TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4474-3p
miRNA Sequence: UUGUGGCUGGUCAUGAGGCUAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511096 ------
NM_000038chr51583 --2606 145 --
NM_000042chr173100 84 32 ------
NM_000046chr542815 2269 738 641 --12949 --
NM_000055chr31328 ------
NM_000081chr1----1160 1657
NM_000084chrX146517 6259 5777 5580 5025 4529 4472 4419 4386 2797 1627 1394 1246 389 --1108 --
NM_000088chr171889 ------
NM_000090chr22868 799 ------
NM_000092chr254376 4056 3987 937 905 ------
NM_000093chr921861 189 --22207 2022 11852
NM_000108chr71225 --159 --
NM_000109chrX1777 ------
NM_000110chr11806 11183 ----
NM_000111chr71280 ------
NM_000125chr663312 2929 1263 1145 1133 334 --33194 1544 412 --
NM_000126chr15----1104 --
NM_000129chr62964 300 ------
NM_000135chr165778 663 397 310 160 ------
NM_000138chr1521740 220 21789 888 ----
NM_000141chr10--1224 152 --
NM_000158chr33537 115 65 ------
NM_000163chr542300 2291 1788 26 --12120 --
NM_000165chr6----11570 --
NM_000167chrX51742 1616 1361 245 118 1275 ----
NM_000168chr711172 --23282 850 12843
NM_000176chr543901 2986 1294 1221 --13077 11431
NM_000210chr222008 178 ----11739
NM_000212chr1752477 2298 1674 1561 699 143 ----
NM_000216chrX23979 3219 21079 62 ----
NM_000232chr442723 2569 2437 1258 --22154 470 --
NM_000245chr751738 1381 783 405 201 11554 --11723
NM_000248chr322958 2267 12354 ----
NM_000259chr1585732 4698 4661 4620 4576 2301 1211 641 15140 ----
NM_000260chr112127 69 ------
NM_000264chr943049 2613 1127 271 1314 12154 --
NM_000267chr1732736 2271 353 --23018 570 --
NM_000282chr13143 ------
NM_000284chrX31506 502 296 ----11878
NM_000286chr17152 ------
NM_000310chr131223 1180 374 ------
NM_000314chr1032708 601 476 12896 ----
NM_000318chr862688 2386 2061 1821 720 113 ----12076
NM_000321chr132169 97 --11154 --
NM_000328chrX126 ------
NM_000332chr646650 5504 2520 715 11727 ----
NM_000333chr33975 330 223 ------
NM_000335chr321919 1573 ----177
NM_000337chr5116400 6337 6204 6124 6021 5530 4446 1841 1295 1136 794 --24895 3991 12201
NM_000345chr41680 ------
NM_000367chr672090 1821 1705 1674 1496 655 150 --12021 --
NM_000368chr954259 3231 3121 1936 826 14739 14448 14156
NM_000393chr211492 --1776 22091 402
NM_000408chr221281 757 ------
NM_000428chr1441625 549 413 229 --148 1369
NM_000430chr1752669 2302 1436 1358 249 1497 ----
NM_000439chr511593 --1262 2861 776
NM_000447chr1181 --1465 --
NM_000449chr141109 936 498 136 ------
NM_000461chr321547 334 --33575 1508 1025 --
NM_000462chr152716 149 11399 1212 --
NM_000495chrX1709 --1340 --
NM_000503chr831620 262 226 ------
NM_000522chr711314 ------
NM_000530chr1185 --11050 --
NM_000531chrX1316 ------
NM_000533chrX1775 ----1271
NM_000539chr341304 1090 1029 563 --2112 66 --
NM_000555chrX87413 6334 5406 5205 3095 2921 1857 185 ------
NM_000572chr11779 ------
NM_000609chr1093168 2740 2461 900 480 389 283 139 75 ------
NM_000612chr1163561 3115 3107 2772 2664 2622 13381 1884 --
NM_000615chr1162722 2648 2242 2221 1839 1027 ------
NM_000617chr1232181 916 33 ------
NM_000618chr1266004 5968 5575 2216 1252 373 ----21895 307
NM_000618chr1266004 5968 5575 2216 1252 373 ----21895 307
NM_000621chr131496 1169 11350 --
NM_000633chr1865163 3798 1997 1968 1313 727 21412 948 25209 3327 11205
NM_000663chr1642743 2492 892 404 13053 1828 --
NM_000675chr225765 737 603 238 69 --1843 --
NM_000676chr171136 --188 --
NM_000689chr9157 ------
NM_000698chr10--1408 198 --
NM_000720chr32450 430 ----1158
NM_000721chr142743 1035 961 213 --1647 --
NM_000723chr1731430 1367 420 --1533 --
NM_000724chr1022028 195 ------
NM_000726chr2144 ------
NM_000738chr112945 799 --21026 636 1743
NM_000793chr1485018 4509 4274 3493 3239 773 543 369 --24910 786 --
NM_000800chr521604 1082 --1620 --
NM_000801chr201877 1233 ----
NM_000806chr511685 ------
NM_000807chr42560 209 ------
NM_000810chr15----133 --
NM_000811chr51524 ------
NM_000812chr41109 ------
NM_000813chr535045 4869 3705 --34271 4261 1450 --
NM_000814chr15103748 3377 3315 3131 3040 1658 1572 1350 626 507 ------
NM_000826chr41445 --1890 --
NM_000827chr542173 1608 790 302 --11855 --
NM_000829chr1131635 761 77 --11610 --
NM_000834chr1231187 1090 231 ------
NM_000844chr31200 --1309 --
NM_000845chr71146 ------
NM_000870chr541451 1263 489 32 ------
NM_000875chr15106499 6019 5562 5214 4773 4492 2735 2726 2092 741 1370 14446 --
NM_000877chr252923 681 603 468 158 --1398 --
NM_000891chr1753572 3478 2543 1254 1153 1115 13050 11477
NM_000899chr121509 ----14027
NM_000901chr4--11889 32341 2112 266 --
NM_000912chr832930 2313 1042 --13120 --
NM_000919chr51439 ------
NM_000926chr1198033 8011 7809 6253 2950 2742 2362 1015 814 --23208 1246 26468 6343
NM_000933chr2021258 1174 ----1198
NM_000935chr311166 ------
NM_000944chr411976 ------
NM_000945chr21801 --1122 --
NM_000963chr11801 32047 1849 324 --12109
NM_000964chr1731063 480 380 ------
NM_000965chr32885 215 ------
NM_000981chr17154 ------
NM_001001331chr341950 933 312 296 --11967 --
NM_001001344chrX41995 1744 545 193 --156 1569
NM_001001349chr1751230 1195 309 139 128 ------
NM_001001396chr194017 4002 3812 2728 1541 1431 1353 543 79 34235 1549 97 11711 --
NM_001001419chr511463 --13311 15188
NM_001001420chr511463 --13311 15188
NM_001001436chr162797 145 ------
NM_001001481chr842862 1191 904 495 --11227 --
NM_001001484chr1052316 2115 1847 1810 644 1778 12139 --
NM_001001556chr152487 68 ------
NM_001001664chr211189 12831 ----
NM_001001668chr1963921 3613 3201 947 729 298 14082 ----
NM_001001669chr552377 741 561 358 276 1254 ----
NM_001001684chr1742259 2163 838 610 1916 1235 --
NM_001001787chr11337 ------
NM_001001870chr171786 ------
NM_001001872chr14190 1242 ----
NM_001001890chr2144235 3680 2694 112 23956 1571 21285 714 --
NM_001001971chr10----1205 --
NM_001001974chr1032224 1470 696 1376 11826 --
NM_001001977chr20130 ------
NM_001001995chrX2324 213 ----1624
NM_001002264chr13289 51 ------
NM_001002269chr91448 ------
NM_001002811chr121345 392 11622 ----
NM_001002812chr121345 392 11622 ----
NM_001002812chr121345 392 11622 ----
NM_001002814chr843776 3393 3011 1179 --13566 --
NM_001002838chrX1735 --21583 1191 --
NM_001002843chr152953 117 ------
NM_001002860chr1463116 1791 1159 1002 772 357 ------
NM_001002909chr172442 72 --22095 610 --
NM_001002919chr2134 ------
NM_001003652chr1868712 7231 6189 5470 3362 1310 ------
NM_001003682chr121214 544 --2570 98 --
NM_001003712chr1233947 3061 2709 --33734 3582 3225 --
NM_001003792chr321001 433 ------
NM_001003793chr321001 433 ------
NM_001003794chr372422 2087 1991 1146 1114 757 556 --23030 2523 12751
NM_001003800chr933019 1007 922 --23751 3094 --
NM_001003810chr41595 ------
NM_001003845chr2----1496 --
NM_001003962chr19147 --192 --
NM_001004065chr933074 2694 369 1643 --42869 1511 1230 498
NM_001004127chr133855 714 256 --11026 --
NM_001004303chr1----1294 --
NM_001004303chr1----1294 --
NM_001004304chr1252992 2939 2658 2492 738 --12482 --
NM_001004722chr21966 ------
NM_001005209chr22536 31 ------
NM_001005353chr11489 11252 1928 --
NM_001005353chr11489 11252 1928 --
NM_001005375chrY11441 ------
NM_001005417chr11263 --1144 --
NM_001005463chr1042336 2279 1675 502 1129 12315 --
NM_001005473chr536557 6299 2018 14272 ----
NM_001005527chr32968 211 ------
NM_001005609chrX1729 1689 31285 622 110 --
NM_001005739chr21760 ------
NM_001005746chr2144 ------
NM_001005747chr2144 ------
NM_001005753chr222055 542 ------
NM_001006115chr362818 2692 2424 1918 1775 713 11733 ----
NM_001006600chr52729 609 1249 1778 --
NM_001006610chr162685 396 --1782 --
NM_001006623chr21826 --134 --
NM_001006636chr22333 146 1155 ----
NM_001007023chr1485018 4509 4274 3493 3239 773 543 369 --24910 786 --
NM_001007024chr17113554 1319 1227 1177 1087 1047 1008 852 724 595 31 --43812 2812 2775 170 --
NM_001007025chr17113554 1319 1227 1177 1087 1047 1008 852 724 595 31 --43812 2812 2775 170 --
NM_001007067chr83956 335 285 ------
NM_001007068chr83956 335 285 ------
NM_001007069chr83956 335 285 ------
NM_001007070chr83956 335 285 ------
NM_001007088chrX3458 228 149 --1472 --
NM_001007102chr61494 ------
NM_001007156chr152321 124 --1496 --
NM_001007237chr141905 1059 277 30 --1151 --
NM_001007246chr2111840 --11357 --
NM_001007257chr11444 ------
NM_001007267chr23911 785 126 ------
NM_001007471chr93304 161 21 1660 1292 --
NM_001007559chr1811902 --144 --
NM_001007565chr31318 ------
NM_001008220chr543891 3444 1129 804 ------
NM_001008222chrX41215 507 209 129 --2416 273 --
NM_001008239chr1843537 2779 880 174 13146 ----
NM_001008272chr3177 ------
NM_001008273chr3177 ------
NM_001008392chr393510 2977 2631 2617 1307 1172 845 791 115 --1574 11092
NM_001008407chr751614 605 438 220 45 ------
NM_001008408chr785247 4336 2173 1295 1268 1118 916 904 1362 21615 148 --
NM_001008410chr262204 1449 1392 762 703 496 ------
NM_001008491chr251902 1601 777 734 214 --11328 --
NM_001008492chr251902 1601 777 734 214 --11328 --
NM_001008564chr1352161 1795 1584 674 157 ------
NM_001008567chr92350 43 ------
NM_001008701chr1962643 983 751 549 129 105 --1211 --
NM_001008707chr142320 162 --1258 --
NM_001008738chr532086 329 120 ------
NM_001008801chr1931743 1434 729 2813 793 1604 --
NM_001008895chr1321121 534 ------
NM_001008925chr432953 385 304 ------
NM_001009183chr14126 ------
NM_001009552chr81156 ------
NM_001009554chr453860 1635 1345 865 570 1393 1600 --
NM_001009554chr453860 1635 1345 865 570 1393 1600 --
NM_001009880chr2244195 4148 2974 130 --23604 115 --
NM_001009899chr396164 5888 5400 4802 4687 4281 2259 1611 148 --14155 --
NM_001009955chr11576 ------
NM_001009955chr11576 ------
NM_001009993chr264221 4007 3517 3038 2868 916 --2626 39 --
NM_001010853chr622790 792 ------
NM_001010854chr144740 252 128 96 ------
NM_001010861chr122242 427 --12133 --
NM_001010867chr1146136 5887 4908 4533 4157 2430 2214 1877 1233 1206 1158 1134 773 572 --1865 --
NM_001010888chrX73631 2867 1562 1352 920 696 222 --21115 729 --
NM_001010891chr525366 2784 26786 324 36217 5840 2470 --
NM_001010942chr122247 146 11018 11126 --
NM_001010971chr11931 ------
NM_001010986chrX21001 970 --21891 1745 --
NM_001011513chr432878 951 693 --24080 3643 --
NM_001011537chr312089 --11646 1948
NM_001011553chr71922 1376 ----
NM_001011666chr775885 5696 5148 4541 1731 1607 290 --15132 --
NM_001011708chr222377 2309 ------
NM_001011724chr13--1116 156 --
NM_001011725chr13--1116 156 --
NM_001011885chr15124 1273 --11759
NM_001012264chr141658 ------
NM_001012270chr1771588 1566 1277 690 566 361 298 ----11193
NM_001012271chr1771691 1669 1380 793 669 464 401 ----11296
NM_001012329chr122195 148 ----11974
NM_001012393chr1144665 1798 1215 327 13509 1428 --
NM_001012642chr1562031 1904 1400 794 410 360 ------
NM_001012661chr111153 ------
NM_001012732chr42359 166 ------
NM_001012751chr1021572 1414 ------
NM_001012756chr1973136 3071 2746 2619 2095 2047 369 ------
NM_001012968chrX12343 --1451 --
NM_001012977chrX11256 11085 ----
NM_001012990chrX156 ------
NM_001013031chr1032649 553 390 1525 ----
NM_001013251chr111153 ------
NM_001013415chr411307 ----11368
NM_001013438chr3----172 --
NM_001013620chr1277660 7315 6255 6033 5453 3108 1776 36568 5679 766 18110 --
NM_001013624chr174346 274 87 39 11120 ----
NM_001013690chr1231994 1949 192 1320 22000 30 --
NM_001013693chr182938 2592 2528 2347 2262 843 773 135 ------
NM_001013693chr182938 2592 2528 2347 2262 843 773 135 ------
NM_001014283chr1341705 1542 1458 113 --1294 --
NM_001014435chr165594 585 531 520 25 ------
NM_001014794chr111198 1241 ----
NM_001014795chr111198 1241 ----
NM_001014797chr10117087 7079 6818 6651 5613 5396 2936 2278 1889 1398 1365 26696 5335 ----
NM_001015053chr17----175 --
NM_001015877chrX12174 ------
NM_001015887chr331627 1346 151 ------
NM_001017371chr21892 ------
NM_001017415chr1199 ------
NM_001017416chr1199 ------
NM_001017424chr1--1292 21846 33 --
NM_001017425chr1--1292 21846 33 --
NM_001017523chr1241523 1286 1252 52 --21701 647 --
NM_001018025chrX1267 --1547 1791
NM_001018050chr22133476 3406 3197 2381 2242 1184 1131 1109 591 569 528 368 308 --23332 2671 --
NM_001018052chr22133476 3406 3197 2381 2242 1184 1131 1109 591 569 528 368 308 --23332 2671 --
NM_001018054chr11986 ------
NM_001018065chr974537 4370 2343 2315 1848 1685 857 --21864 1087 11707
NM_001018066chr974537 4370 2343 2315 1848 1685 857 --21864 1087 11707
NM_001018067chr153685 3670 1372 1010 172 ------
NM_001018068chr153685 3670 1372 1010 172 ------
NM_001018069chr153685 3670 1372 1010 172 ------
NM_001018072chr1241523 1286 1252 52 --21701 647 --
NM_001018074chr543901 2986 1294 1221 --13077 11431
NM_001018075chr543901 2986 1294 1221 --13077 11431
NM_001018076chr543901 2986 1294 1221 --13077 11431
NM_001018077chr543901 2986 1294 1221 --13077 11431
NM_001018100chr152830 202 --1561 --
NM_001023567chr151107 ------
NM_001023587chr32789 466 ------
NM_001024094chr543901 2986 1294 1221 --13077 11431
NM_001024372chr8136 --2470 415 --
NM_001024401chr1682612 2317 1885 974 345 255 173 84 --2925 231 --
NM_001024455chrX71849 747 560 475 196 71 21 1260 22364 623 12493
NM_001024463chr153344 325 182 ------
NM_001024660chr341205 1127 236 176 --11084 --
NM_001024666chrX2688 24 ------
NM_001024680chr241724 1304 686 355 ------
NM_001024808chr1232576 2388 2267 12044 11956 --
NM_001024809chr1731063 480 380 ------
NM_001024847chr311849 --1364 --
NM_001024948chr123243 2938 --23190 452 --
NM_001024956chr1175481 5294 3924 3654 2269 1860 1248 25884 1389 11191 12003
NM_001025076chr1054957 4717 4121 2129 1931 --25688 4825 --
NM_001025077chr1056315 6075 5479 5108 1138 1181 47046 6183 824 719 --
NM_001025079chr344019 3779 3639 1465 ------
NM_001025105chr51964 --1405 --
NM_001025107chr152058 626 589 355 277 --22341 1067 1125
NM_001025107chr152058 626 589 355 277 --22341 1067 1125
NM_001025108chr254071 3796 2995 1455 183 --3913 866 88 --
NM_001025266chr341860 1575 1236 1037 --33139 978 21 --
NM_001025366chr611434 ------
NM_001025366chr611434 ------
NM_001025367chr611434 ------
NM_001025367chr611434 ------
NM_001025368chr611434 ------
NM_001025368chr611434 ------
NM_001025369chr611450 ------
NM_001025369chr611450 ------
NM_001025370chr611434 ------
NM_001025370chr611434 ------
NM_001025580chrX84011 3448 1619 1316 1131 813 682 23 ------
NM_001025603chr141109 936 498 136 ------
NM_001029851chr53815 571 306 ----1784
NM_001029852chr53815 571 306 ----1784
NM_001029853chr53815 571 306 ----1784
NM_001029854chr53815 571 306 ----1784
NM_001029858chr653193 1089 933 710 479 11343 13239 --
NM_001029859chr1172401 2384 2354 1591 451 350 271 ------
NM_001029863chr632465 2149 1288 --1132 11043
NM_001029875chr512370 --11076 --
NM_001029989chr152875 344 ------
NM_001029998chr421332 348 --11280 --
NM_001030001chr142380 344 ------
NM_001030007chr1612880 ------
NM_001030272chr112135 124 ------
NM_001030273chr112135 124 ------
NM_001031685chr13695 601 215 ----1822
NM_001031690chr733113 2921 694 ------
NM_001031695chr2274913 4357 4276 3970 1453 1238 992 --21621 1204 --
NM_001031710chr7147 21079 194 ----
NM_001031711chr541548 1143 719 162 --11328 1708
NM_001031732chr443241 2932 1214 529 ------
NM_001031740chr161580 1223 682 674 430 57 ------
NM_001031812chr51580 --11519 --
NM_001032221chr9------11270
NM_001032280chr621260 445 --1484 --
NM_001032283chr121213 --1358 --
NM_001032284chr121213 --1358 --
NM_001032380chr1031931 1364 430 1414 11540 --
NM_001032394chr622803 2011 --2368 119 --
NM_001032395chr622670 1878 --1235 --
NM_001033026chr192602 81 ------
NM_001033045chr274408 3924 3225 1723 1383 517 43 11671 ----
NM_001033057chr31701 ----158
NM_001033059chr6--11996 ----
NM_001033087chr2053239 2786 662 368 293 ------
NM_001033112chr51825 ------
NM_001033117chr344449 3666 1626 177 13008 34318 3766 1148 --
NM_001033507chr111535 ------
NM_001033551chr17103770 3750 3374 2897 1111 898 880 785 174 71 --13758 --
NM_001033566chr171754 ------
NM_001033568chr171754 ------
NM_001033723chr852715 2073 836 173 38 1807 32670 1886 413 --
NM_001033756chr611368 ------
NM_001033756chr611368 ------
NM_001033925chr1012195 11725 ----
NM_001033953chr111279 128 ----
NM_001034025chr123834 121 44 ------
NM_001034841chr1674813 4687 4301 4253 3509 3372 815 35387 823 129 23684 622 --
NM_001034850chr511370 ------
NM_001034954chr1062891 2620 757 482 251 238 11214 12337 --
NM_001034955chr1062891 2620 757 482 251 238 11214 12337 --
NM_001034956chr1062891 2620 757 482 251 238 11214 12337 --
NM_001034957chr1062891 2620 757 482 251 238 11214 12337 --
NM_001035chr131046 408 319 --1350 --
NM_001035003chr451253 1191 955 290 69 --11205 --
NM_001035004chr451253 1191 955 290 69 --11205 --
NM_001035521chr2----169 --
NM_001037132chr71756 --1581 --
NM_001037133chr71756 --1581 --
NM_001037164chr711499 ------
NM_001037165chr7177957 7265 6968 6928 6724 6463 6347 5956 3518 3185 2290 2256 1169 930 835 371 77 36272 2854 2369 38759 5567 481 --
NM_001037225chr112110 44 ------
NM_001037317chr122242 427 --12133 --
NM_001037334chr1841977 1961 1648 417 ------
NM_001037497chr6------125
NM_001037535chrX21134 1121 --1506 --
NM_001037536chrX21134 1121 --1506 --
NM_001037540chrX21134 1121 --1506 --
NM_001037582chr431325 1304 489 ----11694
NM_001037872chr2--2737 43 ----
NM_001037954chr1183363 2925 2835 1358 1220 744 604 141 ------
NM_001038493chr221246 418 --1122 --
NM_001038702chr52991 953 --1562 --
NM_001038707chr122236 181 ------
NM_001038707chr122236 181 ------
NM_001039199chr2074872 4864 3633 3427 1425 1216 347 ------
NM_001039350chr751648 572 352 306 266 31731 1136 535 ----
NM_001039360chr1841755 1714 1345 507 1282 1366 --
NM_001039574chr11164 ------
NM_001039585chr133721 1154 228 13621 21101 496 --
NM_001039590chrX----32901 1613 460 11128
NM_001039591chrX----32901 1613 460 11128
NM_001039618chr1134847 1400 1169 --15952 15276
NM_001039619chr141241 ------
NM_001039690chr1632056 1704 122 --11663 --
NM_001039770chr321589 241 22374 128 11570 --
NM_001039840chrX44551 1707 1552 1047 22204 728 ----
NM_001039937chr13121 12918 11658 --
NM_001039960chr1261649 1113 560 282 203 132 11584 21183 351 --
NM_001040020chr71100 ------
NM_001040057chr72575 138 1167 ----
NM_001040059chr171587 ------
NM_001040110chr751192 726 584 526 488 ------
NM_001040113chr161734 --1887 --
NM_001040114chr162593 275 --1746 --
NM_001040135chr72604 167 ------
NM_001040142chr231632 385 376 ------
NM_001040143chr231632 385 376 ------
NM_001040144chr1632056 1704 122 --11663 --
NM_001040146chr1632056 1704 122 --11663 --
NM_001040152chr774477 4290 3395 1299 1254 1093 124 ------
NM_001040153chr132312 148 ------
NM_001040172chr541451 1263 489 32 ------
NM_001040173chr541451 1263 489 32 ------
NM_001040284chr1665307 4685 4146 3971 1568 142 1254 25113 1889 --
NM_001040402chr431176 1134 29 1614 --162
NM_001040429chr13----2960 517 --
NM_001040446chr532039 648 76 1926 11076 --
NM_001040450chr1522814 2334 --1170 --
NM_001040453chr1522814 2334 --1170 --
NM_001040653chr361829 935 887 858 778 370 11633 ----
NM_001040708chr81933 ------
NM_001040712chr913303 --169 --
NM_001040876chr421219 28 ------
NM_001042404chr12532 318 ----1104
NM_001042406chr6------149
NM_001042424chr442984 257 162 105 ------
NM_001042425chr621260 445 --1484 --
NM_001042473chr1021498 476 ------
NM_001042475chr6------165
NM_001042481chr14188 11840 ----
NM_001042486chr2011500 ------
NM_001042492chr1732736 2271 353 --23018 570 --
NM_001042494chr1522871 2799 --31202 1068 244 --
NM_001042495chr1522871 2799 --31202 1068 244 --
NM_001042496chr1522871 2799 --31202 1068 244 --
NM_001042497chr1522871 2799 --31202 1068 244 --
NM_001042510chr81118 ------
NM_001042511chr81118 ------
NM_001042517chr132348 47 ------
NM_001042537chrX11633 --22426 705 --
NM_001042543chr421154 66 ------
NM_001042555chr1264318 4310 3673 3661 3144 1154 --11243 --
NM_001042599chr237116 6973 787 12505 15573 15313
NM_001042601chr322929 1080 --12284 --
NM_001042603chr1224498 4048 --1866 --
NM_001042604chr344830 4055 3267 2998 1963 ----
NM_001042681chr151954 1738 1688 748 604 1381 12677 --
NM_001042682chr151954 1738 1688 748 604 1381 12677 --
NM_001042682chr151954 1738 1688 748 604 1381 12677 --
NM_001042749chrX----1210 --
NM_001042750chrX----1210 --
NM_001042751chrX----1210 --
NM_001043351chr121680 833 ------
NM_001044385chr221357 1215 ----1323
NM_001044722chr51580 --11519 --
NM_001044723chr51580 --11519 --
NM_001046chr522954 1950 ------
NM_001071775chr1321830 485 11716 ----
NM_001076778chr382421 2341 2120 1549 890 664 484 24 --12333 --
NM_001080418chr11142 ------
NM_001083620chr41444 --1889 --
NM_001092chr1742284 2229 1984 990 ------
NM_001095chr122637 354 ------
NM_001096chr172619 122 1627 ----
NM_001106chr3108873 8232 7905 6335 3131 2954 2843 2737 2498 304 38179 6768 1250 27179 677 --
NM_001111chr152058 626 589 355 277 --22341 1067 1125
NM_001113490chrX103457 3022 2649 2381 2320 2229 1314 1274 857 586 13354 13221 --
NM_001116chr1682871 2775 1984 1009 762 649 455 87 12326 1955 --
NM_001121chr1011386 ------
NM_001122679chr511096 ------
NM_001128chr1612880 ------
NM_001146chr841662 1632 1446 136 21480 409 --1632
NM_001148chr45887 855 833 759 428 ------
NM_001149chr101276 ------
NM_001152chrX2215 166 ------
NM_001167chrX86327 6179 5753 4846 4387 4186 2138 1230 --12474 --
NM_001174chrX51845 1550 704 522 237 --11623 --
NM_001178chr112135 124 ------
NM_001186chr2131279 676 488 12361 22874 587 13041
NM_001198chr641845 1579 876 194 --11856 1760
NM_001204chr297624 7318 7084 6548 5619 5085 4990 886 663 1530 1978 15699
NM_001206chr92583 118 12483 ----
NM_001212chr17----124 --
NM_001241chr221641 754 ------
NM_001241chr221641 754 ------
NM_001251chr171587 ------
NM_001259chr776041 4870 2065 1726 1478 1288 1087 ------
NM_001265chr13144 --1106 --
NM_001270chr52788 461 --144 --
NM_001271chr1553030 3012 2324 2174 33 --22911 932 --
NM_001273chr122480 433 ------
NM_001280chr191267 ------
NM_001284chr51398 ------
NM_001290chr42769 342 ------
NM_001292chr1561013 931 454 419 252 138 ----1904
NM_001304chr1733527 918 235 ------
NM_001310chr1252964 2942 2415 1038 545 ------
NM_001343chr531549 1441 346 --21659 1377 11111
NM_001347chr43197 121 33 ------
NM_001351chr321657 739 --11415 --
NM_001356chrX22389 666 2894 157 --12022
NM_001361chr167770 660 583 338 295 112 99 ------
NM_001364chr1153722 1878 1766 1713 156 ----11394
NM_001387chr542633 544 528 257 12906 11985 --
NM_001389chr212425 59 ------
NM_001390chr1872874 2549 2496 2256 2212 1161 100 1948 2778 308 13288
NM_001396chr2152333 1054 713 257 189 1118 21088 268 --
NM_001397chr162654 2265 2241 1960 547 95 2919 302 42577 2227 1010 781 --
NM_001399chrX1729 1689 31285 622 110 --
NM_001401chr911085 --11576 --
NM_001416chr171442 ------
NM_001419chr1954046 3954 3061 600 581 --12982 13736
NM_001423chr1271700 1451 1363 775 517 440 250 1313 ----
NM_001431chr6181 1109 ----
NM_001432chr453672 3011 1497 1339 660 ------
NM_001438chr141350 1081 874 821 --33071 1407 1269 --
NM_001448chrX41561 1392 606 128 --11363 --
NM_001460chr14841 778 231 79 1834 22740 2205 12244
NM_001494chr10------1498
NM_001498chr62934 44 ------
NM_001520chr163539 44 33 --1141 --
NM_001521chr2----169 --
NM_001527chr694813 4337 3752 3596 3457 3185 2999 1892 1457 13414 ----
NM_001530chr1421050 750 1101 --1459
NM_001542chr141905 1059 277 30 --1151 --
NM_001543chr5104265 3975 3734 3513 3252 3074 1881 1817 875 383 --1860 --
NM_001546chr621424 91 ------
NM_001560chrX32177 962 682 --1135 1412
NM_001616chr212672 --12997 --
NM_001618chr1----123 --
NM_001634chr6--11996 ----
NM_001650chr1832672 1667 438 ------
NM_001655chr113636 174 93 ------
NM_001656chr512027 --1313 --
NM_001663chr1432252 1772 851 ------
NM_001664chr33956 761 390 ------
NM_001665chr111371 --1447 --
NM_001677chr13975 376 30 ------
NM_001683chr341950 933 312 296 --11967 --
NM_001684chr173734 3719 3529 1258 1148 1070 260 23952 1266 21575 1428 --
NM_001699chr1921841 696 ------
NM_001701chr9194 --11526 11602
NM_001704chr6----1444 --
NM_001709chr1121853 967 --12499 --
NM_001729chr41345 ------
NM_001730chr1321171 480 --1260 --
NM_001730chr1321171 480 --1260 --
NM_001731chr122169 104 ------
NM_001742chr73336 254 37 ------
NM_001749chr19147 --192 --
NM_001754chr2144235 3680 2694 112 23956 1571 21285 714 --
NM_001755chr1642272 2244 1409 617 ------
NM_001759chr1265027 4749 4654 4456 4128 557 1779 ----
NM_001777chr344019 3779 3639 1465 ------
NM_001788chr71922 1376 ----
NM_001789chr31316 1237 1276 --
NM_001802chr1611016 ----1825
NM_001830chrX22933 880 1906 13564 --
NM_001831chr831298 1290 1096 ------
NM_001844chr12171 ------
NM_001845chr1311338 127 1512 --
NM_001862chr2164 ------
NM_001875chr21167 --145 --
NM_001881chr101397 ------
NM_001892chr51964 --1405 --
NM_001901chr61428 ------
NM_001904chr32725 240 1128 ----
NM_001918chr1148603 8404 8220 8080 7744 5855 2854 2748 2594 1960 1790 1040 463 206 16675 77441 7186 6327 6298 6276 6210 619 --
NM_001921chr42359 166 ------
NM_001923chr113581 531 234 --1128 --
NM_001936chr751648 572 352 306 266 31731 1136 535 ----
NM_001937chr12891 823 ------
NM_001938chr111329 ------
NM_001942chr1821989 523 --11863 --
NM_001945chr52886 434 ----1100
NM_001954chr63719 579 286 ------
NM_001955chr611017 --2268 29 --
NM_001957chr421905 471 --12049 1655
NM_001962chr5127 ------
NM_001964chr52233 78 ------
NM_001967chr31573 ------
NM_001968chr4--1701 ----
NM_001969chr1443031 2846 1233 112 --13302 --
NM_001980chr1272068 1616 1444 914 649 510 21 ------
NM_001981chr11855 ------
NM_001993chr12183 21 ------
NM_001995chr421231 182 ------
NM_001999chr511011 --1598 --
NM_002009chr1512246 22475 751 1461 --
NM_002015chr1322040 564 ----23385 3263
NM_002017chr1111087 1926 ----
NM_002024chrX--1163 ----
NM_002025chrX78584 2876 2044 1831 1661 843 610 16323 13691 28223 6444
NM_002028chr1441291 383 348 90 ------
NM_002039chr41363 ------
NM_002044chr152487 68 ------
NM_002063chrX31162 1141 903 --1912 --
NM_002069chr7------11813
NM_002074chr131229 663 611 ------
NM_002076chr1242951 2880 713 287 --12113 --
NM_002077chr941800 1419 353 325 --11755 --
NM_002092chr465005 4826 4673 4434 3610 1808 11009 ----
NM_002114chr61164 ------
NM_002126chr1723213 3073 11347 ----
NM_002129chr41434 ------
NM_002136chr121471 1116 156 --
NM_002137chr71174 ------
NM_002138chr41595 ------
NM_002158chr221382 771 ----23681 63
NM_002160chr91422 ------
NM_002184chr5--123 ----
NM_002193chr241931 1330 386 361 --2456 238 1324
NM_002202chr511058 1725 ----
NM_002203chr574157 3752 2915 2752 1467 1300 535 --13411 --
NM_002207chr32178 163 --2634 239 --
NM_002211chr102756 233 11020 21082 58 --
NM_002214chr765259 4263 2284 1546 1446 700 1741 178 --
NM_002222chr321071 938 --11048 --
NM_002228chr1--11264 ----
NM_002247chr1032312 1674 812 --1864 --
NM_002252chr2----1118 --
NM_002264chr344381 3874 3174 1915 ------
NM_002267chr1351637 271 168 147 136 11988 ----
NM_002268chr351683 1442 1421 304 297 ------
NM_002270chr565584 5416 4943 3564 2026 685 --33985 1845 1548 11901
NM_002285chr254071 3796 2995 1455 183 --3913 866 88 --
NM_002293chr172510 2256 1900 1748 607 563 56 12355 1145 --
NM_002310chr562534 1999 1789 1074 62 30 25838 327 ----
NM_002334chr1111635 ------
NM_002336chr1233635 3327 1589 1217 ----
NM_002345chr121590 ------
NM_002351chrX41275 661 368 110 ----192
NM_002353chr1169 ------
NM_002356chr6--1428 ----
NM_002359chr17103571 3480 3335 2811 2722 1579 1566 1435 402 38 --13377 --
NM_002360chr772591 2442 2434 2204 2070 934 441 --21637 1613 --
NM_002372chr51185 ------
NM_002373chr1521354 878 --11077 --
NM_002375chr342264 830 755 614 ------
NM_002380chr83979 368 142 ------
NM_002387chr575085 3786 3698 1501 1431 1371 54 1549 ----
NM_002390chr1741429 1330 335 292 --176 11350
NM_002397chr521761 863 11883 ----
NM_002398chr211035 ------
NM_002399chr152203 186 ----11438
NM_002401chr1722408 736 --12441 --
NM_002402chr71910 --21098 875 --
NM_002406chr5136 --11052 --
NM_002409chr2242804 2301 2260 952 1612 32351 2090 523 13237
NM_002451chr953040 3018 2793 2659 1483 13308 ----
NM_002467chr8------1132
NM_002474chr162593 275 --1746 --
NM_002480chr1231440 433 69 ------
NM_002481chr1136918 6048 5851 4879 2215 1683 1393 1145 645 431 317 249 138 13174 17506 --
NM_002499chr1582348 2103 1976 1897 1799 1756 1515 165 ------
NM_002500chr2------11012
NM_002501chr1953593 1241 1102 1083 170 1908 13307 1770
NM_002518chr23902 344 61 --1239 --
NM_002519chr1111296 ------
NM_002522chr1753290 2771 2441 1060 1050 --11120 12682
NM_002523chr731019 845 62 ------
NM_002537chr15--1805 133 --
NM_002539chr2----1127 --
NM_002545chr1144665 1798 1215 327 13509 1428 --
NM_002546chr82596 124 ------
NM_002556chr1121720 809 --12079 --
NM_002564chr113940 406 73 --1702 --
NM_002570chr151849 --11028 --
NM_002574chr1141 ------
NM_002581chr965165 4007 2120 1166 283 275 ------
NM_002583chr121555 ------
NM_002588chr541694 1346 1311 287 --125 --
NM_002594chr2052189 1550 914 817 452 --1358 --
NM_002595chr122514 176 --11709 --
NM_002601chr23347 188 137 ------
NM_002613chr16105180 4518 3788 3515 1778 1364 1071 510 491 96 --11541 --
NM_002628chr31966 21212 60 ----
NM_002629chr105839 663 337 157 83 ------
NM_002633chr12568 496 ------
NM_002641chrX22014 229 ------
NM_002645chr1142599 2079 315 214 1248 1183 --
NM_002646chr111673 --11937 --
NM_002655chr854098 940 923 268 232 24481 4463 ----
NM_002656chr61311 ------
NM_002657chr2053687 2810 1322 793 591 --1273 --
NM_002660chr202362 156 ------
NM_002670chr321163 25 ------
NM_002687chr14127 ------
NM_002693chr151115 ------
NM_002698chr1942708 2414 767 306 ------
NM_002703chr42590 64 ------
NM_002709chr252706 2686 173 110 87 ------
NM_002710chr121802 ------
NM_002711chr7------1625
NM_002714chr6----1814 --
NM_002715chr52885 142 ------
NM_002716chr1153674 3206 2975 1343 1251 144 2498 316 --
NM_002717chr81203 --1149 --
NM_002718chr31583 ------
NM_002719chr1441538 556 201 79 --1638 --
NM_002729chr10157 --1714 --
NM_002731chr112223 21213 208 --12360
NM_002734chr1741742 1665 404 97 11857 ----
NM_002736chr731852 1679 412 1798 11572 --
NM_002738chr162734 331 ------
NM_002742chr141642 ------
NM_002745chr2273081 3066 1423 944 622 405 282 --23003 369 --
NM_002755chr15--1739 ----
NM_002816chr171283 ------
NM_002819chr193510 407 63 --21315 361 --
NM_002828chr18151 ----1147
NM_002830chr2--2309 64 ----
NM_002833chr15195 ------
NM_002834chr1241318 1131 924 730 11339 --11259
NM_002837chr1254439 4205 3684 3615 3327 ----1931
NM_002839chr913303 --169 --
NM_002840chr131108 415 158 --170 --
NM_002843chr1122524 2299 --12976 --
NM_002844chr62323 223 ------
NM_002865chr81110 ------
NM_002868chr1242002 1794 1722 945 ------
NM_002869chr111616 ----11366
NM_002874chr921737 386 21816 198 ----
NM_002880chr33709 325 197 --1768 --
NM_002892chr1421182 215 ------
NM_002893chrX142 ------
NM_002895chr202924 895 1942 ----
NM_002902chr151223 ------
NM_002923chr1--174 1623 --
NM_002924chr12459 38 ------
NM_002940chr421219 28 ------
NM_002941chr311646 ----11600
NM_002942chr31393 --1144 --
NM_002945chr172311 247 1704 192 --
NM_002957chr992859 2776 2592 1204 950 697 546 291 40 13677 23157 1574 --
NM_002971chr3----11048 --
NM_002977chr243322 3230 2894 125 13404 ----
NM_002998chr831864 794 106 --12025 --
NM_003003chr17----1209 --
NM_003010chr1731901 963 341 1830 11748 --
NM_003012chr873165 2334 440 308 262 193 83 --1171 --
NM_003013chr41178 ----1583
NM_003016chr1721776 1365 ------
NM_003017chr6----1878 --
NM_003028chr983821 3635 3277 2855 1482 586 549 80 11053 11150 --
NM_003031chr162685 396 --1782 --
NM_003034chr1267417 6639 2096 1436 1306 715 15006 1573 --
NM_003035chr12876 103 ------
NM_003043chr373401 2844 2657 1689 1635 899 122 --12951 --
NM_003045chr1384704 3435 3297 3192 417 307 242 224 --14112 14238
NM_003060chr521285 164 ------
NM_003062chr5160 ------
NM_003069chrX1104 --180 --
NM_003071chr311932 --1559 --
NM_003074chr322145 582 --1490 --
NM_003079chr171167 --1355 --
NM_003099chr15106343 5563 4935 4862 4613 2133 1456 937 570 393 --24661 4059 --
NM_003106chr31342 ------
NM_003108chr2106950 6816 6793 6717 6459 6214 2742 2319 2193 2042 12827 ----
NM_003111chr21892 ------
NM_003112chr712299 ------
NM_003113chr22871 196 ------
NM_003118chr542036 1809 1709 1615 ------
NM_003128chr232589 2338 853 12452 1507 --
NM_003131chr652242 1750 874 439 96 --1130 --
NM_003137chr651651 1504 1384 540 184 12140 11471 --
NM_003140chrY--125 ----
NM_003144chr622162 84 ------
NM_003150chr1742279 757 423 417 --1434 --
NM_003155chr842776 1098 487 329 ------
NM_003161chr1753307 2486 2475 2336 1214 ------
NM_003162chr2--1340 ----
NM_003178chr352114 1963 1620 1392 883 ----11928
NM_003185chr20189 --1257 --
NM_003189chr132611 2468 431 ----1537
NM_003199chr1823758 582 21811 1078 21729 956 25698 2058
NM_003200chr196924 791 478 248 65 27 ------
NM_003202chr541753 1563 599 563 1671 ----
NM_003204chr171673 11293 11444 --
NM_003206chr6----1367 --
NM_003211chr121283 ------
NM_003220chr621260 445 --1484 --
NM_003221chr643909 3533 2912 2583 23629 2687 ----
NM_003236chr263166 2466 1274 372 336 98 --23060 1070 21064 860
NM_003239chr141932 1895 ----
NM_003242chr311849 --1364 --
NM_003246chr1541598 1387 761 311 ------
NM_003253chr212151 143 11299 ----
NM_003257chr151183 ------
NM_003262chr364781 4693 3760 3437 403 196 15223 11282 --
NM_003268chr1------136
NM_003274chr211414 --31154 989 614 --
NM_003275chr92940 564 --1205 11167
NM_003286chr201340 ------
NM_003298chr355672 4492 1773 1719 109 --54901 4775 1753 897 711 --
NM_003304chr321279 118 ------
NM_003320chr1153809 3764 3483 958 463 2332 243 11174 --
NM_003325chr222536 41 --1587 --
NM_003326chr152529 2302 2291 885 233 --1109 --
NM_003329chr9129 ------
NM_003330chr1241416 719 658 254 ------
NM_003336chrX--132 ----
NM_003337chr521503 86 ------
NM_003339chr531558 1540 476 ------
NM_003340chr421359 393 ------
NM_003341chr32170 39 ------
NM_003345chr161103 ------
NM_003359chr43849 383 250 ------
NM_003360chr4176 ------
NM_003368chr1199 ------
NM_003369chr1141874 697 675 270 ------
NM_003371chr92592 46 ------
NM_003374chr5150 ------
NM_003375chr101403 ------
NM_003376chr611434 ------
NM_003376chr611434 ------
NM_003387chr211037 --3751 728 472 --
NM_003390chr1121140 1006 ------
NM_003392chr343668 3553 3470 1073 ------
NM_003399chrX21006 331 --1712 1719
NM_003403chr141700 ------
NM_003405chr221118 170 ----
NM_003406chr821550 643 --1393 11325
NM_003410chrX12726 1760 ----
NM_003413chrX4621 170 115 103 1652 ----
NM_003432chr51178 --1534 --
NM_003439chr742685 2411 1122 24 12872 42816 2171 139 117 22660 1052
NM_003458chr3133767 3609 2747 2727 2702 1579 1166 1081 784 772 683 577 377 ----11338
NM_003466chr23910 498 486 --32448 455 71 --
NM_003468chr213963 ------
NM_003470chr161593 --11409 --
NM_003474chr1042194 2130 1805 134 --1647 --
NM_003477chr11----1582 --
NM_003478chr1121042 900 12667 ----
NM_003482chr1222150 266 --12106 12336
NM_003483chr1222226 403 --12681 --
NM_003498chr1682688 2619 2433 1879 1699 708 484 299 --12459 --
NM_003505chr711613 ------
NM_003583chr1293625 3368 3278 2736 2441 1116 957 307 285 ------
NM_003589chr1321121 534 ------
NM_003590chr223923 2648 ------
NM_003603chr43755 155 40 ------
NM_003607chr153506 1753 861 773 101 24320 1441 11113 --
NM_003615chr343231 2549 2541 1205 --21453 538 --
NM_003619chr41637 1575 ----
NM_003622chr1232526 905 376 1175 1458 --
NM_003626chr1121092 463 ------
NM_003629chr153164 2670 2388 1312 196 12963 11221 --
NM_003632chr17----1159 1617
NM_003637chr12213 97 --11427 1565
NM_003644chr17106117 4876 4711 2215 1832 1146 915 551 321 103 --35971 4259 472 --
NM_003663chr343080 1124 552 187 ----13016
NM_003670chr32375 239 ------
NM_003671chr933545 2936 1240 --12949 11315
NM_003679chr162889 2394 1223 1070 910 79 ------
NM_003684chr111036 --1964 --
NM_003690chr22572 539 ------
NM_003692chr91145 ------
NM_003713chr11408 ------
NM_003714chr563077 2963 2133 632 361 98 --1907 --
NM_003718chr71448 ------
NM_003719chr53815 571 306 ----1784
NM_003728chr4--1512 ----
NM_003732chr51283 ------
NM_003735chr541694 1346 1311 287 --125 --
NM_003736chr541694 1346 1311 287 --125 --
NM_003743chr252174 2102 1595 1517 101 11548 11820 --
NM_003749chr1321723 33 --12432 --
NM_003758chr151282 196 ----
NM_003758chr151282 196 ----
NM_003759chr433969 247 23 ------
NM_003766chr171137 ----1181
NM_003780chr11263 --1144 --
NM_003787chr184694 438 200 129 ------
NM_003794chr3176 ------
NM_003818chr202975 228 ------
NM_003822chr132800 2673 2181 --2988 561 --
NM_003825chr1521479 325 1437 --1460
NM_003829chr911148 --1283 --
NM_003860chr111330 ------
NM_003861chr1422180 436 1774 --130
NM_003870chr1542019 1733 714 136 ------
NM_003872chr292880 2775 2524 2353 2316 2080 1922 792 280 194 1176 --
NM_003885chr176880 804 445 224 215 96 --22277 671 --
NM_003888chr1531654 1158 201 1330 196 --
NM_003895chr2111975 ----1246
NM_003899chr1372621 2581 2540 2302 894 701 421 12245 1221 --
NM_003901chr10112545 2487 2396 2323 2233 2018 1923 1734 1673 832 778 ------
NM_003913chr632989 1302 417 --13903 --
NM_003927chr181918 ------
NM_003929chr121681 542 ------
NM_003940chr3----135 --
NM_003941chr72470 196 --12411 --
NM_003945chr51439 ------
NM_003966chr545602 2558 2449 124 --27684 2797 --
NM_003972chr1031311 1207 316 ----1441
NM_003980chr61571 ------
NM_003983chr1642911 2818 1653 1185 13492 22826 1629 --
NM_003994chr121509 ----14027
NM_004006chrX1777 ------
NM_004007chrX1777 ------
NM_004009chrX1777 ------
NM_004010chrX1777 ------
NM_004011chrX1777 ------
NM_004012chrX1777 ------
NM_004013chrX1777 ------
NM_004014chrX1777 ------
NM_004015chrX1777 ------
NM_004017chrX1777 ------
NM_004019chrX1391 --1422 --
NM_004020chrX1777 ------
NM_004024chr121395 431 11410 21118 38 --
NM_004028chr1832672 1667 438 ------
NM_004050chr14----12323 --
NM_004052chr10193 ----1561
NM_004055chr1141882 1606 1489 349 ------
NM_004075chr12------1239
NM_004077chr121354 ------
NM_004079chr151929 1843 842 677 311 ----12517
NM_004080chr7--21442 408 ----
NM_004081chrY11441 ------
NM_004093chr1362413 2160 604 441 378 279 --33230 2956 2339 --
NM_004094chr1462670 2478 2468 2326 740 182 --11026 --
NM_004096chr1021779 321 11984 ----
NM_004100chr61179 11844 11034 --
NM_004112chr1751195 503 396 95 50 ------
NM_004124chr1453093 1063 1033 571 465 ----12767
NM_004133chr832449 906 866 ------
NM_004134chr51606 ------
NM_004156chr81156 ------
NM_004162chr321203 345 --1441 --
NM_004171chr1189363 9060 7793 7590 7164 2455 2223 605 12853 17191 --
NM_004180chr2----1625 --
NM_004183chr111574 --4766 289 83 77 --
NM_004187chrX31459 1001 395 ------
NM_004200chr1163047 2645 2559 1312 379 95 --11012 12997
NM_004205chr111460 ------
NM_004211chr11----1183 --
NM_004225chr821413 1235 --1333 --
NM_004227chr772747 2645 2431 2253 2057 489 456 12499 1981 --
NM_004232chr1812969 33191 2749 100 23016 1453 --
NM_004241chr101167 ------
NM_004255chr151128 ------
NM_004272chr531543 338 251 ------
NM_004281chr101498 --1463 --
NM_004295chr172282 140 --21300 1007 1333
NM_004301chr31385 ------
NM_004302chr1282844 2515 2334 998 801 468 318 252 12769 --12472
NM_004309chr175933 745 347 310 257 ------
NM_004311chr1052121 2045 2014 1171 653 --1706 --
NM_004320chr16136 ------
NM_004321chr293214 2925 2297 1312 740 614 531 517 159 --12529 --
NM_004330chr15--1918 ----
NM_004331chr842251 1929 593 56 ------
NM_004349chr8------1413
NM_004354chr42253 174 ------
NM_004356chr113187 114 21 ------
NM_004369chr22250 50 ------
NM_004370chr631902 666 274 --1718 --
NM_004379chr231679 478 417 155 ----
NM_004380chr1622244 110 --11686 --
NM_004384chr51580 --11519 --
NM_004392chr1332048 2023 1028 --1972 --
NM_004393chr322169 1700 --11712 --
NM_004397chr1164008 3810 3527 3232 1649 1246 --23468 830 14089
NM_004404chr251902 1601 777 734 214 --11328 --
NM_004419chr101204 ------
NM_004420chr1172389 2232 2122 2012 1855 1522 246 1399 42395 791 490 410 --
NM_004422chr173485 128 111 ------
NM_004426chr1221704 171 ------
NM_004427chr111056 ------
NM_004429chrX11232 ------
NM_004430chr861828 1703 1025 857 643 467 --181 --
NM_004432chr931499 558 236 --12185 --
NM_004434chr142320 162 --1258 --
NM_004440chr621946 1711 ------
NM_004450chr141360 ------
NM_004451chr11197 --1274 1236
NM_004454chr312025 ------
NM_004457chr2129 ------
NM_004459chr1741890 1581 1398 334 ------
NM_004472chr51219 ------
NM_004480chr141305 ------
NM_004482chr2----1325 --
NM_004484chrX1124 ------
NM_004487chr32921 829 1457 ----
NM_004491chr19103755 3696 3350 3308 3213 2711 1379 1193 1184 520 14294 ----
NM_004496chr142897 35 ------
NM_004499chr51209 1488 ----
NM_004501chr163989 3580 1459 1427 924 829 1390 ----
NM_004504chr252331 784 592 383 44 --12661 --
NM_004505chr172720 254 ------
NM_004513chr1583159 2939 2793 2711 2543 1446 796 643 1268 33963 3303 199 --
NM_004514chr1762527 2334 1911 726 619 366 --21105 167 --
NM_004517chr111198 1241 ----
NM_004520chr51625 ------
NM_004529chr9--11179 ----
NM_004535chr2031661 1645 696 11290 ----
NM_004569chr141667 --2139 57 --
NM_004575chr411224 ------
NM_004580chr153467 437 404 --1293 --
NM_004583chr172219 93 --1304 1586
NM_004586chrX64468 1856 1827 1651 1277 242 15259 24133 1230 --
NM_004598chr573113 2840 2614 1039 987 950 47 --12429 --
NM_004612chr954399 2979 1081 851 179 --11231 --
NM_004626chr112179 157 --1498 --
NM_004631chr11986 ------
NM_004646chr191441 ------
NM_004654chrY----21081 324 --
NM_004655chr172926 284 ------
NM_004660chrY32257 662 22 ----1148
NM_004663chr1531465 383 371 ------
NM_004664chr12------144
NM_004687chr1721600 1313 1287 ----
NM_004703chr1732232 2224 1581 ----1103
NM_004705chr111122 ------
NM_004709chrX11171 --11637 --
NM_004713chr14------1694
NM_004719chr1222736 2354 --12596 --
NM_004721chr31262 ------
NM_004723chr11865 1180 2331 207 --
NM_004726chrX65374 5249 4578 3909 2113 1218 23742 1810 ----
NM_004734chr1332598 2330 886 ------
NM_004737chr222897 92 ----1306
NM_004738chr2021940 491 2755 273 21735 1721 --
NM_004742chr321766 1435 ----21508 548
NM_004745chr8116194 5986 5527 5245 4582 2739 2716 2657 1187 883 737 36730 4682 455 11514 --
NM_004747chr102210 162 1564 --11318
NM_004748chr1534251 2833 83 --23170 456 --
NM_004755chr141925 --1305 --
NM_004759chr181863 1762 1737 1642 1627 790 632 279 1511 ----
NM_004763chr27784 728 448 392 336 280 263 ------
NM_004768chr121125 380 ------
NM_004774chr1712784 --11201 --
NM_004776chr2041141 700 628 183 22591 806 23104 305 --
NM_004786chr181187 ------
NM_004788chr1152508 2015 1106 1039 410 ------
NM_004796chr1441752 1621 1531 689 --1201 --
NM_004798chr201408 12955 23311 2916 --
NM_004801chr221048 380 1964 11130 --
NM_004805chr231172 973 265 --11243 --
NM_004808chr1032378 2365 951 22862 233 12066 --
NM_004814chr13478 404 139 ------
NM_004815chr144261 1600 466 187 ------
NM_004817chr9153 ----1513
NM_004822chr17103570 3320 2573 1316 1189 572 560 266 205 134 13300 ----
NM_004831chr191147 ------
NM_004834chr232270 2193 2106 11086 11295 --
NM_004840chrX62284 2258 1916 1546 390 375 --11748 --
NM_004845chrX31393 517 245 23485 3114 53491 3248 95 58 25 13976
NM_004850chr221747 1676 ----1597
NM_004857chr1494447 3359 3005 1883 1762 1327 802 469 187 1324 24282 1210 --
NM_004859chr1752571 2235 2187 1123 25 ------
NM_004863chr14125217 4974 4825 4558 4300 4188 1994 803 683 372 135 122 ------
NM_004865chr62274 126 ------
NM_004871chr17113554 1319 1227 1177 1087 1047 1008 852 724 595 31 --43812 2812 2775 170 --
NM_004874chr81404 ------
NM_004898chr42774 168 12020 ----
NM_004904chr775885 5696 5148 4541 1731 1607 290 --15132 --
NM_004906chr6--184 ----
NM_004921chr142316 1822 834 258 12276 11647 --
NM_004930chr13201 169 108 ------
NM_004947chr361994 1002 840 494 343 181 1513 1308 --
NM_004948chr1811361 ------
NM_004949chr1822158 2020 ------
NM_004956chr743886 3117 3088 1800 --13847 --
NM_004964chr12403 186 ------
NM_004965chr211670 ------
NM_004966chr101857 --1926 --
NM_004973chr621428 226 ------
NM_004975chr204307 274 168 71 --1203 --
NM_004976chr1184201 4089 2031 1615 1493 966 813 782 --14995 --
NM_004985chr1223180 2807 --23527 378 --
NM_004987chr21322 ------
NM_004990chr12125 ------
NM_004992chrX98140 7922 7736 7412 7335 6843 3404 1319 1070 --16407 --
NM_004992chrX98140 7922 7736 7412 7335 6843 3404 1319 1070 --16407 --
NM_004999chr623548 1571 --11358 --
NM_005010chr71756 --1581 --
NM_005011chr751192 726 584 526 488 ------
NM_005020chr71480 --1395 --
NM_005027chr1941159 995 804 30 --3432 90 74 --
NM_005028chr1021546 171 1887 ----
NM_005038chr41479 1171 ----
NM_005045chr7--1372 ----
NM_005056chr1224742 4292 --11110 1210
NM_005065chr1451681 1185 1165 617 218 14520 34863 1895 1694 --
NM_005076chr163943 3682 3437 1325 172 27 --23595 1216 22808 731
NM_005077chr91180 ------
NM_005078chr1531629 163 104 1257 ----
NM_005080chr222225 212 ------
NM_005082chr1772848 1340 1199 1115 815 362 340 --13091 --
NM_005096chrX21202 1146 ------
NM_005099chr141201 1069 1056 259 ------
NM_005112chr41825 ------
NM_005114chr42546 150 ------
NM_005116chr2084001 2994 1818 1260 692 351 299 29 --33783 3381 825 --
NM_005121chr1732822 2748 2512 13747 32729 296 270 13567
NM_005124chr61993 ------
NM_005126chr32741 173 ------
NM_005135chr1522871 2799 --31202 1068 244 --
NM_005137chr2282389 2142 1725 1029 425 330 114 104 2912 526 ----
NM_005151chr1841977 1961 1648 417 ------
NM_005154chr15----1664 --
NM_005156chr943556 1892 1822 514 --11795 --
NM_005180chr103515 478 325 ----11586
NM_005182chr165594 585 531 520 25 ------
NM_005187chr1671976 1547 1426 489 310 218 145 ----11990
NM_005189chr1752383 2338 1923 1666 515 ------
NM_005197chr1464056 3868 1041 608 584 571 12015 1218 1788
NM_005201chr31115 ------
NM_005206chr1711352 ------
NM_005215chr181484 ------
NM_005220chr1731427 262 70 ------
NM_005221chr71271 ------
NM_005222chr7--1676 --1985
NM_005229chrX41202 503 289 65 ------
NM_005230chr12----1632 --
NM_005231chr1151108 936 882 511 194 ------
NM_005233chr332458 481 289 ----22340 371
NM_005235chr237116 6973 787 12505 15573 15313
NM_005244chr201619 ------
NM_005245chr41153 ------
NM_005254chr153282 135 82 ------
NM_005259chr21109 --1130 --
NM_005263chr1----131 1854
NM_005271chr102834 228 ------
NM_005274chr1--1114 ----
NM_005276chr1251607 1352 182 152 74 --1422 --
NM_005276chr1251607 1352 182 152 74 --1422 --
NM_005277chr41525 11308 ----
NM_005308chr102437 426 ------
NM_005316chr1111071 ------
NM_005328chr81298 --129 --
NM_005334chrX61608 1349 1218 685 472 115 ------
NM_005338chr7113947 3769 3703 3611 3257 3075 3049 2858 1380 571 295 --42961 1522 106 73 --
NM_005339chr433562 633 399 ------
NM_005342chrX62449 2137 2003 1975 1018 729 12790 ----
NM_005347chr911574 ------
NM_005375chr611087 ------
NM_005376chr11740 ------
NM_005378chr23361 281 25 ------
NM_005382chr81450 --132 --
NM_005388chr91508 --11239 --
NM_005401chr1159 ------
NM_005402chr721845 1215 --11190 --
NM_005406chr181376 11115 11416 --
NM_005426chr13695 601 215 ----1822
NM_005433chr18--1926 11915 --
NM_005442chr32672 571 ------
NM_005455chr121177 49 ----1292
NM_005458chr942268 679 493 364 ------
NM_005460chr52560 367 ------
NM_005461chr2021333 326 11853 11305 --
NM_005471chr531164 288 159 1819 --1885
NM_005474chr17----175 --
NM_005475chr1262792 2651 2139 770 752 359 11114 ----
NM_005502chr962844 2784 2265 1133 744 430 ----13278
NM_005503chr1551130 864 244 97 77 --2201 108 --
NM_005504chr12106495 6230 6020 5485 2541 2494 1526 1004 874 558 --21826 250 --
NM_005509chr5--2684 86 ----
NM_005520chr5129 ------
NM_005525chr12323 125 ------
NM_005529chr16766 709 409 236 111 34 ----1186
NM_005537chr13--1760 ----
NM_005539chr1021069 527 129 1251 --
NM_005542chr751350 597 546 519 318 ------
NM_005546chr562390 1693 262 199 140 22 --2543 182 --
NM_005563chr1--1845 ----
NM_005566chr11--140 1381 --
NM_005569chr222409 130 --11158 --
NM_005575chr51625 ------
NM_005576chr151248 ------
NM_005578chr354738 4047 3658 452 352 --11337 --
NM_005581chr191491 ------
NM_005595chr1--1124 ----
NM_005596chr966459 5471 5114 5099 569 558 36303 6062 1222 16008 --
NM_005604chr622083 671 11982 --1916
NM_005607chr82846 826 ------
NM_005609chr11142 ------
NM_005610chr1----2252 192 --
NM_005613chr12350 141 ------
NM_005625chr83956 335 285 ------
NM_005629chrX21338 304 11012 140 --
NM_005631chr7----11030 --
NM_005637chr1811902 --144 --
NM_005639chr1221415 98 11814 11191 1669
NM_005644chr1166 ------
NM_005647chrX52216 2197 1326 268 138 12626 11113 --
NM_005648chr81178 ------
NM_005665chr143231 2979 865 780 1209 --11463
NM_005667chr2------167
NM_005668chr523655 940 ----11592
NM_005708chr13--195 1408 --
NM_005715chr621861 769 --11738 --
NM_005723chr41234 ------
NM_005725chr141595 1501 402 52 --1687 --
NM_005730chr1252673 2644 2392 365 194 --1698 --
NM_005734chr112318 76 ------
NM_005738chr711499 ------
NM_005739chr1511955 --12049 1597
NM_005746chr712199 12619 --11694
NM_005748chr123912 827 28 ------
NM_005754chr51318 --21156 27 --
NM_005776chr14148 ----1289
NM_005779chr583486 3314 2994 2772 1337 1188 158 148 --1107 --
NM_005795chr211976 1739 ----
NM_005801chr172174 75 1544 ----
NM_005802chr9----1307 --
NM_005808chr393510 2977 2631 2617 1307 1172 845 791 115 --1574 11092
NM_005828chr1774203 4060 3597 3123 1384 644 159 13538 ----
NM_005832chr31546 --1403 --
NM_005834chrX127 ------
NM_005840chrX77650 5117 5029 2667 2245 1382 1252 --15596 --
NM_005859chr521308 1218 --159 --
NM_005862chr31718 ------
NM_005864chr141191 --1619 --
NM_005870chr1321399 1213 11012 1360 11363
NM_005876chr23795 602 56 1820 ----
NM_005880chr1621040 662 1411 ----
NM_005885chr521510 355 ------
NM_005898chr1132486 1199 943 11211 ----
NM_005899chr171148 ----11335
NM_005901chr1868712 7231 6189 5470 3362 1310 ------
NM_005903chr511463 --13311 15188
NM_005907chr611198 ----1413
NM_005909chr553940 3609 3601 2989 151 ------
NM_005911chr241140 425 126 43 --11015 --
NM_005920chr142772 909 773 616 --1554 --
NM_005935chr475202 3884 3540 3380 2113 1293 857 11090 2743 394 --
NM_005937chr1721248 348 12978 13985 --
NM_005938chrX3337 263 128 --1894 --
NM_005941chr833296 2730 644 ----11107
NM_005943chr631587 1440 122 --21279 541 --
NM_005955chr144547 4228 2126 1637 ----11567
NM_005957chr194820 4117 3864 1965 1692 1679 1071 913 32 11745 11238 --
NM_005964chr17188 --1439 --
NM_005966chr21740 --11829 21952 178
NM_005996chr1231074 610 245 ------
NM_006007chr933929 1482 544 --24492 1526 --
NM_006011chr1573638 3166 2717 1225 705 384 222 --22984 48 1984
NM_006016chr622098 540 ------
NM_006022chr132789 87 ------
NM_006029chr14144 ------
NM_006032chr141213 ------
NM_006033chr1821478 535 ------
NM_006036chr222116 1910 --1603 1531
NM_006037chr274666 3536 3368 3257 1962 1005 653 --23542 139 --
NM_006038chr2062040 1948 1590 1450 474 34 ----11482
NM_006041chr171320 --2515 139 --
NM_006047chr2043383 1343 1169 695 33470 784 729 ----
NM_006054chr1131513 1453 509 ------
NM_006055chr232909 2567 2134 ----1953
NM_006066chr1182 ------
NM_006070chr31318 ------
NM_006071chr222593 328 ----125
NM_006080chr73556 360 321 ------
NM_006085chr12937 185 ------
NM_006091chr1531348 1212 1177 1617 21659 1453 --
NM_006095chr454219 3542 2962 1141 49 --13117 14116
NM_006106chr1152463 2239 2125 656 382 12977 22274 580 --
NM_006108chr1142190 1877 240 46 ------
NM_006109chr141241 ------
NM_006129chr82483 180 --1557 --
NM_006133chr1142194 1997 448 271 --22034 1900 --
NM_006135chr13456 332 265 ------
NM_006136chr711064 --1433 --
NM_006139chr252016 1840 1058 117 96 --1532 --
NM_006145chr191717 1993 ----
NM_006153chr31512 1550 ----
NM_006154chr1541874 1177 95 37 12332 ----
NM_006155chr251902 1601 777 734 214 --11328 --
NM_006158chr821192 1140 11834 11165 --
NM_006186chr221195 1142 --168 --
NM_006194chr1421021 447 1174 ----
NM_006195chr9----129 --
NM_006201chrX2111 46 ----1952
NM_006202chr1941251 551 514 415 ------
NM_006203chr585548 5314 5106 4759 3722 715 86 67 175 35307 1633 471 --
NM_006224chr1732267 810 195 ------
NM_006237chr13------1528
NM_006243chr11177 ------
NM_006245chr64710 288 116 27 ------
NM_006246chr14----141 --
NM_006247chr191353 ------
NM_006251chr51775 --154 --
NM_006258chr102526 512 ------
NM_006264chr41182 ------
NM_006265chr8------1600
NM_006267chr211762 11371 1488 --
NM_006277chr21116 ------
NM_006281chr81911 --11118 --
NM_006281chr81911 --11118 --
NM_006306chrX155763 5680 5646 5614 5412 5379 5038 4489 4332 3817 3613 2159 1506 1262 748 12187 25363 4625 25600 5431
NM_006317chr52798 349 ------
NM_006320chr42895 420 ----1274
NM_006323chr41645 ------
NM_006325chr12----1263 --
NM_006330chr81431 --11478 --
NM_006350chr52266 24 --1144 --
NM_006352chr11796 1275 ----
NM_006359chrX11633 --22426 705 --
NM_006366chr6----1920 --
NM_006367chr11131 ------
NM_006371chr374437 4187 3984 1675 1645 1585 494 --14950 --
NM_006379chr722291 326 --11881 --
NM_006380chr1742843 1679 1567 961 24202 932 ----
NM_006409chr71260 ------
NM_006415chr9132 11045 ----
NM_006416chr6--1311 ----
NM_006420chr2032319 1017 339 ------
NM_006421chr82851 819 ------
NM_006434chr1062891 2620 757 482 251 238 11214 12337 --
NM_006439chr41107 ------
NM_006451chr5183 ------
NM_006454chr4103044 2983 2570 2394 2308 1234 1016 917 736 259 --143 --
NM_006457chr432878 951 693 --24080 3643 --
NM_006460chr17--2705 562 ----
NM_006464chr243431 2999 783 570 ----13736
NM_006469chr111047 ------
NM_006471chr181119 ------
NM_006472chr111181 --11192 --
NM_006482chr1293625 3368 3278 2736 2441 1116 957 307 285 ------
NM_006496chr1------182
NM_006517chrX62127 1993 867 441 332 122 --1767 --
NM_006519chr6163 ------
NM_006526chr202653 102 --21615 835 --
NM_006528chr71133 ------
NM_006534chr20--11032 ----
NM_006544chr1455566 5397 4873 2294 2058 15717 1150 --
NM_006546chr17106488 6127 6092 5984 4552 4494 2339 1470 1392 1011 15022 11088 16643
NM_006548chr351677 1307 1174 624 259 ------
NM_006558chr8----1370 --
NM_006559chr131164 842 457 ------
NM_006561chr1054957 4717 4121 2129 1931 --25688 4825 --
NM_006565chr1631129 1043 330 ------
NM_006572chr1723380 797 11390 ----
NM_006577chr221306 903 1397 ----
NM_006587chr421215 316 --21614 34 --
NM_006595chr1111734 ------
NM_006599chr1677979 6044 2948 2527 2367 2076 943 --23293 2638 1699
NM_006601chr1211013 ------
NM_006602chr206752 618 598 570 226 38 1658 ----
NM_006603chrX----1210 --
NM_006609chr221831 284 11192 ----
NM_006614chr322894 2793 --1801 11033
NM_006618chr111021 --183 11501
NM_006621chr121890 221 ------
NM_006624chr1042030 1634 496 22 ------
NM_006625chr1----1314 --
NM_006625chr1----1314 --
NM_006625chr1----1314 --
NM_006626chr91428 ------
NM_006628chr1534403 919 451 14118 14182 --
NM_006644chr13150 ------
NM_006650chr543891 3444 1129 804 ------
NM_006651chr41594 --2377 111 11166
NM_006654chr1264318 4310 3673 3661 3144 1154 --11243 --
NM_006667chrX--1191 ----
NM_006690chr205869 821 672 618 495 --12324 --
NM_006698chr2041400 1031 256 107 ------
NM_006699chr14939 864 817 255 ----12391
NM_006718chr61311 ------
NM_006722chr322958 2267 12354 ----
NM_006729chrX75527 4552 4230 3623 2226 510 356 21649 1140 ----
NM_006734chr631315 1152 1124 ------
NM_006738chr1533776 1091 910 34572 3965 3599 ----
NM_006746chrX21134 1121 --1506 --
NM_006750chr16105903 2494 2465 2424 2089 1533 1255 890 831 720 137 ----
NM_006755chr111161 ------
NM_006761chr171340 --1820 --
NM_006764chr31381 ------
NM_006766chr812720 --22475 2457 1923
NM_006769chr12654 86 ------
NM_006775chr642761 848 771 538 ------
NM_006783chr131235 ------
NM_006788chr1851656 763 625 604 136 --1421 --
NM_006802chr13996 447 337 ------
NM_006805chr531361 426 127 ------
NM_006807chr1741267 1036 887 27 ------
NM_006811chr201862 ------
NM_006815chr123903 870 410 ------
NM_006817chr121349 ------
NM_006818chr11232 --1875 1197
NM_006827chr1463306 2893 2768 1334 736 247 --2774 768 --
NM_006832chr143434 313 208 2899 36 ----
NM_006838chr1231827 323 78 --21444 447 --
NM_006851chr1232600 950 210 ------
NM_006854chr731990 1833 660 1560 ----
NM_006875chrX3908 61 44 ------
NM_006885chr1623253 2922 14159 ----
NM_006886chr20130 ------
NM_006888chr1421380 1335 12668 1209 --
NM_006897chr121652 ------
NM_006898chr22565 246 1203 --1214
NM_006902chr132287 968 42 --21301 868 --
NM_006914chr91143 ------
NM_006918chr1175481 5294 3924 3654 2269 1860 1248 25884 1389 11191 12003
NM_006920chr231441 382 373 --1545 1608
NM_006922chr241968 1805 559 356 ------
NM_006924chr172752 509 ----1619
NM_006931chr1251955 1864 856 313 42 ------
NM_006940chr1231498 1219 267 21515 415 ----
NM_006948chr213936 806 526 --12059 --
NM_006951chr103753 545 32 --2656 89 --
NM_006962chrX3458 228 149 --1472 --
NM_006981chr922851 2542 1959 ----
NM_006990chr172184 2037 1855 972 922 396 380 --1342 --
NM_006999chr531975 771 61 11272 ----
NM_007006chr1642842 1149 740 33 --11208 13163
NM_007007chr1213813 --23946 985 --
NM_007008chr25776 717 594 313 139 ------
NM_007011chr15115549 5264 4608 4509 4298 4267 2357 2258 2166 1671 1639 --16161 1542
NM_007013chr81332 ------
NM_007023chr22949 158 2810 382 ----
NM_007024chr3163 ------
NM_007026chr17----1193 --
NM_007030chr5115008 4522 3336 1999 1924 1504 1212 946 594 545 251 11224 21270 1264 --
NM_007034chr11685 ------
NM_007038chr2144761 4105 3727 683 15493 11143 --
NM_007039chr1422290 1499 ----11709
NM_007043chr12--12125 1786 --
NM_007050chr2077258 7190 5339 5090 4995 1391 1180 1550 25968 236 17299
NM_007051chr13162 112 27 ------
NM_007052chrX185 ------
NM_007054chr553896 3422 2923 2514 1335 ----123
NM_007064chr341205 1127 236 176 --11084 --
NM_007106chr1321138 784 1311 --11828
NM_007112chr1--1234 185 --
NM_007124chr631857 1589 567 --3630 514 499 --
NM_007125chrY11087 ------
NM_007129chr131917 ------
NM_007135chr91159 --1132 --
NM_007137chrX95452 5401 5103 4774 3411 3350 954 805 612 --45263 3921 1086 746 --
NM_007159chr331547 1402 1193 ----11486
NM_007167chr12834 345 1843 1881 --
NM_007174chr1232191 363 104 ------
NM_007177chr382421 2341 2120 1549 890 664 484 24 --12333 --
NM_007195chr1821448 219 ------
NM_007197chr121741 ------
NM_007200chr1533776 1091 910 34572 3965 3599 ----
NM_007203chr933074 2694 369 1643 --42869 1511 1230 498
NM_007207chr1--1853 ----
NM_007216chr111393 ----1984
NM_007235chr121435 ------
NM_007236chr1521758 276 --32081 1989 1822 11773
NM_007238chr2094307 3289 3232 1935 1744 1653 1385 733 355 14895 43044 964 483 259 13105
NM_007246chr41980 ------
NM_007249chr1356063 3544 3078 2306 579 --16101 --
NM_007274chr13209 62 37 ------
NM_007275chr32365 251 1101 ----
NM_007283chr372422 2087 1991 1146 1114 757 556 --23030 2523 12751
NM_007285chr16160 ------
NM_007308chr41680 ------
NM_007345chr18--2867 107 21712 766 --
NM_007347chr1533060 2512 713 ------
NM_007350chr1243458 1600 1275 769 --11407 --
NM_007353chr763019 2457 1006 843 554 197 --1539 --
NM_007358chr111523 ------
NM_007359chr1721323 1201 11100 11438 --
NM_007363chrX1683 ------
NM_007365chr141540 505 386 184 --1789 --
NM_007368chr132536 176 11391 3330 305 52 --
NM_007373chr1021274 150 ------
NM_007375chr132339 607 451 ------
NM_009588chr61395 ------
NM_012081chr553685 3534 3363 2700 2349 --1685 --
NM_012082chr8------1347
NM_012083chr1041160 878 293 163 1462 ----
NM_012089chr121483 1101 11084 ----
NM_012096chr333200 2656 1412 13687 21382 131 --
NM_012098chr961583 1312 1227 1127 142 64 11210 ----
NM_012101chr115782 770 181 75 29 ------
NM_012102chr151954 1738 1688 748 604 1381 12677 --
NM_012104chr1143294 2782 2704 863 166 13217 --
NM_012104chr1143294 2782 2704 863 166 13217 --
NM_012120chr61418 ------
NM_012141chr13121 12918 11658 --
NM_012154chr8----155 --
NM_012155chr19----1175 --
NM_012156chr2052706 2558 2121 1358 788 12778 32475 852 528 --
NM_012157chr32930 723 ------
NM_012193chr11105292 4868 4772 4316 4207 4088 4039 3872 3431 1613 14880 ----
NM_012199chr144391 3506 1344 238 ------
NM_012202chr112367 350 ------
NM_012214chr236417 5020 1426 26376 1606 24237 774 --
NM_012219chr362819 2785 2560 1137 371 212 12205 13023 --
NM_012234chr343696 3139 2409 156 ------
NM_012238chr1021511 364 ------
NM_012248chr16137 ------
NM_012249chr263452 2402 1304 1273 507 62 1804 21120 467 2272 201
NM_012250chr11121 --21085 331 --
NM_012257chr72779 706 ----1931
NM_012259chr6----186 11049
NM_012261chr20------1106
NM_012262chr134926 4371 1259 ------
NM_012264chr2242076 1410 690 35 11339 3594 304 41 --
NM_012264chr2242076 1410 690 35 11339 3594 304 41 --
NM_012266chr94923 881 843 125 ------
NM_012281chr711610 1897 1829 --
NM_012288chr6105273 5062 2119 1946 1835 1523 1201 898 605 237 --15318 --
NM_012290chr221511 1396 ------
NM_012294chr73531 169 45 ----1888
NM_012297chr412239 ------
NM_012300chr522534 865 --12206 --
NM_012301chr731955 1517 92 1761 12115 --
NM_012306chr12123471 3340 3254 2582 2530 2514 2177 1354 1194 1128 861 195 12778 ----
NM_012308chr1132607 1609 102 ------
NM_012309chr112777 751 23196 1469 --13847
NM_012311chr102609 511 ------
NM_012316chr185331 5102 4779 4006 2081 1955 832 99 ----1616
NM_012325chr2021516 278 ------
NM_012330chr1041242 1173 522 287 ------
NM_012338chr71177 1108 2345 324 --
NM_012343chr511042 ------
NM_012382chr554326 4242 3260 3209 2898 --13515 --
NM_012384chr2081911 1797 1578 1524 952 653 81 54 --11948 11964
NM_012398chr1982940 2882 1883 1189 884 802 634 611 ------
NM_012399chr22--11418 1239 --
NM_012405chr1103717 3669 3211 3102 2930 2793 1335 293 115 81 --31493 1153 570 --
NM_012408chr202155 91 --1752 --
NM_012412chr72691 664 ------
NM_012420chr1042191 1787 828 495 ------
NM_012433chr2135 ------
NM_012446chr5----1112 --
NM_012448chr1742428 1823 780 280 ----22518 621
NM_012471chrX21976 356 --21213 147 --
NM_012479chr71629 1852 1613 --
NM_012486chr1181 --1465 --
NM_013230chrY41665 1582 1543 1133 1405 11378 --
NM_013232chr5152 ------
NM_013233chr221369 244 ------
NM_013238chr131603 ------
NM_013254chr122252 86 1619 ----
NM_013255chr797891 6664 6228 6102 3379 2964 2210 799 634 28215 2372 36068 2389 750 15968
NM_013259chr3177 ------
NM_013261chr443578 3496 1058 604 ------
NM_013267chr122360 49 --191 --
NM_013281chr2021334 133 11144 ----
NM_013286chr363631 3073 1279 1233 610 543 33770 3341 39 23599 3381 --
NM_013309chr1532304 2247 612 1190 146 --
NM_013330chr1----125 --
NM_013341chr222377 2309 ------
NM_013354chr811194 11023 31340 266 36 --
NM_013357chr83775 659 649 ------
NM_013361chr191177 --1557 --
NM_013372chr1532455 2429 1101 12163 ----
NM_013381chr122904 246 --11607 --
NM_013382chr1462389 2158 1970 1669 1613 746 --1190 --
NM_013390chr911103 ------
NM_013396chr212351 68 ------
NM_013410chr11489 11252 1928 --
NM_013423chrX3807 512 76 ------
NM_013427chrX3807 512 76 ------
NM_013433chr1951586 463 420 302 201 1441 11917 --
NM_013434chr2111947 1914 1454 680 645 462 417 309 162 123 27 ------
NM_013434chr2111947 1914 1454 680 645 462 417 309 162 123 27 ------
NM_013436chr2--1787 ----
NM_013437chr811107 ------
NM_013446chr7----1907 --
NM_013448chr141179 ------
NM_013951chr23910 498 486 --32448 455 71 --
NM_013952chr24987 575 563 59 --32525 532 148 --
NM_013953chr24987 575 563 59 --32525 532 148 --
NM_013958chr8--1439 ----
NM_013959chr8--1439 ----
NM_013960chr8136 ------
NM_013961chr8--1439 ----
NM_013962chr8--1439 ----
NM_013989chr1485018 4509 4274 3493 3239 773 543 369 --24910 786 --
NM_013992chr24987 575 563 59 --32525 532 148 --
NM_013993chr63719 579 286 ------
NM_013994chr63719 579 286 ------
NM_013995chrX1489 --32400 2012 1685 --
NM_014001chr1781202 1128 1076 1060 1007 588 338 228 11179 1394 --
NM_014011chr2--1512 22416 198 --
NM_014016chr311444 ----11574
NM_014030chr176491 459 122 94 61 48 ------
NM_014048chr1675160 4942 4339 3902 1962 1731 116 21464 1082 44128 3496 3201 894 --
NM_014089chr1352161 1795 1584 674 157 ------
NM_014106chr1521041 851 ------
NM_014109chr811127 ------
NM_014112chr854520 4087 4066 1413 1387 11314 ----
NM_014117chr16142 1139 ----
NM_014141chr754435 4116 3370 3333 1116 --14414 --
NM_014155chr1167453 6980 6545 6229 1233 1120 --15529 --
NM_014159chr31221 1158 ----
NM_014160chr321348 162 ------
NM_014181chr21178 140 ----
NM_014182chr121259 ------
NM_014191chr121966 1809 ----
NM_014217chr1--1292 21846 33 --
NM_014232chr1721467 1293 11062 176 --
NM_014232chr1721467 1293 11062 176 --
NM_014240chr363841 3545 3020 2836 1406 215 --11470 --
NM_014243chr432011 812 654 ------
NM_014248chr22----1136 --
NM_014253chrX4663 578 504 292 ------
NM_014268chr185991 416 227 202 145 ----2906 518
NM_014271chrX1692 ------
NM_014278chr4--1464 1426 --
NM_014280chr11696 ------
NM_014283chr1--11020 1179 --
NM_014286chr9123474 3371 3291 3054 2961 2788 2210 1453 1052 255 190 59 --12572 --
NM_014289chrX----1175 --
NM_014294chr82383 206 --11165 --
NM_014299chr1931740 620 216 --1745 11747
NM_014300chr15135 ------
NM_014309chr2274903 4347 4266 3960 1443 1228 982 --21611 1194 --
NM_014323chr2211009 --1803 --
NM_014325chr1242237 2179 384 148 --1594 --
NM_014326chr1521380 973 ------
NM_014332chrX1322 ------
NM_014333chr111927 1751 12642 12024
NM_014345chr61848 ------
NM_014352chr1131444 1340 374 1436 ----
NM_014372chr1----1444 --
NM_014382chr331587 476 466 ------
NM_014405chr1751498 805 406 329 57 ------
NM_014408chr12518 27 ------
NM_014423chr524404 50 21343 72 ----
NM_014435chr42653 599 ------
NM_014445chr31737 3906 679 531 --1600
NM_014456chr1031768 1599 250 ------
NM_014469chr11------1735
NM_014480chr191597 ------
NM_014491chr71814 --21031 873 --
NM_014517chr351669 700 241 180 42 11538 ----
NM_014552chr221317 89 ------
NM_014570chr221217 --1779 --
NM_014572chr13----11297 --
NM_014573chr1771790 1778 1662 1536 1201 671 278 --11368 --
NM_014574chr1421545 475 1620 ----
NM_014584chr1411543 ------
NM_014585chr21308 ------
NM_014586chr2153193 1457 438 394 367 --24365 4253 --
NM_014603chr172338 198 1429 11306 --
NM_014607chr23416 333 250 ------
NM_014612chr9--1202 ----
NM_014613chr521196 405 ----1195
NM_014614chr21488 1451 --1251
NM_014615chr1643269 2637 1116 421 --13171 11387
NM_014621chr21240 ------
NM_014630chr1541348 1146 858 585 --13757 --
NM_014636chr973677 3574 3086 1488 1276 1124 962 ------
NM_014647chr1621780 111 11399 1363 --
NM_014659chr153344 325 182 ------
NM_014665chr8103391 3069 2996 2413 1338 1068 953 837 621 484 22926 1319 13542 --
NM_014666chr51830 ------
NM_014667chr322322 2046 --11630 22030 332
NM_014670chr21649 --21267 201 --
NM_014671chr71572 ------
NM_014677chr84403 382 263 25 ------
NM_014682chr821810 903 ------
NM_014683chr1711985 ------
NM_014686chr1961817 1607 629 304 280 79 1845 1310 --
NM_014690chr733113 2921 694 ------
NM_014699chr16--1323 ----
NM_014701chr1563000 1278 684 612 538 50 ------
NM_014702chr663252 3029 2715 2171 1395 1182 22870 676 --1539
NM_014705chr721990 1615 --12069 --
NM_014729chr821547 1483 ------
NM_014730chr1263255 3201 2061 1234 1201 334 --155 15097
NM_014730chr1263255 3201 2061 1234 1201 334 --155 15097
NM_014732chr16144897 4626 4506 4293 2258 1983 1945 1436 1424 877 447 372 224 116 --44498 3578 1898 713 14218
NM_014733chr522016 1473 22124 77 ----
NM_014735chrX32014 1597 1548 --1391 --
NM_014736chr152900 369 ------
NM_014737chr2093577 3259 3136 2859 2672 1249 1193 392 126 --34175 597 456 --
NM_014739chr6----24117 3627 --
NM_014741chr1131932 1852 1812 --22137 733 --
NM_014747chr1115236 4802 2315 2195 2013 1334 1265 574 535 366 234 15225 24513 866 --
NM_014751chr812013 --1712 --
NM_014755chr254021 3485 1463 1429 1021 12675 1918 --
NM_014757chr531586 780 602 ----12056
NM_014758chr1141843 649 96 52 --12181 --
NM_014762chr152002 703 457 405 353 --22520 578 --
NM_014767chr1041481 1303 974 277 --1653 --
NM_014772chr1862861 2776 2245 1451 566 539 --2845 465 --
NM_014774chr143262 2900 959 347 --12460 --
NM_014779chr33720 381 95 1809 --11014
NM_014781chr8----1315 --
NM_014787chr122492 311 158 ----
NM_014788chr972919 2673 2514 2270 2194 2115 38 12436 --1900
NM_014790chr51125 ------
NM_014797chr622737 2417 --1326 --
NM_014810chr122520 1336 --13553 --
NM_014812chr12532 318 ----1104
NM_014819chr51120 --11740 --
NM_014824chr111458 131 1699 --
NM_014826chr153506 1753 861 773 101 24320 1441 11113 --
NM_014828chr1462484 1603 869 738 498 172 ------
NM_014829chr532307 2246 1643 ------
NM_014832chr131179 --1134 --
NM_014836chr1031931 1364 430 1414 11540 --
NM_014838chr2222650 476 --32585 2108 1750 --
NM_014839chr122087 620 ------
NM_014844chr1494171 3814 3175 2969 2819 2679 1547 1434 770 12956 23090 1595 --
NM_014848chr1542299 2121 852 202 --21123 772 --
NM_014850chr344449 3666 1626 177 13008 34318 3766 1148 --
NM_014859chr1751283 1205 978 531 438 --1916 --
NM_014871chr122408 130 ------
NM_014873chr144754 3018 3002 1485 --14276 --
NM_014875chr12768 317 ------
NM_014876chr2261909 1885 1740 1699 853 557 21867 231 ----
NM_014877chr17117650 7577 7433 6654 6186 5775 5574 2403 1953 1298 1203 17772 25152 715 11600
NM_014888chr71100 ------
NM_014893chrY32054 1817 411 12282 ----
NM_014897chr1732744 1082 997 --1461 12916
NM_014898chr1952189 2080 1898 1500 667 ------
NM_014902chr2011500 ------
NM_014903chr124648 606 454 440 11918 ----
NM_014904chr101288 ------
NM_014906chr1731346 1083 312 --1524 --
NM_014909chr1483215 3027 2870 2521 1492 1231 1046 573 ------
NM_014917chr1----1149 --
NM_014920chr643495 3254 2651 1080 --21073 1067 --
NM_014921chr1962643 983 751 549 129 105 --1211 --
NM_014923chr1311767 ----1188
NM_014924chr1452326 2147 1272 881 323 --12849 --
NM_014926chr31206 --1819 --
NM_014935chr152801 2764 2377 225 137 --2303 55 --
NM_014939chr1831330 1070 382 ------
NM_014946chr22222 79 ------
NM_014947chr132237 1998 1196 ------
NM_014949chr11651 ------
NM_014964chr1772359 2300 2293 2286 2192 2184 1912 ------
NM_014970chr11267 ----1246
NM_014974chr1031541 473 104 ----1163
NM_014978chr1061622 1531 1441 742 710 519 ------
NM_014982chr1423829 1434 --21575 1553 --
NM_014988chr422203 1740 ------
NM_014989chr631587 1372 229 11320 1639 --
NM_014990chr142392 209 1259 1125 --
NM_014991chr422749 334 ------
NM_014994chr15102229 2113 2050 1748 1548 830 574 547 335 141 11518 21854 928 --
NM_014996chr3------1343
NM_014997chr712185 183 ----
NM_014999chr1231094 516 72 --184 --
NM_015000chr1232748 2196 455 13136 11225 --
NM_015001chr11869 ------
NM_015011chr131447 ------
NM_015020chr1673450 2987 2644 501 469 391 206 --43664 3619 3338 771 --
NM_015023chr141660 656 578 517 1160 ----
NM_015025chr252731 2405 2121 720 442 ------
NM_015026chr1224712 3921 24804 3332 ----
NM_015027chr1631793 538 81 1619 ----
NM_015032chr131163 --32429 1147 176 --
NM_015035chr20135915 5606 5434 5006 4481 4336 2466 2369 2168 517 465 86 53 15994 1933 25623 1502
NM_015039chr162991 2893 2754 1719 1480 642 --23380 3038 11601
NM_015042chr1583805 3071 2667 1272 1218 1094 1068 328 --2446 248 --
NM_015051chr932976 2659 2077 --23185 2254 --
NM_015052chr721020 427 --2962 318 --
NM_015059chr1543826 3206 1103 184 23727 921 ----
NM_015062chr101265 ------
NM_015064chr1263568 3405 2681 2537 682 25 ------
NM_015071chr565224 4832 4731 4464 2568 496 --36027 5028 4406 --
NM_015073chr1941707 833 760 382 ------
NM_015075chrX92163 1921 1878 1468 755 716 661 440 233 --1239 --
NM_015076chr644428 4384 3994 3020 1659 --13936
NM_015077chr17124615 4573 4523 4461 4175 4026 2955 1626 1427 994 834 616 ----13975
NM_015079chr1553096 2883 681 631 327 --22981 1041 --
NM_015082chr542444 2278 806 217 1710 ----
NM_015090chr1176100 5787 5474 4348 3968 3776 2323 1817 1496 1472 997 588 279 160 152 89 24 ----24798 1831
NM_015092chr1643409 1682 704 272 --182 --
NM_015093chr62458 84 --11271 --
NM_015094chr2294535 4515 4120 3118 2966 1613 1329 350 256 --24590 3556 --
NM_015097chr342276 2252 1779 1682 12268 11803 --
NM_015107chrX4757 746 731 369 --11602 --
NM_015113chr1762111 2084 1876 565 504 40 --2661 145 --
NM_015115chr431176 1134 29 1614 --162
NM_015125chr192428 95 ----1578
NM_015130chr4------1427
NM_015143chr42317 307 1298 ----
NM_015144chr1673801 3457 2630 2467 1175 246 35 --1344 --
NM_015149chr141593 716 597 579 --11386 --
NM_015150chr31330 1380 ----
NM_015155chr1042710 2262 620 83 --12055 --
NM_015156chr1454042 3931 3625 424 80 ------
NM_015157chr111223 --1371 --
NM_015158chr93840 784 635 --1267 --
NM_015163chr1441784 668 601 257 --156 --
NM_015170chr84884 868 663 163 --2744 51 --
NM_015171chr16195 ------
NM_015172chr11397 --11537 --
NM_015184chr31520 ----1460
NM_015191chr1152310 2094 726 598 123 22050 446 ----
NM_015192chr2052648 1219 720 665 36 ------
NM_015194chr1771882 1339 540 523 510 416 34 --11919 --
NM_015215chr122217 326 ------
NM_015216chr511530 --2538 296 --
NM_015225chr942887 2481 2147 1196 1743 32831 1214 1166 1487
NM_015250chr931321 40 26 --22053 1396 --
NM_015264chr2244195 4148 2974 130 --23604 115 --
NM_015265chr2----11005 1393
NM_015267chr1231868 1402 498 1420 ----
NM_015270chr1222212 585 --12043 --
NM_015271chr432975 2701 1248 23612 430 14206 23693 948
NM_015272chr1632131 2119 2075 ------
NM_015275chr121101 --1712 --
NM_015278chr633081 1199 36 --22828 769 --
NM_015282chr262820 2601 2196 1133 896 328 --1243 --
NM_015284chr151829 1598 497 379 204 ------
NM_015286chr1532279 557 300 22499 1550 ----
NM_015288chr583462 3319 3066 3012 2610 2569 1108 447 2953 510 --164
NM_015291chr152985 2628 2322 597 244 ----1856
NM_015294chr17133 ------
NM_015299chr1463766 3028 1237 1032 134 44 32808 2792 483 ----
NM_015310chr8137828 7300 6019 5920 5488 5396 5280 2569 2294 2212 1804 1636 1205 17003 1460 --
NM_015313chr1134818 3253 1277 --11093 --
NM_015315chr513179 ------
NM_015316chr1451127 1014 971 47 37 ------
NM_015317chr262215 2163 2136 934 777 295 ----1328
NM_015320chr22997 228 ----1835
NM_015326chr122849 595 --12803 --
NM_015328chr732742 2111 894 --2558 216 --
NM_015335chr1232232 915 70 ----1952
NM_015336chr1211986 --11727 --
NM_015339chr202826 380 --1671 --
NM_015344chr831984 1703 660 --11678 --
NM_015346chr1411166 11682 --11895
NM_015347chr1242556 2386 350 67 --12612 --
NM_015349chr63849 556 423 ------
NM_015358chr21--41278 943 394 149 ----
NM_015365chrX84011 3448 1619 1316 1131 813 682 23 ------
NM_015374chr222380 30 11454 ----
NM_015382chr141595 ------
NM_015385chr1062891 2620 757 482 251 238 11214 12337 --
NM_015387chr22586 359 --11547 --
NM_015393chr433298 2880 686 1160 13221 --
NM_015396chr34906 302 233 96 ------
NM_015442chr32237 219 ------
NM_015443chr172363 198 1524 ----
NM_015455chr523562 79 12677 12500 --
NM_015460chr33575 120 72 --21377 645 --
NM_015470chr21388 --11227 --
NM_015472chr3130 ------
NM_015472chr3130 ------
NM_015481chr124975 890 349 296 ------
NM_015503chr163522 287 208 --1100 --
NM_015509chr12----21443 1064 --
NM_015520chr32587 253 --1712 1756
NM_015526chr1931313 421 72 ------
NM_015542chr101814 ------
NM_015548chr6----2316 196 --
NM_015550chr732629 2550 431 --12816 --
NM_015557chr162671 2547 2510 876 617 64 --21191 51 --
NM_015564chr523299 2495 12277 11294 --
NM_015567chr132427 297 ------
NM_015568chr2074207 4018 2797 2632 1411 570 332 --34250 685 578 --
NM_015569chr134811 3949 2977 23371 3213 1386 13019
NM_015571chr612527 22285 790 ----
NM_015576chr322132 677 11928 ----
NM_015578chr19----21539 396 --
NM_015630chr21904 1978 ----
NM_015640chr153685 3670 1372 1010 172 ------
NM_015642chr31287 ------
NM_015646chr122247 146 11018 11126 --
NM_015651chr921820 744 --158 --
NM_015678chr13--1298 11089 --
NM_015726chr111341 ------
NM_015840chr152058 626 589 355 277 --22341 1067 1125
NM_015841chr152058 626 589 355 277 --22341 1067 1125
NM_015852chr723180 1430 1809 ----
NM_015859chr141133 ------
NM_015866chr11444 ------
NM_015878chr831896 1723 1462 12009 ----
NM_015879chr1868402 7871 7287 3319 1275 865 --57498 7077 2733 1365 194 17209
NM_015886chr864396 2202 2126 1685 1469 905 15458 13611 --
NM_015891chr621433 1259 --11698 --
NM_015895chr61209 ------
NM_015898chr1952363 1965 1755 658 162 --11959 --
NM_015902chr81209 ------
NM_015904chr21588 ------
NM_015906chr113931 --14819 --
NM_015955chr21528 ------
NM_015967chr1--1812 ----
NM_015981chr562687 2667 2302 2112 194 36 ----13208
NM_015982chr171369 ------
NM_015995chr15115366 5227 4896 4545 4116 3770 1806 1699 1303 793 25 --34655 3418 3366 --
NM_016009chr154884 3574 3523 1661 120 ------
NM_016019chr721003 765 ------
NM_016021chr622093 1057 1676 ----
NM_016023chr821513 128 ----11687
NM_016025chr164419 327 253 235 ------
NM_016032chrX41215 507 209 129 --2416 273 --
NM_016038chr71585 1551 ----
NM_016040chr112760 --1242 --
NM_016061chr21511 11669 ----
NM_016076chr132873 446 324 --12945 --
NM_016079chr222055 542 ------
NM_016081chr42274 245 11411 154 --
NM_016083chr621450 276 ------
NM_016090chr111111 1238 1139 --
NM_016096chr81118 ------
NM_016107chr511280 ------
NM_016120chrX1903 --31094 465 193 --
NM_016124chr151387 1272 1019 607 223 ------
NM_016131chr22751 127 ----12340
NM_016132chr1531259 684 253 --1869 --
NM_016133chr21310 ------
NM_016147chr114726 306 102 64 --1766 --
NM_016152chr32885 215 ------
NM_016206chr358715 7765 7668 7127 2651 26741 1310 ----
NM_016224chr641566 682 533 151 --12122 --
NM_016226chr12------180
NM_016227chr1--11020 1179 --
NM_016240chr851399 591 168 28 21 ------
NM_016252chr21917 --1833 --
NM_016255chr643178 2846 2253 106 1523 ----
NM_016257chr163159 1248 1209 1065 378 45 12914 2814 743 --
NM_016260chr257525 7256 2979 1515 642 12533 25229 1580 --
NM_016271chr18170 --11613 --
NM_016272chr2262266 1848 871 607 586 506 ------
NM_016279chr52434 340 ------
NM_016281chr121251 ------
NM_016287chr131404 609 500 ------
NM_016290chr5----166 --
NM_016308chr141957 1507 1360 170 ------
NM_016315chr2--1532 21586 365 --
NM_016316chr2--2737 43 ----
NM_016320chr1141108 1006 929 323 --128 --
NM_016322chr912543 ------
NM_016339chr1711214 ------
NM_016340chr5--1104 1369 --
NM_016351chr71126 ------
NM_016373chr16------1133
NM_016374chr131614 460 49 ------
NM_016374chr131614 460 49 ------
NM_016376chr17104388 3368 3038 2863 1164 1144 993 747 553 26 ------
NM_016396chr1531207 1124 396 --1315 --
NM_016399chr12185 ------
NM_016410chr9--182 ----
NM_016418chr22103112 2363 1310 1271 1237 1063 833 798 140 76 --33395 2560 1050 --
NM_016422chr1131112 630 396 ------
NM_016423chr14----1192 --
NM_016436chr2022316 2029 1202 11722 --
NM_016441chr222154 543 1495 --2585 562
NM_016480chr51825 ------
NM_016484chrX2570 69 ------
NM_016488chr1211914 11518 ----
NM_016507chr1712932 ------
NM_016513chr643495 3254 2651 1080 --21073 1067 --
NM_016516chr21760 ------
NM_016522chr1121309 1067 ----1568
NM_016530chr1513712 1572 ----
NM_016531chr423297 512 13325 1867 11649
NM_016538chr171132 ------
NM_016544chr2123350 3217 3016 2740 2720 1243 1098 1074 844 726 614 209 --121 1664
NM_016547chr12663 457 ------
NM_016569chr1231074 610 245 ------
NM_016570chr121483 ------
NM_016577chr344465 3660 1673 1274 13800 ----
NM_016603chr52843 612 ------
NM_016604chr53891 230 138 ------
NM_016614chr61107 ------
NM_016620chr11270 --170 --
NM_016621chr1163753 3214 3186 3112 1716 794 --125 1326
NM_016628chr102258 248 ------
NM_016641chr1661616 1539 1317 530 445 380 ------
NM_016654chr153282 135 82 ------
NM_016733chr222409 130 --11158 --
NM_016823chr1711222 ------
NM_016824chr1011386 ------
NM_016829chr35533 316 273 241 62 ------
NM_016936chr1632015 1986 439 --1498 --
NM_016940chr213613 583 475 1499 ----
NM_016952chr1173871 3250 2657 2645 1037 711 253 ----12695
NM_017412chr821030 954 ------
NM_017415chr554483 4120 3251 1744 557 --1429 --
NM_017420chr1423263 2740 --23148 2576 13297
NM_017423chr41468 11998 ----
NM_017426chr41170 ------
NM_017491chr41825 ------
NM_017519chr62947 47 ------
NM_017522chr11986 ------
NM_017541chr32181 159 --1172 --
NM_017544chrX164 ------
NM_017548chr331396 476 63 ------
NM_017559chr172215 70 ------
NM_017570chr8152 ------
NM_017577chr3----11287 11509
NM_017580chr1022081 1871 ----12187
NM_017590chr2262076 2037 2002 1970 1664 514 ------
NM_017594chr932812 1007 173 1991 23382 189 --
NM_017595chr1751230 1195 309 139 128 ------
NM_017610chr1511483 --1599 --
NM_017623chr262416 2210 2021 357 213 107 ------
NM_017626chr1041713 1590 391 381 ------
NM_017628chr433794 1951 1224 ----24274 4164
NM_017629chr12715 181 --21605 87 --
NM_017633chr643824 2912 349 33 12579 --11324
NM_017635chr111319 ------
NM_017637chr9109483 9117 8021 5992 1734 1066 1034 887 140 63 --37155 3480 2900 --
NM_017640chr6148 --1334 --
NM_017643chr17----22782 449 12389
NM_017644chr354242 3934 1531 948 95 --21661 29 --
NM_017650chr785857 5638 5225 1952 1825 1442 777 204 1974 ----
NM_017658chr1433905 2839 1663 11636 12946 --
NM_017661chr152953 117 ------
NM_017666chrX32037 1837 1591 ------
NM_017686chr131129 916 59 ------
NM_017694chr212058 --1164 --
NM_017709chr153127 997 364 227 212 --13186 --
NM_017715chr72749 233 1501 ----
NM_017719chr312134 --21691 1626 --
NM_017728chr1782778 2677 2149 1867 1067 1052 824 703 --12572 13096
NM_017734chr11132 ------
NM_017737chr121952 1647 --11899 --
NM_017738chr92800 184 2410 235 ----
NM_017740chr1641608 1514 737 217 --1156 --
NM_017744chr172171 1789 950 717 520 492 294 ------
NM_017754chr664694 4033 3549 1979 409 96 13206 --13470
NM_017762chr1542163 1975 800 263 --1322 --
NM_017770chr622958 2658 ----22376 1101
NM_017778chr811488 11341 ----
NM_017780chr8------1772
NM_017787chr1072717 2590 2573 2298 667 548 104 --22221 929 --
NM_017813chr865308 5275 4959 4899 3558 304 --1479 --
NM_017824chr1012654 ------
NM_017848chrX23118 2842 --23378 1207 --
NM_017849chr252808 1247 1143 495 225 11092 ----
NM_017851chr1541245 1091 1038 1001 --1175 11157
NM_017866chr81837 ------
NM_017893chr1041366 457 80 60 ------
NM_017902chr1064790 3690 1940 1408 1183 1096 11342 35553 1947 685 --
NM_017911chr2251345 969 482 245 114 --1132 11532
NM_017913chr91351 ------
NM_017925chr931556 628 583 --1775 --
NM_017938chrX31458 783 462 ------
NM_017944chr1152858 2803 2405 334 165 ------
NM_017946chr711358 ------
NM_017964chr23733 329 307 ------
NM_017982chr131075 378 71 ------
NM_017987chr10----1599 --
NM_017993chr133354 283 113 ------
NM_017994chr732018 452 335 --2691 620 --
NM_018008chr32343 329 ------
NM_018009chr122153 61 ------
NM_018013chr663001 2089 655 633 445 128 11869 --1316
NM_018027chr101905 ----12218
NM_018030chr181290 ------
NM_018043chr111193 --1582 --
NM_018070chr11576 ------
NM_018078chr41301 ------
NM_018084chr242674 2385 2321 431 --23209 2849 --
NM_018085chr167792 6268 5984 1760 1608 369 --15750 144
NM_018086chr231754 1727 61 ------
NM_018098chr311178 11067 ----
NM_018107chr145853 340 208 140 99 ------
NM_018113chr122491 133 ------
NM_018120chr81189 ------
NM_018121chr1032901 2311 1027 ------
NM_018126chr4------123
NM_018128chr1731304 478 221 ------
NM_018133chr322171 402 --21597 45 --
NM_018155chr331303 509 321 11326 ----
NM_018157chr1242987 2841 2446 339 ----1666
NM_018159chrX--11631 ----
NM_018171chr12145 ------
NM_018172chr117631 579 527 475 423 371 56 ------
NM_018176chr421524 1227 21609 629 ----
NM_018177chr411045 --1256 --
NM_018200chr1552190 1046 985 240 64 22227 2023 ----
NM_018206chr161611 ------
NM_018211chr11537 --21881 87 --
NM_018227chr423107 2581 ----13091
NM_018234chr262204 1449 1392 762 703 496 ------
NM_018241chr41712 ------
NM_018243chr443086 2740 2488 393 ------
NM_018257chr20----12241 12574
NM_018268chr52629 550 ------
NM_018293chr312918 --22572 1061 --
NM_018299chr842862 1191 904 495 --11227 --
NM_018307chr171754 ------
NM_018312chr1132131 1803 655 --1691 --
NM_018313chr352457 2192 1947 528 57 ------
NM_018315chr411307 ----11368
NM_018328chr21117 --182 --
NM_018339chr931719 1267 291 --1679 --
NM_018354chr20--144 ----
NM_018361chr852960 2900 1344 1156 36 1785 21279 754 23576 3256
NM_018362chr1133452 2807 2611 ------
NM_018364chr133442 882 360 13374 13204 --
NM_018374chr744851 1944 1646 317 --1482 --
NM_018375chr1431723 472 70 11197 ----
NM_018387chr91410 ------
NM_018388chrX1979 ------
NM_018403chr363356 3056 2916 2793 897 357 ------
NM_018412chr71105 ------
NM_018416chr123475 346 142 --1356 --
NM_018424chr931898 1750 703 ------
NM_018429chr522214 572 ------
NM_018439chr1832496 2208 1796 ------
NM_018440chr8137354 6604 6486 5760 5723 5681 5526 3386 3325 2866 2238 920 108 ------
NM_018444chr841803 816 649 230 ----1518
NM_018445chr151198 ------
NM_018448chr12----1807 --
NM_018469chr17196 --1573 --
NM_018471chr21177 ----1541
NM_018482chr842256 1650 228 120 --11838 1501
NM_018486chrX1365 ------
NM_018489chr12887 460 ------
NM_018490chr1121472 1313 ------
NM_018553chr1721426 118 ------
NM_018557chr211530 ------
NM_018566chr154363 3584 1628 1307 853 --14649 --
NM_018569chr411536 ------
NM_018638chr1252085 2074 2050 1406 871 15237 ----
NM_018667chr1672513 2015 1121 698 521 427 420 11144 2438 121 22499 820
NM_018682chr71693 ------
NM_018685chr71942 ------
NM_018695chr52729 609 1249 1778 --
NM_018704chr13694 407 245 11440 11544 --
NM_018710chr8157 ------
NM_018717chr432777 836 817 1672 11149 --
NM_018718chr761837 1827 1597 740 502 171 --1376 --
NM_018834chr51259 1845 ----
NM_018841chr133673 2900 2429 1709 22466 1090 --
NM_018846chr7147 1194 ----
NM_018898chr552142 1692 594 403 24 1271 ----
NM_018899chr552142 1692 594 403 24 1271 ----
NM_018900chr552142 1692 594 403 24 1271 ----
NM_018901chr552142 1692 594 403 24 1271 ----
NM_018902chr552142 1692 594 403 24 1271 ----
NM_018903chr552142 1692 594 403 24 1271 ----
NM_018904chr552142 1692 594 403 24 1271 ----
NM_018905chr552142 1692 594 403 24 1271 ----
NM_018906chr552142 1692 594 403 24 1271 ----
NM_018907chr552142 1692 594 403 24 1271 ----
NM_018908chr552142 1692 594 403 24 1271 ----
NM_018909chr552142 1692 594 403 24 1271 ----
NM_018910chr552142 1692 594 403 24 1271 ----
NM_018911chr552142 1692 594 403 24 1271 ----
NM_018912chr541694 1346 1311 287 --125 --
NM_018913chr541694 1346 1311 287 --125 --
NM_018914chr541694 1346 1311 287 --125 --
NM_018915chr541694 1346 1311 287 --125 --
NM_018916chr541694 1346 1311 287 --125 --
NM_018917chr541694 1346 1311 287 --125 --
NM_018918chr541694 1346 1311 287 --125 --
NM_018919chr541694 1346 1311 287 --125 --
NM_018920chr541694 1346 1311 287 --125 --
NM_018921chr541694 1346 1311 287 --125 --
NM_018922chr541694 1346 1311 287 --125 --
NM_018923chr541694 1346 1311 287 --125 --
NM_018924chr541694 1346 1311 287 --125 --
NM_018925chr541694 1346 1311 287 --125 --
NM_018926chr541694 1346 1311 287 --125 --
NM_018927chr541694 1346 1311 287 --125 --
NM_018928chr541694 1346 1311 287 --125 --
NM_018929chr541694 1346 1311 287 --125 --
NM_018945chr673682 2941 2577 1382 1214 181 92 11074 ----
NM_018948chr111085 ------
NM_018963chr21------1130
NM_018970chr733175 2360 1984 1780 172 --
NM_018976chr1212858 --1296 --
NM_018999chr1051607 736 617 431 356 ------
NM_019000chr511370 ------
NM_019001chr344830 4055 3267 2998 1963 ----
NM_019005chr7189 ------
NM_019006chr15--1538 ----
NM_019036chr6------149
NM_019042chr71319 ------
NM_019045chrX1628 --1718 --
NM_019046chr104984 696 202 134 1372 1318 --
NM_019049chr11624 ------
NM_019050chr441423 803 591 363 ------
NM_019063chr222261 2020 ------
NM_019072chr573643 3554 3415 2847 1148 742 235 ----12614
NM_019094chr1293778 3479 3463 1516 1049 623 544 237 201 ------
NM_019106chr2262821 2584 2525 2189 712 653 1647 1375 --
NM_019116chr1653195 3131 2529 2402 2368 --2973 505 --
NM_019555chr321707 1694 ------
NM_019556chrX1929 ----1405
NM_019558chr21109 ------
NM_019593chr2032792 2139 2059 ------
NM_019594chr941642 1399 1160 534 ------
NM_019595chr21116 ------
NM_019606chr71211 ------
NM_019613chr1741069 291 239 88 --2988 130 --
NM_019842chr6--1404 142 --
NM_019852chr14136 ------
NM_019859chr1011441 ------
NM_019885chr252497 729 536 303 214 11089 11968 --
NM_019903chr1011386 ------
NM_020039chr122637 354 ------
NM_020062chr206844 820 804 748 281 28 ------
NM_020116chr41484 ----1235
NM_020122chr285862 5654 5356 5010 4458 3658 1557 710 --11806 --
NM_020148chr183869 275 132 --32519 2236 909 1957
NM_020155chr11185 ------
NM_020159chr411068 ----1204
NM_020177chr513337 23360 1130 1990 --
NM_020178chr17--143 ----
NM_020184chr232173 418 225 22286 623 22087 1658 --
NM_020189chr8--156 ----
NM_020193chr11--11089 ----
NM_020199chr5177 1146 ----
NM_020225chr42383 343 ------
NM_020228chr1132143 400 207 ----12605
NM_020239chr122236 181 ------
NM_020240chr52991 953 --1562 --
NM_020248chr122195 148 ----11974
NM_020310chr1792565 2462 2167 1831 827 682 616 475 174 --11061 --
NM_020336chr2033360 1219 520 11544 1476 21384 241
NM_020337chr42839 55 1344 2851 433 --
NM_020338chr1042874 2712 951 911 --32940 1496 111 12677
NM_020341chr2021428 499 --31383 756 308 --
NM_020342chr2--1997 1444 --
NM_020346chr111350 ----1508
NM_020348chr1072615 2601 2283 895 688 556 355 1204 ----
NM_020373chr124497 450 431 191 1557 ----
NM_020390chr364446 4110 3477 1204 1080 528 ------
NM_020403chr1321502 184 ----11170
NM_020416chr422107 1771 1247 22393 96 --
NM_020420chrY11441 ------
NM_020429chr752805 2464 575 272 38 ------
NM_020432chr732292 1488 322 ------
NM_020438chr931251 1061 110 ------
NM_020440chr152986 2568 981 865 774 --12196 --
NM_020445chr72604 167 ------
NM_020455chr622803 2011 --2368 119 --
NM_020463chr22953 935 --1279 11246
NM_020465chr1671989 1409 1238 570 528 378 277 12020 --1503
NM_020466chr654729 3262 805 723 466 1892 14111 13394
NM_020473chrX22014 229 ------
NM_020474chr182133 69 ------
NM_020532chr25776 717 594 313 139 ------
NM_020640chr332291 886 841 ------
NM_020651chr241708 1522 479 80 ------
NM_020654chr31415 ------
NM_020673chr2097673 6557 6502 6366 6081 5629 5622 5320 1854 --12339 --
NM_020682chr104894 781 451 277 1796 ----
NM_020686chr1642743 2492 892 404 13053 1828 --
NM_020689chr204688 675 91 62 11557 174 --
NM_020690chr51308 ------
NM_020699chr134475 3594 1653 14365 24836 4235 --
NM_020708chr2042375 2072 594 147 ------
NM_020713chr20102397 1255 966 571 502 451 289 185 140 35 --11137 --
NM_020715chr1421723 601 --11792 --
NM_020718chr1696272 5423 4718 2571 2034 802 668 364 107 14624 1216 --
NM_020727chr2111256 1862 ----
NM_020728chr773063 2778 2342 2330 1138 1102 1080 ------
NM_020732chr62947 47 ------
NM_020739chr1534251 2833 83 --23170 456 --
NM_020742chrX22008 429 ------
NM_020748chr1711463 12105 21571 669 --
NM_020752chr10------1717
NM_020755chr61443 ------
NM_020760chr231687 1292 148 ------
NM_020762chr1231025 375 68 2986 23 ----
NM_020766chrX14528 ----12810
NM_020771chr621396 493 ----1476
NM_020772chr1758438 5787 5228 3414 46 ------
NM_020773chr452599 2206 1798 541 234 --1620 --
NM_020783chr1831675 935 97 2754 334 ----
NM_020784chr142437 363 --31111 342 129 --
NM_020791chr1751216 1200 1109 1074 456 ------
NM_020805chr181425 --11897 11741
NM_020808chr11725 ----160
NM_020813chr1942069 2038 786 350 --12250 --
NM_020818chr141173 ------
NM_020819chr611251 1471 ----
NM_020825chr1683495 3287 2870 2350 1287 1250 530 133 --13597 --
NM_020830chr24826 776 637 103 1581 1768 1355
NM_020841chr1233947 3061 2709 --33734 3582 3225 --
NM_020844chr856417 2878 2458 2287 829 15641 12824 --
NM_020845chr1271910 1903 1768 707 513 364 137 --11964 --
NM_020850chr1662914 2386 1249 805 676 327 12058 22104 630 --
NM_020854chr1831414 1403 480 ------
NM_020858chr153965 168 159 ------
NM_020865chr3142 ------
NM_020872chr311600 ------
NM_020920chr141276 ------
NM_020922chrX1735 --21583 1191 --
NM_020935chr264472 4444 3350 2908 1284 353 --13672 --
NM_020940chr1032455 2296 672 --12410 180
NM_020948chr112338 23129 2987 ----
NM_020951chr1932072 1911 1609 ------
NM_020952chr93304 161 21 1660 1292 --
NM_020962chr151683 --1225 --
NM_020972chr471102 857 775 763 412 363 61 ------
NM_020977chr45887 855 833 759 428 ------
NM_020983chr1222212 585 --12043 --
NM_020987chr101276 ------
NM_020988chr1651038 543 533 469 462 --11149 --
NM_020993chr1232576 2388 2267 12044 11956 --
NM_021007chr231632 385 376 ------
NM_021013chr17138 ------
NM_021033chr1342956 2556 891 702 ------
NM_021035chr202879 271 ------
NM_021064chr641437 1316 1291 68 ------
NM_021069chr43755 155 40 ------
NM_021079chr1752766 1286 1082 1046 32 ------
NM_021103chr2166 ----190
NM_021111chr93471 250 125 --1910 --
NM_021116chr7238510 8352 8278 7642 7136 6574 5783 3487 3338 3188 3152 2929 2868 2728 2468 1992 1688 1271 1204 964 376 111 65 1541 46960 6412 3113 2485 23372 1158
NM_021120chrX52919 2715 2504 1251 291 --12741 --
NM_021136chr141182 ------
NM_021145chr71284 --2129 115 --
NM_021149chr162113 78 ------
NM_021155chr1942582 2312 1838 855 --127 --
NM_021159chr431602 1456 1414 1596 21071 247 --
NM_021161chr14--1142 ----
NM_021163chr7--12607 1365 --
NM_021183chrX2141 26 ------
NM_021184chr61698 ------
NM_021190chr11224 ------
NM_021194chr11112 ------
NM_021218chr94914 882 70 53 ------
NM_021238chr1221818 1654 11738 --169
NM_021255chr1454090 3964 3446 3093 2884 --13037 --
NM_021622chr1032224 1470 696 1376 11826 --
NM_021629chr343350 1883 579 54 ------
NM_021633chr131223 1014 886 ------
NM_021643chr231207 527 275 ------
NM_021647chr453860 1635 1345 865 570 1393 1600 --
NM_021722chr7185 ------
NM_021723chr71126 ------
NM_021728chr141273 ------
NM_021809chr2042321 1915 1619 784 --1808 --
NM_021813chr655357 5233 4479 1875 1382 1335 11783 --
NM_021814chr6----11086 --
NM_021815chr243008 1209 697 437 12566 1908 --
NM_021911chr535045 4869 3705 --34271 4261 1450 --
NM_021912chr15103748 3377 3315 3131 3040 1658 1572 1350 626 507 ------
NM_021913chr1921841 696 ------
NM_021935chr31387 --136 --
NM_021943chr681919 1782 1418 518 495 480 212 137 --11770 --
NM_021949chrX82290 2039 1796 840 488 234 190 63 --1351 1864
NM_021951chr93867 804 301 ------
NM_021956chr611397 ----11092
NM_021959chr62994 936 ------
NM_021960chr132192 1968 195 ----12133
NM_021961chr1156818 6332 6322 2051 1411 15043 ----
NM_021962chr1742284 2229 1984 990 ------
NM_021964chr336667 700 536 11547 ----
NM_021967chr531008 340 79 ------
NM_021998chrX1442 ------
NM_022037chr2141 ------
NM_022039chr10143 1588 ----
NM_022048chr15106375 5308 5128 4433 4334 4191 1489 1254 1207 865 15887 --14714
NM_022051chr12687 229 ------
NM_022058chr2--1141 ----
NM_022060chr1421127 41 --1313 21105 195
NM_022062chr1131695 1439 1372 --1657 --
NM_022085chr631251 456 75 ------
NM_022114chr1113795 3405 1829 1296 1141 1045 997 855 727 334 101 11260 11150 150
NM_022130chr51216 ----1397
NM_022133chr821739 676 ------
NM_022154chr421170 992 ------
NM_022166chr16144509 4395 2420 2383 2322 2307 2225 1973 1402 1167 920 829 126 24 11276 --1775
NM_022173chr2141 ------
NM_022334chr27784 728 448 392 336 280 263 ------
NM_022351chr833419 1130 233 ------
NM_022361chr6--2548 432 ----
NM_022373chr7------2799 24
NM_022437chr21439 --2158 120 --
NM_022458chr712416 --22373 652 --
NM_022459chr1356197 5515 2315 883 798 24519 1667 11093 21705 201
NM_022473chr1583924 3915 3353 3221 1611 1145 939 70 ------
NM_022475chr42558 86 ------
NM_022477chr2041391 480 202 113 --11514 --
NM_022482chr2052262 2241 1687 474 211 12054 ----
NM_022483chr541964 1890 1643 683 ------
NM_022484chr711263 ------
NM_022485chr32301 67 ------
NM_022491chr1253154 833 444 219 107 --22850 2711 --
NM_022494chr101171 ------
NM_022497chr393836 3241 2619 1507 1221 667 645 569 311 ----13228
NM_022566chr152523 413 ------
NM_022659chr81185 ------
NM_022719chr2263323 2464 1373 1058 967 128 13143 12686 --
NM_022731chr11273 ------
NM_022735chr11239 --2268 94 --
NM_022739chr171219 --21053 409 --
NM_022755chr952347 2271 1839 957 390 12560 1483 --
NM_022758chr6103079 2616 2235 1978 1163 1035 546 524 329 241 ------
NM_022763chr333111 371 35 12898 ----
NM_022776chr331381 1291 489 ------
NM_022780chr211177 ------
NM_022781chr922599 2549 --22061 349 --
NM_022832chr42966 639 ------
NM_022841chr152651 495 ----11101
NM_022842chr31284 --11261 --
NM_022844chr161734 --1887 --
NM_022845chr1632226 2198 571 --1901 --
NM_022893chr252953 2588 2529 2384 956 --12493 --
NM_022894chr24485 316 198 59 ------
NM_022898chr1444078 3738 3013 941 44755 4239 1786 1103 11725 --
NM_022910chr1671989 1409 1238 570 528 378 277 12020 --1503
NM_022970chr10--1224 152 --
NM_022978chr531008 340 79 ------
NM_023000chr1421182 215 ------
NM_023001chr1421182 215 ------
NM_023008chr192299 248 --2569 525 --
NM_023072chr1931153 977 152 --1207 --
NM_023079chr1741753 1648 1368 567 ------
NM_023940chr44967 936 214 147 ------
NM_024007chr522690 50 --12586 --
NM_024016chr171197 ------
NM_024017chr172624 373 1262 ----
NM_024038chr191284 ------
NM_024046chr3184 --21188 1074 --
NM_024054chr71327 1287 ----
NM_024068chr122411 100 ------
NM_024076chr1952303 2040 1479 877 799 12422 ----
NM_024090chr41364 --31656 1433 25 --
NM_024095chr123575 412 71 1133 ----
NM_024294chr6103079 2616 2235 1978 1163 1035 546 524 329 241 ------
NM_024295chr831378 680 22 21636 497 137 --
NM_024306chr164800 339 290 194 ----1305
NM_024329chr171553 1337 1239 1129 1111 411 205 ------
NM_024491chr31413 ------
NM_024513chr393275 2789 1428 876 503 320 245 176 62 --23006 1452 12468
NM_024529chr12337 81 ------
NM_024539chrX2394 271 ------
NM_024541chr1041747 1408 707 309 --1426 --
NM_024551chr1212084 12049 --12479
NM_024551chr1212084 12049 --12479
NM_024563chr531903 1579 296 --1492 --
NM_024594chr531858 1382 131 1574 ----
NM_024595chr12932 81 1177 ----
NM_024596chr855321 5275 4299 4143 523 --54909 3974 2117 2085 1549 11323
NM_024612chr1731128 968 204 ------
NM_024613chr821302 100 ----1638
NM_024631chr111513 ------
NM_024639chr622152 1949 --1507 --
NM_024645chr81987 --11450 --
NM_024659chr22333 146 1155 ----
NM_024665chr333919 2889 188 13606 --1936
NM_024667chr1291647 1637 1437 1425 1384 625 535 478 416 ----1573
NM_024674chr162872 2368 2237 1222 945 401 12922 ----
NM_024686chr11461 ------
NM_024689chrX31800 1291 706 ------
NM_024702chr173430 38 32 ----168
NM_024721chr812595 1674 ----
NM_024740chr1143211 1577 1231 426 --21530 174 11123
NM_024757chr92419 181 --1706 --
NM_024762chr192752 306 --1176 1806
NM_024769chr11178 --186 --
NM_024770chr275859 5135 2082 1706 1393 1217 811 --26047 1079 36432 5289 453
NM_024772chr11420 ------
NM_024779chr1231465 1456 80 ----11194
NM_024795chr21580 ------
NM_024811chr1131599 1544 580 ------
NM_024830chr541853 1738 392 328 ------
NM_024834chr1021559 540 --143 --
NM_024837chr15--11692 ----
NM_024845chr1661725 1436 1127 216 151 105 11121 11250 --
NM_024852chr1----1101 --
NM_024887chr11153 1270 --11669
NM_024930chr542479 2451 1942 596 22354 1957 ----
NM_024941chr511013 21351 387 ----
NM_024947chr378335 7584 7453 6060 3169 2356 730 --29203 3737 --
NM_024953chr121502 ----1424
NM_024963chr7135465 5273 5182 5126 4760 4454 4424 4343 2138 1405 1084 432 33 184 33760 2104 116 1306
NM_024971chr93304 161 21 1660 1292 --
NM_024991chr1062891 2620 757 482 251 238 11214 12337 --
NM_024993chr2------11136
NM_025054chr863468 3077 2924 2665 161 66 --1668 --
NM_025057chr141134 ------
NM_025073chr144306 4143 3345 1562 --11638 --
NM_025074chr432375 1246 154 1855 1648 --
NM_025090chr1741074 947 401 196 --1431 --
NM_025106chr171707 634 358 107 76 56 33 ------
NM_025113chr1321163 1136 ------
NM_025133chr22153 92 ------
NM_025135chr181320 ------
NM_025147chr21937 1857 ----
NM_025160chr121250 259 --12990 12655
NM_025179chr194336 3902 3435 3421 3024 1608 729 409 50 --23982 3002 --
NM_025191chr141311 1110 1011 908 12385 --22596 952
NM_025219chr2031683 202 45 --2962 76 --
NM_025221chr451253 1191 955 290 69 --11205 --
NM_025222chr362771 2693 2420 2156 593 428 ------
NM_025238chr15--170 --11556
NM_025243chr252139 2059 1471 450 331 188 ----
NM_025244chr2170 ------
NM_030576chr1782234 1962 1644 1636 1620 938 774 526 --1433 --
NM_030583chr83979 368 142 ------
NM_030594chr1531254 460 125 --1912 --
NM_030627chr533629 3072 2676 ------
NM_030634chr182457 2229 2037 2009 1658 975 431 143 1116 ----
NM_030647chr775293 4205 2466 1586 496 160 21 12514 --25579 2191
NM_030648chr464325 3819 1355 1217 1205 106 --35122 4554 4023 --
NM_030664chr1052316 2115 1847 1810 644 1778 12139 --
NM_030670chr1231525 170 105 ------
NM_030671chr1231525 170 105 ------
NM_030674chr1234582 1870 1704 --21932 726 35765 5758 4341
NM_030756chr101123 ------
NM_030759chr102527 163 ------
NM_030806chr1139149 9111 8414 7449 7288 6389 6376 6160 3329 2153 1402 1044 31 27081 1288 46965 6367 3125 1502 16646
NM_030810chr631251 456 75 ------
NM_030816chr133025 2560 2348 ------
NM_030820chr61306 ------
NM_030884chr342264 830 755 614 ------
NM_030885chr342082 2073 1590 462 11457 ----
NM_030906chr112455 207 ------
NM_030918chr184894 3392 3337 2112 1489 812 794 124 --11678 --
NM_030920chr112123 1519 ----
NM_030925chr1331649 291 23 ------
NM_030938chr171808 1374 ----
NM_030964chr573604 3545 2706 1336 998 676 594 --31369 767 657 --
NM_030981chr1121174 1031 ------
NM_031157chr121471 1116 156 --
NM_031208chr161267 171 ----
NM_031216chr182828 716 ------
NM_031243chr71174 ------
NM_031266chr51209 1488 ----
NM_031267chr71448 ------
NM_031268chr16105180 4518 3788 3515 1778 1364 1071 510 491 96 --11541 --
NM_031271chr821463 606 ------
NM_031289chr121103 --2931 681 --
NM_031296chr422783 1065 ------
NM_031306chr13937 857 358 ------
NM_031369chr41595 ------
NM_031370chr41595 ------
NM_031371chr131614 460 49 ------
NM_031371chr131614 460 49 ------
NM_031411chr552142 1692 594 403 24 1271 ----
NM_031439chr821200 307 --180 --
NM_031449chr711945 ----1617
NM_031453chr1042315 866 673 568 ------
NM_031459chr141440 1042 1019 494 1325 1141 --
NM_031461chr82891 743 ------
NM_031469chr633846 1476 125 --33403 3320 97 --
NM_031476chr1662759 2335 2200 697 643 623 ------
NM_031483chr2022393 620 13491 ----
NM_031844chr163989 3580 1459 1427 924 829 1390 ----
NM_031849chr552142 1692 594 403 24 1271 ----
NM_031857chr552142 1692 594 403 24 1271 ----
NM_031858chr171148 ----11335
NM_031860chr552142 1692 594 403 24 1271 ----
NM_031862chr171148 ----11335
NM_031890chr2272646 2541 2327 2317 1859 931 873 ------
NM_031892chrX4756 688 400 24 ------
NM_031918chr1941308 529 491 225 --1426 --
NM_031935chr11119 ------
NM_031936chr1--1259 ----
NM_031939chr18149 --11125 --
NM_031954chr1292889 2811 2605 2356 2139 1852 430 57 21 12859 ----
NM_031990chr193510 407 63 --21315 361 --
NM_031991chr193510 407 63 --21315 361 --
NM_032012chr954986 3823 1823 1597 434 ------
NM_032013chr2041391 480 202 113 --11514 --
NM_032017chr1102004 1938 1886 1473 1374 611 463 352 174 143 1106 --12047
NM_032050chr2211009 --1803 --
NM_032052chr2211394 --11188 --
NM_032088chr541694 1346 1311 287 --125 --
NM_032092chr541694 1346 1311 287 --125 --
NM_032102chr1152535 2184 757 368 119 ------
NM_032105chr1137051 6181 5984 5012 2348 1816 1526 1278 778 564 450 382 271 --17639 --
NM_032124chr181296 ------
NM_032135chr14----135 --
NM_032139chr192736 302 --1933 --
NM_032144chr211225 ------
NM_032145chr61660 1447 1241 --
NM_032149chr4--1155 ----
NM_032153chr372671 1943 1830 1015 384 110 71 ------
NM_032160chr1864144 3892 3308 3045 1707 250 --1767 --
NM_032174chr121471 164 ------
NM_032182chr1031630 1520 1183 ------
NM_032186chr11270 --170 --
NM_032189chr13154107 3979 3967 3952 2006 1681 1385 670 644 619 602 384 350 322 74 24024 3635 21664 137 --
NM_032221chr201431 11402 1789 --
NM_032229chr131173 1979 ----
NM_032242chr363091 2532 2419 772 196 110 ------
NM_032268chr1642760 1302 841 801 ----1393
NM_032287chr22114265 3118 2987 1385 1357 1036 931 912 795 308 34 ------
NM_032288chr312089 --11646 1948
NM_032291chr121292 443 ------
NM_032298chr191431 ----192
NM_032319chr22302 287 --1157 128
NM_032325chr1141910 1679 563 532 ------
NM_032338chr122582 27 ------
NM_032352chr141520 --11005 --
NM_032373chr1044261 1920 1488 486 14533 34234 4059 1843 14120
NM_032374chr1411777 11582 ----
NM_032376chr17139 --1507 --
NM_032379chr112635 363 ----1786
NM_032380chr52165 42 ------
NM_032403chr541694 1346 1311 287 --125 --
NM_032408chr72126 39 ------
NM_032413chr151105 ------
NM_032431chr113773 697 193 --2709 360 --
NM_032438chr61494 ------
NM_032440chr1022906 444 12245 12194 --
NM_032445chr151262 ------
NM_032449chr142646 1985 1941 1904 ----12826
NM_032457chr463789 3636 3414 2380 1544 399 ------
NM_032458chrX22504 2106 ------
NM_032468chr821462 1120 --11478 11166
NM_032482chr1972112 2076 1920 1904 1098 357 153 --1840 --
NM_032499chr151528 --1129 1515
NM_032505chr322485 813 12757 ----
NM_032520chr16--1240 ----
NM_032538chr6102854 2814 2756 2696 2430 2214 1891 553 319 63 --22527 2327 --
NM_032547chr41463 --1927 --
NM_032560chr14--2385 325 ----
NM_032569chr1642000 1454 774 753 ------
NM_032582chr172743 266 ------
NM_032599chr7------1496
NM_032632chr1411644 ------
NM_032682chr313595 ------
NM_032689chr1961463 1292 1116 1025 443 389 ------
NM_032711chr17103571 3480 3335 2811 2722 1579 1566 1435 402 38 --13377 --
NM_032727chr1021445 362 --11664 --
NM_032737chr1932564 1001 43 1751 21793 513 --
NM_032765chr51989 1816 126 --
NM_032784chr621000 75 ------
NM_032800chr152720 1758 541 443 78 1333 12580 --
NM_032801chr1152503 2074 1611 1589 881 --1169 1379
NM_032804chr1052355 2087 507 157 112 --1648 1288
NM_032810chr101552 --1249 --
NM_032813chr131721 --1901 --
NM_032819chr204590 243 109 101 ------
NM_032826chr7113596 2136 2048 1849 1642 1251 1133 1089 913 378 92 ----15371
NM_032839chr31526 --2496 388 --
NM_032846chr1431365 608 274 --11342 --
NM_032859chr1353838 3214 3206 3086 2888 ------
NM_032866chr15103160 2802 2548 1129 1008 812 799 289 227 53 12562 ----
NM_032875chr17156 --1145 --
NM_032884chr12364 118 ------
NM_032895chr171786 ------
NM_032906chr4----1674 --
NM_032943chr112635 363 ----1786
NM_032975chr1872874 2549 2496 2256 2212 1161 100 1948 2778 308 13288
NM_032980chr1872874 2549 2496 2256 2212 1161 100 1948 2778 308 13288
NM_032995chr251648 604 274 239 71 ----11486
NM_033018chrX2111 46 ----1952
NM_033020chr113931 --14819 --
NM_033036chr1151443 1359 1341 1248 224 11451 ----
NM_033055chr11856 ------
NM_033058chr8174 ------
NM_033081chr201388 --31486 328 37 180
NM_033082chr12164 ------
NM_033116chr141252 ------
NM_033121chr1241582 405 278 51 ------
NM_033132chr1322243 2170 ------
NM_033136chr521785 1263 ------
NM_033137chr521785 1263 ------
NM_033141chr1442131 800 310 156 ------
NM_033150chr12171 ------
NM_033161chr931739 1674 1410 11235 1191 --
NM_033181chr621450 276 ------
NM_033222chr91544 --1194 11409
NM_033224chr776878 5900 5242 3003 1020 613 112 ----11954
NM_033226chr161156 ------
NM_033227chr51557 ------
NM_033228chr51597 --128 --
NM_033254chr31229 --1107 --
NM_033260chr61615 ------
NM_033274chr583405 3317 3104 2871 926 772 507 367 --22971 578 --
NM_033285chr863545 2869 1473 1434 1327 1207 --14285 --
NM_033290chrX73295 2439 2308 1471 1070 687 51 1983 13730 --
NM_033300chr11986 ------
NM_033312chr1------181
NM_033326chr1132013 831 745 --11719 --
NM_033331chr933545 2936 1240 --12949 11315
NM_033337chr31263 --1172 --
NM_033360chr1223301 2928 --23648 499 --
NM_033375chr1751227 346 237 204 178 11099 ----
NM_033380chrX1709 --1340 --
NM_033381chrX1709 --1340 --
NM_033389chr1784646 3618 3582 3468 1951 1571 1442 976 --1505 --
NM_033420chr1921138 146 ------
NM_033421chr206643 613 588 529 407 23 ------
NM_033425chr1183363 2925 2835 1358 1220 744 604 141 ------
NM_033426chr1432955 2612 2271 --2450 136 --
NM_033429chr1563297 2707 2292 1081 897 168 1677 12358 --
NM_033430chr483852 3299 2666 2654 2568 1092 739 670 --13003 --
NM_033437chr483852 3299 2666 2654 2568 1092 739 670 --13003 --
NM_033512chr831038 745 190 --22171 2015 --
NM_033542chr2021893 689 --1494 1287
NM_033550chr2042349 2283 1932 1793 168 ----
NM_033551chr513179 ------
NM_033631chr13924 476 198 --33134 1206 1171 --
NM_033632chr411307 ----11368
NM_033644chr522534 865 --12206 --
NM_033645chr522534 865 --12206 --
NM_033656chr2135545 5462 5267 --14242 --
NM_052840chr1531312 576 150 --123 --
NM_052855chr17168 ------
NM_052874chr161537 1567 ----
NM_052880chr2241300 1200 1105 993 --11230 --
NM_052882chr191511 ------
NM_052885chr1231738 1128 809 --13104 --
NM_052886chr841789 1391 633 337 1506 1728 --
NM_052897chr123220 163 76 ------
NM_052898chr8--165 ----
NM_052899chr55976 868 755 271 92 3967 210 202 4953 717 680 644 --
NM_052900chr8----1435 --
NM_052904chr61505 ------
NM_052905chr2--11629 2467 419 --
NM_052918chr1042848 752 589 21 1724 ----
NM_052932chr113460 371 295 ------
NM_052934chr141980 1802 695 77 1262 ----
NM_052971chr52390 34 --1376 --
NM_052978chr142643 88 --21702 1230 --
NM_053002chr31131 ------
NM_053016chr9107531 7490 6924 6758 6452 5950 5788 5244 3158 639 --32612 1368 384 --
NM_053024chr311288 21534 382 ----
NM_053025chr331540 492 374 --11529 --
NM_053026chr331540 492 374 --11529 --
NM_053027chr331540 492 374 --11529 --
NM_053028chr331540 492 374 --11529 --
NM_053031chr331540 492 374 --11529 --
NM_053032chr331540 492 374 --11529 --
NM_053043chr785247 4336 2173 1295 1268 1118 916 904 1362 21615 148 --
NM_053056chr1182236 1942 1149 968 802 661 585 280 ------
NM_053064chr1422079 461 --22816 916 --
NM_054016chr13654 207 168 --21350 411 --
NM_054016chr13654 207 168 --21350 411 --
NM_054016chr13654 207 168 --21350 411 --
NM_054027chr542176 825 516 381 1793 2889 461 --
NM_054114chr6125 --1144 --
NM_057159chr911085 --11576 --
NM_057164chr22250 50 ------
NM_057165chr22250 50 ------
NM_057166chr22250 50 ------
NM_057167chr22250 50 ------
NM_057175chr422563 1012 11720 11982 --
NM_057180chr12------180
NM_058172chr421367 377 ------
NM_058241chr221541 654 ------
NM_058241chr221541 654 ------
NM_078625chr61191 ------
NM_080415chr172918 789 ------
NM_080476chr20--1126 ----
NM_080546chr922214 532 --11974 --
NM_080596chr6148 ------
NM_080597chr181290 ------
NM_080599chr101814 ------
NM_080645chr631902 666 274 --1718 --
NM_080654chr111153 --1438 --
NM_080655chr9------194
NM_080669chr17103727 3699 3689 3252 1762 1360 1234 1145 687 430 --13341 13744
NM_080676chr2053239 2786 662 368 293 ------
NM_080683chr41182 ------
NM_080684chr41182 ------
NM_080685chr41182 ------
NM_080738chr141939 1848 770 290 ----1439
NM_080743chr6------12291
NM_080759chr1332048 2023 1028 --1972 --
NM_080760chr1332048 2023 1028 --1972 --
NM_080862chr32506 297 1936 1238 --
NM_080867chr1444832 4520 3844 3456 --11180 21723 971
NM_080872chr883949 3875 3741 3622 1516 903 804 580 24077 2810 ----
NM_080874chr42593 269 ------
NM_080927chr333255 2964 2471 12873 1522 --
NM_100264chr102258 248 ------
NM_100486chr102258 248 ------
NM_130385chr1153203 2204 1194 804 234 23063 2586 33070 2780 2441 --
NM_130391chr913303 --169 --
NM_130392chr913303 --169 --
NM_130393chr913303 --169 --
NM_130434chr15----11116 --
NM_130436chr2152333 1054 713 257 189 1118 21088 268 --
NM_130438chr2152910 1290 834 766 235 1695 1845 --
NM_130440chr131108 415 158 --170 --
NM_130446chr361391 760 690 658 402 107 --1155 --
NM_130469chr142832 170 ------
NM_130797chr751648 572 352 306 266 31731 1136 535 ----
NM_130798chr1521479 325 1437 --1460
NM_130830chr383762 3727 3278 2817 2752 2643 2595 1610 11046 11329 --
NM_130838chr152716 149 11399 1212 --
NM_130839chr152716 149 11399 1212 --
NM_133170chr2077258 7190 5339 5090 4995 1391 1180 1550 25968 236 17299
NM_133171chr2041119 953 319 131 1247 ----
NM_133264chr1743773 2572 831 732 12839 33707 1318 256 --
NM_133265chrX103457 3022 2649 2381 2320 2229 1314 1274 857 586 13354 13221 --
NM_133266chr1141041 740 327 120 1448 ----
NM_133328chr193743 673 45 --1287 --
NM_133329chr221441 461 ------
NM_133330chr442984 257 162 105 ------
NM_133331chr442984 257 162 105 ------
NM_133334chr4116002 5800 5560 4965 4910 4891 4156 4072 2324 1402 200 --15512 --
NM_133335chr442984 257 162 105 ------
NM_133370chr443241 2932 1214 529 ------
NM_133372chr532086 329 120 ------
NM_133445chr953725 2983 973 582 303 --13114 --
NM_133468chr742437 2429 2365 247 ------
NM_133510chr14------1265
NM_133631chr311646 ----11600
NM_133634chr2141560 690 539 426 ------
NM_133642chr222897 92 ----1306
NM_133647chr1522871 2799 --31202 1068 244 --
NM_134325chr141515 1337 668 230 ------
NM_134442chr231679 478 417 155 ----
NM_134470chr32515 293 ----1637
NM_138285chr22468 27 ------
NM_138316chr10198 ------
NM_138317chr14--1142 ----
NM_138318chr14--1142 ----
NM_138319chr151849 --11028 --
NM_138324chr152669 41 ------
NM_138335chr43864 728 245 --1238 --
NM_138338chr22133476 3406 3197 2381 2242 1184 1131 1109 591 569 528 368 308 --23332 2671 --
NM_138394chr2155 ------
NM_138409chr621080 939 ----11380
NM_138417chr1125 ------
NM_138426chr722412 1011 1470 ----
NM_138444chr1344900 3723 3035 345 --13577 1179
NM_138459chr642828 928 327 304 ------
NM_138473chr1253176 350 231 95 36 ----11615
NM_138565chr1151108 936 882 511 194 ------
NM_138576chr1444078 3738 3013 941 44755 4239 1786 1103 11725 --
NM_138612chr161201 1216 ----
NM_138619chr1781202 1128 1076 1060 1007 588 338 228 11179 1394 --
NM_138620chr92190 111 ----1457
NM_138713chr1677979 6044 2948 2527 2367 2076 943 --23293 2638 1699
NM_138714chr1677979 6044 2948 2527 2367 2076 943 --23293 2638 1699
NM_138727chr172171 1789 950 717 520 492 294 ------
NM_138728chr172171 1789 950 717 520 492 294 ------
NM_138729chr1--1106 ----
NM_138735chr221048 380 1964 11130 --
NM_138736chr1663376 3342 3091 1649 816 426 24202 3406 ----
NM_138766chr51439 ------
NM_138773chr52862 678 ------
NM_138782chr5--1503 12106 --
NM_138799chr261997 1550 1324 833 265 196 ------
NM_138821chr51439 ------
NM_138822chr51439 ------
NM_138927chr213905 708 70 --2835 62 --
NM_138961chr11----195 --
NM_138962chr17----1363 --
NM_138969chr81284 --1539 --
NM_138970chr1441752 1621 1531 689 --1201 --
NM_138971chr1143294 2782 2704 863 166 13217 --
NM_138971chr1143294 2782 2704 863 166 13217 --
NM_138972chr1143294 2782 2704 863 166 13217 --
NM_138972chr1143294 2782 2704 863 166 13217 --
NM_138973chr1143294 2782 2704 863 166 13217 --
NM_138973chr1143294 2782 2704 863 166 13217 --
NM_139014chr622069 1800 ------
NM_139035chrX1104 --180 --
NM_139057chr1552421 1806 656 183 81 1102 --1227
NM_139076chr4184 ------
NM_139132chr1141108 1006 929 323 --128 --
NM_139136chr12----196 --
NM_139159chr1951058 383 282 140 24 --11067 --
NM_139177chr174504 355 239 34 ------
NM_139244chr62612 245 ------
NM_139246chr961924 1876 706 410 281 165 --1762 --
NM_139276chr1742279 757 423 417 --1434 --
NM_139283chr1212532 ------
NM_139314chr19----1334 --
NM_139321chr2043720 2582 887 56 ------
NM_144567chr142005 1029 579 494 ------
NM_144571chr442122 2031 1180 773 ----15483
NM_144574chr14------1128
NM_144578chr1435301 1618 923 ------
NM_144582chr232400 2189 2079 ------
NM_144583chr241297 1159 639 360 11170 11751 --
NM_144595chr132312 148 ------
NM_144599chr1531596 1514 951 --34916 4093 803 --
NM_144604chr16154 --1147 --
NM_144610chr17158 ------
NM_144618chr111555 --1175 --
NM_144635chr351020 881 835 294 253 1872 ----
NM_144664chr1111924 ------
NM_144667chr1221037 1013 ------
NM_144723chr5----1230 --
NM_144726chr511044 ------
NM_144728chr1--1853 ----
NM_144729chr1--1853 ----
NM_144736chr21252 ------
NM_144767chr1533776 1091 910 34572 3965 3599 ----
NM_144775chr17104957 3773 3541 3295 1325 1182 1129 971 610 302 --24538 215 --
NM_144778chr1321009 652 21902 101 22613 1747 --
NM_144949chr2--1512 22416 198 --
NM_144963chr82305 74 ------
NM_144967chrX2810 64 ------
NM_144969chrX2712 108 1687 ----
NM_144973chr1263250 1430 1175 571 452 87 ------
NM_145004chr8179 ------
NM_145011chr10----1298 1111
NM_145049chr5------1914
NM_145053chr112607 61 2239 211 ----
NM_145055chr1843537 2779 880 174 13146 ----
NM_145117chr1143103 1139 573 511 12756 1102 --
NM_145174chr2221195 287 ------
NM_145185chr19101867 1648 1553 1499 768 498 339 111 70 46 --1280 --
NM_145203chr132941 685 ------
NM_145206chr1043184 2525 356 68 1682 --11265
NM_145246chr1021215 381 ------
NM_145251chr1421297 531 ------
NM_145259chr245616 5322 4941 4409 11922 1700 --
NM_145285chr102764 487 ------
NM_145296chr19--1316 ----
NM_145307chr1034177 4053 3481 ----14223
NM_145313chr1011357 ------
NM_145320chr732629 2550 431 --12816 --
NM_145321chr732629 2550 431 --12816 --
NM_145322chr732629 2550 431 --12816 --
NM_145341chr1031768 1599 250 ------
NM_145350chr1751386 550 283 233 226 ------
NM_145351chr1772526 1875 1690 949 930 867 778 ------
NM_145686chr232270 2193 2106 11086 11295 --
NM_145687chr232270 2193 2106 11086 11295 --
NM_145690chr821550 643 --1393 11325
NM_145698chr1021498 476 ------
NM_145716chr11576 ------
NM_145728chr1532279 557 300 22499 1550 ----
NM_145733chr222373 314 ------
NM_145735chr1332690 2502 962 22560 2312 ----
NM_145753chr31675 --164 --
NM_145808chr7------1835
NM_145861chr141939 1848 770 290 ----1439
NM_145891chr1631526 349 297 ------
NM_145892chr1631526 349 297 ------
NM_145893chr1641648 471 419 41 ------
NM_147150chr933074 2694 369 1643 --42869 1511 1230 498
NM_147156chr1021040 417 170 1338 --
NM_147175chrX----21803 1597 11645
NM_147181chr451253 1191 955 290 69 --11205 --
NM_147182chr451253 1191 955 290 69 --11205 --
NM_147183chr451253 1191 955 290 69 --11205 --
NM_147189chr831932 398 179 ------
NM_147223chr272357 2285 1778 1700 1508 284 172 11731 12003 --
NM_147233chr252174 2102 1595 1517 101 11548 11820 --
NM_148170chr1131968 944 37 14483 23973 123 1789
NM_148174chr831896 1723 1462 12009 ----
NM_148674chr22121 ------
NM_148894chr42769 72 ------
NM_148898chr71814 --21031 873 --
NM_148899chr71814 --21031 873 --
NM_148921chr1772359 2300 2293 2286 2192 2184 1912 ------
NM_148955chr15106343 5563 4935 4862 4613 2133 1456 937 570 393 --24661 4059 --
NM_148977chr10198 ------
NM_148978chr10198 ------
NM_152133chr6125 --1144 --
NM_152253chr2273135 2974 2620 702 577 172 142 32989 924 710 ----
NM_152261chr1222116 2106 ------
NM_152263chr195837 5238 4248 2419 1815 1650 1128 541 318 12002 34632 1978 666 --
NM_152264chr111245 ----1930
NM_152265chr121426 1043 ------
NM_152267chr2222369 964 ------
NM_152271chr8----1398 --
NM_152277chr521838 812 ----1566
NM_152280chr131258 1223 509 --13108 12372
NM_152284chr82792 347 ------
NM_152330chr14188 11840 ----
NM_152331chr14198 ------
NM_152344chr1731081 366 263 ------
NM_152354chr191667 1209 141 --
NM_152384chr2111700 1626 1577 1528 1450 1402 1353 1275 530 243 61 2725 70 ----
NM_152388chr221357 1215 ----1323
NM_152390chr21502 ------
NM_152409chr542684 1064 843 156 ------
NM_152422chr91448 2499 211 31274 1229 186 --
NM_152429chr1021436 420 ----11424
NM_152437chr1252393 1978 1753 903 322 12102 1233 1298
NM_152442chr1231397 541 344 ------
NM_152450chr1521912 1887 11569 32075 1700 747 --
NM_152451chr152830 202 --1561 --
NM_152455chr153995 858 708 ----12634
NM_152470chr1873447 1277 1150 1075 975 90 57 11058 ----
NM_152496chr151236 879 338 330 86 ------
NM_152520chr21980 ----157
NM_152529chr274408 3924 3225 1723 1383 517 43 11671 ----
NM_152538chr331627 1346 151 ------
NM_152542chr442160 770 276 204 ------
NM_152563chr117631 579 527 475 423 371 56 ------
NM_152570chr9192 ------
NM_152586chr101971 --130 --
NM_152594chr151606 21924 703 ----
NM_152608chr122059 762 ------
NM_152613chr22--11258 ----
NM_152622chr531215 779 358 ------
NM_152624chr535366 752 445 --24604 1730 14583
NM_152636chr1142625 2467 2442 800 ------
NM_152638chr122463 363 ----1828
NM_152660chr11406 ------
NM_152667chr2031415 1258 1208 --1479 --
NM_152699chr342967 2381 165 116 ----13425
NM_152704chr132313 198 ------
NM_152707chr101116 1109 --1155
NM_152723chr112166 130 ------
NM_152733chr6136269 6066 5763 4757 4180 2556 2375 1922 1398 960 738 676 372 1692 15257 --
NM_152738chr62426 289 --1393 --
NM_152740chr72207 126 1557 1737 --
NM_152744chr773139 2994 2968 2242 1103 906 747 --12883 --
NM_152745chr7181 ------
NM_152749chr71453 1431 --1763
NM_152756chr514083 --1963 --
NM_152758chr81464 --1379 --
NM_152780chrX41039 255 172 72 --11243 --
NM_152787chrX43691 3167 743 372 11033 ----
NM_152789chr72575 138 1167 ----
NM_152793chr744597 4272 1406 688 --21345 874 11836
NM_152826chr15106343 5563 4935 4862 4613 2133 1456 937 570 393 --24661 4059 --
NM_152835chr121049 475 --11997 12775
NM_152836chr821739 676 ------
NM_152837chr821739 676 ------
NM_152838chr2043383 1343 1169 695 33470 784 729 ----
NM_152888chr82636 93 1384 ----
NM_152890chr11878 --31267 836 405 --
NM_152896chr91137 ------
NM_152903chr1362489 2416 1898 1006 763 692 1313 ----
NM_152924chr15115549 5264 4608 4509 4298 4267 2357 2258 2166 1671 1639 --16161 1542
NM_152989chr1231498 1219 267 21515 415 ----
NM_153013chr511936 --12075 --
NM_153026chr122348 40 --1536 --
NM_153029chr1663698 3373 3361 1557 845 591 --53830 3797 1615 747 741 --
NM_153040chr151149 ------
NM_153042chr621704 406 11610 ----
NM_153184chr31636 ------
NM_153186chr93840 784 635 --1267 --
NM_153188chr565584 5416 4943 3564 2026 685 --33985 1845 1548 11901
NM_153207chr1233652 3196 56 --1993 --
NM_153208chr162737 671 ------
NM_153234chr542129 1893 1008 184 ----11927
NM_153235chr612155 11727 ----
NM_153251chr13------1202
NM_153260chr1511085 ------
NM_153261chr16----11249 171
NM_153262chr11703 --1508 --
NM_153267chr91669 ------
NM_153273chr362818 2692 2424 1918 1775 713 11733 ----
NM_153326chr1182 ------
NM_153331chr31570 ------
NM_153341chr11121 ------
NM_153343chr431574 506 427 1448 ----
NM_153354chr52711 670 ------
NM_153365chr422736 2265 ------
NM_153367chr103454 355 28 --33525 3062 1286 --
NM_153607chr52778 481 ------
NM_153616chr153965 168 159 ------
NM_153617chr153965 168 159 ------
NM_153618chr153965 168 159 ------
NM_153619chr1551406 1397 703 389 261 --11110 --
NM_153649chr121680 833 ------
NM_153704chr8177 ------
NM_153705chr1121643 38 --12345 --
NM_153706chr51177 ------
NM_153748chr12----196 --
NM_153757chr42377 358 ------
NM_153809chr91539 ------
NM_153810chr1075029 3918 3384 3221 1715 1491 942 24221 108 24933 4751 --
NM_153828chr25776 717 594 313 139 ------
NM_153831chr82846 826 ------
NM_153836chr21646 11390 --1465
NM_170665chr1254158 3215 2918 1782 1412 ------
NM_170674chr152203 186 ----11438
NM_170675chr15------11114
NM_170676chr15------11114
NM_170677chr152203 186 ----11438
NM_170696chr1531654 1158 201 1330 196 --
NM_170697chr1531654 1158 201 1330 196 --
NM_170706chr162991 2893 2754 1719 1480 642 --23380 3038 11601
NM_170721chr1721240 921 ------
NM_170731chr1121853 967 --12499 --
NM_170732chr1121853 967 --12499 --
NM_170733chr1121853 967 --12499 --
NM_170734chr1121853 967 --12499 --
NM_170735chr1121853 967 --12499 --
NM_170753chr10197 ------
NM_170774chr2093577 3259 3136 2859 2672 1249 1193 392 126 --34175 597 456 --
NM_171825chr562687 2667 2302 2112 194 36 ----13208
NM_171998chrX21003 732 --11598 --
NM_172058chr831620 262 226 ------
NM_172059chr831620 262 226 ------
NM_172060chr831620 262 226 ------
NM_172069chr222266 1993 --21876 96 --
NM_172070chr211947 ------
NM_172071chr136762 5140 2704 12270 11002 --
NM_172103chr61179 11844 11034 --
NM_172105chr61179 11844 11034 --
NM_172110chr201619 ------
NM_172111chr201619 ------
NM_172112chr201619 ------
NM_172113chr201619 ------
NM_172127chr421765 638 12085 ----
NM_172217chr1583159 2939 2793 2711 2543 1446 796 643 1268 33963 3303 199 --
NM_172230chr113773 697 193 --2709 360 --
NM_172315chr152203 186 ----11438
NM_172316chr152203 186 ----11438
NM_172337chr141273 ------
NM_172344chr221441 461 ------
NM_172373chr131902 21195 862 ----
NM_173054chr7--1372 ----
NM_173171chr221195 1142 --168 --
NM_173172chr241503 1450 223 50 --1376 --
NM_173173chr221195 1142 --168 --
NM_173198chr922851 2542 1959 ----
NM_173199chr9--1513 ----
NM_173200chr922851 2542 1959 ----
NM_173214chr1677979 6044 2948 2527 2367 2076 943 --23293 2638 1699
NM_173355chr23698 333 312 ------
NM_173359chr321311 196 ----11548
NM_173468chr435458 3751 2183 12284 1510 --
NM_173470chrX31867 692 265 --12695 --
NM_173475chr1611621 21474 1417 ----
NM_173476chr1682226 2094 1600 1492 789 572 529 432 11930 21958 557 --
NM_173478chr1721070 33 ------
NM_173510chr222306 158 --21102 406 --
NM_173519chr83621 152 53 12084 ----
NM_173545chr221675 458 21948 1625 1305 --
NM_173546chr31551 ------
NM_173557chr181756 ------
NM_173560chr62554 130 ------
NM_173576chr1022277 326 ------
NM_173582chr1176010 5262 2410 1693 1530 1403 1227 --25057 4527 15942
NM_173595chr1254499 3601 3226 1082 159 ------
NM_173632chr1982697 2554 2437 1334 1088 407 324 224 ------
NM_173642chr1129029 3416 3280 2852 2453 2444 1896 1385 1263 994 882 770 36945 3427 1743 26794 2984 --
NM_173645chr21172 1479 ----
NM_173653chr32223 140 ----11097
NM_173666chr5--11151 ----
NM_173683chr81126 ----1169
NM_173694chrX11036 --21957 1811 --
NM_173797chr51947 --11075 --
NM_173808chr143867 3161 1566 1295 --1184 --
NM_173825chr321899 522 12856 ----
NM_173829chr595941 5476 4099 3980 3749 2436 1613 797 213 11948 35229 5207 5145 --
NM_173833chr851323 1296 1027 584 80 ------
NM_173851chr853857 789 585 470 39 --11090 21159 391
NM_173872chr41353 ------
NM_174890chr102755 535 ------
NM_174911chr853921 2901 2557 941 53 1642 23612 3173 --
NM_174921chr421089 746 ------
NM_174929chr711945 ----1617
NM_175058chr116941 904 562 452 433 252 ------
NM_175069chr911030 1334 1853 --
NM_175610chr151183 ------
NM_175624chr1297566 7015 6800 6639 6440 5397 2988 2554 1512 1610 25774 5124 --
NM_175625chr1297566 7015 6800 6639 6440 5397 2988 2554 1512 1610 25774 5124 --
NM_175634chr8------1413
NM_175635chr8------1413
NM_175636chr8------1413
NM_175736chr12107069 6320 5845 5393 4926 4875 3068 1583 1145 683 --11050 --
NM_175768chr611601 --1116 11296
NM_175847chr193510 407 63 --21315 361 --
NM_175854chr1321086 339 ------
NM_175863chr62947 47 ------
NM_175866chr11136 ------
NM_175907chr1821033 888 --42193 1822 1816 451 --
NM_175913chr201733 --21039 794 --
NM_175920chr51625 ------
NM_175931chr1671976 1547 1426 489 310 218 145 ----11990
NM_176071chr113940 406 73 --1702 --
NM_176072chr113940 406 73 --1702 --
NM_176871chr832946 2678 2513 12373 12867 --
NM_177398chr111535 ------
NM_177399chr111535 ------
NM_177414chr11408 ------
NM_177422chr1----1101 --
NM_177524chr71910 --21098 875 --
NM_177525chr71910 --21098 875 --
NM_177968chr2--11454 11374 --
NM_177972chr1153809 3764 3483 958 463 2332 243 11174 --
NM_177989chr31385 ------
NM_177990chr2021428 499 --31383 756 308 --
NM_177995chr91448 2499 211 31274 1229 186 --
NM_177996chr2052706 2558 2121 1358 788 12778 32475 852 528 --
NM_177999chr983636 3112 2598 1310 931 579 254 154 --126 --
NM_178009chr131206 ------
NM_178010chr1231498 1219 267 21515 415 ----
NM_178037chr1263568 3405 2681 2537 682 25 ------
NM_178038chr1263568 3405 2681 2537 682 25 ------
NM_178042chr31385 ------
NM_178126chr1741988 1819 205 25 11501 ----
NM_178135chr441179 395 389 306 ----11339
NM_178151chrX87413 6334 5406 5205 3095 2921 1857 185 ------
NM_178152chrX87413 6334 5406 5205 3095 2921 1857 185 ------
NM_178153chrX87413 6334 5406 5205 3095 2921 1857 185 ------
NM_178154chr141305 ------
NM_178155chr141305 ------
NM_178156chr141305 ------
NM_178157chr141305 ------
NM_178191chr161541 1367 1207 1134 533 171 11488 11031 --
NM_178229chr151001 833 330 295 164 ------
NM_178454chr11157 1610 ----
NM_178527chr11130 ------
NM_178539chr1231326 313 257 ------
NM_178562chr7----2755 607 --
NM_178565chr821123 59 --21569 562 --
NM_178568chr172501 33 ------
NM_178585chr422749 334 ------
NM_178586chr1441538 556 201 79 --1638 --
NM_178812chr831300 1211 466 ------
NM_178835chr41868 --1307 --
NM_180976chr64710 288 116 27 ------
NM_180977chr64710 288 116 27 ------
NM_181054chr1431196 896 795 1247 ----
NM_181302chr14------1128
NM_181308chr14------1128
NM_181332chrX22008 429 ------
NM_181349chr752805 2464 575 272 38 ------
NM_181351chr1162722 2648 2242 2221 1839 1027 ------
NM_181354chr811141 ------
NM_181356chr62854 719 ------
NM_181358chr143389 3276 3057 863 ------
NM_181361chr31546 --1403 --
NM_181442chr202826 380 --1671 --
NM_181504chr542737 1586 111 39 ----23969 260
NM_181507chr111393 ----1984
NM_181508chr111393 ----1984
NM_181523chr542737 1586 111 39 ----23969 260
NM_181524chr542737 1586 111 39 ----23969 260
NM_181534chr172174 30 ------
NM_181659chr20--11032 ----
NM_181659chr20--11032 ----
NM_181671chr174291 253 46 34 ------
NM_181696chr1141 ------
NM_181697chr1141 ------
NM_181705chr5105392 5005 4615 4449 4182 3982 2008 1603 760 619 34392 2188 1803 13527 15754
NM_181755chr12323 125 ------
NM_181762chrX--132 ----
NM_181777chrX--132 ----
NM_181784chr252607 2300 2254 2218 260 --2210 38 --
NM_181809chr1113213 2658 2455 1507 1331 1168 841 828 535 84 29 ------
NM_181828chr22103112 2363 1310 1271 1237 1063 833 798 140 76 --33395 2560 1050 --
NM_181829chr22103112 2363 1310 1271 1237 1063 833 798 140 76 --33395 2560 1050 --
NM_181830chr22103112 2363 1310 1271 1237 1063 833 798 140 76 --33395 2560 1050 --
NM_181832chr22103127 2378 1325 1286 1252 1078 848 813 155 91 --33410 2575 1065 --
NM_181838chr531558 1540 476 ------
NM_181864chr13209 62 37 ------
NM_181865chr13209 62 37 ------
NM_181866chr13209 62 37 ------
NM_181876chr422107 1771 1247 22393 96 --
NM_181886chr421359 393 ------
NM_181887chr421359 393 ------
NM_181888chr421359 393 ------
NM_181889chr421359 393 ------
NM_181890chr421359 393 ------
NM_181891chr421359 393 ------
NM_181892chr421406 440 ------
NM_181893chr421359 393 ------
NM_181897chr31583 ------
NM_182485chr442424 1202 963 713 22881 438 ----
NM_182507chr1241920 1839 1791 198 1751 ----
NM_182509chr1451604 1329 1280 392 129 11048 ----
NM_182515chr1996339 5550 4712 4167 1998 1044 960 691 542 25326 103 35312 4681 4389 --
NM_182522chr32968 211 ------
NM_182526chr1442953 2921 745 353 ----12717
NM_182557chr1182099 2087 2054 1864 1410 743 312 228 --21482 646 --
NM_182569chr17180 ------
NM_182581chr1----125 --
NM_182641chr1741890 1581 1398 334 ------
NM_182646chr442424 1202 963 713 22881 438 ----
NM_182648chr141179 ------
NM_182666chr32170 39 ------
NM_182691chr71544 11071 ----
NM_182692chr71544 11071 ----
NM_182700chr72527 364 11453 --11532
NM_182729chr1241416 719 658 254 ------
NM_182742chr1241416 719 658 254 ------
NM_182743chr1241416 719 658 254 ------
NM_182763chr132181 1957 184 ----12122
NM_182764chr2041119 953 319 131 1247 ----
NM_182765chr1022186 287 --2434 405 --
NM_182767chr1211444 1405 ----
NM_182789chr5183 ------
NM_182797chr2021278 1194 ----1218
NM_182811chr202362 156 ------
NM_182898chr775885 5696 5148 4541 1731 1607 290 --15132 --
NM_182899chr775885 5696 5148 4541 1731 1607 290 --15132 --
NM_182907chr641845 1579 876 194 --11856 1760
NM_182911chr2170 ------
NM_182915chr262204 1449 1392 762 703 496 ------
NM_182920chr331223 419 26 ------
NM_182925chr54669 598 460 207 --21235 388 --
NM_182931chr71693 ------
NM_182943chr311166 ------
NM_182948chr112223 21213 208 --12360
NM_182964chr1143103 1139 573 511 12756 1102 --
NM_182970chr2094212 3310 2793 2781 2676 569 443 363 213 ------
NM_182972chr132627 2408 1085 12402 ----
NM_182976chr11204 ------
NM_182977chr511042 ------
NM_183004chr1443031 2846 1233 112 --13302 --
NM_183006chr2011500 ------
NM_183047chr202155 91 --1752 --
NM_183048chr202155 91 --1752 --
NM_183234chr153467 437 404 --1293 --
NM_183235chr153467 437 404 --1293 --
NM_183236chr153467 437 404 --1293 --
NM_183238chr1253004 2845 1135 832 138 ------
NM_183323chr5183 ------
NM_183353chrX1903 --31094 465 193 --
NM_183373chr65761 387 231 219 81 1797 ----
NM_183380chr6----2316 196 --
NM_183416chr121854 1704 --11286 --
NM_183422chr132789 87 ------
NM_183425chr2091340 1193 661 274 195 173 136 58 28 --1233 --
NM_194247chr23871 122 21 14259 1203 12933
NM_194259chr161103 ------
NM_194260chr161103 ------
NM_194261chr161103 ------
NM_194282chr422705 1225 --12192 --
NM_194286chr1266135 1961 1879 1073 1014 740 --14961 15080
NM_194291chr862949 2416 2368 1140 655 522 32316 2243 66 12815 --
NM_194301chr142220 37 187 ----
NM_194314chr124168 1607 ------
NM_194317chr262667 2640 2568 686 537 176 --1859 --
NM_194328chr922599 2549 --22061 349 --
NM_194329chr922599 2549 --22061 349 --
NM_194330chr922599 2549 --22061 349 --
NM_194332chr922599 2549 --22061 349 --
NM_194356chr1262191 1739 1567 772 633 144 ------
NM_194463chrX2394 271 ------
NM_197939chr1751029 957 851 212 176 --11070 --
NM_197941chr562807 2591 2537 2524 1997 67 --42623 2410 941 639 --
NM_197955chr151105 ------
NM_197972chr1----125 --
NM_198040chr111056 ------
NM_198056chr321919 1573 ----177
NM_198066chr1452718 2516 2404 2034 47 140 11999 --
NM_198097chr7157 ------
NM_198098chr751758 1424 1244 737 109 ------
NM_198123chr8----1435 --
NM_198124chr8----1435 --
NM_198128chr18170 --11613 --
NM_198158chr322958 2267 12354 ----
NM_198159chr322958 2267 12354 ----
NM_198177chr322958 2267 12354 ----
NM_198178chr322958 2267 12354 ----
NM_198181chr1522424 92 ------
NM_198182chr221317 89 ------
NM_198215chr10----1205 --
NM_198217chr13--1760 ----
NM_198218chr13--1760 ----
NM_198219chr13--1760 ----
NM_198225chr1031931 1364 430 1414 11540 --
NM_198268chr143389 3276 3057 863 ------
NM_198269chr143389 3276 3057 863 ------
NM_198270chrX32143 1111 607 --12351 --
NM_198273chr532621 1274 33 ------
NM_198275chr11130 ------
NM_198324chr121354 ------
NM_198336chr751262 509 458 431 230 ------
NM_198391chr2021334 133 11144 ----
NM_198395chr51318 --21156 27 --
NM_198400chr1541874 1177 95 37 12332 ----
NM_198404chr131799 ------
NM_198463chr3175 ------
NM_198490chr372807 2680 2308 1387 449 275 202 ------
NM_198504chr32640 223 1149 ----
NM_198513chr8----1439 1685
NM_198569chr622670 1878 --1235 --
NM_198793chr344015 3775 3635 1461 ------
NM_198830chr172619 122 1627 ----
NM_198859chr31709 --34550 4477 170 --
NM_198896chr111616 ----11366
NM_198900chr12107069 6320 5845 5393 4926 4875 3068 1583 1145 683 --11050 --
NM_198904chr5----1277 --
NM_198935chr2053114 603 593 456 116 --11023 --
NM_198956chr72527 364 11453 --11532
NM_198993chr1721369 1121 --21611 252 --
NM_198995chr18----152 --
NM_199040chr1293778 3479 3463 1516 1049 623 544 237 201 ------
NM_199050chr2153396 3328 3287 3148 1433 1412 2856 617 --
NM_199078chr262416 2210 2021 357 213 107 ------
NM_199129chr205485 435 216 167 57 ------
NM_199132chr1931743 1434 729 2813 793 1604 --
NM_199138chr132313 198 ------
NM_199168chr101625 --31418 1312 1097 --
NM_199189chr51259 1845 ----
NM_199320chr4--12411 22040 103 --
NM_199320chr4--12411 22040 103 --
NM_199324chr433271 3140 3001 ------
NM_199421chr1444832 4520 3844 3456 --11180 21723 971
NM_199436chr22222 79 ------
NM_199437chr1132143 400 207 ----12605
NM_199438chr1132143 400 207 ----12605
NM_199439chr1132143 400 207 ----12605
NM_199454chr1113795 3405 1829 1296 1141 1045 997 855 727 334 101 11260 11150 150
NM_199478chrX1775 ----1271
NM_199482chr22586 359 --11547 --
NM_199511chr31597 1554 1852 --
NM_199512chr31597 1554 1852 --
NM_201266chr292880 2775 2524 2353 2316 2080 1922 792 280 194 1176 --
NM_201269chr11270 --170 --
NM_201279chr292880 2775 2524 2353 2316 2080 1922 792 280 194 1176 --
NM_201428chr1131513 1453 509 ------
NM_201429chr1131513 1453 509 ------
NM_201430chr1131439 1379 435 ------
NM_201432chr17106117 4876 4711 2215 1832 1146 915 551 321 103 --35971 4259 472 --
NM_201433chr17106117 4876 4711 2215 1832 1146 915 551 321 103 --35971 4259 472 --
NM_201434chr172219 93 --1304 1586
NM_201436chr72691 664 ------
NM_201516chr72747 720 ------
NM_201517chr72691 664 ------
NM_201567chr31316 1237 1276 --
NM_201570chr1022028 195 ------
NM_201571chr1022028 195 ------
NM_201572chr1022028 195 ------
NM_201590chr1022028 195 ------
NM_201591chr41525 11308 ----
NM_201592chr41525 11308 ----
NM_201593chr1022028 195 ------
NM_201595chr141133 ------
NM_201596chr1022028 195 ------
NM_201597chr1022028 195 ------
NM_201599chrX21202 1146 ------
NM_201629chr9153 ----1513
NM_201632chr541753 1563 599 563 1671 ----
NM_201634chr541852 1662 698 662 1770 ----
NM_203290chr6--1151 ----
NM_203307chr1941659 1621 1074 143 1132 11461 --
NM_203327chr2084001 2994 1818 1260 692 351 299 29 --33783 3381 825 --
NM_203339chr831298 1290 1096 ------
NM_203349chr152598 263 1462 ----
NM_203350chr1------1187
NM_203351chr1722408 736 --12441 --
NM_203372chr2129 ------
NM_203391chrX51742 1616 1361 245 118 1275 ----
NM_203394chr1242356 451 422 216 ------
NM_203399chr1--1845 ----
NM_203401chr1--1845 ----
NM_203446chr2122785 1904 ----11056
NM_203453chr941566 1463 528 77 --1189 --
NM_203458chr143218 3152 2521 909 ----21430 946
NM_203459chr132068 995 838 ------
NM_203464chr11489 11252 1928 --
NM_203487chr1321502 184 ----11170
NM_203504chr412239 ------
NM_203505chr412239 ------
NM_205768chr11796 1275 ----
NM_205833chrX3737 651 594 --165 --
NM_205842chr2--1787 ----
NM_205860chr132800 2673 2181 --2988 561 --
NM_205861chr11153 1270 --11669
NM_206594chr141350 1081 874 821 --33071 1407 1269 --
NM_206595chr141350 1081 874 821 --33071 1407 1269 --
NM_206852chr141182 ------
NM_206853chr623262 1311 ----13472
NM_206854chr664523 3439 1095 700 650 294 ----14733
NM_206855chr675488 4404 2060 1665 1615 1259 616 ----15698
NM_206857chr141182 ------
NM_206866chr2131279 676 488 12361 22874 587 13041
NM_206876chr252706 2686 173 110 87 ------
NM_206907chr51775 --154 --
NM_206909chr8137828 7300 6019 5920 5488 5396 5280 2569 2294 2212 1804 1636 1205 17003 1460 --
NM_206927chr112635 363 ----1786
NM_206928chr112635 363 ----1786
NM_206929chr112635 363 ----1786
NM_206930chr112635 363 ----1786
NM_206933chr152554 2188 1813 1056 96 22806 1843 11069 11898
NM_206944chr93304 161 21 1660 1292 --
NM_206945chr93304 161 21 1660 1292 --
NM_206946chr93304 161 21 1660 1292 --
NM_206947chr93304 161 21 1660 1292 --
NM_207015chr3----22126 641 1609
NM_207043chr121963 1447 12123 12236 --
NM_207044chr121963 1447 12123 12236 --
NM_207047chr121963 1447 12123 12236 --
NM_207113chr72596 137 --2382 38 --
NM_207123chr41363 ------
NM_207303chr1043963 3213 2962 193 ------
NM_207304chr132896 539 11789 22500 1634 --
NM_207313chr174985 863 811 429 ------
NM_207332chr81111 ------
NM_207346chr171304 ------
NM_207362chr22542 46 --1179 --
NM_207390chr191719 166 ----
NM_207404chr372241 2211 2009 1948 1940 1513 208 ------
NM_207406chr476532 5249 5105 2602 1771 127 103 14814 --16300
NM_207409chr6294 39 ------
NM_207412chr821127 277 ----11260
NM_207520chr25776 717 594 313 139 ------
NM_207521chr25776 717 594 313 139 ------
NM_207577chr111443 188 12101 11935
NM_207645chr111376 ------
NM_212460chr711499 ------
NM_212464chr1551836 1637 1590 1333 228 --31663 284 272 --
NM_212467chr1562413 2214 2167 1910 460 97 11039 12240 168
NM_212471chr1741742 1665 404 97 11857 ----
NM_212472chr1741742 1665 404 97 11857 ----
NM_212551chr11118 ------
NM_212554chr10123 --1126 --
NM_213589chr265140 4954 4177 3590 1803 1242 24124 46 ----
NM_213606chr1031939 480 50 ----1829
NM_213648chr541753 1563 599 563 1671 ----