TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4474-5p
miRNA Sequence: UUAGUCUCAUGAUCAGACACA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr52364 55 ------
NM_000052chrX1279 22960 931 ----
NM_000081chr1----11515 --
NM_000084chrX55946 1700 990 653 504 --24239 2127 --
NM_000089chr71644 ------
NM_000090chr21647 ------
NM_000092chr2104014 3732 3523 2902 928 874 541 457 312 66 --1791 --
NM_000112chr555538 5173 4693 789 456 --24005 2122 --
NM_000125chr663984 3785 3555 3230 1373 640 21519 213 13079 --
NM_000138chr1532344 840 341 ----21971 976
NM_000141chr1021390 1080 ------
NM_000167chrX11764 ------
NM_000176chr573794 3393 3246 2642 2584 2463 1074 1901 ----
NM_000189chr222069 23 ----12039
NM_000217chr1274988 3697 1611 1591 671 586 416 ----14755
NM_000252chrX11216 21262 83 ----
NM_000277chr12--1290 ----
NM_000282chr131224 ------
NM_000319chr1211126 ------
NM_000321chr1311679 ------
NM_000332chr696660 6605 6148 5618 4965 4605 1912 1609 55 36765 2222 71 1163 --
NM_000393chr242038 695 561 91 ------
NM_000424chr12154 ------
NM_000430chr1743728 2296 801 494 --22823 617 12886
NM_000461chr333918 3731 1519 13533 21202 1014 --
NM_000462chr15--11184 ----
NM_000503chr8--11786 --21194 382
NM_000509chr42204 21 ------
NM_000534chr22189 22 ------
NM_000555chrX55717 5131 2475 2230 765 25227 4900 15307 --
NM_000597chr2--1316 ----
NM_000610chr1162675 2128 1936 1158 1070 783 23059 3045 ----
NM_000618chr1276080 5015 4585 4542 1686 1460 1155 ------
NM_000618chr1276080 5015 4585 4542 1686 1460 1155 ------
NM_000633chr1864733 1906 919 661 578 466 13538 14717 --
NM_000684chr101881 ------
NM_000685chr31742 ------
NM_000685chr31742 ------
NM_000686chrX41408 1307 458 49 1594 ----
NM_000726chr211318 ------
NM_000794chr53699 94 52 ------
NM_000800chr531642 1259 548 --11502 --
NM_000809chr456948 6822 6703 3617 322 36654 3341 1082 37877 6464 5667 --
NM_000813chr595473 2100 1239 873 654 566 546 501 30 --11215 --
NM_000817chr21858 1845 ----
NM_000826chr41733 11930 ----
NM_000827chr522210 484 ----12391
NM_000861chr362667 2546 2506 2021 476 194 11840 ----
NM_000864chr13890 338 87 1815 1368 --
NM_000868chrX32614 2496 170 --1665 1210
NM_000877chr263075 2415 2336 407 272 141 ----1731
NM_000895chr12129 ------
NM_000902chr352847 1281 1145 722 651 --1881 --
NM_000908chr5137 1785 ----
NM_000933chr2031729 1315 126 ----1538
NM_000958chr5----11337 --
NM_000959chr153883 1181 1086 951 681 13058 --12948
NM_001001389chr1162675 2128 1936 1158 1070 783 23059 3045 ----
NM_001001390chr1162675 2128 1936 1158 1070 783 23059 3045 ----
NM_001001391chr1162675 2128 1936 1158 1070 783 23059 3045 ----
NM_001001392chr1162721 2174 1982 1204 1116 829 23105 3091 ----
NM_001001395chr1222399 285 12378 ----
NM_001001556chr1531150 590 257 ----1612
NM_001001664chr233590 1177 289 33751 1584 189 1455 --
NM_001001668chr1974109 3559 1180 1075 739 604 392 52732 2620 940 883 368 13860 --
NM_001001877chrY175 1211 ----
NM_001001928chr2295901 5579 3272 2156 1940 1852 858 822 236 48301 7831 5235 1181 17477 18226
NM_001002243chr21635 ------
NM_001002258chr231802 670 182 21981 479 ----
NM_001002295chr101855 ------
NM_001003407chr1084176 4169 3927 3563 3268 3175 1924 1383 11043 14160 11311
NM_001003408chr1084176 4169 3927 3563 3268 3175 1924 1383 11043 14160 11311
NM_001003652chr1898442 8237 7801 7756 7397 7262 3055 2655 1418 28162 6490 ----
NM_001003674chr18156697 6580 6440 6238 5773 5677 2753 2658 2548 2367 2300 2232 1194 825 340 35171 856 176 34761 2162 1903 --
NM_001003675chr18156697 6580 6440 6238 5773 5677 2753 2658 2548 2367 2300 2232 1194 825 340 35171 856 176 34761 2162 1903 --
NM_001003688chr42785 334 ------
NM_001003712chr1243383 3242 2995 1416 11183 13235 --
NM_001003794chr392311 2184 1241 987 699 621 518 355 173 --1837 --
NM_001003810chr41785 ------
NM_001004317chr654410 4278 3819 3325 309 11533 ----
NM_001004419chr1233063 423 321 13175 21831 1395 1298
NM_001005335chr19--1217 ----
NM_001005404chr1784015 3785 3092 3032 1635 1165 1010 785 11513 14281 --
NM_001005473chr546073 1840 1095 480 24786 2159 --26263 1376
NM_001005476chr21522 ------
NM_001005502chr1275170 4606 3762 3623 1555 1463 581 13359 14948 --
NM_001005746chr211318 ------
NM_001005747chr211318 ------
NM_001005849chr17153 ------
NM_001007024chr1743190 1473 753 381 22864 126 --23783 2888
NM_001007025chr1743190 1473 753 381 22864 126 --23783 2888
NM_001007226chr1711242 --21201 123 11470
NM_001007227chr1711242 --21201 123 11470
NM_001007228chr1711242 --21201 123 11470
NM_001007229chr1711242 --21201 123 11470
NM_001007230chr1711242 --21201 123 11470
NM_001007246chr2131645 770 109 1556 --11455
NM_001008225chr7----1287 --
NM_001008401chr1911471 ------
NM_001008712chr8164 ------
NM_001008726chr1431048 639 396 11341 ----
NM_001008738chr552826 1990 751 615 80 11141 ----
NM_001008895chr1331402 259 82 1945 ----
NM_001009554chr484358 3541 825 635 556 258 164 98 1900 ----
NM_001009554chr484358 3541 825 635 556 258 164 98 1900 ----
NM_001009899chr356031 5664 1896 1003 668 --32110 1463 39 14297
NM_001009960chr762459 2253 1907 1853 447 412 ------
NM_001010853chr643232 2769 2744 387 12131 ----
NM_001010862chrX62818 2734 1110 1092 993 34 2516 287 --11024
NM_001010895chr921407 405 ------
NM_001010908chr101677 ------
NM_001010922chr194060 3999 3534 3359 2713 2631 1114 859 236 12826 1619 126
NM_001010923chr611752 1442 ----
NM_001010935chr12108 33 2750 672 ----
NM_001010984chr112212 11691 ----
NM_001011513chr463496 1496 1315 795 703 263 13078 ----
NM_001011553chr7------1162
NM_001011666chr756497 5084 1320 1097 117 35559 1375 1199 ----
NM_001012393chr1164558 3640 3607 3197 1900 642 --24663 3169 --
NM_001012456chr7136 ------
NM_001012732chr421223 1167 ------
NM_001012751chr1031886 1446 1187 1366 154 --
NM_001012761chr552457 2372 2309 1891 1837 ------
NM_001014283chr1362055 1664 1447 219 56 27 ------
NM_001014449chr162234 214 ------
NM_001014451chr162234 214 ------
NM_001014764chr17--1171 ----
NM_001014797chr10127615 7123 6441 6263 5687 5317 5212 3278 2897 2612 1313 961 48242 6838 1993 639 18113 --
NM_001015045chr441994 840 778 228 --11806 1307
NM_001015072chr7124 ------
NM_001015887chr321625 1423 21299 1138 11249 21144 349
NM_001017440chr7158044 6098 5777 3074 2683 2585 2285 2265 2211 1395 950 944 455 421 99 37407 7189 6131 33284 2408 1751 --
NM_001017523chr1261869 1594 1272 608 438 367 ------
NM_001017926chr8--1535 ----
NM_001018057chr111254 ------
NM_001018064chr921645 811 ----1642
NM_001018065chr986074 5600 5096 4985 3992 2109 2068 23 14758 44485 4130 4085 1278 155
NM_001018066chr986074 5600 5096 4985 3992 2109 2068 23 14758 44485 4130 4085 1278 155
NM_001018067chr134896 4615 105 1135 1253 25341 1756
NM_001018068chr134896 4615 105 1135 1253 25341 1756
NM_001018069chr134896 4615 105 1135 1253 25341 1756
NM_001018072chr1261869 1594 1272 608 438 367 ------
NM_001018074chr573794 3393 3246 2642 2584 2463 1074 1901 ----
NM_001018075chr573794 3393 3246 2642 2584 2463 1074 1901 ----
NM_001018076chr573794 3393 3246 2642 2584 2463 1074 1901 ----
NM_001018077chr573794 3393 3246 2642 2584 2463 1074 1901 ----
NM_001018111chr763551 3446 1348 310 267 86 13427 --1940
NM_001020658chr111243 --1655 --
NM_001020658chr111243 --1655 --
NM_001024094chr573794 3393 3246 2642 2584 2463 1074 1901 ----
NM_001024688chr831524 782 641 31480 482 292 ----
NM_001024956chr1154976 2148 1879 606 582 24247 395 21579 325 --
NM_001025068chr341296 555 402 284 140 ----
NM_001025069chr341296 555 402 284 140 ----
NM_001025077chr1077110 6473 6416 2371 1976 1814 1291 36176 4601 1633 --14839
NM_001025108chr284060 3591 3460 3189 1592 748 255 103 ------
NM_001025201chr2--1120 ----
NM_001025580chrX64081 3991 1675 1463 977 811 --1734 --
NM_001025595chr43642 431 292 ------
NM_001025780chr931542 456 264 ------
NM_001029858chr642783 2384 2195 459 12655 11327 12928
NM_001030002chr171376 ------
NM_001030055chr1444570 3347 1383 492 13436 ----
NM_001031684chr221524 410 ----11018
NM_001031690chr763111 2947 2539 568 531 342 --13004 22428 706
NM_001031715chr151131 ------
NM_001031732chr423660 2240 --12883 --
NM_001031746chr101275 1560 ----
NM_001031804chr1632781 1651 657 ----11327
NM_001032279chr111419 ------
NM_001032293chr17------136
NM_001032394chr642521 1896 1073 658 1682 22694 776 --
NM_001032395chr642388 1763 940 525 1549 22561 643 --
NM_001032999chr2085377 4447 4002 2115 776 494 339 62 --25109 1497 --
NM_001033045chr263565 3327 3235 3107 1235 527 24239 1692 --11395
NM_001033087chr2022744 2000 --1763 --
NM_001033503chr53392 122 51 ------
NM_001033557chr23965 537 305 1166 21035 234 --
NM_001034954chr1042717 2482 2002 490 11110 124 --
NM_001034955chr1042717 2482 2002 490 11110 124 --
NM_001034956chr1042717 2482 2002 490 11110 124 --
NM_001034957chr1042717 2482 2002 490 11110 124 --
NM_001035chr12810 298 1197 --1190
NM_001035003chr441153 1121 496 305 --11251 --
NM_001035004chr441153 1121 496 305 --11251 --
NM_001035235chr54591 583 455 89 --1528 --
NM_001035260chr1021604 563 1468 --1139
NM_001037163chr71271 130 ----
NM_001037331chr182884 103 ------
NM_001037637chr5--1238 ----
NM_001037663chr2145 ------
NM_001037954chr1153442 3426 2923 2719 726 12397 23380 1164 --
NM_001039538chr232378 1140 315 ------
NM_001039585chr154140 1438 1343 1208 938 13315 --13205
NM_001039590chrX63920 3348 2453 965 301 33 23990 3017 ----
NM_001039591chrX63920 3348 2453 965 301 33 23990 3017 ----
NM_001039618chr1195517 4665 4470 4232 3618 1874 1087 970 890 15229 ----
NM_001039709chr2085377 4447 4002 2115 776 494 339 62 --25109 1497 --
NM_001039762chr10--11873 --12350
NM_001039840chrX65304 5223 4537 1005 369 187 45692 5462 3805 787 ----
NM_001040001chr63744 446 190 --1618 --
NM_001040151chr1173256 3153 1208 1042 910 672 45 21319 589 11268 11512
NM_001040152chr743128 1881 1237 702 14883 24653 2000 14516
NM_001040157chr472740 2190 624 595 401 379 342 --12582 12351
NM_001040181chr321178 251 11101 ----
NM_001040182chr321178 251 11101 ----
NM_001040183chr321178 251 11101 ----
NM_001040199chr321178 251 11101 ----
NM_001040200chr321178 251 11101 ----
NM_001040402chr412120 --1313 --
NM_001040441chr1125278 4819 4723 4632 3828 2106 1847 1676 1426 955 669 657 1569 ----
NM_001040446chr532455 178 41 ------
NM_001040665chr774710 4550 4152 4040 3580 1581 122 24298 396 11818 --
NM_001040709chr162218 2179 2142 1731 1654 852 --22062 346 22368 1031
NM_001040712chr953301 2390 2372 2284 2269 13411 22627 125 --
NM_001042388chr181328 1976 ----
NM_001042413chr973414 2746 2540 2499 885 216 78 1982 ----
NM_001042453chrX--167 ----
NM_001042533chr332686 577 548 ------
NM_001042543chr42419 184 11463 ----
NM_001042555chr1243764 3639 2928 1394 1103 23895 1590 --
NM_001042599chr266994 6014 5658 2439 2055 1212 21836 182 36514 1399 1265 1829
NM_001042601chr353278 3184 2374 2232 1205 --12863 --
NM_001042604chr353282 3165 1594 920 169 22946 293 14082 --
NM_001043318chr1493959 3648 1474 1347 1308 1213 739 570 373 ----14027
NM_001044305chr611675 11384 ----
NM_001046chr542857 1104 865 173 ------
NM_001071775chr1311235 11751 ----
NM_001079874chr12397 159 21329 187 ----
NM_001083620chr41732 11928 ----
NM_001099678chr3105218 4913 4516 4133 3922 3884 2527 1886 513 191 ------
NM_001100108chr1108312 7230 7046 6524 6227 5679 5589 5485 689 346 --23139 1894 --
NM_001106chr3138389 8355 8276 6838 6407 6281 6144 6000 5982 3273 2754 811 439 27953 6474 1723 --
NM_001113490chrX2265 26 1214 ----
NM_001117chr182960 504 11809 ----
NM_001126chr11994 ----1164
NM_001128144chr22189 22 ------
NM_001135chr152837 341 ------
NM_001153chr24358 271 228 140 ------
NM_001156chr101524 ------
NM_001167chrX126281 6056 5923 5689 5392 4781 4752 4554 4196 2671 1349 467 26736 235 25611 387 --
NM_001173chr1444570 3347 1383 492 13436 ----
NM_001201chr493158 3136 3034 2497 2478 1557 1401 482 117 23482 153 --13494
NM_001204chr277722 7451 7363 5842 5095 4896 1156 35749 4745 2383 17140 11291
NM_001206chr943177 2681 2542 369 ----1567
NM_001207chr5--1238 ----
NM_001233chr732270 373 26 11758 ----
NM_001257chr1621527 1178 --1407 --
NM_001259chr745099 2536 1782 455 25357 5077 14417 --
NM_001274chr11175 ------
NM_001304chr1763736 2720 2358 614 595 86 13573 ----
NM_001310chr1222715 969 13048 ----
NM_001331chr1172635 2536 2528 790 461 278 92 12852 12715 --
NM_001332chr521427 1048 21489 522 ----
NM_001349chr21221 ------
NM_001364chr1144031 3088 1608 77 63928 3419 1659 800 786 600 --13837
NM_001396chr21--12050 11742 1100
NM_001402chr641950 1709 1250 104 ----11958
NM_001412chrX43592 2575 811 423 33517 120 80 ----
NM_001419chr1954108 3985 3240 357 321 34508 3977 1073 --11552
NM_001423chr1222002 1730 ------
NM_001427chr72558 84 --1223 --
NM_001432chr441372 1205 868 164 1933 --13277
NM_001438chr152670 2641 1049 138 113 --22445 1242 --
NM_001465chr521590 204 ------
NM_001483chr71866 ------
NM_001498chr631212 1156 381 ------
NM_001514chr11492 ------
NM_001518chr71952 ------
NM_001527chr634636 4491 902 1574 13328 11103
NM_001533chr19--1217 ----
NM_001543chr5104450 3933 3741 3732 1776 1635 1556 1160 438 289 2748 24 1851 --
NM_001546chr621376 1161 ------
NM_001616chr253160 1141 554 161 36 --12825 1204
NM_001650chr1831650 708 504 13965 23081 2538 1643
NM_001663chr1442686 1997 1819 458 1937 ----
NM_001664chr31109 ------
NM_001679chr31779 ----1712
NM_001689chr231802 670 182 21981 479 ----
NM_001709chr1131116 1050 22 ------
NM_001742chr71405 --1554 --
NM_001788chr7------1162
NM_001806chr1912922 1675 1122 --
NM_001822chr2--1120 ----
NM_001850chr3137 ------
NM_001858chr654747 4234 3460 2026 1497 33679 1613 325 ----
NM_001874chr1275170 4606 3762 3623 1555 1463 581 13359 14948 --
NM_001918chr1129308 9256 8702 8165 6369 5947 3266 2624 2534 1800 1524 473 28029 282 27036 3386 26147 5761
NM_001921chr421223 1167 ------
NM_001941chr1853930 1342 1162 660 471 23636 431 11116 13140
NM_001946chr123435 267 172 1400 ----
NM_001950chr163717 674 39 ------
NM_001957chr451684 1425 602 271 156 11959 --1400
NM_001959chr2145 ------
NM_001981chr11114 12377 ----
NM_001987chr1274218 3897 3345 2673 1556 671 227 14009 11093 --
NM_002009chr1542427 1977 1717 41 ------
NM_002025chrX117839 7634 6872 6543 6392 6292 5942 3608 3176 3101 2755 17065 --12644
NM_002035chr1863497 3404 3312 3170 2536 26 13787 --1348
NM_002040chr213783 676 21 1271 ----
NM_002044chr1531150 590 257 ----1612
NM_002051chr101855 ------
NM_002069chr75560 507 402 119 69 --11210 --
NM_002092chr484568 4472 3560 3517 2026 1900 1361 814 14854 11258 --
NM_002126chr1723248 858 1291 11402 33903 3732 2976
NM_002130chr51407 11494 ----
NM_002137chr712183 ----11537
NM_002138chr41785 ------
NM_002147chr171629 ------
NM_002154chr52402 31 ------
NM_002158chr233208 2817 1292 ------
NM_002160chr9--1403 ----
NM_002214chr753569 3505 2259 558 61 22108 139 1219 11776
NM_002222chr32885 282 1248 ----
NM_002227chr1133 ------
NM_002232chr121343 1074 ------
NM_002241chr182783 2645 2507 2476 2328 915 380 335 ------
NM_002264chr334537 551 41 23726 2017 --1393
NM_002270chr545213 4982 1808 951 --156 --
NM_002285chr284060 3591 3460 3189 1592 748 255 103 ------
NM_002310chr564940 2527 2061 1496 796 497 25111 287 ----
NM_002312chr131867 ------
NM_002313chr1084176 4169 3927 3563 3268 3175 1924 1383 11043 14160 11311
NM_002336chr1234758 4204 3553 14749 23844 1952 13492
NM_002349chr241547 1342 1232 207 11096 --1536
NM_002356chr6------12728
NM_002374chr232378 1140 315 ------
NM_002395chr611105 21049 103 ----
NM_002469chr12176 ------
NM_002481chr175911 2474 2225 1247 1088 1072 870 15410 26946 5606 --
NM_002485chr831524 782 641 31480 482 292 ----
NM_002545chr1164558 3640 3607 3197 1900 642 --24663 3169 --
NM_002556chr1141900 801 589 377 ------
NM_002577chr333424 1219 284 23443 714 31373 1155 1095 13069
NM_002581chr994350 3960 2067 1701 1244 1193 770 638 529 --11176 13567
NM_002594chr2032481 1853 521 1540 ----
NM_002595chr121583 ------
NM_002642chr1142 ------
NM_002643chr21158 ------
NM_002646chr161760 781 648 455 232 74 ----31346 1340 195
NM_002655chr855182 4875 4531 1804 661 ------
NM_002662chr362130 1888 1552 698 611 443 --11947 --
NM_002667chr611054 2143 137 ----
NM_002670chr331523 1453 1173 21495 287 21373 92 --
NM_002703chr421621 135 --11207 --
NM_002715chr51994 1843 1288 --
NM_002718chr372632 2136 2098 2027 910 499 177 ------
NM_002719chr1441593 707 691 261 --22179 155 --
NM_002721chr91340 ------
NM_002734chr1742162 457 396 220 ------
NM_002737chr1795814 2469 2363 1980 1834 1595 1519 1463 288 --24813 811 --
NM_002745chr2274522 4471 3632 1597 1183 435 382 ------
NM_002752chr51221 ------
NM_002767chr171389 ------
NM_002814chrX1206 ------
NM_002815chr172242 76 ------
NM_002819chr191102 ------
NM_002827chr20----1708 --
NM_002835chr73724 639 295 ----196
NM_002839chr953301 2390 2372 2284 2269 13411 22627 125 --
NM_002843chr1153225 3044 2840 2320 333 42626 2366 1360 1104 ----
NM_002848chr1221061 463 ------
NM_002852chr31566 ----1107
NM_002858chr1--11369 ----
NM_002865chr81189 ------
NM_002884chr12108 33 2750 672 ----
NM_002886chr364062 3965 3806 3538 699 88 45071 4427 4269 2040 ----
NM_002906chr1112142 2840 282 1572 12229
NM_002977chr252820 2746 2657 2461 624 ----13443
NM_003010chr1732098 1925 520 ------
NM_003022chrX21270 114 --1797 --
NM_003034chr12157653 6715 6064 5866 5178 5056 2928 2288 2207 1937 1563 1508 810 683 429 17756 --14946
NM_003043chr394100 3196 2741 2664 1215 941 855 481 349 23676 3186 21091 673 --
NM_003045chr1374515 4501 4452 4003 3891 1819 373 11107 13511 --
NM_003051chr131504 505 271 ------
NM_003071chr321269 446 ----11650
NM_003108chr2117037 6676 6320 6174 5432 4793 2350 1910 1665 1201 726 ------
NM_003118chr562093 1981 1911 793 553 495 11404 1489 --
NM_003137chr631840 1545 1489 2241 233 11515 --
NM_003161chr1713155 ----12636
NM_003175chr1----171 --
NM_003182chr71394 ------
NM_003182chr71394 ------
NM_003199chr1833953 3879 3718 15233 15311 1292
NM_003206chr61156 ------
NM_003211chr1241694 1539 1478 1087 ------
NM_003262chr345270 5154 5014 482 1336 --24620 4032
NM_003292chr1136 --12092 --
NM_003298chr385542 4972 4554 3847 2488 1232 1117 165 24041 1596 1309 --
NM_003320chr1184418 4345 4223 3864 3721 3638 1681 1341 ------
NM_003339chr5--1509 1379 1268
NM_003350chr81887 --1748 1699
NM_003387chr262670 1175 1066 722 339 203 --22918 1186 --
NM_003392chr324323 1294 --13569 --
NM_003410chrX21985 455 12169 11038 --
NM_003411chrY2716 478 21726 1170 ----
NM_003457chr17------136
NM_003463chr633192 1290 344 --12483 --
NM_003468chr254285 4265 3817 1261 1198 ----11673
NM_003472chr631216 1031 393 ------
NM_003563chr1711242 --21201 123 11470
NM_003574chr1875293 5254 5126 3699 3582 2199 2155 --1803 --
NM_003583chr1263876 2563 1507 1002 874 539 23075 2776 11539 --
NM_003589chr1331402 259 82 1945 ----
NM_003590chr243777 2823 2801 651 12516 ----
NM_003607chr153527 3324 1553 333 304 1221 ----
NM_003615chr323712 1009 11253 1159 --
NM_003628chr21522 ------
NM_003632chr17------1345
NM_003633chr552607 1007 577 454 66 21778 1689 ----
NM_003645chr15----1182 --
NM_003653chr171229 ----1105
NM_003663chr342860 1252 963 372 1644 1348 --
NM_003672chr13355 216 155 ------
NM_003679chr153456 2908 2833 954 504 23283 374 ----
NM_003692chr92375 281 1860 ----
NM_003716chr31155 1795 ----
NM_003743chr22174 77 12089 ----
NM_003750chr101625 ------
NM_003766chr171585 ------
NM_003783chr11225 1370 ----
NM_003795chr6--1521 ----
NM_003872chr293046 2757 2649 2552 2037 1865 1176 762 60 --11009 --
NM_003873chr1011820 ------
NM_003913chr664195 3057 2753 915 225 206 145 11513 --
NM_003934chr9--2936 136 ----
NM_003939chr1073401 3385 3292 2967 2668 148 124 14184 ----
NM_003941chr742429 2366 1770 653 12205 --1297
NM_003948chr462588 2481 1905 681 321 91 22487 2294 12135 --
NM_003952chr11--1218 ----
NM_003953chr162770 2049 2025 1005 682 291 1405 ----
NM_003966chr566918 6734 1833 682 607 80 ----11603
NM_004028chr1831650 708 504 13965 23081 2538 1643
NM_004034chr101524 ------
NM_004035chr1774893 4886 1983 1891 1339 478 278 11432 1825 1156
NM_004037chr11890 ------
NM_004061chr5140 ------
NM_004079chr172566 1915 883 784 413 334 321 --1359 --
NM_004087chr31314 11859 ----
NM_004094chr1473035 2551 2514 1192 1161 681 333 ------
NM_004133chr811639 12064 22233 450 12669
NM_004161chr23485 273 134 11013 ----
NM_004162chr32413 105 ------
NM_004170chr91131 ------
NM_004171chr11147940 7760 7402 6654 6635 3651 2719 2615 1749 1509 909 447 370 134 39404 9190 7041 32361 2076 871 17512
NM_004232chr18149 13066 13600 --
NM_004238chr21131 ------
NM_004272chr521927 370 ------
NM_004274chr1432969 1116 995 --22346 1140 --
NM_004293chr963868 3131 2632 2574 1244 870 33489 445 395 12670 --
NM_004311chr1042354 1999 830 299 12798 2886 590 --
NM_004316chr1211082 ------
NM_004326chr12447 42 ------
NM_004331chr851894 915 801 335 288 ------
NM_004338chr18156697 6580 6440 6238 5773 5677 2753 2658 2548 2367 2300 2232 1194 825 340 35171 856 176 34761 2162 1903 --
NM_004342chr732365 753 249 --1927 --
NM_004349chr82840 368 ------
NM_004393chr33856 200 191 1456 12017 --
NM_004412chr1055733 5365 4973 4895 1244 1531 --13801
NM_004440chr631982 406 36 --129 --
NM_004458chrX31735 917 549 ------
NM_004464chr413717 32901 1440 326 1299 13053
NM_004529chr921186 1085 ------
NM_004539chr182347 32 ------
NM_004586chrX74695 4580 4112 3752 3533 1753 1661 33820 1179 735 14557 --
NM_004598chr532905 672 278 ------
NM_004612chr932950 2936 1820 23269 1017 ----
NM_004660chrY31599 839 70 ------
NM_004663chr1521361 57 ------
NM_004694chr171696 ------
NM_004703chr1751947 1715 1675 149 117 1859 --11808
NM_004717chr741512 1132 554 214 1540 --11119
NM_004725chr1031082 933 436 ------
NM_004726chrX85212 4721 3667 2195 2039 1854 1745 526 --1895 --
NM_004734chr1373033 2395 2191 1134 158 150 58 --181 --
NM_004735chr251061 1023 701 196 150 ------
NM_004748chr1574249 3566 2774 2704 1498 1131 1114 13009 --1669
NM_004775chr1812060 12421 1147 --
NM_004798chr2052306 1276 1051 938 914 12987 32842 2708 58 --
NM_004799chr1--187 ----
NM_004808chr1093356 3175 3084 2797 2117 984 891 308 230 1325 12599 --
NM_004815chr153732 3295 1607 1176 1099 14947 ----
NM_004835chr31742 ------
NM_004835chr31742 ------
NM_004841chr11284 ------
NM_004849chr631617 1316 585 ------
NM_004859chr1732072 535 470 ------
NM_004863chr14124928 4836 4700 4450 4310 4041 3675 3482 1748 1558 1302 991 --12106 --
NM_004866chr594634 4370 4278 4001 3261 1926 1417 959 443 23710 1113 ----
NM_004867chrX144 ------
NM_004871chr1743190 1473 753 381 22864 126 --23783 2888
NM_004887chr5145 169 ----
NM_004896chr1021519 478 1383 --154
NM_004898chr412163 11886 ----
NM_004904chr756497 5084 1320 1097 117 35559 1375 1199 ----
NM_004905chr12694 165 ------
NM_004929chr821479 1436 11524 ----
NM_004948chr1871425 1371 926 914 350 144 60 --21278 1172 --
NM_004949chr1851470 723 665 543 60 11709 ----
NM_004956chr754267 3554 3353 3036 3024 24338 2835 1421 12986
NM_004960chr162249 114 ----1321
NM_004966chr101631 ----1758
NM_004972chr951068 1020 952 806 74 ----1841
NM_004976chr11124895 4702 4413 4080 3684 3664 1558 1276 866 771 325 49 1257 11015 --
NM_004985chr1263321 1506 1251 948 863 120 13985 11110 --
NM_005036chr2295901 5579 3272 2156 1940 1852 858 822 236 48301 7831 5235 1181 17477 18226
NM_005044chrX84198 4122 3689 1200 970 835 655 150 --11656 --
NM_005056chr1273443 2122 1689 1436 612 129 45 ----23548 1862
NM_005065chr1431807 1781 1222 44935 4436 3260 825 11377 --
NM_005093chr2085377 4447 4002 2115 776 494 339 62 --25109 1497 --
NM_005109chr342471 1799 926 34 ----12301
NM_005121chr1742974 2684 1490 1475 23142 1428 ----
NM_005124chr65740 422 405 247 203 ------
NM_005133chr111419 ------
NM_005134chr181328 1976 ----
NM_005156chr934801 3942 654 34684 3252 66 22036 1820 14115
NM_005168chr241308 1131 567 111 ----11442
NM_005188chr1188066 8055 7379 6201 5294 5118 2508 2355 36426 2523 416 12268 --
NM_005197chr1496051 5524 4398 4349 4109 2348 1406 209 60 11081 15307 --
NM_005203chr101109 ------
NM_005222chr71662 ------
NM_005235chr266994 6014 5658 2439 2055 1212 21836 182 36514 1399 1265 1829
NM_005277chr421620 671 --1472 --
NM_005281chr11403 --1367 --
NM_005310chr171376 ------
NM_005324chr1711933 ----22141 1768
NM_005338chr794019 3713 3621 3525 3102 2899 2846 2737 992 --13816 13037
NM_005339chr473914 3892 3053 1183 990 584 306 11377 --1140
NM_005358chr131139 --11715 --
NM_005359chr1854956 1463 1129 223 46 36173 5284 5024 15409 --
NM_005387chr111170 --1534 --
NM_005397chr763551 3446 1348 310 267 86 13427 --1940
NM_005399chr184211 4111 3371 3215 1510 1076 381 104 11113 181 11489
NM_005400chr2--12855 22134 470 22092 1128
NM_005406chr183486 352 199 21622 205 ----
NM_005436chr1022735 34 ----13405
NM_005497chr17145792 5737 5699 5640 5397 5317 5169 4905 4739 4453 4401 1384 424 139 --11746 22053 541
NM_005504chr12106354 6324 5553 5537 4509 4472 2202 1491 1178 63 1663 14072 --
NM_005509chr51185 --11271 11288
NM_005524chr31273 ------
NM_005578chr3105142 5062 4931 4680 4496 3132 1997 1432 246 147 1646 ----
NM_005593chr121131 ------
NM_005596chr986208 5828 5477 5284 4842 4535 522 184 15330 14118 --
NM_005607chr8--1820 ----
NM_005627chr61372 ------
NM_005657chr15145 ------
NM_005667chr21450 ------
NM_005668chr554168 3125 2911 1135 791 23096 451 ----
NM_005669chr531821 662 70 31911 1717 1449 ----
NM_005694chr3--152 ----
NM_005711chr511071 ------
NM_005725chr13858 432 395 2906 731 22374 1947 --
NM_005746chr71762 ----12179
NM_005748chr1263252 3089 2358 1294 678 58 13029 ----
NM_005759chr233213 835 53 53874 1202 1181 302 296 1724 --
NM_005760chr2--125 ----
NM_005795chr2----12194 --
NM_005813chr2--21949 1632 --11783
NM_005822chr63740 561 112 11517 --1762
NM_005828chr1764930 4653 4288 4231 3477 3133 1502 23505 1562 --
NM_005840chrX97512 6546 6402 2989 1870 1796 1479 1345 1236 1611 35965 1280 1103 16743
NM_005853chr161544 ------
NM_005859chr51414 ------
NM_005900chr42785 334 ------
NM_005901chr1898442 8237 7801 7756 7397 7262 3055 2655 1418 28162 6490 ----
NM_005902chr1553325 3080 1678 1650 796 13306 --12815
NM_005920chr173832 3742 3563 2727 1439 1374 707 23259 456 ----
NM_005933chr1142383 2348 988 326 --11177 1788
NM_005941chr874036 3025 2752 1179 631 603 55 --12623 --
NM_005966chr211806 2923 857 ----
NM_005968chr191177 ------
NM_005986chr1382739 2677 2659 2429 2397 703 249 22 1227 1535 --
NM_005994chr17------1700
NM_006011chr1594251 4228 3767 3738 1178 951 505 264 99 11381 --11368
NM_006015chr111179 ------
NM_006016chr61602 1487 ----
NM_006033chr1862267 1836 1559 808 175 158 12343 1778 --
NM_006036chr231994 815 96 11588 ----
NM_006079chr6--1537 ----
NM_006080chr722499 263 --12172 11169
NM_006085chr11195 1392 11263 --
NM_006089chrX--1751 ----
NM_006094chr872102 1850 1686 1518 547 376 215 ------
NM_006106chr1122307 532 53046 2280 2093 1254 94 ----
NM_006108chr1132302 1942 301 --11502 --
NM_006113chr12397 159 21329 187 ----
NM_006136chr7----1499 --
NM_006143chr12------137
NM_006159chr12123 ------
NM_006180chr921645 811 ----1642
NM_006194chr141400 ------
NM_006203chr524626 2139 14800 --11872
NM_006226chr21538 1528 ----
NM_006241chr31879 32372 435 163 --21786 154
NM_006244chr111538 ------
NM_006252chr196927 5588 5513 5132 5077 5039 1969 1759 659 42611 1532 1267 447 ----
NM_006258chr1041501 400 311 89 1581 ----
NM_006265chr81526 ------
NM_006282chr20104151 3939 3354 1371 1067 848 830 508 468 266 11047 33584 1213 1106 --
NM_006283chr843786 3717 842 716 1802 14041 14106
NM_006298chr693413 3339 3223 2838 2461 2367 1287 782 335 --11327 --
NM_006306chrX75889 4864 4685 4164 3905 3841 1800 --25528 4176 --
NM_006308chr5--1119 ----
NM_006313chr1211401 ------
NM_006330chr831452 1270 1225 11313 ----
NM_006367chr111018 ------
NM_006380chr1733108 770 762 13851 --11083
NM_006386chr222676 162 1986 --1277
NM_006390chr1211673 --11178 --
NM_006393chr1064065 3770 3141 3046 1302 919 11766 --14444
NM_006401chr91320 ------
NM_006434chr1042717 2482 2002 490 11110 124 --
NM_006457chr463496 1496 1315 795 703 263 13078 ----
NM_006460chr1741629 1511 1307 36 --11695 --
NM_006471chr18157 ------
NM_006482chr1263876 2563 1507 1002 874 539 23075 2776 11539 --
NM_006520chrX1175 11153 ----
NM_006529chr42410 175 11454 ----
NM_006538chr243912 3700 3129 713 13513 2489 159 --
NM_006540chr811564 1432 ----
NM_006546chr1766168 5012 4966 4106 2312 1113 1584 11935 --
NM_006559chr12920 455 11156 ----
NM_006572chr1753005 2236 1087 1063 275 13448 ----
NM_006599chr1645232 5219 3306 1577 27786 6412 12793 12806
NM_006624chr1031917 1810 289 ------
NM_006629chr1841965 515 424 150 ----12616
NM_006646chr1353041 2880 2303 1182 1082 1377 ----
NM_006654chr1243764 3639 2928 1394 1103 23895 1590 --
NM_006667chrX21086 1040 ------
NM_006704chr131106 ------
NM_006720chr1084176 4169 3927 3563 3268 3175 1924 1383 11043 14160 11311
NM_006725chr11------11040
NM_006729chrX75509 5484 5247 4971 4953 4794 4132 ----1483
NM_006766chr81502 ----1886
NM_006790chr52408 96 ------
NM_006800chrX1581 ------
NM_006807chr17--11110 ----
NM_006885chr1611235 177 --14110
NM_006908chr711216 2304 139 ----
NM_006910chr16172 ------
NM_006915chrX51677 887 639 521 378 ------
NM_006916chr21241 ------
NM_006918chr1154976 2148 1879 606 582 24247 395 21579 325 --
NM_006920chr262071 1634 1584 1352 721 269 1483 ----
NM_006924chr1774397 4377 3553 3312 2820 1525 243 24330 2736 --1724
NM_006937chr17153 ------
NM_006939chr14--11186 ----
NM_006940chr1221681 222 11613 ----
NM_006947chr42705 208 ----1417
NM_006948chr213967 352 63 ------
NM_006996chr121883 758 ------
NM_007007chr1233562 3170 755 13474 ----
NM_007011chr1595725 5652 5559 2144 1945 1589 1001 657 179 16925 --11817
NM_007042chr362177 2081 1770 1690 927 574 3272 86 76 ----
NM_007050chr20138110 7706 6727 5715 5185 3209 2463 1744 1500 442 367 127 37 15844 ----
NM_007068chr224933 879 841 132 ------
NM_007078chr1072705 2247 1862 815 233 185 72 --12758 --
NM_007114chr332767 2112 265 --12170 12797
NM_007122chr11506 ------
NM_007125chrY11236 --129 --
NM_007137chrX95373 5036 4660 4635 4393 3448 1959 1446 128 ------
NM_007144chr1731174 1167 1123 1201 ----
NM_007147chr1911033 ------
NM_007157chrX52485 941 931 141 127 171 ----
NM_007159chr331443 1080 305 21721 1114 ----
NM_007172chr2242653 2071 453 372 22618 136 11236 --
NM_007191chr121513 ------
NM_007207chr13619 189 166 ------
NM_007212chr141724 1650 185 128 ----127
NM_007222chr8--1535 ----
NM_007242chr162234 214 ------
NM_007246chr43318 287 161 ------
NM_007249chr1399209 9170 7763 7505 6454 3368 3132 1673 1191 23339 2625 26071 5990 --
NM_007269chr12388 27 ------
NM_007283chr392311 2184 1241 987 699 621 518 355 173 --1837 --
NM_007287chr352847 1281 1145 722 651 --1881 --
NM_007288chr352847 1281 1145 722 651 --1881 --
NM_007289chr352847 1281 1145 722 651 --1881 --
NM_007292chr1774893 4886 1983 1891 1339 478 278 11432 1825 1156
NM_007324chr1--187 ----
NM_007361chr141653 ------
NM_007373chr1051650 1552 460 453 41 ------
NM_009585chr31742 ------
NM_009585chr31742 ------
NM_012089chr121253 31 11579 21169 72 --
NM_012096chr353348 798 714 528 251 1981 13464 1100
NM_012104chr1173563 2620 1170 974 493 179 28 ------
NM_012104chr1173563 2620 1170 974 493 179 28 ------
NM_012120chr62622 396 ------
NM_012124chr113647 255 22 1691 --1775
NM_012129chr741629 894 607 529 ----11898
NM_012164chr956549 5915 5436 2888 2163 14666 17409 --
NM_012183chr11490 ------
NM_012193chr1195248 5053 3652 1770 1201 1008 912 854 226 --24061 3489 23298 1974
NM_012199chr154529 4224 4098 3330 481 ------
NM_012214chr276290 5143 4780 4020 1436 830 394 1724 35745 4702 1137 --
NM_012234chr332785 2383 748 ------
NM_012250chr1121131 213 ------
NM_012262chr133949 893 708 25175 296 ----
NM_012281chr721683 415 22029 96 ----
NM_012287chr333415 3007 449 34235 3240 2810 11369 --
NM_012301chr752124 1780 1402 888 450 --11917 --
NM_012307chr1821015 431 ------
NM_012316chr185194 5112 4969 4881 4789 3418 667 195 1311 45342 677 661 126 13972
NM_012329chr17--11219 ----
NM_012334chr594251 4013 3017 1902 1445 1422 1136 1031 375 --13725 --
NM_012388chr1562923 2708 2669 2269 1159 833 22392 68 ----
NM_012399chr2221915 1764 11680 ----
NM_012420chr1041941 1873 1844 895 12242 ----
NM_012425chr1042365 2154 725 178 ----12421
NM_012431chr783673 3628 3574 851 571 346 318 101 ------
NM_012448chr1752415 2118 2098 1695 863 ----12314
NM_012465chr1073160 2765 2397 2359 2244 979 253 22620 533 --1436
NM_012467chr16197 ------
NM_012471chrX31858 536 527 11531 11444 --
NM_012482chr11595 1201 ----
NM_012484chr5126 ------
NM_013227chr152837 341 ------
NM_013231chr1454199 3114 730 631 83 1394 1948 1876
NM_013243chr151207 ------
NM_013253chr111254 ------
NM_013255chr7128534 8413 8375 7694 7239 5744 3209 2418 1399 955 681 658 37870 1933 206 ----
NM_013261chr432686 2650 73 ------
NM_013262chr611250 ------
NM_013269chr1232990 350 248 13102 21758 1322 1225
NM_013316chr71427 ------
NM_013372chr1573256 2385 1235 1017 812 617 388 --11176 --
NM_013374chr353038 2899 2613 1097 185 12889 ----
NM_013381chr121459 ------
NM_013396chr211158 21102 532 ----
NM_013423chrX2461 355 ------
NM_013427chrX2461 355 ------
NM_013437chr8123 ------
NM_013446chr7----11225 --
NM_013449chr1242690 2455 1841 807 22029 232 ----
NM_013943chr152790 2570 2538 122 65 ----11155
NM_013995chrX32268 736 347 1306 ----
NM_013996chr71394 ------
NM_013996chr71394 ------
NM_013997chr71394 ------
NM_013997chr71394 ------
NM_013998chr71394 ------
NM_013998chr71394 ------
NM_014011chr242200 1980 474 215 --2906 848 --
NM_014028chr643124 2252 2121 965 13053 22976 2699 11033
NM_014034chr611403 ------
NM_014042chr11131 ------
NM_014048chr1653726 2078 1923 1385 1218 ----14702
NM_014106chr1552530 2181 1141 893 613 22692 373 1986 --
NM_014109chr82982 469 1111 ----
NM_014112chr845161 4304 3532 304 31433 1076 174 ----
NM_014141chr754863 4453 3408 1426 1400 24500 4360 --1160
NM_014153chr16--1654 ----
NM_014155chr1196738 6132 5152 2373 1685 1510 505 455 388 56409 4814 1739 1008 569 11231 17530
NM_014178chr14--1505 ----
NM_014181chr252022 1950 1800 686 89 1866 ----
NM_014230chr17130 ------
NM_014241chr10145 ------
NM_014283chr1--1252 1986 --
NM_014294chr8172 1201 ----
NM_014302chr7136 ------
NM_014331chr497430 4782 3082 2304 2241 1637 1522 1389 274 32038 1099 344 --12574
NM_014334chr9125 ------
NM_014345chr62894 74 11010 ----
NM_014350chr5193 ------
NM_014352chr1121501 1477 ------
NM_014372chr121691 327 ------
NM_014409chr13867 261 75 ------
NM_014415chr31421 ------
NM_014421chr431715 169 33 ------
NM_014423chr554640 1804 1698 1570 198 ------
NM_014435chr41176 ------
NM_014447chr43642 431 292 ------
NM_014488chr111489 ------
NM_014498chr31272 ------
NM_014585chr22397 35 1460 21149 238 --
NM_014618chr9--1347 ----
NM_014630chr1553284 2530 1165 876 818 --43927 3627 2559 1392 --
NM_014637chr821206 516 1126 ----
NM_014673chr81206 ------
NM_014676chr111243 --1655 --
NM_014679chr111280 --1367 --
NM_014690chr763111 2947 2539 568 531 342 --13004 22428 706
NM_014701chr1522673 624 ------
NM_014705chr742091 1411 730 532 22158 720 ----
NM_014721chr676932 6641 5614 5426 1554 1522 1041 26714 362 --26468 33
NM_014729chr821602 1517 ------
NM_014730chr1264366 1882 1366 1120 747 650 11252 24396 4239 23978 527
NM_014730chr1264366 1882 1366 1120 747 650 11252 24396 4239 23978 527
NM_014739chr653765 3633 2612 1434 169 --1414 --
NM_014755chr214040 14239 ----
NM_014758chr1162340 1000 925 630 325 94 --1647 --
NM_014761chr1611003 ----3215 201 59
NM_014765chr112605 ------
NM_014774chr173067 2835 2483 2387 1171 1039 398 ----11054
NM_014786chr1111221 ------
NM_014810chr153117 2970 700 313 124 1582 1188 --
NM_014819chr542343 2150 1756 378 21604 559 ----
NM_014826chr153527 3324 1553 333 304 1221 ----
NM_014835chr2071913 1850 1778 739 582 45 36 ------
NM_014841chr63957 880 56 ------
NM_014867chr842457 1181 453 359 --22631 2490 11022
NM_014868chr121110 ------
NM_014873chr174124 1766 1669 1014 913 624 296 --11336 14089
NM_014877chr1767509 4823 3028 2091 1409 576 --16038 --
NM_014883chr441994 840 778 228 --11806 1307
NM_014897chr1763282 3244 3112 901 187 166 13088 1786 22015 395
NM_014904chr1062997 2702 2597 1436 806 581 --2160 87 --
NM_014906chr1763761 3478 3134 1169 1098 1050 33807 1523 516 ----
NM_014923chr1342049 1809 367 161 1932 1111 --
NM_014932chr331898 1641 536 11495 ----
NM_014945chr571968 1776 1729 1562 1422 220 114 ------
NM_014949chr11123 ------
NM_014953chr1333350 2717 29 4859 821 739 316 1887 --
NM_014969chr131060 50 42 1420 ----
NM_014982chr1424090 592 14140 24111 495 --
NM_014988chr452313 2108 1100 894 874 1450 ----
NM_014989chr61556 ------
NM_014990chr14140 ------
NM_014997chr752882 2850 2701 2668 49 22118 459 12448 --
NM_015000chr1262385 2309 2049 1887 546 154 1384 ----
NM_015020chr1673519 2839 1125 1047 989 54 32 1747 1655 --
NM_015051chr952474 2171 1199 798 752 22918 2682 ----
NM_015068chr761603 1464 1113 972 733 89 13735 23505 852 13368
NM_015069chr161254 1515 --1181
NM_015071chr5136180 6098 5936 5333 4563 4384 3973 2182 1431 1401 1383 665 484 11203 --21293 966
NM_015072chr141410 1614 ----
NM_015074chr154859 4654 4057 4019 719 --24318 4074 1502
NM_015087chr1342575 1010 639 569 31040 550 88 1662 --
NM_015092chr1673153 1746 1692 1446 699 537 258 44285 1142 1109 531 11856 --
NM_015115chr412120 --1313 --
NM_015125chr19------1591
NM_015141chr352746 2447 1811 1705 740 ------
NM_015147chr292719 2169 2077 1302 1149 1107 657 508 363 12528 1576 1410
NM_015149chr172209 1703 1697 1632 567 340 320 11720 --1233
NM_015156chr1441404 1298 527 34 --23591 953 11209
NM_015192chr2032563 2086 232 12428 11169 --
NM_015199chr331880 891 552 1499 ----
NM_015200chr432239 2031 841 1497 1145 1217
NM_015206chr1563708 3193 2627 681 646 261 1307 12922 --
NM_015216chr541286 470 451 426 ------
NM_015225chr92366 302 13117 ----
NM_015230chr4128 1184 ----
NM_015236chr421528 244 ------
NM_015263chr1521229 880 --1278 --
NM_015267chr1222153 1740 1519 --1474
NM_015271chr423338 77 13793 11118 --
NM_015272chr1631878 1362 68 11718 ----
NM_015275chr121200 11421 ----
NM_015285chr1852590 1880 1679 798 611 ------
NM_015291chr173516 3173 2933 2767 1227 664 261 --12896 --
NM_015299chr1463852 3709 3628 2805 1439 522 22612 948 22633 295 1290
NM_015310chr877076 6235 2794 2498 2438 2314 847 12328 --25700 5551
NM_015323chr6--11682 ----
NM_015331chr11671 ------
NM_015336chr1222046 1743 ------
NM_015349chr632788 2444 1093 22807 787 13066 --
NM_015352chr2083753 3731 3639 3164 1042 464 348 332 --23141 2838 --
NM_015355chr1731732 1651 689 --11400 --
NM_015365chrX64081 3991 1675 1463 977 811 --1734 --
NM_015375chr194332 4294 3740 3220 2004 1912 961 869 735 14741 ----
NM_015384chr51166 ------
NM_015385chr1042717 2482 2002 490 11110 124 --
NM_015387chr241887 1823 821 215 1770 ----
NM_015439chr61481 ------
NM_015455chr533128 2513 251 23494 3241 --1536
NM_015460chr31556 11995 --11362
NM_015461chr182591 294 1278 1743 --
NM_015508chr351540 371 241 234 75 ------
NM_015526chr194546 233 210 87 1273 11049 --
NM_015531chr111113 ------
NM_015535chr273491 3230 3158 2873 2554 676 289 23292 1448 23789 581 --
NM_015550chr743415 2843 2505 1204 1572 1807 --
NM_015553chr643705 3193 1329 203 11428 14169 --
NM_015554chr1562404 2252 1848 1841 815 471 1512 ----
NM_015564chr572981 2911 2746 2529 528 434 123 ----161
NM_015565chr2131614 894 489 11879 11980 --
NM_015569chr184323 3979 3941 3010 1275 510 320 210 12985 11032 11264
NM_015570chr741711 405 183 95 ------
NM_015571chr622275 1998 11872 ----
NM_015640chr134896 4615 105 1135 1253 25341 1756
NM_015693chr4--1312 ----
NM_015879chr1895931 5920 5768 5444 2555 2284 1988 1307 316 78436 8339 5460 5409 2784 2568 2168 36085 5911 238 --
NM_015881chr111254 ------
NM_015886chr844304 1796 826 494 25591 2244 --22303 1935
NM_015888chr142601 2491 2316 2180 32874 2737 2422 --12801
NM_015906chr154792 1641 1226 394 362 ------
NM_015912chr842568 2045 164 122 1189 1333 1808
NM_015962chr1421436 1382 1156 21475 1111 1104
NM_015999chr12698 286 ------
NM_016009chr153720 3533 3398 944 735 --13572 1107
NM_016018chr811759 12289 12506 --
NM_016021chr642961 1872 163 90 12917 1196 --
NM_016039chr141129 ------
NM_016059chr61367 ------
NM_016072chr1262382 2075 2017 1928 1635 267 --22121 1670 --
NM_016075chr1352916 2253 1272 444 364 12608 ----
NM_016078chr1731057 1012 50 ------
NM_016087chr7--31745 1219 1169 ----
NM_016097chr185982 816 296 276 24 ------
NM_016103chr53392 122 51 ------
NM_016125chr171584 2532 153 ----
NM_016129chr41276 ------
NM_016132chr1543159 3122 2861 654 ----12136
NM_016147chr111388 ------
NM_016206chr3108915 7834 7002 6732 6581 5588 3264 3019 2661 2527 38964 7548 1446 28490 7521 1867
NM_016227chr1--1252 1986 --
NM_016230chr6--1389 ----
NM_016231chr1741546 1427 1202 344 ----1655
NM_016255chr642649 2184 2037 1101 138 11125 --
NM_016260chr2127323 6944 6400 5999 5693 4624 3065 2818 2153 1300 843 327 27312 6957 15905 --
NM_016271chr182565 557 ------
NM_016275chr342766 2608 1704 543 ------
NM_016277chr631180 1053 474 ------
NM_016302chr3--1777 1321 --
NM_016308chr121841 1712 21746 1638 21754 1527 --
NM_016311chr11101 ------
NM_016322chr932597 2024 532 12099 ----
NM_016376chr1763358 2834 1215 961 195 119 --13574 21488 1393
NM_016422chr1172325 2300 1250 1211 1122 905 303 1932 13005 --
NM_016467chr22442 300 ------
NM_016530chr1542877 2773 2642 1534 33579 1041 594 23167 21 --
NM_016542chrX--167 ----
NM_016608chrX1266 ------
NM_016946chr152721 2397 1114 737 702 --33241 2777 452 --
NM_016953chr2124658 3986 3781 2347 2256 1435 1245 893 651 618 451 275 46031 5796 2405 1468 1657 35845 1567 837
NM_017414chr22283 27 ------
NM_017415chr594454 4190 4091 4033 3837 3277 1687 1325 143 13000 1472 --
NM_017423chr431828 1605 198 11390 ----
NM_017440chr121223 ------
NM_017447chr2163969 2981 2747 1249 947 206 2745 317 12678 --
NM_017519chr6137 ------
NM_017563chr385870 4925 4607 4509 2226 1771 1716 1583 --34492 3926 839 --
NM_017577chr32503 119 11615 ----
NM_017596chr173858 3608 3238 3232 3190 3110 788 13631 1102 --
NM_017628chr434915 4352 1428 45082 4180 4020 1448 ----
NM_017629chr12363 211 --11884 --
NM_017633chr673701 3670 3040 1472 895 775 516 33856 3218 2394 1790 --
NM_017637chr988841 8427 7322 6558 5987 2998 2723 1813 39288 6748 6590 27078 1648 --
NM_017644chr375036 4650 4014 3606 1693 1332 876 --1946 --
NM_017645chr963151 2958 2889 627 529 207 ------
NM_017650chr744964 4014 1105 231 11574 24105 1281 --
NM_017657chr21635 ------
NM_017693chr1321588 205 ------
NM_017712chr19165929 5652 5602 5136 4831 4756 4463 4450 4310 1131 1023 985 937 931 396 124 14632 11899 --
NM_017741chr452109 1959 441 349 214 --21870 404 12247
NM_017752chrX51927 1896 624 487 435 11902 ----
NM_017769chr1453232 3101 664 586 547 33241 2199 163 ----
NM_017778chr811079 ------
NM_017810chr16--125 ----
NM_017813chr865477 4549 4009 1853 1109 140 11132 2220 85 --
NM_017824chr1042250 1678 545 88 ----12275
NM_017831chr18104676 4170 3717 3626 3566 3128 1599 717 577 199 23930 1258 11796 --
NM_017849chr282604 2258 1234 812 400 386 316 139 --1708 1667
NM_017864chr81212 ------
NM_017866chr81797 ------
NM_017902chr1095375 4989 3731 3725 1967 606 579 191 76 12123 12286 11137
NM_017919chr9135619 4992 4715 4617 1790 1580 1341 663 573 387 338 242 190 ------
NM_017922chr142591 517 ------
NM_017938chrX42176 531 228 127 --129 11660
NM_017952chr284370 4327 3923 3625 3291 3285 3168 1800 --23932 1746 --
NM_017994chr722483 1981 22972 2072 --133
NM_017996chr15122 ------
NM_018000chr262197 2140 858 820 766 344 ------
NM_018003chr1532257 1711 1576 1624 --1897
NM_018027chr1043111 2864 2841 464 22319 704 --22659 2584
NM_018078chr421055 900 ------
NM_018099chr12175 ------
NM_018112chr93225 152 98 ------
NM_018120chr81113 1563 1187 --
NM_018126chr41976 ------
NM_018133chr331903 753 628 ------
NM_018155chr342987 2756 934 46 ------
NM_018252chr12555 546 1644 --1193
NM_018263chr242428 2302 1683 497 1323 ----
NM_018296chr16--194 ----
NM_018300chr191420 ------
NM_018312chr1131974 1527 751 --11653 22148 635
NM_018313chr362363 1906 1793 758 637 429 ------
NM_018318chr121961 ------
NM_018362chr1134013 3303 1229 11252 --13905
NM_018364chr143908 1299 876 164 11079 12667 --
NM_018371chr81983 1558 1249 --
NM_018373chr14116163 4830 4747 4637 4136 4015 2540 1906 1455 1179 781 12268 1724 14810
NM_018374chr784645 4180 4071 4023 3590 3312 1213 857 13258 --23299 1369
NM_018400chr1173256 3153 1208 1042 910 672 45 21319 589 11268 11512
NM_018403chr353016 2926 2674 1437 123 ------
NM_018433chr2176 ------
NM_018445chr151528 ------
NM_018452chr6_random73636 2665 2589 1163 461 211 82 23294 1301 ----
NM_018472chrX1137 ------
NM_018489chr13944 816 495 11975 11777 11836
NM_018553chr1731680 1664 1174 --11582 --
NM_018566chr154584 4244 1464 392 285 33397 1323 160 ----
NM_018638chr1265658 4717 4079 2284 2110 2063 31048 404 163 24794 2165 --
NM_018640chr1222399 285 12378 ----
NM_018641chr7--1152 ----
NM_018693chr2----161 --
NM_018697chr762171 2004 715 664 424 130 21979 909 ----
NM_018703chr16172 ------
NM_018710chr821395 477 11240 1979 --
NM_018718chr711923 22341 2280 ----
NM_018834chr51244 ------
NM_018890chr711216 2304 139 ----
NM_018945chr643413 2462 652 278 43364 3229 1183 571 --12410
NM_018958chr1511574 --22786 797 12770
NM_018970chr742337 999 473 221 1459 --12745
NM_018999chr1033898 3817 1816 31683 1352 282 11255 --
NM_019001chr353282 3165 1594 920 169 22946 293 14082 --
NM_019006chr153648 560 194 ------
NM_019022chr1843023 2234 818 492 13130 12301 --
NM_019027chr442361 1777 357 174 ------
NM_019035chr441907 1866 1504 351 ------
NM_019049chr12249 38 1571 ----
NM_019063chr252048 1768 810 406 105 22307 229 ----
NM_019084chr1042503 1028 319 32 2370 138 --22446 176
NM_019098chr83541 479 183 11711 11157 --
NM_019116chr1613772 ----23094 31
NM_019593chr2042452 1105 778 552 12007 12994 --
NM_019842chr61396 ------
NM_019891chr131050 866 161 ------
NM_019895chr321178 251 11101 ----
NM_020122chr295993 5668 4965 4927 4874 3955 3668 1890 1833 15413 --15966
NM_020123chr1041437 1158 445 90 ------
NM_020205chr153517 3310 2172 918 707 --12153 132
NM_020242chr32445 323 ------
NM_020336chr2053882 3296 2969 1273 21 12727 ----
NM_020351chr3137 ------
NM_020381chr661994 1761 806 740 257 230 ----12040
NM_020444chr521131 281 1524 1427 11012
NM_020449chrX--1312 ----
NM_020455chr642521 1896 1073 658 1682 22694 776 --
NM_020642chr111589 ------
NM_020654chr3140 ------
NM_020655chr1611478 ------
NM_020666chr5155 1635 145 --
NM_020673chr2066569 5894 2978 1030 920 159 34809 1659 1208 46721 2697 388 224 --
NM_020704chr761882 1008 847 509 425 283 --12186 --
NM_020717chrX64952 4898 4860 4441 4056 3146 ------
NM_020724chr442583 2088 994 394 1587 --1288
NM_020732chr6137 ------
NM_020739chr1574249 3566 2774 2704 1498 1131 1114 13009 --1669
NM_020742chrX4881 826 609 472 ------
NM_020772chr1746087 1635 1519 1367 25677 3098 27640 230 17906
NM_020774chr1866068 3872 2057 1817 1362 662 12266 ----
NM_020776chr1893070 2985 2840 2801 2551 2434 1950 247 107 ------
NM_020781chr762225 2100 1208 664 582 348 1605 12251 --
NM_020783chr181240 21586 976 ----
NM_020809chr1142077 1790 325 211 12123 1159 --
NM_020825chr1663642 3297 2657 2480 1026 108 --1179 --
NM_020839chr31242 3566 269 191 21294 129 --
NM_020841chr1243383 3242 2995 1416 11183 13235 --
NM_020844chr887726 7652 6928 6828 5063 4858 1445 343 --22139 126 27708 841
NM_020850chr1663049 2904 1296 1264 527 88 --22132 441 12084
NM_020854chr18----1410 --
NM_020858chr154754 469 349 87 11980 ----
NM_020861chr62264 44 --1526 --
NM_020870chr432134 1954 442 12241 ----
NM_020872chr3--21386 694 11440 --
NM_020899chr1752454 2227 2148 949 116 ----22246 1969
NM_020917chr1973425 3342 3014 2845 2383 587 472 33124 3006 539 12555 13869
NM_020935chr284419 3632 3253 3204 2941 1642 935 774 ------
NM_020937chr142199 144 ------
NM_020960chr975033 4875 4096 3231 1833 997 441 ------
NM_020980chr151397 1675 ----
NM_021033chr1363227 2606 2523 1417 715 526 --1822 --
NM_021061chr864344 4189 3898 3649 3048 436 1462 33331 3055 182 14313
NM_021072chr532644 2104 279 12383 2578 50 --
NM_021121chr2145 ------
NM_021144chr9------1501
NM_021183chrX32014 1802 520 ------
NM_021205chr152802 2436 2215 660 26 21839 1810 ----
NM_021240chr9--1666 ----
NM_021252chr1042074 1604 1569 485 ------
NM_021570chr91421 ------
NM_021627chr32765 275 11008 ----
NM_021629chr373360 1985 1947 1906 1893 651 115 34968 4295 3557 1645 --
NM_021637chrX1303 ------
NM_021645chr1352196 1782 1673 1639 330 ------
NM_021647chr484358 3541 825 635 556 258 164 98 1900 ----
NM_021728chr141743 ------
NM_021911chr595473 2100 1239 873 654 566 546 501 30 --11215 --
NM_021914chr142425 181 --12025 22253 2106
NM_021940chr611675 11384 ----
NM_021961chr11116488 6455 5398 5310 5018 2934 2647 2630 1981 1468 1450 ------
NM_021964chr356640 6326 5475 1727 825 25905 47 2459 336 --
NM_021970chr42289 73 ------
NM_022048chr1574515 4019 1190 1110 430 85 36 16283 11545 --
NM_022097chr161972 ------
NM_022143chr73420 136 80 1378 --1561
NM_022340chr393590 3551 3354 2842 1377 1317 1044 951 285 12549 12745 --
NM_022343chr93546 522 431 ------
NM_022459chr1386393 6213 5677 5416 4736 2217 1738 1171 15527 --11245
NM_022461chr331106 322 89 ------
NM_022465chr1282976 2300 2209 887 671 641 536 419 --22341 2313 12099
NM_022497chr372955 2607 2569 1233 1006 104 52 23335 3037 23731 1570 --
NM_022652chr123435 267 172 1400 ----
NM_022731chr1126 ------
NM_022735chr14671 485 196 162 ------
NM_022763chr343081 2824 2426 509 ------
NM_022817chr23435 372 252 2657 282 --1779
NM_022828chr531161 660 412 1666 ----
NM_022841chr1552420 1896 1806 911 899 12056 ----
NM_022894chr221387 658 ------
NM_022898chr1463921 3367 1488 1353 934 310 14073 --14316
NM_022970chr1021390 1080 ------
NM_022977chrX31735 917 549 ------
NM_023074chr1931218 905 227 --11053 --
NM_023112chr1492658 1930 1904 1022 752 742 160 95 43 ------
NM_024007chr523100 870 ------
NM_024090chr451640 1616 1394 650 326 ----1306
NM_024345chr9106052 5522 5230 4945 1810 1772 1718 1408 910 840 25292 1110 26076 4301 --
NM_024423chr1864144 1556 1376 874 685 66 23850 645 11330 13354
NM_024430chr181137 ------
NM_024512chr383492 3259 3029 2937 1421 830 536 438 33522 2745 699 ----
NM_024529chr1135 --1319 --
NM_024545chr2121 ------
NM_024569chr162847 2126 2102 1082 759 368 2482 34 ----
NM_024607chr873787 3316 1758 1512 1220 1128 180 11538 14270 --
NM_024615chr5175 ------
NM_024636chr721899 260 1713 1267 --
NM_024638chr361725 468 355 326 262 169 1241 11614 --
NM_024639chr672033 2023 1975 1848 822 774 612 12846 11148 --
NM_024646chr1113833 3481 3316 3239 2910 2500 1353 1152 729 634 273 22669 802 ----
NM_024665chr334246 860 496 14526 --11034
NM_024670chr1081786 1693 1558 1223 1166 615 243 79 21130 188 ----
NM_024674chr142608 1199 1130 1093 --21084 994 13084
NM_024686chr1--1515 ----
NM_024761chr964644 4583 4243 3348 2004 1517 --1710 1355
NM_024770chr2106266 4893 2288 2186 2092 1015 875 616 533 53 --11550 1823
NM_024817chr1575606 5532 4597 4345 4042 677 520 12094 23865 3717 1819
NM_024837chr1531208 730 80 1494 --1629
NM_024920chr411020 ------
NM_024927chr17162 ------
NM_024947chr3109543 9090 8441 7691 7510 7117 7007 3651 2241 2201 22118 1690 26407 1271 --
NM_024949chr413656 162 12002 13548
NM_024989chr2107188 3166 2940 2779 2598 2500 1970 1826 1295 321 15205 22312 714 --
NM_024991chr1042717 2482 2002 490 11110 124 --
NM_025054chr841121 538 371 116 14063 13855 --
NM_025138chr1321500 239 ------
NM_025146chr322517 1970 12288 --1750
NM_025182chr91266 11065 ----
NM_025191chr161251 860 721 420 276 99 1676 ----
NM_025221chr441153 1121 496 305 --11251 --
NM_030623chr221155 52 ------
NM_030627chr532943 2863 638 1603 13567 --
NM_030648chr464734 4609 4569 3878 1606 86 33795 1158 312 15129 --
NM_030667chr1221061 463 ------
NM_030668chr1221061 463 ------
NM_030669chr1221061 463 ------
NM_030674chr1285582 4988 4932 4400 4154 3808 3638 1676 ----11421
NM_030751chr1021524 280 ----1743
NM_030751chr1021524 280 ----1743
NM_030790chr16------186
NM_030791chr1411887 ----11410
NM_030799chr552216 2010 1491 667 573 11501 ----
NM_030820chr62740 346 ------
NM_030881chr222676 162 1986 --1277
NM_030953chr521603 1163 11535 ----
NM_030962chr112618 438 11291 11528 --
NM_030965chr11572 ------
NM_031203chr191177 ------
NM_031243chr712183 ----11537
NM_031298chr17--1171 ----
NM_031369chr41785 ------
NM_031370chr41785 ------
NM_031372chr431653 537 486 ------
NM_031431chr131327 1211 ----
NM_031468chr7158044 6098 5777 3074 2683 2585 2285 2265 2211 1395 950 944 455 421 99 37407 7189 6131 33284 2408 1751 --
NM_031483chr2063571 3072 2962 1058 1049 224 ------
NM_031845chr232378 1140 315 ------
NM_031847chr232378 1140 315 ------
NM_031850chr31742 ------
NM_031850chr31742 ------
NM_031892chrX3349 127 47 192 ----
NM_031900chr51442 ------
NM_031922chr61578 ------
NM_031935chr13676 254 71 ------
NM_031990chr191102 ------
NM_031991chr191102 ------
NM_032012chr9114737 4524 4346 4306 3910 3456 1923 1890 1645 1607 1251 1618 ----
NM_032042chr532680 2554 1911 11069 1747 --
NM_032049chr31742 ------
NM_032049chr31742 ------
NM_032105chr196044 2607 2358 1380 1221 1205 1003 137 81 15543 27079 5739 --
NM_032121chrX52441 2373 1752 1136 1123 1803 ----
NM_032144chr211407 ------
NM_032160chr1861630 1254 1048 706 421 143 24308 904 11491 --
NM_032182chr1011036 ----1324
NM_032228chr113842 807 636 --12413 --
NM_032229chr131803 1356 ----
NM_032231chr152140 74 ------
NM_032233chr142878 261 ------
NM_032246chr151877 ------
NM_032256chr122269 216 ------
NM_032320chr111553 ------
NM_032373chr1065760 5058 4682 2013 1158 86 35183 4769 1019 --15045
NM_032439chr1031255 1227 309 ------
NM_032440chr1022855 748 22681 957 ----
NM_032445chr1562076 968 863 556 155 92 --22536 372 --
NM_032446chr553505 3306 859 796 149 13880 ----
NM_032505chr322301 516 ------
NM_032560chr1421035 359 ------
NM_032601chr2--1185 ----
NM_032778chr332686 577 548 ------
NM_032810chr10--11259 ----
NM_032826chr7125472 4586 3671 1670 1219 1015 923 788 608 600 222 140 2174 160 14259 --
NM_032859chr1342940 2733 875 593 ------
NM_032867chr113466 247 182 --1517 --
NM_032873chr1164389 4342 3023 1653 881 479 --1152 --
NM_032961chr411064 ------
NM_032999chr71952 ------
NM_033000chr71952 ------
NM_033001chr71952 ------
NM_033020chr154792 1641 1226 394 362 ------
NM_033028chr151808 ------
NM_033030chr2--11478 ----
NM_033127chr12252 193 1590 ----
NM_033132chr1311818 --1304 --
NM_033136chr541823 1440 1171 729 --11683 --
NM_033137chr541823 1440 1171 729 --11683 --
NM_033138chr732365 753 249 --1927 --
NM_033139chr732365 753 249 --1927 --
NM_033140chr732365 753 249 --1927 --
NM_033143chr414048 33232 1771 657 1630 13384
NM_033157chr732365 753 249 --1927 --
NM_033185chr17131 ------
NM_033224chr7137919 7675 7276 7256 5695 5399 5252 5131 5075 1977 1906 1058 872 22847 1936 ----
NM_033285chr884156 4022 3343 1743 1707 984 579 222 14358 23401 736 14140
NM_033290chrX62553 1488 744 235 149 64 ------
NM_033326chr11--1147 ----
NM_033360chr1263442 1627 1372 1069 984 241 14106 11231 --
NM_033389chr17113638 3258 1944 1867 1813 1757 1562 1362 1049 749 187 13109 --11476
NM_033402chr81551 ------
NM_033425chr1153442 3426 2923 2719 726 12397 23380 1164 --
NM_033430chr453630 3384 2833 1386 172 ------
NM_033437chr453630 3384 2833 1386 172 ------
NM_033505chr286609 6352 5244 5228 5190 4675 2545 745 24589 79 15380 11863
NM_033637chr1073401 3385 3292 2967 2668 148 124 14184 ----
NM_033656chr2195324 5243 4447 4439 4302 4114 3949 1565 1455 21843 1834 25827 3853 --
NM_052832chr842487 2143 1054 749 1488 22336 1891 --
NM_052834chr1852590 1880 1679 798 611 ------
NM_052879chr1231297 1191 291 21110 1071 --12728
NM_052905chr2--21567 209 ----
NM_052925chr191170 ------
NM_052937chr82653 445 12318 ----
NM_052958chr81255 1280 ----
NM_053002chr31896 ------
NM_053016chr9127149 6983 6806 6669 6308 5024 4851 2236 1904 1279 656 562 12454 --37466 6770 3170
NM_053023chr1163006 2922 2834 1147 845 489 1790 1927 --
NM_053042chr452844 2767 1048 280 90 12929 1758 --
NM_053064chr1422752 131 11122 1897 --
NM_057168chr7--31745 1219 1169 ----
NM_058170chr121159 1105 ----2316 285
NM_078629chrX1581 ------
NM_078630chrX1581 ------
NM_080546chr92469 334 21636 852 ----
NM_080666chr1431048 639 396 11341 ----
NM_080669chr1774443 4154 3842 3364 1653 1460 1268 --13293 14483
NM_080676chr2022744 2000 --1763 --
NM_080686chr6145 ------
NM_080743chr611004 ----22268 692
NM_080798chr101109 ------
NM_080799chr101109 ------
NM_080800chr101109 ------
NM_080801chr101109 ------
NM_080802chr101109 ------
NM_080803chr101109 ------
NM_080804chr101109 ------
NM_080805chr101109 ------
NM_080806chr101109 ------
NM_080807chr101109 ------
NM_080808chr101109 ------
NM_080809chr101109 ------
NM_080810chr101109 ------
NM_080811chr101109 ------
NM_080812chr101109 ------
NM_080813chr101109 ------
NM_080814chr101109 ------
NM_080815chr101109 ------
NM_080867chr1434599 3991 1752 24309 3175 ----
NM_080872chr863067 2836 2688 1060 330 124 11402 --1867
NM_080927chr323351 834 ------
NM_130391chr953301 2390 2372 2284 2269 13411 22627 125 --
NM_130392chr953301 2390 2372 2284 2269 13411 22627 125 --
NM_130393chr953301 2390 2372 2284 2269 13411 22627 125 --
NM_130434chr151918 ------
NM_130436chr21--12050 11742 1100
NM_130438chr2112084 12627 22319 422 1677
NM_130838chr15--11184 ----
NM_130839chr15--11184 ----
NM_133170chr20138110 7706 6727 5715 5185 3209 2463 1744 1500 442 367 127 37 15844 ----
NM_133265chrX2265 26 1214 ----
NM_133370chr423660 2240 --12883 --
NM_133372chr552826 1990 751 615 80 11141 ----
NM_133468chr752435 1989 1832 1825 514 ----12135
NM_133477chr483237 2245 2108 2002 1172 1104 931 743 13206 ----
NM_133494chr1--190 ----
NM_133496chr144572 4542 3225 1041 24140 4063 23529 3171 11372
NM_133638chr5195 ------
NM_133645chr6--1444 1457 --
NM_133646chr265454 5065 4929 4056 4018 3964 15429 --12148
NM_138286chr1953411 2676 996 898 226 24336 1611 12752 --
NM_138316chr102954 398 21176 935 ----
NM_138357chr102622 273 ------
NM_138426chr731989 991 262 --21857 234 --
NM_138444chr1334723 4295 3464 11162 ----
NM_138459chr673601 3190 1442 1329 1082 741 32 13361 ----
NM_138468chr2105912 4648 4507 3988 3897 2417 2363 1535 1401 1175 --14049 1602
NM_138473chr1275147 5110 4703 4439 3271 1577 1480 --13963 11529
NM_138494chr762459 2253 1907 1853 447 412 ------
NM_138576chr1463921 3367 1488 1353 934 310 14073 --14316
NM_138621chr243912 3700 3129 713 13513 2489 159 --
NM_138638chr142425 181 --12025 22253 2106
NM_138713chr1645232 5219 3306 1577 27786 6412 12793 12806
NM_138714chr1645232 5219 3306 1577 27786 6412 12793 12806
NM_138971chr1173563 2620 1170 974 493 179 28 ------
NM_138971chr1173563 2620 1170 974 493 179 28 ------
NM_138972chr1173563 2620 1170 974 493 179 28 ------
NM_138972chr1173563 2620 1170 974 493 179 28 ------
NM_138973chr1173563 2620 1170 974 493 179 28 ------
NM_138973chr1173563 2620 1170 974 493 179 28 ------
NM_139048chr33432 321 26 1370 --1813
NM_139070chr51221 ------
NM_139076chr4124 ------
NM_139126chr61861 1134 --129
NM_139131chr111170 --1534 --
NM_139135chr111179 ------
NM_139156chr11890 ------
NM_139168chr531511 358 339 1601 1728 --
NM_139182chr4128 1184 ----
NM_139207chr1251836 1595 1561 1542 102 11625 ----
NM_144498chr2071913 1850 1778 739 582 45 36 ------
NM_144571chr466921 6556 6501 5238 1706 1010 16437 ----
NM_144578chr1495340 5170 5147 4823 4247 3789 3650 1756 748 ------
NM_144590chr1072162 1042 845 804 633 499 306 11141 ----
NM_144599chr1575482 4903 1786 1447 720 396 378 21362 1158 11936 11922
NM_144609chr171193 ----11265
NM_144664chr1132518 2459 1633 12146 1837 --
NM_144728chr13619 189 166 ------
NM_144729chr13619 189 166 ------
NM_144778chr1322177 792 22036 676 1877 12531
NM_144949chr242200 1980 474 215 --2906 848 --
NM_144963chr82882 616 ------
NM_144979chr4--1485 ----
NM_144982chr12170 1626 1609 --
NM_145011chr102638 152 ------
NM_145176chr64959 569 505 305 13147 12643 --
NM_145244chr42333 23 ------
NM_145251chr1421161 1081 --11214 11634
NM_145259chr256311 6301 5133 1601 1350 36158 4584 982 25643 4805 24339 2031
NM_145266chr5166 ------
NM_145320chr743415 2843 2505 1204 1572 1807 --
NM_145321chr743415 2843 2505 1204 1572 1807 --
NM_145322chr743415 2843 2505 1204 1572 1807 --
NM_145647chr8170 ------
NM_147181chr441153 1121 496 305 --11251 --
NM_147182chr441153 1121 496 305 --11251 --
NM_147183chr441153 1121 496 305 --11251 --
NM_147223chr22357 260 12272 ----
NM_147233chr22174 77 12089 ----
NM_148894chr421242 894 11046 11108 --
NM_148957chr1352483 2052 994 766 314 32404 2039 385 ----
NM_148977chr102954 398 21176 935 ----
NM_148978chr102954 398 21176 935 ----
NM_152261chr1252339 2313 1930 1817 70 ------
NM_152352chr1842952 2875 2696 1131 12459 43086 2786 2061 902 1874
NM_152400chr422104 1724 ------
NM_152420chr9--1699 ----
NM_152440chr1221169 32 ------
NM_152455chr1542091 398 71 30 1878 12314 12528
NM_152510chr221803 ------
NM_152529chr263565 3327 3235 3107 1235 527 24239 1692 --11395
NM_152538chr321625 1423 21299 1138 11249 21144 349
NM_152570chr9--181 ----
NM_152574chr92306 146 ------
NM_152584chrY175 1211 ----
NM_152605chr1911359 11399 ----
NM_152608chr132270 2169 1681 --41654 1641 666 614 11802
NM_152629chr973414 2746 2540 2499 885 216 78 1982 ----
NM_152709chr101228 ------
NM_152724chr1042365 2154 725 178 ----12421
NM_152737chr631900 1405 1385 ------
NM_152748chr71143 ----128
NM_152754chr722849 1005 ------
NM_152758chr813006 2443 293 ----
NM_152787chrX22513 72 ----23712 3657
NM_152835chr131935 1835 516 ------
NM_152888chr83312 198 25 ------
NM_152902chr111824 --11639 --
NM_152903chr1342701 794 740 702 22790 2538 1757 12058
NM_152924chr1595725 5652 5559 2144 1945 1589 1001 657 179 16925 --11817
NM_152989chr1221681 222 11613 ----
NM_152999chr774710 4550 4152 4040 3580 1581 122 24298 396 11818 --
NM_153020chr6----11041 --
NM_153035chr163263 3209 2802 2624 1033 974 12585 2984 600 11091
NM_153038chr21280 ----1688
NM_153182chr332686 577 548 ------
NM_153184chr311553 --1579 --
NM_153188chr545213 4982 1808 951 --156 --
NM_153223chr521038 28 1580 ----
NM_153235chr672011 1913 802 716 701 108 23 --1659 --
NM_153262chr142385 2234 1113 1062 ------
NM_153341chr1188 ------
NM_153354chr5--1757 1867 1986
NM_153456chr1376235 5506 5159 5079 3975 3869 1222 14066 22223 165 --
NM_153490chr171242 ------
NM_153616chr154754 469 349 87 11980 ----
NM_153617chr154754 469 349 87 11980 ----
NM_153618chr154754 469 349 87 11980 ----
NM_153645chr2242653 2071 453 372 22618 136 11236 --
NM_153686chr432121 2057 1718 --12042 --
NM_153700chr15126 ------
NM_153705chr1182664 2426 2057 1745 1653 617 101 87 12135 21708 899 --
NM_153747chr1142 ------
NM_153757chr41478 1144 ----
NM_153831chr8--1820 ----
NM_170686chr762225 2100 1208 664 582 348 1605 12251 --
NM_170692chr11284 ------
NM_170719chr1321500 239 ------
NM_170731chr1131116 1050 22 ------
NM_170732chr1131116 1050 22 ------
NM_170733chr1131116 1050 22 ------
NM_170734chr1131116 1050 22 ------
NM_170735chr1131116 1050 22 ------
NM_170750chrX1352 ------
NM_172058chr8--11786 --21194 382
NM_172059chr8--11786 --21194 382
NM_172060chr8--11786 --21194 382
NM_172071chr176635 6325 5431 5309 5262 1900 1281 2529 242 12329 14725
NM_172127chr4----1286 --
NM_172240chr12--31358 205 176 --11018
NM_172337chr141743 ------
NM_172350chr121218 385 1367 ----
NM_172359chr121222 389 1371 ----
NM_172373chr1321157 245 165 ----
NM_173074chr21302 ------
NM_173078chrX1457 1395 ----
NM_173083chr141164 1125 836 142 ------
NM_173214chr1645232 5219 3306 1577 27786 6412 12793 12806
NM_173468chr465373 5088 4585 4271 4265 1039 11589 15182 --
NM_173469chr1541225 1190 323 309 31465 1414 29 ----
NM_173500chr1561033 1003 910 449 366 190 ------
NM_173511chr263502 3308 3292 2703 1186 131 ----21385 664
NM_173536chr441975 1793 1014 419 2375 177 14130 --
NM_173560chr6--1627 ----
NM_173582chr11146061 5418 5272 5170 4692 4367 4129 3855 1631 1505 1451 1445 1413 1280 1158 25177 1317 --
NM_173602chr1243721 2477 1506 591 12591 --23587 1307
NM_173642chr1178861 8429 8164 8089 7268 7051 6657 6555 6163 3461 2954 2917 2900 2862 2779 2433 589 26132 77 46811 6228 2618 2197 28126 232
NM_173670chr51391 ------
NM_173672chr631923 436 317 --41794 1660 631 178 1743
NM_173797chr51864 ------
NM_173808chr143602 3237 2735 484 14074 --14035
NM_173814chr15132 ------
NM_173822chr241799 549 476 432 ----1324
NM_173825chr373037 2998 2517 2461 2001 1909 225 1605 --12425
NM_173829chr595927 5845 5772 3978 3851 2489 2295 1843 1465 15351 22052 707 --
NM_174890chr102605 71 ------
NM_174934chr1163285 2918 2465 1377 1071 950 --3515 366 249 23161 2764
NM_175056chr33812 643 493 ------
NM_175061chr71360 ------
NM_175624chr1277168 6755 6129 5918 5759 5407 3036 56517 5648 2575 2009 1858 16798 --
NM_175625chr1277168 6755 6129 5918 5759 5407 3036 56517 5648 2575 2009 1858 16798 --
NM_175634chr82840 368 ------
NM_175635chr82840 368 ------
NM_175636chr82840 368 ------
NM_175748chr14------22006 632
NM_175847chr191102 ------
NM_175854chr1331953 569 203 ------
NM_175856chr51257 ------
NM_175863chr6137 ------
NM_176081chr1055733 5365 4973 4895 1244 1531 --13801
NM_176083chr1055733 5365 4973 4895 1244 1531 --13801
NM_177968chr242165 2074 2027 766 ------
NM_177972chr1184418 4345 4223 3864 3721 3638 1681 1341 ------
NM_177999chr953296 3095 2963 577 217 33680 2311 1441 43502 2316 763 282 --
NM_178010chr1221681 222 11613 ----
NM_178151chrX55717 5131 2475 2230 765 25227 4900 15307 --
NM_178152chrX55717 5131 2475 2230 765 25227 4900 15307 --
NM_178153chrX55717 5131 2475 2230 765 25227 4900 15307 --
NM_178190chr12282 115 ------
NM_178191chr131623 1456 1125 ------
NM_178313chr221910 425 22055 461 1285 --
NM_178483chr20--176 ----
NM_178539chr1232070 1933 1804 32085 679 493 1435 --
NM_178586chr1441593 707 691 261 --22179 155 --
NM_178812chr851486 1442 1027 368 53 --11522 --
NM_180989chr1332059 2044 1560 2860 158 ----
NM_181332chrX4881 826 609 472 ------
NM_181358chr143093 961 658 299 ------
NM_181359chr131737 1637 199 12064 ----
NM_181457chr251017 449 278 260 249 --11215 --
NM_181458chr251150 582 411 393 382 --11348 --
NM_181459chr25916 348 177 159 148 --11114 --
NM_181460chr25963 395 224 206 195 --11161 --
NM_181481chr18156697 6580 6440 6238 5773 5677 2753 2658 2548 2367 2300 2232 1194 825 340 35171 856 176 34761 2162 1903 --
NM_181482chr18156697 6580 6440 6238 5773 5677 2753 2658 2548 2367 2300 2232 1194 825 340 35171 856 176 34761 2162 1903 --
NM_181483chr18156697 6580 6440 6238 5773 5677 2753 2658 2548 2367 2300 2232 1194 825 340 35171 856 176 34761 2162 1903 --
NM_181552chr71708 ------
NM_181706chr1121803 1687 1151 ----
NM_181714chr61195 ----11895
NM_181723chr81461 21769 932 ----
NM_181838chr5--1509 1379 1268
NM_181897chr372632 2136 2098 2027 910 499 177 ------
NM_182503chr665362 4486 4340 4231 1746 769 160 11803 --
NM_182515chr19115910 5669 5071 4722 4525 4269 4231 4177 2016 1025 970 24844 682 15162 --
NM_182643chr872102 1850 1686 1518 547 376 215 ------
NM_182659chrY--1177 ----
NM_182701chr61368 1280 ----
NM_182734chr2052810 2333 479 79 67 12675 12035 --
NM_182797chr2031749 1335 146 ----1558
NM_182798chr5--1933 ----
NM_182799chr5--1933 ----
NM_182801chr5--1933 ----
NM_182830chr1432265 1394 264 1197 ----
NM_182898chr756497 5084 1320 1097 117 35559 1375 1199 ----
NM_182899chr756497 5084 1320 1097 117 35559 1375 1199 ----
NM_182901chr111589 ------
NM_182972chr142375 1845 953 728 12075 ----
NM_183050chr632186 2021 245 12365 1681 --
NM_183227chr631180 1053 474 ------
NM_183238chr1263816 3721 3334 3323 2988 2437 11128 32452 1417 700 --
NM_183393chr31155 1795 ----
NM_183394chr31155 1795 ----
NM_183397chr2073917 3696 1925 1887 1752 1250 798 15150 31980 955 471 11041
NM_183404chr20--128 ----
NM_194278chr1493959 3648 1474 1347 1308 1213 739 570 373 ----14027
NM_194282chr462813 2703 2217 1996 481 393 22279 677 11077 --
NM_194283chr542575 1331 1239 119 23452 1451 13875 --
NM_194285chr1183271 3199 2975 2883 2563 1317 1072 860 167 13162 --
NM_194286chr1295973 5725 5650 5180 4952 3964 2493 1917 1423 35388 4072 1793 11661 --
NM_194292chr12315 122 1637 ----
NM_194314chr175105 1910 1735 1324 999 620 227 ------
NM_194434chr1875293 5254 5126 3699 3582 2199 2155 --1803 --
NM_197970chr2--11478 ----
NM_198066chr1452170 2090 190 154 45 21112 590 12261 --
NM_198128chr182565 557 ------
NM_198149chr1--1440 ----
NM_198212chr722232 335 11720 ----
NM_198243chr15125 ------
NM_198268chr143093 961 658 299 ------
NM_198269chr143093 961 658 299 ------
NM_198273chr52974 101 1577 ----
NM_198320chr1275170 4606 3762 3623 1555 1463 581 13359 14948 --
NM_198399chr341296 555 402 284 140 ----
NM_198465chrX52941 2072 922 478 342 2494 109 --175
NM_198468chr653457 3396 3046 1805 739 --12845 1573
NM_198503chr111576 --22070 1606 1475
NM_198569chr642388 1763 940 525 1549 22561 643 --
NM_198570chr7--1335 ----
NM_198581chr276712 6343 6273 4720 4650 2616 1220 27424 7340 22116 197 --
NM_198715chr185901 5630 4129 4016 2482 1638 1521 1284 --26189 2341 12004
NM_198716chr11308 ------
NM_198717chr11308 ------
NM_198829chr711216 2304 139 ----
NM_198859chr384829 3813 3772 3402 1360 1285 1160 501 23838 392 15079 --
NM_199003chr811340 ------
NM_199188chr1231297 1191 291 21110 1071 --12728
NM_199189chr51244 ------
NM_199190chr1231297 1191 291 21110 1071 --12728
NM_199229chr231673 1511 241 --11451 --
NM_199320chr462556 1817 701 640 484 241 1132 1718 11144
NM_199320chr462556 1817 701 640 484 241 1132 1718 11144
NM_199324chr432865 1223 698 12581 11342 --
NM_199421chr1434599 3991 1752 24309 3175 ----
NM_199462chr194332 4294 3740 3220 2004 1912 961 869 735 14741 ----
NM_199482chr241887 1823 821 215 1770 ----
NM_201266chr293046 2757 2649 2552 2037 1865 1176 762 60 --11009 --
NM_201279chr293046 2757 2649 2552 2037 1865 1176 762 60 --11009 --
NM_201516chr71597 ------
NM_201591chr421620 671 --1472 --
NM_201592chr421620 671 --1472 --
NM_201613chr123784 592 186 1747 1741 1679
NM_203364chr111330 ------
NM_203382chr521515 334 ------
NM_203391chrX11764 ------
NM_203404chr11890 ------
NM_203406chr51282 ------
NM_203437chr21635 ------
NM_203458chr133580 1540 506 11259 23016 320 12497
NM_203459chr12335 234 11775 ----
NM_203463chr284975 4557 4257 3675 1743 1104 988 117 ------
NM_203494chr15133 ------
NM_205848chr162434 2390 1800 1794 538 153 31965 1037 1020 135 --
NM_206594chr152670 2641 1049 138 113 --22445 1242 --
NM_206595chr152670 2641 1049 138 113 --22445 1242 --
NM_206832chr171250 ------
NM_206854chr665337 4576 3586 1175 873 445 11261 ----
NM_206855chr686302 5541 4551 2140 1838 1410 984 334 12226 ----
NM_206909chr877076 6235 2794 2498 2438 2314 847 12328 --25700 5551
NM_206937chr131867 ------
NM_207005chr11506 ------
NM_207304chr1322064 679 21923 563 1764 12418
NM_207337chr124892 729 324 73 ------
NM_207406chr485260 4852 2128 2032 1374 1322 1270 1245 ----12382
NM_212471chr1742162 457 396 220 ------
NM_212472chr1742162 457 396 220 ------