TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4475
miRNA Sequence: CAAGGGACCAAGCAUUCAUUAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531333 178 24 ------
NM_000024chr52370 211 ------
NM_000037chr822517 757 11918 1831 --
NM_000038chr521582 427 1284 11282 --
NM_000051chr116973 791 770 684 439 355 ------
NM_000068chr1931510 1494 1178 ------
NM_000075chr12147 --2253 226 --
NM_000081chr111361 ------
NM_000084chrX206547 5858 5806 5444 5365 5228 4853 4443 4327 2491 2215 2115 1750 1633 1219 1046 827 632 537 178 26013 909 45940 5820 2097 125 --
NM_000088chr173997 367 146 --2970 318 --
NM_000089chr7151 ------
NM_000090chr22163 54 1938 ----
NM_000092chr284465 3411 3154 3072 1632 1403 703 104 --2594 117 1158
NM_000093chr952006 1958 1744 1706 951 --22140 2108 --
NM_000097chr32874 487 ------
NM_000109chrX42048 1962 526 49 22139 2029 ----
NM_000125chr6113679 3523 2603 1598 1504 1494 1287 1160 792 513 233 1438 ----
NM_000129chr631321 982 976 1326 ----
NM_000138chr1542448 1992 1763 902 ----11014
NM_000141chr1041094 992 497 308 --11314 --
NM_000151chr1721776 1214 ------
NM_000161chr1441960 1708 652 117 ------
NM_000163chr532372 2350 2004 11475 ----
NM_000165chr641143 1099 471 463 ------
NM_000167chrX31209 696 380 ----173
NM_000168chr7103218 3142 3037 2575 2373 2237 2063 1293 968 146 1446 13322 --
NM_000176chr533145 3084 345 22474 535 ----
NM_000192chr1261490 1389 531 388 320 308 --11507 1474
NM_000202chrX163972 3781 3544 3305 3253 2720 2675 2637 2534 2500 2453 2446 1525 1254 431 40 13242 12548 --
NM_000208chr19114009 3304 1876 1752 1296 1033 839 762 560 239 125 24260 1890 34545 3987 3516 --
NM_000210chr232347 1826 771 ------
NM_000212chr1792238 1965 984 900 840 653 543 379 57 --11746 --
NM_000217chr12105224 4968 4905 3785 3656 3451 1853 971 657 217 32065 1337 1104 11880 --
NM_000220chr113803 243 35 1351 ----
NM_000222chr442004 1756 1303 42 --1293 21373 430
NM_000227chr181415 ------
NM_000245chr742103 1966 822 508 ------
NM_000248chr342141 685 356 40 22214 98 12922 --
NM_000252chrX--11384 ----
NM_000259chr15106009 5963 5041 4885 1935 1869 1155 1014 977 693 12030 --13884
NM_000264chr963330 3136 2222 2074 1196 790 43363 3345 1218 841 ----
NM_000266chrX1204 ------
NM_000267chr1743442 727 387 70 --33319 3289 2442 --
NM_000276chrX82131 1812 841 793 597 449 322 238 2648 155 1408 --
NM_000284chrX21249 267 21715 1661 ----
NM_000286chr171304 2639 310 ----
NM_000288chr61261 ------
NM_000289chr122334 106 ------
NM_000291chrX2305 23 ------
NM_000297chr441949 1887 1631 417 --11824 --
NM_000310chr141237 985 168 71 11248 ----
NM_000314chr1032275 345 126 13257 12680 --
NM_000319chr122405 168 --2367 211 --
NM_000325chr41163 ------
NM_000332chr6116213 6170 5913 5560 5481 4889 2852 2838 2761 1163 457 26433 37 47048 2296 1688 427 --
NM_000333chr341048 906 404 180 ------
NM_000337chr5146517 6468 6257 5782 5277 5179 5115 4921 4295 4280 4262 837 776 412 ------
NM_000345chr42869 184 ----1793
NM_000346chr1761979 1967 1591 1374 1293 82 2613 146 ----
NM_000353chr164829 265 202 136 1444 ----
NM_000361chr2032059 447 395 ------
NM_000362chr22113424 2898 2887 1420 1255 1212 1102 679 402 52 35 ----13630
NM_000367chr631763 801 213 --12178 --
NM_000368chr994810 4363 4119 4091 2956 1907 931 288 266 --54098 710 454 313 133 --
NM_000369chr1421613 616 1483 ----
NM_000378chr113827 324 182 ------
NM_000379chr231445 1178 1071 --21170 352 --
NM_000386chr171561 1255 ----
NM_000390chrX53447 2523 2480 1354 1165 1149 ----
NM_000391chr1141666 1584 1147 276 ----161
NM_000394chr213101 93 83 ------
NM_000399chr104856 420 105 96 1198 ----
NM_000406chr452686 860 531 285 206 22692 2378 ----
NM_000408chr232376 2180 292 42821 2527 2096 308 ----
NM_000430chr1711177 --1100 --
NM_000435chr198865 815 806 748 275 263 106 58 2305 183 173 --
NM_000439chr572434 2274 1858 1562 1029 765 113 146 ----
NM_000441chr731744 583 21 --22353 2124 --
NM_000447chr11413 1106 ----
NM_000450chr14328 313 211 87 ------
NM_000451chrX1461 11805 ----
NM_000452chr1331686 1358 1308 ------
NM_000461chr394353 3619 3581 2967 1457 1371 1228 300 130 14282 11761 --
NM_000462chr1531391 474 168 1231 ----
NM_000476chr951379 1347 608 281 267 11497 ----
NM_000478chr12699 250 ------
NM_000484chr213433 217 202 ------
NM_000489chrX63217 3155 703 686 536 262 53048 3003 2481 1129 825 ----
NM_000493chr62384 197 1792 ----
NM_000500chr61429 144 ----
NM_000503chr831718 1382 1321 ------
NM_000522chr74431 412 159 153 ------
NM_000533chrX61903 757 474 442 220 161 ------
NM_000555chrX247548 6972 6325 5657 5624 5603 5575 5512 5240 4829 2944 2897 2891 2757 2747 2307 1962 1945 1617 1358 1000 950 342 232 46621 5869 2270 1529 25931 924 17292
NM_000572chr12723 688 1118 ----
NM_000578chr251546 1329 1307 543 102 11726 ----
NM_000587chr551193 983 196 155 96 11185 ----
NM_000610chr1162351 2261 2200 2181 745 380 12559 1604 --
NM_000612chr1183313 2573 2384 701 630 559 523 516 13781 ----
NM_000615chr1132904 1219 189 12463 1215 --
NM_000618chr1285959 5300 4788 4224 1823 499 289 49 46020 4307 1556 417 1763 14064
NM_000618chr1285959 5300 4788 4224 1823 499 289 49 46020 4307 1556 417 1763 14064
NM_000633chr1855228 3622 3199 1916 537 --12080 14451
NM_000668chr441389 1362 445 245 ------
NM_000684chr102499 431 11118 1199 --
NM_000686chrX21495 303 ------
NM_000687chr202531 38 2495 287 1676 --
NM_000693chr1541566 1431 486 254 ------
NM_000706chr123830 645 637 ------
NM_000719chr12205993 5929 5704 5619 5202 5116 4827 4427 4225 2629 2537 2380 2355 2344 2165 2138 1343 914 560 47 22176 998 11106 --
NM_000723chr1771638 1543 1284 1059 472 446 112 1310 11391 --
NM_000725chr122831 328 ------
NM_000743chr153405 293 35 11120 ----
NM_000756chr83441 404 357 ------
NM_000793chr1483651 3277 3213 1492 1455 1126 460 207 ------
NM_000795chr116934 906 895 757 378 312 ------
NM_000806chr521630 565 21548 118 ----
NM_000809chr4158563 8551 7741 7657 7142 6930 6831 6759 6334 5764 3655 3226 1638 755 581 58613 8029 6968 2528 2232 29031 9015 13325
NM_000813chr5155274 5077 4624 4329 3727 3519 1855 1847 1632 1089 1074 529 408 371 192 11697 45296 5011 4641 592 --
NM_000814chr1533400 3173 2797 11098 11362 --
NM_000816chr53647 589 172 ------
NM_000818chr103526 126 76 ------
NM_000824chr43385 275 56 ------
NM_000826chr421813 961 --1460 22405 119
NM_000827chr582498 2001 1919 1832 1022 424 288 183 11685 2773 177 --
NM_000829chr1121859 104 ------
NM_000831chr1126233 6072 5600 4424 4303 4100 4019 1764 1503 1065 725 706 15643 ----
NM_000833chr1631268 1124 231 ------
NM_000838chr672736 2612 2358 2008 1882 715 626 12189 ----
NM_000840chr71382 ------
NM_000844chr321069 804 ------
NM_000861chr382587 2345 2118 1898 1730 718 573 556 --11833 --
NM_000864chr131118 954 456 ------
NM_000866chr331344 569 249 --1472 --
NM_000868chrX92528 1715 785 621 302 290 282 270 262 ------
NM_000872chr102545 149 --41443 1139 1003 70 --
NM_000875chr15146679 6005 4895 4779 2411 2391 2178 1728 1722 1136 418 327 313 307 17027 1180 --
NM_000876chr621397 919 --1580 --
NM_000883chr74622 535 473 119 ------
NM_000883chr74622 535 473 119 ------
NM_000891chr17103515 3267 3258 2995 2844 1071 991 592 439 323 13338 1919 --
NM_000895chr12135 ------
NM_000898chrX4780 773 160 31 ----1192
NM_000899chr1273370 3092 1545 1309 815 606 420 12721 11679 11706
NM_000901chr441703 1002 249 243 12571 ----
NM_000917chr101718 --1875 --
NM_000919chr52518 54 ------
NM_000933chr2051688 1383 518 317 176 21704 90 ----
NM_000944chr422373 1812 ------
NM_000945chr271863 1560 1389 1314 821 544 525 11919 11496 --
NM_000948chr6137 ------
NM_000949chr52716 118 1781 ----
NM_000950chrX33029 2429 1167 23378 847 12302 --
NM_000961chr2053666 2689 2581 1359 954 33189 3121 1038 1441 1514
NM_000962chr972785 2302 2241 2063 927 775 415 32641 1046 971 11999 --
NM_000963chr121986 761 --1713 --
NM_000965chr331060 952 385 ------
NM_000966chr122998 931 ------
NM_000990chr1163762 3348 1428 645 462 45 11149 1950 22493 389
NM_001001132chr2131339 1332 938 --2928 264 --
NM_001001323chr1252867 2790 2653 818 766 1790 ----
NM_001001331chr342481 2290 1907 1844 ------
NM_001001342chr1011226 11427 31193 1059 1040 --
NM_001001344chrX42294 2058 2000 852 ------
NM_001001389chr1162351 2261 2200 2181 745 380 12559 1604 --
NM_001001390chr1162351 2261 2200 2181 745 380 12559 1604 --
NM_001001391chr1162351 2261 2200 2181 745 380 12559 1604 --
NM_001001392chr1162397 2307 2246 2227 791 426 12605 1650 --
NM_001001394chr22245 87 --154 --
NM_001001395chr1232659 768 756 ------
NM_001001419chr584791 4666 3875 3839 3732 1407 934 670 24602 4308 23497 1974 --
NM_001001420chr584791 4666 3875 3839 3732 1407 934 670 24602 4308 23497 1974 --
NM_001001433chr2042921 2557 2188 198 12739 23142 2857 1524
NM_001001481chr853086 2402 722 328 125 22931 2784 --11092
NM_001001484chr104872 845 358 117 21647 856 ----
NM_001001502chr54110 77 47 41 ------
NM_001001549chr752571 1904 1794 1013 781 ------
NM_001001550chr752571 1904 1794 1013 781 ------
NM_001001555chr752571 1904 1794 1013 781 ------
NM_001001556chr1521138 85 21571 411 ----
NM_001001557chr831677 759 520 1343 ----
NM_001001668chr1994149 4117 3328 3246 3184 3158 3146 2842 673 1317 ----
NM_001001787chr13194 186 74 ------
NM_001001790chr9------1388
NM_001001791chr102273 39 --11546 --
NM_001001890chr2194252 3475 2864 2826 2814 2796 2717 974 627 12879 ----
NM_001001938chr9113948 3717 3350 3340 3074 1562 1278 1129 1093 312 289 11643 13769 --
NM_001001974chr1021815 48 --11914 --
NM_001001995chrX21513 1445 ------
NM_001002032chr172277 68 ------
NM_001002033chr172168 84 ------
NM_001002233chr851998 1952 1938 1726 794 --11432 --
NM_001002243chr24935 298 49 36 ------
NM_001002259chr122127 110 ------
NM_001002265chr102265 132 2687 670 --189
NM_001002266chr102265 132 2687 670 --189
NM_001002294chr12311 304 ------
NM_001002295chr105972 822 446 246 41 --151 --
NM_001002296chr851083 365 357 97 71 ------
NM_001002838chrX21348 610 ------
NM_001002843chr151387 1848 ----
NM_001002860chr14104598 4278 3992 3450 2924 1678 1501 803 520 273 11882 14005 --
NM_001002909chr1771833 1718 1490 769 346 219 56 --11578 --
NM_001003406chr2273080 2765 2649 2559 1251 1057 697 2735 554 ----
NM_001003407chr10125083 4911 4758 4128 4072 3169 1736 1443 1336 1064 972 756 2722 307 ----
NM_001003408chr10125083 4911 4758 4128 4072 3169 1736 1443 1336 1064 972 756 2722 307 ----
NM_001003652chr18138316 7918 6830 6435 6415 6326 6287 6128 5334 1824 1617 1016 73 16220 38411 5837 868 --
NM_001003674chr18146559 6049 5911 5618 4719 4695 4687 2818 2507 2309 2025 1944 553 147 12561 14546 --
NM_001003675chr18146559 6049 5911 5618 4719 4695 4687 2818 2507 2309 2025 1944 553 147 12561 14546 --
NM_001003676chr1131041 263 147 --2756 162 --
NM_001003681chr2261910 1633 1571 526 337 77 ------
NM_001003698chr651956 1667 1551 582 542 21992 1703 ----
NM_001003699chr651956 1667 1551 582 542 21992 1703 ----
NM_001003712chr1221256 1122 13911 1787 1293
NM_001003800chr973284 3137 2682 1330 1247 801 396 1229 21045 820 --
NM_001003810chr43346 154 128 1586 ----
NM_001003937chr241493 1431 1100 688 ------
NM_001004065chr923614 1038 12901 ----
NM_001004127chr132370 126 1820 ----
NM_001004304chr1282285 2174 2092 2072 1976 683 553 244 1605 33225 2306 1104 --
NM_001004313chr17--11860 12050 --
NM_001004317chr633228 3028 910 22843 29 --23289 1736
NM_001004329chr125379 348 289 256 156 ------
NM_001004342chr1255758 5092 5076 5054 4565 4386 4201 3814 2146 1973 1874 1818 1751 1600 1483 1317 979 829 770 762 752 743 724 716 678 34559 786 646 ----
NM_001004356chr421544 1365 ------
NM_001004358chr421544 1365 ------
NM_001004360chr231744 1520 388 ------
NM_001004419chr1254026 3597 3453 1328 848 14590 34102 1507 1427 14212
NM_001004720chr22242 114 1960 ----
NM_001004722chr22411 283 11129 ----
NM_001005207chr171221 ------
NM_001005271chr1741168 1087 831 153 ------
NM_001005273chr1741168 1087 831 153 ------
NM_001005335chr19299 47 154 ----
NM_001005366chr121185 1396 ----
NM_001005368chr102142 26 ------
NM_001005375chrY11827 --11786 --
NM_001005386chr252163 1882 1555 851 821 150 11971 --
NM_001005404chr17114262 3752 3661 3319 3240 3220 1733 971 733 563 176 --1185 --
NM_001005463chr1032091 1840 653 1999 1841 --
NM_001005473chr5126498 6448 5642 5515 5212 5186 5000 2372 2303 2287 376 100 46349 5685 1765 759 ----
NM_001005474chr33539 433 185 ------
NM_001005505chr351798 1693 1476 1164 97 ------
NM_001005527chr33409 401 384 --11207 --
NM_001005611chrX2450 127 ------
NM_001005612chrX2318 185 1149 ----
NM_001005743chr141369 41107 1009 996 258 ----
NM_001005744chr141369 41107 1009 996 258 ----
NM_001005745chr141369 41107 1009 996 258 ----
NM_001005782chr23220 109 38 ------
NM_001005845chr831689 227 188 1368 ----
NM_001005849chr171563 1151 ----
NM_001006115chr362754 2154 698 409 314 111 12021 11114 --
NM_001006610chr162859 758 1383 ----
NM_001006612chrX4384 179 128 73 ------
NM_001006613chrX4384 179 128 73 ------
NM_001006614chrX4384 179 128 73 ------
NM_001006617chr961110 1093 911 473 392 334 --11303 --
NM_001006619chr961110 1093 911 473 392 334 --11303 --
NM_001006620chr961110 1093 911 473 392 334 --11303 --
NM_001006621chr961110 1093 911 473 392 334 --11303 --
NM_001006636chr21366 ------
NM_001006684chrX1124 1598 ----
NM_001007023chr1483651 3277 3213 1492 1455 1126 460 207 ------
NM_001007024chr1764102 3915 3739 3118 998 882 --13926 --
NM_001007025chr1764102 3915 3739 3118 998 882 --13926 --
NM_001007067chr8146 --1998 --
NM_001007068chr8146 --1998 --
NM_001007069chr8146 --1998 --
NM_001007070chr8146 --1998 --
NM_001007097chr994200 4098 4079 4024 3839 1162 614 324 267 11680 23205 1356 1691
NM_001007098chr11112 1193 ----
NM_001007099chr11761 1623 1746 --
NM_001007100chr11761 1623 1746 --
NM_001007102chr641466 1176 618 358 --11501 --
NM_001007156chr154644 327 222 86 ------
NM_001007226chr1761492 1421 1262 565 495 225 --41291 1157 1142 1010 --
NM_001007227chr1761492 1421 1262 565 495 225 --41291 1157 1142 1010 --
NM_001007228chr1761492 1421 1262 565 495 225 --41291 1157 1142 1010 --
NM_001007229chr1761492 1421 1262 565 495 225 --41291 1157 1142 1010 --
NM_001007230chr1761492 1421 1262 565 495 225 --41291 1157 1142 1010 --
NM_001007237chr14938 459 360 52 2405 385 ----
NM_001007246chr2131706 1196 172 11536 ----
NM_001007277chr114392 277 248 75 ------
NM_001007471chr92673 79 ----1637
NM_001007538chr1341566 1215 394 105 --124 --
NM_001007544chr13503 429 349 ------
NM_001007794chr1----1540 --
NM_001008220chr563821 3287 2531 705 651 168 --1637 --
NM_001008222chrX2536 297 --2237 100 --
NM_001008225chr73674 582 124 174 ----
NM_001008239chr1893717 2563 1389 929 701 504 462 301 36 13396 22352 620 --
NM_001008388chr44854 817 365 134 ------
NM_001008391chr112211 177 ------
NM_001008392chr3143573 3365 3333 3030 3000 2709 2218 1349 1336 1281 992 949 383 303 ------
NM_001008407chr741582 1473 1409 136 ------
NM_001008408chr7124823 4733 4132 3913 2428 2079 1519 1088 830 639 223 99 ------
NM_001008495chr831738 1513 825 31520 870 514 --12223
NM_001008539chr884275 4054 3653 1279 1023 952 731 713 24423 3397 25301 4207 --
NM_001008541chr1072272 2009 1939 1799 1775 1681 327 2535 68 ----
NM_001008541chr1072272 2009 1939 1799 1775 1681 327 2535 68 ----
NM_001008660chr1151408 1279 1037 979 109 2533 100 11527 2374 91
NM_001008701chr19122977 2895 2887 2831 2494 2022 1195 1179 690 632 613 503 22904 2756 ----
NM_001008708chr22565 490 ------
NM_001008738chr552344 2254 1050 1033 91 12428 ----
NM_001008744chr1431390 1030 61 188 ----
NM_001008895chr13--1410 21222 292 --
NM_001008925chr473274 2927 2800 2566 1040 947 239 32677 605 416 23438 347 --
NM_001009552chr81503 1418 ----
NM_001009554chr483888 1827 1755 1416 1380 1064 525 369 53976 3432 1586 457 109 24577 2909 11285
NM_001009554chr483888 1827 1755 1416 1380 1064 525 369 53976 3432 1586 457 109 24577 2909 11285
NM_001009555chr41508 --124 --
NM_001009566chr141414 1336 961 520 --1529 --
NM_001009569chr1021118 606 --1119 --
NM_001009899chr395819 5224 4500 4408 1974 1962 1732 1178 873 34619 4481 690 24701 2410 11238
NM_001009958chr71491 ----1481
NM_001009960chr722106 1787 --1770 --
NM_001009993chr264140 3686 3028 1314 968 661 1820 44276 3929 3475 1567 --
NM_001010853chr662983 2531 1005 918 511 60 ------
NM_001010854chr141183 1717 ----
NM_001010861chr152740 2684 2552 2487 43 ------
NM_001010862chrX83099 2826 2153 1101 733 531 197 97 12687 22146 470 --
NM_001010867chr1146054 5920 5832 5800 5717 5659 5099 4477 2313 1907 964 640 388 316 16001 25771 1973 --
NM_001010888chrX114403 3308 3285 3145 3041 3015 1578 1209 1065 389 381 23645 1411 11262 --
NM_001010891chr556506 6439 5722 5550 4879 25649 52 14799 --
NM_001010895chr982000 1885 1448 1360 783 777 690 520 ------
NM_001010908chr101647 ------
NM_001010924chr103774 247 51 --1854 --
NM_001010971chr13883 835 305 ------
NM_001010984chr131042 546 33 1812 1279 --
NM_001010986chrX41981 1831 1586 502 1128 ----
NM_001011513chr483034 2865 2802 2775 1249 1116 1059 347 12904 24024 1597 --
NM_001011537chr331672 1495 265 --2916 402 --
NM_001011553chr71766 1758 1873 --
NM_001011666chr7116526 6001 4962 4719 4699 4643 2098 1698 682 662 564 66361 5869 5473 4763 4712 4495 24511 55 --
NM_001011708chr2112886 2763 2745 2711 1167 1157 1121 1079 882 796 347 12027 ----
NM_001011713chr141637 ----1343
NM_001011885chr1511309 11325 11503 --
NM_001012267chr941565 609 439 382 11489 --1639
NM_001012393chr11105046 4655 4562 4024 1494 1434 1308 946 624 278 11398 13526 14848
NM_001012410chr3--2490 462 ----
NM_001012420chr1542027 1864 1036 177 11019 1732 --
NM_001012423chr1542027 1864 1036 177 11019 1732 --
NM_001012426chr672909 2124 1244 1048 949 457 43 --13103 --
NM_001012427chr672909 2124 1244 1048 949 457 43 --13103 --
NM_001012514chr251107 1058 957 126 35 ------
NM_001012516chr251107 1058 957 126 35 ------
NM_001012642chr1561976 1759 1659 320 157 29 --11543 --
NM_001012643chr192556 529 1226 ----
NM_001012732chr441217 1094 349 157 1149 ----
NM_001012751chr1011294 11609 1708 --
NM_001012753chr1911106 --2478 126 --
NM_001012755chrX115077 4387 4364 3185 3171 3099 1375 1166 806 296 212 54673 3198 285 183 103 21726 1094 --
NM_001012761chr572363 2287 1874 1077 583 356 244 1540 1479 --
NM_001012968chrX92420 2236 2176 927 663 551 486 328 317 31104 580 334 ----
NM_001012977chrX6525 500 481 323 200 130 --11169 --
NM_001013031chr1073313 841 813 583 482 402 254 ------
NM_001013399chr63922 358 190 ------
NM_001013406chr741749 1548 1100 200 --1406 --
NM_001013438chr33939 269 169 ------
NM_001013439chr32785 115 ------
NM_001013620chr12106692 6290 5912 3150 2097 1875 1735 1509 994 351 38296 727 709 21174 859 1505
NM_001013635chr1251183 1168 1157 879 829 --2860 286 --
NM_001013690chr1282123 1638 552 537 411 396 313 36 --11770 --
NM_001013693chr152688 2185 2137 850 306 1432 188 11904
NM_001013693chr152688 2185 2137 850 306 1432 188 11904
NM_001013699chr12--1464 ----
NM_001013739chr72332 281 ------
NM_001014380chr1355518 4366 2127 1698 1172 35817 4016 2185 14173 --
NM_001014434chr11641 2647 191 ----
NM_001014797chr10128178 7740 7419 7407 7198 2781 2339 2183 1541 512 501 276 11220 ----
NM_001014809chr45878 823 190 137 56 --2340 292 --
NM_001014812chr151112 ------
NM_001014839chr121029 733 ------
NM_001014841chr121029 733 ------
NM_001014972chr21234 ------
NM_001015045chr442462 2203 1588 681 11930 --11918
NM_001015048chr1453138 2938 2246 1244 931 23070 756 22477 240 13257
NM_001015049chr1453138 2938 2246 1244 931 23070 756 22477 240 13257
NM_001015053chr1761594 1230 1059 420 234 105 --21115 266 --
NM_001015877chrX113077 3027 2634 2326 812 705 662 642 555 520 490 22319 387 ----
NM_001015880chr1021367 1131 ------
NM_001015881chrX3453 409 193 ------
NM_001015882chr92866 797 1158 ----
NM_001015887chr331516 619 440 21484 98 ----
NM_001017368chr17102717 2492 2339 2091 2006 1026 881 782 552 442 1934 1482 --
NM_001017371chr221073 64 11090 ----
NM_001017395chr382974 2816 2489 2387 1288 898 704 239 21299 813 13220 22555 267
NM_001017396chr261878 1490 708 437 405 151 ------
NM_001017415chr11117 ------
NM_001017416chr11117 ------
NM_001017424chr11275 11505 ----
NM_001017425chr11275 11505 ----
NM_001017440chr7207795 7592 7560 7337 6740 6700 6012 5564 5471 3177 2819 2490 1852 1593 1554 1426 1044 1012 686 508 35703 2730 1065 ----
NM_001017523chr1221613 140 11783 ----
NM_001017926chr831738 1684 1572 ------
NM_001017962chr101718 --1875 --
NM_001017973chr53385 84 33 --173 --
NM_001017974chr53385 84 33 --173 --
NM_001017979chr42730 284 ------
NM_001017995chr594817 4097 4007 3797 1485 938 734 370 37 14716 13735 --
NM_001017999chr182097 1961 1890 1718 1486 896 474 391 11695 12152 --
NM_001017999chr182097 1961 1890 1718 1486 896 474 391 11695 12152 --
NM_001018000chr182097 1961 1890 1718 1486 896 474 391 11695 12152 --
NM_001018000chr182097 1961 1890 1718 1486 896 474 391 11695 12152 --
NM_001018001chr182097 1961 1890 1718 1486 896 474 391 11695 12152 --
NM_001018009chr341130 357 351 281 1891 ----
NM_001018025chrX2254 35 ------
NM_001018037chr92896 538 ------
NM_001018050chr2263017 2699 2566 1384 1281 332 13255 33398 2402 687 --
NM_001018052chr2263017 2699 2566 1384 1281 332 13255 33398 2402 687 --
NM_001018054chr111230 21258 1222 ----
NM_001018064chr982141 1781 1589 1340 725 229 217 209 --21515 240 --
NM_001018065chr9175906 5630 5444 5297 5041 4904 4114 3956 3875 3739 1729 1667 1375 1102 687 545 419 ------
NM_001018066chr9175906 5630 5444 5297 5041 4904 4114 3956 3875 3739 1729 1667 1375 1102 687 545 419 ------
NM_001018072chr1221613 140 11783 ----
NM_001018074chr533145 3084 345 22474 535 ----
NM_001018075chr533145 3084 345 22474 535 ----
NM_001018076chr533145 3084 345 22474 535 ----
NM_001018077chr533145 3084 345 22474 535 ----
NM_001018108chr1591900 892 860 783 736 688 276 155 117 11567 1143 --
NM_001018111chr763525 1436 1398 554 293 151 --1975 --
NM_001020658chr131657 1487 1414 11367 ----
NM_001020658chr131657 1487 1414 11367 ----
NM_001023567chr1541885 1787 736 177 1212 ----
NM_001023587chr341177 846 714 47 1852 ----
NM_001024024chr1431014 762 167 ------
NM_001024070chr1431010 758 163 ------
NM_001024094chr533145 3084 345 22474 535 ----
NM_001024218chr142850 229 1651 ----
NM_001024401chr1672843 2539 2500 2435 2066 1897 588 --11970 --
NM_001024455chrX92449 2435 2255 1902 1652 1066 835 533 336 1952 ----
NM_001024463chr1551050 736 366 258 101 ------
NM_001024649chr542961 2195 541 463 1884 ----
NM_001024660chr3----11117 --
NM_001024666chrX1114 --2537 448 --
NM_001024680chr251668 1522 1408 1184 707 --11454 --
NM_001024808chr1252361 2015 1902 402 221 ------
NM_001024847chr352292 1827 952 671 613 11531 ----
NM_001024934chr6--2475 105 263 47 --
NM_001024935chr6--2475 105 263 47 --
NM_001024936chr6--2475 105 263 47 --
NM_001024948chr121289 708 --23293 2485 --
NM_001025068chr351670 1334 1267 143 94 ------
NM_001025069chr351670 1334 1267 143 94 ------
NM_001025076chr1095791 5553 2443 2364 2105 1711 1108 502 88 12387 45522 4799 4691 1875 --
NM_001025077chr10127149 6911 4994 2466 1860 1446 1389 1226 1171 979 272 249 --36880 6157 6049 --
NM_001025079chr3103730 3502 3144 2710 2674 2554 2545 902 699 658 --13357 12586
NM_001025081chr1851559 1181 474 454 306 --2244 221 --
NM_001025090chr1851559 1181 474 454 306 --2244 221 --
NM_001025092chr1851559 1181 474 454 306 --2244 221 --
NM_001025101chr1851559 1181 474 454 306 --2244 221 --
NM_001025107chr162490 499 479 463 336 104 22537 1671 12680 --
NM_001025107chr162490 499 479 463 336 104 22537 1671 12680 --
NM_001025202chr72332 281 ------
NM_001025233chr1252281 2043 1850 1014 424 ------
NM_001025252chr853003 2269 2262 370 124 33121 1218 426 1212 --
NM_001025253chr853003 2269 2262 370 124 33121 1218 426 1212 --
NM_001025266chr394886 4485 4311 1538 1325 491 396 372 69 14668 13558 --
NM_001025356chr1282722 2550 2028 1963 1824 1173 1150 268 2431 369 ----
NM_001025366chr671804 1709 1518 1358 1246 244 133 11367 ----
NM_001025366chr671804 1709 1518 1358 1246 244 133 11367 ----
NM_001025367chr671804 1709 1518 1358 1246 244 133 11367 ----
NM_001025367chr671804 1709 1518 1358 1246 244 133 11367 ----
NM_001025368chr671804 1709 1518 1358 1246 244 133 11367 ----
NM_001025368chr671804 1709 1518 1358 1246 244 133 11367 ----
NM_001025369chr671820 1725 1534 1374 1262 260 149 11383 ----
NM_001025369chr671820 1725 1534 1374 1262 260 149 11383 ----
NM_001025370chr671804 1709 1518 1358 1246 244 133 11367 ----
NM_001025370chr671804 1709 1518 1358 1246 244 133 11367 ----
NM_001025579chr175972 961 864 825 290 ------
NM_001025580chrX134120 4034 3741 3631 3486 2616 1700 393 380 373 361 354 84 43719 3412 990 260 ----
NM_001025595chr461557 1117 492 237 222 140 ------
NM_001025616chr461763 1735 1646 1635 425 23 --1695 --
NM_001025777chr241197 1107 516 231 1382 ----
NM_001025780chr931559 1376 33 1581 ----
NM_001029858chr672720 2571 2549 2223 855 732 506 1892 ----
NM_001029863chr622628 534 ----11196
NM_001029875chr542077 1922 1171 1117 22573 118 12235 --
NM_001029882chr12597 41 ------
NM_001029882chr12597 41 ------
NM_001029955chr463236 2835 2722 641 569 486 23282 557 1209 --
NM_001029998chr451353 1126 1005 549 524 21462 462 ----
NM_001030006chr1752132 1981 772 614 246 1540 21871 1074 --
NM_001030007chr1673741 2541 1111 1062 831 371 243 13721 11306 --
NM_001030055chr1441634 1477 1178 126 22921 147 1986 --
NM_001030272chr112500 422 1436 ----
NM_001030273chr112500 422 1436 ----
NM_001031677chr52406 65 --1483 --
NM_001031679chr1252573 2424 2223 1243 785 1558 12758 --
NM_001031680chr192255 1996 1882 1841 1760 938 788 642 365 ------
NM_001031690chr7143070 2785 2776 2570 2277 2253 2244 2060 2053 2040 1225 984 821 411 ------
NM_001031695chr22175198 5189 4983 4871 4846 4459 4175 4068 3934 3912 3564 1869 1769 1513 1138 812 795 35329 831 192 ----
NM_001031710chr741020 923 689 129 2889 164 ----
NM_001031711chr561433 1234 1209 737 586 70 1492 21599 309 --
NM_001031716chr221143 111 ----199
NM_001031723chr42316 123 2462 160 ----
NM_001031732chr443610 2442 2261 331 ----13505
NM_001031738chr2--1457 ----
NM_001031804chr16114420 4212 4122 3643 3143 2859 2760 1226 1032 1021 593 23522 2769 ----
NM_001031812chr51474 1947 11429 --
NM_001032221chr961652 1442 1392 499 421 415 11531 180 --
NM_001032280chr631478 1199 683 31687 1114 457 11338 --
NM_001032282chr831343 1092 241 ------
NM_001032288chr202998 371 ------
NM_001032296chr1372139 1913 753 186 59 42 34 42852 2726 1872 665 1912 --
NM_001032380chr102493 444 1225 ----
NM_001032393chrX4778 717 171 149 ------
NM_001032394chr652636 2443 1939 1061 1022 1923 ----
NM_001032395chr652503 2310 1806 928 889 1790 ----
NM_001032730chr12683 519 ------
NM_001032999chr20105385 4116 3321 2133 2044 1298 1189 1163 851 256 14515 33800 3411 913 --
NM_001033025chr161257 1228 1217 1162 506 111 ------
NM_001033044chr141785 1334 629 206 --2513 347 --
NM_001033045chr274151 3491 3168 1158 1102 1016 459 1262 24075 118 1328
NM_001033047chr442247 1688 431 79 32459 2277 1938 1258 --
NM_001033049chr2151953 1701 1631 1516 607 1327 2929 553 --
NM_001033056chr141785 1334 629 206 --2513 347 --
NM_001033059chr652006 801 758 564 204 --21550 639 --
NM_001033087chr2012037 3272 203 124 1673 --
NM_001033088chr151340 1395 ----
NM_001033112chr52725 86 ------
NM_001033117chr394695 4685 4483 4435 3549 3490 1320 1259 491 14559 24523 3900 --
NM_001033507chr141739 1490 727 711 12006 ----
NM_001033551chr1753560 2617 1409 667 575 12755 ----
NM_001033557chr211295 --138 --
NM_001033561chr173786 774 168 ------
NM_001033566chr172666 22 ------
NM_001033568chr172666 22 ------
NM_001033576chr1762779 2655 2438 2203 201 165 22518 1789 ----
NM_001033578chr822030 708 12171 ----
NM_001033602chr1342667 1875 1751 596 --12512 --
NM_001033659chr1731442 567 156 11461 ----
NM_001033723chr872483 2476 2405 2182 947 744 245 --11989 --
NM_001033756chr671738 1643 1452 1292 1180 178 67 11301 ----
NM_001033756chr671738 1643 1452 1292 1180 178 67 11301 ----
NM_001033910chr131757 1498 279 2214 120 12171 --
NM_001033925chr1021751 1341 ------
NM_001033953chr11145 ------
NM_001034837chr53741 289 181 ----1660
NM_001034838chr53741 289 181 ----1660
NM_001034850chr511303 41322 1203 1057 428 --11521
NM_001034852chr1432043 1757 1694 1240 ----
NM_001035chr1173 --11196 --
NM_001035003chr421217 186 1927 --1285
NM_001035004chr421217 186 1927 --1285
NM_001035005chr183655 76 64 --1206 --
NM_001035254chr942506 2459 958 470 --21724 553 --
NM_001035260chr1031509 1156 458 1216 --11115
NM_001035511chr162136 2036 1480 1435 1407 344 ------
NM_001035512chr172243 2143 1587 1542 1514 451 114 ------
NM_001035513chr172243 2143 1587 1542 1514 451 114 ------
NM_001035521chr2--1670 ----
NM_001035534chr9101373 1361 1220 1110 1092 1061 303 294 199 45 --11047 --
NM_001037131chr22438 219 21168 374 11005 --
NM_001037132chr742261 2144 2137 1888 --11920 --
NM_001037133chr742261 2144 2137 1888 --11920 --
NM_001037163chr72591 102 --1350 --
NM_001037164chr711788 --2476 197 --
NM_001037174chr221983 833 11825 21938 1900 --
NM_001037317chr152740 2684 2552 2487 43 ------
NM_001037331chr184911 753 359 201 ------
NM_001037334chr183625 426 298 12063 ----
NM_001037339chr12629 542 --1382 --
NM_001037340chr12629 542 --1382 --
NM_001037341chr12629 542 --1382 --
NM_001037341chr12629 542 --1382 --
NM_001037494chr12--1259 ----
NM_001037495chr12--1259 ----
NM_001037533chr13587 255 88 ------
NM_001037535chrX2521 441 11437 ----
NM_001037536chrX2521 441 11437 ----
NM_001037540chrX2521 441 11437 ----
NM_001037553chr21125158 4921 4880 4447 3293 1217 1164 1079 1007 785 753 267 ------
NM_001037631chr21156 --1876 --
NM_001037639chr3136 ------
NM_001037954chr1152990 2773 2519 2239 892 12640 2678 225 --
NM_001038493chr22571 222 ------
NM_001038640chr15--2804 280 ----
NM_001038702chr542786 1879 1094 117 ------
NM_001038707chr162224 2212 1461 648 516 314 1684 1591 --
NM_001038707chr162224 2212 1461 648 516 314 1684 1591 --
NM_001039199chr20104878 4008 3576 3334 3048 1788 1578 1253 1174 38 24022 3825 ----
NM_001039350chr751482 1451 1383 1227 686 ------
NM_001039395chr942281 1971 441 343 12311 ----
NM_001039459chr74461 325 199 127 11158 195 --
NM_001039479chr1472244 2079 1987 1616 1516 630 444 1895 21554 277 --
NM_001039538chr223314 1030 ------
NM_001039547chr3188006 7486 7144 6447 6088 5288 5008 3066 2392 1667 1329 1301 968 820 742 624 553 296 1591 22914 2607 --
NM_001039574chr12893 691 --1935 --
NM_001039577chr144389 4045 1644 752 1284 1238 --
NM_001039580chr464523 4492 3817 1080 454 380 11828 --13259
NM_001039585chr133656 3480 113 1203 ----
NM_001039590chrX54013 3573 2943 1163 1030 1401 11524 1831
NM_001039591chrX54013 3573 2943 1163 1030 1401 11524 1831
NM_001039618chr1175292 4153 3903 1260 1218 304 232 45016 2228 776 49 13771 --
NM_001039690chr1642162 1714 211 170 1153 ----
NM_001039709chr20105385 4116 3321 2133 2044 1298 1189 1163 851 256 14515 33800 3411 913 --
NM_001039771chr1461061 1019 948 858 241 60 ------
NM_001039840chrX95926 5258 4149 2375 2345 1590 961 683 84 21182 391 44324 4264 4014 3726 --
NM_001039888chr14661 571 314 97 ------
NM_001039916chr124487 156 138 91 --21012 83 --
NM_001039917chr124487 156 138 91 --21012 83 --
NM_001039918chr124487 156 138 91 --21012 83 --
NM_001039919chr124487 156 138 91 --21012 83 --
NM_001039920chr124487 156 138 91 --21012 83 --
NM_001039937chr1383679 3295 3193 3187 2603 2546 255 139 54165 3000 2684 862 842 42929 2736 2704 2674 --
NM_001039960chr1281316 1256 393 380 270 259 115 79 11482 11749 --
NM_001040001chr622048 1550 31378 1326 1274 12062 --
NM_001040002chr1721299 84 --1306 --
NM_001040056chr162319 36 1612 ----
NM_001040057chr731514 513 204 126 ----
NM_001040100chr35959 926 359 112 84 --1168 --
NM_001040108chr14103317 3302 2962 2468 2456 2241 2108 777 466 113 12269 32411 1254 882 --
NM_001040110chr721223 89 --21752 1270 --
NM_001040135chr72784 53 ------
NM_001040142chr211657 --2950 918 --
NM_001040143chr211657 --2950 918 --
NM_001040144chr1642162 1714 211 170 1153 ----
NM_001040146chr1642162 1714 211 170 1153 ----
NM_001040152chr755079 3797 3641 3299 1165 13852 ----
NM_001040157chr422061 568 1250 12135 --
NM_001040158chr51538 ------
NM_001040167chr721105 380 --11187 --
NM_001040195chr13629 536 45 --1174 --
NM_001040202chr431869 103 96 31683 539 321 ----
NM_001040214chr6--1622 22312 1883 --
NM_001040260chr461028 483 446 418 200 95 1392 ----
NM_001040261chr461028 483 446 418 200 95 1392 ----
NM_001040272chr941881 447 272 179 --1474 11497
NM_001040273chr1072097 2083 2065 1841 1771 462 360 22110 651 ----
NM_001040284chr1675587 5243 4733 4592 4494 4346 933 34940 3924 1101 ----
NM_001040402chr472573 1017 792 783 180 112 98 12916 1363 --
NM_001040429chr1363510 2423 2281 2260 1373 1203 12534 21248 41 --
NM_001040441chr174566 4028 1744 1563 1452 889 65 --24138 2053 14101
NM_001040446chr562092 944 842 717 600 97 ----12034
NM_001040450chr1532758 1145 378 ----11846
NM_001040453chr1532758 1145 378 ----11846
NM_001040458chr561687 733 619 479 112 24 ------
NM_001040619chr121318 224 ------
NM_001040624chr862286 2082 1877 534 285 45 --22173 2066 --
NM_001040625chr862286 2082 1877 534 285 45 --22173 2066 --
NM_001040626chr862286 2082 1877 534 285 45 --22173 2066 --
NM_001040627chr862286 2082 1877 534 285 45 --22173 2066 --
NM_001040628chr862286 2082 1877 534 285 45 --22173 2066 --
NM_001040629chr862286 2082 1877 534 285 45 --22173 2066 --
NM_001040630chr862286 2082 1877 534 285 45 --22173 2066 --
NM_001040653chr382409 1749 1736 965 821 815 274 76 --22523 240 --
NM_001040708chr821031 971 ------
NM_001040709chr1122456 2147 2127 2102 1679 972 948 911 497 352 287 75 --1438 --
NM_001040712chr973225 2660 1302 1035 808 494 90 12676 33255 3209 59 --
NM_001040715chr1681086 1035 1000 835 794 456 370 133 1381 1170 --
NM_001042353chr204481 377 68 57 1414 1395 --
NM_001042355chr1684781 4672 4305 3836 3437 1560 503 167 1592 24929 2143 1822
NM_001042388chr181847 1312 ----
NM_001042404chr12288 173 ------
NM_001042406chr62902 128 ------
NM_001042412chr1684781 4672 4305 3836 3437 1560 503 167 1592 24929 2143 1822
NM_001042413chr962683 1584 1002 568 523 193 1531 33732 2593 1088 14071
NM_001042424chr473092 2580 2345 2092 1137 557 221 ------
NM_001042425chr631478 1199 683 31687 1114 457 11338 --
NM_001042459chr3156 ------
NM_001042473chr1022101 766 21909 1678 ----
NM_001042476chr1631995 1971 118 --11634 --
NM_001042481chr1442566 1918 1738 449 22067 996 ----
NM_001042486chr2051551 470 463 407 169 ------
NM_001042492chr1743442 727 387 70 --33319 3289 2442 --
NM_001042494chr1543808 3578 3165 3157 23523 662 23416 752 --
NM_001042495chr1543808 3578 3165 3157 23523 662 23416 752 --
NM_001042496chr1543808 3578 3165 3157 23523 662 23416 752 --
NM_001042497chr1543808 3578 3165 3157 23523 662 23416 752 --
NM_001042506chrX6525 500 481 323 200 130 --11179 --
NM_001042510chr832111 450 427 --11499 --
NM_001042511chr832111 450 427 --11499 --
NM_001042517chr133658 322 213 ------
NM_001042533chr321292 1054 22650 96 12968 12669
NM_001042537chrX5830 491 408 304 90 1183 1434 --
NM_001042550chr981673 1637 1424 668 646 614 592 125 1174 ----
NM_001042555chr1284142 3378 1847 1278 1197 1126 554 93 21896 463 34287 1295 897 --
NM_001042599chr2187617 7064 6814 5937 5763 5509 5475 5159 3035 2601 2547 2443 2337 1582 1488 409 81 63 87576 7025 6446 6133 2164 1959 870 679 46439 5561 2803 2115 --
NM_001042601chr332332 2175 220 --12923 --
NM_001042603chr12165325 4777 4771 4727 3913 3898 3886 3278 1791 1737 1452 1337 1201 1164 460 238 14195 21807 1432 --
NM_001042604chr384316 3929 3753 1642 1383 1076 468 35 14331 ----
NM_001042669chr461763 1735 1646 1635 425 23 --1695 --
NM_001042681chr172402 2386 2159 1980 988 686 305 11790 ----
NM_001042682chr172402 2386 2159 1980 988 686 305 11790 ----
NM_001042682chr172402 2386 2159 1980 988 686 305 11790 ----
NM_001042683chr631729 1152 108 --1169 --
NM_001042728chr122998 931 ------
NM_001042749chrX31920 1370 756 1349 --1726
NM_001042750chrX31920 1370 756 1349 --1726
NM_001042751chrX31920 1370 756 1349 --1726
NM_001042762chr71881 --1936 --
NM_001043318chr1493946 3883 3781 1537 1097 1013 1004 796 666 ------
NM_001043351chr162153 1854 881 372 167 123 ------
NM_001044305chr641648 638 622 46 ------
NM_001044385chr293931 3708 3333 3064 2741 2692 1614 1163 915 --1787 --
NM_001044722chr51474 1947 11429 --
NM_001044723chr51474 1947 11429 --
NM_001046chr532809 1891 254 1974 1428 --
NM_001049chr1452354 770 540 468 331 --21510 267 12328
NM_001068chr3----150 --
NM_001077628chr11681 ------
NM_001083620chr421811 960 --1459 22403 119
NM_001083621chr194349 3581 3503 3274 1318 1178 1137 1067 1026 34158 810 757 ----
NM_001092chr1751899 862 842 491 425 ------
NM_001096chr17145 --1839 --
NM_001099678chr3125990 5572 5237 4652 4495 2478 1788 1740 1698 1146 635 487 1872 15840 --
NM_001100108chr1157873 7766 6164 5270 5231 5193 2969 2751 2428 2195 1782 1538 1420 1099 893 55855 1715 1429 1105 838 15946 --
NM_001106chr3148669 8133 7926 7569 7298 7226 3384 2855 2661 1764 1721 1276 522 342 37717 2400 711 39586 2199 316 --
NM_001111chr162490 499 479 463 336 104 22537 1671 12680 --
NM_001113490chrX63480 3055 2952 2386 2273 1321 1777 ----
NM_001117chr1861843 1587 817 671 654 558 22008 1851 ----
NM_001119chr461425 1343 1304 376 346 79 21375 1363 11494 --
NM_001121chr1021599 630 ------
NM_001122631chr111627 1575 1553 --
NM_001122679chr531333 178 24 ------
NM_001124chr111690 1192 ----
NM_001128chr1673741 2541 1111 1062 831 371 243 13721 11306 --
NM_001140chr175236 224 212 200 140 ------
NM_001144chr1631040 240 196 --11189 --
NM_001146chr852004 897 415 186 105 --11995 --
NM_001148chr421413 739 11504 ----
NM_001160chr1262669 2465 2090 878 794 223 1526 12741 --
NM_001172chr141613 --1296 --
NM_001173chr1441634 1477 1178 126 22921 147 1986 --
NM_001174chrX51968 1578 426 376 53 12010 ----
NM_001175chr124405 161 96 71 1120 ----
NM_001177chr1242061 1653 1583 51 --11557 --
NM_001178chr112500 422 1436 ----
NM_001186chr2142526 1137 726 364 2137 109 1778 --
NM_001191chr2041213 1124 474 206 --1147 --
NM_001198chr662245 2179 2095 1639 803 433 ------
NM_001204chr2116697 6347 2439 2114 1350 1302 1239 797 554 492 459 44803 2976 2775 1326 36918 2671 2201 --
NM_001205chr52413 61 ------
NM_001206chr972867 2786 1200 542 472 309 242 12407 ----
NM_001219chr772205 2107 1734 1462 896 742 596 --21564 1554 --
NM_001232chr14815 139 126 107 ------
NM_001233chr732132 1867 1726 22223 568 ----
NM_001241chr21168 1128 ----
NM_001241chr21168 1128 ----
NM_001256chr17102752 2593 2328 1172 1032 965 748 404 275 62 ------
NM_001257chr1621503 443 1197 ----
NM_001268chr132382 70 --1770 1873
NM_001269chr14417 162 149 118 ------
NM_001270chr52857 847 ------
NM_001271chr1562781 2294 2227 2144 1106 734 11239 ----
NM_001273chr124586 385 101 56 ------
NM_001280chr192577 27 --1614 --
NM_001282chr1752132 1981 772 614 246 1540 21871 1074 --
NM_001283chr7----1679 --
NM_001284chr52383 209 2459 376 ----
NM_001290chr43998 850 318 ------
NM_001292chr153889 184 97 ------
NM_001293chr112387 98 1437 ----
NM_001300chr102447 349 ------
NM_001304chr1763015 2492 2370 1203 91 54 2645 177 23811 1142 --
NM_001313chr45878 823 190 137 56 --2340 292 --
NM_001315chr641543 1527 777 489 11939 1307 --
NM_001316chr203366 333 94 ----1374
NM_001326chr11143 ----1480
NM_001331chr1182777 2068 1963 1862 943 729 669 76 42509 2213 1036 504 32229 1028 968 12649
NM_001332chr52450 408 11267 11139 --
NM_001343chr53596 356 294 --21335 638 --
NM_001346chr332650 2508 1912 22792 2614 1552 11760
NM_001356chrX22496 1622 --11648 --
NM_001357chr1121 1204 ----
NM_001364chr11154443 4376 3985 3866 3273 3248 3242 3176 3169 3154 1286 1140 934 857 499 33267 3115 972 33308 1823 895 --
NM_001378chr21466 --1154 --
NM_001382chr112143 35 ----122
NM_001385chr8152 1114 ----
NM_001386chr8121784 1636 1618 1587 876 821 775 737 725 351 173 75 22412 1684 ----
NM_001387chr572899 2530 2271 2209 892 789 740 11012 12515 --
NM_001388chr174734 706 127 118 ------
NM_001390chr1883308 2672 1343 1129 998 677 643 602 12564 ----
NM_001396chr211915 11038 11100 --
NM_001400chr13465 382 182 --21241 352 --
NM_001401chr94387 218 147 37 1503 ----
NM_001406chr17111380 1359 1243 1160 467 422 414 387 247 241 232 2399 163 ----
NM_001408chr151384 1093 1068 359 35 ------
NM_001412chrX53704 3651 3531 2933 417 23051 1191 ----
NM_001415chrX51249 1228 772 504 143 ------
NM_001417chr1251936 1357 1304 1214 567 ------
NM_001419chr1993700 3576 3351 3301 1939 1861 1089 930 277 24114 224 1485 --
NM_001422chr1141098 518 204 93 ------
NM_001423chr1252081 1593 694 524 219 11904 ----
NM_001427chr762132 823 805 771 729 570 ------
NM_001429chr222875 110 145 ----
NM_001431chr641136 980 811 444 1167 ----
NM_001438chr1153303 2582 682 555 526 478 466 458 443 431 368 252 237 231 171 3832 311 271 ----
NM_001439chr161257 1228 1217 1162 506 111 ------
NM_001448chrX31450 1438 203 --21543 381 --
NM_001449chrX5996 875 511 98 57 --11054 --
NM_001451chr1631235 1167 505 ------
NM_001461chr14487 216 190 142 1597 1117 --
NM_001463chr23814 171 151 ------
NM_001482chr151722 ------
NM_001493chrX1207 2691 186 1226 --
NM_001497chr952596 2422 2060 82 59 12382 ----
NM_001498chr63455 443 413 ------
NM_001521chr2--1670 ----
NM_001527chr653981 3203 1338 1149 1069 14806 24426 1515 --
NM_001530chr1441099 983 306 23 ------
NM_001533chr19299 47 154 ----
NM_001542chr14938 459 360 52 2405 385 ----
NM_001543chr594719 4621 4377 4002 1863 606 559 390 302 --21870 1681 --
NM_001546chr631437 1244 224 --1233 --
NM_001552chr173327 221 101 ------
NM_001584chr11--178 1985 --
NM_001587chrX82131 1812 841 793 597 449 322 238 2648 155 1408 --
NM_001609chr1044337 1643 1192 167 13675 ----
NM_001614chr172480 129 ------
NM_001614chr172480 129 ------
NM_001616chr233139 2962 2353 1359 1109 --
NM_001620chr113708 691 67 ------
NM_001621chr722534 2085 ------
NM_001621chr722534 2085 ------
NM_001634chr652006 801 758 564 204 --21550 639 --
NM_001642chr1141258 1227 1029 461 ------
NM_001649chrX62110 721 491 461 423 333 1216 12498 --
NM_001650chr1883848 3546 2739 2560 1620 554 349 57 1493 12694 --
NM_001655chr1151884 1793 1603 1531 1477 2656 325 ----
NM_001656chr521655 783 11458 ----
NM_001659chr1292625 2096 2083 1020 911 734 402 317 161 --22433 359 --
NM_001660chr3--1649 ----
NM_001663chr1461757 399 191 180 165 96 2553 417 1333 --
NM_001664chr31984 --1197 --
NM_001668chr171970 1919 1790 499 135 98 91 21527 260 12281 --
NM_001677chr13832 824 712 ------
NM_001678chr17111774 1732 1701 1646 1618 1468 1405 1357 1189 135 53 --1477 --
NM_001682chr1262581 2504 2367 1125 532 480 1504 ----
NM_001683chr342481 2290 1907 1844 ------
NM_001690chr392499 2295 2224 2102 1827 648 358 180 31 1216 ----
NM_001693chr851101 418 379 356 61 ----1318
NM_001695chr874218 3814 1387 1096 768 96 32 11017 1279 --
NM_001699chr1931725 360 151 ------
NM_001701chr921333 41 --11014 --
NM_001702chr81558 ------
NM_001709chr1132352 1896 228 --12608 --
NM_001717chr151528 --2609 443 --
NM_001731chr122748 307 ------
NM_001740chr163500 494 468 ------
NM_001742chr711207 11528 ----
NM_001744chr53582 377 55 ------
NM_001746chr542961 2195 541 463 1884 ----
NM_001753chr741762 1249 682 42 1229 1165 --
NM_001754chr2194252 3475 2864 2826 2814 2796 2717 974 627 12879 ----
NM_001755chr1642004 661 523 342 ------
NM_001759chr12104786 4699 3419 1644 1339 1265 1131 1060 1046 226 --23341 50 --
NM_001768chr241059 899 64 46 11014 ----
NM_001773chr151407 1322 1295 1093 1058 1462 --1550
NM_001777chr3103730 3502 3144 2710 2674 2554 2545 902 699 658 --13357 12586
NM_001788chr71766 1758 1873 --
NM_001790chr53366 265 110 ------
NM_001796chr161238 ------
NM_001798chr1231088 1073 731 1245 ----
NM_001800chr192194 76 --1490 --
NM_001806chr1932899 1993 930 11117 ----
NM_001810chr202769 662 1113 1562 --
NM_001829chr41389 1103 1617 --
NM_001839chr12152 145 1564 134 --
NM_001852chr14569 530 437 261 ------
NM_001854chr131107 441 256 --21500 548 --
NM_001859chr9113419 3293 3004 2995 1558 1281 623 348 266 172 86 1234 13069 13467
NM_001873chr41652 2194 139 ----
NM_001891chr41340 --1143 --
NM_001893chr171280 ------
NM_001895chr2041203 1151 381 295 ------
NM_001904chr33872 693 310 ------
NM_001914chr18--1361 1300 --
NM_001921chr441217 1094 349 157 1149 ----
NM_001935chr24923 860 760 358 ------
NM_001936chr751482 1451 1383 1227 686 ------
NM_001938chr11266 --1179 --
NM_001941chr1853810 2662 1172 758 235 43946 2795 1348 1053 ----
NM_001945chr521102 1056 --11353 --
NM_001946chr124788 356 186 55 11002 ----
NM_001949chr652151 1128 306 289 209 31271 1177 402 22303 82 --
NM_001955chr62799 111 31122 980 894 1218 --
NM_001957chr431430 442 84 1103 ----
NM_001964chr54334 207 172 94 ------
NM_001973chr11156 1275 ----
NM_001977chr43379 215 160 ------
NM_001981chr112190 12207 ----
NM_001982chr123906 312 203 1230 ----
NM_001987chr12144188 4153 4107 3684 3548 3496 1475 632 616 604 533 500 244 138 13436 ----
NM_001990chr15133 125 112 106 36 ------
NM_001994chr1--152 ----
NM_001999chr521333 541 ------
NM_002006chr495498 5432 5018 4632 4156 2020 1418 445 200 22212 1847 21184 802 1477
NM_002015chr1342103 149 142 95 --11260 --
NM_002024chrX11434 1698 12023 --
NM_002025chrX219216 8434 8352 8330 8299 8041 7517 7444 6991 6942 6334 6307 2676 2527 1431 1200 1152 917 641 280 100 21138 1103 22090 796 --
NM_002026chr241035 1016 873 36 ------
NM_002033chr1154003 1464 777 632 217 33837 3306 3024 11211 --
NM_002035chr18113237 1457 919 646 516 501 493 485 477 469 461 12468 1853 --
NM_002040chr2162148 1272 1059 1029 906 850 11214 ----
NM_002044chr1521138 85 21571 411 ----
NM_002045chr3155 --2124 91 --
NM_002051chr105972 822 446 246 41 --151 --
NM_002063chrX1233 --1359 --
NM_002065chr141785 1334 629 206 --2513 347 --
NM_002069chr711443 11177 --11653
NM_002072chr96937 818 791 362 324 317 --1754 --
NM_002074chr171616 1088 583 506 489 229 146 ------
NM_002076chr1253182 2375 2060 1026 213 1227 3874 782 221 --
NM_002077chr961936 1871 1690 1580 539 506 --21634 867 --
NM_002080chr163838 816 346 --1232 --
NM_002081chr231761 1700 1103 ------
NM_002086chr1792060 1882 1664 743 597 428 283 275 256 12226 ----
NM_002092chr464118 3241 3116 1875 1161 728 24001 1270 34968 4919 4801 --
NM_002095chr81288 --1296 --
NM_002101chr22426 325 ------
NM_002107chr12491 57 ------
NM_002111chr4113251 3200 2802 2599 1319 1191 759 544 537 146 98 12448 32901 1019 279 --
NM_002126chr1764184 4027 3199 2663 2576 645 13594 33392 2932 212 1534
NM_002131chr631341 329 43 ------
NM_002137chr731893 962 317 21726 441 ----
NM_002138chr43346 154 128 1586 ----
NM_002140chr921148 413 ----1206
NM_002145chr171146 --124 --
NM_002146chr172501 146 21408 450 ----
NM_002147chr173638 245 226 1804 ----
NM_002148chr22611 566 --1658 --
NM_002158chr232914 2851 305 13610 ----
NM_002187chr531136 809 358 ------
NM_002188chr53695 538 261 1129 ----
NM_002193chr221423 609 --11657 --
NM_002196chr2041040 220 191 181 --1256 --
NM_002196chr2041040 220 191 181 --1256 --
NM_002199chr42884 167 ------
NM_002207chr31122 1205 ----
NM_002210chr233035 2495 1405 22503 998 ----
NM_002221chr1162867 2663 2468 2250 2205 2186 2158 1170 828 471 464 276 80 69 59 40 --1939 --
NM_002224chr62732 707 ----1287
NM_002227chr131262 810 43 ------
NM_002229chr192408 157 ------
NM_002240chr21581 66 57 51 27 ------
NM_002241chr143147 942 935 46 31023 971 229 32937 857 36 --
NM_002245chr11640 ------
NM_002247chr1052344 1995 1959 526 431 11575 ----
NM_002249chr11449 ------
NM_002254chr272057 2044 2036 1568 784 770 579 1173 1372 --
NM_002264chr354211 765 353 311 230 31122 714 151 ----
NM_002267chr1372417 2230 1787 857 759 743 348 12074 ----
NM_002270chr595436 5124 4915 4251 1666 1472 1410 691 41 14954 24115 1028 --
NM_002271chr1341518 795 627 205 160 ----
NM_002293chr142633 2380 499 250 --2215 126 --
NM_002296chr1--21097 460 ----
NM_002298chr137621 565 559 547 494 429 368 --11447 --
NM_002310chr5136119 5850 5821 5497 5480 4433 4145 2396 1817 1808 1044 970 455 25163 1843 12190 --
NM_002313chr10125083 4911 4758 4128 4072 3169 1736 1443 1336 1064 972 756 2722 307 ----
NM_002332chr12159 1747 ----
NM_002333chr191902 11184 184 --
NM_002334chr1131797 131 59 143 135 --
NM_002336chr1244967 934 677 671 24823 1426 ----
NM_002345chr121558 ------
NM_002355chr122168 89 --21031 266 1177
NM_002358chr42479 265 --1152 --
NM_002359chr17153980 3849 3311 3047 3005 2888 2780 2730 1634 931 434 121 104 81 71 --53712 2948 1492 1143 740 --
NM_002361chr19174 1222 ----
NM_002373chr151161 147 172 --
NM_002374chr223314 1030 ------
NM_002381chr22229 91 ----1926
NM_002382chr1481187 1060 518 495 216 120 112 58 ------
NM_002385chr1851559 1181 474 454 306 --2244 221 --
NM_002395chr621037 242 --11526 --
NM_002397chr532068 1937 276 1656 11798 --
NM_002399chr1511332 ----1900
NM_002401chr1742219 1895 716 411 ----1560
NM_002408chr142727 719 ------
NM_002430chr22111892 1750 1735 1013 996 829 725 707 437 353 58 --11763 --
NM_002442chr1231326 1289 455 1444 21722 1156 --
NM_002444chrX51437 753 221 41 34 --21311 1265 --
NM_002448chr42688 101 1599 --1195
NM_002449chr521206 226 11257 ----
NM_002451chr993054 2730 2591 1426 1201 656 591 491 272 13373 --13402
NM_002469chr121312 171 ----
NM_002481chr1227560 7396 7379 6699 6671 6638 6462 6148 5581 5142 4972 4891 3122 3025 2856 1839 1001 982 714 700 685 70 35927 2966 1925 17225 11644
NM_002486chr942287 2276 1762 99 ------
NM_002492chr32116 35 ------
NM_002495chr5--186 ----
NM_002499chr153526 446 217 --1913 --
NM_002500chr22931 180 ------
NM_002501chr19103948 2900 2555 1607 1597 1584 1565 986 79 31 --21173 1148 --
NM_002508chr161983 1681 1568 1551 545 23 1479 ----
NM_002509chr203696 627 79 ------
NM_002515chr1431737 1641 1541 141 ----
NM_002518chr23976 399 204 --11164 --
NM_002519chr1121220 1070 149 --11036
NM_002520chr5----178 --
NM_002522chr17113463 3136 3048 1375 1366 979 876 627 385 187 84 23516 2959 21098 75 --
NM_002526chr62644 584 ------
NM_002545chr11105046 4655 4562 4024 1494 1434 1308 946 624 278 11398 13526 14848
NM_002547chrX84102 3562 3183 3082 2901 745 238 195 --11434 --
NM_002556chr1171987 1781 1624 1527 1358 865 110 2435 83 --11662
NM_002568chr81308 1438 ----
NM_002572chr112109 77 ------
NM_002577chr383121 2950 1513 1506 1489 902 795 445 23795 1544 ----
NM_002581chr995315 4870 4705 4695 4196 1589 1554 1444 52 --1566 --
NM_002588chr571683 1586 1298 1273 1166 486 383 ------
NM_002592chr20------1228
NM_002594chr2022271 491 --1902 --
NM_002595chr1221642 718 --11751 --
NM_002599chr1141060 973 462 361 ------
NM_002600chr12629 542 --1382 --
NM_002605chr152884 469 1991 284 38 --
NM_002608chr2251581 1539 1490 1108 73 1266 ----
NM_002623chr20167 ------
NM_002629chr104881 741 181 56 ------
NM_002636chr62436 155 ------
NM_002641chrX1764 11644 1526 --
NM_002645chr11--42309 1984 1126 768 ----
NM_002646chr162176 2165 1854 1614 1360 883 11354 1181 --
NM_002648chr66978 930 416 328 235 30 ------
NM_002655chr854185 1736 1670 1235 826 11156 ----
NM_002657chr2093213 2647 2511 981 869 841 779 617 316 23582 1274 31298 1289 1159 13197
NM_002666chr1551208 1161 916 302 187 ------
NM_002669chr4126 ------
NM_002670chr351463 1332 1004 580 423 ------
NM_002687chr1461324 1310 1209 333 254 73 ------
NM_002693chr152304 149 ------
NM_002698chr19142601 2592 2584 2376 2346 2332 2246 2225 2034 1967 1194 1129 995 333 --1346 --
NM_002699chr151508 1462 1255 1089 596 ------
NM_002705chr164782 661 263 84 ------
NM_002707chr2--179 ----
NM_002709chr253109 2712 2568 990 509 13237 11024 --
NM_002710chr121123 --1225 --
NM_002711chr74735 332 294 107 124 ----
NM_002716chr1183451 3220 3110 894 727 404 377 195 13699 13148 13488
NM_002718chr362695 2324 2211 2035 889 280 12201 --11914
NM_002719chr1452351 1919 1762 867 619 --1579 --
NM_002720chr161239 ------
NM_002721chr91360 --1498 --
NM_002725chr1114403 4260 4225 4174 3801 1761 1675 1473 479 253 90 1116 ----
NM_002726chr61173 ------
NM_002731chr172797 2574 666 656 278 239 79 --1103 1843
NM_002734chr1751980 1522 890 240 23 ------
NM_002736chr71114 11895 ----
NM_002737chr17166496 6325 5888 5851 5801 4284 4121 2449 2390 2126 1786 1778 1651 1414 1065 168 25000 174 ----
NM_002738chr16124 ------
NM_002742chr141537 ------
NM_002745chr22144447 4071 3998 3916 3310 3207 3103 2946 1257 1242 1044 336 318 119 13424 22760 1547 --
NM_002748chr15------11167
NM_002755chr153843 326 83 1884 1691 --
NM_002763chr1--1514 1419 --
NM_002764chrX5889 679 643 630 214 1806 1958 --
NM_002790chr1155 ------
NM_002815chr17----123 --
NM_002819chr1951402 1022 548 523 328 ------
NM_002821chr62563 178 ------
NM_002827chr2031454 1290 185 ----11270
NM_002833chr1571327 1200 639 627 368 320 155 140 21161 499 --
NM_002835chr71618 1674 --1224
NM_002836chr20----1180 --
NM_002839chr973225 2660 1302 1035 808 494 90 12676 33255 3209 59 --
NM_002840chr131336 385 326 ------
NM_002841chr31434 2637 593 ----
NM_002843chr1193271 3132 2425 2180 1140 911 899 889 740 12340 ----
NM_002849chr123958 822 33 ------
NM_002850chr1921142 240 --1769 --
NM_002855chr1173507 2676 1476 1382 1359 1342 257 22711 1037 ----
NM_002857chr1142650 2556 2460 2420 2128 1690 747 733 505 383 371 300 276 168 1956 21021 970 --
NM_002858chr13554 358 236 ------
NM_002859chr1241608 1334 1244 331 --21301 395 --
NM_002868chr12112265 2032 1989 1928 1712 1676 1588 616 537 392 328 --31750 1659 367 --
NM_002869chr1121759 100 21487 512 ----
NM_002874chr932097 822 404 12284 ----
NM_002880chr34871 565 173 72 ------
NM_002886chr3135033 4821 4670 3777 3365 3311 3302 1865 1347 1255 1235 1140 542 --21437 581 --
NM_002890chr5175 ----1357
NM_002891chr151125 ------
NM_002892chr1431433 1102 155 ------
NM_002895chr203774 617 67 ------
NM_002897chr21589 --1538 --
NM_002898chr123639 616 178 ------
NM_002902chr15136 --1679 --
NM_002906chr1131734 720 375 1444 ----
NM_002911chr1941402 1053 553 347 ------
NM_002912chr61359 1795 ----
NM_002930chr18298 21 ------
NM_002941chr311316 11240 ----
NM_002945chr172858 591 --1645 --
NM_002955chr651956 1667 1551 582 542 21992 1703 ----
NM_002956chr1231020 942 885 ------
NM_002959chr1104145 4127 4119 3334 3075 2912 1112 964 892 616 14243 1260 --
NM_002968chr16198 ----1907
NM_002971chr321021 744 ------
NM_002977chr262849 2448 1185 957 730 92 ----1902
NM_002979chr11761 1623 1746 --
NM_002994chr431570 1517 67 3605 520 373 11965 --
NM_002995chr12266 115 1337 1594 --
NM_002996chr1651820 1480 1458 1388 270 --1422 --
NM_002998chr842035 1718 787 419 ------
NM_003001chr172243 2143 1587 1542 1514 451 114 ------
NM_003010chr1732432 2231 1786 1707 ----
NM_003011chr9111659 1361 589 474 421 384 311 239 205 53 30 --1132 --
NM_003012chr892567 2328 2083 1961 1236 1141 943 687 156 ----13015
NM_003016chr1711574 21580 1419 ----
NM_003021chr195980 817 253 172 31 1187 ----
NM_003026chr91954 --2423 372 1508
NM_003027chr152130 88 ------
NM_003029chr131431 1309 43 1449 --11232
NM_003030chr31762 --11359 --
NM_003031chr162859 758 1383 ----
NM_003034chr12117044 6325 6072 5316 5089 4915 3075 940 910 722 516 48112 7033 2298 1492 27579 6261 --
NM_003042chr371801 1768 1380 788 686 640 352 31735 858 365 1411 --
NM_003043chr364330 4229 3813 3752 1536 906 11046 ----
NM_003045chr1364864 4853 3696 1529 551 277 --33202 1879 1220 --
NM_003046chr884275 4054 3653 1279 1023 952 731 713 24423 3397 25301 4207 --
NM_003051chr121808 1701 11954 ----
NM_003060chr531203 871 81 --11070 1922
NM_003068chr82278 203 ------
NM_003071chr321901 425 --31832 1444 1376 --
NM_003074chr362284 1689 1404 1396 341 71 21609 849 21967 1740 --
NM_003076chr1271696 1535 1438 507 472 204 185 ------
NM_003077chr173848 157 61 ------
NM_003081chr203763 436 180 --2390 188 --
NM_003085chr54110 77 47 41 ------
NM_003091chr20----1233 --
NM_003100chr51454 ------
NM_003104chr152139 91 11186 ----
NM_003107chr612218 11910 ----
NM_003108chr2126506 5684 5642 4785 4498 2264 1963 1842 1817 1613 1040 277 44622 4440 856 283 37268 259 52 --
NM_003110chr172851 770 11050 ----
NM_003111chr221073 64 11090 ----
NM_003112chr722760 1016 33219 468 284 --12670
NM_003113chr22322 69 ------
NM_003128chr262875 2776 2225 880 272 99 31904 1895 32 11961 --
NM_003130chr731119 913 53 1109 ----
NM_003137chr671696 617 349 312 276 97 76 2627 295 1733 --
NM_003140chrY147 ------
NM_003144chr61861 --1323 --
NM_003150chr1741825 942 700 321 ------
NM_003152chr173242 136 24 ------
NM_003155chr872806 2531 2420 2254 2231 354 108 ------
NM_003156chr115318 164 69 56 37 11182 1360 --
NM_003161chr1743128 1080 638 362 11145 ----
NM_003165chr961751 1541 1491 598 520 514 11630 1179 --
NM_003170chr172119 82 ------
NM_003173chrX21238 519 ------
NM_003178chr352237 1754 1595 1480 178 ------
NM_003181chr64695 559 185 131 ------
NM_003185chr202522 465 11349 ----
NM_003188chr61158 1779 ----
NM_003189chr143255 2844 1356 381 --11336 --
NM_003199chr1864641 4037 3659 2231 1703 1696 2588 51 24468 805 --
NM_003200chr1972207 2020 1574 855 686 664 593 12060 ----
NM_003202chr531742 448 114 ------
NM_003203chr272429 2314 1687 564 375 245 83 1765 21881 53 --
NM_003204chr1721736 1285 ------
NM_003215chr441402 1246 1132 405 ------
NM_003216chr22123335 3208 3169 3134 2078 1333 1023 686 575 507 330 183 33049 2974 660 12816 --
NM_003217chr1271731 1655 617 417 385 220 57 12032 ----
NM_003220chr631478 1199 683 31687 1114 457 11338 --
NM_003221chr6153883 3620 3518 3430 3282 3110 2952 2865 2774 1647 1090 986 957 522 312 12897 1800 --
NM_003223chr162643 26 1310 1120 --
NM_003236chr233042 2395 1296 23445 648 22150 1384 --
NM_003242chr352292 1827 952 671 613 11531 ----
NM_003246chr1531419 250 108 ------
NM_003247chr631633 75 49 --1110 --
NM_003253chr211560 --11809 --
NM_003255chr1782624 2365 2055 2042 1650 291 152 78 --2835 431 --
NM_003262chr3104259 4150 3704 3692 3454 3391 1460 1232 441 150 15082 ----
NM_003269chr621115 355 ------
NM_003275chr921117 597 --11139 --
NM_003286chr2031141 795 434 1335 ----
NM_003288chr2041584 1154 307 238 11541 ----
NM_003289chr93202 47 33 1179 ----
NM_003290chr194835 314 184 58 2237 226 177 --
NM_003292chr131766 591 182 1532 ----
NM_003297chr12--1209 1327 --
NM_003298chr3125709 5361 5340 4827 4252 4207 1632 868 799 756 377 177 24150 3817 13998 --
NM_003309chr651751 584 565 508 131 ----11882
NM_003320chr1184308 4181 4061 3571 2771 1244 793 161 23584 3547 ----
NM_003336chrX3930 404 130 1769 ----
NM_003337chr531193 478 126 1450 ----
NM_003339chr521407 1199 --165 --
NM_003340chr411193 --163 --
NM_003342chr1742537 2192 2020 974 41215 576 487 433 1688 --
NM_003347chr2292268 2065 1689 1428 869 597 553 353 217 ------
NM_003348chr1221273 403 11212 21522 129 --
NM_003349chr202998 371 ------
NM_003352chr23220 109 38 ------
NM_003368chr11117 ------
NM_003369chr1142573 891 663 524 ------
NM_003370chr194258 227 219 32 ------
NM_003374chr51580 --1198 --
NM_003376chr671804 1709 1518 1358 1246 244 133 11367 ----
NM_003376chr671804 1709 1518 1358 1246 244 133 11367 ----
NM_003387chr252188 1878 1811 356 87 2951 934 21150 380 --
NM_003390chr114889 800 737 365 ------
NM_003392chr353153 2969 2691 1543 513 ----12710
NM_003394chr124724 665 99 78 ------
NM_003403chr14178 ------
NM_003404chr2021757 59 ------
NM_003405chr224685 212 63 29 --1141 --
NM_003406chr831680 1595 1228 11446 1540 --
NM_003407chr193579 564 68 --154 --
NM_003409chr182251 175 --1326 --
NM_003410chrX42902 2079 1239 561 22594 2418 11940 --
NM_003411chrY21842 675 1585 11150 11503
NM_003412chr382672 2307 2284 1947 1117 1107 188 120 ------
NM_003413chrX1790 11902 ----
NM_003418chr3126 --1313 --
NM_003432chr5173 ------
NM_003439chr752826 2355 1002 725 595 ------
NM_003453chr13----1677 --
NM_003458chr3123999 3961 3843 3834 3174 3049 2920 1318 1305 967 949 525 --23406 2801 --
NM_003463chr662804 2776 2563 995 982 444 23134 2359 ----
NM_003466chr262433 2256 1560 956 619 353 ------
NM_003468chr274138 3016 2951 1490 1313 1248 997 --12804 12778
NM_003470chr1691864 1618 1533 1332 504 421 325 314 300 11875 11363 --
NM_003471chr332343 2302 122 ------
NM_003473chr1031048 744 230 11089 1999 --
NM_003474chr10--12240 1790 --
NM_003478chr1142938 2766 340 184 32358 965 353 32798 2370 1209 --
NM_003481chr122505 107 --1495 --
NM_003482chr1282672 2627 2600 1778 922 573 554 522 --12123 --
NM_003483chr1262192 1065 1049 622 541 208 --12785 --
NM_003487chr17128 --121 --
NM_003489chr2162848 2840 2194 869 750 610 32783 929 687 ----
NM_003502chr163535 267 162 --1457 --
NM_003503chr131318 470 243 ------
NM_003505chr77701 606 574 385 167 133 119 11214 1733 --
NM_003507chr231380 566 504 ------
NM_003559chr17123433 3117 2855 2406 1289 996 989 929 610 484 443 280 --13602 13063
NM_003563chr1761492 1421 1262 565 495 225 --41291 1157 1142 1010 --
NM_003564chr15576 270 235 195 108 ------
NM_003566chr1263185 2304 2275 1261 920 455 32701 976 505 22542 754 --
NM_003574chr1894124 1772 1591 960 695 517 437 347 43 2479 151 23608 3493 25332 251
NM_003576chr1372139 1913 753 186 59 42 34 42852 2726 1872 665 1912 --
NM_003581chr22242 114 1960 ----
NM_003583chr1263208 854 805 773 670 398 ------
NM_003586chr162486 210 1412 ----
NM_003587chr6137 ------
NM_003589chr13--1410 21222 292 --
NM_003590chr253689 1527 227 149 95 12869 ----
NM_003597chr232300 2037 911 --11719 --
NM_003602chr74443 437 330 284 ------
NM_003607chr193847 3789 1613 1564 1101 1009 734 421 68 13853 ----
NM_003615chr341517 981 828 182 22712 887 ----
NM_003618chr231300 1003 964 ------
NM_003620chr1771107 924 805 771 718 269 245 1987 ----
NM_003627chr112421 222 ------
NM_003629chr183035 2816 2290 1329 1109 1093 813 432 33190 2988 911 12952 --
NM_003631chr103411 280 138 --1323 --
NM_003632chr172833 356 --1287 --
NM_003633chr572614 2437 1889 1882 638 331 258 ------
NM_003636chr141870 591 382 49 --11813 --
NM_003637chr141527 1488 1452 337 --1290 --
NM_003644chr17216151 6023 5945 5728 5202 4902 4719 4686 4482 4172 2170 2148 1700 1352 1253 1138 485 414 369 293 217 --35793 4344 1087 --
NM_003651chr122546 487 ------
NM_003654chr114264 160 141 114 ------
NM_003660chr191259 ----1313
NM_003663chr333423 849 339 11112 --1708
NM_003664chr51468 ------
NM_003670chr351026 982 926 222 34 ------
NM_003671chr992995 2925 2584 2245 2227 920 816 745 315 1951 33078 1203 734 --
NM_003672chr13679 502 483 136 ----
NM_003677chr1262163 1978 746 738 438 286 ------
NM_003685chr192802 357 ------
NM_003688chrX2263 93 ------
NM_003704chr42530 440 ------
NM_003714chr532770 2683 844 11005 ----
NM_003716chr33829 280 55 ------
NM_003722chr332717 2470 1990 22128 485 12096 --
NM_003735chr571683 1586 1298 1273 1166 486 383 ------
NM_003736chr571683 1586 1298 1273 1166 486 383 ------
NM_003737chr112363 337 ------
NM_003743chr251834 1609 921 872 583 11763 ----
NM_003744chr141369 41107 1009 996 258 ----
NM_003746chr12--1259 ----
NM_003749chr134906 804 347 191 ------
NM_003750chr101813 ------
NM_003758chr1531082 69 47 31526 1499 1360 --11616
NM_003758chr1531082 69 47 31526 1499 1360 --11616
NM_003759chr473518 3135 3054 2845 2610 1105 283 24050 1386 53387 744 579 428 376 1321
NM_003763chr2042921 2557 2188 198 12739 23142 2857 1524
NM_003768chr191633 1556 747 601 591 555 311 194 51 11578 1546 --
NM_003773chr31253 154 1294 --
NM_003774chr1293341 3290 3092 2833 2418 2359 2176 1230 836 1786 23226 249 --
NM_003787chr182609 137 ----11514
NM_003794chr32432 22 ------
NM_003798chr9--173 ----
NM_003800chr632397 2054 422 --1917 1765
NM_003816chr821303 397 ------
NM_003822chr122022 496 12622 ----
NM_003825chr151193 11396 ----
NM_003858chr142613 506 ------
NM_003860chr112337 313 ------
NM_003861chr1472902 2167 2027 859 368 241 144 11987 22828 574 12058
NM_003862chr51250 --1333 --
NM_003872chr292711 2678 1197 1165 940 836 435 270 75 --11877 --
NM_003873chr1011835 11005 ----
NM_003877chr126894 856 690 239 208 176 1698 ----
NM_003884chr32597 149 --21687 496 --
NM_003885chr1732309 1902 124 12657 ----
NM_003887chr262256 1924 908 488 347 37 ------
NM_003888chr1581359 1321 1304 1230 1097 420 102 45 ------
NM_003895chr2142047 1351 276 216 --1592 --
NM_003902chr13669 593 124 ------
NM_003908chr2041341 454 313 140 ------
NM_003909chr882977 2811 1886 1022 969 921 466 114 --12398 --
NM_003913chr631580 830 495 24053 2905 1464 --
NM_003916chrX31279 949 61 1264 ----
NM_003922chr15126 ----1431
NM_003924chr431417 1405 651 ------
NM_003931chr6--2475 105 263 47 --
NM_003932chr2231803 699 448 21862 1734 ----
NM_003938chr194990 298 209 183 ------
NM_003939chr1093330 3147 3089 1383 895 649 636 372 289 23464 2861 22923 2675 --
NM_003948chr452342 1976 1946 966 112 --12424 --
NM_003949chr1741931 1741 1712 1699 ------
NM_003953chr162632 2360 2344 2210 876 306 22350 2151 1824 --
NM_003958chr693894 3740 2639 1307 870 741 684 512 283 1888 23411 2992 --
NM_003966chr5146634 6421 5322 5242 2740 2717 2693 2682 2669 2646 2333 1946 1402 41 37582 2567 2352 47141 6172 2960 1347 --
NM_003971chr17168 --139 --
NM_003975chr11104 ------
NM_003980chr631015 590 64 ------
NM_003983chr16114399 4146 3840 3690 3616 3196 3183 1601 1154 1040 369 32790 867 497 34272 613 550 --
NM_003994chr1273370 3092 1545 1309 815 606 420 12721 11679 11706
NM_004006chrX42048 1962 526 49 22139 2029 ----
NM_004007chrX42048 1962 526 49 22139 2029 ----
NM_004009chrX42048 1962 526 49 22139 2029 ----
NM_004010chrX42048 1962 526 49 22139 2029 ----
NM_004011chrX42048 1962 526 49 22139 2029 ----
NM_004012chrX42048 1962 526 49 22139 2029 ----
NM_004013chrX42048 1962 526 49 22139 2029 ----
NM_004014chrX42048 1962 526 49 22139 2029 ----
NM_004015chrX42048 1962 526 49 22139 2029 ----
NM_004016chrX31962 1876 440 22053 1943 ----
NM_004017chrX42048 1962 526 49 22139 2029 ----
NM_004018chrX31962 1876 440 22053 1943 ----
NM_004020chrX42048 1962 526 49 22139 2029 ----
NM_004021chrX31962 1876 440 22053 1943 ----
NM_004022chrX31962 1876 440 22053 1943 ----
NM_004023chrX31962 1876 440 22053 1943 ----
NM_004028chr1883848 3546 2739 2560 1620 554 349 57 1493 12694 --
NM_004035chr1763934 3180 1819 556 538 250 --11095 --
NM_004036chr24549 478 265 233 ------
NM_004037chr14351 141 108 82 ------
NM_004050chr1492312 2001 1809 1723 966 762 609 591 394 --22332 745 --
NM_004055chr114746 475 208 142 --198 --
NM_004061chr53643 533 145 ------
NM_004063chr81660 1751 --1123
NM_004067chr741256 1066 623 512 ------
NM_004080chr731285 442 298 ------
NM_004081chrY11827 --11786 --
NM_004087chr371517 1350 1337 1326 1261 56 25 1284 1459 --
NM_004089chrX3453 409 193 ------
NM_004090chr17143216 2932 2840 2738 2660 2545 2449 2239 740 624 389 366 353 202 21176 609 12615 --
NM_004093chr1352706 2379 1309 491 61 --12644 --
NM_004094chr143722 553 437 11090 --12803
NM_004097chr23863 569 285 ------
NM_004098chr102978 933 11182 ----
NM_004100chr632573 2542 2384 11961 1610 --
NM_004103chr84733 714 696 118 1724 ----
NM_004112chr1751256 1240 1212 433 360 11640 ----
NM_004113chr34152 70 47 36 ------
NM_004114chrX174 1797 ----
NM_004124chr1443515 2730 688 354 1200 12279 --
NM_004156chr81503 1418 ----
NM_004161chr22461 170 11364 ----
NM_004162chr341126 1038 810 183 ------
NM_004171chr11249282 9225 9199 9017 8656 8506 8299 8211 7816 6580 6574 6532 5950 3702 3176 2808 2465 2284 1708 1448 1438 1054 922 293 37274 6516 407 13855 --
NM_004175chr222480 107 --130 --
NM_004180chr22460 245 ------
NM_004185chr11628 ----1166
NM_004199chr53385 84 33 --173 --
NM_004210chr1082128 1454 857 669 574 250 241 89 ------
NM_004215chr81368 ------
NM_004229chrX21840 591 11617 1346 --
NM_004232chr1853178 2900 1515 981 883 1506 1302 11550
NM_004235chr91347 --1749 --
NM_004236chr152425 28 ------
NM_004255chr15--1112 ----
NM_004261chr12987 28 ------
NM_004263chr2101637 1606 1419 1377 1349 1123 518 486 407 108 --1693 --
NM_004268chr112801 300 --11217 --
NM_004272chr541674 765 590 47 ------
NM_004274chr1472887 1025 543 333 320 217 160 ------
NM_004277chr61169 11514 ----
NM_004279chr741943 1897 699 374 12334 11737 --
NM_004293chr993462 3016 2748 2689 347 286 223 117 56 12461 --1728
NM_004295chr1751269 1224 1077 543 246 1441 ----
NM_004296chr14103971 3893 3427 2728 1450 1410 1027 512 322 237 186 12684 --
NM_004302chr1242286 2222 774 389 ------
NM_004304chr22377 25 1288 ----
NM_004311chr1083053 2976 2941 2908 2729 2565 2138 800 --1416 --
NM_004319chr152506 2456 2212 849 380 1652 1703 --
NM_004320chr16172 ------
NM_004321chr263418 3172 2704 1115 728 700 13289 21430 1261 --
NM_004323chr972343 2170 865 818 649 205 60 --32570 2409 616 --
NM_004326chr161038 993 952 848 842 799 --21140 342 --
NM_004338chr18146559 6049 5911 5618 4719 4695 4687 2818 2507 2309 2025 1944 553 147 12561 14546 --
NM_004342chr722287 2106 ------
NM_004349chr811079 --11193 --
NM_004350chr192255 1996 1882 1841 1760 938 788 642 365 ------
NM_004356chr111550 --1455 --
NM_004364chr1951184 1120 1013 501 160 ------
NM_004370chr631878 676 527 ------
NM_004371chr16962 620 601 383 223 143 11266 ----
NM_004376chr1031142 1118 505 11308 ----
NM_004379chr221244 617 ------
NM_004380chr1651702 1635 913 194 27 11726 ----
NM_004384chr51474 1947 11429 --
NM_004389chr2----1230 --
NM_004392chr1332654 1738 1645 --191 --
NM_004393chr342337 1786 1682 718 --1774 --
NM_004395chr51182 --1713 --
NM_004397chr1164081 4017 3755 3225 1671 76 14171 1597 --
NM_004411chr71791 --172 --
NM_004417chr52128 102 ------
NM_004420chr1192419 2338 1939 1877 1591 1577 843 836 454 --11897 --
NM_004426chr1251679 1614 1575 1409 520 1791 ----
NM_004427chr13779 407 286 --11114 --
NM_004429chrX41030 960 556 59 --11168 --
NM_004430chr862608 2234 1739 985 923 796 1896 ----
NM_004432chr92742 407 11569 ----
NM_004436chr11577 ------
NM_004437chr163268 2396 1407 1233 433 188 --1573 --
NM_004440chr651897 593 412 282 107 1387 11567 --
NM_004441chr371276 1206 1196 818 467 447 418 ------
NM_004447chr12--1254 1452 --
NM_004450chr141277 ----1404
NM_004454chr351928 1546 662 139 94 ----1887
NM_004455chr131092 917 343 --1438 --
NM_004457chr221634 1079 --21266 186 --
NM_004458chrX32274 468 220 21774 847 --11943
NM_004459chr1731659 1514 1337 --11790 --
NM_004468chr12401 58 ------
NM_004472chr52190 51 ------
NM_004475chr174744 257 161 23 1196 11193 --
NM_004480chr141702 1533 ----
NM_004481chr172224 2110 1819 873 497 431 258 --22469 2290 --
NM_004482chr2--1660 1753 --
NM_004485chr183804 3477 3386 2758 2724 443 179 28 32781 1711 375 32931 2812 919 --
NM_004494chr131242 1194 37 --41221 1066 808 271 --
NM_004496chr1431154 303 290 ------
NM_004500chr1451907 647 311 186 133 ----11984
NM_004501chr143300 1623 1252 1104 --33893 3459 119 --
NM_004503chr126780 669 633 218 187 32 ------
NM_004504chr232925 2841 499 ------
NM_004505chr1731515 422 356 1652 ----
NM_004514chr1783071 2625 1157 1022 992 853 807 586 --1436 --
NM_004519chr82245 192 ------
NM_004520chr52536 120 ------
NM_004527chr1721299 84 --1306 --
NM_004529chr91186 11112 --1574
NM_004535chr2031693 1439 346 --11492 --
NM_004549chr1121560 1412 ------
NM_004554chr141642 21500 596 ----
NM_004561chr1151673 1361 1353 688 531 ------
NM_004575chr441462 1259 579 60 --1244 --
NM_004586chrX83896 3385 1594 1242 868 432 157 132 45140 4912 1940 850 --1347
NM_004588chr1173709 3609 2640 1099 510 259 180 23676 679 33647 3242 2840 --
NM_004592chr12------1169
NM_004593chr3----2896 72 --
NM_004595chrX1114 1103 ----
NM_004598chr593188 3127 2785 2121 1177 992 590 423 267 22928 1056 3866 817 96 11127
NM_004602chr2031426 562 228 ------
NM_004612chr974531 3523 1582 699 443 113 28 34809 1795 1357 21612 190 --
NM_004619chr131757 1498 279 2214 120 12171 --
NM_004630chr1141104 1039 959 273 ------
NM_004631chr111230 21258 1222 ----
NM_004637chr351288 1237 1115 889 31 ------
NM_004640chr6137 ------
NM_004641chr1021118 606 --1119 --
NM_004643chr143742 727 536 ------
NM_004645chr174745 578 536 279 ------
NM_004654chrY--126 ----
NM_004655chr1721209 539 --1875 --
NM_004656chr36824 818 427 376 152 59 ------
NM_004660chrY12083 --11592 --
NM_004663chr15--1618 11391 --
NM_004670chr1021367 1131 ------
NM_004673chr131493 1481 1156 ------
NM_004685chr1332319 2220 981 1320 ----
NM_004686chr84568 437 348 310 ------
NM_004687chr1722002 741 11386 21736 77 --
NM_004690chr62504 154 ------
NM_004703chr1752349 2121 1887 528 282 --21682 1565 --
NM_004709chrX31565 1309 542 ------
NM_004715chr182707 692 ------
NM_004717chr741400 1386 430 107 11506 ----
NM_004718chr2--1648 154 --
NM_004719chr123882 503 189 22727 2717 ----
NM_004723chr12353 117 ------
NM_004726chrX55321 4489 3838 1667 145 33641 3487 1502 21339 734 --
NM_004730chr572004 1928 1791 765 538 531 223 ------
NM_004734chr1332280 922 266 12923 1596 --
NM_004736chr141894 1420 458 52 --11991 11429
NM_004737chr2241129 1073 180 122 --1242 --
NM_004738chr2062447 2440 2431 1711 1605 838 1341 ----
NM_004742chr371864 1809 1245 361 302 262 127 1434 1655 --
NM_004744chr443838 3529 2930 708 ------
NM_004745chr8126492 6178 5887 5007 4897 4891 4398 4267 2244 1481 1152 794 16634 14953 --
NM_004748chr1564098 3571 2868 1361 1313 1242 22936 303 ----
NM_004760chr72627 359 12479 12210 --
NM_004768chr12831 51 1322 ----
NM_004772chr521159 506 ------
NM_004774chr1772847 2150 1119 897 429 343 222 ------
NM_004783chr16----1481 1520
NM_004788chr114912 352 290 70 1721 2274 86 --
NM_004792chr2--173 ----
NM_004796chr1452249 2005 934 743 330 11616 ----
NM_004798chr20133617 3535 2923 2723 2563 920 681 625 375 345 328 289 168 --22549 1262 --
NM_004801chr221426 81 11447 1456 --
NM_004815chr1104377 4357 4336 3900 3889 3508 3424 3369 2989 886 13243 14014 14037
NM_004821chr55784 623 614 600 589 --1188 --
NM_004822chr1793913 3474 3231 3212 2650 2565 1223 925 764 --23828 3082 --
NM_004824chr621016 395 ------
NM_004831chr196780 766 754 428 300 156 1927 ----
NM_004834chr283008 2731 2685 1348 331 325 158 66 13419 ----
NM_004839chr151151 --1617 --
NM_004844chr341130 357 351 281 1891 ----
NM_004845chrX123811 3370 3274 2922 2914 2875 2852 2832 1541 1359 1119 321 --13321 --
NM_004850chr231621 1456 183 ------
NM_004857chr1474008 3742 3664 3307 1919 1397 365 14183 --1617
NM_004859chr1712154 1358 ----
NM_004863chr14155060 4082 4015 3929 3768 3629 3511 1841 1627 1244 1137 1056 969 308 190 23327 654 15094 --
NM_004866chr553532 1008 816 403 153 13545 ----
NM_004867chrX123 ------
NM_004871chr1764102 3915 3739 3118 998 882 --13926 --
NM_004873chr1453138 2938 2246 1244 931 23070 756 22477 240 13257
NM_004884chr1531672 571 206 11417 21568 223 --
NM_004893chr51538 ------
NM_004896chr1031424 1071 373 1131 --11030
NM_004897chr103929 639 77 1198 ----
NM_004898chr43695 478 130 32756 2591 630 ----
NM_004902chr201213 ----1863
NM_004904chr7116526 6001 4962 4719 4699 4643 2098 1698 682 662 564 66361 5869 5473 4763 4712 4495 24511 55 --
NM_004905chr12932 712 ------
NM_004912chr741749 1548 1100 200 --1406 --
NM_004922chr1031005 663 108 --1327 --
NM_004924chr193926 840 166 --3363 343 306 --
NM_004926chr1431781 1496 1317 ------
NM_004937chr1782192 2169 2113 1036 892 705 664 238 ------
NM_004938chr92460 73 ----2941 378
NM_004947chr372598 2130 1606 720 428 247 209 1258 11718 --
NM_004953chr3----1300 --
NM_004956chr783145 3074 3001 1431 1136 878 460 41 --33254 3015 816 --
NM_004961chrX41351 1298 602 523 11060 ----
NM_004968chr71634 ------
NM_004972chr931077 867 745 1210 ----
NM_004973chr631678 1113 1068 ------
NM_004976chr11115196 4333 4189 3563 3170 2006 1505 564 411 397 314 157 34447 1481 465 --
NM_004978chr171556 1354 1301 505 477 408 265 1662 21598 218 --
NM_004979chrX51048 1034 827 807 51 ------
NM_004985chr1254204 2750 1429 665 553 11341 ----
NM_004992chrX218247 7837 7523 7160 7051 6984 6805 6787 5824 5166 3007 2520 2292 2227 2048 2010 1302 1270 1256 1217 1062 32457 2237 957 56164 5434 2367 675 59 12073
NM_004992chrX218247 7837 7523 7160 7051 6984 6805 6787 5824 5166 3007 2520 2292 2227 2048 2010 1302 1270 1256 1217 1062 32457 2237 957 56164 5434 2367 675 59 12073
NM_004993chr1451369 1316 1245 1017 507 ------
NM_004995chr1441077 1071 617 372 ------
NM_004996chr1661714 1471 1463 1215 1189 494 ------
NM_005010chr742261 2144 2137 1888 --11920 --
NM_005011chr721223 89 --21752 1270 --
NM_005020chr72565 520 --1528 --
NM_005021chr62150 142 2277 108 ----
NM_005023chr521424 1256 ------
NM_005028chr1042271 2244 2035 827 ------
NM_005030chr16----1267 --
NM_005056chr12175569 5021 5015 4971 4157 4142 4130 3522 2035 1981 1696 1581 1445 1408 704 482 195 14439 22051 1676 --
NM_005063chr10143764 3433 3087 3002 2901 1529 1473 1132 795 672 381 264 238 217 2270 204 123 --
NM_005065chr1443759 3685 2030 321 34885 2003 1904 25114 1853 11795
NM_005066chr12239 198 1718 ----
NM_005067chr3--1392 1351 --
NM_005068chr61136 21462 1148 ----
NM_005077chr9----2372 346 --
NM_005078chr1571741 1475 1451 410 348 330 315 --21334 1168 --
NM_005079chr853003 2269 2262 370 124 33121 1218 426 1212 --
NM_005080chr222738 275 ----1783
NM_005087chr32785 115 ------
NM_005088chrX1911 ----1231
NM_005093chr20105385 4116 3321 2133 2044 1298 1189 1163 851 256 14515 33800 3411 913 --
NM_005095chr132173 1581 876 12241 1640 --
NM_005096chrX81256 1114 1016 815 436 381 118 59 --11191 --
NM_005105chr151912 1533 632 384 29 1106 11642 --
NM_005109chr382596 2531 2287 2228 2137 1013 418 159 ------
NM_005112chr441037 859 394 148 ------
NM_005114chr42527 235 --1633 --
NM_005116chr20124316 4231 4148 2919 2846 983 968 686 406 318 304 270 --34098 4067 54 --
NM_005119chr131080 432 398 11287 ----
NM_005121chr1742996 2390 1339 436 1442 ----
NM_005124chr61136 ------
NM_005126chr32735 369 ------
NM_005128chr212654 246 ------
NM_005134chr181847 1312 ----
NM_005135chr1543808 3578 3165 3157 23523 662 23416 752 --
NM_005137chr2261985 1626 837 732 198 63 1246 ----
NM_005151chr183625 426 298 12063 ----
NM_005153chr164765 520 109 75 ------
NM_005154chr15----1466 --
NM_005156chr975349 4741 3797 3644 1963 1523 200 65413 4321 3714 3351 1932 623 ----
NM_005157chr941789 755 246 218 --21744 715 --
NM_005160chr22136646 6608 6438 6404 6093 5741 5682 5642 4949 2637 2061 2009 1354 26059 4272 22104 880 --
NM_005168chr221493 1239 1404 11299 --
NM_005169chr113579 498 45 --1604 --
NM_005184chr1961408 211 191 68 47 35 ------
NM_005186chr114575 506 273 105 ------
NM_005188chr11177285 5972 5537 5460 3142 3136 3077 2982 2783 2464 2310 2201 1367 1358 1227 400 226 27131 5552 57362 2922 2737 1799 85 --
NM_005190chr63922 358 190 ------
NM_005197chr14125509 5469 4948 4854 4807 4568 4381 4375 1493 1470 1261 140 --11734 --
NM_005207chr2263527 3507 3146 2416 292 55 33304 3169 1275 ----
NM_005214chr21119 --1839 --
NM_005215chr181169 1511 ----
NM_005219chr551751 1566 1280 481 465 ------
NM_005220chr1751288 960 447 122 110 ------
NM_005224chr191459 --1699 --
NM_005229chrX51284 1092 1046 877 803 ------
NM_005230chr122391 241 ------
NM_005233chr332297 825 511 31801 1007 589 ----
NM_005235chr2187617 7064 6814 5937 5763 5509 5475 5159 3035 2601 2547 2443 2337 1582 1488 409 81 63 87576 7025 6446 6133 2164 1959 870 679 46439 5561 2803 2115 --
NM_005238chr1183039 2866 2661 2573 2505 2452 1398 865 12177 ----
NM_005241chr33982 957 390 ------
NM_005252chr143306 189 97 --1299 --
NM_005256chr111945 ------
NM_005257chr1811269 --21286 1172 1485
NM_005259chr22993 258 ------
NM_005264chr103170 145 69 ------
NM_005274chr11143 ------
NM_005277chr431602 1415 640 ------
NM_005302chr7--179 ----
NM_005311chr752571 1904 1794 1013 781 ------
NM_005316chr1131081 981 953 ------
NM_005318chr224940 874 76 66 21166 172 --1953
NM_005324chr1711456 1464 1320 --
NM_005328chr82592 47 1250 ----
NM_005329chr1611719 --11575 1110
NM_005336chr292204 2028 2022 1877 645 551 434 406 371 ------
NM_005339chr453637 1167 814 707 572 ------
NM_005342chrX32143 2043 137 21988 68 ----
NM_005359chr1896026 5960 5827 4371 4351 2463 2386 2369 829 25349 669 36460 4985 4302 --
NM_005375chr61805 ------
NM_005376chr1191 --1314 --
NM_005388chr941602 1343 1267 336 11669 2109 72 11144
NM_005392chr971735 1590 1362 1187 1180 491 348 11672 1148 --
NM_005397chr763525 1436 1398 554 293 151 --1975 --
NM_005398chr1031130 267 260 ------
NM_005399chr193578 3336 2800 2768 2724 2683 1208 705 46 22926 581 ----
NM_005400chr272994 2971 2670 1963 979 957 145 ------
NM_005402chr721867 1563 ------
NM_005406chr1831581 1377 141 ------
NM_005407chr145386 318 312 145 124 21277 1251 ----
NM_005409chr41420 ----1975
NM_005412chr123500 181 142 ------
NM_005413chr22365 91 ------
NM_005415chr23484 314 236 ------
NM_005417chr2051721 1496 1270 650 281 --11854 --
NM_005430chr125997 898 843 818 380 ------
NM_005433chr182907 308 12810 1689 12375
NM_005434chr231735 1113 139 21279 723 1238 --
NM_005436chr1042545 704 608 74 24088 890 12996 --
NM_005439chr123451 183 25 ------
NM_005440chr17103283 3266 3231 2847 2774 2484 2441 2333 508 386 12490 23088 703 --
NM_005443chr42466 65 1126 ----
NM_005445chr10----1125 --
NM_005455chr121436 742 11225 1656 --
NM_005458chr941667 805 797 206 1250 ----
NM_005474chr1761594 1230 1059 420 234 105 --21115 266 --
NM_005475chr1273016 2751 1076 777 340 265 85 11133 --13046
NM_005487chr2261910 1633 1571 526 337 77 ------
NM_005493chr6--1270 ----
NM_005497chr17136138 5663 5578 5322 4682 4525 4334 4161 2290 2116 1012 851 402 25858 712 ----
NM_005499chr191125 --172 --
NM_005502chr943018 2248 327 53 ------
NM_005504chr12146181 4755 4371 4282 2445 2040 1766 1708 1683 1626 1578 1545 1292 289 35694 5368 4220 1616 --
NM_005509chr5--2433 402 ----
NM_005512chr1151522 1294 799 743 577 ------
NM_005513chr371465 1276 1143 1030 565 204 24 11108 ----
NM_005517chr131238 358 229 21336 389 ----
NM_005520chr52771 725 ------
NM_005522chr761435 1006 392 386 314 110 21284 476 2284 102 --
NM_005524chr32327 48 ------
NM_005537chr132846 129 ------
NM_005544chr23972 954 722 ----1756
NM_005552chr143198 166 84 --1184 --
NM_005561chr134766 756 319 294 --144 --
NM_005562chr141457 1094 676 519 ------
NM_005563chr11835 --1717 --
NM_005565chr51132 1138 ----
NM_005570chr1821040 824 --1473 --
NM_005573chr52252 144 2605 102 ----
NM_005578chr3124801 4783 4767 4369 3743 3201 2047 1920 992 510 488 96 21954 1604 ----
NM_005584chr133253 108 48 1114 ----
NM_005585chr151296 1314 ----
NM_005593chr121439 1449 ----
NM_005595chr11977 1306 1876 --
NM_005596chr985704 5498 4735 4106 2509 925 393 91 24234 275 12008 24147 1416
NM_005599chr121466 528 ----11190
NM_005604chr642029 773 577 53 1189 --22465 132
NM_005607chr83975 868 715 ------
NM_005610chr11832 ------
NM_005611chr162990 167 2924 84 ----
NM_005614chr721020 140 --1417 --
NM_005618chr61629 136 ----
NM_005625chr8146 --1998 --
NM_005634chrX2239 218 ------
NM_005638chrX21656 507 --21720 108 --
NM_005639chr1221552 179 --183 11278
NM_005647chrX42505 2244 838 131 --23223 636 --
NM_005649chr51479 --1493 --
NM_005652chr1661197 1171 1164 816 798 43 11029 ----
NM_005655chr821092 241 ------
NM_005657chr151157 ------
NM_005664chr1531036 785 184 ------
NM_005665chr154785 3844 3659 1902 1472 13050 14147 24453 3252
NM_005668chr564637 3011 2837 1233 578 544 ----13309
NM_005688chr341047 1020 861 402 --125 --
NM_005704chr1--1751 1985 --
NM_005707chr153997 318 141 ------
NM_005711chr5--1215 1880 --
NM_005715chr652034 1771 703 194 35 ------
NM_005717chr11223 1479 --1166
NM_005722chr252163 1882 1555 851 821 150 11971 --
NM_005725chr121586 1560 11809 ----
NM_005730chr1283290 3243 3107 2784 2742 2582 2279 792 --13252 12891
NM_005734chr112643 541 1711 ----
NM_005737chr252898 2860 2590 2057 1924 11067 11158 --
NM_005738chr711788 --2476 197 --
NM_005739chr1571806 1556 1525 898 869 775 176 1328 ----
NM_005746chr742661 2526 2516 2145 ------
NM_005748chr1233351 585 206 11258 ----
NM_005749chr17--1515 ----
NM_005754chr531188 269 170 ------
NM_005756chrX41379 1028 561 484 11034 ----
NM_005759chr294319 3638 3518 3397 3358 1892 939 818 611 21886 1723 24698 1391 --
NM_005768chr12270 54 ------
NM_005776chr141539 --1850 --
NM_005778chr31197 1483 178 --
NM_005779chr523601 30 13149 ----
NM_005780chr1321035 713 ------
NM_005786chr1841073 991 953 92 --1886 --
NM_005789chr1751776 1492 1330 437 205 --11944 --
NM_005796chr16----1252 --
NM_005801chr174196 69 60 39 ------
NM_005802chr91106 1530 1257 --
NM_005808chr3143573 3365 3333 3030 3000 2709 2218 1349 1336 1281 992 949 383 303 ------
NM_005813chr231927 985 313 ------
NM_005814chr191446 1150 1140 937 524 176 97 74 67 ------
NM_005817chr193667 292 34 ------
NM_005822chr652281 1696 1645 823 116 ------
NM_005828chr17174588 4551 3969 3871 3752 3745 3738 1965 1680 1540 1505 580 353 259 252 239 149 13272 12024 14702
NM_005832chr321066 361 --11032 --
NM_005834chrX1237 ------
NM_005840chrX207208 7032 6469 6251 5895 5609 5544 5467 2890 2515 1946 918 659 617 579 567 526 482 124 116 31717 1081 722 35200 2038 674 --
NM_005841chr45928 915 733 153 115 --1873 --
NM_005852chr1741168 1087 831 153 ------
NM_005857chr141440 955 573 367 11405 ----
NM_005859chr51184 11490 1444 --
NM_005862chr31138 1968 ----
NM_005877chr2252137 686 504 223 27 ------
NM_005885chr5162 --2226 44 --
NM_005895chr1223839 1070 34158 2826 2579 11084 --
NM_005898chr1142764 2300 954 95 22720 832 23090 2228 --
NM_005901chr18138316 7918 6830 6435 6415 6326 6287 6128 5334 1824 1617 1016 73 16220 38411 5837 868 --
NM_005903chr584791 4666 3875 3839 3732 1407 934 670 24602 4308 23497 1974 --
NM_005904chr182949 471 ----1426
NM_005906chr621158 1069 11311 156 --
NM_005907chr6260 36 41629 442 188 176 --1682
NM_005909chr564094 3619 3594 2911 2725 1293 ------
NM_005910chr1793886 3528 3243 2999 2819 1122 1012 691 296 ------
NM_005911chr241071 1032 366 192 11201 ----
NM_005920chr1133320 3013 2973 2911 2718 2414 2358 1221 1036 832 531 268 103 --12898 --
NM_005927chr52925 296 1202 ----
NM_005933chr1192760 2425 2417 2353 2242 1947 730 721 272 22482 138 ----
NM_005935chr485279 4162 4071 1811 1665 1466 1131 886 33218 2108 2100 33952 1932 1756 --
NM_005937chr17114009 3600 3175 2782 2623 1408 942 820 676 407 203 13652 22729 1483 --
NM_005941chr843314 2804 946 353 --1221 --
NM_005943chr641140 1120 256 192 ------
NM_005955chr1125112 5087 4967 4091 4034 3971 3395 2175 1490 1197 813 751 14347 --24493 4267
NM_005962chr1072272 2009 1939 1799 1775 1681 327 2535 68 ----
NM_005962chr1072272 2009 1939 1799 1775 1681 327 2535 68 ----
NM_005964chr1751049 1042 495 484 98 ------
NM_005966chr2--12046 --12328
NM_005968chr191255 ------
NM_005996chr1261544 1349 539 375 308 104 21255 1051 1622 --
NM_006007chr911592 23097 2796 22886 2748 --
NM_006011chr15114077 4050 4040 3997 3605 3375 3320 2825 1528 1117 920 13930 14212 --
NM_006015chr181257 1249 1046 1033 991 362 144 130 --1206 --
NM_006030chr351798 1693 1476 1164 97 ------
NM_006034chr1171612 968 688 467 262 145 67 --32490 1765 275 --
NM_006036chr251026 851 844 705 293 ------
NM_006037chr2154698 4376 4096 4045 3522 3184 3127 3103 1647 1276 886 448 103 40 26 --13079 --
NM_006038chr2061826 1662 1456 1401 502 340 1322 ----
NM_006040chr163978 534 60 --11242 --
NM_006047chr2063206 2982 2750 2514 1272 539 --1887 1751
NM_006048chr151205 1115 496 334 267 ------
NM_006054chr1151638 524 452 338 148 --11113 --
NM_006055chr262958 2714 2463 965 410 156 12489 --12987
NM_006060chr764286 3750 3310 3126 2952 955 ------
NM_006064chrX--2397 328 ----
NM_006067chr164888 286 213 179 11024 ----
NM_006071chr222249 112 ------
NM_006079chr61287 2231 73 ----
NM_006080chr712986 11180 ----
NM_006085chr131322 1249 213 ------
NM_006089chrX1575 21783 75 ----
NM_006090chr1----1540 --
NM_006091chr1551747 1400 1385 1290 552 31631 69 57 21251 561 --
NM_006094chr852220 1557 668 321 65 11914 --12368
NM_006095chr443312 1655 1525 195 13977 ----
NM_006106chr11103475 2688 2682 2401 1247 983 920 421 310 155 12508 22669 2629 --
NM_006108chr1171622 732 620 510 457 266 155 --32040 845 480 11846
NM_006116chr2241591 1558 1323 514 ------
NM_006134chr2161476 1344 1272 1184 320 27 ------
NM_006135chr121410 462 --1572 --
NM_006136chr711170 ------
NM_006139chr23540 405 318 1561 11902 --
NM_006145chr194857 825 410 291 ------
NM_006147chr13476 93 23 ----1312
NM_006153chr31246 ----1200
NM_006157chr111379 1276 ----
NM_006158chr851582 1523 1324 1248 572 --1358 --
NM_006159chr121565 1648 ----
NM_006160chr172634 628 ------
NM_006161chr52270 238 --1176 --
NM_006166chr1252552 2543 2228 2148 1966 1845 --12200
NM_006167chr892011 1680 952 943 856 616 606 488 56 --21788 970 --
NM_006178chr173527 268 254 21040 162 21538 1085 11005
NM_006180chr982141 1781 1589 1340 725 229 217 209 --21515 240 --
NM_006183chr12--147 1104 --
NM_006185chr114244 166 159 74 ------
NM_006194chr1441314 532 184 141 ------
NM_006195chr931270 1263 992 1541 21360 950 --
NM_006203chr565435 5119 4004 3742 2229 344 24505 1620 13832 24663 1654
NM_006206chr442553 2427 2240 1794 --123 --
NM_006216chr2161 ------
NM_006223chrX2530 416 ------
NM_006224chr1792429 2395 2066 1916 932 873 856 618 272 1136 21800 1583 --
NM_006237chr1332134 1423 138 22153 1675 1127 --
NM_006241chr352423 1722 1585 830 787 ------
NM_006243chr13795 783 364 1999 ----
NM_006245chr651051 863 833 345 170 ----1871
NM_006246chr142852 147 1447 --1322
NM_006251chr543350 2264 2244 2214 22422 1135 ----
NM_006252chr197605 6702 6546 6311 5180 5057 4973 1480 978 36876 6180 2863 --1881
NM_006256chr152734 2382 1738 465 328 ------
NM_006265chr82968 128 ------
NM_006267chr251842 1789 751 698 329 2662 585 ----
NM_006268chr1151181 983 974 736 79 ------
NM_006275chr2052275 2033 1909 193 100 1529 ----
NM_006281chr83966 283 225 ------
NM_006281chr83966 283 225 ------
NM_006282chr2094657 4430 4307 3789 3393 1410 1003 154 102 1936 34767 4248 3422 --
NM_006283chr894893 4604 3612 3371 1883 1498 1369 602 48 24386 260 13626 --
NM_006306chrX84780 4453 4360 3993 1530 1467 990 46 45917 4990 4632 4366 14974 --
NM_006310chr1731278 1154 145 ------
NM_006313chr1231225 595 259 2298 130 --1197
NM_006320chr45323 310 302 290 54 ------
NM_006321chr361857 1627 1620 876 684 166 --11645 --
NM_006325chr122314 232 ------
NM_006327chr10284 53 ------
NM_006328chr114629 531 496 470 --1185 --
NM_006336chr981421 1266 1234 1118 403 369 274 263 1149 ----
NM_006345chr421257 329 1493 ----
NM_006352chr141948 1925 1559 217 11283 ----
NM_006357chr22469 128 ------
NM_006358chr223872 359 77 1947 ----
NM_006359chrX5830 491 408 304 90 1183 1434 --
NM_006364chr142906 63 ----1374
NM_006367chr13820 346 32 ------
NM_006369chr15302 136 128 120 100 ------
NM_006375chrX31402 1274 391 --21478 100 --
NM_006378chr961174 1026 342 280 183 155 --1191 --
NM_006379chr731889 1777 343 2816 625 ----
NM_006380chr1744420 3973 3059 2964 ------
NM_006386chr2271981 1943 1676 1511 614 99 64 1709 12439 --
NM_006389chr1181218 949 861 536 520 434 405 290 --3396 173 111 --
NM_006393chr1063950 2838 821 573 254 118 23224 388 11233 1324
NM_006407chr321116 422 3896 560 476 ----
NM_006420chr2063342 2586 2532 2353 1180 762 12301 ----
NM_006421chr81253 2871 830 1164 --
NM_006430chr23542 507 485 --176 --
NM_006439chr41449 ------
NM_006451chr51382 1310 ----
NM_006454chr473075 2794 2112 1211 947 870 551 ------
NM_006457chr483034 2865 2802 2775 1249 1116 1059 347 12904 24024 1597 --
NM_006459chr1031616 1311 225 --11942 --
NM_006460chr1731338 539 222 1242 --11407
NM_006471chr18164 --131 --
NM_006472chr13875 90 50 ------
NM_006480chr53480 196 97 ------
NM_006482chr1263208 854 805 773 670 398 ------
NM_006489chr1431737 1641 1541 141 ----
NM_006494chr193213 117 94 --1101 --
NM_006496chr121247 693 11893 ----
NM_006500chr1121072 23 11288 ----
NM_006510chr65867 854 669 411 157 1759 ----
NM_006516chr151576 1431 642 530 123 ------
NM_006519chr6393 38 31 ------
NM_006520chrX2345 57 ------
NM_006526chr2041889 459 269 79 ------
NM_006532chr1971775 1539 1466 1459 603 548 202 --12027 --
NM_006534chr2083205 3123 3080 2430 2387 1173 1127 538 32809 1217 345 12256 1511
NM_006539chr16286 64 1207 ----
NM_006544chr1446123 5470 5125 4280 36003 5679 3685 35342 1058 36 --
NM_006546chr17236219 5954 5936 5452 5422 5218 5158 5121 5035 4645 4559 4382 4154 2659 2627 2155 2146 1672 1555 1055 867 784 333 16528 ----
NM_006547chr72277 158 11673 1605 --
NM_006548chr331198 387 311 11351 ----
NM_006549chr1262863 1987 1893 870 780 143 ------
NM_006557chr921493 415 ----1113
NM_006559chr1--1400 11243 --
NM_006561chr1095791 5553 2443 2364 2105 1711 1108 502 88 12387 45522 4799 4691 1875 --
NM_006572chr1763129 2993 2492 2399 1111 351 ------
NM_006575chr143486 377 183 ------
NM_006578chr1551547 1333 1324 1287 1265 ------
NM_006595chr1132064 1913 1642 21890 1495 1139 --
NM_006599chr16167849 7574 7564 7412 7404 7393 6834 5864 5585 5154 2573 1738 1703 1677 1436 844 37496 7293 295 25906 2242 13154
NM_006601chr122776 317 --1895 --
NM_006603chrX31920 1370 756 1349 --1726
NM_006609chr272506 2387 2355 2336 2212 1948 132 21003 202 ----
NM_006614chr343427 2675 2636 387 --11368 --
NM_006618chr151623 1381 1318 1154 432 3510 212 131 ----
NM_006621chr161880 1630 1599 787 209 90 1483 ----
NM_006622chr52485 219 ------
NM_006625chr1----1150 1322
NM_006625chr1----1150 1322
NM_006625chr1----1150 1322
NM_006626chr941701 790 322 253 2931 259 2942 911 --
NM_006628chr1563993 1809 1309 1278 817 79 11420 --14095
NM_006629chr1842580 2445 1795 355 12512 ----
NM_006644chr13125 ------
NM_006646chr1382537 1880 1187 787 743 443 367 58 1908 ----
NM_006650chr563821 3287 2531 705 651 168 --1637 --
NM_006651chr42540 251 --1553 --
NM_006654chr1284142 3378 1847 1278 1197 1126 554 93 21896 463 34287 1295 897 --
NM_006660chr15265 38 ------
NM_006682chr742541 1876 439 55 --1182 --
NM_006698chr2091319 1147 955 564 460 446 436 421 392 --11293 --
NM_006700chr124781 576 277 31 ------
NM_006706chr52257 219 ------
NM_006717chr932636 1227 103 1324 23127 2441 --
NM_006720chr10125083 4911 4758 4128 4072 3169 1736 1443 1336 1064 972 756 2722 307 ----
NM_006722chr342141 685 356 40 22214 98 12922 --
NM_006726chr441106 1083 916 65 ------
NM_006731chr9125852 5632 3554 2034 2011 1776 1401 1271 1177 278 255 31 24346 1326 15122 --
NM_006732chr1972061 1849 1837 1778 1541 658 177 11527 ----
NM_006735chr72362 44 1120 ----
NM_006736chr271512 1188 608 601 511 499 198 ------
NM_006746chrX2521 441 11437 ----
NM_006750chr16187942 7819 7330 7303 6708 6516 6223 5931 5338 3180 2679 2282 1431 987 681 634 534 407 25240 975 47608 7025 6067 427 --
NM_006756chr821301 1293 1149 ----
NM_006763chr162002 1929 1883 1712 1432 862 ------
NM_006766chr852621 2403 2103 607 165 11651 ----
NM_006772chr671720 1454 1447 1247 226 202 27 ------
NM_006775chr621168 353 1330 ----
NM_006777chrX62437 2332 1054 814 691 577 ------
NM_006783chr13----2250 80 --
NM_006788chr1851872 711 701 357 114 1831 11518 --
NM_006790chr52381 150 ------
NM_006791chr153460 167 65 ------
NM_006795chr1151503 1159 1115 463 158 ------
NM_006803chr831812 843 120 1129 --1754
NM_006805chr541072 187 181 159 ------
NM_006807chr17----1108 --
NM_006814chr2062638 2477 2441 2250 2011 972 11781 2828 224 --
NM_006815chr1251020 436 390 300 236 ------
NM_006823chr81251 ------
NM_006826chr261247 1106 470 432 162 30 2414 62 ----
NM_006827chr1492207 968 925 780 746 470 445 310 132 22900 533 23032 1063 --
NM_006832chr141906 1217 ----
NM_006838chr1231709 1548 670 11837 ----
NM_006851chr1242611 2605 2084 938 52776 2752 2307 2202 792 --12815
NM_006852chr1752567 2352 1024 822 340 --32779 1920 873 --
NM_006854chr731838 545 31 --11641 --
NM_006856chr1231073 1040 367 1967 31138 736 314 1403
NM_006861chr1261850 1702 1384 566 68 39 11375 ----
NM_006873chr2103581 3000 2867 2676 1130 880 728 709 597 371 13065 ----
NM_006874chr421212 1139 ------
NM_006884chr31762 --11359 --
NM_006885chr1644214 2815 1095 1068 --1257 21080 1053
NM_006887chr23476 463 185 ------
NM_006888chr1453253 3132 3029 2902 21 --11354 --
NM_006894chr12311 304 ------
NM_006898chr22680 42 --1187 --
NM_006899chr201133 ------
NM_006908chr7--11104 21307 34 --
NM_006912chr1--1361 21572 406 1161
NM_006913chr6157 1437 ----
NM_006914chr941430 1165 583 248 ------
NM_006920chr2--21965 82 ----
NM_006922chr232308 481 320 ------
NM_006924chr1763685 3527 2966 1220 695 162 2578 52 13838 14407
NM_006930chr561955 1918 1860 1850 1233 655 --21698 1594 --
NM_006931chr1281808 1582 1576 1541 866 800 294 115 ------
NM_006937chr171563 1151 ----
NM_006940chr1281919 1600 1401 760 637 544 487 471 --11245 --
NM_006943chr2063041 2826 2820 644 455 357 --1840 --
NM_006947chr451449 1394 1201 1179 681 21286 263 ----
NM_006948chr2142429 1737 87 47 1251 1699 11903
NM_006950chrX6775 698 377 357 313 88 --1213 --
NM_006965chr182978 459 1381 1299 --
NM_006973chr102142 26 ------
NM_006981chr942695 752 513 502 4658 522 161 100 1442 --
NM_006988chr211783 --11125 --
NM_006990chr171898 1665 959 672 298 246 38 1333 ----
NM_006997chr102123 66 ------
NM_006999chr51244 --2593 325 --
NM_007005chr931385 1094 61 ------
NM_007006chr1662773 2443 1419 1369 105 41 ------
NM_007007chr1254730 4328 4246 3543 2946 12953 --1541
NM_007011chr15176793 6472 5881 4628 4530 2667 2652 2558 2149 2000 1921 1572 1434 1240 642 532 407 --14229 11164
NM_007013chr82188 165 1419 ----
NM_007026chr174568 470 445 77 ------
NM_007038chr21105880 4871 4661 4300 4031 3841 1827 835 505 403 12189 ----
NM_007039chr1442194 1680 1562 1556 --11578 --
NM_007042chr342586 2531 2087 314 ------
NM_007043chr1241604 1530 333 36 ------
NM_007050chr20146657 6563 6330 6161 5468 5301 2718 2491 2348 1369 1313 1024 329 217 35348 2377 1453 46981 2007 1737 1093 26488 937
NM_007052chrX2387 229 --139 --
NM_007064chr3----11117 --
NM_007067chr1751361 1130 1057 246 109 ------
NM_007073chr643780 1312 1129 235 13938 ----
NM_007106chr1342653 2548 2519 2371 1677 12356 --
NM_007107chr342084 1606 757 285 ------
NM_007111chr13183 ----1570
NM_007114chr333002 2778 249 1541 22247 2066 --
NM_007118chr53748 605 29 ------
NM_007123chr13480 469 59 ------
NM_007124chr651768 1442 766 408 221 ------
NM_007129chr135855 787 653 369 207 ------
NM_007144chr1721297 1274 ------
NM_007145chr1911151 ------
NM_007147chr1921073 214 1984 ----
NM_007166chr1151408 1279 1037 979 109 2533 100 11527 2374 91
NM_007170chr12823 786 --1360 --
NM_007172chr2242555 2031 189 82 ------
NM_007174chr1281782 1677 925 782 599 420 407 236 --11897 --
NM_007175chr853303 3016 277 149 71 33256 837 359 --12503
NM_007192chr142278 84 --11043 --
NM_007195chr1883505 3475 3198 2895 2688 2543 2488 1495 12952 43436 3232 2988 2367 --
NM_007203chr923614 1038 12901 ----
NM_007207chr14810 795 601 286 ------
NM_007212chr152294 1897 1619 497 172 1216 1346 --
NM_007214chr62451 253 ------
NM_007216chr111255 ------
NM_007218chr8----2703 188 --
NM_007219chr204965 951 942 729 ----1265
NM_007222chr831738 1684 1572 ------
NM_007236chr1542375 2132 2062 409 11923 ----
NM_007238chr2074851 4591 4288 4081 3881 3671 1639 --23146 314 1417
NM_007245chr161711 --1123 --
NM_007249chr13139106 8797 8614 8015 7882 7459 7297 6958 3199 2733 1358 847 734 48686 3751 411 43 --16309
NM_007275chr32453 438 1918 1310 --
NM_007276chr7--31143 796 221 ----
NM_007282chr33674 74 30 ------
NM_007285chr161457 2504 155 ----
NM_007286chr561313 731 615 471 328 214 1819 21837 855 --
NM_007292chr1763934 3180 1819 556 538 250 --11095 --
NM_007294chr1741153 495 197 98 ----1171
NM_007295chr1741153 495 197 98 ----1171
NM_007296chr1741153 495 197 98 ----1171
NM_007297chr1741153 495 197 98 ----1171
NM_007298chr1741153 495 197 98 ----1171
NM_007299chr1741153 495 197 98 ----1171
NM_007300chr1741153 495 197 98 ----1171
NM_007302chr1741153 495 197 98 ----1171
NM_007303chr1741153 495 197 98 ----1171
NM_007304chr1741153 495 197 98 ----1171
NM_007305chr1741153 495 197 98 ----1171
NM_007313chr941789 755 246 218 --21744 715 --
NM_007320chr191250 --1313 --
NM_007331chr422258 970 12510 --21901 497
NM_007345chr1852169 1675 895 382 202 ------
NM_007350chr1264393 3741 3728 3104 1005 100 13646 23233 3214 14588
NM_007358chr131570 1514 1267 ----11831
NM_007362chr361477 1358 1139 1049 552 35 ------
NM_007363chrX2235 94 1755 ----
NM_007372chr173883 194 35 ------
NM_007373chr1021764 1220 1328 ----
NM_007375chr142590 1129 906 431 22322 417 ----
NM_012064chr1261173 1140 763 335 209 152 --11120 --
NM_012069chrX92548 2524 2506 893 814 620 587 226 132 ------
NM_012081chr523438 2595 13163 ----
NM_012083chr1041025 927 854 61 --1936 --
NM_012090chr1------1934
NM_012095chr1083435 3269 2482 2284 1414 1328 1066 1045 22675 2501 ----
NM_012097chr221983 833 11825 21938 1900 --
NM_012102chr172402 2386 2159 1980 988 686 305 11790 ----
NM_012104chr1153285 2483 2463 880 394 31382 813 312 13079 --
NM_012104chr1153285 2483 2463 880 394 31382 813 312 13079 --
NM_012129chr761979 1913 1830 1005 836 91 22165 790 ----
NM_012137chr192162 2136 1910 937 541 441 419 407 80 --22906 1887 --
NM_012141chr1383679 3295 3193 3187 2603 2546 255 139 54165 3000 2684 862 842 42929 2736 2704 2674 --
NM_012154chr81825 ------
NM_012156chr20143353 2965 2895 2888 2838 2752 1382 1370 1052 806 777 405 341 272 13149 23329 2242 --
NM_012158chr1311672 1191 ----
NM_012161chr461182 1031 448 350 177 95 1467 ----
NM_012164chr9167453 7038 6922 6800 6783 6690 5696 5179 2968 1894 1792 1523 1193 1149 861 807 67146 6897 6681 6164 5356 2862 36807 6282 5999 --
NM_012175chr111222 1803 ----
NM_012180chr42536 167 1544 --1671
NM_012192chr1172311 2239 1488 527 486 131 123 ------
NM_012193chr1184695 4371 3347 3333 3282 1879 1867 707 43459 1558 1534 689 24551 4344 --
NM_012199chr1154522 4481 3955 3303 2952 2938 2923 2900 1802 1762 1524 1155 1070 751 130 14117 34609 4303 2892 11172
NM_012214chr2136436 5215 5094 4927 2526 2374 2166 2159 2003 1369 890 731 529 46214 6134 4056 702 ----
NM_012215chr1041946 698 376 227 ----137
NM_012223chr2--1251 137 --
NM_012234chr351430 1180 1068 418 405 13338 31126 1057 597 --
NM_012244chr1411404 --11160 --
NM_012247chr101281 153 1950 --
NM_012249chr253271 2271 1365 1179 386 --13098 1163
NM_012250chr1121285 52 1226 1144 --
NM_012252chr794212 3725 3302 1520 1207 862 758 696 399 13352 --1376
NM_012255chr20128 ------
NM_012259chr63344 180 165 11217 11460 --
NM_012262chr154397 4290 2006 1682 1271 24403 3715 ----
NM_012281chr721855 632 1517 ----
NM_012286chrX1173 ------
NM_012287chr343791 3629 3500 1549 12756 1911 1664
NM_012288chr6125440 5384 5069 4538 4524 3739 3574 3493 431 346 220 158 25046 2114 64967 3966 3560 1293 1070 322 14988
NM_012290chr221468 153 11710 11547 --
NM_012297chr41821 --21830 301 --
NM_012298chr33706 320 87 1220 1306 --
NM_012300chr551814 590 481 244 190 11551 22083 1714 --
NM_012301chr721411 216 --1876 --
NM_012304chr562475 2365 2155 970 478 236 --2875 277 --
NM_012309chr1174558 4058 3742 3387 1608 1409 647 23802 3631 11125 --
NM_012311chr103628 224 207 ------
NM_012316chr1145130 5038 4168 3803 3684 2119 1918 1678 1459 997 972 696 622 377 1246 11310 --
NM_012325chr2041546 1145 160 72 11251 11293 --
NM_012326chr22864 247 --177 --
NM_012329chr1731257 1046 360 ------
NM_012330chr1051693 1160 378 262 193 ------
NM_012333chr151540 1525 1191 571 335 11247 11185 --
NM_012334chr543967 3869 3421 154 22886 1410 11324 --
NM_012340chr201178 ------
NM_012343chr51735 ------
NM_012345chr1321506 154 21890 502 1743 --
NM_012382chr543460 3390 2885 1408 33050 1459 584 24438 3505 --
NM_012384chr2061861 1785 909 864 435 47 ------
NM_012395chr773194 3116 2806 2372 2287 2262 329 23005 1167 12277 --
NM_012398chr1952919 2841 2585 783 254 --12171 --
NM_012399chr2251804 1658 1444 733 499 --11966 --
NM_012402chr115957 414 240 115 86 ------
NM_012412chr71829 ------
NM_012414chr12180 114 ------
NM_012420chr1062029 876 773 715 85 38 --22273 1710 --
NM_012425chr1082299 2062 1010 757 422 128 73 62 ------
NM_012428chr153730 249 28 ------
NM_012433chr21275 ------
NM_012448chr1762175 1674 730 677 490 87 ------
NM_012455chr281361 1245 1095 1043 1019 233 216 113 ------
NM_012461chr144475 275 195 52 ------
NM_012463chr1211831 1338 ----
NM_012465chr1053442 3235 2844 2172 354 --33180 650 311 1955
NM_012471chrX41799 1652 318 52 ------
NM_012479chr782369 2186 1972 784 648 553 395 272 22022 1753 ----
NM_012486chr11413 1106 ----
NM_013229chr1262669 2465 2090 878 794 223 1526 12741 --
NM_013230chrY2566 283 --11608 --
NM_013231chr1484130 3434 3211 2813 2732 1690 1445 790 1320 11426 --
NM_013233chr22399 58 1314 ----
NM_013236chr222460 181 --2351 292 --
NM_013245chr164725 719 691 575 ------
NM_013248chr201209 --121 --
NM_013254chr121610 ------
NM_013257chr822030 708 12171 ----
NM_013261chr452776 787 769 746 61 11368 23424 278 --
NM_013269chr1253953 3524 3380 1255 775 14517 34029 1434 1354 14139
NM_013272chr15----1153 --
NM_013275chr162638 152 1615 1193 --
NM_013279chr1192074 2061 2047 2016 1843 1738 858 816 363 11603 ----
NM_013281chr2021188 263 ------
NM_013283chr5----1671 --
NM_013296chr1126 166 ----
NM_013305chr183699 113 52 ------
NM_013309chr1552195 2031 953 160 125 --21765 906 12680
NM_013313chr2293546 3363 3069 2526 883 832 291 166 24 23239 1157 1857 --
NM_013316chr73795 177 82 193 ----
NM_013341chr2112886 2763 2745 2711 1167 1157 1121 1079 882 796 347 12027 ----
NM_013354chr841356 372 320 157 --11405 --
NM_013357chr82703 71 ------
NM_013364chrX41994 1963 1642 1236 ------
NM_013368chr191117 ------
NM_013372chr15102770 2142 1343 947 546 530 494 467 362 210 22810 1041 23084 443 12964
NM_013374chr352760 2569 2056 939 388 11021 ----
NM_013381chr1252402 2138 770 270 212 12034 ----
NM_013399chr1651876 1518 1280 1267 1148 --1711 --
NM_013400chr731062 842 45 1970 ----
NM_013423chrX2930 258 1972 ----
NM_013427chrX2930 258 1972 ----
NM_013433chr1971923 1784 1577 1543 1343 1334 756 ------
NM_013437chr8--1558 1235 --
NM_013438chr921584 707 21420 1354 ----
NM_013444chrX81140 988 345 249 212 189 181 157 3280 267 258 ----
NM_013446chr731405 1348 1255 --1543 --
NM_013448chr142682 173 1650 --1605
NM_013449chr12162952 2719 2300 2129 2111 2098 1206 689 659 640 634 625 315 223 178 170 --22438 529 --
NM_013450chr22352 30 1116 ----
NM_013937chr63899 420 104 ------
NM_013951chr262433 2256 1560 956 619 353 ------
NM_013979chr52413 61 ------
NM_013989chr1483651 3277 3213 1492 1455 1126 460 207 ------
NM_013995chrX31699 872 412 12004 ----
NM_013999chr1721336 121 --1343 --
NM_014005chr542211 1044 638 615 11214 22928 2508 --
NM_014011chr252012 951 806 571 482 --22552 1952 --
NM_014016chr331271 589 348 --1181 1505
NM_014021chr173442 3257 2228 1252 1119 1111 645 1918 12968 --
NM_014023chr1042755 2197 1951 1849 ------
NM_014031chr5--2239 119 ----
NM_014034chr621127 470 1264 ----
NM_014038chr72295 128 ------
NM_014043chr31253 21490 283 ----
NM_014044chr2--1164 ----
NM_014048chr1634924 4118 1101 14782 23542 3468 --
NM_014055chr123434 396 353 ------
NM_014059chr13--1258 122 --
NM_014079chr321046 199 1840 ----
NM_014106chr1551919 1906 792 350 31 21897 334 ----
NM_014109chr82409 39 11282 ----
NM_014112chr884814 4699 4591 4425 4379 1683 1105 131 15151 1711 1685
NM_014117chr16102509 2267 2243 1784 1043 982 933 845 416 96 1767 ----
NM_014141chr785052 3498 3454 1532 601 497 429 211 24605 3236 ----
NM_014155chr11136038 5975 5850 5677 5094 2779 2284 2208 1596 1496 1097 405 145 12157 35372 545 155 14690
NM_014169chr141208 152 144 --
NM_014181chr242826 1936 879 714 1859 ----
NM_014182chr121479 175 ----
NM_014186chr1172115 1814 1722 603 576 448 204 ------
NM_014189chr461425 1343 1304 376 346 79 21375 1363 11494 --
NM_014190chr461777 1695 1656 728 698 431 21727 1715 21846 319 --
NM_014191chr121833 --1723 --
NM_014213chr22166 63 ------
NM_014217chr11275 11505 ----
NM_014223chr14727 687 518 194 ------
NM_014231chr1291938 1842 1614 1584 1479 737 474 165 136 ------
NM_014232chr17111072 623 400 347 340 286 275 266 252 228 60 1500 1312 11457
NM_014232chr17111072 623 400 347 340 286 275 266 252 228 60 1500 1312 11457
NM_014233chr1792176 1730 1656 1630 1397 1351 765 666 414 --191 --
NM_014240chr343786 1142 412 121 23581 150 13088 --
NM_014243chr442092 1540 172 55 ------
NM_014245chr32447 223 --1131 --
NM_014246chr2232332 1708 567 --21643 413 --
NM_014250chr2261910 1633 1571 526 337 77 ------
NM_014253chrX32112 1925 539 ------
NM_014267chr113870 324 240 1339 ----
NM_014268chr1821334 1316 11234 11271 --
NM_014270chr19172 ------
NM_014271chrX3587 343 27 ------
NM_014278chr4--1324 ----
NM_014279chr94816 642 261 165 1359 ----
NM_014280chr14724 712 264 46 --1735 --
NM_014283chr131058 995 338 1327 --1290
NM_014284chr121029 733 ------
NM_014285chr93306 199 102 1422 1820 --
NM_014293chr22113816 3745 3278 2697 1615 1293 1023 980 655 586 29 ----22648 264
NM_014294chr811130 11148 11335 --
NM_014299chr1961800 1533 1450 1431 386 49 --11771 --
NM_014309chr22175188 5179 4973 4861 4836 4449 4165 4058 3924 3902 3554 1859 1759 1503 1128 802 785 35319 821 182 ----
NM_014316chr1631995 1971 118 --11634 --
NM_014319chr1231377 412 71 ------
NM_014331chr4107465 7033 6199 5551 5474 3090 2425 2072 1077 240 56123 4929 3044 2104 1856 25064 2625 --
NM_014333chr1162663 2294 2036 1102 853 438 1425 2895 326 --
NM_014342chr111509 --21381 1319 --
NM_014345chr64950 933 174 163 ------
NM_014352chr1131522 946 251 ------
NM_014368chr951915 1795 1619 1431 400 ------
NM_014372chr12694 376 21630 116 ----
NM_014374chr731062 842 45 1970 ----
NM_014381chr14103317 3302 2962 2468 2456 2241 2108 777 466 113 12269 32411 1254 882 --
NM_014382chr331119 487 199 ------
NM_014388chr195686 5526 5361 4990 3848 3839 3818 1504 164 25886 369 ----
NM_014393chr852310 752 373 300 229 2788 176 1216 --
NM_014396chr72191 161 11828 --12263
NM_014397chr921405 64 --1218 11079
NM_014410chr18144 1348 ----
NM_014411chr781686 1362 1286 1261 1243 562 342 111 21996 1307 1428 1163
NM_014415chr3136 ------
NM_014421chr42769 345 --1737 --
NM_014423chr595041 4686 2103 1956 1847 1792 1653 1164 1137 23691 2131 12236 --
NM_014426chr202543 207 ------
NM_014432chr6--21308 1093 --1185
NM_014445chr352208 1821 1695 1584 1569 1460 ----
NM_014447chr461556 1116 492 237 222 140 ------
NM_014452chr631138 1000 193 ----1464
NM_014454chr61865 1128 ----
NM_014455chr1----1431 --
NM_014456chr1021544 320 ----1690
NM_014488chr114680 623 510 459 ------
NM_014494chr1641668 392 349 305 ------
NM_014497chr21234 ------
NM_014507chr2221025 856 ------
NM_014515chr1241051 254 116 33 ------
NM_014517chr361733 1632 1616 1250 778 294 ------
NM_014548chr1541528 1380 1291 1279 21627 516 11538 --
NM_014554chr1291786 1695 1683 1677 1667 1609 579 310 165 --2692 548 --
NM_014570chr222235 226 --1208 --
NM_014571chr182887 2859 2740 2680 2193 865 689 548 12576 1385 --
NM_014572chr1311502 11377 ----
NM_014574chr1431000 484 321 1444 ----
NM_014575chr3----2536 492 --
NM_014584chr1431625 1355 300 ------
NM_014592chr53741 289 181 ----1660
NM_014603chr1741688 1484 621 49 1528 21516 1265 --
NM_014607chr24642 602 446 198 141 1118 --
NM_014612chr9----197 --
NM_014613chr562304 2135 1221 888 704 37 1589 32039 755 493 12757
NM_014630chr1593965 3500 3068 2722 1219 603 472 267 255 12475 13673 --
NM_014634chr22103535 3091 2724 2663 2289 2265 1383 739 639 46 --22791 2752 --
NM_014636chr9103900 3112 2946 2734 1441 1354 1019 840 723 666 ----13283
NM_014647chr165714 559 402 196 82 ------
NM_014655chr1122331 1956 1853 1799 1635 1590 582 425 319 241 213 189 1434 1798 --
NM_014659chr1551050 736 366 258 101 ------
NM_014660chr71801 --1130 --
NM_014663chr131122 312 89 ------
NM_014665chr8113692 3515 3347 2859 2704 2427 2351 2344 2312 696 369 --2298 43 --
NM_014667chr342352 2182 1897 375 --12123 --
NM_014676chr131657 1487 1414 11367 ----
NM_014677chr82914 342 ------
NM_014682chr8--12005 ----
NM_014683chr1721691 211 21658 1361 ----
NM_014686chr1922103 657 --22457 136 --
NM_014689chr21412 --1538 --
NM_014690chr7143070 2785 2776 2570 2277 2253 2244 2060 2053 2040 1225 984 821 411 ------
NM_014701chr1523253 872 22538 2361 ----
NM_014705chr751913 1904 766 420 258 21376 643 ----
NM_014707chr772262 2224 1778 1707 1626 486 476 1877 22286 2174 --
NM_014711chr1621773 1471 ------
NM_014713chr21545 ------
NM_014718chr125715 561 539 528 129 ------
NM_014719chr731080 864 412 ----11035
NM_014720chr102126 75 21350 737 --11228
NM_014721chr6106943 6827 5958 5462 5439 5340 5297 4709 1869 773 47166 6453 6315 1959 ----
NM_014723chr2083205 2619 2299 2138 1108 708 329 70 --23212 425 --
NM_014729chr811693 1193 21755 773 --
NM_014730chr12165191 4853 4765 4432 4160 4063 3714 3536 3515 3418 3386 3233 2028 1488 238 213 43380 898 786 553 64679 4325 3740 1320 1061 342 --
NM_014730chr12165191 4853 4765 4432 4160 4063 3714 3536 3515 3418 3386 3233 2028 1488 238 213 43380 898 786 553 64679 4325 3740 1320 1061 342 --
NM_014731chr20121798 1556 1350 1338 1226 1145 635 590 341 275 142 81 ------
NM_014735chrX51539 1510 604 515 322 11776 32109 1809 1490 --
NM_014742chr2071659 1447 1122 563 398 319 127 ------
NM_014743chr453057 2829 2461 318 142 1596 ----
NM_014746chr2124378 4063 3979 3776 3484 1749 1444 819 784 716 482 394 11640 ----
NM_014747chr1165758 5385 5126 5020 4998 4953 4693 3980 3782 3646 2031 1464 1458 1121 760 441 25509 5473 2804 274 --
NM_014751chr831682 762 245 ----11384
NM_014752chr113447 404 114 11800 --11521
NM_014755chr283156 3067 2877 1283 1107 993 655 210 ------
NM_014757chr542364 1800 745 542 22205 918 ----
NM_014758chr1172349 952 657 456 421 306 255 --1211 --
NM_014761chr1631031 304 148 ----122
NM_014764chr1231227 472 462 2403 267 ----
NM_014765chr131862 540 473 --22499 769 --
NM_014766chr773810 3400 2839 2590 824 523 115 --13130 13031
NM_014767chr1082646 2410 2377 1351 1217 992 319 246 --2948 669 --
NM_014772chr1843355 3008 2463 924 11458 23310 735 --
NM_014774chr183024 2839 2798 2591 2318 2082 720 277 21281 1141 22823 2009 --
NM_014776chr12102988 2962 2726 2619 2450 2230 2115 1250 638 541 22131 316 --11112
NM_014782chrX1113 ------
NM_014784chr131116 904 824 1209 ----
NM_014786chr1131261 1231 872 ------
NM_014787chr132101 2020 740 ------
NM_014791chr9----1300 --
NM_014795chr22483 423 ------
NM_014800chr74461 325 199 127 11158 195 --
NM_014803chr103874 797 359 12542 ----
NM_014810chr193391 3157 2945 2927 2638 1414 1271 1046 433 --12604 --
NM_014812chr12288 173 ------
NM_014819chr542133 1944 1665 53 --1454 --
NM_014820chr331907 1660 1425 ------
NM_014824chr1161885 1763 1329 629 595 331 ------
NM_014826chr193847 3789 1613 1564 1101 1009 734 421 68 13853 ----
NM_014827chr121077 158 --11560 --
NM_014829chr522169 764 22390 717 --1225
NM_014830chr1262831 2403 1539 1391 728 74 ----13716
NM_014835chr2022092 367 --2838 197 --
NM_014836chr102493 444 1225 ----
NM_014839chr162319 2272 1784 1770 959 530 ------
NM_014840chr1242439 2318 2290 2200 1330 12543 --
NM_014844chr1434157 1666 1522 --11170 --
NM_014846chr8137 1252 ----
NM_014848chr1542585 2463 1842 376 1959 ----
NM_014850chr394695 4685 4483 4435 3549 3490 1320 1259 491 14559 24523 3900 --
NM_014858chr11980 --1782 --
NM_014859chr1731122 988 395 --2326 199 --
NM_014860chr241649 746 737 668 21796 78 ----
NM_014862chr15124079 3863 3464 2904 2599 1622 1610 1470 1364 957 303 279 24007 3056 --13669
NM_014864chr1124266 4092 3940 3656 2882 1283 954 936 877 800 698 409 --21040 367 --
NM_014870chr194349 3581 3503 3274 1318 1178 1137 1067 1026 34158 810 757 ----
NM_014872chr962194 2130 1933 1674 604 224 ------
NM_014873chr131282 1185 825 23753 668 ----
NM_014876chr2242203 470 299 184 12126 11747 --
NM_014877chr17107695 7410 7195 6775 6381 6127 5832 1761 1321 97 12453 36837 4962 2955 --
NM_014883chr442462 2203 1588 681 11930 --11918
NM_014890chr3156 ------
NM_014892chr62551 517 1138 ----
NM_014893chrY32323 1573 748 ----11735
NM_014897chr1743101 3071 2257 366 21103 82 ----
NM_014901chr561627 1586 712 283 248 158 11846 11998 --
NM_014902chr2051551 470 463 407 169 ------
NM_014903chr1252393 2074 1933 956 432 1708 1362 --
NM_014904chr102749 326 1119 23455 778 1246
NM_014905chr261601 1444 686 656 487 163 1719 --11627
NM_014906chr1793921 3370 3094 2930 2913 2732 451 305 220 --13641 --
NM_014912chr1042883 2789 2729 612 22607 1324 ----
NM_014914chr22438 219 21168 374 11005 --
NM_014917chr11695 ------
NM_014918chr1521281 1134 21322 132 11066 --
NM_014920chr643073 2618 336 26 ------
NM_014921chr19122977 2895 2887 2831 2494 2022 1195 1179 690 632 613 503 22904 2756 ----
NM_014923chr131248 11692 ----
NM_014924chr142378 358 1841 1530 --
NM_014934chr1353082 2977 2530 1281 1077 --1146 13843
NM_014938chr1242604 2169 1671 400 ------
NM_014939chr1861352 1265 1053 960 522 390 ----1465
NM_014944chr141414 1336 961 520 --1529 --
NM_014945chr5111864 1281 1238 693 646 516 324 295 244 179 82 --21336 229 --
NM_014946chr222020 1024 23020 2252 21903 1082 --
NM_014947chr122595 445 --12811 --
NM_014949chr11758 --1850 1154
NM_014950chr1431429 659 604 ------
NM_014952chr1522036 589 21852 1376 1503 11505
NM_014961chr441609 1461 352 219 11939 --1482
NM_014964chr1762257 2060 1902 1859 1803 972 ------
NM_014969chr13736 410 322 ------
NM_014974chr1021251 491 ------
NM_014977chr144500 353 186 153 --1442 --
NM_014978chr102300 288 21324 1295 11129 --
NM_014982chr1485195 4033 2142 1785 1376 666 524 153 24099 672 34075 3722 449 --
NM_014988chr452585 2520 2472 2066 312 ------
NM_014989chr681715 1635 1362 1332 1295 1278 607 564 ------
NM_014991chr473212 2148 799 604 306 224 103 ------
NM_014994chr1532096 762 199 1327 ----
NM_014996chr341002 916 212 128 1417 175 1318
NM_014997chr7102241 2173 2154 1098 1031 851 317 252 207 191 31111 823 55 --12862
NM_014999chr1231576 1397 1374 ------
NM_015000chr1253091 3068 1139 1040 262 ------
NM_015001chr13923 633 265 ------
NM_015008chr382974 2816 2489 2387 1288 898 704 239 21299 813 13220 22555 267
NM_015020chr1653506 2866 2604 691 193 --23676 1384 --
NM_015023chr161465 1448 1433 1256 1210 277 --11551 --
NM_015024chr831402 1372 201 11132 139 --
NM_015026chr1274619 4588 4555 4482 4444 3837 3623 44287 3168 1717 124 13291 13757
NM_015032chr1322799 806 11935 1514 --
NM_015033chr973254 2837 2097 941 897 818 131 --32890 1300 539 12823
NM_015037chr101265 ------
NM_015039chr1103430 3329 3257 3121 1679 1643 1631 1532 1499 257 --34046 3136 1221 13464
NM_015042chr1594373 4281 4246 3852 3638 3444 2875 2829 853 12881 23472 2978 11245
NM_015044chr1682910 2421 2235 806 695 656 506 325 --13258 12634
NM_015045chr1021507 82 --1459 --
NM_015046chr952142 1944 538 336 220 1251 1453 --
NM_015052chr731093 93 72 179 11125 --
NM_015053chr162148 1675 553 539 388 83 21764 1725 12235 --
NM_015063chr195385 342 215 125 82 --21375 960 --
NM_015064chr1252816 1212 1096 1049 562 --1909 --
NM_015068chr753931 2649 2493 1526 1315 32704 1479 1246 11491 --
NM_015069chr161492 ------
NM_015070chr1321059 145 11152 ----
NM_015071chr5116364 5496 5254 2316 2288 1955 1599 994 902 357 80 ------
NM_015074chr1134588 3953 3798 3787 3420 3148 3137 1912 1744 1406 1184 357 66 24290 1904 54665 4493 3512 1801 571 --
NM_015075chrX21958 355 11762 ----
NM_015076chr644475 4224 3152 911 --24289 4174 --
NM_015079chr1583181 3079 2732 2432 2368 2138 615 121 ------
NM_015080chr114936 401 393 222 1120 ----
NM_015086chr1251589 622 96 90 80 ------
NM_015087chr1322672 2656 --22275 612 --
NM_015090chr1176036 5927 5709 5162 5135 4845 4599 4278 4257 2132 1786 1357 655 477 434 418 404 24724 4621 35395 4710 2437 --
NM_015092chr1644470 3014 945 733 24363 1377 13482 --
NM_015093chr621345 748 ------
NM_015094chr2263310 1810 1314 1229 823 607 --24552 307 --
NM_015097chr33896 90 29 1700 21730 687 --
NM_015100chr161884 1849 1716 626 617 606 --11643 --
NM_015107chrX72445 2388 2172 1649 1518 521 173 --11539 --
NM_015115chr472573 1017 792 783 180 112 98 12916 1363 --
NM_015116chr1361685 1461 1181 392 293 58 ------
NM_015129chrX31464 77 55 11687 ----
NM_015130chr411230 11267 11290 --
NM_015132chr741686 1278 727 508 11577 ----
NM_015137chr842368 2302 1713 226 22461 366 ----
NM_015138chr1572783 819 493 481 237 168 64 --12671 --
NM_015149chr141679 1346 215 128 --21434 471 --
NM_015153chr63678 200 181 1305 ----
NM_015155chr1063307 2572 2388 2302 1005 584 12768 12327 --
NM_015156chr14113498 3363 1621 1153 1113 886 861 638 375 261 174 13519 13865 --
NM_015157chr1141005 777 445 276 1451 ----
NM_015158chr96770 752 246 229 188 55 ------
NM_015176chr141657 1641 1417 636 21590 1168 11469 194
NM_015185chrX92734 2626 2177 1096 957 912 553 373 318 1963 1590 --
NM_015191chr1152571 2532 1674 290 51 --1891 --
NM_015192chr2032570 1102 503 2108 61 ----
NM_015194chr1772032 1534 643 423 197 181 142 ------
NM_015199chr362578 2291 2041 1974 1955 1067 32909 2707 2174 22069 1101 --
NM_015200chr482435 2268 1996 1862 517 305 155 84 32295 1912 1772 11988 --
NM_015205chr1364594 3352 1896 1469 1405 37 ----1598
NM_015206chr1562611 905 832 618 487 435 13617 ----
NM_015208chr1853913 3283 1255 507 350 ------
NM_015209chr182097 1961 1890 1718 1486 896 474 391 11695 12152 --
NM_015215chr152994 2127 550 444 332 122 ----
NM_015225chr91379 32987 947 556 --1297
NM_015226chr16153454 3286 3148 3034 2730 2109 1171 882 435 286 197 179 170 142 21 --22880 1240 13277
NM_015230chr411800 11596 1272 --
NM_015233chr1342667 1875 1751 596 --12512 --
NM_015235chr1031878 768 162 ------
NM_015236chr42980 216 --1226 --
NM_015245chr642577 2548 2330 2061 --1587 --
NM_015247chr1684781 4672 4305 3836 3437 1560 503 167 1592 24929 2143 1822
NM_015250chr921586 1439 1379 ----
NM_015252chr22228 161 ----1622
NM_015260chr1931581 1549 469 --11005 --
NM_015265chr232467 636 268 ------
NM_015267chr1251449 1430 885 354 47 ------
NM_015268chr32471 119 --1257 --
NM_015270chr1282150 1928 1659 1641 929 894 685 532 --22241 1587 --
NM_015271chr444303 3086 2789 638 33097 1267 152 1858 13011
NM_015272chr1621680 58 ------
NM_015275chr1212136 11780 ----
NM_015277chr183305 183 115 --21830 1549 --
NM_015282chr242558 2403 1225 690 --42204 1951 1108 139 --
NM_015285chr1872547 2364 789 694 645 282 69 --11608 --
NM_015288chr5123665 3615 3200 3001 2667 1083 978 853 644 588 204 82 --12687 --
NM_015291chr183155 2458 2361 2278 966 288 278 145 --33055 1073 980 --
NM_015296chr1331039 403 44 ------
NM_015299chr1473679 1555 901 821 415 369 75 12817 23812 747 --
NM_015305chr14101893 1821 1794 1554 608 269 188 133 115 30 ------
NM_015310chr8188268 7958 7882 7465 6872 6678 5887 3206 3042 2799 2733 2675 2620 1712 1030 985 289 271 11521 35459 1330 1263 17570
NM_015313chr1143657 3239 1470 936 23463 1917 13448 --
NM_015314chr731923 1894 435 2722 640 ----
NM_015315chr563140 2770 2681 2436 2185 2172 --13436 --
NM_015317chr272708 2372 2086 1115 666 458 446 --12125 --
NM_015320chr231013 721 377 ------
NM_015321chr19154915 4865 4727 4295 4237 4022 3483 1893 1885 1487 1298 1251 920 438 77 13508 13948 --
NM_015323chr62663 300 11138 ----
NM_015326chr1112552 2371 2167 2026 1988 1154 875 863 606 523 181 11139 31009 936 561 --
NM_015328chr762388 1964 1136 779 617 599 ------
NM_015335chr1252448 2440 997 134 94 12161 2329 36 --
NM_015336chr1232446 915 89 ------
NM_015338chr2021561 1450 --11947 --
NM_015339chr2021011 695 ------
NM_015344chr842083 1923 194 128 1405 ----
NM_015345chr662387 1113 681 449 379 208 --12761 --
NM_015346chr1451607 1565 1402 524 290 --1602 --
NM_015349chr652694 2251 2073 999 76 21921 206 ----
NM_015353chr1772764 2054 1918 1099 968 830 454 --21007 603 --
NM_015355chr1731836 1516 405 --1588 --
NM_015359chr892841 2678 2208 2172 1836 1085 646 232 198 22049 343 ----
NM_015365chrX134120 4034 3741 3631 3486 2616 1700 393 380 373 361 354 84 43719 3412 990 260 ----
NM_015375chr1114853 4552 4227 3366 3279 1588 802 575 496 220 40 --11425 --
NM_015381chr2252080 1859 1284 781 530 ------
NM_015384chr51119 ------
NM_015387chr212073 22084 723 ----
NM_015394chr1221637 444 ------
NM_015396chr33443 269 79 ------
NM_015397chr951564 1401 1277 299 53 1364 ----
NM_015415chr11170 ------
NM_015429chr31743 ----11003
NM_015436chr473093 2746 2619 2385 859 766 58 32496 424 235 23257 166 --
NM_015446chr111455 1612 ----
NM_015455chr551356 1288 1131 406 324 11246 14033 --
NM_015458chr865264 4870 4585 4433 1987 1823 14354 ----
NM_015460chr352084 1870 1586 568 503 ------
NM_015466chr3124 1192 --196
NM_015472chr31127 ------
NM_015472chr31127 ------
NM_015493chr1962144 2100 1491 1430 596 76 --147 --
NM_015497chr152807 289 --1119 --
NM_015509chr1271413 1365 1325 1281 1151 543 439 --1634 --
NM_015511chr2071135 1058 1046 981 959 948 140 ------
NM_015514chr142430 99 --3409 388 55 --
NM_015520chr341797 553 430 359 --32738 1890 1881 --
NM_015523chr112218 191 ------
NM_015527chr167785 777 739 717 696 595 228 --2514 102 --
NM_015534chr1--1787 ----
NM_015535chr264130 4053 3526 1497 1205 862 32881 1186 126 --11390
NM_015541chr321147 1002 --11159 --
NM_015542chr104986 889 416 252 ------
NM_015548chr6129 ----1761
NM_015550chr783169 2726 2672 2544 2291 843 790 641 --12255 --
NM_015554chr1552699 2631 1966 750 500 --22781 1913 --
NM_015557chr143673 3122 2352 1076 --23084 414 --
NM_015564chr532667 2640 449 ----12599
NM_015565chr211738 11591 11530 --
NM_015567chr1351195 534 495 409 221 1170 ----
NM_015568chr2094349 4273 3890 3726 3205 3185 1643 1617 758 22877 872 22761 2745 --
NM_015569chr1104600 4378 3903 3108 1931 1919 1445 1138 1062 493 14404 ----
NM_015570chr71733 --21761 1307 --
NM_015576chr392375 2333 2309 2065 1145 1036 868 765 211 ----22225 1824
NM_015577chr54650 225 215 126 11324 ----
NM_015578chr1942091 1923 722 465 ------
NM_015604chr142636 237 --1214 --
NM_015607chr1----2200 158 --
NM_015609chr132335 1924 464 11886 ----
NM_015635chr951440 621 346 337 193 1303 11941 --
NM_015652chr102624 179 --1224 --
NM_015670chr173474 109 86 --277 56 --
NM_015677chr22636 251 1571 ----
NM_015678chr1311455 11647 --1540
NM_015680chr23605 579 97 2551 480 ----
NM_015686chrX82454 2411 2378 2333 2086 1920 1760 418 12387 ----
NM_015691chrX52882 630 553 367 194 ------
NM_015695chr6121968 1886 1850 1840 1821 1805 740 651 559 546 533 220 ------
NM_015711chr192849 259 ------
NM_015719chr193525 152 145 ------
NM_015726chr181785 1363 642 575 539 455 426 337 11314 ----
NM_015833chr2151953 1701 1631 1516 607 1327 2929 553 --
NM_015840chr162490 499 479 463 336 104 22537 1671 12680 --
NM_015841chr162490 499 479 463 336 104 22537 1671 12680 --
NM_015850chr892410 2357 2266 2122 1820 1729 1689 875 87 ------
NM_015852chr723459 3046 ------
NM_015872chr161771 1704 1548 1458 433 262 --1465 --
NM_015878chr811847 21561 98 ----
NM_015879chr18128347 8298 6384 5625 2812 2794 2022 1186 744 676 666 135 13307 46649 5614 1931 824 --
NM_015886chr895704 4977 4061 2060 1528 1246 305 171 129 ------
NM_015888chr122745 54 --23249 1192 --
NM_015891chr632047 517 287 --11561 --
NM_015892chr1052110 741 430 158 68 22360 615 12317 --
NM_015906chr184668 4271 3351 1868 1741 1473 1062 884 13501 24480 4032 24055 3310
NM_015912chr821969 1943 --32338 2036 1685 --
NM_015955chr21133 1161 ----
NM_015959chr113724 616 96 1446 ----
NM_015975chrX2547 148 1526 ----
NM_015981chr552970 1968 638 461 406 12809 22496 1078 --
NM_016006chr33264 227 194 ------
NM_016009chr133467 3110 223 14851 ----
NM_016019chr73251 161 27 1403 ----
NM_016021chr642167 2071 2050 114 1465 1212 --
NM_016022chr131073 316 163 --2769 146 --
NM_016026chr142372 280 11066 ----
NM_016032chrX2536 297 --2237 100 --
NM_016041chr17170 ------
NM_016057chr1241002 883 377 285 ------
NM_016061chr231542 1448 555 11082 11360 --
NM_016072chr1231997 1932 1880 11482 ----
NM_016073chr153987 296 100 ------
NM_016075chr1372818 2785 2415 836 566 130 23 13004 12595 1913
NM_016076chr163019 2968 2962 696 584 34 32231 2187 81 12416 11151
NM_016090chr1111050 --11079 --
NM_016096chr832111 450 427 --11499 --
NM_016099chr851083 365 357 97 71 ------
NM_016107chr5--1447 --1992
NM_016120chrX2324 286 --1147 --
NM_016127chr8161 ------
NM_016131chr251977 760 544 412 47 --22270 1497 --
NM_016132chr1532721 2526 877 --12477 --
NM_016133chr22462 349 ------
NM_016146chr113257 169 39 ------
NM_016147chr116980 874 827 455 382 232 ------
NM_016152chr331060 952 385 ------
NM_016156chr1162214 2173 2047 1972 937 458 ------
NM_016162chr122229 125 --2307 260 --
NM_016169chr10143247 3181 3098 3060 3015 2809 2640 2607 2329 1288 1178 1078 1009 780 22988 501 ----
NM_016173chr3134524 3749 3317 3252 3215 2994 1746 1321 1129 760 684 626 340 43377 2907 1564 1486 ----
NM_016185chr172168 84 ------
NM_016194chr1551547 1333 1324 1287 1265 ------
NM_016201chr392281 2170 1918 1450 1439 910 782 654 500 --1101 --
NM_016206chr3198633 8582 8110 7344 7209 5454 3377 3274 2863 2458 2177 2113 2079 1860 1747 1251 874 610 247 27284 3351 27196 1209 --
NM_016213chr15----169 --
NM_016217chr642930 2903 394 93 13045 ----
NM_016221chr51491 --32303 337 291 --
NM_016226chr121351 ------
NM_016227chr131058 995 338 1327 --1290
NM_016230chr61435 --1143 123
NM_016231chr17--1671 11221 --
NM_016235chr1621356 1216 136 11040 --
NM_016248chr1363579 1310 1282 1238 633 391 12844 ----
NM_016255chr653213 3157 2909 2486 2265 2974 562 ----
NM_016257chr193275 3254 3089 2887 2244 1024 446 330 24 23005 2401 53170 2329 1199 500 435 --
NM_016260chr2116785 5639 5580 5555 2463 2214 1986 1974 1454 1050 1034 56312 5939 5593 1479 1112 15182 --
NM_016261chr173566 551 121 ------
NM_016272chr225914 885 679 572 358 --2962 851 --
NM_016277chr641637 1608 1526 1146 1206 ----
NM_016281chr124980 943 909 892 1120 1230 --
NM_016282chr961756 1727 1474 1123 674 52 ------
NM_016284chr162913 79 ------
NM_016287chr172064 1926 1799 1652 1612 601 197 1667 1261 --
NM_016289chr221789 206 11564 ----
NM_016303chrX4384 179 128 73 ------
NM_016308chr121770 271 ----1721
NM_016319chr123707 282 253 1262 ----
NM_016322chr982799 2506 2359 1012 794 635 629 324 ------
NM_016333chr165418 165 136 102 88 --158 --
NM_016338chr52862 397 1977 ----
NM_016353chr842253 2005 828 739 31882 978 878 1108 --
NM_016373chr165797 768 618 312 89 1677 1224 --
NM_016374chr12569 356 11367 ----
NM_016374chr12569 356 11367 ----
NM_016376chr1773490 3263 2974 2962 1193 1049 32 13849 ----
NM_016396chr1552530 2489 2384 2059 527 --12305 --
NM_016410chr92201 103 ------
NM_016418chr22103593 3539 3529 2827 2803 2512 1363 1122 343 315 --33321 3137 2378 --
NM_016422chr111676 53141 3055 2019 881 532 12293 --
NM_016424chr1731996 724 308 ------
NM_016436chr2042260 1942 569 454 ------
NM_016441chr222264 716 1963 ----
NM_016442chr542115 1561 604 163 --11958 --
NM_016448chr111373 --1587 --
NM_016454chr152331 26 ------
NM_016456chr16790 676 303 195 106 84 ------
NM_016467chr22911 134 ------
NM_016470chr204490 449 176 102 ------
NM_016480chr52725 86 ------
NM_016499chr111526 ------
NM_016505chr12700 265 1203 1219 --
NM_016506chr11136 --1522 --
NM_016507chr1763094 3080 862 786 139 32 22812 458 1751 --
NM_016513chr643073 2618 336 26 ------
NM_016519chr41210 ------
NM_016522chr1121671 1640 --11090 --
NM_016525chr93856 258 145 ------
NM_016530chr1563487 3427 3420 1607 246 187 13292 13856 --
NM_016531chr463962 3231 915 827 588 393 23415 1079 ----
NM_016544chr2123425 2942 2866 2843 1307 1230 1152 720 700 601 321 84 1582 --2925 483
NM_016547chr12638 555 ------
NM_016559chr331448 1017 161 ------
NM_016569chr1261544 1349 539 375 308 104 21255 1051 1622 --
NM_016571chr6--125 ----
NM_016574chr116934 906 895 757 378 312 ------
NM_016577chr3124394 3988 3581 3324 3287 2962 2927 1351 1334 1279 705 409 --14301 --
NM_016578chr112231 200 ------
NM_016587chr7--31143 796 221 ----
NM_016603chr561909 1774 1658 304 277 46 11439 ----
NM_016607chrX3394 296 84 ------
NM_016612chr81244 1453 ----
NM_016618chr2--2423 229 ----
NM_016620chr1--11258 ----
NM_016621chr11154041 3866 3841 3792 3771 3627 3550 3025 1685 1560 1479 1181 977 889 719 23851 3485 24468 3410 --
NM_016623chr83258 210 125 ------
NM_016626chr181691 --1186 --
NM_016628chr102638 588 ------
NM_016631chr211138 ------
NM_016645chr151340 1395 ----
NM_016652chr2021810 561 11201 ----
NM_016656chrX--2397 328 ----
NM_016824chr1021599 630 ------
NM_016834chr1793886 3528 3243 2999 2819 1122 1012 691 296 ------
NM_016835chr1793886 3528 3243 2999 2819 1122 1012 691 296 ------
NM_016836chr21589 --1538 --
NM_016839chr21589 --1538 --
NM_016841chr1793886 3528 3243 2999 2819 1122 1012 691 296 ------
NM_016936chr1662086 1937 1799 1608 1551 521 11602 ----
NM_016946chr1123329 3213 3001 1386 1233 1223 950 517 494 403 291 191 ----12517
NM_016952chr1193773 3320 3070 1614 1585 1567 335 274 205 24042 3384 12996 --
NM_017409chr123723 57 24 1786 ----
NM_017410chr1261110 908 895 870 477 467 ------
NM_017415chr5134352 3691 3588 3505 3132 2954 1811 1487 1203 909 694 441 405 24571 3498 1796 --
NM_017420chr1453014 2442 1520 707 217 12473 ----
NM_017439chr7163 --1431 --
NM_017444chr871683 1604 1408 1365 1357 1216 61 ------
NM_017450chr1731441 972 543 11159 11066 --
NM_017451chr1741117 927 754 67 11018 ----
NM_017452chr2031426 562 228 ------
NM_017453chr2031426 562 228 ------
NM_017454chr2031426 562 228 ------
NM_017455chr153730 249 28 ------
NM_017488chr251626 1492 1486 405 388 ------
NM_017491chr441037 859 394 148 ------
NM_017519chr631280 233 214 ------
NM_017522chr111230 21258 1222 ----
NM_017553chr1561287 1226 1010 997 495 24 1415 1362 --
NM_017563chr385805 4673 4410 1634 1377 597 264 148 ------
NM_017575chr1761591 1238 1184 567 426 40 31625 1527 1222 ----
NM_017577chr31192 --11153 --
NM_017580chr1042359 908 544 250 --22217 404 --
NM_017590chr2232649 852 387 12683 1975 12540
NM_017593chr4----1429 --
NM_017596chr1124651 3752 2852 1857 1781 1190 830 717 169 123 60 49 --34118 1151 188 --
NM_017599chr121377 --2757 39 --
NM_017602chrX3936 770 197 ------
NM_017610chr151640 21869 485 1252 --
NM_017617chr92364 31 --11106 --
NM_017628chr494964 4032 2122 2101 1218 1060 498 445 159 13247 33929 2033 1873 --
NM_017629chr161948 1890 1378 1293 1261 369 1663 ----
NM_017633chr673720 3169 2975 2861 2566 205 199 1211 ----
NM_017635chr1111489 --21442 106 --
NM_017637chr9149057 8748 7911 7400 7097 6453 6227 3018 2507 1990 1844 1508 212 161 11331 19100 --
NM_017640chr63595 266 113 ------
NM_017643chr17103004 2814 2754 2535 2423 1185 796 782 662 541 12703 13024 --
NM_017644chr351149 1103 1044 771 87 1363 14007 --
NM_017650chr765873 4513 1586 1370 1132 856 35932 5544 5243 13864 --
NM_017657chr24935 298 49 36 ------
NM_017658chr1454445 3949 1582 1540 1125 23555 3499 1968 --
NM_017660chr19102606 2372 2332 2150 1164 1104 937 567 260 252 --22382 1288 --
NM_017661chr151387 1848 ----
NM_017664chr1351067 792 678 371 37 2874 710 1218 --
NM_017666chrX31766 396 54 --1603 --
NM_017668chr162678 216 ------
NM_017672chr1521158 181 1312 ----
NM_017686chr131148 880 365 ------
NM_017693chr1331322 1178 652 --1214 --
NM_017694chr221793 405 ------
NM_017709chr193527 3390 3114 3030 2645 1587 1093 452 140 21482 1316 --12754
NM_017712chr1996185 5711 5398 3917 2146 2115 2009 626 572 13953 25187 1168 --
NM_017719chr352082 998 970 818 643 ------
NM_017724chr3----1685 --
NM_017730chr31223 2693 532 ----
NM_017734chr13631 65 29 ------
NM_017737chr12503 204 --12002 --
NM_017738chr96944 869 815 794 265 135 ------
NM_017739chr13526 206 177 ------
NM_017741chr442618 2564 1105 283 21990 104 32716 962 825 --
NM_017742chr1831970 767 138 ------
NM_017744chr161777 1678 572 561 311 219 1747 ----
NM_017745chrX2170 113 ------
NM_017753chr91951 ------
NM_017754chr6104536 4278 3752 3533 3165 1177 1151 903 643 352 13236 11460 --
NM_017758chr1741398 948 140 58 ------
NM_017766chr12144 83 ------
NM_017770chr672965 2891 2857 2142 710 542 280 11958 1469 --
NM_017772chr661606 1496 1322 587 320 166 11366 11521 --
NM_017776chrX--11147 --11004
NM_017778chr831519 535 503 --11002 --
NM_017780chr81282 --2866 599 --
NM_017784chr31320 ------
NM_017799chr1431971 1240 69 12013 11288 --
NM_017801chr322598 2205 32128 952 519 ----
NM_017810chr165644 619 277 84 31 ----1656
NM_017811chr982718 2605 2451 2115 1169 566 295 163 22818 2781 12377 --
NM_017813chr885726 5257 5070 4328 1731 1582 1012 762 44730 4656 3633 1115 15552 --
NM_017824chr1021909 764 ------
NM_017848chrX44450 3806 3036 1476 11396 13520 --
NM_017849chr2123171 3100 2225 2041 1198 932 909 897 844 469 322 77 --33197 3093 2943 --
NM_017873chr962302 1961 1028 908 562 448 --1790 --
NM_017893chr1061195 1001 350 276 133 88 ------
NM_017896chr20103078 2969 2433 2343 2261 711 677 654 548 111 1427 21270 198 --
NM_017902chr10134640 4547 4501 4136 3988 3620 2226 2219 2060 1604 1510 1392 762 24476 1190 24017 376 15496
NM_017906chr61104 ------
NM_017910chr2--1327 ----
NM_017915chr122805 745 ------
NM_017919chr9175196 4842 4308 4122 3902 3832 2099 1587 1567 1464 1116 1084 1045 851 740 626 584 55149 4933 4902 3934 3667 24807 2335 15047
NM_017922chr142548 112 ------
NM_017938chrX31583 554 432 1544 ----
NM_017944chr1132996 962 884 32703 2380 630 ----
NM_017946chr721302 473 ------
NM_017953chr11214 ------
NM_017955chr144872 468 415 316 --1265 --
NM_017958chr262969 2884 2671 2438 2231 114 1728 ----
NM_017964chr2--21004 218 1838 --
NM_017987chr103652 496 167 21884 355 1555 --
NM_017994chr772738 2726 1868 1207 995 798 281 1596 12747 --
NM_018000chr231491 700 523 12245 ----
NM_018010chr351619 1568 1144 1125 277 11131 --1356
NM_018011chr135574 508 482 174 155 ------
NM_018014chr21144 11074 ----
NM_018027chr1052770 2247 2018 1057 591 1853 12651 --
NM_018028chr1941116 1022 1002 273 1132 ----
NM_018032chr161386 ------
NM_018037chr11263 ------
NM_018043chr1171435 1360 1353 1271 535 175 151 1378 ----
NM_018045chr1112991 2408 2337 2292 2244 2197 2091 2012 860 790 449 ------
NM_018047chr53623 589 83 ------
NM_018048chr1231691 433 305 32060 1812 620 32045 1440 782 1426
NM_018050chr122500 130 1703 1728 122
NM_018061chr121375 289 11165 1652 --
NM_018063chr101316 ----1469
NM_018078chr42409 80 1326 ----
NM_018079chr23501 494 186 2194 142 ----
NM_018084chr23191 151 51 23134 994 ----
NM_018085chr1167905 7868 7172 6716 6655 6490 6210 5932 2437 2376 1704 960 694 640 554 274 11101 37997 7484 2451 --
NM_018086chr211428 11662 ----
NM_018092chr1641330 1222 412 400 1640 ----
NM_018095chr11136 --1522 --
NM_018097chr153721 280 166 ------
NM_018098chr31228 ------
NM_018107chr146763 745 730 372 271 123 1865 ----
NM_018117chr103648 533 272 ------
NM_018121chr1073128 2215 2160 2032 1032 566 517 23012 2008 11143 --
NM_018133chr322144 200 11760 11567 --
NM_018137chr121050 1015 11149 ----
NM_018150chr1176 --1901 --
NM_018155chr343160 2694 2404 2126 ------
NM_018157chr1243165 2923 2498 345 ------
NM_018164chr121279 ------
NM_018178chr191835 1765 700 654 560 520 427 104 24 11726 ----
NM_018181chr1861520 1387 634 345 137 121 --11718 --
NM_018182chr1772064 1924 1731 794 744 309 258 1322 22039 533 --
NM_018184chr341598 89 61 27 --1749 --
NM_018195chr1172044 1858 1778 1607 1568 1365 555 11435 ----
NM_018200chr1591940 1910 1764 1036 718 456 262 212 113 11822 11027 --
NM_018201chr951638 634 595 335 252 --22493 2311 --
NM_018206chr16270 27 ------
NM_018211chr121837 274 194 ----
NM_018214chr64852 370 329 55 1828 ----
NM_018225chr9105353 4275 3654 3605 3575 3409 2082 1145 493 323 --15439 --
NM_018227chr432512 1243 103 --23156 3080 --
NM_018243chr4113533 3446 3368 3057 2684 1568 1342 1326 1309 1113 1099 1964 ----
NM_018244chr2031052 980 425 1231 ----
NM_018247chr652148 2077 2001 1057 744 11231 13016 --
NM_018254chr151991 808 709 549 215 21770 601 31885 1675 818 --
NM_018275chr72523 219 ------
NM_018286chr172816 150 --1867 --
NM_018293chr353000 2858 2674 2426 471 11194 --1935
NM_018299chr853086 2402 722 328 125 22931 2784 --11092
NM_018302chr462415 2184 2137 1724 681 390 11859 ----
NM_018307chr172666 22 ------
NM_018313chr322326 231 11890 ----
NM_018319chr1431390 1030 61 188 ----
NM_018320chr113972 863 407 ------
NM_018325chr93626 620 576 --1193 --
NM_018330chr1011133 --1249 --
NM_018351chr12114519 4334 4320 4065 3838 3789 3682 2870 1746 1629 1065 14437 ----
NM_018362chr1131407 876 54 12860 ----
NM_018364chr164009 2967 2630 705 672 265 31608 1198 332 24147 354 13715
NM_018370chr121144 1766 ----
NM_018371chr851440 1431 1098 644 41 --1594 --
NM_018375chr1471888 1835 1661 757 742 642 582 1267 2381 88 --
NM_018394chr391612 1588 1436 1351 308 238 211 203 94 ------
NM_018398chr3141 122 1283 --
NM_018401chr451914 1615 1337 84 41 11531 ----
NM_018403chr343800 3573 3507 827 23820 854 33140 2618 908 11386
NM_018413chr121199 ------
NM_018416chr12132508 2274 2225 2033 1955 1924 1665 958 568 391 284 195 173 31949 1891 994 32540 575 82 --
NM_018419chr202322 24 ------
NM_018424chr941236 616 599 289 --1494 --
NM_018426chr61409 1611 ----
NM_018440chr8158458 8153 7657 7215 7065 6867 6249 6110 2139 2025 1634 1169 859 646 402 37288 5439 2285 47705 5489 671 656 --
NM_018448chr121122 21253 962 ----
NM_018452chr6_random43526 2379 1508 1478 23830 245 ----
NM_018471chr23574 162 150 ------
NM_018482chr82560 366 ------
NM_018489chr142243 1800 1493 530 11854 ----
NM_018509chr1731227 1194 673 31508 694 165 11627 --
NM_018534chr22199 114 ------
NM_018553chr1731571 1167 223 --11330 --
NM_018555chr193784 405 206 1581 ----
NM_018557chr241440 1353 455 287 ------
NM_018566chr1104832 4715 4029 3785 3292 3253 2054 904 149 116 --11494 --
NM_018584chr131250 1148 896 11040 ----
NM_018622chr3136 ------
NM_018638chr1244376 1219 827 569 25082 976 13873 --
NM_018640chr1232659 768 756 ------
NM_018644chr113430 114 75 1726 ----
NM_018650chr122232 577 12270 ----
NM_018652chr15--2804 280 ----
NM_018660chr852293 2117 1079 589 28 --1997 --
NM_018664chr13366 322 70 ------
NM_018667chr1632468 1745 936 12824 1734 --
NM_018682chr7--1164 ----
NM_018684chrX91328 1285 1106 978 970 957 541 310 228 11233 ----
NM_018689chr1542206 1958 1664 1027 --22591 1776 --
NM_018693chr21103 135 ----
NM_018712chr112598 137 ------
NM_018713chr12978 189 ------
NM_018715chr131801 1599 872 22051 211 21751 200 1430
NM_018717chr422471 756 12324 ----
NM_018718chr74397 346 153 140 --1929 --
NM_018837chr202724 332 ------
NM_018841chr1103984 3697 3069 2663 2634 740 680 595 515 144 21045 169 21296 163 --
NM_018846chr73923 689 129 2889 164 ----
NM_018847chr931960 1894 1829 --11901 --
NM_018890chr7--11104 21307 34 --
NM_018898chr541548 831 256 82 ------
NM_018899chr541548 831 256 82 ------
NM_018900chr541548 831 256 82 ------
NM_018901chr541548 831 256 82 ------
NM_018902chr541548 831 256 82 ------
NM_018903chr541548 831 256 82 ------
NM_018904chr541548 831 256 82 ------
NM_018905chr541548 831 256 82 ------
NM_018906chr541548 831 256 82 ------
NM_018907chr541548 831 256 82 ------
NM_018908chr541548 831 256 82 ------
NM_018909chr541548 831 256 82 ------
NM_018910chr541548 831 256 82 ------
NM_018911chr541548 831 256 82 ------
NM_018912chr571683 1586 1298 1273 1166 486 383 ------
NM_018913chr571683 1586 1298 1273 1166 486 383 ------
NM_018914chr571683 1586 1298 1273 1166 486 383 ------
NM_018915chr571683 1586 1298 1273 1166 486 383 ------
NM_018916chr571683 1586 1298 1273 1166 486 383 ------
NM_018917chr571683 1586 1298 1273 1166 486 383 ------
NM_018918chr571683 1586 1298 1273 1166 486 383 ------
NM_018919chr571683 1586 1298 1273 1166 486 383 ------
NM_018920chr571683 1586 1298 1273 1166 486 383 ------
NM_018921chr571683 1586 1298 1273 1166 486 383 ------
NM_018922chr571683 1586 1298 1273 1166 486 383 ------
NM_018923chr571683 1586 1298 1273 1166 486 383 ------
NM_018924chr571683 1586 1298 1273 1166 486 383 ------
NM_018925chr571683 1586 1298 1273 1166 486 383 ------
NM_018926chr571683 1586 1298 1273 1166 486 383 ------
NM_018927chr571683 1586 1298 1273 1166 486 383 ------
NM_018928chr571683 1586 1298 1273 1166 486 383 ------
NM_018929chr571683 1586 1298 1273 1166 486 383 ------
NM_018945chr653291 2885 2662 725 160 23581 1480 12703 --
NM_018948chr111000 21258 89 ----
NM_018951chr71105 11030 ----
NM_018953chr126821 755 148 62 50 44 ------
NM_018959chr192576 286 ------
NM_018963chr2131452 267 144 2302 95 11444 --
NM_018976chr1222201 99 12657 ----
NM_018977chrX2949 373 --11044 --
NM_018979chr123801 482 465 32461 1985 1967 --1773
NM_018992chr161135 11062 11367 --
NM_018993chr2051068 607 428 413 203 ------
NM_018994chr1122 1504 ----
NM_018999chr10134925 4789 4604 4529 4333 4254 3210 1882 1295 1120 770 339 244 11394 14551 --
NM_019000chr511303 41322 1203 1057 428 --11521
NM_019001chr384316 3929 3753 1642 1383 1076 468 35 14331 ----
NM_019004chr772167 2086 580 488 462 188 142 22108 385 1519 --
NM_019005chr7156 ------
NM_019006chr151218 ------
NM_019008chr22123803 3767 3556 3294 2510 1471 646 584 421 360 156 93 1890 13723 --
NM_019022chr1882495 2473 2445 2281 835 753 703 147 12359 ----
NM_019027chr442372 1948 1903 699 12304 ----
NM_019030chr5----1178 --
NM_019035chr431963 1718 1362 11855 --1829
NM_019036chr62902 128 ------
NM_019041chr652462 2305 2253 507 83 21651 1026 12052 11816
NM_019046chr10------1639
NM_019053chr1041010 983 928 798 ------
NM_019063chr251752 1713 1471 154 30 ----2779 656
NM_019072chr553914 3281 1715 1520 216 1377 ----
NM_019083chr151478 1455 1259 1238 352 ------
NM_019084chr1031824 873 147 11670 ----
NM_019087chr52336 281 --2643 256 --
NM_019096chr65982 905 404 354 35 ------
NM_019098chr841796 1576 713 263 1353 1294 --
NM_019102chr73456 400 82 --191 --
NM_019102chr73456 400 82 --191 --
NM_019106chr2292989 2172 1305 1252 818 800 751 723 288 12598 1245 --
NM_019114chr92956 267 --12101 --
NM_019116chr1693621 3433 1496 1320 1071 632 543 458 203 12573 33377 2447 1305 22706 1102
NM_019555chr34729 343 150 129 ------
NM_019557chr13776 690 289 --1837 --
NM_019590chr1041470 1443 1319 443 --1506 --
NM_019593chr2063079 2837 2828 2068 916 802 --22438 201 --
NM_019594chr931349 1260 463 --11488 --
NM_019597chrX4778 717 171 149 ------
NM_019600chr153634 325 196 3705 678 302 --1584
NM_019606chr74481 387 113 89 ------
NM_019610chr132118 588 282 --1137 --
NM_019854chr121713 ------
NM_019857chrX21777 1156 1621 ----
NM_019859chr102576 180 --41474 1170 1034 101 --
NM_019860chr102624 228 --41522 1218 1082 149 --
NM_019862chr1661714 1471 1463 1215 1189 494 ------
NM_019885chr252343 2232 891 334 123 12037 1347 --
NM_019891chr1--31309 1066 307 ----
NM_019898chr1661714 1471 1463 1215 1189 494 ------
NM_019899chr1661714 1471 1463 1215 1189 494 ------
NM_019900chr1661714 1471 1463 1215 1189 494 ------
NM_019903chr1021599 630 ------
NM_020066chr12876 366 ----1791
NM_020116chr441704 1157 562 542 --1371 --
NM_020120chr241197 1107 516 231 1382 ----
NM_020122chr275112 5062 4507 2008 1431 1415 1383 25393 5303 22308 675 --
NM_020123chr103557 299 125 ------
NM_020127chr121805 295 --31873 712 438 --
NM_020130chr851409 1243 1046 266 111 ------
NM_020132chr21125158 4921 4880 4447 3293 1217 1164 1079 1007 785 753 267 ------
NM_020134chr23871 793 204 --21016 220 --
NM_020139chr42187 176 ------
NM_020141chr152361 1940 1698 231 207 ------
NM_020144chr721623 769 2588 366 11720 --
NM_020147chr153788 232 66 ------
NM_020148chr1842331 1099 303 79 1282 12494 --
NM_020150chr1041833 831 565 131 --11932 --
NM_020177chr583267 2445 2373 1345 1339 1313 1305 387 21278 454 ----
NM_020178chr1711125 1848 1901 --
NM_020180chr1811182 1498 ----
NM_020182chr20133438 3416 3189 2726 2602 2315 1450 1426 1408 1251 1123 798 666 ------
NM_020184chr272074 2052 1978 1543 1454 459 439 --11799 --
NM_020204chr11641 2647 191 ----
NM_020205chr163333 2371 1355 1102 665 643 23431 3154 13257 --
NM_020226chr42519 89 ------
NM_020228chr1182388 1976 1929 1803 1573 926 307 131 ------
NM_020231chr32666 564 1129 ----
NM_020239chr162224 2212 1461 648 516 314 1684 1591 --
NM_020240chr542786 1879 1094 117 ------
NM_020310chr1762574 2383 2183 2039 779 430 --12413 11741
NM_020336chr2063818 3193 2790 2668 2549 620 33529 2807 2651 --31468 899 706
NM_020337chr433058 2966 2896 --1374 --
NM_020338chr10113194 3070 2654 2446 1188 1088 1028 917 752 578 329 ------
NM_020340chr612148 --1870 --
NM_020342chr222612 2224 --2297 62 --
NM_020346chr1121754 1103 ------
NM_020348chr1042640 1010 130 121 ------
NM_020357chr321273 58 3500 376 367 ----
NM_020366chr14------160
NM_020374chr1251569 1393 544 400 224 --1210 --
NM_020379chr12316 219 ------
NM_020381chr651959 1278 522 298 113 ------
NM_020390chr354341 3554 1732 913 902 24168 1286 21322 614 --
NM_020403chr131628 ------
NM_020420chrY11827 --11786 --
NM_020423chr12526 40 1456 ----
NM_020428chr1931002 918 803 ------
NM_020429chr732164 136 129 1198 22329 724 --
NM_020432chr741729 1517 796 464 ------
NM_020433chr2091419 1314 1160 656 551 521 440 315 28 11444 1270 --
NM_020440chr162528 2252 1188 1070 998 139 --12408 --
NM_020443chr1196919 6613 6539 6431 6043 5715 5654 5638 5143 4261 4228 2703 2315 1481 1122 1112 886 361 283 35466 4829 4255 15327 --
NM_020445chr72784 53 ------
NM_020452chr181915 1866 1691 1440 1323 473 396 97 1835 --11606
NM_020455chr652636 2443 1939 1061 1022 1923 ----
NM_020456chr1322135 1737 --1425 1935
NM_020457chr163443 429 130 ------
NM_020473chrX1764 11644 1526 --
NM_020474chr1821765 683 ------
NM_020478chr822517 757 11918 1831 --
NM_020526chr151766 1593 1243 642 240 ------
NM_020530chr223776 398 353 --1925 --
NM_020630chr101584 1590 ----
NM_020638chr1271853 1520 1324 567 385 306 289 --2137 71 --
NM_020644chr111303 ----1283
NM_020647chr811839 --12264 --
NM_020648chr1862856 2419 659 539 272 218 ------
NM_020651chr221560 273 11383 ----
NM_020654chr31528 11211 --11566
NM_020661chr1261949 1830 1591 786 442 70 1381 11572 --
NM_020666chr52749 251 ------
NM_020673chr20137255 6424 5666 4775 3109 1957 1677 1445 1296 1184 1103 398 72 36487 6459 1330 ----
NM_020689chr2061208 1161 551 525 344 104 --21515 1456 --
NM_020698chr1293007 2920 2802 2586 1971 1107 343 330 177 42771 2098 1940 148 ----
NM_020699chr1145189 5012 4909 4825 3839 3436 3357 1222 1124 448 439 384 235 46 35202 1894 40 13339 --
NM_020708chr2021672 656 12444 1796 --
NM_020713chr2052378 2105 1955 643 148 --1363 --
NM_020717chrX73465 3299 1630 1620 1600 1543 132 34544 1112 721 ----
NM_020718chr16126100 5487 5105 4989 2439 2371 1653 1552 1135 946 822 425 --1277 --
NM_020724chr452470 1683 483 433 422 ------
NM_020727chr2163642 1423 1121 361 280 167 ------
NM_020728chr743147 2963 2267 216 --1940 --
NM_020732chr631280 233 214 ------
NM_020734chr1243092 2557 1332 940 1480 1322 --
NM_020739chr1564098 3571 2868 1361 1313 1242 22936 303 ----
NM_020742chrX32396 1799 1673 --12647 --
NM_020747chr52923 387 ------
NM_020748chr1721842 1587 ----11819
NM_020750chr64922 430 54 45 ------
NM_020752chr1072693 2538 2506 2208 2154 2082 210 12122 11001 --
NM_020766chrX104538 4340 3749 2890 2837 2784 1772 1436 1365 1065 --22931 162 --
NM_020768chr573191 3007 2339 1025 849 436 364 42385 2191 759 635 ----
NM_020769chrX4923 723 170 61 ------
NM_020771chr641227 1055 163 156 21220 1197 1260 --
NM_020772chr17158453 8200 7242 6720 6182 5600 5250 3017 2809 2659 2520 1968 958 494 351 38538 7458 2878 16791 --
NM_020773chr432096 2070 982 1286 --32284 1971 1929
NM_020774chr18104322 1996 1888 1858 1522 1297 1287 1067 617 280 54202 2075 1984 1454 305 --22334 268
NM_020775chr11171 ------
NM_020776chr1882877 1992 1902 1199 1181 949 321 92 --12669 1499
NM_020777chr472503 2490 2384 2174 2018 780 471 ----1931
NM_020778chr1594390 3318 1620 1415 1259 1094 841 676 606 14591 34616 4296 1020 --
NM_020786chr1651793 1768 1554 1452 191 ------
NM_020791chr1711137 ------
NM_020794chr1--11300 ----
NM_020795chr1741787 810 560 418 11972 21740 185 --
NM_020796chr572913 2475 1853 1023 980 661 222 1727 12133 --
NM_020800chr321041 985 11261 ----
NM_020801chr5102636 2572 2546 2537 2133 988 643 304 217 50 12143 ----
NM_020802chr1163085 2662 2372 1048 766 331 ------
NM_020805chr18--21768 1610 ----
NM_020806chr142850 229 1651 ----
NM_020809chr112557 148 21997 1803 1880 --
NM_020819chr611065 1818 ----
NM_020825chr16103511 3232 3045 2787 2544 1329 1154 959 788 335 13582 21005 800 --
NM_020826chr11113584 3529 2509 2321 2256 665 628 578 256 60 23 --11000 --
NM_020830chr273315 2635 2231 712 619 448 58 12370 ----
NM_020832chr13224 175 119 1610 ----
NM_020836chr143757 243 126 ------
NM_020839chr331538 371 302 --11579 --
NM_020841chr1221256 1122 13911 1787 1293
NM_020844chr896522 5458 4905 4725 2811 2512 2436 2354 1830 66976 6486 5303 3060 1729 1314 22306 1487 14892
NM_020845chr1262464 2288 2046 2036 1722 843 --12006 12115
NM_020850chr1682558 2449 2051 914 893 827 187 142 12139 12986 --
NM_020853chr1292643 2523 2461 1039 962 888 630 443 212 42650 2630 651 267 ----
NM_020854chr1811144 --2232 58 11059
NM_020856chr19--1615 ----
NM_020858chr1542308 2197 2133 759 ------
NM_020859chr4133960 3495 3435 3377 3072 2913 2646 2563 2524 1530 359 159 115 13359 13207 --
NM_020861chr651377 519 115 107 57 ------
NM_020866chr1311048 1842 ----
NM_020868chr231744 1520 388 ------
NM_020870chr442197 1761 1439 657 11609 ----
NM_020871chrX31838 994 230 21963 769 ----
NM_020872chr331649 1120 161 ------
NM_020899chr175617 566 557 549 261 --11710 --
NM_020918chr1033147 2923 2604 1441 2589 48 --
NM_020921chr1432714 1146 853 1698 ----
NM_020922chrX21348 610 ------
NM_020925chr13971 940 99 ------
NM_020940chr1012088 --1348 --
NM_020948chr1103632 3457 3434 3362 3031 3005 2997 2721 2709 91 --1720 --
NM_020952chr92673 79 ----1637
NM_020956chr1994734 4629 4617 4455 3786 3402 1480 685 371 --13731 --
NM_020958chr141272 --1353 --
NM_020960chr995002 4051 3708 3446 1963 1434 1148 847 167 ------
NM_020962chr1582495 2334 2279 1620 1584 755 735 647 ------
NM_020967chr2031147 293 144 1173 ----
NM_020975chr102472 247 1620 12022 --
NM_020977chr421413 739 11504 ----
NM_020980chr1551385 1255 1194 681 44 ------
NM_020983chr1282150 1928 1659 1641 929 894 685 532 --22241 1587 --
NM_020993chr1252361 2015 1902 402 221 ------
NM_021003chr143817 720 296 --2618 590 --
NM_021005chr152943 74 ------
NM_021007chr211657 --2950 918 --
NM_021012chr1773223 2407 2053 1194 1122 837 608 ------
NM_021020chr873420 3101 2244 2177 1267 908 157 13159 12266 --
NM_021032chr34152 70 47 36 ------
NM_021033chr1322913 980 1215 --13205
NM_021035chr2031307 215 97 --21287 1274 11244
NM_021038chr333405 2688 118 12801 ----
NM_021061chr864469 4249 4140 3002 161 80 1453 ----
NM_021072chr531007 441 237 12062 1312 12119
NM_021079chr1753012 2869 2344 993 204 --1742 --
NM_021088chr261878 1490 708 437 405 151 ------
NM_021090chr22114216 3160 1887 1643 1080 996 914 749 657 236 42 ----11200
NM_021096chr2273080 2765 2649 2559 1251 1057 697 2735 554 ----
NM_021097chr253045 845 790 760 746 12944 ----
NM_021116chr7188722 8578 8503 7822 6663 6350 3406 2563 2400 2379 2358 2105 2070 1852 1594 1522 1069 983 1908 13380 --
NM_021120chrX4960 755 48 24 --21219 970 --
NM_021133chr141102 238 132 51 11333 ----
NM_021136chr142683 61 --1158 --
NM_021144chr92446 436 ------
NM_021145chr71121 1164 ----
NM_021148chr721830 1625 21814 101 ----
NM_021149chr1621142 340 2901 168 ----
NM_021155chr19143008 2488 2471 2400 2321 2248 2233 1976 1852 1111 930 507 250 123 22621 98 22276 34 --
NM_021156chr2031027 410 54 1110 ----
NM_021159chr441560 572 566 224 ------
NM_021165chr12838 708 1620 1696 --
NM_021183chrX41716 787 592 122 1494 1253 11836
NM_021188chr143491 476 338 ------
NM_021190chr12281 148 ------
NM_021191chr1252546 2081 1871 408 140 32102 1720 727 1551 --
NM_021192chr23380 126 83 --1102 --
NM_021194chr11101 ------
NM_021215chr2072329 1965 717 544 391 354 96 12294 ----
NM_021220chr20----1126 --
NM_021229chr123505 435 150 ------
NM_021238chr1221977 1711 ------
NM_021239chr144586 428 201 168 ------
NM_021249chr1431484 1283 40 1313 11414 --
NM_021260chr1471332 1086 1078 933 533 479 24 136 ----
NM_021622chr1021815 48 --11914 --
NM_021629chr384172 3686 3572 1828 1334 873 797 482 11126 1613 11282
NM_021633chr151372 1237 1182 179 72 11117 --11128
NM_021637chrX31231 1112 444 ------
NM_021638chr4114749 4408 4277 3737 3551 3379 3366 3148 1794 1751 1442 14708 21467 946 1727
NM_021643chr231908 1317 1297 ----2668 562
NM_021645chr1372363 2024 1744 768 454 391 49 31689 712 265 --1466
NM_021647chr483888 1827 1755 1416 1380 1064 525 369 53976 3432 1586 457 109 24577 2909 11285
NM_021648chr672656 2333 2194 2175 1725 122 98 138 21087 911 --
NM_021649chr531740 696 280 11201 ----
NM_021724chr171263 168 ----
NM_021729chr111308 ------
NM_021813chr695606 5410 4092 3912 1753 1704 1539 821 574 ------
NM_021905chr692082 1518 1457 1436 842 629 473 371 93 11875 22261 2242 --
NM_021911chr5155274 5077 4624 4329 3727 3519 1855 1847 1632 1089 1074 529 408 371 192 11697 45296 5011 4641 592 --
NM_021912chr1533400 3173 2797 11098 11362 --
NM_021913chr1931725 360 151 ------
NM_021914chr1431864 875 265 22070 1678 ----
NM_021923chr421544 1365 ------
NM_021939chr173780 614 204 1226 1773 --
NM_021940chr641648 638 622 46 ------
NM_021942chr41941 ------
NM_021946chrX41331 1043 925 549 --1298 --
NM_021947chr172894 314 ------
NM_021949chrX52589 2353 2295 1147 291 ------
NM_021954chr1373172 3105 2864 2484 2444 454 303 --1353 12530
NM_021956chr641236 970 612 232 --1312 --
NM_021960chr131896 1779 309 1962 21773 1122 --
NM_021961chr11207379 6991 6526 6108 5872 5669 5389 2908 2772 2709 2686 2621 2614 2287 1994 1934 1816 1363 408 309 34594 2123 1551 16931 --
NM_021962chr1751899 862 842 491 425 ------
NM_021964chr345363 5217 4249 2083 12446 ----
NM_021976chr681044 895 805 752 329 283 231 210 --11027 --
NM_021977chr6133817 3502 3291 2953 2890 2837 2768 2497 1562 1542 788 599 288 22789 760 13154 --
NM_021984chrX41351 1298 602 523 11060 ----
NM_021987chrX41351 1298 602 523 11060 ----
NM_021988chr202998 371 ------
NM_021990chrX41351 1298 602 523 11060 ----
NM_022048chr15156400 6344 5963 5462 4950 4778 4692 4563 2515 2248 2007 1688 1028 649 232 --1581 --
NM_022049chr141872 1817 669 49 21842 497 1178 --
NM_022060chr1451380 1118 1025 859 505 --2522 81 --
NM_022062chr1151885 1765 1684 613 471 --2732 164 --
NM_022073chr1471527 1326 1272 1064 593 195 47 158 ----
NM_022075chr15972 692 661 624 258 1320 ----
NM_022080chr2042689 1718 778 734 32312 1819 1057 1324 --
NM_022087chr72657 455 ------
NM_022114chr1113867 3809 3228 3194 1627 1307 986 971 667 174 89 24677 3396 --14131
NM_022116chr71881 --1936 --
NM_022118chr131574 --1612 --
NM_022123chr142534 473 1483 ----
NM_022130chr5128 --1536 --
NM_022131chr321515 509 --136 11034
NM_022137chr1432043 1757 1694 1240 ----
NM_022166chr16206082 5531 5524 5164 5114 5044 4925 4737 2483 2399 2285 2161 1741 1722 1374 1333 1269 596 215 116 24754 1884 25723 269 --
NM_022169chr1151280 1269 1190 122 98 --1520 --
NM_022170chr771481 430 408 372 361 297 247 --2594 256 --
NM_022307chr71634 ------
NM_022337chr111539 ------
NM_022340chr353392 2518 1337 1218 884 1437 23573 696 1397
NM_022346chr42912 261 21223 27 ----
NM_022366chr1184 ------
NM_022367chr15682 676 593 461 196 2642 504 ----
NM_022442chr202998 371 ------
NM_022458chr722293 2095 32446 543 228 12430 --
NM_022459chr1386316 5900 1467 733 616 533 321 33 11279 11974 --
NM_022461chr331216 1169 44 ------
NM_022463chr17164 --21476 473 --
NM_022465chr12202945 2900 2844 2820 2713 2580 2500 2390 2072 2025 1949 1877 1223 1214 981 908 774 341 217 156 1368 32868 2216 810 --
NM_022473chr1563971 3411 1389 828 665 76 14049 12791 --
NM_022474chr1462631 2402 2296 1102 782 137 2188 163 11766 --
NM_022475chr41109 1255 ----
NM_022477chr2031422 491 253 ------
NM_022482chr2042598 2151 1998 1005 11763 ----
NM_022484chr721136 977 1489 ----
NM_022494chr101357 127 ----
NM_022496chr12--1339 153 --
NM_022497chr363564 2501 1074 842 117 97 --1473 --
NM_022648chr2114391 4354 4128 3862 3390 1762 1737 1263 1194 825 660 23264 2806 23103 548 --
NM_022650chr5175 ----1357
NM_022652chr124788 356 186 55 11002 ----
NM_022658chr1251326 349 298 276 39 ------
NM_022716chr193007 2941 2225 2082 1241 910 537 463 194 ------
NM_022719chr2263909 3477 3314 3291 3021 2361 12777 ----
NM_022726chr621119 1085 ------
NM_022733chr151169 981 973 397 32 11204 1310 --
NM_022735chr141795 1713 1423 156 ------
NM_022737chr191898 ------
NM_022739chr1751229 952 370 177 59 ------
NM_022745chr152833 2466 2452 1147 226 ------
NM_022749chr821115 220 ------
NM_022753chr192784 2477 1862 1819 792 769 610 187 32 22498 670 ----
NM_022756chr181367 1343 1227 1035 543 456 279 49 ------
NM_022758chr6113097 3088 2581 2335 2131 1058 841 792 627 563 74 13227 ----
NM_022763chr342663 2530 1983 1102 1270 12309 --
NM_022781chr972833 1243 741 714 609 98 37 1947 12333 11314
NM_022782chr121318 ------
NM_022825chrX2286 279 ------
NM_022831chr131752 1531 1440 11701 ----
NM_022832chr472305 2096 1895 1777 438 398 147 1388 12361 1930
NM_022833chr9101373 1361 1220 1110 1092 1061 303 294 199 45 --11047 --
NM_022836chr141519 1398 637 566 ------
NM_022840chr1821364 1070 157 ----
NM_022841chr1542738 1827 1030 438 32170 2023 863 ----
NM_022843chr1341172 1087 602 372 ------
NM_022845chr1641958 615 477 296 ------
NM_022893chr252563 618 401 317 223 32329 911 241 33180 2649 2573 --
NM_022894chr241755 1562 1318 348 ------
NM_022898chr14114105 3803 3617 3254 3165 3101 1447 1232 1054 527 330 34746 3817 303 34707 3569 1632 --
NM_022912chr232960 2351 674 22384 980 ----
NM_022970chr1041094 992 497 308 --11314 --
NM_022977chrX32274 468 220 21774 847 --11943
NM_023000chr1431433 1102 155 ------
NM_023001chr1431433 1102 155 ------
NM_023009chr14707 261 141 52 --2756 546 1217
NM_023012chr12160 ------
NM_023034chr84551 545 220 21 1390 ----
NM_023037chr132458 328 ------
NM_023039chr5148 ------
NM_023071chr1231037 386 196 ------
NM_023074chr1961095 899 859 320 298 243 1260 ----
NM_023079chr1741892 1422 512 52 11191 11589 --
NM_023105chr892410 2357 2266 2122 1820 1729 1689 875 87 ------
NM_023106chr892410 2357 2266 2122 1820 1729 1689 875 87 ------
NM_023110chr892410 2357 2266 2122 1820 1729 1689 875 87 ------
NM_023111chr892410 2357 2266 2122 1820 1729 1689 875 87 ------
NM_023925chr122127 110 ------
NM_023929chr842140 1086 676 306 11953 32805 1050 566 --
NM_023943chr3142 ------
NM_024007chr541966 864 787 632 ------
NM_024015chr1731084 1078 234 ------
NM_024017chr1771447 1210 1145 242 179 158 118 ----1133
NM_024019chr47996 418 408 347 90 74 45 ----1692
NM_024045chr101202 --1213 --
NM_024046chr33830 334 234 --1278 --
NM_024050chr192566 165 ------
NM_024052chr1792390 2180 1954 1926 1059 542 310 268 99 --1815 --
NM_024061chr71491 ----1481
NM_024076chr1932180 809 483 12349 ----
NM_024077chr92699 624 ------
NM_024090chr431768 426 180 ----11486
NM_024095chr1281311 1097 1054 519 387 353 95 53 ------
NM_024107chr174618 569 232 186 141 ----
NM_024117chr961110 1093 911 473 392 334 --11303 --
NM_024293chr23733 259 71 1752 ----
NM_024294chr6113097 3088 2581 2335 2131 1058 841 792 627 563 74 13227 ----
NM_024295chr872062 2044 1997 1761 368 266 197 ------
NM_024312chr1221146 256 ------
NM_024345chr985642 2061 1318 1215 757 690 337 320 14469 1296 14157
NM_024408chr193048 2398 2329 1263 1146 774 603 577 269 63634 3397 3064 2497 2336 1211 ----
NM_024411chr2061389 1297 1266 1185 300 146 --1204 11462
NM_024423chr1854024 2876 1386 972 449 44160 3009 1562 1267 ----
NM_024424chr113827 324 182 ------
NM_024425chr113827 324 182 ------
NM_024426chr113827 324 182 ------
NM_024430chr1861809 1795 1679 1325 450 372 1541 11744 --
NM_024494chr11628 ----1166
NM_024496chr14123 ----1783
NM_024511chr463405 2860 814 784 539 292 33067 3037 2999 ----
NM_024512chr342873 1136 1122 758 11291 11062 --
NM_024524chr322043 986 1148 1109 --
NM_024525chr12606 491 --1461 --
NM_024528chrX1139 ------
NM_024529chr13814 808 413 11149 ----
NM_024539chrX11245 ------
NM_024545chr2------1113
NM_024548chr331664 520 275 11731 ----
NM_024551chr1252183 1905 1720 746 365 ------
NM_024551chr1252183 1905 1720 746 365 ------
NM_024557chr112224 66 2695 427 ----
NM_024563chr521872 97 ------
NM_024567chr82652 70 ------
NM_024569chr162709 2437 2421 2287 953 383 22427 2228 1901 --
NM_024586chr15487 257 175 116 71 ------
NM_024620chr19--1102 ----
NM_024624chr211505 31584 1027 120 --1538
NM_024631chr111410 ------
NM_024638chr322384 783 22391 442 ----
NM_024645chr831375 1200 184 --11025 --
NM_024646chr193223 3088 2844 999 719 657 466 160 40 21177 211 31501 338 205 --
NM_024657chrX4173 72 49 25 131 ----
NM_024659chr21366 ------
NM_024665chr364626 4349 3367 3229 398 62 13375 ----
NM_024666chr152534 45 11663 11518 --
NM_024674chr183218 3206 3162 3055 2541 2042 620 323 1715 ----
NM_024700chr13816 363 38 1934 ----
NM_024713chr1511326 11507 ----
NM_024719chr13287 30 ------
NM_024721chr821699 946 1381 ----
NM_024726chr22534 64 ------
NM_024740chr1142553 2537 892 196 31276 673 419 1530 --
NM_024744chr242200 2088 824 603 21986 173 12353 --
NM_024759chr81614 --2632 197 --
NM_024761chr9164269 3991 3960 3871 3456 1971 1760 1559 1364 1188 1176 929 784 666 496 486 13372 34750 3234 791 --
NM_024762chr192190 140 ------
NM_024770chr2126631 6284 5117 2550 2224 2023 1795 1522 755 568 560 140 12667 1257 --
NM_024779chr1261603 1098 1055 218 97 90 --1187 --
NM_024785chr24554 539 505 125 11488 ----
NM_024786chr51164 ------
NM_024811chr1141584 590 371 99 1522 ----
NM_024828chr911281 41378 1144 475 372 ----
NM_024830chr571980 1973 1961 1860 793 600 322 --1161 --
NM_024831chr81533 2182 77 1218 --
NM_024834chr1021882 1641 31469 1249 302 --1772
NM_024875chr1091770 1711 1626 1541 298 237 227 220 47 ------
NM_024887chr162082 1854 1613 111 87 63 ----1292
NM_024893chr201258 1159 ----
NM_024899chr181509 1173 ----
NM_024909chr6101572 1469 1412 1400 1305 1193 520 486 429 423 1411 ----
NM_024920chr42316 123 31123 462 160 ----
NM_024921chrX31466 1452 59 --1678 --
NM_024930chr53667 396 45 --12490 --
NM_024939chr1631040 462 53 --11147 --
NM_024944chr2151300 1290 1206 906 318 ------
NM_024946chr1681604 1486 1394 1114 519 187 95 78 ------
NM_024947chr3109182 8965 6603 2912 2839 2723 2340 2327 1348 330 37803 6294 1299 17905 --
NM_024949chr474791 4297 3329 1466 576 385 377 24940 563 23821 586 11715
NM_024953chr1232037 1816 415 22767 2149 11968 --
NM_024958chr2051191 1140 985 824 88 ------
NM_024969chr23692 185 145 135 ----
NM_024971chr92673 79 ----1637
NM_024989chr2128132 7451 7292 6529 6178 5443 5407 3242 3120 1981 1537 96 37620 6953 6917 15937 --
NM_025004chr112617 195 2700 260 ----
NM_025054chr843892 2932 1287 1062 43599 1258 1090 319 --12995
NM_025073chr184667 4513 3770 3693 3577 3314 517 212 --33481 1730 1711 --
NM_025074chr442459 1118 911 215 ------
NM_025076chr22509 212 ------
NM_025090chr1761385 1253 1126 1083 952 456 --1564 --
NM_025099chr172138 30 ------
NM_025133chr2----2854 434 --
NM_025134chr1652104 1962 1925 1813 1736 12170 --11712
NM_025137chr15----1126 --
NM_025146chr35931 886 583 495 132 1204 1832 --
NM_025151chr851998 1952 1938 1726 794 --11432 --
NM_025160chr183500 3407 3345 1461 1446 1328 457 302 --13580 --
NM_025187chr1621165 946 11322 2890 533 --
NM_025191chr162969 1159 1068 599 552 312 22664 887 ----
NM_025194chr1921163 808 11114 ----
NM_025202chr231013 760 285 --1292 --
NM_025208chr1132187 855 362 1471 ----
NM_025221chr421217 186 1927 --1285
NM_025222chr362567 2200 1904 733 365 115 --13007 --
NM_025235chr1041430 1406 815 76 --11582 --
NM_025238chr1511106 11122 11300 --
NM_025248chr1793205 3160 2742 2306 2298 1167 321 267 64 --23177 2182 --
NM_025263chr62394 245 --1421 --
NM_030576chr1742261 2138 170 163 ------
NM_030579chr1693742 3609 3560 2994 2962 2643 1055 716 241 --33676 2302 1467 --
NM_030594chr1541289 1109 402 274 21019 995 ----
NM_030621chr1463483 2868 2625 1675 732 388 12749 ----
NM_030623chr251421 1404 1210 351 30 ------
NM_030625chr1032503 916 505 1537 1941 --
NM_030627chr593987 3185 3170 2553 516 498 464 238 198 21495 734 34030 1447 97 --
NM_030634chr1102349 2310 2118 2084 1820 1697 917 855 492 474 22443 603 21803 880 --
NM_030647chr7116317 5538 5254 4970 4457 2524 2282 2103 1437 757 30 35234 2143 1378 25940 253 --
NM_030648chr465222 5183 3905 1689 645 576 24932 3455 25347 1367 --
NM_030650chr283185 3178 3050 2972 1259 1249 1002 209 23010 2835 --23916 2884
NM_030652chr61269 1230 ----
NM_030660chr1451369 1316 1245 1017 507 ------
NM_030661chr73239 121 104 ------
NM_030664chr104872 845 358 117 21647 856 ----
NM_030670chr1232074 1901 1768 11745 ----
NM_030671chr1232074 1901 1768 11745 ----
NM_030674chr12145197 5032 4834 4640 4486 4293 3979 3869 2135 1712 1385 1299 1243 180 14667 11568 1310
NM_030751chr1021816 518 11742 11866 --
NM_030751chr1021816 518 11742 11866 --
NM_030761chr152298 952 807 604 502 ------
NM_030762chr1231955 231 183 2670 339 ----
NM_030773chr2041857 1325 1183 274 1425 ----
NM_030784chr62261 60 ------
NM_030796chr782192 2180 1949 1594 555 266 143 112 ------
NM_030797chr21110 ----1269
NM_030799chr541405 282 256 147 22171 1831 ----
NM_030806chr1159094 8740 7421 6309 5827 5711 3156 1644 1458 1364 1247 1063 842 382 259 11072 16479 27165 5703
NM_030808chr175886 875 778 739 204 ------
NM_030809chr1272385 1947 1605 721 715 552 502 148 ----
NM_030816chr162925 2603 999 783 735 464 1669 ----
NM_030881chr2271981 1943 1676 1511 614 99 64 1709 12439 --
NM_030885chr3122198 2187 2175 1901 1751 1628 1584 921 506 484 381 226 2659 355 ----
NM_030891chr2111176 --11305 --
NM_030912chr103816 300 135 ------
NM_030916chr12610 182 1948 ----
NM_030918chr1235382 4905 4792 4608 4443 4376 4360 4261 4193 4112 3984 3806 3367 2121 1806 1340 985 866 838 764 556 201 99 24575 826 21094 604 --
NM_030920chr142059 1776 1473 794 31357 779 345 1401 --
NM_030926chr251107 1058 957 126 35 ------
NM_030934chr141896 1799 1325 1284 ------
NM_030937chr121353 1009 ------
NM_030938chr1741181 334 167 88 ------
NM_030939chr621141 1070 ------
NM_030949chr6191 1949 --1510
NM_030952chr131331 904 442 1853 11316 --
NM_030953chr52195 188 1270 ----
NM_030962chr1131262 347 323 ------
NM_030963chr61159 ------
NM_030964chr5143480 3061 2400 1499 1157 990 904 816 748 697 634 572 533 48 --13074 --
NM_030973chr19127 ------
NM_030979chr13--1339 ----
NM_030981chr1171096 1037 854 812 315 186 53 --11050 --
NM_031203chr191255 ------
NM_031208chr1621002 210 178 ----
NM_031216chr1871593 1542 1521 1379 789 279 75 11784 ----
NM_031243chr731893 962 317 21726 441 ----
NM_031262chr921091 356 ----1149
NM_031263chr921148 413 ----1206
NM_031272chr17271 63 ------
NM_031289chr1241022 995 918 139 --2335 93 --
NM_031305chr461763 1735 1646 1635 425 23 --1695 --
NM_031314chr1451907 647 311 186 133 ----11984
NM_031369chr43346 154 128 1586 ----
NM_031370chr43346 154 128 1586 ----
NM_031371chr12569 356 11367 ----
NM_031371chr12569 356 11367 ----
NM_031372chr451369 649 643 631 519 1273 21660 185 1398
NM_031411chr541548 831 256 82 ------
NM_031417chr19101952 1751 1133 1019 955 703 363 311 199 97 --1815 --
NM_031419chr33539 433 185 ------
NM_031424chr204481 377 68 57 1414 1395 --
NM_031426chr982699 2527 2283 2277 2251 460 343 212 --22476 1126 1704
NM_031427chr14135477 4818 4709 3852 3727 2208 2040 1868 1635 1297 479 418 210 1150 --1796
NM_031435chr1243204 3002 1188 1030 13010 12612 --
NM_031438chr54691 379 256 239 11227 1464 --
NM_031439chr871700 1692 1343 1308 1286 1256 229 31556 1385 1279 1351 --
NM_031442chrX32349 2173 2114 --1377 --
NM_031445chr272968 2793 2786 2444 1221 1024 464 --1567 11074
NM_031461chr862313 2227 2010 1851 1707 610 1574 ----
NM_031468chr7207795 7592 7560 7337 6740 6700 6012 5564 5471 3177 2819 2490 1852 1593 1554 1426 1044 1012 686 508 35703 2730 1065 ----
NM_031469chr663990 3644 1644 1277 1012 375 13049 --12936
NM_031483chr2093597 3341 3252 1330 948 800 710 518 55 33290 2379 276 23528 365 13025
NM_031492chr113546 355 194 ----1217
NM_031844chr143300 1623 1252 1104 --33893 3459 119 --
NM_031845chr223314 1030 ------
NM_031847chr223314 1030 ------
NM_031849chr541548 831 256 82 ------
NM_031854chr172344 164 2350 29 140 --
NM_031857chr541548 831 256 82 ------
NM_031860chr541548 831 256 82 ------
NM_031889chr471942 768 759 543 507 474 291 --31431 693 656 --
NM_031890chr22133036 2667 2620 2175 2078 1998 1112 954 704 478 343 219 21 --22593 439 --
NM_031892chrX1114 --1941 --
NM_031899chr341431 423 417 92 11349 ----
NM_031904chr1162025 1605 1373 704 339 228 --12082 --
NM_031914chr144976 852 695 319 ------
NM_031922chr6----1365 --
NM_031935chr11141 --180 1211
NM_031990chr1951402 1022 548 523 328 ------
NM_031991chr1951402 1022 548 523 328 ------
NM_031992chr771481 430 408 372 361 297 247 --2594 256 --
NM_032012chr954064 1937 1758 645 638 24222 908 34357 1213 1024 --
NM_032013chr2031422 491 253 ------
NM_032017chr171870 1833 834 733 708 479 289 --1273 --
NM_032027chr12222 80 ------
NM_032041chr862286 2082 1877 534 285 45 --22173 2066 --
NM_032042chr562114 1898 1090 951 730 696 ------
NM_032047chr342096 2062 1912 756 --21998 502 --
NM_032051chr223271 225 97 ------
NM_032052chr221285 --1298 --
NM_032088chr571683 1586 1298 1273 1166 486 383 ------
NM_032092chr571683 1586 1298 1273 1166 486 383 ------
NM_032102chr1152926 2128 1213 560 82 22551 421 ----
NM_032116chr1355518 4366 2127 1698 1172 35817 4016 2185 14173 --
NM_032121chrX52571 1908 1057 491 224 32385 1914 1799 ----
NM_032124chr182251 189 163 1326 --
NM_032127chr11164 ------
NM_032132chr11156 -----