 --1151 --
NM_004485chr144372 1228 815 406 11240 11134 --
NM_004487chr3------1916
NM_004498chr15----1394 --
NM_004501chr154141 3379 3254 675 212 1454 12857 14134
NM_004504chr262994 2388 2254 812 282 69 11025 --12589
NM_004505chr1721473 1420 11854 ----
NM_004506chr6----1743 --
NM_004516chr19----1335 --
NM_004520chr52752 217 ------
NM_004525chr23474 198 88 1218 ----
NM_004527chr1721241 147 ------
NM_004529chr921389 470 ------
NM_004540chr211279 ------
NM_004550chr1--1152 ----
NM_004567chr332034 1809 35 ------
NM_004569chr142641 26 ------
NM_004583chr17----2571 560 --
NM_004586chrX94748 4448 3765 3746 3571 1515 1191 840 393 --2424 318 --
NM_004596chr191138 ------
NM_004599chr221672 ------
NM_004600chr121192 427 ------
NM_004612chr963930 3359 992 974 637 200 1873 ----
NM_004614chr1622458 647 --12236 --
NM_004622chr221758 496 --11641 --
NM_004627chr213693 666 226 ------
NM_004631chr12245 49 11160 ----
NM_004634chr32419 258 2526 91 ----
NM_004636chr31427 1406 ----
NM_004637chr321280 1039 ------
NM_004642chr122491 237 ------
NM_004654chrY11035 140 ----
NM_004655chr1731324 1071 532 ------
NM_004660chrY42306 1827 637 512 ----1565
NM_004667chr154655 592 241 52 ------
NM_004685chr131257 --11099 --
NM_004687chr1771767 1495 1285 774 615 526 510 ------
NM_004690chr61265 --1702 --
NM_004694chr171233 --1145 --
NM_004703chr173892 718 274 ------
NM_004709chrX51720 1704 1217 1124 311 ------
NM_004719chr1252331 2272 804 345 169 12347 ----
NM_004725chr10--2954 211 ----
NM_004726chrX45592 3833 394 249 --35312 2133 321 --
NM_004730chr552024 686 671 574 131 ------
NM_004731chr1241528 1421 1340 1247 --1749 --
NM_004733chr3--1422 --1622
NM_004734chr1331065 423 208 12317 12180 --
NM_004736chr142107 1739 1501 479 22272 1491 ----
NM_004744chr463125 1261 1253 1182 999 576 --2639 80 --
NM_004745chr831546 1212 430 ------
NM_004748chr1534207 1584 22 13215 13435 --
NM_004755chr1451137 1004 816 809 798 --21181 167 --
NM_004756chr1921423 1066 ------
NM_004757chr41103 ------
NM_004760chr741654 1604 1583 365 --12250 --
NM_004770chr81164 ------
NM_004772chr531395 1342 1108 ------
NM_004774chr1722914 1065 --12314 --
NM_004775chr181917 --12157 --
NM_004776chr2032758 2261 1262 13229 1227 --
NM_004781chr12551 333 21703 1360 1499 --
NM_004781chr12551 333 21703 1360 1499 --
NM_004798chr2042974 970 179 36 ------
NM_004800chr131191 ------
NM_004808chr1053209 2702 2344 748 685 ----12785
NM_004824chr62313 171 --1268 --
NM_004834chr212608 23295 1370 1844 --
NM_004841chr121145 1095 --1337 --
NM_004842chr621549 1346 ------
NM_004850chr231542 1273 489 ------
NM_004856chr15------1612
NM_004857chr1454750 3497 1430 667 309 13806 23471 626 24714 3860
NM_004859chr1731197 1058 1001 ----12295
NM_004865chr61284 ------
NM_004879chr111259 ------
NM_004887chr521110 163 ----1913
NM_004888chr91962 198 ----
NM_004893chr51202 --1218 1190
NM_004896chr1041315 570 272 148 ------
NM_004898chr452889 2812 2265 1073 919 1330 12452 --
NM_004904chr7106602 6412 6321 5576 4482 2599 1279 1251 1058 689 12500 16226 --
NM_004905chr11214 1150 ----
NM_004915chr212668 573 ------
NM_004921chr162247 1901 968 423 363 64 12294 ----
NM_004929chr821030 60 --11512 --
NM_004932chr521570 1521 ----11283
NM_004937chr1742539 1697 648 393 ------
NM_004938chr911160 ------
NM_004947chr332056 1945 637 1415 22319 990 --
NM_004950chr12----122 --
NM_004956chr754235 1752 1193 1007 146 21413 934 23427 716 --
NM_004973chr641738 1660 98 68 11442 --1153
NM_004976chr1155083 4559 3813 3377 1722 --21436 811 11183
NM_004985chr1234509 1180 77 13435 24230 90 --
NM_004992chrX108122 7713 7257 5819 2932 2670 2287 983 775 175 --16328 18404
NM_004992chrX108122 7713 7257 5819 2932 2670 2287 983 775 175 --16328 18404
NM_004995chr142960 429 ------
NM_004998chr15--2809 247 ----
NM_004999chr663863 3649 3542 3419 2905 1775 2630 443 ----
NM_005009chr16--1288 ----
NM_005010chr73854 658 54 ------
NM_005014chr9--1593 1351 --
NM_005023chr521234 365 ------
NM_005028chr1022217 91 11540 1649 --
NM_005036chr2287058 5871 5426 2724 1973 624 420 175 --21815 53 --
NM_005044chrX54173 3775 1701 825 182 1553 13603 --
NM_005054chr221563 350 ------
NM_005056chr1274571 4377 4318 4137 3908 1606 1095 1503 ----
NM_005063chr1023512 3224 13850 ----
NM_005065chr1454592 1829 911 869 125 1740 ----
NM_005069chr2121693 1217 ------
NM_005087chr3----1347 --
NM_005110chr51718 --1832 --
NM_005119chr121038 136 ------
NM_005121chr1733114 909 802 --13077 --
NM_005126chr332258 1737 617 11647 11902 --
NM_005133chr111395 ------
NM_005134chr181305 ------
NM_005135chr1521391 1245 --33623 2424 1014 1362
NM_005137chr2252134 1830 1788 743 109 1538 ----
NM_005140chrX4772 711 92 30 ------
NM_005151chr1821709 255 --12112 --
NM_005154chr15--1596 2269 137 --
NM_005156chr995369 4874 4718 4435 4271 4154 3780 1869 1134 ------
NM_005159chr1521489 253 12209 ----
NM_005168chr251480 1264 1231 464 450 --21574 654 --
NM_005178chr191388 ------
NM_005180chr104674 616 317 297 ------
NM_005181chr81249 ------
NM_005182chr161421 ------
NM_005188chr1157400 3022 2429 2217 767 --37207 6988 830 17718
NM_005194chr202116 108 ----1561
NM_005197chr1425294 2279 --24632 3755 --
NM_005204chr102798 35 ------
NM_005206chr1721218 244 ------
NM_005214chr21159 --1265 --
NM_005230chr121154 1208 ----
NM_005233chr332276 2031 504 --1562 --
NM_005235chr236527 5501 2573 --27412 1607 --
NM_005238chr1142938 2202 1346 1097 1480 1989 22999 927
NM_005241chr331360 549 353 ------
NM_005242chr521265 598 ------
NM_005244chr201471 1687 ----
NM_005248chr11539 --1220 --
NM_005252chr142753 61 ------
NM_005256chr112791 379 --1151 --
NM_005257chr1821425 993 ------
NM_005259chr211473 ----11046
NM_005261chr81854 ------
NM_005277chr441848 1529 350 160 11393 ----
NM_005295chr7----1208 --
NM_005296chrX1247 ------
NM_005302chr71426 ------
NM_005318chr2211112 ------
NM_005324chr1721995 292 --1179 --
NM_005329chr1632050 1983 294 --11913 21614 635
NM_005334chrX2688 92 ------
NM_005336chr232017 291 236 ------
NM_005339chr443578 3020 2660 503 ------
NM_005342chrX52105 1763 591 510 254 ----11799
NM_005358chr1331770 1320 151 --125 --
NM_005375chr61758 --2437 21 11125
NM_005378chr21863 1574 --1239
NM_005382chr81458 ------
NM_005385chr332590 2261 663 --1784 --
NM_005386chr202802 122 ------
NM_005398chr10----11355 --
NM_005400chr21879 --11048 --
NM_005402chr7159 ------
NM_005407chr141998 --11217 --
NM_005433chr1821111 850 22302 2097 11829 --
NM_005436chr1063254 2828 2721 2519 1049 968 1109 23923 460 --
NM_005440chr172971 822 1448 12038 --
NM_005455chr131782 373 281 11695 ----
NM_005458chr95988 754 602 343 140 11895 ----
NM_005461chr2021355 1310 41626 1375 1291 635 ----
NM_005465chr11566 ------
NM_005474chr1721443 320 ----1584
NM_005476chr91431 1382 ----
NM_005477chr1552205 2142 722 594 506 --2975 215 --
NM_005477chr1552205 2142 722 594 506 --2975 215 --
NM_005487chr2231991 1852 1414 --11507 --
NM_005493chr6----1806 --
NM_005497chr1765755 5159 4257 3728 1404 1238 15883 ----
NM_005499chr192485 135 ------
NM_005509chr541821 1650 1362 1313 1147 ----
NM_005522chr71448 ------
NM_005537chr131211 ------
NM_005539chr1021228 433 1510 11131 --
NM_005545chr152717 245 ------
NM_005546chr53957 717 304 --175 --
NM_005561chr133793 685 140 ------
NM_005569chr2221533 44 ------
NM_005570chr1811073 ------
NM_005573chr51555 ------
NM_005585chr151451 ------
NM_005587chr152271 189 ----1707
NM_005591chr1122301 149 22643 1772 --12423
NM_005593chr121550 ------
NM_005595chr11372 --2242 101 --
NM_005596chr975296 4425 4318 1188 1079 581 255 21026 1015 ----
NM_005604chr631825 895 528 11695 --1326
NM_005611chr1611339 ------
NM_005627chr62775 659 ------
NM_005639chr1251887 1672 1563 1508 481 --11685 --
NM_005644chr1----1293 --
NM_005647chrX32724 1352 902 ------
NM_005649chr51395 ------
NM_005665chr133704 1571 1211 ------
NM_005668chr544460 4111 1324 1301 ------
NM_005688chr34948 473 432 39 --1378 --
NM_005692chr7172 ------
NM_005693chr11--1133 ----
NM_005700chr112163 118 ------
NM_005715chr631946 876 716 1103 --11855
NM_005719chr12144 ----1203
NM_005720chr7----1239 --
NM_005722chr252408 2037 1956 1719 665 ----1930
NM_005734chr111613 ------
NM_005737chr222288 672 11029 ----
NM_005738chr741622 1556 784 226 ------
NM_005739chr1522003 108 11567 1167 --
NM_005742chr22829 125 ------
NM_005746chr722238 672 --11846 --
NM_005748chr1252707 2633 2351 1226 795 13051 12581 --
NM_005749chr17--1282 ----
NM_005751chr72482 179 ------
NM_005759chr253945 2927 1805 1693 567 34784 4097 3598 --11679
NM_005766chr131185 --1894 11391
NM_005776chr141797 1309 ----
NM_005779chr543589 1394 1175 927 12691 11194 --
NM_005786chr1821188 57 138 ----
NM_005789chr1711432 ------
NM_005808chr333080 2924 2852 12243 13494 --
NM_005822chr652253 1600 1579 1567 491 --32289 2228 1813 --
NM_005826chr11104 ------
NM_005832chr32987 248 ------
NM_005833chr9--1158 ----
NM_005840chrX107529 7403 7300 6960 6491 5683 4686 3067 2641 1879 --15133 --
NM_005857chr111349 ------
NM_005868chr722470 1903 --22045 291 --
NM_005870chr1341183 1051 565 221 ------
NM_005871chr101258 1865 ----
NM_005882chr42818 242 ------
NM_005885chr51133 ------
NM_005888chr121124 ------
NM_005895chr1253451 3364 3335 3223 2680 13687 ----
NM_005898chr1163026 2392 2151 1249 818 685 --1578 1500
NM_005900chr431165 1100 351 ----1385
NM_005901chr18118340 7737 7680 6789 6254 6089 2557 2025 1130 117 60 28258 5520 12269 18701
NM_005902chr1534549 1353 1133 --24305 2835 --
NM_005903chr595046 4080 3686 3406 2003 1665 1330 1190 538 1836 23292 741 --
NM_005906chr641509 1402 647 29 11714 ----
NM_005908chr4145 ------
NM_005909chr574077 3773 3149 2893 1074 820 273 --14042 --
NM_005911chr231220 922 387 ------
NM_005923chr62605 273 ------
NM_005926chr151362 --1201 --
NM_005933chr1142493 2395 2191 860 12590 22328 388 --
NM_005935chr454556 4468 4320 2006 666 11306 --14181
NM_005937chr1764153 1423 983 701 365 212 13244 ----
NM_005941chr843218 1560 1460 1397 --13913 13062
NM_005955chr155351 3716 3584 367 249 14692 ----
NM_005962chr1042205 2131 1705 888 --1686 --
NM_005962chr1042205 2131 1705 888 --1686 --
NM_005966chr241600 1540 609 287 --21835 929 --
NM_005977chr133372 279 55 ------
NM_005986chr132607 471 ------
NM_005999chr141225 1197 1153 576 ------
NM_006007chr981642 1446 1342 1286 1098 1087 743 707 13350 13007 --
NM_006011chr1524166 4141 --24284 208 13713
NM_006016chr6----11973 1469
NM_006030chr31293 11349 ----
NM_006036chr222032 1826 ------
NM_006037chr264655 4469 3954 3173 3148 1572 --34285 3479 2961 --
NM_006038chr2032032 1342 221 --11911 173
NM_006040chr1621289 1062 --1931 --
NM_006054chr1121159 71 --1358 --
NM_006060chr763475 3220 2770 1667 1595 1411 11457 11700 --
NM_006064chrX--1385 ----
NM_006070chr31111 1354 165 --
NM_006076chr742475 1174 589 331 ------
NM_006080chr752833 2759 1908 1097 97 12059 1940 --
NM_006084chr141309 ------
NM_006088chr91142 ------
NM_006089chrX1232 ------
NM_006094chr821966 1868 ------
NM_006095chr474389 3146 3092 3050 1299 498 450 --1168 --
NM_006106chr1142733 2557 1028 387 --12904 --
NM_006136chr721369 512 ------
NM_006141chr1632227 1979 567 1642 ----
NM_006145chr19----1896 11152
NM_006154chr1532007 892 137 ------
NM_006157chr11--1352 ----
NM_006161chr52565 477 ------
NM_006164chr22156 44 1453 ----
NM_006166chr1252222 2067 1938 1771 498 --1832 --
NM_006180chr92334 203 --11664 --
NM_006183chr12--1144 ----
NM_006186chr211068 ------
NM_006194chr1421278 238 ------
NM_006195chr921225 210 ------
NM_006203chr595495 4715 4525 4205 4073 3651 2103 1757 150 1545 13672 --
NM_006206chr452217 2042 541 534 348 ------
NM_006212chr135271 4579 21 --14144 --
NM_006218chr3149 --1112 --
NM_006224chr1742168 1688 1563 580 --1589 --
NM_006226chr251254 1179 879 403 335 1946 ----
NM_006237chr1331808 1499 248 ----11877
NM_006243chr111063 --1849 --
NM_006251chr522329 2058 12076 13030 1916
NM_006252chr157476 7243 5807 4894 32 14692 --12671
NM_006256chr152476 2205 1990 1072 716 --1208 22093 1976
NM_006258chr1021057 149 ------
NM_006285chr91212 ------
NM_006298chr672955 2723 2317 1268 882 627 619 179 3260 39 29 --
NM_006306chrX55247 4201 1969 792 127 11141 15780 --
NM_006310chr171379 ------
NM_006313chr1241475 493 425 154 ------
NM_006315chr454327 2868 2798 1810 638 --24527 3148 --
NM_006320chr41925 ----1802
NM_006330chr81286 ------
NM_006335chr13862 738 136 ------
NM_006345chr431224 912 887 ------
NM_006352chr132045 1476 167 --11770 --
NM_006359chrX32335 751 65 ------
NM_006364chr1441108 847 464 291 1339 ----
NM_006371chr323515 1372 14560 --14199
NM_006379chr73789 737 487 --1182 --
NM_006380chr1764357 3657 2819 1618 692 642 --14074 1492
NM_006386chr22--12354 11804 --
NM_006390chr1251843 1733 606 139 130 ------
NM_006393chr1044301 812 757 181 ----11586
NM_006401chr91331 ------
NM_006411chr61913 ------
NM_006416chr6--148 ----
NM_006424chr431556 787 179 ------
NM_006431chr12--1225 ----
NM_006434chr1012168 --22078 840 --
NM_006449chr231378 364 308 ------
NM_006457chr463393 3020 2988 2921 1172 558 --23747 3699 --
NM_006459chr1031859 1277 281 ------
NM_006464chr264134 3995 3572 3298 442 145 13256 ----
NM_006467chr54867 485 414 94 ------
NM_006472chr131197 1170 800 ----11226
NM_006482chr1283407 3360 3270 2451 1571 1233 603 128 22985 1270 12378 13526
NM_006486chr222631 510 --1119 --
NM_006489chr1412015 --3532 420 283 1739
NM_006496chr121539 130 ------
NM_006504chr1032681 1007 438 ------
NM_006516chr131625 1500 1179 1649 21593 585 --
NM_006517chrX2114 64 1901 ----
NM_006526chr2041389 815 671 330 ------
NM_006527chr42486 229 --1576 --
NM_006534chr2042425 1300 842 54 ------
NM_006537chr15------1593
NM_006538chr254061 3843 1035 883 229 14101 --14002
NM_006539chr161515 ------
NM_006544chr1475369 4674 3991 1627 1529 1429 1069 14698 --1580
NM_006546chr1766065 1298 1185 1093 1078 246 --24142 937 --
NM_006547chr732019 1995 1750 --1839 --
NM_006548chr311382 11641 ----
NM_006557chr911736 --11547 --
NM_006559chr1------1868
NM_006561chr1036076 5530 986 ------
NM_006565chr161792 ------
NM_006575chr1421224 85 ------
NM_006577chr211209 ------
NM_006595chr113536 81 71 ------
NM_006597chr11125 ------
NM_006599chr1687453 7044 6771 6497 5376 2857 992 576 27755 5765 11344 18126
NM_006603chrX31735 1488 480 21659 372 ----
NM_006609chr252083 1895 1883 1872 269 ------
NM_006614chr343296 1440 183 155 ----12692
NM_006621chr121705 1350 ------
NM_006624chr101483 ------
NM_006625chr121026 170 ------
NM_006625chr121026 170 ------
NM_006625chr121026 170 ------
NM_006626chr952334 2217 2131 1959 73 1448 ----
NM_006628chr1564503 4055 3911 3253 266 186 1690 ----
NM_006633chr51599 ------
NM_006648chr91116 ------
NM_006654chr12104713 4480 4039 4000 3786 3682 3186 1219 1206 219 23365 616 ----
NM_006664chr9132 ------
NM_006667chrX1108 ------
NM_006682chr782251 1142 1084 921 791 360 140 62 ----11828
NM_006687chr9127 ----1104
NM_006690chr2022309 1763 --22260 389 --
NM_006698chr20172 1169 ----
NM_006699chr122341 416 ------
NM_006706chr53331 126 81 ------
NM_006713chr51152 ------
NM_006717chr932856 2796 176 --12096 --
NM_006718chr62347 52 ------
NM_006722chr333074 2849 2126 --13003 1802
NM_006726chr4--1937 --1455
NM_006727chr5186 ------
NM_006729chrX55042 4660 656 634 532 --23748 2071 14290
NM_006731chr985765 5482 5333 4258 3607 752 579 164 --11388 --
NM_006734chr631440 639 278 1415 ----
NM_006738chr1544193 4015 3888 561 1735 11717 --
NM_006749chr811058 --2942 302 --
NM_006750chr1678027 6689 5767 1549 469 353 198 --27575 2373 12615
NM_006751chr22899 81 ------
NM_006754chr71944 --173 --
NM_006761chr171797 --1272 --
NM_006765chr82236 26 ------
NM_006766chr842668 1890 761 491 11700 --11689
NM_006775chr642911 990 762 121 1238 13058 1281
NM_006777chrX32844 493 370 --12794 --
NM_006788chr1851750 1719 1599 1309 393 ------
NM_006800chrX1562 ------
NM_006805chr511459 ------
NM_006811chr201782 ------
NM_006815chr121358 --1936 --
NM_006822chr172289 233 ------
NM_006823chr8----3523 455 443 --
NM_006826chr23836 513 200 ------
NM_006832chr141676 1152 ----
NM_006838chr12----11352 --
NM_006839chr21118 ------
NM_006854chr711427 --12005 --
NM_006870chr201334 --1565 --
NM_006885chr164724 447 392 268 --13273 13174
NM_006888chr1473514 3093 2970 2782 2684 988 240 ------
NM_006895chr221945 1551 1373 1109 --
NM_006898chr21787 ------
NM_006902chr143326 2929 2452 90 ----1829
NM_006906chr114992 629 160 32 ------
NM_006908chr711032 --11483 1365
NM_006912chr152357 1697 1655 256 70 12301 1195 --
NM_006914chr92533 459 ------
NM_006915chrX32487 1643 505 12480 1985 --
NM_006918chr11115189 5107 4809 4263 4051 4039 2263 1421 856 827 140 --33995 3758 506 --
NM_006920chr221539 1290 11744 11463 --
NM_006922chr212411 11763 12171 --
NM_006924chr1733156 2916 1176 --11067 --
NM_006939chr143263 202 90 1307 ----
NM_006940chr1211480 ----1279
NM_006943chr2053219 2469 1116 1080 709 --1497 --
NM_006947chr41438 ------
NM_006951chr101712 ------
NM_006965chr1831164 1056 30 ------
NM_006981chr922930 288 12259 11176 --
NM_006988chr211255 --1490 --
NM_006991chr321004 174 --1834 --
NM_006996chr11684 ------
NM_006997chr101111 ----1159
NM_006999chr511806 11793 ----
NM_007005chr921535 44 ----11580
NM_007010chr1711189 --11527 --
NM_007011chr1595415 5327 4988 2438 1950 1861 1429 1206 614 --26147 5908 16701
NM_007013chr81950 ------
NM_007023chr2--1788 ----
NM_007026chr17----1601 --
NM_007030chr564941 4517 3980 3537 182 25 24845 84 ----
NM_007038chr2176049 5448 5208 5190 4427 1295 172 11270 15925 150
NM_007039chr144854 263 112 62 --21688 762 --
NM_007043chr122284 65 --11642 --
NM_007045chr61587 ------
NM_007054chr533236 1200 220 --23832 2555 --
NM_007064chr31641 1686 --11165
NM_007073chr653557 2851 1540 975 67 --14042 --
NM_007078chr1052559 1896 429 394 374 11208 ----
NM_007084chr1331192 575 64 ------
NM_007096chr91254 ------
NM_007106chr133640 564 379 1365 --21126 967
NM_007107chr322280 911 12198 22162 211 --
NM_007114chr352210 2029 1231 235 41 ------
NM_007124chr61306 ------
NM_007125chrY1435 ------
NM_007146chr175911 861 700 555 134 --32860 1977 324 --
NM_007150chrX42111 1831 856 229 1877 ----
NM_007157chrX42646 2594 1970 836 22661 1063 11115 --
NM_007159chr3--11735 11101 --
NM_007166chr1131262 1156 432 ------
NM_007174chr122880 263 ------
NM_007175chr833175 2821 576 12352 ----
NM_007176chr1411151 ------
NM_007187chr132771 350 ------
NM_007197chr12----1908 --
NM_007200chr1544193 4015 3888 561 1735 11717 --
NM_007202chr171663 1556 2726 96 --
NM_007203chr953759 2763 2416 1361 74 1474 ----
NM_007212chr1174 11737 ----
NM_007222chr811543 21498 529 ----
NM_007236chr1541968 1943 1851 181 --1109 --
NM_007246chr4182 ------
NM_007249chr13149386 8241 8058 7616 6930 3472 2999 2691 2659 2321 2186 1589 1104 546 ----27324 1135
NM_007271chr611340 1604 --1446
NM_007275chr341097 474 416 370 --1961 --
NM_007276chr71449 --1174 --
NM_007308chr41170 ------
NM_007315chr211429 11396 ----
NM_007345chr182232 64 ----11904
NM_007347chr1523236 896 23074 377 12903 --
NM_007358chr121431 722 ------
NM_007359chr1721729 1468 11247 ----
NM_007363chrX1124 ------
NM_007373chr1041600 1315 1169 118 ------
NM_007375chr142728 2466 2459 573 192 ----
NM_012081chr543518 3479 2439 936 --11396 --
NM_012082chr84656 384 361 317 ------
NM_012089chr111231 ----1221
NM_012092chr221646 543 ------
NM_012095chr1073243 3030 2188 2178 1158 816 105 --2572 531 --
NM_012096chr363258 2816 1491 1025 418 204 11090 ----
NM_012097chr222042 575 1626 ----
NM_012098chr941472 1332 1279 497 ------
NM_012104chr1153024 2774 1275 359 217 --11282 1922
NM_012104chr1153024 2774 1275 359 217 --11282 1922
NM_012120chr622954 704 ------
NM_012137chr1--12893 12545 --
NM_012141chr1331447 618 493 --13373 13605
NM_012153chr1112234 1361 ----
NM_012154chr81646 ------
NM_012158chr1351815 1293 750 741 447 ----1322
NM_012193chr1144462 1811 634 52 14932 ----
NM_012197chr941323 659 602 515 11384 ----
NM_012199chr163992 3710 1488 1128 719 711 24296 3737 23452 277 --
NM_012210chr931114 267 213 --11194 11024
NM_012213chr161690 ------
NM_012214chr2166108 5955 5942 5840 5609 5595 5535 2324 2148 1687 1292 1234 928 648 605 250 15489 ----
NM_012215chr1041704 1457 763 494 11509 1308 --
NM_012224chr42431 41 --11120 --
NM_012229chr1021023 427 ------
NM_012233chr21835 ------
NM_012234chr352284 1168 910 693 455 ------
NM_012238chr1031300 605 457 1228 142 --
NM_012242chr103274 222 117 ------
NM_012247chr102961 326 --1939 --
NM_012249chr2--1696 --13160
NM_012252chr754817 1171 1158 1150 321 11533 14607 --
NM_012255chr201104 ------
NM_012257chr72693 125 ----1184
NM_012259chr611401 --11031 --
NM_012261chr20167 ------
NM_012262chr185159 4063 1799 1371 1231 1185 931 344 --24017 1391 --
NM_012281chr722412 951 ------
NM_012282chrX1755 2336 245 ----
NM_012286chrX1574 ------
NM_012294chr762804 2734 1016 1009 237 36 13744 ----
NM_012297chr442646 2324 1987 1880 1478 12536 --
NM_012300chr52474 400 --12278 --
NM_012307chr1821096 252 ------
NM_012309chr1113286 13436 13155 --
NM_012317chrX7825 803 796 760 737 663 182 ------
NM_012319chr182925 82 ------
NM_012320chr1611388 ------
NM_012329chr1721106 48 1106 ----
NM_012330chr102493 411 ------
NM_012333chr121031 292 --11163 --
NM_012342chr10170 ------
NM_012382chr533291 1594 1432 ----12853
NM_012384chr2022258 751 ------
NM_012388chr1522600 719 --12143 --
NM_012416chr921188 1019 ------
NM_012419chr61100 ------
NM_012420chr1052023 914 436 159 135 ----11676
NM_012425chr1042070 925 875 753 12410 ----
NM_012430chr32480 67 --1736 --
NM_012431chr753430 2309 1201 268 88 ----11001
NM_012434chr62517 85 ------
NM_012437chr13471 139 34 ------
NM_013230chrY1506 11303 ----
NM_013231chr1443616 3147 259 149 ----11291
NM_013254chr121492 162 ----
NM_013256chr193503 283 264 ------
NM_013257chr842221 2066 1782 629 ----1256
NM_013261chr433502 3333 1158 --12843 --
NM_013262chr6147 ------
NM_013269chr1233006 854 459 ------
NM_013277chr123199 102 30 ------
NM_013283chr54582 141 93 56 ------
NM_013296chr1--1155 187 --
NM_013309chr1522322 2117 --1487 --
NM_013316chr73849 384 211 --1863 --
NM_013326chr18--156 ----
NM_013341chr232490 995 381 ------
NM_013354chr8------2342 143
NM_013372chr1523204 223 12596 ----
NM_013374chr332161 443 237 172 ----
NM_013381chr1241733 579 440 81 22266 1567 ----
NM_013396chr2111370 --21401 368 --
NM_013433chr1921509 1325 ------
NM_013436chr22658 163 --1664 --
NM_013437chr811296 1872 1914 --
NM_013438chr921590 1526 ----1352
NM_013444chrX11081 11163 ----
NM_013448chr143228 146 120 ------
NM_013450chr231219 1176 789 1309 ----
NM_013943chr153039 2891 1258 723 632 23023 534 ----
NM_013995chrX42498 2025 1035 811 12225 --1852
NM_013996chr7174 ------
NM_013996chr7174 ------
NM_013997chr7174 ------
NM_013997chr7174 ------
NM_013998chr7174 ------
NM_013998chr7174 ------
NM_013999chr1721278 184 ------
NM_014002chr1----2148 35 --
NM_014011chr212256 --12068 --
NM_014016chr3----11305 --
NM_014021chr143386 2989 628 304 --33269 3250 267 --
NM_014023chr103967 730 309 ------
NM_014028chr633147 2386 2111 --1816 --
NM_014033chr12----12307 --
NM_014034chr63964 586 281 --11545 --
NM_014048chr1674679 4597 4565 3587 3381 1669 885 11689 15018 --
NM_014057chr931304 392 301 --1226 --
NM_014071chr201345 ------
NM_014079chr31176 ------
NM_014112chr8104896 4881 4395 4374 1832 1815 1591 1424 1353 386 11705 --11141
NM_014117chr1642683 2170 722 464 ------
NM_014141chr763872 3380 3276 1851 1473 281 1685 ----
NM_014153chr16138 ------
NM_014155chr1176782 6763 6604 5891 2392 2356 137 12697 ----
NM_014157chr1673966 3756 2898 408 401 245 215 ------
NM_014181chr212930 22808 372 ----
NM_014190chr421178 96 31592 611 366 ----
NM_014210chr171232 ------
NM_014217chr141779 708 173 78 ------
NM_014223chr11134 1707 ----
NM_014238chr1721559 1124 198 --11384
NM_014240chr353707 2864 1461 1077 654 21442 538 ----
NM_014250chr2231991 1852 1414 --11507 --
NM_014263chr102521 55 --11166 --
NM_014267chr111230 ------
NM_014268chr1821229 128 ------
NM_014271chrX1102 ----1762
NM_014278chr41351 1436 ----
NM_014279chr92964 147 ------
NM_014283chr111226 ------
NM_014289chrX41361 1336 1135 456 ------
NM_014294chr821437 1107 1927 21391 66 --
NM_014300chr151132 --1122 --
NM_014305chr131175 ------
NM_014309chr22105028 4132 3715 3511 1796 1620 1566 1548 1172 798 --25433 5401 --
NM_014319chr121270 1635 ----
NM_014331chr4107256 7098 6942 6897 6679 4872 2492 1980 1379 561 --25978 5330 17473
NM_014333chr1132491 2002 1972 --12802 --
NM_014335chr1511036 --1899 --
NM_014350chr5----153 1845
NM_014351chr2211418 --11440 --
NM_014368chr942066 1697 1525 725 12172 ----
NM_014372chr152042 2015 1576 1548 688 ------
NM_014382chr321772 369 ----11429
NM_014392chr42486 197 ------
NM_014394chr10--166 --11016
NM_014399chr72276 251 --1369 --
NM_014415chr331445 594 477 ------
NM_014421chr43801 490 57 ------
NM_014423chr5104840 4830 4518 3953 2264 1171 792 756 681 653 14034 ----
NM_014431chr101239 --1480 11701
NM_014447chr431403 1240 1221 1300 1103 --
NM_014452chr6--11205 ----
NM_014454chr621022 790 169 ----
NM_014456chr1021465 97 ----11782
NM_014458chr11146 1477 ----
NM_014469chr111771 --2670 249 --
NM_014488chr113523 240 234 --1170 --
NM_014491chr71421 ------
NM_014494chr1621985 885 1400 --157
NM_014515chr12--1881 1400 --
NM_014547chr151728 ------
NM_014547chr151728 ------
NM_014554chr1232094 1436 851 ------
NM_014572chr1341711 653 367 267 1225 ----
NM_014574chr1411196 --1553 --
NM_014577chr221852 --1882 --
NM_014584chr141364 ------
NM_014585chr221170 348 ------
NM_014607chr21404 --22058 1564 --
NM_014612chr941081 417 378 236 ------
NM_014629chr821226 206 ------
NM_014630chr1521308 1085 11571 ----
NM_014635chr21314 ------
NM_014636chr934013 2971 1029 --23343 3173 1349
NM_014646chr1863189 2843 2784 2394 974 852 --12139 --
NM_014647chr1642167 1543 830 789 ----22059 320
NM_014655chr132319 903 571 --1917 12230
NM_014666chr51188 11140 11007 --
NM_014667chr341593 485 319 66 12192 ----
NM_014670chr21233 ------
NM_014676chr11203 ------
NM_014682chr821896 503 32149 1687 129 ----
NM_014683chr1711502 1599 ----
NM_014685chr161416 ------
NM_014686chr1952156 1934 1833 888 871 ------
NM_014689chr2------1437
NM_014702chr652668 2519 802 448 60 --13423 --
NM_014707chr71366 11816 3743 643 609 --
NM_014711chr1651763 733 650 631 104 ------
NM_014721chr665734 5182 5147 4762 1586 80 35936 1773 378 45016 4615 1743 740 --
NM_014725chrX11339 --11403 --
NM_014729chr81117 12116 12054 --
NM_014730chr1224999 1785 --34735 4579 404 --
NM_014730chr1224999 1785 --34735 4579 404 --
NM_014732chr1695136 4919 2200 2172 2013 1911 1558 1035 1028 --15163 --
NM_014733chr542027 1424 788 267 ----2231 61
NM_014735chrX11679 --1703 --
NM_014739chr663941 3828 3815 3203 2997 89 23019 1613 ----
NM_014743chr462942 2674 2232 2200 406 355 ----12266
NM_014747chr131603 1579 782 --24908 3801 12289
NM_014751chr81132 ------
NM_014752chr1141540 333 301 227 ------
NM_014755chr223362 894 2941 487 --23107 866
NM_014761chr162843 774 --1337 --
NM_014764chr124444 200 147 51 ------
NM_014765chr112479 ----1454
NM_014766chr743236 1326 1168 1123 ------
NM_014776chr1262813 2685 2561 2313 1078 686 ------
NM_014779chr331112 1093 179 ------
NM_014786chr113901 426 149 ------
NM_014787chr132701 2683 281 ----1113
NM_014795chr251123 446 383 266 192 ------
NM_014803chr1042726 1909 1023 900 --12319 --
NM_014810chr143435 1279 989 644 --23111 2698 --
NM_014812chr141746 776 498 467 1634 ----
NM_014813chr1192 ------
NM_014819chr522197 1674 ------
NM_014820chr321566 575 12027 1802 --
NM_014827chr121654 1623 ------
NM_014830chr1243771 3099 1409 1178 --13586 12977
NM_014835chr2041576 1512 1420 870 1647 ----
NM_014836chr1011354 1122 3762 468 69 --
NM_014838chr2242504 2065 403 112 1847 ----
NM_014839chr172426 2311 2009 1948 1904 1703 723 ------
NM_014840chr1242941 324 287 119 ----1609
NM_014841chr61178 ------
NM_014847chr11441 ------
NM_014848chr1562496 2273 917 763 526 304 ----11955
NM_014850chr341676 1265 1182 255 ------
NM_014862chr1554065 3532 2976 2570 919 13924 ----
NM_014868chr125924 879 774 585 331 ------
NM_014870chr133383 1163 372 24263 1826 ----
NM_014871chr121104 ------
NM_014872chr942147 599 523 346 ------
NM_014873chr144844 3865 1715 64 21938 943 ----
NM_014874chr131779 1406 327 --1156 --
NM_014877chr1755613 5293 2441 1676 371 15818 25160 2563 --
NM_014883chr432398 968 884 11006 ----
NM_014887chr131800 ----1821
NM_014891chr721270 231 --11046 --
NM_014893chrY21692 913 ------
NM_014897chr1733015 952 76 23192 374 1500 1408
NM_014899chr533038 2240 2119 1857 ----
NM_014901chr532133 1713 431 1303 ----
NM_014902chr2011048 ------
NM_014903chr1222340 209 ------
NM_014904chr1033977 3637 1168 --13880 13682
NM_014906chr1753739 949 903 748 467 13028 ----
NM_014912chr1031155 63 28 ------
NM_014923chr1331455 631 167 152 199 --
NM_014924chr1463073 2693 2596 2515 1137 785 ------
NM_014926chr311017 ------
NM_014932chr311478 ------
NM_014937chr1031277 464 231 ------
NM_014939chr1821553 369 11103 ----
NM_014942chr622589 1737 ------
NM_014947chr123135 713 --1191 --
NM_014949chr11862 ------
NM_014950chr1411729 11616 ----
NM_014952chr1562057 1420 1310 541 77 60 ------
NM_014953chr1354305 3325 1095 975 331 --13985 --
NM_014961chr421652 542 --12238 --
NM_014962chr2032050 1923 176 12688 22788 1012 --
NM_014964chr17--32274 1594 1520 --1226
NM_014978chr1021453 637 11711 ----
NM_014982chr1445241 1564 1421 1348 2581 560 13677 1533
NM_014989chr631923 757 83 ------
NM_014990chr14--11213 ----
NM_014999chr1241644 1385 1139 287 ------
NM_015000chr1282708 2275 2172 2104 1050 825 671 275 ------
NM_015002chr1222077 226 11861 ----
NM_015008chr333647 2351 1376 1333 ----
NM_015017chr151238 1149 1025 822 143 ------
NM_015020chr1663593 3116 3065 2775 1365 879 ------
NM_015024chr811463 ------
NM_015025chr232578 1928 760 --12255 --
NM_015026chr1273733 3315 1811 1710 1583 1161 416 --1827 --
NM_015039chr133954 2812 621 12819 ----
NM_015040chr243300 2428 2210 400 ------
NM_015042chr1523988 3787 --1415 --
NM_015045chr1012123 ----11917
NM_015049chr243025 2979 1289 1006 160 1550 --
NM_015051chr942589 2460 2208 314 --12344 --
NM_015052chr721305 1208 ----1383
NM_015054chr121179 ------
NM_015056chr2162651 2627 1977 1712 1009 49 1421 ----
NM_015057chr131275 ------
NM_015061chr91887 ------
NM_015064chr1252855 2786 2714 2595 981 ----12458
NM_015068chr723487 2550 --11121 1833
NM_015071chr5166273 6244 6230 6113 5876 4805 4759 4710 4574 4433 4390 477 453 292 230 195 --11421 --
NM_015074chr174203 3283 3244 1309 1107 945 136 14886 ----
NM_015076chr6114195 4069 3529 3506 1652 863 740 535 287 269 143 11227 1465 --
NM_015082chr512559 ------
NM_015090chr144616 1346 1118 910 26059 837 ----
NM_015091chr142814 282 ------
NM_015092chr1673590 3509 1546 1401 1388 498 147 14649 ----
NM_015097chr342347 2051 1875 1446 ------
NM_015110chr942293 926 821 229 --1614 --
NM_015115chr463099 2492 2248 1091 410 104 ------
NM_015130chr41341 ------
NM_015132chr731975 460 296 --11998 --
NM_015138chr151649 12512 ----
NM_015143chr42256 133 ------
NM_015144chr1673195 3049 2616 2552 671 499 295 13450 --22876 472
NM_015149chr121747 1416 --1146 --
NM_015155chr1073378 2447 2346 858 647 274 33 11084 ----
NM_015156chr1443286 3244 1091 738 12730 13916 --
NM_015157chr1121172 1119 ------
NM_015161chr162564 67 11289 ----
NM_015163chr1421242 778 ------
NM_015169chr81370 ------
NM_015172chr121593 1074 ------
NM_015176chr131249 1100 712 1216 ----
NM_015180chr141288 --1322 --
NM_015185chrX21126 858 --181 --
NM_015192chr2042800 2770 2122 435 --2518 402 --
NM_015199chr352735 2614 415 142 66 --1829 --
NM_015200chr432592 979 850 12190 12622 --
NM_015208chr1863836 3384 1512 313 297 241 --22944 52 --
NM_015215chr122709 798 --11245 --
NM_015216chr52976 179 ------
NM_015225chr972938 2699 856 822 624 394 105 ------
NM_015226chr1643231 3130 2742 1275 ----12144
NM_015230chr441577 1342 1258 147 --1695 --
NM_015231chr111790 ------
NM_015236chr431284 1247 283 11203 ----
NM_015238chr5------1231
NM_015239chr91217 ------
NM_015247chr1665056 4961 1901 1327 956 189 14700 ----
NM_015250chr951808 1789 1662 767 154 ------
NM_015252chr21117 --1897 --
NM_015263chr153820 747 245 --1445 --
NM_015267chr1222019 1582 ------
NM_015268chr31187 ------
NM_015269chr11621 ------
NM_015271chr463830 1664 1220 800 695 40 --11054 23256 2836
NM_015277chr183586 514 446 ------
NM_015278chr61236 --12898 --
NM_015282chr252841 2124 1882 349 320 ------
NM_015284chr152070 1985 1481 589 488 ------
NM_015285chr1832346 1923 364 ----12284
NM_015288chr543291 2975 1511 364 ----1540
NM_015291chr132422 770 730 23494 2147 ----
NM_015296chr13--2895 479 ----
NM_015299chr1452944 2523 1384 1226 879 --13008 --
NM_015310chr8127933 7906 6808 6715 6491 5099 3258 1672 1563 558 478 116 --12275 26732 5321
NM_015313chr1144468 1478 919 768 21160 189 ----
NM_015317chr222402 962 1760 ----
NM_015327chr1----11202 --
NM_015332chr752995 2578 1246 1191 530 ------
NM_015335chr1252548 2456 2172 861 125 ------
NM_015336chr1231834 682 435 ----12429
NM_015339chr201101 ------
NM_015344chr822040 1960 12135 ----
NM_015347chr1262463 1910 1852 951 851 775 1258 1942 --
NM_015349chr632701 2677 1040 ------
NM_015355chr1751920 1737 609 494 106 --1178 --
NM_015358chr2121057 290 ----1506
NM_015359chr832474 2411 2025 ------
NM_015360chr5----1174 --
NM_015361chr21121 ------
NM_015365chrX33710 1265 655 13822 ----
NM_015374chr2241465 1277 1226 489 ----11351
NM_015375chr153961 3715 3572 3130 725 13884 34641 4544 3926 --
NM_015378chr122205 803 1421 ----
NM_015381chr22--1773 ----
NM_015382chr141493 ------
NM_015385chr1012168 --22078 840 --
NM_015387chr221647 194 --1556 --
NM_015396chr331367 1298 472 ------
NM_015397chr931921 1848 138 ------
NM_015409chr1252709 2162 1964 298 206 --1105 --
NM_015416chr12168 1824 1946 --
NM_015423chr1121685 1408 --11174 --
NM_015424chr11163 ------
NM_015435chr82344 206 --11094 --
NM_015436chr432196 115 94 ----13134
NM_015443chr1731317 280 210 145 ----
NM_015455chr573805 3542 3488 3176 3047 1092 651 1498 53689 1621 1160 969 346 --
NM_015458chr874941 4909 3938 3561 907 880 337 11648 ----
NM_015460chr341539 804 266 80 --2516 185 --
NM_015475chr22890 131 ------
NM_015477chr152962 879 ------
NM_015483chr731127 1009 980 11022 1864 --
NM_015497chr1511075 ------
NM_015508chr341356 110 92 48 --1435 2537 298
NM_015531chr11------1148
NM_015535chr264062 4048 2957 2679 637 228 --1760 --
NM_015548chr62244 36 --1322 --
NM_015550chr72628 124 23312 389 12964 --
NM_015554chr1542193 2064 344 98 ------
NM_015564chr5--33179 829 817 13349 1801
NM_015565chr2111695 --199 --
NM_015571chr642120 982 820 203 11759 ----
NM_015575chr223690 990 ------
NM_015576chr332952 1086 497 11913 ----
NM_015577chr541749 1611 473 102 11333 1607 --
NM_015578chr1931528 1412 275 --1118 1213
NM_015601chr102718 94 ----141
NM_015626chr1711198 ------
NM_015627chr141739 612 365 113 ----1624
NM_015630chr221115 863 ------
NM_015635chr931364 804 465 1434 21928 242 --
NM_015640chr132032 1699 634 25174 4699 24207 1142 --
NM_015646chr1241270 969 517 69 11082 ----
NM_015652chr10--162 ----
NM_015678chr1321431 1368 ----11448
NM_015680chr2--124 ----
NM_015686chrX32327 1847 813 ------
NM_015691chrX31969 425 356 ------
NM_015702chr22116 28 ------
NM_015711chr191748 ------
NM_015833chr211246 --11963 --
NM_015840chr132117 866 67 ------
NM_015841chr132117 866 67 ------
NM_015850chr842457 2387 2234 285 ------
NM_015855chr111607 1688 ----
NM_015866chr131421 1097 242 --171 11357
NM_015872chr131752 1627 1381 ------
NM_015879chr18138609 8011 7549 7400 7299 5962 2029 1948 1415 1258 924 815 143 36867 6369 3415 48427 5867 1205 858 27931 7623
NM_015885chr11------1701
NM_015886chr845046 4572 4333 734 --12106 --
NM_015888chr142999 2723 2636 1095 --12547 --
NM_015889chr221873 ------
NM_015891chr632078 1416 574 ----11583
NM_015902chr82797 630 1763 1177 --
NM_015905chr72582 494 ------
NM_015906chr114013 --24537 3433 --
NM_015912chr83893 410 108 1829 ----
NM_015913chr11134 1746 ----
NM_015932chr13188 ----1182
NM_015938chr33422 301 275 ------
NM_015939chr203672 245 40 1615 ----
NM_015975chrX2295 204 ------
NM_015980chr521563 566 ----1356
NM_015990chr421102 266 1718 ----
NM_016018chr842852 2625 390 50 1669 ----
NM_016019chr72729 52 ------
NM_016022chr11829 ------
NM_016032chrX31190 521 250 --11095 --
NM_016041chr172275 126 ------
NM_016061chr221577 1091 --11650 1469
NM_016073chr151780 ------
NM_016076chr153184 2728 2685 2300 2080 ------
NM_016078chr171208 --1764 --
NM_016083chr673834 3776 3540 3335 3054 1521 1409 --23168 410 12508
NM_016090chr1111066 ------
NM_016098chr63344 336 40 ------
NM_016107chr5----11286 --
NM_016120chrX--1750 ----
NM_016121chr1----11032 --
NM_016123chr1231097 927 473 ------
NM_016129chr42375 75 ------
NM_016131chr242333 1996 1866 1691 ----1873
NM_016133chr221265 250 --11611 --
NM_016151chr16243 36 ------
NM_016152chr3----11153 --
NM_016162chr121655 ------
NM_016169chr1022876 1225 13285 ----
NM_016185chr172246 111 ------
NM_016190chr1126 ------
NM_016195chr101616 195 ----
NM_016203chr71255 1193 ----
NM_016206chr368459 6908 6415 1082 430 192 12310 26932 518 26890 3535
NM_016213chr15--147 ----
NM_016224chr631743 1687 245 ------
NM_016227chr111226 ------
NM_016231chr1711573 ------
NM_016235chr1621273 1230 ------
NM_016248chr1363473 3079 2431 1563 733 141 23890 343 --11492
NM_016255chr673311 2832 2781 2679 1324 1130 307 --11054 --
NM_016258chr1----1582 --
NM_016260chr276627 5532 2457 2335 1919 1251 957 --1693 11931
NM_016269chr431166 1070 980 ------
NM_016271chr1811685 ------
NM_016275chr352781 2295 2232 949 570 136 ----
NM_016277chr641438 1222 479 371 21504 47 ----
NM_016279chr5138 ------
NM_016281chr1221022 466 ------
NM_016287chr131867 1811 1626 --11764 1428
NM_016289chr232282 67 39 1319 ----
NM_016291chr3122 ------
NM_016303chrX159 ------
NM_016308chr151653 1284 835 630 499 --11492 --
NM_016315chr2------11703
NM_016320chr1131142 831 77 ------
NM_016322chr963068 2118 1033 945 842 60 --22617 2190 1294
NM_016338chr541074 951 937 844 1475 ----
NM_016374chr161393 1221 1205 1128 141 22 --198 --
NM_016374chr161393 1221 1205 1128 141 22 --198 --
NM_016376chr1743776 3484 3390 356 23058 1457 11614 13941
NM_016377chr621549 1346 ------
NM_016396chr1523013 2221 ------
NM_016403chr112616 546 ------
NM_016410chr9--1188 ----
NM_016422chr1132731 978 78 1187 ----
NM_016424chr1721428 576 ------
NM_016436chr2072634 2607 2468 2386 2181 2141 751 --12090 --
NM_016441chr242324 1675 429 174 --1768 1125
NM_016447chr7--1186 ----
NM_016448chr131804 1241 254 ------
NM_016472chr1411031 --1310 --
NM_016485chr631918 902 154 ------
NM_016488chr1221674 452 1442 11705 --
NM_016507chr1721179 1113 12026 ----
NM_016525chr9------1764
NM_016529chr131256 --1323 --
NM_016530chr1543362 1141 486 406 ------
NM_016531chr464123 3556 3459 3352 3036 809 44229 3312 3051 2881 ----
NM_016542chrX21108 602 ------
NM_016545chr1--1263 1734 --
NM_016559chr321114 583 --1384 123
NM_016577chr344328 4243 2874 1385 ------
NM_016586chr143409 391 202 ------
NM_016587chr71449 --1174 --
NM_016598chr331181 1148 145 --151 --
NM_016603chr5102222 2058 1881 1822 1531 1478 803 529 263 100 ----11631
NM_016620chr1--1471 1524 --
NM_016621chr1111200 --11724 --
NM_016626chr181397 --21162 218 11710
NM_016644chr52179 68 1351 ----
NM_016656chrX--1385 ----
NM_016733chr2221533 44 ------
NM_016818chr212668 573 ------
NM_016824chr10--1442 21225 485 --
NM_016953chr255454 1175 842 359 118 13811 --14076
NM_017410chr1221125 935 ------
NM_017412chr81264 ------
NM_017415chr554016 4007 3935 3300 1170 13403 ----
NM_017420chr1453675 1361 716 508 183 ----11045
NM_017423chr421466 759 --1463 --
NM_017426chr42500 265 ------
NM_017489chr811110 --1107 --
NM_017522chr12245 49 11160 ----
NM_017545chr201597 --1466 --
NM_017548chr31138 1817 ----
NM_017551chr1012696 --11902 --
NM_017558chr16--1455 ----
NM_017563chr375726 4994 4269 1264 417 137 23 26392 332 15482 26253 1915
NM_017569chr13148 ----184
NM_017580chr1052034 1970 1919 1721 368 ------
NM_017595chr1731215 635 493 ------
NM_017610chr1521896 102 11478 ----
NM_017612chr12------157
NM_017629chr13749 628 228 1134 21788 154 1525
NM_017632chr41310 ------
NM_017633chr663564 2814 2771 2476 2404 1363 ------
NM_017634chr821663 206 11807 ----
NM_017635chr1121282 93 --11157 --
NM_017637chr989339 7934 7337 6098 2061 1459 1404 796 ----1675
NM_017641chr121169 ------
NM_017645chr913028 ----22984 286
NM_017650chr765484 5158 3928 3911 824 455 14846 --11238
NM_017657chr21135 ------
NM_017658chr1443962 3322 1247 280 11219 23087 1232 14430
NM_017661chr151526 ------
NM_017686chr141136 1052 790 753 ------
NM_017709chr153324 2904 1259 1032 651 13284 --12712
NM_017719chr32671 293 1541 ----
NM_017734chr12241 51 ------
NM_017736chr1621164 111 --11953 --
NM_017737chr131760 643 158 ----2786 574
NM_017738chr91477 1277 ----
NM_017742chr1811534 21256 1216 ----
NM_017752chrX31757 823 178 12117 ----
NM_017758chr1711505 ------
NM_017761chr141510 1464 433 134 ------
NM_017762chr1572180 2105 1869 1777 962 621 605 22307 128 ----
NM_017769chr1412850 11249 11033 1424
NM_017770chr631132 323 188 1943 22983 841 11076
NM_017778chr861448 1326 1103 1067 526 462 ------
NM_017780chr82676 193 1332 1788 --
NM_017786chr81127 1609 ----
NM_017787chr1021877 518 ----172
NM_017799chr1431912 280 143 ----11770
NM_017811chr91762 ------
NM_017813chr865568 5040 4056 877 707 343 --25611 828 --
NM_017824chr1052290 934 401 210 137 ------
NM_017848chrX64172 3423 1868 1264 689 371 ------
NM_017856chrX41697 674 511 156 ------
NM_017873chr973096 2689 2637 2413 1215 803 222 --174 --
NM_017893chr1021166 1019 ------
NM_017902chr1065753 4840 3576 2012 1055 170 11698 23594 86 --
NM_017913chr91129 ------
NM_017915chr122985 142 ----1414
NM_017922chr14--1242 ----
NM_017925chr951867 1827 1305 452 157 ------
NM_017933chr241428 1366 1027 33 11639 ----
NM_017938chrX32080 762 268 ------
NM_017944chr1162991 2907 2789 2539 1205 195 ----1119
NM_017948chr91348 ------
NM_017952chr252866 2797 1697 846 222 23876 2950 --14353
NM_017958chr252577 2289 2136 781 214 1143 --13062
NM_017987chr102624 510 --22138 1433 1863
NM_017988chr123785 190 91 ------
NM_017994chr742883 2530 1141 343 ------
NM_018011chr131617 ------
NM_018014chr21976 ------
NM_018027chr1053317 2713 1248 539 218 ------
NM_018046chr541873 1777 1720 615 ------
NM_018061chr131468 659 496 ------
NM_018078chr441072 840 321 177 ------
NM_018084chr252118 2076 709 488 339 --22691 207 --
NM_018086chr211546 --21865 678 --
NM_018087chr1170 ------
NM_018092chr16----2269 252 --
NM_018098chr3189 ------
NM_018117chr101491 ------
NM_018120chr811093 ------
NM_018121chr1012596 12343 ----
NM_018126chr41600 --140 --
NM_018133chr321980 1634 ------
NM_018151chr21615 ------
NM_018155chr342850 2473 2193 233 --12773 --
NM_018156chr122205 803 1421 ----
NM_018157chr1243268 2826 2245 1098 12253 12697 --
NM_018164chr12168 ------
NM_018181chr1831759 509 94 ------
NM_018182chr1712198 ------
NM_018184chr361525 1429 1395 832 618 139 11901 ----
NM_018191chr1321918 42 ------
NM_018200chr1531988 830 752 --11998 --
NM_018206chr161299 ------
NM_018208chr1138 11188 ----
NM_018243chr423228 2605 11270 23737 522 --
NM_018246chr852735 938 875 747 324 12116 12700 --
NM_018247chr622342 1918 12212 --22557 959
NM_018254chr142057 1827 946 489 ------
NM_018257chr2052594 2432 1929 1701 1007 1513 ----
NM_018270chr203697 336 41 --1320 --
NM_018293chr342307 1184 772 625 --154 --
NM_018313chr31718 ----1946
NM_018314chr111650 1756 ----
NM_018315chr41430 ------
NM_018330chr101175 11677 ----
NM_018334chr71186 ------
NM_018351chr1244722 2949 1306 918 --1816 --
NM_018361chr843785 3446 2978 765 ----1332
NM_018364chr163761 3727 3004 1242 581 402 --11049 --
NM_018367chr1132232 625 450 1960 ----
NM_018370chr1231965 1593 467 ------
NM_018374chr724707 192 11321 14748 --
NM_018388chrX11342 ----1172
NM_018403chr363132 2734 1279 1052 669 598 --21298 651 --
NM_018416chr1232342 1834 1758 ------
NM_018424chr931620 1461 746 1727 ----
NM_018429chr532095 1773 203 11110 ----
NM_018433chr22573 469 1582 ----
NM_018440chr8178680 8164 7945 7855 7504 7331 7211 6914 6170 5879 5396 5316 5267 3086 2260 714 368 12504 32696 2150 1657 13466
NM_018442chr1122 ------
NM_018444chr862044 1718 1544 460 374 107 ------
NM_018446chr3128 ------
NM_018448chr121171 149 ----
NM_018452chr6_random43064 374 139 130 --12597 --
NM_018462chr31887 ------
NM_018465chr91222 ------
NM_018477chr142828 116 1138 ----
NM_018482chr832554 2090 245 11916 ----
NM_018489chr131785 584 302 --22156 1650 --
NM_018490chr112513 88 ------
NM_018527chr132169 107 ------
NM_018557chr231493 1288 213 1664 196 11454
NM_018566chr184993 4411 4072 3499 1605 1543 1142 989 --11294 34454 3719 1828
NM_018584chr1183 ------
NM_018590chr1021203 207 --144 --
NM_018602chr151122 ------
NM_018638chr1234676 4127 3631 14906 --15253
NM_018640chr1232490 691 563 --137 12509
NM_018650chr131749 674 631 ------
NM_018652chr1551044 959 790 784 285 ------
NM_018671chr151232 ------
NM_018682chr71595 --1704 --
NM_018685chr7--1824 ----
NM_018695chr522286 1715 --11860 --
NM_018698chrX31654 1207 163 1261 182 --
NM_018710chr831115 925 161 ------
NM_018712chr1141531 1139 521 215 ----1307
NM_018713chr13890 265 39 ------
NM_018717chr422459 2110 1505 ----
NM_018718chr7159 ------
NM_018834chr51233 ------
NM_018844chr742050 1739 146 91 ------
NM_018846chr71240 --1824 --
NM_018890chr711032 --11483 1365
NM_018898chr512263 11974 --12015
NM_018899chr512263 11974 --12015
NM_018900chr512263 11974 --12015
NM_018901chr512263 11974 --12015
NM_018902chr512263 11974 --12015
NM_018903chr512263 11974 --12015
NM_018904chr512263 11974 --12015
NM_018905chr512263 11974 --12015
NM_018906chr512263 11974 --12015
NM_018907chr512263 11974 --12015
NM_018908chr512263 11974 --12015
NM_018909chr512263 11974 --12015
NM_018910chr512263 11974 --12015
NM_018911chr512263 11974 --12015
NM_018931chr51271 ------
NM_018945chr662808 1416 872 544 330 197 ------
NM_018955chr17251 41 ------
NM_018970chr782857 2645 1999 1131 664 560 482 348 --1859 --
NM_018976chr1242272 1877 1849 472 ------
NM_018977chrX31099 828 782 --1675 --
NM_018979chr12--12553 1607 --
NM_018983chr41225 142 ----
NM_018999chr1054637 4513 4341 3941 1489 13788 11627 14152
NM_019001chr363679 1769 680 381 147 91 21911 266 1729 --
NM_019003chrX------1129
NM_019022chr1853159 2831 598 453 212 12988 ----
NM_019027chr442058 1751 604 269 1565 1497 --
NM_019028chr111158 --1334 --
NM_019044chr2104463 4212 3515 3318 3115 2923 1666 1559 959 244 --14176 1384
NM_019045chrX1785 1330 ----
NM_019049chr11209 --1617 --
NM_019050chr452021 1990 648 531 435 ------
NM_019058chr101212 ------
NM_019059chr71327 2520 156 ----
NM_019072chr553928 3731 3597 1174 605 23760 2907 22778 257 --
NM_019084chr101731 ------
NM_019087chr511646 1185 ----
NM_019091chr231099 991 967 ------
NM_019102chr7122 ----160
NM_019102chr7122 ----160
NM_019555chr32156 87 --11290 --
NM_019556chrX11166 ----1528
NM_019557chr11335 --1880 --
NM_019558chr21316 ------
NM_019590chr101547 ------
NM_019593chr2052801 447 373 297 73 --13167 --
NM_019597chrX1208 1751 ----
NM_019610chr121690 857 --1251 --
NM_019843chr222151 101 ------
NM_019854chr121698 ------
NM_019885chr242810 2517 1124 948 1677 22659 2411 --
NM_019891chr11963 ------
NM_019903chr10--1442 21225 485 --
NM_020066chr12400 193 1291 ----
NM_020116chr4----1331 --
NM_020122chr285927 5420 4734 2350 1964 1823 933 608 ------
NM_020123chr1041005 402 333 235 --11241 --
NM_020132chr2174904 4824 4269 3475 3135 1194 1072 14105 ----
NM_020144chr721412 603 11688 12099 --
NM_020148chr1862983 2822 1987 1158 1090 114 33063 2058 214 --12036
NM_020150chr1032251 1617 1384 ------
NM_020156chr71584 2602 47 141 --
NM_020159chr421720 595 1629 ----
NM_020177chr553306 2290 903 649 86 --43132 133 67 24 --
NM_020178chr171211 ------
NM_020182chr2033328 1196 619 ------
NM_020190chr1--1467 ----
NM_020193chr1131302 1228 88 1525 ----
NM_020198chr1751583 1127 1075 626 321 ------
NM_020205chr122314 206 12277 1954 --
NM_020245chr674801 4633 4349 3993 994 482 370 14987 --13803
NM_020310chr1732780 954 186 12821 ----
NM_020319chr71819 1684 ----
NM_020336chr2012950 13696 12349 12610
NM_020337chr42531 242 ------
NM_020338chr1033287 3269 3170 --1497 --
NM_020341chr2031512 481 398 ----22024 1722
NM_020342chr271818 1733 964 553 535 160 107 11742 --11931
NM_020348chr1022754 2628 ----11946
NM_020354chr10--1749 ----
NM_020357chr311411 ------
NM_020384chrX31773 1343 701 --11184 --
NM_020390chr354652 4633 4512 4139 3550 2639 400 21801 1364 --
NM_020403chr13------1466
NM_020416chr41818 ----1103
NM_020423chr11206 ------
NM_020429chr732283 735 208 ------
NM_020432chr731587 212 48 ------
NM_020449chrX2486 181 ------
NM_020453chr42270 108 --1144 --
NM_020456chr1341563 608 200 35 ------
NM_020466chr6104286 4244 3382 1956 1728 1536 1356 1217 783 330 33690 3248 818 ----
NM_020473chrX41862 1271 1258 756 21416 1380 ----
NM_020546chr522181 194 12103 22559 249 11108
NM_020630chr103458 140 22 ------
NM_020640chr331485 793 460 22309 2105 ----
NM_020644chr112858 298 ------
NM_020647chr811856 ------
NM_020651chr221294 1173 1108 1721 --
NM_020654chr331352 1077 63 ------
NM_020673chr20127143 7015 6699 5514 5485 4919 2440 1702 1417 1066 548 345 --17382 26939 5798
NM_020686chr1632273 344 137 12399 --12899
NM_020689chr2021700 436 ----21598 1476
NM_020693chr11179 ------
NM_020699chr175331 5001 4024 1914 1712 1591 503 --43914 3856 2166 1385 --
NM_020703chr1--1589 ----
NM_020704chr712529 ----12130
NM_020717chrX104716 4470 4199 3432 1835 1139 964 338 315 269 ------
NM_020718chr1675825 5764 5306 1708 1617 1430 860 ----12250
NM_020726chr51209 ------
NM_020727chr2143476 3362 2964 816 1917 11228 --
NM_020728chr762638 2352 2207 2115 1996 1075 22298 988 ----
NM_020734chr1213365 ------
NM_020738chr241505 1355 1214 257 ------
NM_020739chr1534207 1584 22 13215 13435 --
NM_020740chr171356 ------
NM_020749chr831284 263 36 1512 ----
NM_020752chr1072771 2199 2002 1942 1079 1035 551 --21136 449 --
NM_020755chr611224 1560 --1348
NM_020760chr221604 377 11850 ----
NM_020764chr1611055 ------
NM_020766chrX74090 3934 3415 1786 749 517 456 --24066 1687 --
NM_020772chr1797939 7827 7102 6824 3037 2887 2756 2069 1297 38290 7781 3311 37674 1259 39 --
NM_020774chr1876020 5753 5579 4351 2342 2137 1266 ------
NM_020782chr12114817 4606 4246 3462 3445 3301 3195 1797 1014 737 437 --14075 14438
NM_020791chr1741323 1002 182 93 --11432 --
NM_020792chr342463 1778 683 467 ------
NM_020794chr111390 ----1141
NM_020796chr522565 2281 ------
NM_020801chr552352 2259 2185 892 804 1495 ----
NM_020804chr642323 2134 782 167 ------
NM_020805chr1831816 1647 442 11984 ----
NM_020806chr142750 589 ------
NM_020809chr111303 22262 1616 --1465
NM_020810chr1422488 907 ----1303
NM_020819chr6--11099 --11049
NM_020824chr102154 131 ------
NM_020825chr1683481 3153 3091 2960 924 666 381 226 1862 ----
NM_020830chr283184 2843 1151 960 892 596 466 79 --12598 --
NM_020841chr1273212 3166 2662 2525 861 748 521 11033 13830 --
NM_020850chr1633218 3137 2812 --1500 --
NM_020853chr1231733 1065 618 1219 12770 --
NM_020854chr184964 145 110 72 --1488 --
NM_020856chr193405 395 311 2415 290 --11583
NM_020858chr1532328 516 301 --11475 11922
NM_020860chr41458 ------
NM_020868chr21149 1257 ----
NM_020871chrX42409 1997 1005 621 --11770 1941
NM_020872chr31505 --31422 389 271 --
NM_020909chr274091 4057 1582 1091 877 719 35 14144 --11430
NM_020917chr1963723 3053 2790 1147 1135 326 ------
NM_020918chr1042885 2734 2722 1415 --13029 --
NM_020920chr141304 1395 ----
NM_020921chr1443291 2979 2490 1369 --13338 22548 781
NM_020922chrX----1301 --
NM_020924chr9------1133
NM_020935chr294554 4095 3803 2855 1618 1083 600 234 32 --1872 --
NM_020940chr1042462 2256 2229 273 22720 1810 ----
NM_020946chr941677 1527 1256 537 1278 11697 --
NM_020948chr153169 2913 2694 2363 897 11145 12515 --
NM_020952chr91177 ------
NM_020975chr102574 243 --11327 11390
NM_020977chr451976 1849 1757 1534 720 --188 --
NM_020987chr1021343 548 ------
NM_021005chr151994 1201 ----
NM_021007chr241969 1739 1679 1663 ----1738
NM_021019chr121180 ------
NM_021033chr132847 434 --23183 516 --
NM_021038chr333135 3106 2598 --11162 1753
NM_021064chr641214 629 462 335 ------
NM_021069chr411680 ------
NM_021072chr541704 583 553 217 --12212 --
NM_021079chr1712906 ------
NM_021083chrX83549 3491 3415 3308 3272 2936 2556 253 --12952 --
NM_021088chr261844 784 578 485 413 146 1425 1355 --
NM_021090chr2254646 3468 1867 1144 792 14204 1513 --
NM_021097chr22801 139 22929 926 ----
NM_021102chr191383 ------
NM_021109chrX244 27 ------
NM_021109chrX244 27 ------
NM_021111chr921280 349 1553 ----
NM_021116chr799067 7882 7240 6725 6271 5644 1216 843 135 15948 1288 15924
NM_021120chrX2736 627 1729 1263 --
NM_021132chr101937 ------
NM_021136chr142582 467 ------
NM_021137chr173590 501 190 ----11624
NM_021139chr41375 ------
NM_021140chrX2802 164 ------
NM_021144chr91182 ----136
NM_021145chr73941 718 361 ------
NM_021151chr73984 393 23 ------
NM_021159chr41298 ------
NM_021163chr733133 120 111 23057 2655 12923 22405 490
NM_021183chrX3762 717 697 ------
NM_021190chr11529 ------
NM_021202chr2052510 2205 1920 776 425 --12502 --
NM_021204chr41958 2648 328 ----
NM_021238chr1231528 1491 772 ------
NM_021244chr61174 168 ----
NM_021255chr1421444 839 ------
NM_021622chr1021583 242 ----1334
NM_021633chr12312 273 ------
NM_021643chr241230 740 380 372 ------
NM_021649chr531655 454 445 ------
NM_021705chr631259 414 299 --11155 11107
NM_021728chr142728 265 1770 ----
NM_021738chr101586 --2564 280 --
NM_021813chr685721 5588 4556 4468 3715 982 757 69 1864 --12102
NM_021814chr641453 1146 599 221 11588 ----
NM_021817chr1--1300 ----
NM_021818chr142570 75 ------
NM_021907chr21252 ------
NM_021911chr585221 4856 4761 4528 3669 3601 1590 330 --24157 1890 --
NM_021912chr1543392 2746 1587 736 ------
NM_021914chr145974 944 510 433 404 21833 503 1278 --
NM_021935chr321024 214 ------
NM_021940chr621066 245 --1455 --
NM_021945chr642363 2282 854 263 ------
NM_021946chrX11257 --1143 --
NM_021947chr174842 446 347 286 ------
NM_021949chrX12099 --12720 --
NM_021959chr6121 ------
NM_021961chr1154587 1499 1380 1008 361 1790 16058 --
NM_021962chr1731794 356 104 ------
NM_021964chr394628 4037 2242 1999 925 561 222 175 33 12568 --15393
NM_021973chr41230 ------
NM_021976chr61670 --2770 302 --
NM_021979chr141364 ------
NM_021980chr1021409 169 ------
NM_021988chr20--11402 ----
NM_021998chrX21522 1134 --2558 203 --
NM_022048chr1565879 4449 1668 1395 1335 549 ------
NM_022051chr11566 ------
NM_022058chr22556 30 --1508 --
NM_022060chr1411354 ------
NM_022064chr3------1208
NM_022068chr182178 81 ------
NM_022075chr12801 66 ------
NM_022079chr102718 94 ----141
NM_022080chr203626 342 247 ------
NM_022097chr162420 253 1157 ----
NM_022118chr131426 ------
NM_022130chr521181 369 --11393 --
NM_022166chr1666117 5763 5372 4628 1131 221 --1534 15556
NM_022170chr721560 1083 ------
NM_022373chr72963 359 ------
NM_022442chr20--11402 ----
NM_022456chr1256209 5168 2121 412 216 24973 1578 ----
NM_022459chr1346151 4351 1395 1189 21990 49 14533 --
NM_022465chr1262990 1932 663 592 518 182 ----1413
NM_022469chr141065 483 317 126 --12545 --
NM_022473chr1544469 2981 1310 773 ------
NM_022474chr1452788 2067 1855 454 259 --11080 11831
NM_022476chr1641073 420 226 183 11082 1332 --
NM_022483chr531897 691 585 --11501 --
NM_022484chr721391 33 11096 ----
NM_022488chr3--1132 ----
NM_022497chr3113775 3751 3286 3254 3130 3106 2510 1200 996 827 678 23474 125 1432 --
NM_022571chr14147 ------
NM_022650chr51207 ------
NM_022652chr121126 ------
NM_022658chr1221338 458 11175 ----
NM_022716chr133170 2773 2296 ----1673
NM_022719chr22113842 3722 3691 2940 2489 2423 1488 947 716 431 171 --13376 --
NM_022726chr6--11568 ----
NM_022735chr131601 1260 172 11674 186 --
NM_022749chr821038 68 ------
NM_022753chr142081 1050 622 59 --12224 1298
NM_022755chr922015 663 --1160 --
NM_022763chr342561 2487 2385 684 --12044 --
NM_022771chr122385 57 1874 ----
NM_022780chr231559 1390 1162 --1690 --
NM_022781chr942227 907 659 132 22276 252 1583 --
NM_022782chr12--143 ----
NM_022805chr15--199 ----
NM_022806chr15--199 ----
NM_022807chr15--199 ----
NM_022808chr15--199 ----
NM_022824chr531188 561 436 ----1737
NM_022826chr21929 ------
NM_022831chr121651 1632 ------
NM_022841chr1542727 2587 857 383 31991 674 620 22276 1709 12515
NM_022843chr1321407 184 1584 --1206
NM_022844chr162940 257 ------
NM_022845chr1691426 743 636 529 502 445 258 166 106 12038 11701 --
NM_022893chr252995 2602 2280 2165 796 13153 --1585
NM_022894chr231439 477 180 ------
NM_022897chr51331 ------
NM_022898chr1494630 4284 4233 4095 1531 856 694 662 132 11333 11280 --
NM_022918chr1132163 1518 1475 1695 --11680
NM_023000chr1441635 482 279 82 --11542 --
NM_023001chr1441635 482 279 82 --11542 --
NM_023008chr191132 --178 --
NM_023010chrX1846 ------
NM_023012chr123773 535 81 1758 ----
NM_023016chr252797 2510 2473 2060 502 ------
NM_023071chr1241104 992 729 437 1811 ----
NM_023074chr191993 184 ----
NM_023076chr1692964 2467 2415 1852 991 720 564 384 48 ------
NM_023105chr842457 2387 2234 285 ------
NM_023106chr842457 2387 2234 285 ------
NM_023110chr842457 2387 2234 285 ------
NM_023111chr842457 2387 2234 285 ------
NM_023112chr1422759 2536 ----12994
NM_023923chr17759 579 539 533 149 135 82 ------
NM_023929chr841795 903 867 423 ----12622
NM_024007chr522979 2555 11991 ----
NM_024017chr171618 ------
NM_024052chr1721044 991 ----12041
NM_024054chr7--1343 ----
NM_024061chr71606 ------
NM_024090chr41758 --1223 --
NM_024095chr123399 327 61 ------
NM_024107chr172670 582 --1734 --
NM_024117chr921161 175 ------
NM_024297chr17----1459 --
NM_024312chr12246 35 ------
NM_024325chr2011282 11073 ----
NM_024345chr994594 3891 1967 1575 1352 1290 561 218 152 --1770 --
NM_024408chr163481 3468 3217 3035 1083 1037 ------
NM_024415chr51228 ------
NM_024416chr931304 392 301 --1226 --
NM_024429chr71255 1193 ----
NM_024496chr141279 ------
NM_024513chr363463 3364 722 434 163 71 ------
NM_024524chr333177 2096 90 ------
NM_024525chr11558 ------
NM_024529chr1----1257 --
NM_024539chrX1473 ------
NM_024548chr311617 ------
NM_024567chr81275 ------
NM_024574chr41113 ------
NM_024581chr61179 ------
NM_024582chr42745 251 ------
NM_024583chr23855 249 190 ------
NM_024607chr853839 3597 3510 983 234 11698 ----
NM_024612chr173978 800 105 --183 1373
NM_024613chr821352 304 11543 1507 --
NM_024615chr51228 ------
NM_024617chr91714 ------
NM_024639chr621862 551 1296 ----
NM_024645chr821603 41 --1297 --
NM_024646chr183814 3628 2767 1580 1395 1227 786 141 ------
NM_024656chr1951562 1555 1054 382 259 ----21038 169
NM_024665chr363362 1851 1810 1779 962 249 11302 34382 3603 3415 11709
NM_024674chr152464 778 668 439 100 ------
NM_024680chr111378 ------
NM_024689chrX11159 ----137
NM_024700chr1----291 71 --
NM_024702chr172528 86 ------
NM_024713chr1541355 1334 236 25 ------
NM_024721chr842079 1052 513 212 ------
NM_024725chr111160 --1204 --
NM_024743chr41533 ------
NM_024745chr163718 385 310 ------
NM_024749chr161987 1623 822 700 598 458 ----1627
NM_024755chr152763 375 ------
NM_024759chr81183 1770 --1560
NM_024770chr286438 5893 5707 5669 5590 1947 676 273 16687 --14954
NM_024786chr59790 769 748 727 704 681 660 637 616 ------
NM_024792chr174952 403 181 55 ------
NM_024834chr101663 ------
NM_024841chr1131849 953 711 ------
NM_024852chr1133 ------
NM_024881chr1963698 3577 2592 1084 987 340 ------
NM_024884chr1443769 2932 364 27 159 43919 3913 3244 1347 --
NM_024896chr972290 2255 983 650 510 347 224 --32000 1643 156 1840
NM_024900chr421843 525 22274 1686 ----
NM_024900chr421843 525 22274 1686 ----
NM_024939chr1621679 1453 --11062 --
NM_024941chr5--11302 --11175
NM_024947chr379392 9314 9164 8841 8586 6502 1330 11149 39174 5826 2124 11105
NM_024953chr1252617 2182 2072 1837 604 124 ----
NM_024960chr202436 94 1452 ----
NM_024971chr91177 ------
NM_024989chr247926 7063 2113 361 --48092 8037 2887 338 16131
NM_024991chr1012168 --22078 840 --
NM_024993chr2123 --1237 11464
NM_025040chr1912471 21543 1524 1975 11981
NM_025054chr831409 1269 1133 ------
NM_025069chr8--1193 ----
NM_025073chr163640 1514 538 349 315 69 --13921 21272 920
NM_025083chr1531996 1843 663 ----12031
NM_025133chr23773 422 308 1949 1211 --
NM_025134chr1641693 503 241 201 ----12142
NM_025138chr131471 ------
NM_025146chr321037 504 1722 ----
NM_025147chr22226 95 --11067 --
NM_025151chr852135 2041 1717 1609 821 ------
NM_025152chr1441356 1230 708 659 ------
NM_025154chr731272 1084 363 1518 ----
NM_025160chr143881 1342 590 419 11557 ----
NM_025179chr133855 3183 1315 --11679 --
NM_025180chr363341 3271 3163 1371 676 175 1310 ----
NM_025181chr21180 --1626 --
NM_025182chr91985 --1819 --
NM_025187chr162466 446 ------
NM_025191chr132957 2423 285 13376 2840 240 --
NM_025195chr82685 331 21745 637 ----
NM_025221chr4------1892
NM_025222chr342801 2286 1868 483 --12165 --
NM_025227chr20--1299 ----
NM_025235chr1042031 422 370 208 1251 12195 --
NM_025237chr171311 ------
NM_025248chr1722383 886 1900 --11030
NM_025263chr611220 --21578 684 --
NM_030621chr1463575 3385 2899 1454 1345 750 13955 ----
NM_030625chr1022581 625 1261 ----
NM_030627chr583935 3871 3645 3270 3056 1585 1220 881 --21637 612 --
NM_030629chr1631867 1746 660 ------
NM_030637chr141140 ------
NM_030647chr756252 6015 4879 3867 1514 1570 --35504 5203 2299
NM_030648chr4105588 5294 4421 3592 2152 1197 1125 696 231 55 33539 2033 802 11046 --
NM_030650chr243751 588 525 74 13259 1761 13646
NM_030661chr721364 553 --11576 --
NM_030751chr101506 ------
NM_030751chr101506 ------
NM_030752chr61170 ------
NM_030755chr1432285 2068 322 --1159 --
NM_030759chr101537 ------
NM_030780chr811408 ------
NM_030791chr1411140 ------
NM_030806chr178753 7932 7730 6586 6515 6506 2936 16593 49262 1449 907 101 12731
NM_030816chr123115 848 ------
NM_030820chr6------2733 211
NM_030881chr22--12354 11804 --
NM_030885chr341430 802 469 84 12341 ----
NM_030891chr2121332 1109 ------
NM_030906chr112417 52 1196 ----
NM_030913chr11231 ------
NM_030915chr232342 824 802 ------
NM_030917chr41188 ------
NM_030918chr175160 4631 3820 2151 1378 1173 1131 14655 ----
NM_030920chr121888 1572 ------
NM_030934chr141763 1524 1238 1199 ----1703
NM_030953chr51109 ------
NM_030962chr1111580 1222 1599 --
NM_030964chr553380 2952 2722 2583 196 ------
NM_030979chr131333 ------
NM_031157chr121234 ------
NM_031216chr1841707 872 644 184 ------
NM_031217chr111128 ------
NM_031226chr152464 32 ------
NM_031243chr742383 2018 1614 313 ----11641
NM_031262chr9----1774 --
NM_031263chr9----1831 --
NM_031268chr1654606 4497 3696 2076 133 ------
NM_031296chr452672 1763 931 522 422 ------
NM_031362chr252410 1843 1772 401 204 12779 ----
NM_031365chr252546 1979 1908 537 340 12915 ----
NM_031366chr252546 1979 1908 537 340 12915 ----
NM_031371chr161393 1221 1205 1128 141 22 --198 --
NM_031371chr161393 1221 1205 1128 141 22 --198 --
NM_031411chr512263 11974 --12015
NM_031419chr321483 408 ------
NM_031424chr201156 ------
NM_031435chr1242981 648 447 67 --12894 --
NM_031442chrX22167 2142 --11109 1925
NM_031453chr1042049 1005 584 326 ------
NM_031469chr642943 1489 455 104 1767 --13464
NM_031483chr2032772 2625 772 --13417 --
NM_031492chr11----1509 --
NM_031844chr154141 3379 3254 675 212 1454 12857 14134
NM_031845chr233342 3310 608 12411 ----
NM_031847chr233342 3310 608 12411 ----
NM_031849chr512263 11974 --12015
NM_031857chr512263 11974 --12015
NM_031860chr512263 11974 --12015
NM_031890chr2233020 2748 776 1817 ----
NM_031892chrX3971 307 207 ------
NM_031942chr23928 454 358 11053 ----
NM_031953chr41476 ------
NM_031992chr721560 1083 ------
NM_032017chr142079 1639 1591 1533 --127 --
NM_032028chr51539 ----1630
NM_032042chr582817 2707 2010 680 668 245 232 153 ------
NM_032047chr332118 2057 429 ------
NM_032052chr221984 ------
NM_032102chr1122049 929 ------
NM_032121chrX22608 34 ------
NM_032124chr181417 1136 ----
NM_032144chr231671 1139 545 ----1426
NM_032145chr631334 1246 155 --21398 441 21687 1469
NM_032147chr12------11042
NM_032154chr101943 ------
NM_032186chr1--1471 1524 --
NM_032189chr1344315 3667 1159 906 34842 4307 1895 1121 --
NM_032199chr1043723 3463 3219 989 22912 1178 ----
NM_032208chr232794 2414 2265 ----12969
NM_032217chr43994 303 212 ------
NM_032221chr2051490 1323 818 670 269 ----11925
NM_032228chr1133407 2883 963 --12667 23244 1001
NM_032229chr132998 180 ------
NM_032236chr1--2182 70 1938 --
NM_032239chr42923 904 ------
NM_032242chr353324 2454 2067 914 420 --1243 --
NM_032268chr1653044 2152 1104 1016 818 1130 ----
NM_032289chr511900 11909 ----
NM_032291chr11289 --1623 --
NM_032303chr921384 494 ------
NM_032312chr22253 134 ------
NM_032320chr112192 70 ------
NM_032352chr1461427 1401 1210 580 425 133 ------
NM_032373chr1085699 5298 4939 4747 4205 3924 879 40 12201 ----
NM_032410chr811210 ------
NM_032411chr21214 ------
NM_032424chr1121381 1086 ------
NM_032431chr11--11100 ----
NM_032438chr62630 30 ------
NM_032439chr102460 51 ------
NM_032440chr1042877 2613 2003 1861 --145 12869
NM_032445chr151937 ------
NM_032457chr433677 3284 3114 22879 1309 ----
NM_032458chrX73309 3237 3075 2871 2547 2334 662 12415 ----
NM_032466chr82472 459 1536 1244 --
NM_032491chr121440 --1259 --
NM_032494chr2141 ------
NM_032499chr154468 462 234 70 11453 ----
NM_032505chr362707 2466 2387 818 321 215 1943 --1448
NM_032521chr20------12954
NM_032523chr21157 ------
NM_032557chr44775 353 300 25 ------
NM_032569chr1641606 1418 618 236 ------
NM_032582chr1721496 1283 11866 ----
NM_032603chr23731 685 120 ------
NM_032622chr4--11432 ----
NM_032632chr141149 21562 220 1190 --
NM_032638chr341563 1399 69 30 ------
NM_032682chr333378 2346 451 11347 --11112
NM_032701chr191633 ------
NM_032741chr61913 ------
NM_032772chr101367 ------
NM_032777chr821177 315 --11462 --
NM_032780chr112798 361 ------
NM_032781chr114992 629 160 32 ------
NM_032801chr1121926 566 12515 ----
NM_032802chr151240 ------
NM_032812chr10129 ------
NM_032829chr1211164 ----11081
NM_032837chr1741462 528 175 40 1477 12159 --
NM_032859chr1332799 2774 1571 --2881 505 --
NM_032873chr1184455 3740 3523 2794 1117 711 693 391 ------
NM_032905chr1021168 307 1318 ----
NM_032932chr1795859 4930 4518 4452 1863 1610 1103 1093 749 ------
NM_032936chr71189 ------
NM_032961chr42899 359 --1265 1889
NM_032975chr1832329 837 405 13074 12839 23155 2582
NM_032978chr182373 150 --1940 --
NM_032979chr182373 150 --1940 --
NM_032980chr1832329 837 405 13074 12839 23155 2582
NM_032981chr182373 150 --1940 --
NM_032993chr41225 142 ----
NM_032999chr72830 220 ------
NM_033000chr72830 220 ------
NM_033001chr72830 220 ------
NM_033014chr931304 392 301 --1226 --
NM_033020chr114013 --24537 3433 --
NM_033023chr71196 ------
NM_033030chr2----11565 --
NM_033117chr93374 119 89 ------
NM_033119chr16164 ------
NM_033132chr1312153 ----21448 405
NM_033136chr521385 658 31751 1419 277 --11398
NM_033137chr521385 658 31751 1419 277 --11398
NM_033138chr721864 196 ------
NM_033139chr721864 196 ------
NM_033140chr721864 196 ------
NM_033147chr21252 ------
NM_033148chr21252 ------
NM_033157chr721864 196 ------
NM_033181chr673834 3776 3540 3335 3054 1521 1409 --23168 410 12508
NM_033207chr1032638 814 34 ------
NM_033211chr531907 387 379 1525 ----
NM_033222chr941143 1107 1010 490 ------
NM_033224chr775628 5121 4881 2980 2141 1389 477 --12264 --
NM_033227chr51568 ------
NM_033228chr51608 ------
NM_033254chr3----1489 1499
NM_033260chr61143 ------
NM_033272chr22332 123 ------
NM_033285chr8124455 4394 4371 3112 3063 2850 1315 867 855 697 427 299 ----1482
NM_033290chrX23206 2689 --21128 1049 --
NM_033300chr12245 49 11160 ----
NM_033326chr1122406 29 11008 ----
NM_033331chr943284 2841 1189 442 ------
NM_033334chr91107 ------
NM_033360chr1234630 1301 198 13556 24351 211 --
NM_033389chr1723834 1395 --23569 3137 11844
NM_033394chr221124 645 11078 ----
NM_033396chr111313 ------
NM_033425chr1163205 3092 2694 962 948 927 --13253 --
NM_033427chr71637 ------
NM_033430chr453917 1494 886 539 256 1306 ----
NM_033437chr453917 1494 886 539 256 1306 ----
NM_033496chr10137 --1474 --
NM_033497chr10137 --1474 --
NM_033498chr10137 --1474 --
NM_033500chr10137 --1474 --
NM_033503chr1553733 3693 3626 3257 1268 1912 11542 --
NM_033505chr286560 5565 5448 5043 4944 4891 4720 29 24335 1534 25347 5009 --
NM_033540chr3--1102 ----
NM_033546chr181160 ------
NM_033624chr1222077 226 11861 ----
NM_033631chr143645 3249 2617 1259 ------
NM_033632chr41430 ------
NM_033642chrX1216 ----1311
NM_033644chr52474 400 --12278 --
NM_033645chr52474 400 --12278 --
NM_033656chr2174981 4820 3921 1086 738 547 187 22110 759 1315 --
NM_033666chr101892 ------
NM_052834chr1832346 1923 364 ----12284
NM_052865chr201914 ------
NM_052875chr1111783 12039 ----
NM_052879chr1222516 407 ------
NM_052886chr811923 11892 ----
NM_052896chr122545 2120 --1759 --
NM_052898chr82626 291 11426 ----
NM_052900chr821469 1289 ------
NM_052904chr61272 11024 2478 300 --
NM_052905chr22663 588 --1746 1720
NM_052910chr1321767 1622 ------
NM_052911chr18--1880 1695 --
NM_052918chr1033687 3316 2910 ----1566
NM_052923chr6154 ------
NM_052927chr521780 145 194 ----
NM_052934chr121593 43 ------
NM_053002chr3170 142 ----
NM_053016chr9106615 6229 5640 5471 3018 2704 1499 1347 1203 343 11022 16178 --
NM_053023chr1152988 2940 2889 508 82 ----11058
NM_053024chr341364 1234 995 228 ------
NM_053025chr321175 459 1185 --1595
NM_053026chr321175 459 1185 --1595
NM_053027chr321175 459 1185 --1595
NM_053028chr321175 459 1185 --1595
NM_053031chr321175 459 1185 --1595
NM_053032chr321175 459 1185 --1595
NM_053056chr1162624 2408 2089 1048 1018 92 1363 ----
NM_053067chr9------1352
NM_053274chr1141 ------
NM_054026chr8------1892
NM_057089chr72502 166 ------
NM_057159chr9--11102 ----
NM_057169chr1262813 2685 2561 2313 1078 686 ------
NM_057170chr1262813 2685 2561 2313 1078 686 ------
NM_057175chr442308 2105 793 746 --1407 --
NM_057749chr81396 1161 ----
NM_058170chr12425 116 ----1236
NM_058172chr441704 1139 1119 416 ------
NM_058191chr213780 669 132 154 ----
NM_058237chr143797 420 366 1809 ----
NM_058241chr242267 2257 612 309 1723 ----
NM_058241chr242267 2257 612 309 1723 ----
NM_078467chr62472 170 21293 1270 ----
NM_078469chr1041173 1135 919 412 1111 ----
NM_078483chr553969 3013 2940 841 636 ----13314
NM_078629chrX1562 ------
NM_078630chrX1562 ------
NM_079420chr2124 ------
NM_079422chr2124 ------
NM_080422chr18------1326
NM_080423chr18------1326
NM_080425chr20------1327
NM_080426chr20------1327
NM_080546chr921447 903 ------
NM_080626chr121323 ------
NM_080632chrX1846 ------
NM_080664chr141102 ------
NM_080682chr11613 1563 1543 --
NM_080717chr1221543 1203 ------
NM_080738chr111725 --1381 --
NM_080742chr6182 ------
NM_080743chr662139 2121 1818 1664 962 364 --1321 --
NM_080748chr20--154 ----
NM_080759chr1331618 1073 653 --11767 --
NM_080760chr1331618 1073 653 --11767 --
NM_080792chr201173 ----1764
NM_080872chr842919 2856 1584 398 ------
NM_080874chr4--11606 1162 --
NM_080927chr333140 504 436 ------
NM_130386chr18--1584 --1107
NM_130391chr963029 3022 2322 2198 2185 78 --12491 --
NM_130392chr963029 3022 2322 2198 2185 78 --12491 --
NM_130393chr963029 3022 2322 2198 2185 78 --12491 --
NM_130434chr151445 ------
NM_130435chr1032681 1007 438 ------
NM_130439chr1042205 2131 1705 888 --1686 --
NM_130439chr1042205 2131 1705 888 --1686 --
NM_130443chr112163 118 ------
NM_130469chr143941 866 215 1602 ----
NM_130781chr52536 160 ------
NM_130798chr151310 ------
NM_130808chr31348 ------
NM_130838chr1531641 1337 1232 ------
NM_130839chr1531641 1337 1232 ------
NM_133264chr1753632 3379 3182 2558 457 ----12848
NM_133265chrX2468 145 13185 22434 1122 --
NM_133330chr443217 1243 1105 714 2543 192 ----
NM_133331chr443217 1243 1105 714 2543 192 ----
NM_133334chr496206 6106 5708 5501 2236 1787 1750 1525 1106 --14662 --
NM_133335chr443217 1243 1105 714 2543 192 ----
NM_133370chr433002 2393 1422 1935 ----
NM_133372chr542138 2065 246 141 ------
NM_133473chr1931802 651 73 --1754 128
NM_133476chr1221051 966 ------
NM_133493chr623801 1719 --31026 793 350 --
NM_133496chr153879 3374 1815 1651 1497 14242 14351 1119
NM_133625chr31445 1135 ----
NM_133631chr321261 349 ----11533
NM_133646chr275319 5021 4822 4103 3819 1874 1276 15266 1106 1797
NM_133647chr1521391 1245 --33623 2424 1014 1362
NM_134265chr1711198 ------
NM_134442chr221544 633 2642 163 ----
NM_138270chrX42536 2454 903 645 --11032 --
NM_138286chr1964152 3387 920 647 152 145 1633 32963 1521 247 --
NM_138316chr101325 1277 ----
NM_138335chr43634 229 41 ------
NM_138357chr102464 63 ------
NM_138375chr182473 56 --1142 --
NM_138423chr1521904 1507 11642 ----
NM_138426chr741746 886 267 220 --12067 --
NM_138453chr5155 ------
NM_138459chr623556 473 --11222 --
NM_138468chr245207 2218 1391 206 --15507 --
NM_138473chr1263885 3383 3162 1622 785 245 11573 13415 1105
NM_138555chr15------1612
NM_138559chr21966 ------
NM_138576chr1494630 4284 4233 4095 1531 856 694 662 132 11333 11280 --
NM_138609chr51202 --1218 1190
NM_138610chr51202 --1218 1190
NM_138621chr254061 3843 1035 883 229 14101 --14002
NM_138633chr621549 1346 ------
NM_138635chr75958 931 835 348 208 ------
NM_138638chr145974 944 510 433 404 21833 503 1278 --
NM_138694chr663649 1322 463 442 338 241 ------
NM_138713chr1687453 7044 6771 6497 5376 2857 992 576 27755 5765 11344 18126
NM_138714chr1687453 7044 6771 6497 5376 2857 992 576 27755 5765 11344 18126
NM_138715chr821955 1596 --81936 1916 1910 1898 1880 1874 1862 1804 --
NM_138731chr1423757 3326 ------
NM_138766chr52402 103 ------
NM_138771chr741050 562 467 215 1972 ----
NM_138773chr51245 1122 ----
NM_138779chr13168 --1177 --
NM_138782chr53877 175 55 11682 ----
NM_138799chr241862 684 249 234 1311 1798 --
NM_138811chr7----21043 461 --
NM_138821chr52402 103 ------
NM_138822chr52402 103 ------
NM_138927chr21------1684
NM_138931chr311022 ------
NM_138961chr111113 ------
NM_138967chr153494 487 201 ------
NM_138971chr1153024 2774 1275 359 217 --11282 1922
NM_138971chr1153024 2774 1275 359 217 --11282 1922
NM_138972chr1153024 2774 1275 359 217 --11282 1922
NM_138972chr1153024 2774 1275 359 217 --11282 1922
NM_138973chr1153024 2774 1275 359 217 --11282 1922
NM_138973chr1153024 2774 1275 359 217 --11282 1922
NM_138983chr2121283 109 --2427 391 1966
NM_139015chr1211077 ------
NM_139035chrX1745 ------
NM_139057chr1532798 2584 1116 ------
NM_139058chrX1419 1111 ----
NM_139068chr52496 161 ------
NM_139069chr52496 161 ------
NM_139070chr52365 30 ------
NM_139071chr1221520 422 --1529 --
NM_139072chr21769 ------
NM_139076chr42314 171 ------
NM_139132chr1131142 831 77 ------
NM_139167chr8----1491 --
NM_139168chr53745 351 326 --21396 1374 --
NM_139169chr103832 753 171 11466 ----
NM_139182chr441577 1342 1258 147 --1695 --
NM_139207chr1241449 1396 166 37 --11521 --
NM_139242chr1531148 414 145 ------
NM_139276chr1741487 932 627 162 ------
NM_139279chr242500 1211 371 106 ----1691
NM_139312chr102521 55 --11166 --
NM_144498chr2041576 1512 1420 870 1647 ----
NM_144571chr485800 5498 5107 2756 2445 2059 503 268 26196 2186 15259 15789
NM_144574chr141186 ------
NM_144582chr242636 1646 1608 484 ------
NM_144595chr131649 1918 ----
NM_144599chr1565023 4640 4461 3703 1314 417 2979 457 13465 --
NM_144628chr2033003 2525 2003 --12204 --
NM_144632chr221853 783 ------
NM_144635chr321216 124 ------
NM_144642chr321328 542 ------
NM_144643chr41122 ------
NM_144653chr9----136 --
NM_144658chrX1292 ------
NM_144660chr102278 89 ------
NM_144664chr1152384 1801 580 153 21 ------
NM_144665chr11----1228 --
NM_144710chr22485 149 ----1263
NM_144723chr51591 ------
NM_144767chr1544193 4015 3888 561 1735 11717 --
NM_144778chr1332776 2588 606 --1413 --
NM_144949chr212256 --12068 --
NM_144963chr822131 504 --1211 1877
NM_144973chr1245270 3820 1665 1037 --14207 --
NM_144979chr41611 ----2509 132
NM_145018chr112211 75 ------
NM_145055chr1873310 1495 1179 1162 886 422 29 ------
NM_145112chr14--11013 ----
NM_145117chr112564 215 ------
NM_145175chr231294 986 558 ------
NM_145203chr13148 ------
NM_145206chr1041314 1299 826 579 13343 ----
NM_145259chr237089 5078 723 14906 14397 26412 955
NM_145284chrX31701 1619 639 1325 ----
NM_145287chr181178 ------
NM_145291chr41387 ------
NM_145305chrX1185 21301 27 ----
NM_145307chr1074332 4259 3334 1850 1771 468 64 --11572 21199 315
NM_145320chr72628 124 23312 389 12964 --
NM_145321chr72628 124 23312 389 12964 --
NM_145322chr72628 124 23312 389 12964 --
NM_145332chr63710 381 142 ------
NM_145333chr63710 381 142 ------
NM_145341chr1021465 97 ----11782
NM_145350chr17--11456 --11631
NM_145351chr17--12596 --12771
NM_145686chr212608 23295 1370 1844 --
NM_145687chr212608 23295 1370 1844 --
NM_145690chr831817 431 271 ----11360
NM_145698chr1032044 1533 163 ------
NM_145739chr21157 ------
NM_145753chr331576 517 427 ------
NM_145800chrX1413 175 1998 --
NM_145802chrX1362 124 1947 --
NM_145808chr782750 2608 2502 2393 2384 1162 773 510 12548 ----
NM_145810chr23928 454 358 11053 ----
NM_145858chr212477 434 ------
NM_145861chr111725 --1381 --
NM_145891chr1631070 614 417 ------
NM_145892chr1631070 614 417 ------
NM_145893chr1631192 736 539 ------
NM_147147chr653557 2851 1540 975 67 --14042 --
NM_147150chr953759 2763 2416 1361 74 1474 ----
NM_147171chr72482 179 ------
NM_147181chr4------1892
NM_147182chr4------1892
NM_147183chr4------1892
NM_147185chr72482 179 ------
NM_147223chr232247 2104 302 ------
NM_147233chr232064 1921 119 ------
NM_148898chr71421 ------
NM_148899chr71421 ------
NM_148921chr17--32274 1594 1520 --1226
NM_148955chr1576516 6193 6150 5480 5164 4476 1607 --26247 2009 --
NM_148977chr101325 1277 ----
NM_148978chr101325 1277 ----
NM_152261chr1211014 --22582 33 --
NM_152265chr121337 146 --11217 --
NM_152271chr81246 ------
NM_152275chr2----32232 2100 343 1846
NM_152277chr542116 1853 1515 1453 ----11740
NM_152280chr133418 2573 209 ------
NM_152284chr81221 1296 --1746
NM_152291chr4----1121 --
NM_152300chr1711189 --11527 --
NM_152305chr331701 1517 1473 --11394 --
NM_152330chr1412626 ------
NM_152344chr171128 11357 ----
NM_152360chr191138 ------
NM_152380chr131050 252 27 ------
NM_152388chr233745 902 625 --32537 305 196 --
NM_152390chr21480 1693 ----
NM_152409chr563180 3159 2766 1286 929 815 1593 ----
NM_152423chrX21120 538 --1457 --
NM_152431chr111385 ------
NM_152437chr12--1573 12117 --
NM_152440chr1221008 1000 --11063 --
NM_152450chr1511384 1322 ----
NM_152463chr171508 ------
NM_152493chr11233 ------
NM_152519chr222217 1671 ----12118
NM_152522chr24894 364 225 164 ------
NM_152529chr283881 3411 3091 1529 1225 1171 925 380 11309 ----
NM_152549chr51446 ------
NM_152556chr752085 1946 932 237 84 --21800 245 11747
NM_152586chr102853 93 ------
NM_152588chr1221672 247 21725 1479 11158 --
NM_152589chr122254 99 ------
NM_152594chr1531693 381 319 22279 1830 --12198
NM_152606chr191504 ------
NM_152614chr21135 ------
NM_152622chr531326 605 493 --23461 980 --
NM_152624chr5157444 6391 6254 5878 4678 4544 2799 2589 2101 1751 1656 1466 1038 602 169 15897 1458 --
NM_152636chr1143111 601 594 34 --12342 --
NM_152638chr1211189 ------
NM_152641chr1232761 2063 1123 --1694 1374
NM_152653chr32721 557 ------
NM_152660chr11836 ------
NM_152665chr11490 1278 ----
NM_152678chr332508 808 171 ------
NM_152682chr43693 380 31 ------
NM_152694chrX1155 1602 ----
NM_152699chr343738 2635 1219 174 22647 443 23362 3030 13286
NM_152707chr102760 131 ------
NM_152721chr18--1713 1302 --
NM_152724chr1042070 925 875 753 12410 ----
NM_152734chr611500 --45021 4831 4613 802 --
NM_152737chr621740 1508 --1276 2623 229
NM_152739chr71261 ------
NM_152745chr711067 ------
NM_152748chr71394 ------
NM_152749chr711099 ------
NM_152753chr63784 244 142 ------
NM_152754chr743282 1487 589 552 1616 ----
NM_152756chr533625 1637 1577 24317 3491 1854 2887 275
NM_152758chr842629 2145 2015 219 ------
NM_152780chrX3924 448 267 ------
NM_152787chrX63484 3111 2898 1288 1148 347 --146 --
NM_152789chr71249 ------
NM_152793chr734523 86 78 --14552 --
NM_152826chr1576516 6193 6150 5480 5164 4476 1607 --26247 2009 --
NM_152835chr152824 2581 1923 1109 816 11075 --12251
NM_152857chr62892 75 --1829 --
NM_152858chr62892 75 --1829 --
NM_152890chr131072 379 107 --1342 --
NM_152896chr91626 ------
NM_152924chr1595415 5327 4988 2438 1950 1861 1429 1206 614 --26147 5908 16701
NM_152932chr3128 ------
NM_152989chr1211480 ----1279
NM_152991chr113640 620 476 ------
NM_152998chr7163 ------
NM_152999chr771770 1507 1168 1089 948 498 434 --14980 --
NM_153015chr811028 ----1407
NM_153020chr631578 1301 1287 ----1462
NM_153026chr12122 --1363 --
NM_153029chr1644010 3989 3633 577 --11018 --
NM_153042chr621595 192 ----1169
NM_153046chr14------1580
NM_153050chr2254646 3468 1867 1144 792 14204 1513 --
NM_153051chr2254646 3468 1867 1144 792 14204 1513 --
NM_153184chr331933 1880 1627 ------
NM_153188chr534204 2282 1080 25473 2034 25317 4658 --
NM_153201chr11125 ------
NM_153207chr1243667 2994 1383 1293 --1417 --
NM_153208chr163790 718 210 ------
NM_153235chr621642 561 180 ----
NM_153251chr131187 ------
NM_153252chrX1322 ------
NM_153261chr1631309 1256 226 11602 ----
NM_153262chr12992 774 --12756 1587
NM_153267chr91272 ------
NM_153331chr32501 490 ------
NM_153332chr822119 196 --23021 2398 1644
NM_153333chrX154 ------
NM_153377chr121328 ------
NM_153447chr191275 ------
NM_153456chr13156065 6044 5868 5738 5397 5141 4321 4089 2488 2006 1725 1614 1393 959 741 ------
NM_153487chr624854 1683 1176 43541 1730 1043 622 --
NM_153607chr542654 2552 464 366 --23204 93 --
NM_153616chr1532328 516 301 --11475 11922
NM_153617chr1532328 516 301 --11475 11922
NM_153618chr1532328 516 301 --11475 11922
NM_153619chr1533566 1124 933 --12713 23160 2561
NM_153631chr721364 553 --11576 --
NM_153632chr721364 553 --11576 --
NM_153634chr1211181 ------
NM_153640chr202436 94 1452 ----
NM_153686chr4264 21 ----1129
NM_153689chr241934 935 529 48 --21825 795 --
NM_153695chr9135 ------
NM_153707chr92136 36 ------
NM_153764chr111699 --161 --
NM_153765chr111699 --161 --
NM_153766chr111699 --161 --
NM_153767chr111699 --161 --
NM_153810chr10103835 3779 3619 3204 2025 1944 1574 881 820 361 34664 4655 2002 21101 516 --
NM_170606chr721472 240 1582 ----
NM_170665chr1214400 31193 1026 478 ----
NM_170692chr121145 1095 --1337 --
NM_170695chr18172 ------
NM_170706chr133954 2812 621 12819 ----
NM_170709chr842221 2066 1782 629 ----1256
NM_170710chr452895 2648 885 721 386 12064 163 --
NM_170719chr131471 ------
NM_170731chr111220 22858 2803 1440 --
NM_170732chr111220 22858 2803 1440 --
NM_170733chr111220 22858 2803 1440 --
NM_170734chr111220 22858 2803 1440 --
NM_170735chr111220 22858 2803 1440 --
NM_170751chr62313 171 --1268 --
NM_170752chr62313 171 --1268 --
NM_170768chr1121629 1538 ----1157
NM_170782chr1--1335 127 --
NM_171998chrX32481 897 219 ----11856
NM_172037chr82164 73 ------
NM_172058chr861403 1396 1297 634 322 202 --1584 --
NM_172059chr861403 1396 1297 634 322 202 --1584 --
NM_172060chr861403 1396 1297 634 322 202 --1584 --
NM_172070chr211969 11427 ----
NM_172071chr137480 5175 2367 15383 37229 1371 523 21886 834
NM_172097chr152758 196 --1215 --
NM_172103chr632237 2130 673 12149 11999 --
NM_172105chr632237 2130 673 12149 11999 --
NM_172110chr201471 1687 ----
NM_172111chr201471 1687 ----
NM_172112chr201471 1687 ----
NM_172113chr201471 1687 ----
NM_172159chr321841 298 22138 2001 ----
NM_172160chr321841 298 22138 2001 ----
NM_172169chr1011794 ------
NM_172170chr1011794 ------
NM_172171chr1011794 ------
NM_172173chr1011794 ------
NM_172230chr11--11100 ----
NM_172240chr122882 252 ------
NM_172337chr142728 265 1770 ----
NM_172373chr132487 274 ------
NM_172375chr14167 ------
NM_173075chr431294 444 413 11560 ----
NM_173083chr12216 164 --1178 --
NM_173171chr211068 ------
NM_173172chr231376 1024 326 ------
NM_173173chr211068 ------
NM_173198chr922930 288 12259 11176 --
NM_173200chr922930 288 12259 11176 --
NM_173207chr18172 ------
NM_173208chr18172 ------
NM_173209chr18172 ------
NM_173210chr18172 ------
NM_173211chr18172 ------
NM_173214chr1687453 7044 6771 6497 5376 2857 992 576 27755 5765 11344 18126
NM_173355chr21384 ----1283
NM_173359chr311884 21688 580 ----
NM_173454chr151372 --192 --
NM_173468chr475857 4840 3893 1242 1153 755 470 15509 ----
NM_173469chr1521179 1108 ------
NM_173470chrX52764 2524 2180 515 345 ------
NM_173473chr1072618 2470 2451 2088 725 601 411 ----12726
NM_173475chr162618 167 1568 ----
NM_173494chrX1867 1853 ----
NM_173495chrX42564 2041 1614 423 --1758 --
NM_173511chr223876 3740 13052 --1219
NM_173552chr311827 22398 125 143 11602
NM_173560chr63564 534 138 ------
NM_173563chr6189 ------
NM_173570chr332095 733 392 11600 ----
NM_173576chr102844 239 --1692 --
NM_173582chr1186240 5128 3990 2175 1621 1270 536 85 24401 1697 25923 1887 --
NM_173595chr1243513 1350 486 81 24249 1270 1552 --
NM_173602chr1233676 2784 1421 ------
NM_173607chr1421958 502 ----11513
NM_173642chr1169041 9020 8840 8547 7192 6730 5804 2998 2739 2314 796 572 558 128 121 22 1279 --17164
NM_173647chr2------1713
NM_173648chr21824 --1216 2190 47
NM_173683chr82498 58 ------
NM_173694chrX22141 200 ------
NM_173808chr153086 1131 1061 391 301 1777 ----
NM_173812chr1211357 11572 ----
NM_173822chr211369 ------
NM_173829chr565328 5201 5125 4704 1190 923 1458 15723 --
NM_173833chr821654 115 --11419 --
NM_173851chr821535 899 21554 170 23530 871 --
NM_174886chr18172 ------
NM_174907chr31124 ------
NM_174911chr832473 847 290 --13365 13251
NM_174921chr42953 70 ------
NM_174934chr1152813 2602 2507 903 775 ----13539
NM_174936chr111217 ------
NM_174937chr102515 126 ------
NM_175061chr7183 1356 ----
NM_175607chr32157 148 1215 --177
NM_175612chr32157 148 1215 --177
NM_175623chr1256209 5168 2121 412 216 24973 1578 ----
NM_175630chr22732 702 ------
NM_175634chr83862 475 127 ------
NM_175635chr83862 475 127 ------
NM_175636chr83862 475 127 ------
NM_175733chr111814 --22067 1505 1135
NM_175736chr12137454 7165 6903 6722 6713 5646 5445 4895 1431 979 194 163 24 37368 1756 1265 16318 --
NM_175748chr1471906 1879 1720 1516 1366 741 721 ------
NM_175767chr531370 1150 225 --21877 1196 --
NM_175852chr152997 2683 2619 344 128 --11072 --
NM_175854chr1321110 61 1293 ----
NM_175861chr1234750 3664 1518 --22328 1645 --
NM_175866chr13541 533 441 1175 --11497
NM_175900chr161292 --21302 75 --
NM_175907chr1842331 1095 848 45 ----12884
NM_176801chr421178 96 31592 611 366 ----
NM_176814chr751421 577 204 189 95 11330 ----
NM_176863chr1711432 ------
NM_177398chr11158 --1221 --
NM_177399chr11158 --1221 --
NM_177414chr111544 --11089 1391
NM_177422chr1133 ------
NM_177438chr1463575 3385 2899 1454 1345 750 13955 ----
NM_177441chr172670 582 --1734 --
NM_177531chr82358 85 1134 ----
NM_177538chr2107067 6543 5378 3407 2722 2213 2177 825 689 552 ------
NM_177553chr112791 379 --1151 --
NM_177951chr143894 858 605 ------
NM_177966chr341875 1866 1569 1271 1747 11385 --
NM_177968chr251931 1634 201 191 139 ------
NM_177969chr2----1195 --
NM_177974chr1521904 1507 11642 ----
NM_177985chr222042 575 1626 ----
NM_177990chr2031512 481 398 ----22024 1722
NM_177999chr963659 3252 3200 2976 1366 785 --1637 --
NM_178010chr1211480 ----1279
NM_178037chr1252855 2786 2714 2595 981 ----12458
NM_178038chr1252855 2786 2714 2595 981 ----12458
NM_178123chr2--1238 166 --
NM_178151chrX137771 7470 7158 5438 2676 2620 2326 1901 1786 1772 1570 372 243 11207 15908 --
NM_178152chrX137771 7470 7158 5438 2676 2620 2326 1901 1786 1772 1570 372 243 11207 15908 --
NM_178153chrX137771 7470 7158 5438 2676 2620 2326 1901 1786 1772 1570 372 243 11207 15908 --
NM_178154chr141680 ------
NM_178155chr141680 ------
NM_178156chr141680 ------
NM_178157chr141680 ------
NM_178313chr242046 1932 1787 357 --12133 --
NM_178314chr12------1830
NM_178423chr721183 843 1184 1326 --
NM_178425chr721183 843 1184 1326 --
NM_178439chr2163 ------
NM_178549chr11192 2579 429 --1421
NM_178566chr91313 ------
NM_178584chr22485 149 ----1263
NM_178586chr1422131 977 --12213 --
NM_178587chr141114 ------
NM_178815chr1072790 2422 1958 1910 1001 550 360 --12074 2824 442
NM_178839chr22366 30 ------
NM_178863chr161432 ------
NM_180989chr1342202 875 770 713 ------
NM_181054chr14----11172 --
NM_181077chr1562289 1765 892 528 495 217 ------
NM_181265chr452895 2648 885 721 386 12064 163 --
NM_181302chr141186 ------
NM_181308chr141186 ------
NM_181349chr732283 735 208 ------
NM_181351chr1132879 2700 63 1430 --12982
NM_181354chr841404 1336 220 57 ------
NM_181358chr1----23625 2721 --
NM_181359chr122491 887 ------
NM_181361chr32987 248 ------
NM_181442chr201101 ------
NM_181443chr2032050 1923 176 12688 22788 1012 --
NM_181453chr21314 ------
NM_181457chr2----11278 --
NM_181481chr1876730 4633 4518 4469 1367 867 586 16532 35764 1648 403 --
NM_181482chr1876730 4633 4518 4469 1367 867 586 16532 35764 1648 403 --
NM_181483chr1876730 4633 4518 4469 1367 867 586 16532 35764 1648 403 --
NM_181486chr1221543 1203 ------
NM_181504chr552926 2809 1538 1037 489 --23724 806 --
NM_181521chr1666851 5850 2736 1362 819 373 32808 1875 1055 ----
NM_181523chr552926 2809 1538 1037 489 --23724 806 --
NM_181524chr552926 2809 1538 1037 489 --23724 806 --
NM_181534chr17155 ------
NM_181552chr7------1370
NM_181645chr11--1190 1686 1642
NM_181659chr2042425 1300 842 54 ------
NM_181659chr2042425 1300 842 54 ------
NM_181670chr121301 --1441 --
NM_181689chr202802 122 ------
NM_181698chr102553 220 ------
NM_181702chr81854 ------
NM_181704chr212233 23 --1249 --
NM_181714chr641866 1294 1252 287 ----11882
NM_181723chr831832 1448 595 ------
NM_181741chr231200 1129 1031 ----1375
NM_181742chr231200 1129 1031 ----1375
NM_181746chr12801 66 ------
NM_181782chr61450 --11773 --
NM_181787chr832702 1315 1287 --1173 1849
NM_181836chr532511 2354 458 1960 --11738
NM_181838chr531111 1086 251 11344 ----
NM_181839chr8----3523 455 443 --
NM_181872chr91237 --148 --
NM_181876chr41818 ----1103
NM_181886chr431376 1268 31 --1411 --
NM_181887chr431376 1268 31 --1411 --
NM_181888chr431376 1268 31 --1411 --
NM_181889chr431376 1268 31 --1411 --
NM_181890chr431376 1268 31 --1411 --
NM_181891chr431376 1268 31 --1411 --
NM_181892chr431423 1315 78 --1458 --
NM_181893chr431376 1268 31 --1411 --
NM_181897chr331958 250 125 --1480 --
NM_182484chr212233 23 --1249 --
NM_182485chr452798 2561 2405 886 773 ------
NM_182507chr1231762 805 31 --11534 --
NM_182508chr1321052 810 --12576 --
NM_182509chr1421681 1248 11457 31309 490 250 --
NM_182515chr1994885 4578 4245 2649 2178 2038 1214 828 646 21429 307 36666 2333 744 --
NM_182524chr41225 ------
NM_182526chr1422302 1136 ----12531
NM_182580chr142362 2171 1033 714 1772 ----
NM_182641chr1721904 1826 11445 ----
NM_182643chr821966 1868 ------
NM_182646chr452798 2561 2405 886 773 ------
NM_182648chr143228 146 120 ------
NM_182680chrX--1143 ----
NM_182691chr72253 165 --1368 --
NM_182692chr72253 165 --1368 --
NM_182697chr71126 ------
NM_182715chr71944 --173 --
NM_182729chr1221195 1182 11858 --11390
NM_182734chr2043047 3017 2369 682 --2765 649 --
NM_182742chr1221195 1182 11858 --11390
NM_182743chr1221195 1182 11858 --11390
NM_182765chr102258 39 --22202 374 --
NM_182767chr1271847 1788 1515 826 699 488 160 1586 174 1837
NM_182796chr54582 141 93 56 ------
NM_182797chr202424 397 11767 ----
NM_182811chr2021102 777 1236 ----
NM_182830chr1451682 868 674 573 40 --1154 --
NM_182896chr351725 1374 572 175 69 --11313 --
NM_182898chr7106602 6412 6321 5576 4482 2599 1279 1251 1058 689 12500 16226 --
NM_182899chr7106602 6412 6321 5576 4482 2599 1279 1251 1058 689 12500 16226 --
NM_182910chr141288 --1322 --
NM_182913chr141288 --1322 --
NM_182914chr141288 --1322 --
NM_182925chr541046 1026 291 27 ------
NM_182931chr71595 --1704 --
NM_182943chr31908 ------
NM_182944chr141341 ------
NM_182948chr153108 1142 1115 790 195 --1218 --
NM_182964chr112564 215 ------
NM_182970chr2024035 824 --13968 --
NM_182972chr131963 816 303 --12866 12842
NM_182975chr1166 ------
NM_183006chr2011048 ------
NM_183043chr133372 279 55 ------
NM_183044chr133372 279 55 ------
NM_183049chr4244 27 ------
NM_183078chr642778 2515 2474 1313 ------
NM_183227chr641438 1222 479 371 21504 47 ----
NM_183238chr1253840 3110 2804 936 861 33462 3454 948 1968 --
NM_183353chrX--1750 ----
NM_183360chr21252 ------
NM_183361chr21252 ------
NM_183380chr62244 36 --1322 --
NM_183393chr31319 ------
NM_183394chr31319 ------
NM_183416chr142078 1411 1356 709 ------
NM_183419chr82344 206 --11094 --
NM_194247chr233171 684 98 11663 --21576 704
NM_194250chr22383 293 ------
NM_194259chr161573 ------
NM_194260chr161573 ------
NM_194261chr161573 ------
NM_194278chr1453010 2883 1178 880 367 ------
NM_194282chr432644 2129 763 ----12975
NM_194283chr554006 3686 2731 1586 1095 ------
NM_194285chr1172736 2550 2125 1291 1062 602 395 13444 ----
NM_194292chr141778 1352 561 137 ------
NM_194301chr141425 11041 ----
NM_194314chr134507 1570 1441 45188 4302 4084 720 --14789
NM_194317chr262695 2302 1901 1845 1833 134 11036 ----
NM_194328chr942227 907 659 132 22276 252 1583 --
NM_194329chr942227 907 659 132 22276 252 1583 --
NM_194330chr942227 907 659 132 22276 252 1583 --
NM_194332chr942227 907 659 132 22276 252 1583 --
NM_194429chr61587 ------
NM_194463chrX1473 ------
NM_197939chr17----21097 145 --
NM_197941chr532571 2280 104 ----22351 2043
NM_197968chr13----140 --
NM_197970chr2----11565 --
NM_198066chr1432813 936 879 11035 ----
NM_198123chr821469 1289 ------
NM_198124chr821469 1289 ------
NM_198128chr1811685 ------
NM_198158chr333074 2849 2126 --13003 1802
NM_198159chr333074 2849 2126 --13003 1802
NM_198177chr333074 2849 2126 --13003 1802
NM_198178chr333074 2849 2126 --13003 1802
NM_198181chr1582770 2669 1939 986 901 733 727 308 ------
NM_198195chr32680 188 ------
NM_198212chr752200 930 737 718 632 ------
NM_198215chr101105 ------
NM_198217chr131211 ------
NM_198218chr131211 ------
NM_198219chr131211 ------
NM_198225chr1011354 1122 3762 468 69 --
NM_198240chr122513 68 1364 ----
NM_198261chr123773 535 81 1758 ----
NM_198262chr123773 535 81 1758 ----
NM_198268chr1----23625 2721 --
NM_198269chr1----23625 2721 --
NM_198270chrX33217 1256 898 12939 ----
NM_198273chr552986 2930 2223 759 249 12906 1938 12263
NM_198279chrX1257 195 31146 1080 813 --
NM_198324chr12--21029 115 ----
NM_198334chr111740 1701 143 --
NM_198335chr111740 1701 143 --
NM_198390chr1631867 1746 660 ------
NM_198399chr331482 718 709 ------
NM_198400chr1532007 892 137 ------
NM_198401chr821679 478 ------
NM_198404chr131104 --1680 --
NM_198465chrX32870 2547 369 12775 22755 2473 --
NM_198468chr654147 3806 3239 1335 851 14216 1974 --
NM_198485chr342458 2056 1738 671 --1548 --
NM_198494chr11176 --1220 --
NM_198503chr122052 164 ------
NM_198507chr51190 ------
NM_198513chr831872 1245 653 1201 ----
NM_198521chr121124 ------
NM_198549chr143085 2665 1274 824 ------
NM_198567chr52416 113 ------
NM_198578chr1231162 475 283 1514 ----
NM_198581chr2117433 6222 6110 5818 5198 4553 2389 2210 1304 573 241 1819 ----
NM_198584chr832669 2146 534 ----12500
NM_198715chr145023 4319 3867 1255 24943 1618 24982 4749 1789
NM_198793chr353518 2603 1237 1220 474 33526 3060 1547 33620 846 369 --
NM_198794chr1421224 85 ------
NM_198829chr711032 --11483 1365
NM_198830chr171286 ------
NM_198859chr3104177 3445 3391 1815 1543 1076 960 680 84 65 ------
NM_198889chr43994 303 212 ------
NM_198892chr4196 127 ----
NM_198896chr1132175 1815 693 --11654 1577
NM_198900chr12137454 7165 6903 6722 6713 5646 5445 4895 1431 979 194 163 24 37368 1756 1265 16318 --
NM_198935chr2052838 2400 992 320 188 ------
NM_198990chr743336 2698 2147 1261 1393 ----
NM_198995chr181385 ------
NM_199000chr722003 1636 ------
NM_199039chr421102 266 1718 ----
NM_199044chr123036 319 1239 ----
NM_199051chr11293 ------
NM_199054chr1932024 846 228 1123 ----
NM_199072chr742576 2535 325 109 ------
NM_199129chr201424 ------
NM_199144chr20--11402 ----
NM_199160chr942007 1638 1466 666 12113 ----
NM_199168chr1051472 535 371 296 168 21441 1014 ----
NM_199169chr2033328 1196 619 ------
NM_199170chr2033328 1196 619 ------
NM_199171chr2033328 1196 619 ------
NM_199188chr1222516 407 ------
NM_199189chr51233 ------
NM_199190chr1222516 407 ------
NM_199192chr2174 ------
NM_199193chr2174 ------
NM_199203chr20--11402 ----
NM_199320chr422115 498 ------
NM_199320chr422115 498 ------
NM_199324chr423740 3590 23093 878 1760 --
NM_199355chr162259 203 11194 ----
NM_199461chr1042278 1419 381 162 ----11146
NM_199462chr153961 3715 3572 3130 725 13884 34641 4544 3926 --
NM_199464chr13----193 --
NM_199478chrX11572 ----1605
NM_199482chr221647 194 --1556 --
NM_199511chr33678 244 90 ------
NM_199512chr33678 244 90 ------
NM_201263chr121840 793 ------
NM_201266chr242102 2095 960 610 ------
NM_201269chr1--1471 1524 --
NM_201279chr242102 2095 960 610 ------
NM_201428chr1121159 71 --1358 --
NM_201429chr1121159 71 --1358 --
NM_201434chr17----2571 560 --
NM_201521chr6159 ------
NM_201522chr6159 ------
NM_201523chr6159 ------
NM_201526chr152717 245 ------
NM_201545chr151383 1062 455 437 424 ----1179
NM_201591chr441848 1529 350 160 11393 ----
NM_201592chr441848 1529 350 160 11393 ----
NM_201624chr151238 1149 1025 822 143 ------
NM_201633chr51336 ------
NM_203281chrX151 ------
NM_203282chr1951707 1223 1205 456 290 193 --1395
NM_203291chr18--174 ----
NM_203292chr18--167 ----
NM_203301chr1431519 436 413 --1575 11755
NM_203305chr931747 1608 1599 --1424 --
NM_203346chr232017 291 236 ------
NM_203349chr1532068 677 521 ------
NM_203350chr131677 268 176 11590 ----
NM_203351chr1722503 484 ------
NM_203394chr1252671 2552 2229 346 329 ------
NM_203406chr552933 2376 986 949 80 12158 ----
NM_203416chr121385 ------
NM_203434chr921012 971 1923 1815 --
NM_203437chr21135 ------
NM_203446chr2152335 2300 1980 1064 876 1916 ----
NM_203453chr91727 1434 ----
NM_203454chr121135 1121 1117 ----
NM_203459chr132531 1849 580 ----1286
NM_203463chr274449 4224 4198 1049 1008 142 127 13514 11175 14120
NM_203487chr13------1466
NM_203488chr141425 --1302 --
NM_203504chr442646 2324 1987 1880 1478 12536 --
NM_203505chr442646 2324 1987 1880 1478 12536 --
NM_205768chr132045 1476 167 --11770 --
NM_205842chr22658 163 --1664 --
NM_205848chr122745 959 ------
NM_205860chr132533 2032 88 1542 12248 --
NM_206594chr123403 2780 1119 22886 1282 --
NM_206595chr123403 2780 1119 22886 1282 --
NM_206852chr142582 467 ------
NM_206853chr662707 2553 1344 1053 434 234 13434 12777 --
NM_206854chr673968 3814 1695 1495 787 669 474 14695 14038 1203
NM_206855chr694933 4779 4150 2460 1752 1634 1439 405 85 15660 15003 11168
NM_206857chr142582 467 ------
NM_206860chr101111 ----1159
NM_206861chr101111 ----1159
NM_206862chr101111 ----1159
NM_206866chr2112144 --32394 2245 836 12185
NM_206876chr253173 2245 1439 763 70 ------
NM_206907chr522329 2058 12076 13030 1916
NM_206909chr8127933 7906 6808 6715 6491 5099 3258 1672 1563 558 478 116 --12275 26732 5321
NM_206914chr121287 --1585 11368
NM_206925chr1522677 2271 --12607 --
NM_206943chr22598 40 ------
NM_206944chr91177 ------
NM_206945chr91177 ------
NM_206946chr91177 ------
NM_206947chr91177 ------
NM_207012chr1073243 3030 2188 2178 1158 816 105 --2572 531 --
NM_207015chr32614 281 --22330 908 12066
NM_207042chr11571 ------
NM_207045chr11571 ------
NM_207046chr11571 ------
NM_207121chr201156 ------
NM_207122chr1131130 929 68 ------
NM_207174chr212668 573 ------
NM_207292chr333135 3106 2598 -