TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4476
miRNA Sequence: CAGGAAGGAUUUAGGGACAGGC

<
mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000018chr17265 39 --167 --
NM_000021chr145693 142 130 78 37 --11046 --
NM_000024chr54436 414 369 131 ----1374
NM_000033chrX2942 122 1629 ----
NM_000034chr161166 ------
NM_000037chr841915 1746 789 464 --12190 --
NM_000038chr541640 1580 1324 281 --11585 --
NM_000044chrX2106 45 ------
NM_000051chr1193227 2823 2211 1223 814 753 728 702 25 1565 ----
NM_000055chr3135 1423 ----
NM_000068chr1931509 1502 610 11518 11177 --
NM_000074chrX5775 656 623 607 358 ----1690
NM_000075chr123228 186 49 1115 ----
NM_000080chr172227 91 --1606 1279
NM_000081chr12618 501 11315 ----
NM_000084chrX186524 6128 5874 5854 5825 5808 5447 5409 2712 2217 2098 2046 1900 1771 1632 826 818 720 34743 4630 1476 36918 5861 5829 1130
NM_000088chr1741117 405 145 46 --3369 359 321 --
NM_000089chr76705 661 192 96 65 48 ------
NM_000090chr21936 --1360 --
NM_000092chr2134242 3944 3153 3132 3074 2932 2840 1631 1014 596 481 119 106 63616 3363 2877 1799 61 43 24468 1486 --
NM_000093chr972273 2127 1743 1632 967 950 540 12233 11634 --
NM_000109chrX72136 2047 2040 2026 1066 930 591 ------
NM_000125chr6133678 3376 3332 2710 1629 1597 1556 1503 1493 1221 899 697 236 1125 11446 13364
NM_000138chr1592378 2360 2290 1991 1844 1762 905 303 191 ------
NM_000141chr1031316 1052 182 --1307 --
NM_000142chr451579 1502 1384 1084 504 11342 ----
NM_000153chr1451672 1565 1446 534 40 --146 11625
NM_000163chr512371 --1892 --
NM_000165chr631552 1142 416 21300 520 ----
NM_000167chrX61323 686 676 646 469 337 11393 1695 --
NM_000168chr782830 2340 2220 2171 2065 971 326 201 --22372 2240 22377 2301
NM_000170chr91435 ------
NM_000175chr19----141 --
NM_000176chr551395 632 532 391 342 22772 1029 21373 1197 --
NM_000178chr204357 135 124 27 ------
NM_000189chr261969 1882 832 755 33 27 --142 --
NM_000192chr1251388 1338 981 310 201 132 1323 --
NM_000202chrX113971 3916 3885 3296 2671 2634 2612 2448 1506 725 42 32875 2523 1194 63133 2636 2489 2456 2415 875 --
NM_000208chr1994327 4258 4118 3551 1884 1875 1394 802 394 24676 4199 43519 3175 761 50 1766
NM_000210chr242346 773 712 423 1720 12350 --
NM_000212chr1752008 1679 920 544 290 11687 21898 361 --
NM_000216chrX73872 3147 1597 1579 862 799 762 --13519 1484
NM_000217chr12145226 4684 4187 4176 3787 3639 3592 3453 3352 2061 2030 1953 1265 216 44053 1998 1412 661 34962 3985 2063 13360
NM_000218chr113865 383 193 2969 687 ----
NM_000220chr114988 903 703 349 1926 ----
NM_000221chr22210 59 ------
NM_000222chr461680 1595 1381 294 131 45 --11501 --
NM_000232chr422933 2672 13104 ----
NM_000237chr82404 118 --21442 719 --
NM_000240chrX71448 843 748 668 426 372 258 21683 681 ----
NM_000248chr382750 2691 2393 2212 355 268 95 39 22058 1189 143 --
NM_000252chrX2379 146 1473 ----
NM_000258chr31232 --2248 244 --
NM_000259chr15116008 5541 5439 5033 5021 4887 4673 4625 4159 2483 2258 35216 1018 654 45040 4018 4005 2078 --
NM_000264chr9103332 3131 3093 2331 2142 1264 1158 899 791 63 23306 1245 12077 --
NM_000266chrX2400 185 --1206 --
NM_000267chr17133456 3290 3210 2934 2748 2392 2140 1121 896 374 105 78 62 --1390 1901
NM_000268chr2283680 3472 3176 2451 978 784 253 127 --52455 2366 1265 1256 816 --
NM_000276chrX52133 1710 1505 797 353 21816 143 31712 1507 436 --
NM_000278chr1061593 1565 839 673 591 513 --11701 --
NM_000280chr112996 687 ------
NM_000284chrX11712 ------
NM_000289chr121105 1285 ----
NM_000297chr4112011 1964 1951 1918 1628 1600 1557 1362 494 458 419 12061 --11890
NM_000303chr1621452 234 --11425 11112
NM_000304chr1721038 385 ------
NM_000310chr161236 994 874 116 70 46 11079 31240 988 500 --
NM_000314chr1073009 2274 1052 737 344 280 131 --1588 --
NM_000319chr125989 950 404 368 122 --1268 --
NM_000321chr133454 255 77 --1351 --
NM_000328chrX1323 1297 ----
NM_000330chrX62112 2056 1798 1396 610 161 31466 855 401 11418 --
NM_000332chr6186503 6167 6127 5949 5915 5554 5515 4884 4619 4547 2868 2851 2788 2428 2134 1963 1238 288 32736 1646 102 37051 5672 2305 15485
NM_000334chr1741904 1895 1591 1582 1675 21943 1808 --
NM_000335chr331700 846 653 1410 196 --
NM_000337chr5116508 6466 6110 5790 5708 5428 5099 4924 4816 4659 501 11094 15276 --
NM_000338chr15--1939 ----
NM_000340chr331148 1084 469 --11152 11401
NM_000345chr42186 126 --11050 --
NM_000346chr1741976 1963 609 132 --11224 --
NM_000351chrX164249 3992 3978 3782 3757 3605 2937 2792 1524 1416 1316 1039 936 827 517 231 22832 1675 1670 --
NM_000362chr22163544 3420 3125 2882 2577 1422 1214 882 843 721 411 399 368 279 68 37 33397 2837 2385 41292 1278 818 197 --
NM_000365chr122138 74 --2112 27 1330
NM_000367chr612179 12282 ----
NM_000368chr9164692 4365 4356 4312 4239 4100 1814 1647 914 713 517 456 375 368 283 195 23084 621 31906 1406 80 14814
NM_000369chr1481412 1393 1361 1338 763 717 481 264 11936 ----
NM_000378chr112321 112 --1327 --
NM_000386chr172761 28 --2564 22 --
NM_000390chrX32592 2119 147 32933 2847 521 ----
NM_000391chr1181495 1460 1181 1111 547 524 453 273 1670 41665 1579 1309 1146 1390
NM_000393chr251679 810 739 714 361 21369 677 ----
NM_000394chr214431 111 100 81 ------
NM_000399chr102148 88 1171 190 --
NM_000408chr282743 2338 2289 2125 1332 1133 1127 526 1809 1546 --
NM_000411chr2182529 2453 2321 2029 1308 711 670 87 13050 --1673
NM_000412chr3----2271 267 --
NM_000414chr52272 219 ------
NM_000415chr122133 48 ------
NM_000421chr173344 309 261 ------
NM_000425chrX1588 --1171 1124
NM_000428chr1452469 2296 1016 360 256 2866 75 22256 258 --
NM_000430chr1783431 3095 3076 2653 2471 353 101 35 --12509 --
NM_000435chr197862 303 288 265 179 109 75 --4278 248 80 60 --
NM_000439chr592384 2214 2046 1611 1561 812 739 253 41 22060 515 3767 725 222 --
NM_000441chr7151 --12355 --
NM_000447chr1----1104 --
NM_000448chr1182668 2524 2221 2138 2005 1198 957 434 11034 ----
NM_000449chr121356 1023 21104 98 21017 64 --
NM_000450chr15692 683 376 268 213 1627 197 1216
NM_000451chrX51931 1921 1831 313 96 11946 1460 11860
NM_000452chr13101930 1886 1685 1517 1307 815 803 730 583 378 32006 352 194 --11690
NM_000458chr173916 815 198 ------
NM_000460chr35492 400 377 98 51 192 ----
NM_000461chr3104337 4264 4072 3674 3628 3101 1093 989 787 584 --21711 1296 --
NM_000462chr1521686 1291 11822 1171 11294
NM_000474chr7----1527 --
NM_000478chr13747 489 171 ------
NM_000484chr21--1831 11053 --
NM_000486chr1282827 2646 2510 1990 1216 1038 823 123 --43222 1983 827 540 --
NM_000488chr1--129 ----
NM_000489chrX143154 3044 3001 2910 2475 1127 1091 777 705 695 292 264 172 123 1208 ----
NM_000493chr62383 150 ------
NM_000503chr841716 1558 1324 394 ------
NM_000505chr5122 ------
NM_000509chr4--2198 71 ----
NM_000522chr73217 156 134 ----1416
NM_000527chr1952324 1951 1549 823 191 --42104 550 197 40 --
NM_000530chr12380 267 ------
NM_000533chrX41902 1830 1502 759 21302 112 124 --
NM_000538chr1341518 299 215 117 --1576 --
NM_000539chr341353 511 301 56 --21193 1010 --
NM_000544chr6_cox_hap1123304 3284 3242 2745 2551 2474 1290 1187 1004 744 372 279 33125 2936 2500 22450 492 2482 284
NM_000554chr1983314 3285 3157 3128 1065 412 161 123 11288 2163 46 11090
NM_000555chrX217684 7651 6962 6324 5900 5867 5656 5581 5540 5526 5348 4828 2776 2405 2306 2268 1527 916 340 278 164 25694 2023 56975 6792 5812 5660 5605 12710
NM_000557chr202419 22 --151 --
NM_000574chr141350 1066 1046 246 2967 862 1500 21069 249
NM_000575chr221013 407 ------
NM_000578chr251517 1511 1440 1387 524 1145 ----
NM_000594chr6123 --1637 --
NM_000598chr731507 493 206 1249 ----
NM_000599chr2123927 3465 3245 3188 2993 1669 1412 1086 1019 830 607 21 --33359 3295 1027 --
NM_000601chr71335 ------
NM_000602chr731178 503 97 ------
NM_000609chr1082728 2664 2641 2208 1240 1214 501 273 13140 12163 --
NM_000610chr1192654 2107 1940 685 443 415 333 263 197 --12944 --
NM_000611chr11217111 6762 6327 6130 6121 5697 5019 4793 4769 2676 2174 1920 1393 1094 1074 697 647 611 329 254 55 36928 6464 2311 24727 1496 --
NM_000615chr11102899 2802 2501 2460 1218 1017 892 694 673 664 --11081 1567
NM_000618chr12176597 6163 5961 5834 5812 5638 5299 4699 4678 4479 4305 2633 2617 1907 1278 1065 415 22211 433 34945 1826 804 --
NM_000618chr12176597 6163 5961 5834 5812 5638 5299 4699 4678 4479 4305 2633 2617 1907 1278 1065 415 22211 433 34945 1826 804 --
NM_000620chr1282036 1987 1953 1907 504 191 158 64 --52022 1989 1877 407 66 --
NM_000621chr1321431 218 ----1992
NM_000625chr172425 129 ------
NM_000627chr21676 --1678 --
NM_000633chr1895042 4882 4340 3727 3418 2105 1669 452 376 --15227 34912 1264 1214
NM_000663chr1673101 2473 2255 1174 1140 958 190 ------
NM_000680chr8277 55 ------
NM_000681chr1061174 1139 904 402 179 114 2274 243 ----
NM_000682chr291522 1449 644 582 448 305 219 95 59 --21677 352 --
NM_000684chr1051247 508 498 433 229 --1278 --
NM_000685chr3--1685 2765 174 --
NM_000685chr3--1685 2765 174 --
NM_000693chr1571736 1574 1428 1137 462 150 91 --122 11274
NM_000719chr12176562 6320 5934 5926 5001 4919 4620 4446 4418 2631 2377 2174 2135 1686 996 913 789 --76277 4766 2379 2358 2346 1280 846 --
NM_000721chr1102654 2525 2329 2240 2115 1987 1736 1673 389 311 ------
NM_000723chr1791417 1286 503 448 431 405 365 308 113 1320 3492 254 238 --
NM_000724chr10--11507 --1598
NM_000725chr121330 1662 2789 259 --
NM_000726chr221051 1027 ------
NM_000756chr82434 401 ------
NM_000788chr471061 979 963 571 554 330 304 2930 527 ----
NM_000794chr53915 834 127 ------
NM_000795chr1161118 936 916 908 759 734 --4918 894 321 311 --
NM_000800chr531389 668 158 --1423 --
NM_000801chr2071064 1008 993 983 782 185 100 1800 2708 197 --
NM_000806chr531546 562 116 11832 ----
NM_000807chr41285 1278 ----
NM_000809chr4268793 8648 8027 7412 7143 6924 6833 6814 6782 6758 6611 6333 6065 6020 5694 5610 3669 3604 3172 2841 2586 2229 1428 1180 578 469 49084 5792 1796 443 68554 7145 6835 6337 2526 584 --
NM_000810chr151216 ------
NM_000811chr51283 151 ----
NM_000812chr41383 --136 --
NM_000813chr594643 3518 2128 1948 1854 1773 1695 1630 369 35461 1569 711 15375 --
NM_000814chr1593913 3871 3027 2976 1364 1117 1095 551 148 11474 ----
NM_000817chr211140 ------
NM_000818chr10175 1477 ----
NM_000820chr131267 --1104 --
NM_000824chr42384 57 ------
NM_000826chr4--12489 ----
NM_000827chr561870 1025 628 421 182 146 1438 1423 --
NM_000828chrX71405 839 588 555 462 162 135 ----1818
NM_000829chr1152174 2016 1930 1743 734 ------
NM_000831chr176232 5911 5266 4613 4421 1694 374 1774 45528 4615 4022 909 --
NM_000833chr1671542 1270 1122 1010 556 543 171 1337 ----
NM_000834chr1241295 1054 908 315 1804 2213 112 11264
NM_000837chr81364 --1526 --
NM_000838chr682735 2719 2186 2007 1015 966 561 236 --11757 --
NM_000840chr7--2361 170 ----
NM_000842chr114680 652 499 488 --1517 --
NM_000844chr321061 242 ------
NM_000855chr112337 276 ------
NM_000859chr531299 364 169 ------
NM_000864chr151121 807 794 236 145 --2957 953 --
NM_000868chrX4510 305 281 61 32619 718 25 6297 293 285 273 269 265 --
NM_000870chr581337 1210 1161 630 520 238 151 110 --1384 --
NM_000872chr1041444 1415 1363 1005 21389 1300 21417 72 --
NM_000875chr15186833 6416 5956 5537 4993 4922 4781 4748 2382 2155 2118 1853 1725 1393 1146 809 607 315 26621 1365 32677 1343 330 1519
NM_000876chr621230 448 --21232 173 --
NM_000880chr8--194 ----
NM_000883chr74624 483 277 120 ------
NM_000883chr74624 483 277 120 ------
NM_000891chr1773266 3252 1070 992 920 661 438 13633 23270 994 --
NM_000899chr1253772 3369 3095 1433 608 12848 21682 1544 --
NM_000902chr382897 2453 2034 1972 1300 1210 664 483 13180 12036 --
NM_000905chr71124 134 ----
NM_000908chr53671 570 188 ------
NM_000917chr101876 163 --1679
NM_000919chr5156 1181 ----
NM_000927chr72577 116 ------
NM_000933chr2041702 544 175 87 ------
NM_000935chr331020 952 817 ------
NM_000944chr452318 2199 1779 1653 1555 31657 701 320 22376 675 --
NM_000945chr281917 1701 1386 1316 539 530 524 38 21855 355 ----
NM_000949chr53730 150 119 1188 1779 --
NM_000950chrX103621 3402 3376 3337 3271 3129 2313 1441 1166 234 23408 58 13205 --
NM_000956chr14--1350 1285 --
NM_000958chr511208 ----11000
NM_000961chr2073937 3737 3119 2735 705 227 74 ----1360
NM_000962chr9123015 2741 2301 2282 1920 1040 926 873 601 497 387 181 1752 42065 2001 930 827 --
NM_000963chr152276 1864 1705 760 377 --11635 --
NM_000964chr1731375 1335 126 ----160
NM_000965chr31255 21249 361 3996 955 384 --
NM_000966chr122755 115 --5933 883 425 339 174 --
NM_000983chr131014 526 166 2530 404 ----
NM_000990chr1173946 3596 2684 1147 1046 549 44 --12507 --
NM_001001132chr2151340 1334 390 297 135 ----1277
NM_001001323chr1232369 788 457 12574 ----
NM_001001331chr372319 2289 1930 1904 1835 1078 58 --32293 268 164 --
NM_001001342chr1031298 1061 1018 1220 1179 --
NM_001001344chrX62180 1689 1003 874 831 356 12570 1139 --
NM_001001389chr1192654 2107 1940 685 443 415 333 263 197 --12944 --
NM_001001390chr1192654 2107 1940 685 443 415 333 263 197 --12944 --
NM_001001391chr1192654 2107 1940 685 443 415 333 263 197 --12944 --
NM_001001392chr1192700 2153 1986 731 489 461 379 309 243 --12990 --
NM_001001395chr1262557 2244 935 755 424 367 1462 --12663
NM_001001396chr1224091 3880 3849 3825 3742 3734 3680 3541 3426 3317 3255 3069 2978 2712 1782 1190 1071 945 860 822 814 294 --93673 3668 3664 3111 1691 1583 1458 871 866 --
NM_001001419chr584793 3556 3499 3461 3353 1962 669 404 13998 23842 1976 14685
NM_001001420chr584793 3556 3499 3461 3353 1962 669 404 13998 23842 1976 14685
NM_001001433chr2083050 2827 2554 2446 1070 483 197 152 13031 ----
NM_001001436chr162191 120 1612 ----
NM_001001481chr883417 2782 2700 2627 1238 895 327 124 23421 1298 12822 --
NM_001001484chr1082423 1645 871 853 625 357 146 116 --1361 --
NM_001001502chr52108 88 ------
NM_001001520chr192135 55 ------
NM_001001549chr731792 624 602 12207 32617 1907 409 --
NM_001001550chr731792 624 602 12207 32617 1907 409 --
NM_001001555chr731792 624 602 12207 32617 1907 409 --
NM_001001556chr1561165 1135 557 422 83 60 ------
NM_001001557chr862178 1679 1586 1519 341 170 11660 12180 --
NM_001001560chr223850 534 158 ------
NM_001001664chr233619 2559 361 11488 ----
NM_001001668chr1953391 3355 3183 1057 315 ------
NM_001001701chr441494 646 634 69 11488 22269 127 --
NM_001001702chr541644 766 499 68 --21563 383 --
NM_001001709chr91927 --1800 1932
NM_001001787chr11193 --2197 185 --
NM_001001890chr21133987 3474 2999 2942 2868 2852 2838 2828 2798 2757 1109 976 591 34020 3686 3648 44247 3102 3063 2979 --
NM_001001938chr9173980 3799 3552 3348 3118 3073 2684 2613 1641 1532 1287 1240 1234 436 396 325 314 31589 1171 120 11565 --
NM_001001971chr102925 58 ------
NM_001001995chrX71805 1588 1559 1334 680 577 160 ------
NM_001002006chr22117 55 1576 ----
NM_001002033chr172695 39 ------
NM_001002233chr882001 1725 1443 692 671 604 461 345 ----11730
NM_001002243chr23934 51 35 ----1302
NM_001002252chr12264 26 ------
NM_001002257chr272871 2762 2483 2354 2269 1218 1094 12321 43163 1113 727 472 162
NM_001002265chr103749 662 24 --3668 169 78 --
NM_001002266chr103749 662 24 --3668 169 78 --
NM_001002294chr12310 281 ------
NM_001002295chr104821 794 445 53 ------
NM_001002762chr1062574 2538 2519 2258 831 342 12225 2521 378 --
NM_001002811chr171488 1478 1221 602 562 548 181 --31490 1235 1231 --
NM_001002812chr171488 1478 1221 602 562 548 181 --31490 1235 1231 --
NM_001002812chr171488 1478 1221 602 562 548 181 --31490 1235 1231 --
NM_001002838chrX61785 1675 523 404 321 77 ------
NM_001002843chr152845 337 11195 ----
NM_001002860chr1494048 4019 3758 3720 3365 1371 688 551 400 23320 1668 11681 --
NM_001002876chr222406 156 ------
NM_001002909chr17101957 1650 1643 1488 768 432 370 343 333 197 22265 1754 --32120 1389 773
NM_001002919chr21127 ------
NM_001003652chr18178492 7401 6832 6603 6127 5579 5333 3454 3217 2710 2364 1502 1086 938 725 528 399 68694 7200 7165 2979 1682 160 36131 2452 2226 --
NM_001003674chr18106558 6050 5913 4702 4685 2311 1946 1629 1429 1145 35364 5194 1954 24310 1147 16563
NM_001003675chr18106558 6050 5913 4702 4685 2311 1946 1629 1429 1145 35364 5194 1954 24310 1147 16563
NM_001003676chr112336 258 --1266 --
NM_001003681chr2251909 1782 1568 1483 482 --22023 1636 --
NM_001003688chr421119 438 ------
NM_001003690chr66415 335 150 123 96 47 --1315 --
NM_001003694chr33596 576 570 ------
NM_001003698chr651666 1634 1236 541 69 1285 11364 --
NM_001003699chr651666 1634 1236 541 69 1285 11364 --
NM_001003712chr1253909 3099 2892 1402 1136 43620 2459 1126 540 ----
NM_001003792chr32438 417 --1452 11136
NM_001003793chr32438 417 --1452 11136
NM_001003794chr392938 2811 2478 2020 1882 1027 1001 745 679 --62299 1198 747 540 441 380 11004
NM_001003800chr983399 3348 2986 1327 1139 861 775 573 --13287 --
NM_001003805chr14165 ------
NM_001003810chr42584 254 ------
NM_001003891chr222246 83 1221 1113 --
NM_001003937chr281573 1496 1434 693 502 248 184 133 --31102 663 111 --
NM_001003940chr15153853 3637 3350 3261 2979 2823 2460 1512 1246 1173 1030 1009 862 499 427 11167 42760 2507 2395 174 --
NM_001003942chr15153853 3637 3350 3261 2979 2823 2460 1512 1246 1173 1030 1009 862 499 427 11167 42760 2507 2395 174 --
NM_001003943chr15153857 3641 3354 3265 2983 2827 2464 1516 1250 1177 1034 1013 866 503 431 11171 42764 2511 2399 178 --
NM_001004065chr963894 3745 3386 3134 2954 2931 --23349 3306 --
NM_001004106chr54950 676 242 81 --1848 --
NM_001004317chr642841 1638 851 452 --24430 26 --
NM_001004329chr122508 378 11128 ----
NM_001004342chr1206041 5827 5601 4761 4200 1872 1638 1431 844 832 811 780 765 727 719 713 680 643 512 315 34840 4236 4170 115798 5021 4567 2102 1614 1409 981 793 774 742 276 --
NM_001004346chr421005 166 --1990 --
NM_001004356chr421545 1047 ------
NM_001004358chr421545 1047 ------
NM_001004360chr251741 1701 1432 584 234 ------
NM_001004419chr1254588 4333 4159 1532 1330 ------
NM_001004441chr551604 1374 1365 1123 26 ------
NM_001004720chr23974 957 667 ------
NM_001004722chr231143 1126 836 ------
NM_001005158chr31396 ------
NM_001005159chr31396 ------
NM_001005217chr43454 74 61 ------
NM_001005266chr155620 494 484 208 187 ------
NM_001005267chr155620 494 484 208 187 ------
NM_001005268chr155620 494 484 208 187 ------
NM_001005269chr155620 494 484 208 187 ------
NM_001005271chr1771078 1065 1043 262 195 176 92 --31171 1167 274 --
NM_001005273chr1771078 1065 1043 262 195 176 92 --31171 1167 274 --
NM_001005335chr191263 --151 --
NM_001005340chr72744 229 182 1858 --
NM_001005366chr125882 394 386 48 25 2874 822 1751 --
NM_001005375chrY41788 1394 1371 199 --11381 11309
NM_001005386chr23456 47 39 2527 287 ----
NM_001005404chr17124433 4287 4264 3664 3503 3239 3219 3011 1584 1335 148 60 --21076 970 --
NM_001005463chr1052086 1709 1046 731 192 --32189 1847 860 --
NM_001005473chr5146495 6447 5985 5185 5177 4921 4835 2599 2433 2327 2305 2290 2111 1474 35386 1667 85 45189 5138 1106 364 15418
NM_001005476chr2--2187 36 ----
NM_001005502chr12125120 4794 4558 4421 4295 3431 2044 1700 1229 1159 573 118 --11963 24100 1848
NM_001005505chr351692 1631 1392 517 54 --2327 243 --
NM_001005527chr331208 400 327 1926 ----
NM_001005609chrX153847 3444 3346 3139 2449 2377 1403 1261 1075 832 790 602 561 175 35 12568 1241 --
NM_001005732chr21166 --1630 --
NM_001005733chr212228 66 --1587 --
NM_001005741chr11156 --1393 --
NM_001005742chr11156 --1393 --
NM_001005746chr221051 1027 ------
NM_001005747chr221051 1027 ------
NM_001005753chr252252 2121 2063 2027 1954 --21701 661 1776
NM_001005781chr21487 ------
NM_001005782chr22936 327 ------
NM_001005785chrY41788 1394 1371 199 --11381 11309
NM_001005786chrY41788 1394 1371 199 --11381 11309
NM_001005845chr831563 167 34 21712 41 2473 402 --
NM_001005849chr172598 140 ------
NM_001005861chr31112 --1723 --
NM_001005910chr31498 1519 ----
NM_001005911chr31498 1519 ----
NM_001005920chr1621098 995 --1723 --
NM_001006115chr362124 1974 1125 829 458 406 --32756 2638 31 12173
NM_001006600chr551978 1750 1683 1507 541 ------
NM_001006605chr151114 993 821 471 110 --11128 --
NM_001006605chr151114 993 821 471 110 --11128 --
NM_001006610chr163858 761 380 ------
NM_001006612chrX163 ------
NM_001006613chrX163 ------
NM_001006614chrX163 ------
NM_001006634chr163215 143 71 ------
NM_001006636chr22398 55 ------
NM_001006641chr961779 1577 1446 1329 1195 334 --11331 --
NM_001006642chr961779 1577 1446 1329 1195 334 --11331 --
NM_001006643chr961779 1577 1446 1329 1195 334 --11331 --
NM_001006665chr14765 546 171 165 --1293 1806
NM_001006684chrX3408 123 41 ------
NM_001006933chrX157 ------
NM_001006939chr103743 647 612 ------
NM_001006946chr261822 1391 1300 525 232 59 ------
NM_001007024chr17104320 4236 3732 3584 3460 3386 1771 845 466 429 --24217 3914 --
NM_001007025chr17104320 4236 3732 3584 3460 3386 1771 845 466 429 --24217 3914 --
NM_001007027chr11--159 ----
NM_001007067chr851060 1003 786 83 45 --2341 49 2243 121
NM_001007068chr851060 1003 786 83 45 --2341 49 2243 121
NM_001007069chr851060 1003 786 83 45 --2341 49 2243 121
NM_001007070chr851060 1003 786 83 45 --2341 49 2243 121
NM_001007072chr151103 ------
NM_001007075chr43945 186 38 1349 ----
NM_001007097chr984019 3832 3819 3556 1957 1829 1721 613 24959 271 23157 1165 --
NM_001007098chr11319 --1115 --
NM_001007099chr12760 621 2802 154 ----
NM_001007100chr12760 621 2802 154 ----
NM_001007102chr641465 1430 1332 617 ------
NM_001007156chr1571883 1581 1494 748 672 398 198 ------
NM_001007214chr121631 117 1147 ----
NM_001007226chr1731028 1012 497 --11424 --
NM_001007227chr1731028 1012 497 --11424 --
NM_001007228chr1731028 1012 497 --11424 --
NM_001007229chr1731028 1012 497 --11424 --
NM_001007230chr1731028 1012 497 --11424 --
NM_001007237chr142189 813 532 461 32438 442 329 22460 55 --
NM_001007246chr2141582 1534 1193 174 11441 11199 --
NM_001007250chr13882 743 661 2924 276 134 --
NM_001007257chr131547 1255 1030 --1466 --
NM_001007267chr21133 ------
NM_001007466chr694967 3974 1964 1483 1475 1134 1107 311 303 11225 15028 --
NM_001007471chr92565 76 --178 --
NM_001007527chr5185 1217 ----
NM_001007553chr151189 1113 1012 444 435 --1145 --
NM_001007559chr1831873 697 90 ------
NM_001007565chr3--1269 ----
NM_001007793chr101202 148 ----
NM_001007794chr1--1514 ----
NM_001008220chr5113820 3784 2663 1086 941 591 547 232 123 56 43 ------
NM_001008222chrX71333 1184 1167 1058 889 559 299 21340 1315 ----
NM_001008223chr123446 119 35 --2542 511 --
NM_001008225chr71601 ------
NM_001008239chr1873296 1017 212 147 45 38 21 23388 1414 31193 566 300 --
NM_001008272chr35217 110 99 90 82 ------
NM_001008273chr35217 110 99 90 82 ------
NM_001008388chr44410 209 107 92 ------
NM_001008391chr112717 200 --1179 --
NM_001008392chr353572 2879 991 344 302 13166 43576 2711 1160 948 1388
NM_001008393chr452745 2630 2601 2281 1811 2563 50 32782 2648 2473 12604
NM_001008401chr1911511 11505 ----
NM_001008408chr7155927 5607 5590 5433 4822 4642 4040 2427 2268 1502 1456 1336 1020 829 605 --25517 1521 --
NM_001008410chr292309 2079 1934 1613 855 846 797 753 530 ------
NM_001008495chr851851 1512 824 512 438 --11517 1362
NM_001008539chr8125381 4680 4457 4421 4233 4056 3968 1769 1757 1278 1090 609 ------
NM_001008540chr21360 ------
NM_001008541chr1062271 2255 1798 1773 636 324 --1389 --
NM_001008541chr1062271 2255 1798 1773 636 324 --1389 --
NM_001008566chr221429 ------
NM_001008660chr1131407 439 112 --31411 982 978 --
NM_001008701chr19192917 2877 2865 2838 2828 2738 2476 2284 2024 1229 1196 1178 1018 888 847 614 600 366 332 --62845 2754 2493 1198 1182 872 --
NM_001008708chr23593 564 489 1198 ----
NM_001008738chr522389 1057 --12426 --
NM_001008784chr32218 21 ------
NM_001008800chr1154 ------
NM_001008801chr1922184 28 ------
NM_001008883chr1154 ------
NM_001008925chr463047 2735 2401 1147 863 803 23126 2854 22803 238 --
NM_001008938chr111368 ----1325
NM_001009184chr81364 --1526 --
NM_001009185chr52621 129 ------
NM_001009552chr81465 ------
NM_001009554chr483887 3424 1870 1829 1508 495 454 368 14161 43973 3426 1758 295 --
NM_001009554chr483887 3424 1870 1829 1508 495 454 368 14161 43973 3426 1758 295 --
NM_001009555chr461736 1266 1245 1097 710 354 --21090 507 --
NM_001009814chr13194 ------
NM_001009880chr22134811 4542 4311 3999 3918 3587 3202 1804 1561 1303 910 886 190 24431 897 13332 --
NM_001009894chr1221378 1263 ------
NM_001009899chr3155948 5737 5348 5200 5021 4726 4479 4434 4405 4269 2507 1979 1873 1168 687 64393 2437 2305 582 458 259 --14211
NM_001009923chr202578 142 1717 ----
NM_001009955chr12528 158 1449 ----
NM_001009955chr12528 158 1449 ----
NM_001009959chr242531 2466 480 392 11707 2902 533 1573
NM_001009993chr2114362 3777 3674 3221 3190 3058 2837 1602 1569 984 883 33936 1798 101 13104 --
NM_001010000chr1862680 1223 837 815 240 191 43171 965 483 299 33167 2817 1199 1745
NM_001010852chr6----1146 --
NM_001010861chr182739 2643 2469 2158 2114 1716 710 372 ------
NM_001010867chr1146105 6097 5831 5391 5226 5057 4071 2639 2632 2455 2088 813 212 74 26275 2582 ----
NM_001010888chrX134492 4102 3708 3495 3284 3200 3192 1575 1253 1208 1177 402 380 --13580 --
NM_001010891chr586745 6438 6262 5647 5635 4986 991 767 1128 ----
NM_001010895chr921976 49 1324 ----
NM_001010898chr183712 3215 3070 2645 1167 773 690 72 1207 43346 2426 1179 853 --
NM_001010917chr1092174 2065 793 473 427 321 230 212 154 1274 1601 --
NM_001010923chr631683 630 68 21778 1643 ----
NM_001010924chr102993 249 11213 153 --
NM_001010932chr71335 ------
NM_001010942chr122447 177 --1111 --
NM_001010986chrX21833 504 12452 11980 --
NM_001011513chr493870 3783 3162 3006 2777 1634 932 254 210 23590 2739 32665 346 342 --
NM_001011515chr431068 948 388 2696 138 ----
NM_001011516chr431068 948 388 2696 138 ----
NM_001011537chr351887 1606 1505 540 257 ------
NM_001011553chr71222 --1755 1225
NM_001011645chrX2106 45 ------
NM_001011663chr102955 672 ------
NM_001011666chr7146003 5955 5689 5588 5471 5052 4513 4409 2580 1572 1436 1262 661 489 46530 4723 4467 2358 36359 2097 57 12446
NM_001011705chr132286 270 ------
NM_001011708chr222764 1076 11000 31160 1124 795 --
NM_001011713chr141636 ------
NM_001011720chr82385 303 2576 207 11235 --
NM_001011885chr1511141 ------
NM_001012264chr146957 768 691 605 192 83 1701 3669 238 87 --
NM_001012267chr931713 1487 542 ------
NM_001012333chr113321 254 98 ------
NM_001012334chr113321 254 98 ------
NM_001012393chr11145045 5004 4575 3216 3210 2043 1704 1307 1257 887 626 535 275 91 13534 43912 1496 1396 282 1949
NM_001012398chr16----134 --
NM_001012410chr32452 183 1481 ----
NM_001012415chr94926 739 729 216 1617 ----
NM_001012418chr6144106 3976 3861 3793 3688 3415 3207 3182 2884 1686 1325 840 717 671 34229 3958 3726 33692 3573 3212 --
NM_001012426chr6113146 2995 2863 2126 1351 1329 1246 1172 1047 459 45 --41004 948 921 467 1443
NM_001012427chr6113146 2995 2863 2126 1351 1329 1246 1172 1047 459 45 --41004 948 921 467 1443
NM_001012446chr92297 253 ------
NM_001012512chr182208 92 ------
NM_001012513chr182219 103 ------
NM_001012614chr4--1535 ----
NM_001012642chr1562041 1699 1691 752 159 31 --11734 --
NM_001012732chr441152 1091 146 66 192 1266 11052
NM_001012751chr1041584 1577 1297 709 --1711 --
NM_001012755chrX114670 4385 3145 1796 1638 1120 1086 1040 1007 72 44 14446 44391 3248 1181 1059 11499
NM_001012968chrX82505 2422 1935 1101 662 510 385 347 1490 2332 327 --
NM_001012977chrX51161 896 522 197 152 1168 1203 --
NM_001012979chrX159 ------
NM_001012989chrX153 ------
NM_001012990chrX1313 ------
NM_001013031chr10121302 1067 864 815 696 667 653 536 484 465 403 241 22974 908 ----
NM_001013398chr731507 493 206 1249 ----
NM_001013399chr6--11128 ----
NM_001013415chr431430 1424 56 2443 274 ----
NM_001013438chr321014 938 ------
NM_001013439chr32860 784 ------
NM_001013615chr151057 998 933 817 209 ----1794
NM_001013622chr471161 378 316 254 192 131 69 ------
NM_001013635chr1291170 1116 1054 1012 454 295 287 189 26 --11182 --
NM_001013690chr1292167 2120 1925 1623 1600 1580 579 569 360 31790 778 218 12369 --
NM_001013693chr182474 2279 2239 874 428 258 234 90 ------
NM_001013693chr182474 2279 2239 874 428 258 234 90 ------
NM_001013699chr121461 ------
NM_001013843chr151362 ------
NM_001014380chr1385815 5312 5240 4202 4100 3610 2074 1697 21679 683 34894 4014 1610 --
NM_001014434chr13640 42 35 1810 ----
NM_001014435chr162508 86 ------
NM_001014442chr13----128 --
NM_001014797chr10167406 7233 7199 7155 6865 5607 5477 2841 2341 2292 2178 1047 819 504 436 273 32908 2481 202 87914 7739 7207 5585 3151 3023 2182 2101 --
NM_001014809chr44877 294 134 61 ----1253
NM_001014811chr111119 ------
NM_001014839chr13126 104 64 --1949 --
NM_001014841chr13126 104 64 --1949 --
NM_001015045chr462461 2202 656 530 356 116 11839 2785 549 1290
NM_001015053chr17111270 1262 1228 1123 1117 1049 517 422 270 248 212 --31233 567 525 --
NM_001015508chr83304 241 191 --2708 700 --
NM_001015877chrX73076 2455 1139 1026 665 522 384 --1482 --
NM_001015881chrX41192 900 514 57 ------
NM_001015887chr351553 1469 731 621 96 21853 1418 ----
NM_001017365chr1154 ------
NM_001017366chr1154 ------
NM_001017367chr1154 ------
NM_001017368chr1792494 2182 2008 1835 851 452 306 285 162 ------
NM_001017371chr221084 1072 11247 ----
NM_001017395chr393281 3010 2546 2487 1297 897 811 530 238 12481 23140 2492 --
NM_001017405chr42688 268 --2355 65 --
NM_001017415chr11187 ------
NM_001017416chr11187 ------
NM_001017424chr181856 1500 1212 529 278 268 210 177 --11502 --
NM_001017425chr181856 1500 1212 529 278 268 210 177 --11502 --
NM_001017440chr7337958 7613 7563 7346 7061 6875 6516 6017 3240 3176 2648 2626 2492 2315 1961 1915 1866 1736 1626 1613 1547 1522 1485 1340 1092 1060 906 848 827 680 507 489 69 27396 1351 52818 2509 2147 733 511 12495
NM_001017523chr1261894 1781 1615 1177 162 37 11421 21737 1320 --
NM_001017920chr21126 ------
NM_001017923chr1421065 200 1623 ----
NM_001017926chr831408 1150 305 11536 ----
NM_001017928chr3--198 ----
NM_001017962chr101876 163 --1679
NM_001017963chr142940 796 ------
NM_001017973chr5----126 --
NM_001017974chr5----126 --
NM_001017977chr1--1374 ----
NM_001017979chr42684 291 ------
NM_001017981chr222487 244 --2571 40 --
NM_001017995chr5204812 4713 4552 4498 4230 3736 3677 3375 3292 3130 3049 2952 1875 1623 1419 654 555 438 237 130 --24816 3794 24265 4132
NM_001017999chr152273 2021 1769 1693 758 --21889 375 --
NM_001017999chr152273 2021 1769 1693 758 --21889 375 --
NM_001018000chr152273 2021 1769 1693 758 --21889 375 --
NM_001018000chr152273 2021 1769 1693 758 --21889 375 --
NM_001018001chr152273 2021 1769 1693 758 --21889 375 --
NM_001018005chr15--1145 ----
NM_001018025chrX1334 ------
NM_001018037chr931081 537 60 ------
NM_001018050chr2282737 2701 2663 2548 2403 1152 1119 331 --42565 2353 2134 252 --
NM_001018052chr2282737 2701 2663 2548 2403 1152 1119 331 --42565 2353 2134 252 --
NM_001018054chr141255 1066 1023 899 ------
NM_001018056chr9193 ------
NM_001018064chr981588 779 283 220 212 193 166 27 --2794 308 --
NM_001018065chr9135736 4926 4727 4613 4254 3799 3740 1669 1582 1374 620 471 169 55910 5329 4898 4553 933 65296 4993 3959 3955 423 418 --
NM_001018066chr9135736 4926 4727 4613 4254 3799 3740 1669 1582 1374 620 471 169 55910 5329 4898 4553 933 65296 4993 3959 3955 423 418 --
NM_001018067chr164890 3922 3507 2107 1254 43 11188 11025 --
NM_001018068chr164890 3922 3507 2107 1254 43 11188 11025 --
NM_001018069chr164890 3922 3507 2107 1254 43 11188 11025 --
NM_001018072chr1261894 1781 1615 1177 162 37 11421 21737 1320 --
NM_001018074chr551395 632 532 391 342 22772 1029 21373 1197 --
NM_001018075chr551395 632 532 391 342 22772 1029 21373 1197 --
NM_001018076chr551395 632 532 391 342 22772 1029 21373 1197 --
NM_001018077chr551395 632 532 391 342 22772 1029 21373 1197 --
NM_001018100chr151693 ------
NM_001018108chr15121819 904 859 726 685 596 587 490 335 215 154 76 21892 823 31565 863 785 --
NM_001018111chr7113639 3597 3527 3392 2884 1124 1055 913 585 553 431 ------
NM_001020658chr131486 1411 440 11250 11365 --
NM_001020658chr131486 1411 440 11250 11365 --
NM_001020818chr19151878 1734 1721 1548 1541 561 531 504 466 210 184 103 91 78 49 --5214 197 140 93 82 --
NM_001020819chr19151878 1734 1721 1548 1541 561 531 504 466 210 184 103 91 78 49 --5214 197 140 93 82 --
NM_001020820chr19151878 1734 1721 1548 1541 561 531 504 466 210 184 103 91 78 49 --5214 197 140 93 82 --
NM_001020821chr19151878 1734 1721 1548 1541 561 531 504 466 210 184 103 91 78 49 --5214 197 140 93 82 --
NM_001020825chr5--1247 ----
NM_001023567chr1541906 877 573 458 2994 628 1575 1880
NM_001023587chr341179 713 337 200 1873 2850 46 --
NM_001024024chr142271 166 1792 ----
NM_001024070chr142267 162 1788 ----
NM_001024094chr551395 632 532 391 342 22772 1029 21373 1197 --
NM_001024218chr142649 228 --1232 --
NM_001024226chr11934 ------
NM_001024227chr11934 ------
NM_001024228chr11934 ------
NM_001024455chrX72690 2530 2447 2140 2045 1068 763 11027 62452 1901 950 834 765 39 11906
NM_001024463chr153399 365 128 ------
NM_001024649chr5112888 2480 1977 1921 1045 1020 911 894 882 856 780 ------
NM_001024666chrX2539 180 --1648 --
NM_001024668chr122792 655 --1666 --
NM_001024680chr221366 710 21458 1167 11411 --
NM_001024688chr852123 2052 1627 373 304 3757 421 38 12054 11514
NM_001024808chr12122753 2490 2447 2360 2320 2014 980 861 820 411 404 383 ----11102
NM_001024809chr1731375 1335 126 ----160
NM_001024845chr12886 807 ------
NM_001024847chr341661 908 227 94 --11626 --
NM_001024934chr64557 125 103 97 ------
NM_001024935chr64557 125 103 97 ------
NM_001024936chr64557 125 103 97 ------
NM_001024937chr177693 607 515 251 200 183 80 ------
NM_001024947chr531117 281 249 --1352 --
NM_001024948chr163213 2488 2390 1271 1156 707 1542 ----
NM_001025068chr34722 658 488 81 --1142 --
NM_001025069chr34722 658 488 81 --1142 --
NM_001025076chr10174921 4801 4337 4270 2472 2385 2363 2255 2237 2211 2009 1107 580 393 333 142 40 85190 4405 4387 4185 3944 2139 1899 352 34978 2442 1714 32368 1443 1112
NM_001025077chr10156279 6159 5695 5628 2465 1938 1751 1691 1500 1387 1159 1126 967 550 40 66548 5763 5745 5543 5302 1710 16336 34777 2801 2470
NM_001025079chr3123488 3133 2822 2712 2697 2676 1511 1135 946 698 660 304 11172 21106 905 --
NM_001025081chr1881249 1182 1031 476 468 453 337 246 31329 508 39 1224 11160
NM_001025090chr1881249 1182 1031 476 468 453 337 246 31329 508 39 1224 11160
NM_001025092chr1881249 1182 1031 476 468 453 337 246 31329 508 39 1224 11160
NM_001025101chr1881249 1182 1031 476 468 453 337 246 31329 508 39 1224 11160
NM_001025105chr551390 1378 1351 1020 511 ------
NM_001025107chr192534 2437 2388 2154 704 460 335 300 169 1257 1478 --
NM_001025107chr192534 2437 2388 2154 704 460 335 300 169 1257 1478 --
NM_001025108chr2123595 3289 3182 3140 1221 967 953 879 708 643 629 118 34039 388 357 33040 1194 229 14183
NM_001025201chr23543 191 136 ------
NM_001025205chr32290 112 --1292 --
NM_001025232chr121143 159 ----
NM_001025233chr1232756 909 624 11697 1847 --
NM_001025248chr1531285 502 119 1289 2935 931 --
NM_001025249chr1531285 502 119 1289 2935 931 --
NM_001025252chr843119 1216 369 306 ----12373
NM_001025253chr843119 1216 369 306 ----12373
NM_001025580chrX174096 4033 3740 3479 3166 3026 2703 1701 1387 1259 801 463 372 353 345 258 47 --84119 4037 3630 396 376 357 329 68 11704
NM_001025595chr421597 221 --11560 --
NM_001025596chr111204 ------
NM_001025603chr121356 1023 21104 98 21017 64 --
NM_001025777chr251379 1106 1093 513 379 ------
NM_001025780chr921373 32 --21375 36 --
NM_001029858chr662995 2947 890 833 537 505 1512 22152 699 --
NM_001029860chr8185 1115 ----
NM_001029863chr652625 2175 997 504 307 --32631 2627 1009 --
NM_001029875chr592658 2220 1923 1169 1115 727 552 526 116 --11925 --
NM_001029882chr11569 --1211 --
NM_001029882chr11569 --1211 --
NM_001029884chr672608 2492 2286 939 721 334 131 21052 35 21728 336 --
NM_001029998chr451004 913 459 369 285 1887 --1238
NM_001030001chr141327 ------
NM_001030006chr1761810 773 697 646 618 178 22117 952 21984 775 --
NM_001030007chr16113806 3761 3630 2543 2468 1282 1185 1113 855 760 232 1138 53718 2981 1284 773 394 --
NM_001030055chr1434030 1177 386 11460 ----
NM_001030059chr10------1303
NM_001030272chr111420 ------
NM_001030273chr111420 ------
NM_001030287chr14867 291 162 88 1470 1872 --
NM_001031628chr121414 --1519 --
NM_001031677chr53485 405 345 --167 --
NM_001031679chr1273151 2725 2495 1245 286 234 133 23537 3308 1556 --
NM_001031689chr9149 ------
NM_001031690chr7132731 2569 2338 2250 2100 2068 1223 1116 1012 831 823 376 26 1664 52779 2775 2039 1126 413 --
NM_001031695chr22155200 5074 4002 3933 3914 3905 3474 1870 1642 1220 823 814 607 462 189 25110 3923 34079 3916 597 --
NM_001031702chr34771 370 245 29 ------
NM_001031710chr731019 861 162 ----11024
NM_001031711chr571823 1235 731 644 509 311 223 11751 2635 589 --
NM_001031716chr21110 ------
NM_001031723chr41460 ------
NM_001031732chr4103231 2890 2782 2767 2443 2260 657 543 330 271 11107 --12446
NM_001031738chr23454 116 55 ------
NM_001031804chr16124214 4165 3659 3263 2759 1031 1020 802 777 595 580 440 --53642 3519 3463 2763 1145 --
NM_001031812chr511877 ------
NM_001031855chrX4205 188 60 34 ------
NM_001032221chr961845 1529 1394 592 301 163 --11655 --
NM_001032279chr111363 ------
NM_001032280chr671685 1202 1175 1061 634 602 453 --194 --
NM_001032281chr2123 ------
NM_001032282chr841182 883 507 488 ------
NM_001032288chr2051329 549 378 33 27 --11075 --
NM_001032289chrX2332 70 --151 --
NM_001032293chr173223 193 118 ------
NM_001032296chr13132800 2685 2296 2222 2173 1870 964 913 752 465 215 41 33 --32802 2724 45 --
NM_001032380chr1021230 128 ------
NM_001032393chrX3776 162 152 --2716 496 --
NM_001032394chr662635 1021 747 598 535 308 32682 2080 1088 12639 --
NM_001032395chr662502 888 614 465 402 175 32549 1947 955 12506 --
NM_001032999chr20155099 5091 4689 4513 4451 4440 4115 3299 3238 1885 1812 1450 1332 1300 1162 11260 34748 3324 245 --
NM_001033025chr151255 1247 1229 1220 530 1204 1505 11261
NM_001033026chr192431 50 --2159 90 --
NM_001033047chr452456 2244 2081 590 244 11692 12246 --
NM_001033049chr2182301 2022 1975 1786 1585 1515 325 255 12197 1932 --
NM_001033057chr332042 1884 1784 --12044 --
NM_001033059chr652007 1552 649 549 91 2465 63 ----
NM_001033081chr161912 1816 1594 1544 1531 197 --3720 715 611 --
NM_001033082chr161912 1816 1594 1544 1531 197 --3720 715 611 --
NM_001033085chr2------1244
NM_001033087chr2062731 2693 2262 675 343 200 22820 1325 21018 707 1681
NM_001033088chr154393 339 326 167 --1343 --
NM_001033112chr51724 1793 ----
NM_001033117chr3184694 4684 4553 4040 3882 3546 3495 3392 1915 1688 1611 1445 1322 1269 1086 813 690 316 24054 3459 54698 4557 4485 3548 1867 --
NM_001033503chr5--1202 ----
NM_001033506chr11121 ------
NM_001033507chr121488 421 11255 ----
NM_001033518chr7152619 2315 2281 2000 1960 1936 1841 1088 1030 893 784 662 597 570 339 1923 1680 11008
NM_001033519chr7152619 2315 2281 2000 1960 1936 1841 1088 1030 893 784 662 597 570 339 1923 1680 11008
NM_001033520chr7152619 2315 2281 2000 1960 1936 1841 1088 1030 893 784 662 597 570 339 1923 1680 11008
NM_001033551chr17104057 3622 3430 3364 3190 1434 399 300 254 179 23849 3144 32836 584 327 13714
NM_001033557chr211294 143 11298 --
NM_001033561chr173805 314 296 --1899 --
NM_001033566chr172695 665 ------
NM_001033568chr172695 665 ------
NM_001033576chr1741740 598 289 208 22495 2027 32372 1752 1744 --
NM_001033578chr832167 2032 952 ------
NM_001033659chr1731502 1441 1094 --11455 --
NM_001033723chr8122569 2538 1970 946 859 765 742 495 483 364 244 122 184 22609 1991 12486
NM_001033859chr17265 39 --167 --
NM_001033910chr162042 2008 1560 638 118 31 ----11750
NM_001033925chr1052142 1340 542 445 49 --11746 --
NM_001034025chr122914 63 --1880 --
NM_001034833chr52274 232 --1207 --
NM_001034837chr52204 197 1151 ----
NM_001034838chr52204 197 1151 ----
NM_001034845chr441437 1407 161 92 ------
NM_001034850chr541391 1305 1054 426 ------
NM_001034852chr1472042 1842 1715 1526 1437 1406 1384 21319 462 ----
NM_001034915chr821333 976 1339 21337 473 --
NM_001035chr121078 158 ------
NM_001035254chr9112332 2257 1822 960 929 828 747 734 589 77 38 --21727 556 12462
NM_001035260chr1041508 426 291 212 1340 ----
NM_001035267chr121282 ------
NM_001035511chr182033 1884 1875 1766 1444 720 712 595 --32135 1446 217 --
NM_001035512chr192140 1991 1982 1873 1551 827 819 702 57 130 32242 1553 324 --
NM_001035513chr192140 1991 1982 1873 1551 827 819 702 57 130 32242 1553 324 --
NM_001035521chr24736 666 525 86 1159 ----
NM_001035534chr981375 1104 492 461 305 244 181 47 --31050 343 297 --
NM_001037132chr742032 650 280 229 1643 ----
NM_001037133chr742032 650 280 229 1643 ----
NM_001037164chr731909 658 546 1185 ----
NM_001037172chr311084 ------
NM_001037317chr182739 2643 2469 2158 2114 1716 710 372 ------
NM_001037331chr183358 303 199 ------
NM_001037334chr1851739 899 562 297 286 11774 12401 --
NM_001037339chr151203 628 540 514 117 --1545 --
NM_001037340chr151203 628 540 514 117 --1545 --
NM_001037341chr151203 628 540 514 117 --1545 --
NM_001037341chr151203 628 540 514 117 --1545 --
NM_001037535chrX41473 520 444 168 --1524 158
NM_001037536chrX41473 520 444 168 --1524 158
NM_001037540chrX41473 520 444 168 --1524 158
NM_001037553chr2195161 4939 4923 4879 4764 4446 4351 1025 308 25077 630 45155 3569 3527 1905 --
NM_001037738chr51195 1237 ----
NM_001037872chr22596 529 ------
NM_001038640chr152269 255 --1870 --
NM_001038702chr552783 2407 2181 868 116 --22785 963 --
NM_001038707chr142241 2211 1725 449 1595 3821 647 459 --
NM_001038707chr142241 2211 1725 449 1595 3821 647 459 --
NM_001039029chr1221857 783 22028 364 21862 330 --
NM_001039091chrX5521 393 281 176 153 ------
NM_001039199chr20144745 4007 3838 3333 3202 3158 3151 3047 1854 1787 1176 1009 844 37 --141 11792
NM_001039350chr751382 688 500 172 79 137 31129 694 690 --
NM_001039355chr144742 84 35 21 --1326 --
NM_001039366chr222391 92 ------
NM_001039457chr1285 53 1252 ----
NM_001039459chr751139 880 462 294 28 --2743 324 --
NM_001039465chr142449 214 ------
NM_001039479chr1442279 1851 627 446 --11556 --
NM_001039538chr293571 3062 2560 1354 981 842 817 747 299 ------
NM_001039547chr3177146 7009 6718 6648 6191 5962 2923 2013 1998 1651 1215 1131 835 817 741 623 294 43159 1500 653 519 58008 5005 2916 2609 588 26915 1701
NM_001039550chr24724 693 180 54 ------
NM_001039570chr2294674 4436 4385 4181 4091 3530 3491 693 93 1683 44114 3827 3370 1308 --
NM_001039571chr2294674 4436 4385 4181 4091 3530 3491 693 93 1683 44114 3827 3370 1308 --
NM_001039574chr12819 284 ------
NM_001039577chr1104500 4426 4391 3927 3073 2874 1575 1340 776 164 --43985 1712 945 280 --
NM_001039582chrX2360 47 --1296 --
NM_001039590chrX33835 2941 2465 43966 2910 2517 758 11029 --
NM_001039591chrX33835 2941 2465 43966 2910 2517 758 11029 --
NM_001039618chr11135847 5013 4752 3900 3891 3676 2293 2244 2225 1407 306 231 39 11199 1235 --
NM_001039690chr16112367 2164 2062 1896 1847 1713 1515 870 333 288 254 11476 1151 --
NM_001039709chr20155099 5091 4689 4513 4451 4440 4115 3299 3238 1885 1812 1450 1332 1300 1162 11260 34748 3324 245 --
NM_001039711chr151052 891 838 779 86 ------
NM_001039712chr151052 891 838 779 86 ------
NM_001039771chr1461064 951 433 337 191 47 1991 1885 --
NM_001039802chr151364 1318 1310 896 175 21236 548 122 --
NM_001039840chrX42374 2340 959 888 24295 42 21674 1059 --
NM_001039877chr197815 760 602 288 211 179 148 ------
NM_001039916chr123171 89 54 --1137 --
NM_001039917chr123171 89 54 --1137 --
NM_001039918chr123171 89 54 --1137 --
NM_001039919chr123171 89 54 --1137 --
NM_001039920chr123171 89 54 --1137 --
NM_001039937chr13103678 3297 3192 2998 2910 2682 2545 859 840 39 --23705 2651 23197 2739
NM_001039938chr1351529 1450 1286 1163 953 21028 980 ----
NM_001039960chr1231435 1313 257 1400 31319 1315 262 --
NM_001040002chr1741065 204 116 82 --1481 --
NM_001040057chr71206 ------
NM_001040100chr32958 82 1295 21054 141 --
NM_001040108chr1493316 2538 2243 1204 1157 884 476 422 153 --33309 3305 3301 --
NM_001040110chr721363 255 ------
NM_001040113chr164878 826 791 39 1152 ----
NM_001040118chr112544 49 --1497 --
NM_001040135chr73783 723 208 ------
NM_001040142chr222012 621 ----1953
NM_001040143chr222012 621 ----1953
NM_001040144chr16112367 2164 2062 1896 1847 1713 1515 870 333 288 254 11476 1151 --
NM_001040146chr16112367 2164 2062 1896 1847 1713 1515 870 333 288 254 11476 1151 --
NM_001040152chr765057 3796 3298 1438 342 94 13107 ----
NM_001040153chr133930 366 98 ------
NM_001040158chr52166 99 ------
NM_001040159chr42301 77 ------
NM_001040172chr581337 1210 1161 630 520 238 151 110 --1384 --
NM_001040173chr581337 1210 1161 630 520 238 151 110 --1384 --
NM_001040181chr32960 767 --3979 962 732 --
NM_001040182chr32960 767 --3979 962 732 --
NM_001040183chr32960 767 --3979 962 732 --
NM_001040197chr12583 24 --1173 --
NM_001040199chr32960 767 --3979 962 732 --
NM_001040200chr32960 767 --3979 962 732 --
NM_001040202chr441978 1826 319 102 12479 ----
NM_001040214chr641744 619 257 37 1212 1275 --
NM_001040260chr461027 1003 895 744 390 193 --1421 --
NM_001040261chr461027 1003 895 744 390 193 --1421 --
NM_001040272chr972340 1867 1452 459 284 127 79 22136 1914 11662 1407
NM_001040273chr1092055 2049 2002 1940 1888 1842 649 461 407 --11312 --
NM_001040280chr661298 1276 1122 1110 506 24 --21304 1112 --
NM_001040284chr16125760 5669 5586 5176 5081 4690 2314 1508 1315 1289 932 744 22354 967 15590 --
NM_001040402chr451046 1016 833 791 114 --12570 --
NM_001040409chr221011 991 ------
NM_001040429chr1352295 1442 1202 1195 159 ------
NM_001040432chr3--1131 ----
NM_001040441chr195118 4140 4018 3955 3726 3348 1277 142 52 33884 496 69 ----
NM_001040446chr542091 1107 684 345 1525 2814 603 12067
NM_001040450chr1522630 2498 32307 1897 102 1381 --
NM_001040453chr1522630 2498 32307 1897 102 1381 --
NM_001040455chr114841 414 272 252 ------
NM_001040610chr15128 ------
NM_001040619chr141317 612 538 128 195 21322 226 --
NM_001040624chr862349 2343 1860 536 155 57 --22069 134 --
NM_001040625chr862349 2343 1860 536 155 57 --22069 134 --
NM_001040626chr862349 2343 1860 536 155 57 --22069 134 --
NM_001040627chr862349 2343 1860 536 155 57 --22069 134 --
NM_001040628chr862349 2343 1860 536 155 57 --22069 134 --
NM_001040629chr862349 2343 1860 536 155 57 --22069 134 --
NM_001040630chr862349 2343 1860 536 155 57 --22069 134 --
NM_001040633chr71127 1957 ----
NM_001040647chr73483 267 57 --2697 680 --
NM_001040648chr73483 267 57 --2697 680 --
NM_001040665chr7144856 4803 4724 4655 4598 4338 4165 4046 1824 1730 1679 1610 1464 1197 24323 4105 ----
NM_001040666chr73558 505 40 125 ----
NM_001040697chr11----1512 --
NM_001040708chr831028 970 921 --11018 --
NM_001040709chr1102455 2438 2130 1631 913 817 776 538 425 228 1181 72440 971 834 645 367 192 72 --
NM_001040712chr931038 988 429 23009 1136 13179 194
NM_001042353chr202406 369 1475 2380 376 --
NM_001042355chr16124930 4817 4573 4549 4068 3835 3645 2145 1035 878 675 368 23993 1206 44595 4307 2147 1193 25307 506
NM_001042357chr104963 954 427 112 2564 138 --1588
NM_001042358chr104963 954 427 112 2564 138 --1588
NM_001042360chr104963 954 427 112 2564 138 --1588
NM_001042363chr104963 954 427 112 2564 138 --1588
NM_001042370chr11228 ------
NM_001042388chr185761 351 310 273 266 --2107 26 --
NM_001042389chr104963 954 427 112 2564 138 --1588
NM_001042390chr104963 954 427 112 2564 138 --1588
NM_001042392chr104963 954 427 112 2564 138 --1588
NM_001042395chr104963 954 427 112 2564 138 --1588
NM_001042404chr14521 404 284 174 2444 126 ----
NM_001042406chr61901 11240 ----
NM_001042412chr16124930 4817 4573 4549 4068 3835 3645 2145 1035 878 675 368 23993 1206 44595 4307 2147 1193 25307 506
NM_001042413chr983190 2685 2534 1586 1136 1090 285 210 --22573 850 --
NM_001042425chr671685 1202 1175 1061 634 602 453 --194 --
NM_001042437chr25878 838 730 679 153 1169 163 --
NM_001042472chr205564 556 420 411 52 --1488 --
NM_001042476chr1672192 1801 1748 1635 734 366 84 --11998 --
NM_001042481chr1462065 671 492 452 117 95 12249 12568 --
NM_001042486chr2051526 1216 512 413 247 ------
NM_001042490chr5167 ------
NM_001042492chr17133456 3290 3210 2934 2748 2392 2140 1121 896 374 105 78 62 --1390 1901
NM_001042494chr1563639 3448 1076 1002 754 582 12406 ----
NM_001042495chr1563639 3448 1076 1002 754 582 12406 ----
NM_001042496chr1563639 3448 1076 1002 754 582 12406 ----
NM_001042497chr1563639 3448 1076 1002 754 582 12406 ----
NM_001042506chrX61172 1156 896 522 197 152 1168 1203 --
NM_001042510chr831406 589 357 31552 1522 677 1430 --
NM_001042511chr831406 589 357 31552 1522 677 1430 --
NM_001042517chr13--2908 342 ----
NM_001042533chr373069 1261 756 726 345 332 94 1893 ----
NM_001042537chrX82172 1604 832 679 488 407 307 192 --22025 1660 --
NM_001042539chr163986 944 903 --11068 --
NM_001042555chr1264772 4144 3552 3377 1211 312 23803 1493 13517 --
NM_001042599chr2207584 7572 7023 6817 6736 6465 6186 5765 5511 5472 5364 3037 2445 742 537 356 346 334 79 66 11913 47616 5564 2807 1585 25518 2605
NM_001042601chr333295 2334 318 2434 107 1623 --
NM_001042603chr12125335 4768 4697 4658 3939 1783 1736 1545 1394 1200 206 144 24787 1572 34774 1340 459 --
NM_001042604chr374439 4318 3752 3462 1384 914 38 33297 3135 1722 14323 13758
NM_001042610chr1681394 1381 1319 1284 1199 1072 1018 450 --31403 577 216 --
NM_001042632chr2062416 1925 1902 1671 250 120 --1511 --
NM_001042633chr2062416 1925 1902 1671 250 120 --1511 --
NM_001042681chr1132397 2385 2282 2104 2083 2042 1979 987 916 876 569 304 184 --12146 --
NM_001042682chr1132397 2385 2282 2104 2083 2042 1979 987 916 876 569 304 184 --12146 --
NM_001042682chr1132397 2385 2282 2104 2083 2042 1979 987 916 876 569 304 184 --12146 --
NM_001042683chr631567 1151 717 --11732 --
NM_001042724chr193757 565 52 1821 ----
NM_001042728chr122755 115 --5933 883 425 339 174 --
NM_001042749chrX21739 758 ------
NM_001042750chrX21739 758 ------
NM_001042751chrX21739 758 ------
NM_001042762chr75915 832 356 178 44 ------
NM_001043318chr1473770 3533 3440 3164 1487 1264 501 13244 1704 --
NM_001043351chr162093 1853 176 140 124 118 --2777 375 --
NM_001044305chr641390 1282 1083 282 1642 ----
NM_001044385chr243706 2740 1331 776 33083 3041 258 1778 --
NM_001044387chr1944202 1023 855 699 13904 13316 --
NM_001044388chr1944202 1023 855 699 13904 13316 --
NM_001044722chr511877 ------
NM_001044723chr511877 ------
NM_001046chr552808 464 430 338 253 ------
NM_001048183chr1123771 3629 3494 3474 688 625 618 468 450 318 219 47 --43433 3420 2890 1134 1505
NM_001049chr1482422 2020 1598 950 745 630 301 260 --32227 333 270 --
NM_001071775chr1321818 1476 ------
NM_001078chr12697 670 ------
NM_001079874chr151890 675 433 316 269 11921 11714 --
NM_001080418chr11545 --1166 --
NM_001083620chr4--12487 ----
NM_001083621chr194495 4346 4155 2952 1172 785 746 731 657 --51317 807 523 501 28 --
NM_001087chr22322 121 ------
NM_001092chr176861 844 489 474 360 348 ----11891
NM_001095chr1281839 1686 1517 1498 1490 1271 1207 367 --51720 1519 1492 706 119 --
NM_001096chr173334 304 47 ------
NM_001099678chr3125991 5701 5575 5239 4654 4201 2475 2399 2176 1739 1063 993 44182 2469 2186 2069 22477 563 --
NM_001100108chr1178319 7872 6774 6753 6686 6440 5269 3109 2971 2750 2197 1419 1095 834 749 671 66 --57765 2212 2208 1427 1423 --
NM_001106chr3218748 8435 7561 7476 7297 6734 6272 6221 6061 3449 3380 2960 2200 1987 1720 1194 1079 1013 495 478 339 --47992 3791 2202 461 13388
NM_001109977chr44303 252 175 107 --1152 --
NM_001111chr192534 2437 2388 2154 704 460 335 300 169 1257 1478 --
NM_001113490chrX103470 3374 2951 2906 2789 2691 2447 2274 769 572 12235 ----
NM_001116chr16102865 2161 2141 2043 1997 1935 614 196 181 77 --11961 12292
NM_001117chr1872004 1848 1840 1617 830 641 546 1166 32069 1842 1589 --
NM_001119chr431359 1259 335 --21496 337 --
NM_001121chr1051369 1274 629 564 296 11196 11315 --
NM_001123chr10155 1104 ----
NM_001126chr12192 54 --1939 --
NM_001127chr223922 73 30 ------
NM_001128chr16113806 3761 3630 2543 2468 1282 1185 1113 855 760 232 1138 53718 2981 1284 773 394 --
NM_001130chr194887 637 333 176 1181 ----
NM_001131chr63368 338 174 ------
NM_001135chr154756 727 281 86 ------
NM_001140chr175245 238 222 213 98 --4227 207 203 199 1216
NM_001144chr161198 2955 181 1167 --
NM_001146chr862017 1940 1916 1756 896 107 ------
NM_001148chr451797 1696 1501 529 225 --11942 --
NM_001149chr1011207 ------
NM_001154chr41166 --155 --
NM_001156chr102507 110 ------
NM_001159chr22231 40 ------
NM_001167chrX126705 6408 4891 4662 2534 2459 1972 1940 1338 1173 1049 367 34582 1761 834 36677 4852 1439 --
NM_001173chr1434030 1177 386 11460 ----
NM_001174chrX2309 52 --21577 429 --
NM_001177chr1231582 406 229 12266 11520 --
NM_001178chr111420 ------
NM_001183chrX3595 163 54 195 --1600
NM_001186chr2182608 2525 762 701 440 280 134 106 1756 ----
NM_001187chr214475 228 207 86 ------
NM_001191chr204944 476 379 40 --1478 --
NM_001198chr662303 2242 2218 2189 1900 309 --11641 --
NM_001199chr82231 185 ------
NM_001200chr2021085 797 ----1802
NM_001201chr493623 3611 3543 3374 2726 1197 861 504 61 43429 1013 955 796 11270 23751 911
NM_001202chr141111 ------
NM_001204chr2197397 7382 6745 6340 4789 2438 2258 2203 1844 1531 1469 1349 1323 1186 796 778 680 577 541 32876 2615 558 14801 12091
NM_001206chr932198 2058 147 21971 1043 11192 --
NM_001217chr191100 ------
NM_001219chr771881 1742 1395 902 634 349 24 --11567 --
NM_001222chr1021656 507 11789 11658 --
NM_001226chr4148 ------
NM_001233chr762221 2133 933 827 788 46 2584 89 ----
NM_001237chr43812 802 290 1413 1355 --
NM_001237chr43812 802 290 1413 1355 --
NM_001238chr191118 ------
NM_001241chr242035 880 170 125 ------
NM_001241chr242035 880 170 125 ------
NM_001256chr1762890 2172 2109 1998 1033 250 ------
NM_001257chr1641411 1369 441 186 --11185 --
NM_001259chr7176358 6231 5914 5498 5012 4822 4472 2202 1737 1599 1312 1226 1081 1059 900 775 111 45815 4979 4284 4227 65987 5855 4709 2204 999 918 25142 4521
NM_001262chr11230 --1251 --
NM_001268chr132252 31 ------
NM_001270chr54856 416 128 24 ------
NM_001271chr1572990 2782 2293 2006 1105 1093 162 13227 ----
NM_001273chr123585 114 53 --3182 100 45 --
NM_001274chr111143 165 ----
NM_001275chr14--1261 2404 276 --
NM_001277chr111907 --2909 692 --
NM_001282chr1761810 773 697 646 618 178 22117 952 21984 775 --
NM_001283chr74604 464 188 124 --1681 --
NM_001284chr51385 --1504 --
NM_001290chr42317 148 --2852 205 --
NM_001292chr151891 --1859 --
NM_001293chr114388 129 97 63 ------
NM_001299chr191483 ------
NM_001300chr102446 348 ------
NM_001304chr1773510 3034 2732 2369 2362 1198 98 1580 43813 2488 2437 175 11534
NM_001310chr12122996 2671 2451 2335 2097 1232 1077 1061 791 402 349 80 ------
NM_001313chr44877 294 134 61 ----1253
NM_001315chr681898 1472 1450 896 783 462 267 105 12020 ----
NM_001328chr4--1535 ----
NM_001329chr1021636 290 ------
NM_001331chr11152829 2230 2211 2186 2076 2019 1883 1747 1737 1110 1071 500 446 169 75 1948 21122 148 --
NM_001332chr531265 570 64 ----1242
NM_001343chr54599 320 304 175 11540 --1468
NM_001351chr331770 1368 1345 1528 11355 11283
NM_001356chrX22028 1572 ------
NM_001357chr11273 ------
NM_001362chr1421004 989 ------
NM_001364chr11164444 3869 3774 3706 3232 3218 3192 3131 3113 1919 1826 1785 936 917 391 267 24394 3181 64175 3873 3310 3245 1442 1088 13291
NM_001365chr174761 633 557 122 ----2127 112
NM_001385chr81141 ------
NM_001386chr892023 2013 1600 1578 871 840 778 349 67 --178 --
NM_001387chr5132922 2898 2870 2274 2208 2122 1240 1213 891 791 737 714 674 --1744 --
NM_001388chr171453 --1708 --
NM_001389chr211478 --1441 --
NM_001391chr182304 108 ------
NM_001394chr82570 113 ------
NM_001395chrX2994 979 ------
NM_001396chr2111036 22713 290 21103 958 --
NM_001397chr152307 1968 1038 503 112 ------
NM_001399chrX153847 3444 3346 3139 2449 2377 1403 1261 1075 832 790 602 561 175 35 12568 1241 --
NM_001400chr13467 427 381 ------
NM_001401chr931361 1344 220 ------
NM_001402chr631964 1662 375 ------
NM_001406chr17121671 1515 1476 1360 1162 556 468 437 416 407 246 186 1485 41649 1242 363 40 11384
NM_001407chr331481 1209 563 --31680 420 384 --
NM_001408chr151263 1099 1071 355 37 --21383 1053 --
NM_001412chrX33703 2596 1189 42957 2413 1437 289 ----
NM_001417chr1251745 1665 1465 1213 760 --1118 --
NM_001418chr111140 --1294 --
NM_001418chr111140 --1294 --
NM_001419chr19144581 4009 3908 3883 3745 3613 3166 3144 3098 1747 1244 1024 932 221 14821 23520 1863 --
NM_001421chrX51679 1641 1373 1365 326 --11449 --
NM_001422chr1111097 21060 267 1206 --
NM_001423chr1241989 1590 1564 451 --11592 --
NM_001426chr23641 613 568 ------
NM_001429chr224901 889 415 109 1973 1232 --
NM_001430chr261815 485 447 313 307 251 1644 ----
NM_001431chr671218 1135 883 852 805 249 163 --3447 443 165 --
NM_001432chr453099 1446 1232 1054 237 --11196 --
NM_001438chr1183646 3097 852 524 515 480 468 440 433 381 320 285 259 234 216 206 193 22 31037 787 187 10504 492 487 482 470 457 452 442 337 210 --
NM_001439chr151255 1247 1229 1220 530 1204 1505 11261
NM_001448chrX11545 --21441 384 --
NM_001449chrX61080 1056 489 121 100 64 --2510 106 --
NM_001451chr1641234 971 352 76 11292 1189 --
NM_001453chr651670 661 463 351 329 11195 1382 --
NM_001458chr7--1671 ----
NM_001460chr163255 3234 2989 2665 2562 395 23331 786 23474 150 --
NM_001461chr15595 462 390 214 192 1149 1141 --
NM_001463chr23813 706 334 137 ----
NM_001482chr153725 373 328 ------
NM_001491chr642564 713 480 460 --1808 --
NM_001493chrX4735 686 228 173 --2688 184 --
NM_001494chr101673 ----1150
NM_001497chr972684 2427 2421 2380 2214 2063 140 1858 1499 --
NM_001511chr41589 ------
NM_001518chr731153 846 104 1837 --1927
NM_001521chr24736 666 525 86 1159 ----
NM_001527chr634744 3688 3152 14142 1288 --
NM_001530chr141365 ----1143
NM_001533chr191263 --151 --
NM_001542chr142189 813 532 461 32438 442 329 22460 55 --
NM_001543chr5144718 4654 4216 4039 3698 3576 2964 1946 1921 1808 1626 733 469 266 14011 34826 1873 702 --
NM_001546chr631235 479 187 --21247 1243 --
NM_001552chr1751099 991 944 879 417 ------
NM_001554chr1----1437 --
NM_001555chrX----128 --
NM_001560chrX82300 2127 2101 954 940 870 307 49 22636 2484 ----
NM_001570chr321416 212 --1217 --
NM_001584chr1131020 458 284 21014 151 --1988
NM_001587chrX52133 1710 1505 797 353 21816 143 31712 1507 436 --
NM_001604chr112996 687 ------
NM_001609chr1074134 3671 3436 3395 2918 2783 1777 24113 1502 13594 --
NM_001610chr111224 1803 ----
NM_001614chr171479 --1483 --
NM_001614chr171479 --1483 --
NM_001616chr233129 2976 2378 --32581 2535 830 --
NM_001617chr251232 968 423 268 50 1892 ----
NM_001621chr762832 2536 1870 838 716 631 31146 658 441 1524 --
NM_001621chr762832 2536 1870 838 716 631 31146 658 441 1524 --
NM_001634chr652007 1552 649 549 91 2465 63 ----
NM_001635chr72435 296 1974 ----
NM_001642chr1151233 1226 1198 1145 858 ------
NM_001650chr1882813 2696 681 613 553 351 263 56 23019 2979 --23472 2564
NM_001654chrX2422 334 ------
NM_001655chr1141880 1602 1539 1476 1778 11530 --
NM_001656chr541859 785 613 416 21912 820 ----
NM_001658chr11934 ------
NM_001659chr12182667 2561 2554 2538 2263 2230 2044 1728 1684 1088 1069 888 733 591 399 381 360 166 12156 42095 2082 401 79 22436 758
NM_001660chr31645 ------
NM_001662chr74283 255 104 90 --192 --
NM_001663chr149897 866 834 540 415 398 190 99 93 22031 382 2551 183 --
NM_001668chr1112266 1972 1918 1789 683 645 593 256 131 100 70 --21525 258 --
NM_001670chr22----1630 --
NM_001674chr14867 291 162 88 1470 1872 --
NM_001677chr12831 135 --2835 823 --
NM_001678chr17131751 1729 1698 1626 1410 1369 1326 1205 1191 494 450 190 139 --31404 1359 727 1270
NM_001681chr121724 ------
NM_001682chr1242083 1124 502 171 12288 ----
NM_001683chr372319 2289 1930 1904 1835 1078 58 --32293 268 164 --
NM_001684chr1203808 3597 3566 3542 3459 3451 3397 3258 3143 3034 2972 2786 2695 1499 907 788 662 577 539 531 --93390 3385 3381 2828 1408 1300 1175 588 583 11686
NM_001690chr392498 1694 1665 312 212 94 64 36 30 12096 22105 314 --
NM_001693chr8----21045 443 1806
NM_001695chr864220 4087 3711 2963 281 117 33925 871 108 --1120
NM_001696chr222391 92 ------
NM_001701chr92247 55 --21474 1356 --
NM_001703chr1----1185 --
NM_001704chr61553 ------
NM_001706chr32228 38 ------
NM_001707chr73361 168 122 ------
NM_001709chr1132351 1864 858 ------
NM_001711chrX61077 1029 792 769 747 673 1975 1684 --
NM_001717chr1511478 --1446 1195
NM_001720chr151727 873 645 635 35 --1141 --
NM_001722chr81152 --2505 187 --
NM_001730chr1311508 11543 ----
NM_001730chr1311508 11543 ----
NM_001731chr122339 187 1711 1747 --
NM_001735chr9177 ------
NM_001742chr721395 45 1542 ----
NM_001743chr21150 ------
NM_001746chr5112888 2480 1977 1921 1045 1020 911 894 882 856 780 ------
NM_001748chr131004 939 876 --21008 297 --
NM_001753chr791518 1510 681 592 563 227 139 53 41 --1664 --
NM_001754chr21133987 3474 2999 2942 2868 2852 2838 2828 2798 2757 1109 976 591 34020 3686 3648 44247 3102 3063 2979 --
NM_001755chr1661940 808 688 624 522 348 ------
NM_001759chr12104508 3760 3573 3422 3416 1950 1871 1414 708 53 21427 889 21158 1063 --
NM_001760chr661004 735 728 391 373 241 ----1918
NM_001761chr1651761 724 704 512 274 --1728 --
NM_001768chr271226 1187 1058 471 330 88 66 --2450 45 --
NM_001773chr181428 1228 1182 1167 587 476 104 82 --21321 60 --
NM_001777chr3123488 3133 2822 2712 2697 2676 1511 1135 946 698 660 304 11172 21106 905 --
NM_001781chr123623 140 90 ----1854
NM_001782chr9------160
NM_001783chr195384 251 105 94 85 ------
NM_001788chr71222 --1755 1225
NM_001789chr331593 1483 1217 11597 ----
NM_001790chr54386 365 309 74 --2369 350 --
NM_001791chr151364 1318 1310 896 175 21236 548 122 --
NM_001794chr20182 1256 ----
NM_001798chr125785 733 241 233 124 ----1296
NM_001800chr19279 73 ------
NM_001810chr205770 661 606 546 205 --2565 221 --
NM_001822chr23543 191 136 ------
NM_001826chr14409 349 159 64 154 189 --
NM_001829chr42870 97 --1619 --
NM_001830chrX83507 3206 3195 3155 3007 2779 978 339 22607 228 32909 1365 1344 --
NM_001839chr13661 166 151 190 ----
NM_001842chr91538 --1197 --
NM_001844chr12159 1160 ----
NM_001854chr111106 1261 1551 --
NM_001858chr664121 1783 1251 408 289 39 13565 13348 --
NM_001862chr2180 ------
NM_001874chr12125120 4794 4558 4421 4295 3431 2044 1700 1229 1159 573 118 --11963 24100 1848
NM_001881chr10--2407 203 ----
NM_001882chr52181 93 ------
NM_001884chr51442 --1565 1503
NM_001889chr1150 2108 26 ----
NM_001891chr41339 ------
NM_001892chr551390 1378 1351 1020 511 ------
NM_001895chr2031018 840 360 1990 1997 --
NM_001901chr6------11056
NM_001904chr31871 1429 1305 --
NM_001913chr71630 --1806 --
NM_001914chr182359 266 --1302 --
NM_001920chr122733 216 ------
NM_001921chr441152 1091 146 66 192 1266 11052
NM_001923chr112101 83 --2610 471 --
NM_001931chr1121098 284 11294 11221 --
NM_001932chr171651 ----1660
NM_001933chr1421013 520 --2986 280 --
NM_001935chr22922 361 ------
NM_001936chr751382 688 500 172 79 137 31129 694 690 --
NM_001938chr11359 11749 ----
NM_001942chr1862011 1877 1772 1605 796 242 1587 ----
NM_001945chr521099 247 --21355 1049 --
NM_001946chr123772 355 80 --1999 --
NM_001948chr1531285 502 119 1289 2935 931 --
NM_001949chr672477 2057 1269 705 618 426 399 33008 2749 532 3316 309 93 186
NM_001951chr84501 408 140 128 160 --1557
NM_001955chr631120 891 221 ------
NM_001956chr13516 446 92 ------
NM_001962chr52451 131 1549 ----
NM_001964chr521197 190 --1174 --
NM_001965chr23433 134 79 ------
NM_001967chr32246 74 ------
NM_001968chr41587 1750 ----
NM_001969chr1453497 1310 1104 1038 48 12451 11084 --
NM_001973chr11366 ------
NM_001975chr126791 752 244 237 224 217 --2231 186 --
NM_001977chr421697 217 --11404 --
NM_001978chr85993 909 722 169 109 --2867 111 --
NM_001981chr171779 1735 1500 1472 504 317 41 1618 ----
NM_001982chr125267 245 228 206 197 --1315 --
NM_001987chr12134152 3635 3497 1601 1501 1474 1336 1215 683 629 509 290 243 21434 396 ----
NM_001990chr13136 128 22 ------
NM_001995chr451151 546 522 285 222 ------
NM_001999chr531270 540 326 --1117 --
NM_002006chr4145449 5239 5187 4692 4631 4586 4153 2210 1433 1113 663 555 525 447 25708 3721 25434 1503 --
NM_002009chr1541960 1752 869 66 32505 894 500 21805 85 --
NM_002013chr141241 ----1203
NM_002015chr1363302 2500 2481 2323 181 148 --12190 --
NM_002017chr1151411 1261 1237 171 103 1858 ----
NM_002023chr151474 1299 288 178 131 --2507 135 --
NM_002024chrX61785 1433 880 696 683 308 129 ----
NM_002025chrX238988 8783 8753 8436 8349 8044 7706 7564 7448 6994 6988 6586 6308 6243 6234 3404 2213 1154 1127 1076 643 627 126 27956 1052 78438 8355 8038 7558 6973 1156 645 12521
NM_002026chr251032 1013 901 180 94 --21034 1019 --
NM_002028chr144864 846 198 134 --11134 --
NM_002031chr61211 ------
NM_002037chr6----1319 --
NM_002040chr2171262 1058 957 849 773 90 34 12227 ----
NM_002044chr1561165 1135 557 422 83 60 ------
NM_002045chr32146 125 --2347 94 --
NM_002048chr931065 442 213 ------
NM_002051chr104821 794 445 53 ------
NM_002054chr22484 407 ------
NM_002056chr21812 ------
NM_002060chr11197 --1170 1488
NM_002061chr141203 455 265 34 21641 385 1204 --
NM_002062chr631573 295 147 ------
NM_002063chrX3969 235 136 --129 --
NM_002069chr721686 1615 1677 1175 --
NM_002072chr96936 802 371 311 222 32 --4940 794 786 756 --
NM_002074chr151661 1619 488 231 145 --11610 --
NM_002076chr12113161 2519 1116 1094 887 876 784 722 223 159 46 12201 12842 --
NM_002077chr952066 2007 1935 1689 1517 1846 31916 610 509 --
NM_002080chr16----135 --
NM_002082chr54913 639 205 44 --1811 --
NM_002084chr53537 270 103 --2852 331 1106
NM_002086chr17112065 2044 2033 1912 1884 1851 1666 613 530 497 248 ------
NM_002090chr42599 45 1104 ----
NM_002091chr182208 92 ------
NM_002092chr464119 3757 1797 1148 1025 61 --14804 1640
NM_002094chr162157 72 ------
NM_002103chr195992 930 815 752 722 --3732 714 203 1758
NM_002107chr1160 ------
NM_002111chr4143557 3512 3263 3221 3138 2902 2804 2785 2709 2429 1468 1193 539 229 1609 22446 281 --
NM_002114chr6168 --170 --
NM_002126chr17104183 3764 3590 3394 3193 3134 991 644 378 50 11188 2548 83 --
NM_002128chr132570 502 12435 ----
NM_002130chr51197 ------
NM_002131chr64948 136 90 42 11308 ----
NM_002135chr124487 414 377 122 1404 1365 --
NM_002137chr771892 1873 1812 961 935 730 438 1285 2965 320 --
NM_002138chr42584 254 ------
NM_002139chrX4605 578 447 257 --1568 --
NM_002145chr173295 266 25 --1149 --
NM_002146chr17101451 1406 1379 1199 511 503 437 180 143 116 ------
NM_002147chr174305 247 225 154 --1922 --
NM_002148chr22607 143 --1660 --
NM_002149chr21210 --1499 --
NM_002156chr2----1375 --
NM_002157chr21149 ------
NM_002158chr2103608 3576 3212 2966 2898 2871 2519 2320 1360 738 --22873 307 --
NM_002160chr92556 186 ------
NM_002161chr93403 104 35 ------
NM_002167chr11438 --1144 --
NM_002168chr15------1108
NM_002182chr372686 1056 729 487 338 270 162 ----1341
NM_002187chr521311 1251 11088 11139 --
NM_002188chr53694 183 70 ------
NM_002192chr71618 ----1452
NM_002193chr251430 611 561 403 58 ------
NM_002198chr51291 ------
NM_002199chr43992 667 36 ------
NM_002203chr583951 3877 2833 2631 1322 1001 822 618 --32594 927 826 --
NM_002204chr1731310 359 42 1237 21356 232 --
NM_002205chr124941 370 298 85 ------
NM_002207chr33202 125 61 ------
NM_002210chr273131 2187 1375 996 977 158 71 12803 11275 --
NM_002220chr152328 245 ----1366
NM_002221chr1102869 2662 2247 1160 708 551 491 79 58 41 1163 32961 62 43 --
NM_002222chr321342 425 ------
NM_002223chr1273940 3858 3436 1535 648 397 31 ------
NM_002225chr153389 72 27 --145 --
NM_002226chr142686 340 --1745 --
NM_002227chr12188 45 ------
NM_002230chr177980 891 443 401 216 63 43 --2992 167 --
NM_002232chr161390 1267 991 908 849 430 ----1383
NM_002234chr125704 578 172 134 125 --1136 --
NM_002240chr21269 24 --150 --
NM_002241chr1103149 2084 1233 938 789 402 189 122 48 41 --31017 966 946 12032
NM_002247chr102430 80 --2908 434 --
NM_002249chr11450 --1452 --
NM_002250chr19133 ------
NM_002252chr22111 35 1462 ----
NM_002253chr42995 76 ------
NM_002254chr282061 2050 1741 1570 662 540 442 162 --12275 11445
NM_002264chr3104796 4464 4230 3771 3426 3403 3121 1296 485 197 34800 1217 646 34571 4210 568 --
NM_002265chr172855 305 ----1858
NM_002266chr17180 1206 ----
NM_002267chr1352229 2153 2047 2023 25 1206 12072 --
NM_002268chr321621 761 ------
NM_002270chr5175404 5348 5123 5097 5060 4952 4914 4601 4209 3885 3728 2174 1851 1665 1399 1228 572 13907 24254 2176 --
NM_002271chr1371820 1578 835 794 574 419 55 --21571 57 --
NM_002280chr172159 28 ------
NM_002283chr123803 762 25 --2775 519 --
NM_002285chr2123595 3289 3182 3140 1221 967 953 879 708 643 629 118 34039 388 357 33040 1194 229 14183
NM_002293chr1102632 2390 2379 2228 2079 1776 1110 497 247 217 --21938 1734 --
NM_002309chr2292594 2242 2053 1963 1129 847 726 714 540 --33010 2249 230 --
NM_002312chr131359 21059 770 ----
NM_002314chr751071 842 306 167 136 ------
NM_002319chr73745 326 31 --2308 38 --
NM_002333chr1931182 1005 438 --186 --
NM_002334chr1162041 1589 797 685 314 37 ----1800
NM_002345chr121636 ------
NM_002351chrX----1555 --
NM_002353chr14231 125 110 76 --1183 --
NM_002355chr1281149 1109 1057 1033 908 165 120 28 11314 ----
NM_002356chr662825 2608 1981 1001 863 346 --1252 12360
NM_002358chr4151 ------
NM_002359chr17133890 3044 2890 2843 2831 2825 2731 1613 1239 123 116 106 80 --53823 3514 1130 934 95 12915
NM_002360chr721916 536 ------
NM_002373chr1521224 478 11273 1480 --
NM_002374chr293571 3062 2560 1354 981 842 817 747 299 ------
NM_002375chr372059 1605 537 291 224 73 25 --31828 1710 682 --
NM_002376chr14146 ------
NM_002382chr1481059 1039 934 839 517 181 115 59 11177 --11065
NM_002383chr166809 767 726 374 349 327 --1891 --
NM_002384chr181394 --1211 --
NM_002385chr1881249 1182 1031 476 468 453 337 246 31329 508 39 1224 11160
NM_002387chr594783 4497 3588 3430 1476 1101 921 689 209 24846 3444 23590 423 --
NM_002390chr1731876 205 103 ------
NM_002391chr113321 254 98 ------
NM_002395chr631371 197 49 ------
NM_002397chr521936 257 ------
NM_002398chr211086 ------
NM_002399chr1541314 1017 971 380 --11074 --
NM_002401chr1752359 2265 1868 410 143 ------
NM_002404chr174688 374 239 26 --128 --
NM_002430chr22132600 2529 2193 2112 1737 1727 992 709 436 419 293 259 57 11618 31749 352 38 --
NM_002442chr1261744 1591 1328 1279 1185 451 11485 ----
NM_002444chrX61381 1359 1313 392 288 40 11388 21436 223 --
NM_002448chr42496 98 1651 ----
NM_002457chr111129 ------
NM_002465chr12134 --1234 --
NM_002466chr201108 ------
NM_002469chr123413 203 24 --157 --
NM_002472chr17187 ------
NM_002473chr2241031 198 181 58 --31000 455 91 --
NM_002479chr14747 534 307 232 --1146 --
NM_002480chr1221399 499 11019 ----
NM_002481chr1337852 7559 7269 6976 6673 6640 6464 5925 5481 5364 5353 5341 5196 4969 4886 3075 2962 2855 2818 2746 2637 2387 1504 1255 996 981 915 716 687 552 304 186 77 35053 1380 121 77563 7494 7227 5580 5355 4971 689 21959 694
NM_002485chr852123 2052 1627 373 304 3757 421 38 12054 11514
NM_002486chr94925 757 100 86 2184 108 ----
NM_002499chr1592313 2244 2045 1634 914 902 868 768 174 11550 2916 693 --
NM_002500chr21422 1491 1865 --
NM_002501chr19133206 3196 2599 1610 1600 1531 1213 1196 867 615 570 378 181 23806 2803 53128 2903 1576 901 353 1456
NM_002505chr671584 1509 1270 541 394 352 70 ------
NM_002507chr17101743 1475 1432 1283 793 765 729 671 285 205 ------
NM_002508chr161679 1617 1579 511 359 22 ------
NM_002509chr203691 285 221 --2699 629 --
NM_002515chr1451745 1739 1729 1638 440 --11543 --
NM_002516chr19153 --2266 232 --
NM_002518chr21975 1938 1398 --
NM_002519chr1121231 1102 41390 551 345 162 21302 572 --
NM_002520chr51103 ------
NM_002522chr1793135 3129 2394 1497 1377 1365 878 834 384 11587 42929 2525 511 388 --
NM_002524chr12846 263 ------
NM_002526chr61296 11689 ----
NM_002537chr153437 428 394 1253 1795 --
NM_002542chr32210 40 ------
NM_002545chr11145045 5004 4575 3216 3210 2043 1704 1307 1257 887 626 535 275 91 13534 43912 1496 1396 282 1949
NM_002546chr8298 27 ------
NM_002547chrX103079 1436 924 761 740 357 350 339 63 41 --33984 1042 657 21645 117
NM_002553chr71397 1442 ----
NM_002556chr11121984 1889 1839 1771 1526 1451 1355 868 855 820 756 296 11456 41784 1623 1340 97 11789
NM_002568chr8----1311 --
NM_002570chr1521164 229 --159 --
NM_002572chr11380 74 37 --1350 --
NM_002576chr1151185 291 224 112 38 ------
NM_002577chr3133713 3504 3123 2574 1625 1536 1525 1491 903 792 777 431 407 --2893 196 --
NM_002578chrX1114 2149 134 ----
NM_002581chr9125156 5062 4861 4708 2151 1657 1446 1026 977 848 605 433 34805 3627 1231 ----
NM_002585chr13260 146 135 ------
NM_002586chr661288 1162 394 315 246 234 --11100 --
NM_002588chr5101718 1406 1300 1237 645 541 501 389 322 174 --11391 --
NM_002589chr41152 ----153
NM_002595chr1231718 1278 469 11584 140 --
NM_002599chr114362 286 156 112 11229 21124 141 --
NM_002600chr151203 628 540 514 117 --1545 --
NM_002601chr22196 71 1413 ----
NM_002603chr81144 ------
NM_002605chr153318 153 85 ------
NM_002607chr72244 44 1864 146 --
NM_002608chr22111538 1524 1516 1509 1492 1374 1273 590 338 260 172 11113 11580 --
NM_002609chr53130 119 84 ------
NM_002610chr252894 2717 2362 1249 391 22459 2234 12825 --
NM_002612chr73409 88 59 ------
NM_002613chr16115379 4687 3930 3620 2116 2104 1942 1919 1413 1155 615 1344 21260 537 14454
NM_002616chr17144 ------
NM_002620chr4------173
NM_002623chr203801 97 66 --170 --
NM_002628chr321142 385 ------
NM_002633chr13453 411 400 --2472 383 --
NM_002634chr173934 858 718 --171 --
NM_002636chr63435 427 65 145 ----
NM_002641chrX21642 191 --11829 --
NM_002643chr21167 ------
NM_002645chr1152632 1982 1123 665 363 12860 12333 --
NM_002646chr161738 865 797 787 724 183 --22178 667 --
NM_002648chr671198 979 449 438 428 327 238 --2981 973 1934
NM_002649chr731183 280 143 1130 1624 --
NM_002651chr14886 866 649 348 --1315 --
NM_002652chr7139 191 ----
NM_002655chr895251 3913 3666 1731 1618 1490 1209 1152 844 11519 21735 1234 24258 747
NM_002657chr20143580 3183 2863 2474 1545 1300 1291 1272 1144 978 851 400 313 287 12553 32515 2510 1368 12651
NM_002661chr161198 ------
NM_002670chr341460 1250 1241 435 ----11336
NM_002674chr121160 ------
NM_002687chr1451206 1113 495 335 70 --21153 72 --
NM_002690chr81105 ------
NM_002693chr153312 303 151 ------
NM_002697chr1196 1267 ----
NM_002698chr1982832 2603 2591 2532 2368 1961 1012 78 1797 32314 2295 2276 --
NM_002699chr151383 1371 1091 598 528 --21254 535 11259
NM_002706chr21577 --1581 --
NM_002707chr2176 ------
NM_002709chr273590 3534 3200 3108 1030 924 878 23209 1287 22394 1280 --
NM_002710chr121957 --2738 122 --
NM_002711chr7----1614 --
NM_002713chr14884 412 262 88 2291 219 1276 1254
NM_002714chr65971 361 297 191 57 --1939 --
NM_002715chr53914 443 277 ------
NM_002716chr1153625 2515 848 505 193 23337 159 23502 3113 --
NM_002717chr83243 103 33 ------
NM_002718chr362568 2384 619 503 238 51 2818 696 22323 892 --
NM_002719chr1492350 2279 2010 1757 1682 1597 616 105 71 ------
NM_002720chr163238 66 33 --1242 --
NM_002721chr9--144 ----
NM_002730chr1941357 1173 973 246 --3908 460 240 --
NM_002731chr173080 2960 658 558 276 253 229 33101 2732 443 12800 --
NM_002734chr1762213 1982 1921 1535 1524 114 ------
NM_002736chr721893 113 1184 11611 --
NM_002737chr17226495 6327 6208 5850 5798 4998 4452 4145 4133 4041 2661 2148 2017 1991 1777 1664 1639 1429 1067 1060 921 323 15504 25800 1781 1272
NM_002742chr142716 668 ------
NM_002745chr22104454 4022 3209 2948 2761 1395 1043 387 294 57 --23601 1692 --
NM_002746chr161187 ------
NM_002747chr1841503 562 507 81 --1668 1234
NM_002748chr151150 1372 ----
NM_002752chr51400 ------
NM_002753chr41296 ------
NM_002763chr12512 201 ------
NM_002764chrX6887 803 750 680 645 213 1112 2892 682 --
NM_002765chrX5521 393 281 176 153 ------
NM_002775chr101213 1541 1151 --
NM_002796chr1179 ------
NM_002806chr141332 ------
NM_002819chr1941165 1020 545 327 11120 1352 --
NM_002821chr66564 556 546 249 163 153 --2566 155 --
NM_002822chr1231808 1230 337 2680 271 ----
NM_002823chr21579 ------
NM_002827chr2051371 1244 1194 202 156 --11481 --
NM_002828chr18--2996 754 ----
NM_002829chr93926 431 31 --1270 --
NM_002833chr1561425 1202 628 365 151 108 --4501 411 322 38 1373
NM_002834chr12103715 3414 3057 2971 1628 1477 1142 1105 398 218 --23418 1004 --
NM_002839chr931038 988 429 23009 1136 13179 194
NM_002840chr171377 1216 1151 384 370 293 226 --1518 --
NM_002841chr31469 ------
NM_002843chr1163325 2422 1115 737 641 493 --121 --
NM_002844chr6--21367 351 --21272 374
NM_002845chr182471 32 1249 ----
NM_002848chr1221234 940 ------
NM_002849chr12182 ------
NM_002850chr1951055 1006 778 443 241 --1243 --
NM_002855chr11133598 3506 3063 3048 2709 1408 1344 827 653 624 254 208 189 11006 23120 1362 --
NM_002858chr12433 357 ------
NM_002859chr12111712 1358 1336 1319 1253 1212 1158 665 550 333 30 ------
NM_002866chr195229 47 38 29 21 ------
NM_002867chr11469 ------
NM_002868chr12122233 2104 2090 2062 1908 1845 805 536 375 369 263 249 12245 52404 2264 1988 1931 1818 11662
NM_002869chr1131705 596 452 12069 21763 26 --
NM_002871chr161916 1366 1262 1241 640 277 41287 497 217 166 195 --
NM_002874chr952481 2057 890 698 652 22193 286 ----
NM_002880chr35680 658 566 258 124 --2162 75 --
NM_002881chr271176 1002 937 508 225 126 81 --1237 --
NM_002882chr22126 --240 35 --
NM_002886chr3155174 4975 4891 4823 4598 3567 3549 3301 1863 1828 1303 1154 1139 541 420 --1545 --
NM_002890chr51265 ------
NM_002892chr1451316 606 233 158 21 ------
NM_002893chrX3350 337 117 ------
NM_002895chr204964 911 836 639 ------
NM_002897chr22559 551 ------
NM_002906chr1152044 1631 1519 440 383 ------
NM_002912chr61358 1185 1793 --
NM_002918chr1921132 763 ------
NM_002924chr15588 234 209 199 161 ------
NM_002926chr441173 1022 325 129 ------
NM_002931chr62309 73 ------
NM_002938chr471944 1660 1414 1289 496 345 79 1603 31914 1304 149 --
NM_002941chr331238 1174 274 1442 --1209
NM_002942chr31208 11102 ----
NM_002945chr17158 --1590 --
NM_002953chr14765 546 171 165 --1293 1806
NM_002955chr651666 1634 1236 541 69 1285 11364 --
NM_002956chr1231212 941 884 ------
NM_002958chr31112 --1723 --
NM_002959chr184172 4147 3604 3489 2852 954 894 792 21025 242 34130 3333 1111 1968
NM_002968chr1621008 925 --197 --
NM_002970chrX--168 ----
NM_002971chr341019 364 348 178 ------
NM_002973chr12145 ------
NM_002977chr263275 2451 1269 958 931 924 32288 2250 141 2988 715 11205
NM_002979chr12760 621 2802 154 ----
NM_002994chr451514 1221 603 518 139 1658 ----
NM_002997chr261822 1391 1300 525 232 59 ------
NM_002998chr831717 1701 701 22017 303 31452 422 402 --
NM_003001chr192140 1991 1982 1873 1551 827 819 702 57 130 32242 1553 324 --
NM_003009chr193314 264 101 ------
NM_003010chr1752332 1495 591 500 467 ------
NM_003011chr931368 471 379 --4386 242 215 29 --
NM_003012chr8102981 2969 1235 1203 942 628 611 471 409 158 12493 31218 1144 1140 --
NM_003013chr41163 ------
NM_003014chr721408 37 ------
NM_003016chr1731855 1678 770 --1782 --
NM_003017chr611234 --11375 --
NM_003021chr197819 742 448 255 76 58 33 --1206 --
NM_003026chr951079 951 915 464 425 --1953 11114
NM_003028chr9103767 3596 3005 2715 2655 2633 2502 2372 986 283 --12925 --
NM_003029chr171320 1130 345 276 252 44 21 --2520 254 11021
NM_003030chr331745 1373 113 1230 11362 --
NM_003031chr163858 761 380 ------
NM_003034chr12157980 7225 7043 7031 6324 6263 5612 5589 5091 4927 3164 2084 1490 1031 630 27924 7807 46328 725 721 519 --
NM_003036chr131158 991 932 11003 ----
NM_003037chr14147 118 86 27 ------
NM_003042chr351765 1571 540 413 84 1835 ----
NM_003043chr3114329 4001 3749 3246 2869 2668 1565 1175 511 475 383 --53751 3056 1180 909 34 --
NM_003045chr1394916 4584 4566 3156 1528 888 553 422 335 24982 1543 34213 3695 363 13700
NM_003046chr8125381 4680 4457 4421 4233 4056 3968 1769 1757 1278 1090 609 ------
NM_003047chr131243 1091 44 --184 --
NM_003051chr151960 1946 1710 1702 1295 2535 325 11704 --
NM_003060chr51398 --21073 189 --
NM_003068chr82840 204 1318 1275 --
NM_003069chrX2578 567 2669 300 ----
NM_003070chr93772 743 697 --142 1859
NM_003071chr341756 1694 1435 294 21950 551 11501 11905
NM_003072chr191131 ------
NM_003074chr3121911 1883 1871 1655 1607 1463 1406 1398 856 732 408 80 ------
NM_003076chr12101692 1679 1414 1181 1159 1036 471 398 187 171 --21421 475 --
NM_003077chr17121 --2586 577 --
NM_003079chr172391 369 --1173 1325
NM_003081chr201191 ------
NM_003085chr52108 88 ------
NM_003088chr75887 879 292 114 69 --1714 --
NM_003089chr191156 ------
NM_003093chr61176 ------
NM_003094chr131084 790 744 1168 ----
NM_003099chr15156060 5942 5919 5241 5074 4097 2617 2460 2207 1505 767 700 611 551 208 12600 36053 754 116 --
NM_003104chr1541021 958 327 88 --2985 280 --
NM_003106chr32835 250 ------
NM_003107chr662607 1797 661 489 372 209 11892 2894 453 12221
NM_003108chr2217201 6809 6373 6349 6300 6202 5683 5644 5213 4409 2583 2263 1841 1819 1803 1762 1059 1035 371 252 25 --35580 1845 280 --
NM_003111chr221084 1072 11247 ----
NM_003112chr792868 2361 2339 1044 648 466 275 215 120 ------
NM_003114chr83759 644 26 1142 ----
NM_003115chr11465 ------
NM_003128chr272407 1891 1742 1132 879 354 28 12699 ----
NM_003131chr692263 1968 1959 1765 820 665 651 503 345 --42112 1756 254 206 --
NM_003133chr11354 1336 ----
NM_003136chr141162 --2123 70 --
NM_003137chr6112085 1394 905 734 619 524 484 273 95 68 51 22208 1725 2736 275 11534
NM_003139chr115803 677 660 138 35 --2720 50 1240
NM_003142chr21229 ------
NM_003144chr621397 325 ------
NM_003146chr112261 34 ------
NM_003149chr361537 1100 1042 574 530 304 --21624 306 11213
NM_003150chr1742183 1849 941 391 --2570 323 --
NM_003155chr892808 2423 2253 2234 2075 859 618 556 258 ------
NM_003156chr1151217 1156 1145 62 39 --172 --
NM_003161chr1741405 1261 1157 363 22195 1120 21393 1143 --
NM_003162chr22996 24 ------
NM_003164chr111433 --1377 --
NM_003170chr172573 548 ------
NM_003173chrX1186 --11241 --
NM_003174chr102555 200 --1287 1665
NM_003178chr331482 496 447 1138 12157 --
NM_003179chrX71382 1359 1206 1199 1122 245 67 ------
NM_003180chr193330 125 98 ------
NM_003181chr62164 130 ------
NM_003184chr83264 230 22 --124 --
NM_003185chr2041232 1105 524 463 11036 2992 242 --
NM_003188chr62832 157 ------
NM_003189chr173215 672 645 274 255 248 179 --42843 2834 555 122 2695 336
NM_003194chr62552 142 --138 --
NM_003199chr18115635 5096 4087 3709 1326 1097 807 342 306 229 49 15455 ----
NM_003200chr1922022 1609 ------
NM_003201chr101334 1677 ----
NM_003204chr1741735 1361 599 242 11379 1244 1104
NM_003206chr61441 ------
NM_003211chr12--21639 1342 ----
NM_003216chr22103136 2715 2460 2364 2112 978 920 846 775 505 12500 33211 2081 1335 1943
NM_003217chr12111904 1751 1654 619 324 249 199 132 56 42 34 --51658 1301 585 388 384 --
NM_003220chr671685 1202 1175 1061 634 602 453 --194 --
NM_003221chr6123538 3517 3370 3195 2951 2866 2845 1451 1134 1027 802 309 11049 73845 3460 3433 3429 2895 1649 525 13639
NM_003222chr202489 59 2921 168 1279 --
NM_003223chr166728 696 622 551 307 28 ------
NM_003224chr204949 857 259 235 --2271 148 --
NM_003234chr39957 854 734 691 680 561 481 457 435 12347 1277 --
NM_003236chr2103443 3184 3044 2394 1294 1224 1018 778 550 61 23573 3245 --1108
NM_003239chr145837 774 250 166 148 ------
NM_003242chr341661 908 227 94 --11626 --
NM_003244chr182285 125 ------
NM_003246chr155662 249 220 107 57 --1111 --
NM_003250chr173322 142 48 --1148 --
NM_003253chr2181544 1513 1343 559 474 467 379 42 11312 1563 --
NM_003255chr1772567 1827 1055 865 837 433 147 --22054 81 11654
NM_003257chr152906 350 ------
NM_003262chr373770 3702 3677 3668 2061 1447 274 54351 4263 1845 1069 882 24049 3707 --
NM_003269chr621007 352 ------
NM_003270chrX3846 791 256 --1994 --
NM_003274chr2171846 1834 1814 560 519 431 71 --22770 407 --
NM_003275chr91378 ------
NM_003285chr13557 518 368 --8550 546 542 534 530 526 522 347 --
NM_003286chr201436 --11108 --
NM_003290chr194290 235 186 55 1275 ----
NM_003291chr131855 ------
NM_003298chr3186009 5360 5260 5089 4917 4501 4251 3945 3814 2188 1524 1404 1208 1056 1045 178 114 40 35308 4684 424 24147 180 14830
NM_003299chr121102 ------
NM_003300chr141329 1450 ----
NM_003304chr321026 190 11251 ----
NM_003314chr54471 450 442 177 --1292 --
NM_003319chr2172 ------
NM_003320chr1163568 3535 1685 1016 234 98 34379 4241 3992 22775 2770 14133
NM_003324chr1241396 1055 68 27 ------
NM_003334chrX2154 54 ------
NM_003336chrX3927 152 128 1144 ----
NM_003337chr51448 ------
NM_003338chr1041953 1517 752 484 ------
NM_003339chr531404 650 110 21511 89 11505 --
NM_003340chr42444 178 ------
NM_003341chr3--1137 ----
NM_003342chr1762867 1100 963 541 340 71 22789 912 22568 2540 1397
NM_003344chr721559 354 21762 41 1510 --
NM_003345chr164496 428 196 132 ------
NM_003347chr2252270 1647 1520 599 383 22313 137 21431 356 --
NM_003348chr1271705 1417 1379 1209 1147 404 53 ------
NM_003349chr2051329 549 378 33 27 --11075 --
NM_003350chr83923 865 41 ------
NM_003352chr22936 327 ------
NM_003359chr42937 912 ------
NM_003363chr32552 456 --1119 --
NM_003368chr11187 ------
NM_003370chr196764 588 574 229 62 33 ------
NM_003371chr941321 738 459 114 --1763 --
NM_003372chrX------1331
NM_003373chr1081951 1760 1580 1384 626 602 471 389 --41494 611 496 369 --
NM_003374chr53775 199 159 --1583 --
NM_003380chr10----190 --
NM_003383chr9193 ------
NM_003384chr14284 26 ------
NM_003385chr24924 319 272 145 ------
NM_003387chr282419 1880 1853 1810 947 928 296 82 --22324 1153 12107
NM_003390chr115802 729 310 241 89 ------
NM_003392chr373416 3313 3156 541 515 258 134 22697 1182 11020 --
NM_003394chr124664 596 176 77 --1668 --
NM_003400chr23668 341 168 ------
NM_003403chr144531 328 43 22 ------
NM_003404chr2041361 829 701 591 ----21760 704
NM_003405chr22161 --2574 28 --
NM_003406chr851810 1741 1594 1560 1496 11455 21735 1483 --
NM_003407chr192577 221 ------
NM_003409chr181920 1383 ----
NM_003410chrX63025 2076 2068 2000 630 620 12254 12286 --
NM_003411chrY31582 1349 366 11239 --11824
NM_003412chr372711 1940 1114 1036 983 341 187 --11120 --
NM_003413chrX2454 247 11397 2792 254 --
NM_003418chr32240 162 ------
NM_003420chr34730 577 81 44 --1799 1262
NM_003427chr62678 490 ------
NM_003432chr52494 117 ------
NM_003439chr752767 1244 597 186 132 11138 1728 --
NM_003445chr193740 734 700 ------
NM_003453chr132695 95 ------
NM_003457chr173223 193 118 ------
NM_003458chr3133963 3811 3782 3733 3372 3195 2919 2802 1319 1302 1014 524 264 --83854 3842 3837 3818 3052 2923 2629 944 --
NM_003462chr181508 1397 1272 678 458 425 320 110 --2547 442 --
NM_003463chr653132 2749 981 896 257 12960 ----
NM_003466chr252488 2345 2011 888 550 1576 1857 --
NM_003467chr21360 ------
NM_003468chr283505 3339 3015 2950 2806 2725 1395 501 23407 405 23028 224 11569
NM_003469chr21159 ------
NM_003470chr1691722 1650 1617 1580 1559 1331 1163 501 420 --41731 1621 530 355 --
NM_003471chr322345 656 ------
NM_003473chr102232 181 1864 ----
NM_003474chr1062265 1639 1612 958 774 356 11565 21985 1543 1793
NM_003478chr1163080 2853 2831 2738 1211 347 --13122 --
NM_003481chr124507 497 480 106 ------
NM_003482chr1282756 1995 1117 921 572 538 199 51 ------
NM_003483chr1282774 2494 2194 1051 1038 623 538 99 22042 796 22064 197 --
NM_003487chr172198 89 --175 --
NM_003489chr2143444 2781 1051 793 --11116 --
NM_003496chr72793 134 ----1740
NM_003498chr1652221 2063 1046 1013 647 22016 961 42727 2067 1094 1051 --
NM_003503chr14922 469 279 204 11077 ----
NM_003505chr761279 742 660 594 384 102 --51212 775 614 609 388 --
NM_003549chr3129 ------
NM_003557chr181298 1229 521 439 395 354 169 151 --1178 --
NM_003558chr91263 ------
NM_003559chr17173435 3191 3114 2900 2754 2744 2733 2415 2405 1596 1355 1288 988 606 597 486 224 11202 63193 2990 2904 2502 2409 992 --
NM_003563chr1731028 1012 497 --11424 --
NM_003564chr13536 233 197 --1110 --
NM_003566chr1263121 2648 2274 973 757 356 33497 1123 802 1489 --
NM_003567chr1--1285 ----
NM_003569chr62593 272 ------
NM_003574chr18115655 5132 4126 4063 3884 3821 3713 3497 1977 473 282 --11214 --
NM_003576chr13132800 2685 2296 2222 2173 1870 964 913 752 465 215 41 33 --32802 2724 45 --
NM_003580chr8--3467 404 140 ----
NM_003581chr23974 957 667 ------
NM_003587chr6141 ------
NM_003590chr253701 3688 2723 2707 1526 ----23704 2630
NM_003595chr221429 ------
NM_003603chr422121 225 11579 ----
NM_003607chr193467 3208 1645 1373 1189 1011 964 204 70 23303 917 13851 --
NM_003615chr383956 3719 3698 3100 3003 2487 971 374 23044 2783 ----
NM_003617chr1184640 4522 4288 4244 3918 3808 3644 3518 3106 3099 1484 1478 1146 1050 552 211 83 42 11552 34551 671 193 14645
NM_003620chr1731106 804 773 --1721 --
NM_003621chr111507 ------
NM_003628chr2--2187 36 ----
NM_003629chr163470 3188 2941 909 807 437 180 1816 --
NM_003631chr104721 644 326 140 ------
NM_003632chr172358 211 --2759 289 --
NM_003633chr552157 1868 1022 1014 635 12305 ----
NM_003634chr224840 196 32 26 --1872 1190
NM_003637chr161496 402 391 358 338 42 --2491 418 --
NM_003642chr2------1244
NM_003644chr17326379 6360 6153 6025 5715 4688 4481 4414 4393 4346 4291 4188 4174 2169 2145 2121 2064 1483 1473 1347 1270 1254 1201 1164 1056 810 786 750 736 598 544 353 --65595 4905 4816 2173 1355 500 --
NM_003648chr282637 1008 864 745 394 236 144 128 --1529 --
NM_003651chr121532 ----1491
NM_003654chr111143 --1117 --
NM_003655chr174591 585 237 199 --1536 --
NM_003656chr3164 --1169 --
NM_003659chr21315 ------
NM_003660chr193675 636 42 --1258 --
NM_003663chr333511 2618 2547 22583 907 12499 --
NM_003664chr54355 181 91 70 ------
NM_003670chr341477 1174 542 438 149 41392 984 37 33 --
NM_003672chr141923 681 422 86 ----3684 506 112
NM_003677chr124887 860 741 419 ------
NM_003679chr163449 3135 2945 2423 2155 2119 22805 2212 11204 --
NM_003680chr11501 --2250 26 --
NM_003685chr193799 227 22 --2801 380 1951
NM_003692chr91316 ------
NM_003701chr132809 31 1679 ----
NM_003704chr41672 ------
NM_003705chr21120 1719 1794 --
NM_003711chr52215 81 1298 ----
NM_003713chr171369 1304 1242 1201 704 435 155 ------
NM_003714chr522274 266 12969 22682 30 --
NM_003716chr33952 828 185 ------
NM_003718chr7----1547 --
NM_003721chr192139 116 ------
NM_003728chr42664 249 ------
NM_003732chr53288 207 71 ------
NM_003735chr5101718 1406 1300 1237 645 541 501 389 322 174 --11391 --
NM_003736chr5101718 1406 1300 1237 645 541 501 389 322 174 --11391 --
NM_003740chr641637 747 144 41 ----1137
NM_003743chr241937 920 578 197 1307 11612 --
NM_003749chr1352313 2015 1594 338 188 --1935 1307
NM_003750chr102829 750 ----1818
NM_003758chr1531524 604 68 --21125 73 --
NM_003758chr1531524 604 68 --21125 73 --
NM_003759chr4103799 3370 3231 3053 2847 2611 976 917 581 157 44231 3855 818 752 23509 1108 --
NM_003760chr11541 ------
NM_003761chr24305 87 78 31 --180 --
NM_003762chr13950 463 102 ----1176
NM_003763chr2083050 2827 2554 2446 1070 483 197 152 13031 ----
NM_003766chr172242 171 ------
NM_003768chr181635 1558 1544 733 592 527 313 53 2369 201 31684 594 315 --
NM_003774chr1253340 3310 1267 1232 784 1253 ----
NM_003778chr33648 194 126 ------
NM_003783chr121058 1002 ------
NM_003787chr182626 617 21253 638 11147 --
NM_003794chr31126 --1868 --
NM_003795chr62486 219 ----1202
NM_003797chr111171 ------
NM_003800chr6112364 2279 2210 1947 1844 1827 958 919 791 421 181 1481 12053 --
NM_003816chr811177 11326 187 --
NM_003819chr1--170 ----
NM_003822chr142021 1973 1169 494 ------
NM_003825chr1531392 617 209 --2192 151 --
NM_003827chr195574 492 462 90 31 ------
NM_003829chr91197 --1162 --
NM_003831chr1811460 11552 2451 418 --
NM_003842chr852409 2283 1899 1834 31 --11717 21914 705
NM_003850chr131211 ------
NM_003861chr14122875 2653 2571 2325 2141 2029 1050 911 858 616 591 146 --32852 577 367 22037 244
NM_003864chr4------1169
NM_003867chr83555 195 49 ----157
NM_003870chr1572047 2005 1704 1625 1349 540 239 --3220 75 71 161
NM_003872chr272788 2222 1224 690 477 432 74 1439 ----
NM_003873chr1042294 1833 804 210 ------
NM_003877chr124929 896 695 687 1108 --2307 212
NM_003884chr321136 292 123 ----
NM_003885chr1762653 2345 1910 1901 858 113 --1767 --
NM_003887chr272304 1513 905 802 703 445 337 2884 550 21926 793 --
NM_003888chr15101442 1334 1303 1263 1096 422 386 380 279 56 11467 61324 1312 1308 1233 363 341 --
NM_003895chr212644 183 11845 ----
NM_003896chr25878 838 730 679 153 1169 163 --
NM_003901chr10112700 2667 2332 2076 1941 468 420 378 267 168 157 --21825 1710 12721
NM_003902chr13668 592 123 --1724 --
NM_003907chr32328 294 ------
NM_003908chr2031340 1103 977 ------
NM_003909chr852776 2698 2012 920 117 31118 440 151 1968 1692
NM_003913chr6114212 4176 4050 3980 3925 2666 1636 1579 1380 1097 1051 23111 397 1467 11678
NM_003916chrX31282 948 26 1598 1952 --
NM_003919chr7175 ------
NM_003921chr141292 722 336 225 11591 ----
NM_003924chr431547 1408 663 11321 1200 --
NM_003927chr184775 723 446 33 ------
NM_003931chr64557 125 103 97 ------
NM_003932chr2231530 1361 97 1211 11805 --
NM_003936chr28960 839 435 414 360 331 295 245 1933 ----
NM_003939chr10193894 3820 3714 3646 3531 3426 3317 3279 3144 2938 2695 1496 1194 1052 962 898 654 633 290 --33827 2722 1382 --
NM_003941chr732304 1626 57 11899 ----
NM_003947chr311356 --1203 --
NM_003949chr1791915 1895 1683 1598 1381 1361 1262 615 449 --11701 --
NM_003951chrX1285 ----141
NM_003953chr1112633 2565 2463 2377 2362 2263 2199 2149 1857 308 264 --52635 1106 954 875 826 --
NM_003955chr171369 ------
NM_003956chr10147 ----1454
NM_003957chr111254 1853 ----
NM_003958chr693659 3650 3102 1489 742 683 452 428 159 13536 63893 2781 2638 744 520 511 --
NM_003966chr5267300 7172 6303 6017 5855 5323 5235 4910 4791 4780 3068 2738 2712 2691 2649 2564 2335 2051 1228 1105 888 497 408 388 329 24 36048 5542 2748 107268 7217 2962 2804 2743 2720 2716 2704 2696 2340 37707 7692 5326
NM_003968chr32251 149 ------
NM_003971chr173637 248 126 ------
NM_003980chr621049 66 --168 1255
NM_003981chr154918 895 664 34 ------
NM_003983chr16124143 3993 3839 3453 3287 3224 3178 2788 2714 1238 472 453 24121 3545 44394 4047 3689 1604 14252
NM_003986chr111103 ------
NM_003987chr1061593 1565 839 673 591 513 --11701 --
NM_003988chr1061670 1642 916 750 668 590 --11778 --
NM_003989chr1061529 1501 775 609 527 449 --11637 --
NM_003990chr1061529 1501 775 609 527 449 --11637 --
NM_003992chr152308 277 ------
NM_003994chr1253772 3369 3095 1433 608 12848 21682 1544 --
NM_003995chr91215 --1204 --
NM_004006chrX72136 2047 2040 2026 1066 930 591 ------
NM_004007chrX72136 2047 2040 2026 1066 930 591 ------
NM_004009chrX72136 2047 2040 2026 1066 930 591 ------
NM_004010chrX72136 2047 2040 2026 1066 930 591 ------
NM_004011chrX72136 2047 2040 2026 1066 930 591 ------
NM_004012chrX72136 2047 2040 2026 1066 930 591 ------
NM_004013chrX72136 2047 2040 2026 1066 930 591 ------
NM_004014chrX72136 2047 2040 2026 1066 930 591 ------
NM_004015chrX72136 2047 2040 2026 1066 930 591 ------
NM_004016chrX72050 1961 1954 1940 980 844 505 ------
NM_004017chrX72136 2047 2040 2026 1066 930 591 ------
NM_004018chrX72050 1961 1954 1940 980 844 505 ------
NM_004019chrX3330 164 107 ------
NM_004020chrX72136 2047 2040 2026 1066 930 591 ------
NM_004021chrX72050 1961 1954 1940 980 844 505 ------
NM_004022chrX72050 1961 1954 1940 980 844 505 ------
NM_004023chrX72050 1961 1954 1940 980 844 505 ------
NM_004024chr141226 521 447 128 195 11231 --
NM_004028chr1882813 2696 681 613 553 351 263 56 23019 2979 --23472 2564
NM_004034chr102507 110 ------
NM_004035chr1784874 4867 4644 3935 1096 1074 404 249 14648 25186 414 --
NM_004036chr23646 548 235 --177 --
NM_004037chr13657 613 343 --1354 1869
NM_004047chr1285 53 1252 ----
NM_004050chr1442000 965 683 610 11788 1761 12258
NM_004055chr1192005 1638 1536 1376 786 553 414 207 110 1286 11718 --
NM_004061chr52644 559 --1574 --
NM_004067chr751473 1414 1255 1155 114 ------
NM_004068chr32290 112 --1292 --
NM_004077chr1261182 1106 1099 843 418 195 --21233 176 --
NM_004081chrY41788 1394 1371 199 --11381 11309
NM_004082chr21111 --1232 --
NM_004083chr12148 1213 ----
NM_004085chrX1514 1303 --1517
NM_004089chrX41192 900 514 57 ------
NM_004090chr17113019 2819 2672 2302 2266 2152 1217 607 490 368 156 11230 12741 --
NM_004093chr1373139 2359 2183 2076 1977 1315 29 13287 12381 --
NM_004094chr1442090 554 433 49 1372 1440 1313
NM_004096chr1091676 1653 1443 779 694 641 547 208 137 --31534 650 645 1298
NM_004097chr23655 361 205 ------
NM_004098chr1031180 979 935 ----1938
NM_004099chr952087 1688 1616 1567 24 ------
NM_004100chr642571 2539 1003 559 ----12577
NM_004102chr12588 78 ------
NM_004103chr88766 730 717 711 698 115 86 32 1841 1800 --
NM_004112chr1771764 1638 1333 1214 453 288 253 --1436 1696
NM_004113chr372018 765 150 69 44 38 22 --150 --
NM_004114chrX2927 839 ----1157
NM_004116chr21408 ------
NM_004117chr661664 1626 1607 870 414 58 2759 659 --1417
NM_004124chr1473043 2299 2239 529 520 198 111 ------
NM_004126chr72254 113 ------
NM_004132chr1061189 922 831 272 192 157 --3986 833 254 --
NM_004133chr83746 629 102 12715 ----
NM_004134chr53611 128 63 ------
NM_004136chr1552362 1001 709 167 25 21302 815 22907 333 --
NM_004156chr81465 ------
NM_004157chr33564 334 46 --2893 336 126
NM_004161chr251362 1035 989 459 405 --1261 1992
NM_004162chr3--141 11125 --
NM_004163chr182195 111 1409 ----
NM_004170chr92418 326 1402 ----
NM_004171chr11209540 9249 9226 9215 9198 8248 8210 7832 7814 6787 6583 6302 6072 6026 3521 3179 2490 1166 556 77 69532 7312 3441 2519 1477 712 39030 6577 1682 18215
NM_004185chr1----179 --
NM_004187chrX101301 1240 1006 462 449 431 360 212 83 63 21289 952 1435 1440
NM_004193chr102401 193 --148 --
NM_004199chr5----126 --
NM_004200chr11153229 2883 2819 2292 2156 2096 2064 1238 1206 1182 1129 1036 788 244 225 --52887 1094 1090 1054 921 --
NM_004202chrY264 51 --1567 --
NM_004205chr11229 22 --1183 --
NM_004209chr164881 843 287 84 --11171 --
NM_004210chr1082003 1867 1846 577 571 313 111 86 --31350 769 391 --
NM_004215chr82463 367 ------
NM_004225chr821383 1005 ------
NM_004227chr752653 2144 2100 1955 299 21119 582 22104 303 --
NM_004229chrX31638 669 152 11909 31614 1527 1518 --
NM_004232chr1832903 1513 849 12924 ----
NM_004233chr661298 1276 1122 1110 506 24 --21304 1112 --
NM_004235chr93628 580 72 ------
NM_004236chr151424 ------
NM_004238chr2----1104 --
NM_004239chr141122 ------
NM_004252chr174527 508 153 62 --1118 --
NM_004254chr114281 259 108 21 --1358 --
NM_004255chr151109 ------
NM_004262chr471323 1314 1253 1247 1080 1064 1047 1881 1154 --
NM_004263chr261608 1484 517 501 342 221 --21636 1404 1697
NM_004268chr1161035 954 938 892 499 486 1378 1303 --
NM_004272chr541753 1455 587 298 ------
NM_004274chr1483047 2987 2905 2215 1172 704 335 158 12265 1546 --
NM_004279chr772111 1978 1938 1896 1739 538 347 --1702 --
NM_004283chr195671 344 317 272 103 ------
NM_004288chr21929 1163 ----
NM_004290chr571069 1010 877 374 300 106 49 11255 11159 --
NM_004291chr53133 109 45 --165 --
NM_004293chr943459 2459 2334 1392 23003 2767 33461 625 120 --
NM_004295chr1721176 439 1988 1249 --
NM_004301chr31267 --128 --
NM_004302chr12102572 2541 2461 2305 2281 2255 762 664 475 388 --22285 2120 --
NM_004304chr24376 296 286 27 ------
NM_004308chr11121893 1808 1789 1464 634 612 600 309 297 262 55 29 --21449 299 --
NM_004311chr10102975 2943 2549 2255 2135 847 639 339 223 74 --42950 2945 2732 2728 --
NM_004316chr1221183 81 --1443 --
NM_004319chr1123035 2927 2535 2523 2487 2437 2421 2394 2238 1259 848 162 22767 560 52466 2308 2005 706 650 --
NM_004323chr9132587 2255 2199 2167 2065 2029 864 848 817 648 378 294 199 1125 22346 2342 --
NM_004326chr171142 1010 996 990 908 845 798 --21149 802 --
NM_004329chr103344 148 110 1892 ----
NM_004331chr852028 1790 956 747 263 42004 1739 1700 223 1865 --
NM_004338chr18106558 6050 5913 4702 4685 2311 1946 1629 1429 1145 35364 5194 1954 24310 1147 16563
NM_004339chr2151761 634 189 123 32 ------
NM_004342chr711700 --12290 --
NM_004349chr811022 11227 ----
NM_004354chr43865 123 72 ------
NM_004356chr11----1161 1458
NM_004364chr1951198 1122 923 380 370 --21124 163 --
NM_004370chr641827 1459 821 649 --11488 --
NM_004371chr15960 621 230 82 69 ------
NM_004379chr231281 654 596 1676 ----
NM_004380chr162733 29 --2916 725 11997
NM_004383chr152409 124 ------
NM_004384chr511877 ------
NM_004385chr54665 530 64 55 1279 --167
NM_004386chr1992291 2134 1973 1829 1651 1504 804 698 32 21915 1897 1841 --
NM_004389chr25677 587 566 44 35 ------
NM_004391chr362003 1823 1419 1330 804 669 --31899 1887 1695 --
NM_004392chr1372653 1832 1643 928 583 346 105 21875 783 ----
NM_004393chr342336 2085 1827 1627 ------
NM_004395chr51273 --4696 540 527 228 --
NM_004397chr11104167 3597 3481 2998 2810 2752 1558 1351 599 531 1572 33757 3224 939 21362 606
NM_004398chr11122 1495 ----
NM_004399chr123663 295 262 --2299 38 1366
NM_004405chr23929 399 285 --1319 --
NM_004408chr92178 34 ------
NM_004414chr2151175 622 482 361 82 --1486 --
NM_004416chr1261082 890 710 694 687 22 ------
NM_004417chr51595 ------
NM_004423chr3102066 2008 1695 1093 1015 839 783 775 393 218 --22523 2247 12252
NM_004427chr181021 778 444 420 297 288 254 173 11039 31139 410 406 --
NM_004429chrX41334 337 208 60 --1251 --
NM_004430chr8132233 2195 2185 2067 1070 975 959 953 894 696 621 206 164 ------
NM_004431chr13331 320 202 --2533 113 --
NM_004432chr952193 2091 2050 1567 406 1182 1256 12198
NM_004433chr131710 1589 669 --4629 406 312 59 --
NM_004436chr11144 --2146 82 --
NM_004437chr1133192 3143 2662 2473 2415 2409 2398 2345 1232 1078 665 651 35 12590 42417 1043 984 488 --
NM_004438chr233202 2138 1017 --1857 --
NM_004440chr62385 109 ------
NM_004441chr34862 449 419 387 ------
NM_004442chr151601 1557 1151 1064 28 ------
NM_004447chr121252 ------
NM_004449chr2131108 933 585 --11051 --
NM_004450chr14----1323 --
NM_004454chr342238 2171 1927 1834 11814 21931 659 --
NM_004456chr71170 ------
NM_004457chr22607 189 --11081 --
NM_004458chrX62572 2436 2082 1689 1053 470 1381 1773 --
NM_004459chr1741597 1544 1336 1260 1554 11513 11971
NM_004468chr13607 113 27 ------
NM_004469chrX3464 438 138 ------
NM_004475chr1791195 1128 956 875 478 276 256 187 154 --1836 --
NM_004480chr142530 274 ------
NM_004481chr171821 1729 817 528 256 233 89 12662 12471 22413 2161
NM_004482chr23757 657 41 --1761 --
NM_004484chrX3303 72 50 ----1324
NM_004487chr341241 401 195 92 ------
NM_004492chr15----1241 1230
NM_004494chr191068 1038 1016 970 813 492 341 273 97 11185 ----
NM_004496chr1471162 1101 857 317 306 240 150 --1289 --
NM_004497chr193683 606 71 ------
NM_004498chr151349 ------
NM_004499chr51394 196 ----
NM_004501chr163587 1622 1549 1249 1148 845 33304 3131 1002 ----
NM_004504chr2102843 2823 2672 2641 2136 2005 1924 1060 498 184 1726 --1503
NM_004505chr1742028 669 427 355 --21383 550 --
NM_004514chr1762085 1165 1134 810 585 515 --1438 --
NM_004515chr1--3355 231 23 ----
NM_004516chr19149 ------
NM_004519chr82191 161 ------
NM_004525chr221315 617 2983 412 ----
NM_004527chr1741065 204 116 82 --1481 --
NM_004529chr931147 1032 551 ------
NM_004535chr20--11781 11725 --
NM_004537chr1241231 1087 1035 48 --11091 --
NM_004550chr12139 42 ------
NM_004561chr113687 628 533 1336 21847 1629 --
NM_004566chr1072535 1016 968 937 852 627 93 1254 1791 --
NM_004569chr143531 195 33 ------
NM_004571chr2162725 2636 2315 2216 1372 155 --12210 12648
NM_004573chr153812 94 47 2666 232 --1779
NM_004574chr17141 ------
NM_004575chr451258 1198 578 265 33 --135 --
NM_004578chr12924 240 ------
NM_004583chr173490 258 250 --1183 1268
NM_004586chrX105136 3662 2144 1850 1241 1106 848 670 499 194 14434 24453 152 --
NM_004588chr11113904 3672 3607 3244 3177 3093 2799 2642 917 834 182 23101 3071 1405 23613 2735
NM_004598chr563024 2784 2677 2559 2500 1049 32942 556 53 31054 270 266 11181
NM_004600chr161554 1375 1043 578 542 228 ------
NM_004602chr202559 371 1481 ----
NM_004603chr72342 137 --21100 303 --
NM_004606chrX262 32 ------
NM_004612chr984807 4576 4042 3517 1355 442 212 112 21523 668 2827 192 --
NM_004615chrX2723 179 ------
NM_004619chr162042 2008 1560 638 118 31 ----11750
NM_004620chr114563 179 148 50 --152 --
NM_004630chr1171045 958 892 371 350 251 242 --21038 946 --
NM_004631chr141255 1066 1023 899 ------
NM_004634chr33596 576 570 ------
NM_004637chr371206 1154 1116 990 891 441 83 ----11241
NM_004639chr6198 --123 --
NM_004643chr144726 636 569 535 ------
NM_004645chr173744 537 282 ------
NM_004651chrX2358 268 ------
NM_004654chrY262 23 1894 2479 475 --
NM_004655chr1721206 990 1303 1992 --
NM_004656chr37955 938 393 285 247 154 61 ------
NM_004660chrY21574 233 ------
NM_004663chr1531279 1243 1167 ------
NM_004666chr621228 216 11317 ----
NM_004673chr151492 1155 1142 517 476 ------
NM_004674chr83476 163 31 ------
NM_004684chr4128 ------
NM_004685chr1311110 --1318 --
NM_004686chr851779 567 438 349 308 --11717 --
NM_004687chr1772003 1457 1384 539 516 273 53 11483 ----
NM_004690chr62654 608 1136 ----
NM_004694chr173776 705 238 ------
NM_004696chr12837 794 ------
NM_004697chr92789 55 1870 11060 --
NM_004703chr1752259 2081 527 293 281 --11761 --
NM_004705chr113220 189 24 1626 ----
NM_004709chrX4491 231 225 219 ------
NM_004714chr191361 ------
NM_004716chr116919 800 741 712 329 35 ----1136
NM_004723chr131032 923 857 --1236 --
NM_004725chr1051423 1074 521 476 349 11269 11076 1176
NM_004726chrX115516 4091 4003 3542 2223 1737 1677 1500 735 442 52 34435 4302 3806 ----
NM_004731chr1251425 1325 1280 283 135 ------
NM_004732chr17----1240 --
NM_004733chr31605 --1154 --
NM_004734chr1342956 2279 2156 652 22706 2586 12283 --
NM_004736chr161857 1417 1402 129 82 53 2828 38 2457 55 --
NM_004739chr112458 70 1439 1537 1480
NM_004742chr351319 1256 620 360 327 --1185 1623
NM_004744chr452973 1333 707 624 179 13686 13591 --
NM_004745chr8176920 6599 6495 6255 6177 5734 5638 4904 4868 4294 2243 2017 1479 1290 588 41 21 22021 831 14513 --
NM_004747chr102619 306 --1267 --
NM_004748chr1593934 3719 3570 3464 1331 1241 851 632 300 24216 2905 11245 --
NM_004760chr731641 770 310 --12431 --
NM_004762chr1721679 1276 11785 1230 --
NM_004764chr123205 163 93 ------
NM_004766chr31197 1100 ----
NM_004772chr561362 1350 1274 505 357 280 ------
NM_004774chr1773177 2846 2744 2686 2153 896 215 --1985 --
NM_004775chr1851975 817 680 609 164 1657 ----
NM_004779chr56914 510 490 215 91 72 --2529 496 --
NM_004781chr11389 21110 1086 --1246
NM_004781chr11389 21110 1086 --1246
NM_004783chr162483 149 ------
NM_004784chr41125 ------
NM_004785chr162441 429 --1491 --
NM_004787chr4146 ------
NM_004788chr11102707 2059 1929 1911 1694 914 354 286 94 73 32205 1818 296 ----
NM_004794chrX151 ------
NM_004796chr1462450 2251 2204 2197 1657 329 1765 ----
NM_004798chr20123532 3428 3109 2978 2551 927 715 689 627 315 288 44 --43411 378 331 304 --
NM_004801chr221443 1053 11571 41445 591 419 80 --
NM_004805chr231004 228 58 --1910 --
NM_004815chr194428 4376 4359 3887 3241 1568 1293 856 282 24853 4100 ----
NM_004818chr123483 227 81 --1247 --
NM_004821chr56655 612 592 584 558 321 --2626 617 --
NM_004822chr17123907 3830 3702 3405 2785 1601 1390 1334 924 540 283 103 --33912 1497 526 12788
NM_004824chr651147 1017 393 383 204 ------
NM_004831chr194751 723 328 168 --3783 757 753 1812
NM_004834chr273417 2987 2730 2702 2687 2529 305 --43071 3045 307 152 --
NM_004835chr3--1685 2765 174 --
NM_004835chr3--1685 2765 174 --
NM_004836chr22956 724 155 ----
NM_004839chr151500 ------
NM_004840chrX72379 2359 2164 820 517 142 86 --2580 470 12387
NM_004841chr141149 801 715 321 11030 2976 878 --
NM_004849chr631350 1338 656 2524 359 2508 194 --
NM_004850chr23244 105 47 1704 ----
NM_004855chr151214 ------
NM_004856chr153570 159 78 ------
NM_004857chr1453663 1199 1027 910 364 34046 3426 602 11918 --
NM_004859chr174766 262 252 126 ------
NM_004863chr14105317 4593 4014 3679 3628 1306 715 670 650 438 2945 935 43924 3339 3321 189 23633 1249
NM_004866chr574520 3543 3533 1894 1007 152 114 13922 ----
NM_004867chrX2596 482 ------
NM_004869chr1841712 1212 158 40 ------
NM_004871chr17104320 4236 3732 3584 3460 3386 1771 845 466 429 --24217 3914 --
NM_004872chr11300 ------
NM_004874chr8----2473 120 --
NM_004884chr1531570 573 225 11521 ----
NM_004887chr531001 885 295 11135 31003 297 118 --
NM_004888chr961084 935 831 387 300 131 1251 1939 --
NM_004891chr21213 ------
NM_004893chr52166 99 ------
NM_004896chr1041423 341 206 127 1255 ----
NM_004897chr102931 833 2792 266 ----
NM_004898chr4112916 2743 2626 2588 2281 2081 1996 1158 694 648 627 --22294 650 --
NM_004899chr23459 301 151 --1396 --
NM_004902chr204625 289 122 42 ------
NM_004904chr7146003 5955 5689 5588 5471 5052 4513 4409 2580 1572 1436 1262 661 489 46530 4723 4467 2358 36359 2097 57 12446
NM_004907chr194965 304 293 239 ------
NM_004915chr213849 800 320 1818 --1199
NM_004922chr103901 662 226 1419 1144 --
NM_004926chr1491784 1506 1493 1316 680 558 515 212 128 11773 ----
NM_004930chr14590 273 91 79 --152 --
NM_004932chr531477 662 530 ------
NM_004934chr5137 ------
NM_004938chr951043 996 447 98 70 1308 ----
NM_004947chr392597 2587 1999 1720 722 552 426 275 246 --3846 255 250 1872
NM_004952chr15847 721 668 302 161 --1691 --
NM_004955chr61119 --2604 58 --
NM_004956chr784248 3567 3144 3041 3017 887 137 40 13496 13148 --
NM_004960chr162239 76 ------
NM_004961chrX41252 342 245 115 --1570 --
NM_004962chr10258 47 1712 ----
NM_004964chr16522 433 204 177 49 26 ------
NM_004965chr21--1502 144 --
NM_004966chr101900 ------
NM_004969chr10150 1445 ----
NM_004973chr621599 1332 1589 ----
NM_004976chr11104192 3692 3566 1735 1502 1482 1355 910 566 55 --23173 1508 --
NM_004977chr192567 76 ------
NM_004978chr161482 1282 476 418 385 179 --3508 221 46 --
NM_004979chrX61073 387 208 187 103 52 --21051 830 --
NM_004981chr222427 112 --1153 --
NM_004985chr12104322 4203 1800 710 664 554 464 415 175 105 23936 293 ----
NM_004992chrX417886 7796 7659 7522 7405 7007 6976 6806 6784 6535 6416 6374 6312 6007 5924 5871 5706 5698 5669 5318 3373 3125 3097 3004 2619 2567 2522 2455 2291 2235 1830 1567 1508 1304 1264 1257 1227 1203 945 934 340 12434 76987 6983 6167 5720 3076 1799 1273 11291
NM_004992chrX417886 7796 7659 7522 7405 7007 6976 6806 6784 6535 6416 6374 6312 6007 5924 5871 5706 5698 5669 5318 3373 3125 3097 3004 2619 2567 2522 2455 2291 2235 1830 1567 1508 1304 1264 1257 1227 1203 945 934 340 12434 76987 6983 6167 5720 3076 1799 1273 11291
NM_004993chr143438 180 36 --1460 --
NM_004995chr143483 237 194 ------
NM_004996chr1681631 1379 1285 1188 1079 596 493 297 11791 ----
NM_004998chr153953 647 134 1919 ----
NM_005010chr742032 650 280 229 1643 ----
NM_005011chr721363 255 ------
NM_005012chr11123 ------
NM_005016chr12----131 --
NM_005017chr3----133 --
NM_005020chr75564 530 178 160 63 --3532 85 76 --
NM_005021chr61106 ------
NM_005022chr17151 --153 --
NM_005026chr152020 1444 791 549 274 --1328 --
NM_005028chr1022250 2034 ------
NM_005030chr161268 --1270 --
NM_005032chrX3720 398 188 ------
NM_005040chr112179 30 --189 --
NM_005044chrX94429 4273 4209 4136 3810 3724 3264 762 94 1638 --14057
NM_005045chr75886 728 153 128 29 ------
NM_005055chr11248 26 ------
NM_005056chr12125579 5012 4941 4902 4183 2027 1980 1789 1638 1444 450 388 25031 1816 45018 1584 703 194 --
NM_005063chr1093432 3089 2678 1197 1134 991 960 671 265 12682 52451 954 675 385 340 --
NM_005065chr1495116 4882 4809 4080 2000 1901 1855 689 311 33725 2139 898 32029 1644 971 14875
NM_005068chr631299 1146 531 21485 468 ----
NM_005077chr92407 365 --1339 --
NM_005078chr1561450 1170 1153 1144 501 327 ------
NM_005079chr843119 1216 369 306 ----12373
NM_005080chr227943 914 830 740 352 277 230 ------
NM_005087chr32860 784 ------
NM_005093chr20155099 5091 4689 4513 4451 4440 4115 3299 3238 1885 1812 1450 1332 1300 1162 11260 34748 3324 245 --
NM_005094chr93184 173 163 ------
NM_005095chr161839 1552 1372 805 663 642 11698 ----
NM_005096chrX121250 1080 1018 856 448 438 415 347 286 168 142 119 ------
NM_005097chr101106 181 ----
NM_005099chr11171 --2515 25 --
NM_005105chr142062 1980 1910 370 --41532 770 694 178 --
NM_005109chr382526 2111 1968 1786 975 363 247 141 12356 22042 619 12231
NM_005110chr52144 34 --1528 --
NM_005112chr41774 --1858 --
NM_005114chr4----1437 132
NM_005116chr20104315 4190 2898 1470 1337 1002 683 405 373 320 --34354 4100 967 1343
NM_005119chr121206 1093 1322 ----
NM_005120chrX2226 47 --149 --
NM_005121chr1763257 3016 2997 2594 2387 1521 1510 32736 1529 531 --
NM_005124chr62131 113 --1138 --
NM_005126chr332208 1587 1535 11925 1690 --
NM_005128chr213702 639 511 ------
NM_005133chr111363 ------
NM_005134chr185761 351 310 273 266 --2107 26 --
NM_005135chr1563639 3448 1076 1002 754 582 12406 ----
NM_005146chr112428 68 --1218 --
NM_005151chr1851739 899 562 297 286 11774 12401 --
NM_005154chr151536 ------
NM_005156chr964471 4319 3794 1928 1149 958 25355 4104 44743 4075 3796 3369 --
NM_005157chr941582 1481 716 602 --31747 406 200 --
NM_005160chr22156648 6095 5877 5381 5040 4914 4363 4270 2569 2277 1972 1746 1111 882 473 14750 35685 2636 2571 --
NM_005161chr11112120 1508 1378 795 772 496 480 430 342 160 61 21591 565 72203 1563 1455 804 376 372 364 --
NM_005168chr221615 1371 1499 1585 --
NM_005171chr121868 156 ----
NM_005180chr1031549 1217 113 175 ----
NM_005181chr82654 70 ----1236
NM_005182chr162508 86 ------
NM_005184chr1991380 1157 1146 1120 348 245 232 213 172 --1179 --
NM_005186chr112560 508 --2477 104 --
NM_005188chr11347986 7867 7689 7533 7364 7128 7027 6897 6651 5489 5457 5446 5438 3139 3079 2924 2902 2855 2831 2726 2309 1754 1683 1641 1621 1381 1368 1289 1226 1142 1046 615 602 345 23146 1003 127869 6809 6455 5971 5744 5585 5550 2463 1370 1362 641 631 37196 5789 2741
NM_005189chr1752415 1622 876 319 40 --22325 2146 12395
NM_005190chr6--11128 ----
NM_005197chr14206195 5470 5376 5081 4946 4806 4530 4409 4378 4172 4081 2452 2237 1492 1483 1458 305 170 139 128 1906 45277 1736 1584 1469 --
NM_005202chr1112263 1968 1800 1645 900 886 626 479 348 199 145 --1892 --
NM_005203chr101163 ------
NM_005206chr172930 901 --1412 --
NM_005207chr2263381 3081 2415 1273 290 117 13555 23166 645 --
NM_005215chr181509 --1172 --
NM_005219chr561395 1120 489 466 364 129 1353 21661 584 --
NM_005220chr1761464 1450 1128 961 315 112 21269 324 1132 --
NM_005222chr77961 760 629 269 246 218 184 --5230 212 204 192 173 1223
NM_005229chrX41037 1012 929 29 1881 1398 --
NM_005233chr33969 829 587 --1971 --
NM_005235chr2207584 7572 7023 6817 6736 6465 6186 5765 5511 5472 5364 3037 2445 742 537 356 346 334 79 66 11913 47616 5564 2807 1585 25518 2605
NM_005238chr1192961 2868 2481 2433 2348 1253 1040 250 40 --22576 1397 --
NM_005240chr13802 666 575 --1561 --
NM_005241chr351351 1314 981 881 296 ----1986
NM_005252chr143309 198 84 ------
NM_005254chr1521085 872 ------
NM_005256chr11--1841 ----
NM_005257chr1831190 1174 350 --21268 883 --
NM_005259chr2--129 ----
NM_005263chr16960 495 371 323 106 98 ------
NM_005264chr104948 160 144 61 1879 ----
NM_005268chr11223 ------
NM_005269chr122179 57 139 ----
NM_005271chr10121 --192 --
NM_005277chr441692 1601 1286 639 2614 22 11417 --
NM_005281chr13655 301 70 ------
NM_005291chr23765 330 74 --1303 --
NM_005296chrX11031 152 ----
NM_005302chr72303 77 ------
NM_005311chr731792 624 602 12207 32617 1907 409 --
NM_005312chr9112658 2579 2140 1862 1026 963 545 533 526 311 171 --21818 182 --
NM_005313chr153934 392 38 11126 ----
NM_005316chr11--1440 ----
NM_005318chr2241162 858 170 106 ------
NM_005324chr1762039 1897 1586 1455 461 232 ------
NM_005328chr82590 248 ------
NM_005329chr1622241 934 11664 32067 1718 1577 --
NM_005336chr2132169 2151 2027 2000 1797 1735 1728 1457 844 404 341 120 113 --1905 12003
NM_005339chr474142 3256 1594 1428 1164 1120 41 1467 --11616
NM_005342chrX32851 1105 957 ------
NM_005346chr62255 112 174 ----
NM_005347chr931701 1649 537 ------
NM_005348chr142940 796 ------
NM_005349chr42567 486 ------
NM_005354chr192533 252 --1535 --
NM_005358chr1331673 673 494 1316 2694 505 --
NM_005359chr18156471 6356 6195 5346 5101 4830 4553 4374 4366 4304 4165 2084 1394 828 183 12496 36523 6025 4483 --
NM_005370chr1931165 1150 223 1862 ----
NM_005375chr64901 804 332 164 ------
NM_005376chr121082 240 21124 1032 ----
NM_005378chr21758 1745 1326 --
NM_005381chr2185 1282 ----
NM_005385chr322150 545 32575 2505 123 22141 1071 12108
NM_005386chr203696 587 197 --1589 --
NM_005388chr951666 1601 1434 1342 557 ------
NM_005389chr62673 24 ------
NM_005392chr981669 1361 1188 1179 559 488 114 24 --11190 --
NM_005397chr7113639 3597 3527 3392 2884 1124 1055 913 585 553 431 ------
NM_005398chr10----2482 263 --
NM_005399chr193999 1752 1584 1447 1327 1098 1066 901 577 23105 335 12799 --
NM_005400chr2102970 2802 2673 2650 2360 2257 2247 960 452 414 1726 22974 2667 12363
NM_005402chr751866 1743 1371 332 279 --21745 21 --
NM_005406chr182329 60 ------
NM_005407chr1461579 1283 1275 314 248 201 31533 1211 458 2423 289 --
NM_005409chr42367 197 --11099 --
NM_005410chr51591 ------
NM_005412chr125494 223 180 144 47 ----182
NM_005413chr25366 89 80 51 31 1343 ----
NM_005415chr22746 233 1543 1235 --
NM_005417chr2041720 649 419 367 --1137 --
NM_005429chr4----1125 --
NM_005430chr125996 947 897 383 149 --2820 655 --
NM_005433chr1862751 2569 2192 527 307 91 12168 1311 --
NM_005436chr1083475 3118 2807 2667 1636 868 655 73 1555 13834 --
NM_005438chr112112 57 1610 ----
NM_005439chr127507 495 388 182 169 156 72 --1186 --
NM_005440chr1793282 3265 3233 2790 2485 2410 391 383 76 11307 33091 2935 644 --
NM_005442chr33432 104 72 ------
NM_005443chr45582 552 496 465 124 1106 1469 --
NM_005445chr10------1269
NM_005450chr171160 ------
NM_005455chr151670 1612 1509 741 223 1383 1745 --
NM_005456chr113737 670 489 ------
NM_005458chr972231 1944 1799 1788 1669 462 247 --1533 --
NM_005460chr52431 75 1587 ----
NM_005461chr2031476 1269 355 11989 ----
NM_005465chr151632 819 794 147 103 21870 410 22043 823 --
NM_005466chr141493 --1495 1100
NM_005471chr531093 1056 51 --1406 --
NM_005474chr17111270 1262 1228 1123 1117 1049 517 422 270 248 212 --31233 567 525 --
NM_005475chr1272993 2608 2049 2030 812 203 149 23027 378 42754 2496 88 84 2986 781
NM_005476chr961442 392 198 165 152 27 1210 --21010 299
NM_005479chr1021206 302 ------
NM_005487chr2251909 1782 1568 1483 482 --22023 1636 --
NM_005493chr62780 624 1136 1309 --
NM_005494chr71663 ------
NM_005501chr1731123 394 172 150 21169 45 --
NM_005502chr932803 2423 2178 --152 13022
NM_005504chr12225977 5804 5637 5393 5366 5223 4984 4866 4374 4368 2444 2401 1765 1682 1625 1544 1277 617 548 487 418 267 15819 54289 4285 4273 1686 779 --
NM_005507chr113332 202 169 --176 --
NM_005509chr53399 324 103 ------
NM_005512chr1131521 1299 167 --31525 746 132 --
NM_005513chr351464 604 567 168 87 11254 2203 26 --
NM_005517chr15556 459 360 249 225 --11326 --
NM_005520chr51724 ------
NM_005522chr751371 1033 286 105 84 155 --1114
NM_005523chr751336 1296 1027 595 484 ------
NM_005524chr32325 50 ------
NM_005530chr1571468 1447 1195 1185 1171 993 484 --11178 --
NM_005537chr132783 131 ------
NM_005539chr1041054 558 500 347 ------
NM_005541chr211024 2997 104 21189 1060 --
NM_005542chr721708 194 ------
NM_005544chr23914 788 118 11019 ----
NM_005546chr562222 1789 1752 1588 802 550 31855 1595 317 1246 --
NM_005552chr142168 86 1580 ----
NM_005561chr1331002 368 86 --147 --
NM_005562chr141467 1456 503 191 1424 1678 11338
NM_005563chr15836 671 620 340 23 1218 1838 139
NM_005565chr53530 194 133 --1135 --
NM_005566chr111433 ------
NM_005570chr1821039 474 1446 ----
NM_005573chr54599 143 99 70 ------
NM_005575chr52702 604 ------
NM_005578chr3145031 4966 4832 4774 4761 4368 3777 2062 1919 1602 1446 1147 995 363 14814 34804 4790 4786 14826
NM_005581chr193104 97 90 --2134 130 --
NM_005584chr134573 229 110 38 1245 ----
NM_005587chr151275 ------
NM_005594chr12197 ------
NM_005595chr12877 286 --1304 --
NM_005596chr974931 4776 2462 1800 1784 1442 88 36420 3948 421 24914 90 --
NM_005599chr121219 997 11274 31311 531 527 --
NM_005602chr341144 960 852 838 ------
NM_005604chr63580 410 62 --1706 --
NM_005607chr83881 147 56 --1867 --
NM_005610chr11618 1289 ----
NM_005611chr163920 158 82 ------
NM_005625chr851060 1003 786 83 45 --2341 49 2243 121
NM_005626chr11150 1421 1182 --
NM_005627chr62941 212 1396 ----
NM_005637chr1831873 697 90 ------
NM_005638chrX51519 1418 1298 506 76 11559 11659 --
NM_005639chr1241554 1494 213 84 2531 337 ----
NM_005644chr12357 347 ------
NM_005647chrX103225 1143 841 821 770 763 671 638 599 545 23068 528 1867 12909
NM_005650chr221170 ------
NM_005652chr1631166 1108 73 --11027 --
NM_005653chr12----137 --
NM_005655chr841182 883 507 488 ------
NM_005656chr2141462 1153 305 291 --11467 11482
NM_005659chr221365 1393 1386 --
NM_005660chrX144 ------
NM_005662chr81116 ------
NM_005665chr143108 1831 1473 602 31610 1512 1489 24788 3861 11476
NM_005667chr21343 ------
NM_005668chr523025 33 --1580 --
NM_005682chr1611271 ------
NM_005688chr311019 --21023 99 1406
NM_005707chr154438 388 317 41 --1140 1441
NM_005708chr132375 61 ------
NM_005711chr531046 261 29 1672 1311 --
NM_005715chr662733 2617 802 705 265 212 --11967 --
NM_005717chr12848 224 1391 1118 --
NM_005721chr22255 53 ------
NM_005722chr23456 47 39 2527 287 ----
NM_005724chr152182 175 ------
NM_005725chr152065 1873 1589 668 524 32429 1919 440 --1643
NM_005730chr12143669 3457 3062 2949 2937 1237 1180 1151 1083 1071 505 421 325 45 23259 796 41135 683 494 423 12209
NM_005731chr2--1428 ----
NM_005734chr113709 642 282 1205 ----
NM_005736chr1031538 987 59 ------
NM_005737chr2122895 2859 2808 2691 2371 2253 1987 1832 1794 787 715 383 ----12864
NM_005738chr731909 658 546 1185 ----
NM_005739chr1571881 1805 1736 866 452 325 284 2363 53 2534 490 --
NM_005740chr225613 340 297 136 40 --1325 --
NM_005742chr21605 1684 ----
NM_005746chr742335 2225 426 127 ----12530
NM_005748chr1273380 3336 3243 3116 2321 2221 1254 11000 --22980 2915
NM_005751chr7145 ------
NM_005754chr55804 489 468 268 172 --1179 --
NM_005756chrX11030 11290 ----
NM_005759chr2114168 3893 3023 1900 1721 938 532 452 326 187 46 23403 3289 23591 445 --
NM_005766chr1341223 369 281 52 31160 508 354 256 38 11171
NM_005776chr14--1275 ----
NM_005779chr593423 3039 2418 1265 853 847 775 729 432 ------
NM_005786chr185988 973 962 887 425 --2889 91 1833
NM_005789chr17152173 2165 2064 1914 1895 1516 1509 1494 1419 1337 1324 732 439 343 204 11662 21947 465 --
NM_005795chr242464 818 760 575 12589 12120 --
NM_005796chr16248 33 ------
NM_005801chr173612 62 38 ------
NM_005802chr92527 108 2787 631 ----
NM_005807chr11208 ------
NM_005808chr353572 2879 991 344 302 13166 43576 2711 1160 948 1388
NM_005813chr241929 996 688 303 12461 1586 --
NM_005814chr171243 934 526 454 129 69 57 ----177
NM_005819chr1113435 3147 3065 2935 2639 2480 2316 1213 810 389 286 --11361 12624
NM_005822chr611829 12168 21695 119 --
NM_005826chr11172 ------
NM_005828chr17205018 4749 4278 4237 4150 3908 3880 3778 3754 3729 3668 1967 1789 1678 1504 1395 1100 582 240 45 24989 4975 74587 3529 2027 722 637 575 242 --
NM_005832chr331271 977 252 1470 ----
NM_005839chr12803 373 1381 ----
NM_005840chrX227484 7450 6471 6459 6273 4738 3057 2892 2263 2097 1435 1295 720 588 570 528 485 479 461 442 395 179 24806 1353 76049 4699 2686 921 619 600 582 --
NM_005841chr42927 112 2459 296 3736 732 157 --
NM_005842chr13145 ------
NM_005851chr113316 281 104 ------
NM_005852chr1771078 1065 1043 262 195 176 92 --31171 1167 274 --
NM_005857chr141437 1214 1155 567 11361 41443 1439 576 369 --
NM_005859chr541528 1487 1353 187 1303 ----
NM_005862chr31390 ------
NM_005864chr144581 280 116 110 --3682 127 118 --
NM_005870chr1341295 1043 190 64 ------
NM_005871chr101671 21022 281 ----
NM_005875chr31407 ------
NM_005876chr21748 --1700 --
NM_005880chr1641644 1232 246 37 ------
NM_005882chr42688 268 --2355 65 --
NM_005885chr52453 28 1608 ----
NM_005895chr1264037 3233 2820 2642 1086 998 11601 32824 1073 1069 --
NM_005898chr1142581 2128 953 97 22886 163 ----
NM_005899chr174973 548 522 303 1581 ----
NM_005900chr421119 438 ------
NM_005901chr18178492 7401 6832 6603 6127 5579 5333 3454 3217 2710 2364 1502 1086 938 725 528 399 68694 7200 7165 2979 1682 160 36131 2452 2226 --
NM_005902chr15144613 4595 4253 3708 2917 2890 2865 1682 1428 1273 1079 479 332 112 23282 1568 23023 2892 --
NM_005903chr584793 3556 3499 3461 3353 1962 669 404 13998 23842 1976 14685
NM_005904chr1841043 978 141 72 ------
NM_005907chr641661 1626 439 349 ------
NM_005909chr5124258 4035 3973 3519 3464 3283 2924 2913 2710 1706 1185 1175 24012 2807 43254 2926 2829 1292 --
NM_005910chr17114062 3685 3547 3004 1506 1249 1124 865 314 283 209 --11531 13047
NM_005911chr261416 1031 995 482 342 93 ----184
NM_005917chr21135 ------
NM_005920chr1153791 3706 3594 3317 3051 2715 2512 2419 2373 1266 1177 834 230 102 66 --22900 106 12756
NM_005922chr61103 ----1317
NM_005923chr6160 1170 ----
NM_005924chr71981 1838 ----
NM_005927chr571168 922 489 467 313 200 174 1414 ----
NM_005928chr154704 155 35 27 ------
NM_005933chr11112795 2759 2352 2244 2227 1864 767 757 728 378 222 --42479 2420 1946 675 --
NM_005934chr1952347 2016 1825 1787 942 --72578 2447 2078 1967 1829 366 146 --
NM_005935chr495185 4810 4070 3998 3823 2098 2090 881 562 53699 1588 1564 1065 800 25278 3267 1236
NM_005937chr17103858 3669 3598 2622 2584 1112 1106 1043 463 200 24022 3320 1675 23962 3928
NM_005938chrX51347 1288 1260 1087 275 --11079 --
NM_005941chr8123876 3761 3594 2944 1313 892 859 352 253 229 128 22 31647 329 84 2824 255 --
NM_005943chr651396 1358 1322 1119 193 --11153 --
NM_005955chr1225092 4978 4964 4837 4562 4340 4056 3964 3871 3655 3490 3398 2177 2165 2154 1849 1487 1199 905 812 769 124 15106 31489 886 759 1422
NM_005962chr1062271 2255 1798 1773 636 324 --1389 --
NM_005962chr1062271 2255 1798 1773 636 324 --1389 --
NM_005964chr1741051 1041 998 494 --1101 --
NM_005966chr252404 2044 1976 1871 1578 11710 --11662
NM_005967chr123687 556 113 --1103 --
NM_005969chr115988 475 342 226 219 1801 ----
NM_005977chr131321 ------
NM_005986chr1352691 2558 1784 1104 173 12010 42081 1797 731 377 --
NM_005996chr1281357 1234 1129 1107 1048 625 374 175 11199 1103 --
NM_005997chr12122 28 --132 --
NM_005998chr1154 ------
NM_006003chr19276 29 ------
NM_006007chr944469 3330 1591 950 1992 1516 --
NM_006011chr15164047 3968 3926 3825 3701 3677 3588 3184 2963 2873 2833 2797 1315 1198 1141 38 13431 44157 3191 3018 2840 21211 1029
NM_006015chr131256 354 166 11117 1199 --
NM_006024chr72785 122 1708 ----
NM_006030chr351692 1631 1392 517 54 --2327 243 --
NM_006032chr141188 1208 ----
NM_006035chr1421195 313 ----1410
NM_006036chr241918 1819 426 295 12393 1579 --
NM_006037chr2114730 4108 4095 3561 3402 3125 1683 1646 1597 779 68 24574 3656 64840 3760 3525 1829 1650 151 --
NM_006038chr2082219 1824 1613 1455 1400 863 319 48 11930 1712 1518
NM_006039chr173951 419 308 --31048 361 223 --
NM_006040chr1631244 1067 566 ------
NM_006047chr2052752 2743 2516 1201 918 2530 70 ----
NM_006048chr151204 1191 1114 497 186 --1435 --
NM_006051chr52210 101 --1212 --
NM_006054chr1141436 486 340 149 --1451 --
NM_006060chr7134288 3885 3774 3620 3244 3124 2954 999 957 893 781 301 67 23532 289 23313 3309 1240
NM_006062chr271150 1078 937 317 235 108 58 --21152 1080 --
NM_006064chrX--143 1306 --
NM_006068chr41280 ------
NM_006070chr3--1269 ----
NM_006079chr64299 288 185 44 ------
NM_006080chr73772 608 286 32751 256 189 1931 1172
NM_006089chrX51819 574 444 221 166 ------
NM_006090chr1--1514 ----
NM_006091chr1591746 1626 1401 1395 1292 633 563 493 224 --31628 1388 554 --
NM_006095chr484030 3668 1654 1522 913 726 635 274 --21786 474 --
NM_006106chr11113021 2895 2714 2630 2504 2395 1003 873 558 420 153 12845 13474 --
NM_006107chr171470 ------
NM_006108chr1152043 1702 785 217 168 2881 461 1157 --
NM_006113chr151890 675 433 316 269 11921 11714 --
NM_006134chr2131560 1115 26 --11343 --
NM_006135chr151093 1042 1027 491 393 31253 966 327 ----
NM_006136chr751171 920 540 467 222 1864 21173 235 --
NM_006139chr252421 2149 558 315 197 11906 2688 321 --
NM_006141chr1621088 266 32764 1081 309 --12452
NM_006142chr13471 176 87 ------
NM_006143chr12194 ------
NM_006145chr19137 ----166
NM_006147chr14495 475 448 21 --1407 --
NM_006148chr17142953 2648 2266 2211 2069 1952 960 778 766 506 435 212 137 129 --42903 1956 717 157 --
NM_006153chr31213 ------
NM_006154chr1532388 631 105 --2822 744 --
NM_006156chr141258 ------
NM_006158chr841581 570 210 170 1735 11326 --
NM_006159chr121564 ------
NM_006160chr174633 465 326 208 --21575 23 --
NM_006161chr53249 235 26 --1237 --
NM_006166chr1242550 917 789 129 12604 ----
NM_006167chr862027 1966 1682 941 887 43 ------
NM_006176chr115686 599 299 272 234 --1277 --
NM_006177chr143746 689 99 ------
NM_006178chr1761395 1377 1057 1037 616 231 1405 31497 257 160 --
NM_006180chr981588 779 283 220 212 193 166 27 --2794 308 --
NM_006185chr114552 477 180 87 ------
NM_006186chr211259 1189 ----
NM_006187chr1233000 2720 2173 --3917 398 375 --
NM_006191chr124853 641 154 47 1291 1715 --
NM_006195chr951397 953 514 437 403 --11265 11364
NM_006196chr2----132 --
NM_006197chr82499 456 --1223 --
NM_006198chr211246 ------
NM_006201chrX2819 79 --31097 852 439 --
NM_006202chr19121830 1647 1567 1531 1400 796 618 461 409 375 348 161 ------
NM_006203chr5135118 4839 3981 3919 3791 3741 3655 1969 1961 1704 1617 908 504 21177 1110 ----
NM_006206chr442426 2085 406 25 12481 --12474
NM_006212chr1115006 4497 4165 1428 989 759 600 484 459 428 101 25265 3509 4658 650 646 641 --
NM_006216chr22108 62 --164 --
NM_006224chr1782522 2322 2137 2121 923 870 704 431 11751 32139 1915 1616 --
NM_006226chr2169 21389 1278 ----
NM_006228chr82314 177 --1119 --
NM_006237chr1372303 2112 1893 1422 736 164 129 --32144 142 66 --
NM_006238chr6132032 1862 1820 1783 1684 1419 761 286 264 235 221 197 180 --3340 309 269 --
NM_006241chr372425 2252 2175 1525 902 831 68 ----1823
NM_006242chr2031722 1592 591 ------
NM_006243chr14895 762 735 314 1426 ----
NM_006245chr63860 832 342 ------
NM_006246chr143518 445 390 ------
NM_006251chr553349 3184 613 482 453 ------
NM_006252chr197460 6544 6427 6174 5537 5440 2691 2640 2459 67498 6365 6110 4806 1671 386 1791 --
NM_006254chr31158 ------
NM_006255chr143397 80 66 1348 ----
NM_006256chr152267 1809 1712 648 164 12396 12381 --
NM_006258chr1031165 599 244 --1432 --
NM_006264chr42481 142 ------
NM_006265chr841036 467 441 127 --1131 --
NM_006267chr261176 750 659 611 601 349 --31841 583 579 11616
NM_006268chr1151172 1104 867 390 76 --2977 82 --
NM_006275chr2041727 1667 838 62 12000 32484 2381 196 143
NM_006277chr22178 140 ------
NM_006278chr11--1583 ----
NM_006279chr11934 --1570 --
NM_006282chr2084727 4685 4638 3424 1537 1518 743 341 14731 34719 3392 1262 14251
NM_006292chr11153 2177 36 ----
NM_006293chr154837 753 662 174 ------
NM_006298chr662727 2068 993 843 561 361 1493 12986 --
NM_006301chr12----1237 --
NM_006306chrX145914 5881 4988 4976 4936 4779 4699 4610 4553 1527 908 893 738 81 24728 3965 24364 265 34784 4582 1534
NM_006307chrX1133 ------
NM_006310chr1741277 366 271 100 --21157 884 --
NM_006313chr121295 --136 --
NM_006315chr4133369 2746 1650 1506 1446 1375 1249 999 856 619 482 324 297 1844 14218 1421
NM_006317chr52785 604 ------
NM_006320chr451121 326 301 285 56 --5313 309 305 293 289 --
NM_006321chr351647 1626 662 501 86 --21860 1630 --
NM_006322chr133827 820 109 2296 287 ----
NM_006327chr101264 ------
NM_006328chr112136 95 1426 197 --
NM_006334chr91313 ------
NM_006335chr12882 390 ------
NM_006336chr961239 1231 402 273 147 86 --11424 --
NM_006343chr2192 1484 ----
NM_006345chr4171 11094 2491 328 --
NM_006347chr1128 --134 --
NM_006348chr74323 270 234 195 1127 1381 --
NM_006350chr5143 ----1322
NM_006352chr182006 1946 1924 1879 1497 532 216 94 ------
NM_006354chr33262 137 62 --166 --
NM_006357chr21468 ------
NM_006359chrX82172 1604 832 679 488 407 307 192 --22025 1660 --
NM_006364chr142905 62 --1909 --
NM_006366chr641079 1008 863 187 ------
NM_006367chr121043 81 --1780 1700
NM_006369chr16400 356 309 127 103 97 --1131 --
NM_006371chr3134765 4637 3689 3614 3429 3217 593 572 512 212 170 98 25 24134 534 34116 773 615 1173
NM_006373chr1771241 1114 982 552 268 254 165 1534 1356 --
NM_006375chrX31744 464 219 --21481 228 --
NM_006378chr941339 1034 575 465 11072 21028 291 --
NM_006379chr741770 724 623 345 11967 1347 --
NM_006380chr1764278 3661 3560 2743 1228 405 12770 ----
NM_006386chr2281860 1510 790 544 296 285 98 74 11662 163 --
NM_006387chr1941153 1104 916 253 --2422 56 --
NM_006389chr1171217 894 538 435 398 175 40 1937 41060 501 408 114 --
NM_006390chr1241503 1298 363 155 11377 11488 --
NM_006393chr1094200 3979 3657 2971 1162 924 572 276 253 22932 351 43981 3222 865 117 --
NM_006401chr91341 --1163 --
NM_006405chr14----139 --
NM_006407chr321111 557 --11119 --
NM_006411chr63902 93 41 1336 ----
NM_006420chr2032768 2356 409 --1761 --
NM_006421chr831191 264 255 173 ----
NM_006422chr122178 21 --163 --
NM_006439chr41216 ------
NM_006449chr251943 1601 1527 1482 21 ------
NM_006451chr541104 1032 723 344 ------
NM_006454chr461944 1165 1077 872 553 188 11194 ----
NM_006457chr493870 3783 3162 3006 2777 1634 932 254 210 23590 2739 32665 346 342 --
NM_006459chr1041533 1310 577 529 1322 2569 455 1229
NM_006460chr175644 538 240 221 171 1625 ----
NM_006463chr23600 454 22 175 ----
NM_006464chr2114481 3859 3037 2989 2969 2863 1665 1383 1116 769 681 11372 53774 2942 1616 1605 1479 12918
NM_006465chr15122001 1978 1940 1908 800 776 598 508 481 421 391 269 --2852 842 --
NM_006471chr182219 98 ------
NM_006472chr12834 55 1129 11118 --
NM_006478chr22365 46 37 ------
NM_006483chr191361 ------
NM_006484chr191361 ------
NM_006488chr22210 59 ------
NM_006489chr1451745 1739 1729 1638 440 --11543 --
NM_006494chr192103 47 ------
NM_006496chr151891 1309 1246 778 566 11963 --1339
NM_006497chr173795 651 281 1775 2567 563 --
NM_006500chr1141285 371 129 25 ------
NM_006509chr192379 272 --1101 --
NM_006510chr66866 845 349 331 250 161 ----1414
NM_006517chrX72156 1540 625 598 580 39 28 1280 3590 586 214 --
NM_006519chr6----126 --
NM_006520chrX31730 455 58 1644 ----
NM_006521chrX41102 508 191 30 --1941 --
NM_006526chr2011596 11934 1714 --
NM_006527chr43730 243 149 ------
NM_006532chr1941997 1943 573 191 ------
NM_006534chr2083207 2805 2388 2331 2127 1172 559 207 --22390 2285 13213
NM_006537chr151402 1107 ----
NM_006540chr821543 24 ------
NM_006544chr1485344 5127 5077 2208 1519 1406 669 539 --15245 --
NM_006546chr17136620 6275 5956 5685 5215 5112 4561 4212 2513 1671 1556 419 332 35171 2441 470 86517 5939 5120 4644 4384 4349 4308 2150 --
NM_006547chr721807 1671 1319 ----
NM_006548chr331707 1489 46 --21517 1201 --
NM_006549chr12142940 2862 2661 2579 2561 2466 2441 2340 2308 2055 2039 1827 484 142 --22596 2563 12848
NM_006558chr81323 ------
NM_006559chr1----1133 --
NM_006560chr111204 ------
NM_006561chr10174921 4801 4337 4270 2472 2385 2363 2255 2237 2211 2009 1107 580 393 333 142 40 85190 4405 4387 4185 3944 2139 1899 352 34978 2442 1714 32368 1443 1112
NM_006565chr162523 359 1271 177 --
NM_006570chr95387 307 132 124 21 ------
NM_006572chr1752616 2187 605 309 123 1841 1743 --
NM_006577chr211227 ------
NM_006584chr17126 ------
NM_006587chr421141 654 --155 --
NM_006593chr27662 645 622 319 297 253 64 1241 2631 627 --
NM_006595chr1172063 1910 1904 1859 1351 578 433 ----11918
NM_006599chr16227915 7848 7576 7414 7181 6925 6754 6401 5729 5492 5151 3267 3224 2560 2435 1835 1757 1701 1676 1435 638 293 36583 818 280 88052 7567 7563 7291 5136 1777 1680 393 27397 5868
NM_006601chr122884 775 1862 ----
NM_006603chrX21739 758 ------
NM_006609chr272997 2386 2354 1950 1928 695 56 22892 514 ----
NM_006614chr3113674 3462 2922 2849 2677 2560 2254 1310 1104 159 44 13223 12256 --
NM_006618chr181380 1317 1152 1110 992 525 502 210 21458 1333 11321 --
NM_006621chr171697 1661 505 414 333 266 91 31562 109 83 2600 93 11634
NM_006622chr51218 ------
NM_006624chr101854 --11683 --
NM_006626chr962684 1890 959 839 140 57 12151 11700 --
NM_006628chr1584649 4350 4219 3983 1303 1277 1022 78 ------
NM_006629chr1852582 2444 2390 2250 1769 32184 1855 1099 ----
NM_006633chr51546 ------
NM_006636chr221011 991 ------
NM_006640chr1721906 1376 --21778 1369 --
NM_006644chr132567 236 1450 ----
NM_006646chr13102184 2052 2032 1970 1062 994 915 742 442 402 --31239 746 263 --
NM_006648chr9--1110 ----
NM_006650chr5113820 3784 2663 1086 941 591 547 232 123 56 43 ------
NM_006651chr421068 554 1583 2556 248 --
NM_006654chr1264772 4144 3552 3377 1211 312 23803 1493 13517 --
NM_006660chr15137 --141 --
NM_006662chr162123 28 --1131 --
NM_006667chrX2734 287 1163 ----
NM_006670chr63578 218 141 ------
NM_006675chr1283338 3251 2952 2482 1313 1137 1024 981 --53159 2719 2387 989 320 --
NM_006680chr111119 ------
NM_006690chr2052033 1994 1984 1971 222 --151 --
NM_006694chr12258 125 ------
NM_006698chr2051294 1253 1140 459 22 --3563 559 391 --
NM_006699chr172723 2503 2445 2307 2289 397 321 21065 699 22121 1970 --
NM_006700chr125780 739 599 575 230 1641 ----
NM_006704chr132145 114 ------
NM_006706chr5--1298 1743 --
NM_006708chr641269 1083 991 828 1537 1281 1136
NM_006717chr952745 2301 1162 1056 77 --32533 1142 199 --
NM_006721chr10155 1104 ----
NM_006722chr382750 2691 2393 2212 355 268 95 39 22058 1189 143 --
NM_006724chr61103 ----1317
NM_006726chr42824 446 11118 1915 --
NM_006727chr5191 1128 1159 --
NM_006729chrX155373 4823 4813 4469 4335 4065 3667 3525 3435 2146 1850 1625 1053 1041 920 13492 14440 --
NM_006732chr1921543 639 --41839 1545 817 661 --
NM_006734chr611230 --1347 --
NM_006735chr73297 112 98 --166 --
NM_006736chr251734 1703 1508 1190 101 --2611 604 --
NM_006738chr15104670 4651 4235 4210 4008 3461 3160 2881 1789 1330 34608 3413 3015 33869 3747 3227 11166
NM_006742chr1681634 1410 1336 1278 664 588 437 420 --51494 756 615 422 136 --
NM_006744chr102171 89 --1173 --
NM_006746chrX41473 520 444 168 --1524 158
NM_006750chr16197818 7044 6599 6584 5465 5415 4948 4902 3065 2678 1803 973 680 673 518 462 429 167 109 21353 820 77853 7822 7329 6070 5189 3182 1749 27029 685
NM_006754chr73889 279 159 11129 --1162
NM_006755chr111168 ------
NM_006756chr84964 278 159 86 --1147 --
NM_006764chr31449 130 ----
NM_006766chr8102506 1932 1795 1756 1057 736 655 461 443 304 1469 22624 445 12659
NM_006769chr11151 --1132 --
NM_006772chr6121719 1546 1532 1457 1405 1290 1205 673 565 559 201 24 11618 21446 35 --
NM_006775chr662179 2009 2000 1167 1110 204 --12056 --
NM_006777chrX122935 2871 2801 2436 2316 1086 1053 813 359 353 272 163 1825 ----
NM_006778chr651925 1495 670 390 185 ------
NM_006783chr133607 284 82 ------
NM_006788chr18111874 1754 1701 738 569 473 464 360 323 300 127 --21458 829 --
NM_006791chr151176 ------
NM_006793chr102304 26 ------
NM_006795chr1181571 1383 1086 562 520 462 143 111 11107 41118 1114 564 466 --
NM_006800chrX----2623 570 --
NM_006802chr12372 287 ------
NM_006805chr551723 1446 1074 103 47 --21516 1448 11280
NM_006806chr211154 ------
NM_006807chr171266 --2841 358 --
NM_006811chr202987 924 --1834 --
NM_006814chr2092555 2139 2091 2010 830 572 523 488 247 --1878 --
NM_006815chr1241017 969 294 238 ------
NM_006819chr113385 337 22 ------
NM_006823chr83532 312 252 11308 ----
NM_006825chr123999 958 212 1390 ----
NM_006826chr221249 431 31085 393 80 3187 29 25 --
NM_006827chr1483034 2867 2260 966 467 444 190 114 --23198 783 12848
NM_006832chr141120 ------
NM_006838chr1221711 190 --2398 224 --
NM_006851chr1262774 2443 937 925 848 645 22709 153 22804 2750 --
NM_006852chr17122729 2679 2564 2466 2454 2443 2361 2224 1922 1141 1108 689 12125 12632 12533
NM_006854chr781840 1601 1556 1530 1421 1279 757 414 11497 ----
NM_006856chr124764 420 369 264 --1888 --
NM_006861chr1271383 1373 694 568 543 200 150 --1346 11389
NM_006873chr2123242 3063 2928 2866 2786 1328 1129 730 708 450 374 363 1245 --12680
NM_006875chrX2254 190 --1213 --
NM_006877chr62309 283 --2295 269 --
NM_006884chr331745 1373 113 1230 11362 --
NM_006885chr16104241 3864 3520 1696 1567 1092 1071 1065 821 664 --63510 3112 1513 1358 1329 1099 --
NM_006887chr22460 196 ------
NM_006888chr14103543 3296 3069 3031 2698 2445 2253 1194 737 146 --12561 --
NM_006894chr12310 281 ------
NM_006896chr71829 1889 1831 --
NM_006906chr112772 99 1170 ----
NM_006908chr741067 1020 981 324 --11102 21194 258
NM_006914chr931429 599 349 --11168 --
NM_006915chrX32508 722 38 1496 1349 --
NM_006920chr221963 1527 ------
NM_006922chr232336 839 765 ------
NM_006924chr17102885 2805 2745 1207 1127 988 697 576 360 49 24046 1624 ----
NM_006925chr142449 214 ------
NM_006931chr1251578 1407 865 289 193 --31585 428 118 --
NM_006937chr172598 140 ------
NM_006939chr141914 ------
NM_006940chr1271597 1402 1301 636 562 470 87 11855 21247 486 --
NM_006941chr2241044 807 273 139 ------
NM_006943chr20123311 3302 3296 2946 2590 2398 976 878 667 457 395 202 13278 33128 2306 1055 --
NM_006947chr451677 1451 1252 1178 150 11665 21314 1280 1486
NM_006950chrX4687 642 312 42 --2360 316 --
NM_006981chr9122828 2640 2152 754 739 512 501 457 350 159 138 89 --32394 516 98 --
NM_006987chr1741306 1226 1124 172 --21180 161 --
NM_006988chr2131127 782 348 --1786 1792
NM_006990chr181875 983 448 401 359 182 161 127 --71795 1791 635 245 53 37 27 142
NM_006996chr1--2506 25 ----
NM_006997chr101122 ----1127
NM_006999chr551394 594 349 242 230 1532 1398 --
NM_007005chr931186 1073 1055 1312 1138 --
NM_007007chr1273884 3669 2949 2943 1772 82 26 --34733 4729 4331 --
NM_007008chr21588 1246 ----
NM_007010chr1731212 554 195 2632 399 ----
NM_007011chr15126476 5880 5491 4579 4529 2651 2150 1920 1888 1558 437 163 44922 4670 2110 512 55787 4533 4241 2675 2655 --
NM_007013chr81136 ------
NM_007015chr132286 270 ------
NM_007017chr51194 188 ----
NM_007023chr231023 779 264 ------
NM_007027chr3----1139 --
NM_007030chr554742 4148 3469 3247 378 --54637 962 743 521 513 --
NM_007036chr51822 177 ----
NM_007039chr1462049 1679 1561 1552 658 81 21723 1582 11565 --
NM_007042chr372600 2525 1969 782 461 444 286 ------
NM_007045chr61541 1177 ----
NM_007050chr20186804 6616 6329 5131 2822 2717 2347 2321 2023 1613 1346 1012 908 844 617 383 216 163 18122 25346 1451 25632 1162
NM_007052chrX1621 --1231 --
NM_007054chr583630 3604 3579 3516 3432 3266 3026 639 23702 3325 13436 23635 642
NM_007067chr1761532 1279 1154 1129 1107 415 --11358 --
NM_007068chr222427 356 128 ----
NM_007073chr683790 3782 3773 3628 2952 1128 352 216 23805 1452 ----
NM_007078chr1021070 302 --2585 493 --
NM_007084chr1331485 410 357 ------
NM_007106chr1352835 2725 2650 674 386 ------
NM_007107chr352191 756 431 398 284 12154 1812 --
NM_007111chr132874 82 ------
NM_007114chr342780 2069 538 248 --11070 --
NM_007122chr12586 76 --178 --
NM_007124chr671882 1766 751 679 410 216 29 1330 --21602 225
NM_007125chrY2346 117 ----1366
NM_007129chr133655 317 209 --2854 371 --
NM_007137chrX125525 4437 4270 4095 4084 3970 3868 3824 3627 1481 1313 815 --24275 3629 1276
NM_007144chr1771326 1127 949 467 98 87 48 --123 --
NM_007146chr1762641 2447 2186 2084 1775 1101 ------
NM_007147chr1931106 1076 216 --1294 --
NM_007150chrX122125 1773 1732 1683 1637 1378 764 576 565 212 139 92 1316 ----
NM_007157chrX92336 2273 2254 1865 793 784 776 270 222 1757 42304 2275 889 304 --
NM_007158chr151189 1113 1012 444 435 --1145 --
NM_007159chr341084 686 291 85 ------
NM_007166chr1131407 439 112 --31411 982 978 --
NM_007170chr14914 604 340 84 --1789 1190
NM_007172chr2262291 2030 699 330 317 85 23184 2039 --1193
NM_007174chr1282030 1983 1742 1679 924 828 628 482 --31715 781 419 --
NM_007175chr873254 3179 2445 2220 554 103 90 1896 1506 1153
NM_007185chr16756 432 314 289 219 52 ------
NM_007187chr132933 894 ------
NM_007189chr741378 582 206 195 --1560 --
NM_007190chr103814 88 27 1993 ----
NM_007191chr122156 58 ------
NM_007192chr1471045 1007 440 291 280 83 33 ------
NM_007195chr18173620 3461 3438 3271 3128 2839 2794 2784 2770 2542 2487 1166 1138 897 818 531 367 1772 1917 --
NM_007197chr12175 1866 ----
NM_007200chr15104670 4651 4235 4210 4008 3461 3160 2881 1789 1330 34608 3413 3015 33869 3747 3227 11166
NM_007202chr173771 603 542 --1610 --
NM_007203chr963894 3745 3386 3134 2954 2931 --23349 3306 --
NM_007204chr12414 130 1516 ----
NM_007207chr15809 669 600 285 82 --1794 --
NM_007212chr15807 542 350 171 117 12301 1213 --
NM_007214chr621000 203 ----11248
NM_007219chr203935 647 112 1969 ----
NM_007220chrX114878 4814 4522 4210 3990 3958 3726 3096 1656 1527 557 1748 24204 3180 33995 3845 3507
NM_007221chr11427 ------
NM_007222chr831408 1150 305 11536 ----
NM_007224chr125635 504 170 108 66 ------
NM_007232chr202361 327 --1166 --
NM_007236chr15122357 2131 2104 1899 949 477 444 401 373 253 97 63 1430 ----
NM_007238chr20104722 4325 4287 4106 3845 3656 3327 1342 317 73 14838 14084 14759
NM_007245chr162837 365 ------
NM_007246chr421055 968 ------
NM_007249chr13259105 8982 8613 7879 7729 7626 7515 7461 7407 7279 6978 6950 6803 6669 6627 5935 5755 2761 2503 1650 1353 1147 895 849 152 26346 5770 17885 39291 8085 1030
NM_007250chrX2600 76 1459 143 --
NM_007269chr11436 1229 ----
NM_007275chr33437 392 326 --1442 --
NM_007276chr74694 260 218 205 ------
NM_007278chr171139 1123 4354 340 301 63 --
NM_007283chr392938 2811 2478 2020 1882 1027 1001 745 679 --62299 1198 747 540 441 380 11004
NM_007285chr162463 153 ------
NM_007286chr582115 1488 1315 746 617 331 291 233 --1213 --
NM_007287chr382897 2453 2034 1972 1300 1210 664 483 13180 12036 --
NM_007288chr382897 2453 2034 1972 1300 1210 664 483 13180 12036 --
NM_007289chr382897 2453 2034 1972 1300 1210 664 483 13180 12036 --
NM_007292chr1784874 4867 4644 3935 1096 1074 404 249 14648 25186 414 --
NM_007294chr1751276 1152 1133 100 63 1317 ----
NM_007295chr1751276 1152 1133 100 63 1317 ----
NM_007296chr1751276 1152 1133 100 63 1317 ----
NM_007297chr1751276 1152 1133 100 63 1317 ----
NM_007298chr1751276 1152 1133 100 63 1317 ----
NM_007299chr1751276 1152 1133 100 63 1317 ----
NM_007300chr1751276 1152 1133 100 63 1317 ----
NM_007302chr1751276 1152 1133 100 63 1317 ----
NM_007303chr1751276 1152 1133 100 63 1317 ----
NM_007304chr1751276 1152 1133 100 63 1317 ----
NM_007305chr1751276 1152 1133 100 63 1317 ----
NM_007308chr42186 126 ------
NM_007313chr941582 1481 716 602 --31747 406 200 --
NM_007320chr191236 ------
NM_007325chrX71405 839 588 555 462 162 135 ----1818
NM_007345chr1851674 1572 892 381 248 22135 1656 11678 --
NM_007347chr1532972 1994 874 ------
NM_007349chr7180 --1111 --
NM_007350chr1264395 4085 3416 3318 1731 1620 21447 162 34460 1338 959 --
NM_007353chr7123061 2790 2382 2326 2140 1945 1061 956 910 737 662 429 22784 603 22103 960 --
NM_007357chr12422 174 1452 --1569
NM_007358chr131682 1266 90 --21684 1516 --
NM_007359chr1761405 1338 1206 605 576 536 1413 41229 1093 366 164 --
NM_007365chr1102043 1915 1822 1597 1580 863 847 553 377 73 12059 2841 627 --
NM_007371chr93490 222 135 1113 ----
NM_007372chr172575 222 --1886 --
NM_007373chr1021594 324 --31766 1223 1219 --
NM_007374chr14------1550
NM_007375chr142361 1782 630 415 --12593 11882
NM_009585chr3--1685 2765 174 --
NM_009585chr3--1685 2765 174 --
NM_012064chr1251175 1121 1045 151 106 --2338 212 --
NM_012069chrX42565 1001 622 225 --1131 --
NM_012074chr1431078 813 240 --1822 --
NM_012081chr532328 288 183 12967 13345 --
NM_012083chr1041089 961 939 902 --41110 976 853 836 --
NM_012090chr121206 368 ------
NM_012092chr241450 599 430 47 --21371 695 --
NM_012095chr10113512 3405 2796 2718 2670 2286 2194 1413 1312 1110 401 --22441 1417 --
NM_012096chr332568 2349 585 23359 1480 ----
NM_012102chr1132397 2385 2282 2104 2083 2042 1979 987 916 876 569 304 184 --12146 --
NM_012104chr11163539 3399 3339 3224 3080 2687 2672 2473 2416 2323 1442 1380 1032 1020 998 339 11162 22689 2462 11222
NM_012104chr11163539 3399 3339 3224 3080 2687 2672 2473 2416 2323 1442 1380 1032 1020 998 339 11162 22689 2462 11222
NM_012110chr4244 27 ------
NM_012117chr12------184
NM_012129chr792163 1834 1004 755 720 548 535 90 34 22515 205 --12085
NM_012134chr141333 1264 1228 653 --1182 --
NM_012137chr1122860 2796 2741 2377 2314 2251 2149 2135 936 489 347 79 12593 62161 2139 1909 555 540 443 --
NM_012141chr13103678 3297 3192 2998 2910 2682 2545 859 840 39 --23705 2651 23197 2739
NM_012153chr11102493 2483 2460 2376 2227 2023 1788 1609 684 325 --2926 689 --
NM_012156chr20143346 2887 2835 2823 2754 2516 2434 1270 779 739 732 621 354 271 12453 43355 2497 2485 656 --
NM_012158chr1341671 1609 1508 189 ----11465
NM_012161chr431183 464 49 ------
NM_012164chr9217144 7130 7037 6675 6284 6094 6021 5983 5771 5744 5690 5394 5354 2859 2039 1190 1144 854 806 549 283 12751 34731 1795 447 --
NM_012175chr112866 224 ------
NM_012180chr43541 535 166 1200 ----
NM_012183chr13239 165 136 ------
NM_012188chr53931 901 856 1140 ----
NM_012189chr182484 470 --1474 --
NM_012191chr32128 29 ------
NM_012192chr1152412 1873 1487 792 135 22351 1549 ----
NM_012193chr11145286 4698 4631 4538 4419 4373 3573 3564 3475 1815 822 710 682 24 24986 1266 75193 3456 3350 3335 1878 1870 1554 --
NM_012197chr931474 1464 266 --157 --
NM_012199chr1214611 4232 4077 4011 3828 2951 2928 1869 1821 1801 1639 1523 1503 1305 1146 1054 938 781 749 129 42 12832 64341 4053 3954 2922 1439 825 13959
NM_012207chr10157 ------
NM_012210chr981224 1130 1004 965 477 421 386 49 ----1391
NM_012214chr2136438 6212 5343 2523 2295 2264 2002 1976 1781 885 857 528 29 25455 549 2889 734 12391
NM_012215chr1051883 1664 728 374 226 ------
NM_012218chr1942239 2223 382 30 ------
NM_012219chr383205 2889 2726 2631 1198 1142 384 185 1739 12675 --
NM_012223chr241207 1062 247 174 ------
NM_012224chr43912 787 126 ------
NM_012232chr17122026 1913 1891 1885 1694 1673 1620 1454 381 320 49 40 --12038 --
NM_012234chr393710 3336 3027 2727 1385 1179 599 435 406 1227 --11071
NM_012238chr1041705 1237 697 265 ------
NM_012242chr102286 132 ------
NM_012243chr11383 ------
NM_012244chr1451656 1367 1315 1162 343 11626 31477 511 33 --
NM_012247chr102750 173 --1649 --
NM_012249chr262228 1364 1286 1007 926 611 1425 23224 2524 13102
NM_012250chr1121106 55 --1146 188
NM_012252chr793958 3644 3561 3474 3349 729 420 252 213 13573 23718 459 --
NM_012255chr203168 72 29 ------
NM_012257chr741016 869 230 169 ------
NM_012259chr61262 ------
NM_012262chr1124421 4401 4285 3920 3856 2060 2036 1936 1549 1285 871 204 34131 1850 865 22005 1938 13182
NM_012281chr742015 800 515 380 1269 ----
NM_012287chr342991 1583 1551 342 21624 587 13790 --
NM_012288chr6215383 4968 4931 4668 4246 3950 3932 3738 3668 3490 2028 1826 1745 1255 1239 767 345 223 217 183 172 21887 357 105068 4980 3590 2227 1229 863 306 161 157 87 13759
NM_012294chr773906 3889 3397 3024 1558 1474 1433 33468 3231 2477 177 11153
NM_012296chr11163512 3494 3426 3374 3206 2961 2678 2640 2487 1470 847 395 292 157 83 53 --13017 13929
NM_012297chr451976 1855 901 820 547 --1824 --
NM_012298chr34705 667 153 101 --1218 --
NM_012300chr562178 1659 666 589 406 243 --31813 922 593 --
NM_012301chr721769 1412 151 1677 --
NM_012302chr141097 1086 797 303 11024 ----
NM_012304chr5112474 2327 2260 2178 1694 987 921 790 326 145 106 --12478 --
NM_012307chr185872 810 681 355 174 ------
NM_012308chr1172493 2299 1990 1765 871 583 39 --2585 138 --
NM_012309chr11144239 4018 3798 3741 3629 3368 1676 1607 1376 1227 698 495 442 401 24254 582 34955 1394 444 --
NM_012311chr102622 223 --1645 --
NM_012316chr1155407 3557 1992 1966 1917 1712 1640 1314 1282 859 604 401 376 243 153 23479 849 51921 1681 1084 979 975 --
NM_012318chr431228 1209 504 ------
NM_012322chr7--178 ----
NM_012323chr2241615 1547 484 148 11595 ----
NM_012325chr2021618 1012 1130 ----
NM_012326chr2178 ----181
NM_012329chr1721043 391 21322 1086 21045 359 --
NM_012330chr1051692 1533 730 380 192 ------
NM_012333chr151245 1190 570 502 175 --31194 652 613 --
NM_012334chr573891 3420 1407 772 365 357 113 --22884 530 --
NM_012340chr202179 169 ------
NM_012382chr5114269 4062 3393 3341 3047 2884 2843 1742 895 881 832 33357 1687 995 11457 13855
NM_012392chr1283 41 152 143 --
NM_012395chr783193 2807 2365 2332 2290 2280 2126 402 13242 12809 --
NM_012398chr1941135 1012 785 734 ------
NM_012408chr202870 269 ------
NM_012414chr11113 1842 ----
NM_012416chr931170 245 183 21117 894 ----
NM_012417chr172603 119 ------
NM_012420chr1051712 775 598 371 186 ------
NM_012423chr191306 --145 --
NM_012425chr104420 376 38 28 32685 690 132 21013 1009 --
NM_012428chr152248 93 ------
NM_012432chr1259 42 --127 --
NM_012434chr62609 69 --2611 387 --
NM_012444chr203446 328 128 1437 ----
NM_012446chr51135 ------
NM_012448chr172540 29 --32552 945 911 --
NM_012453chr781423 1415 1251 474 223 176 134 92 11404 174 --
NM_012461chr144585 558 477 49 ------
NM_012463chr1231754 335 149 --11561 --
NM_012464chr452361 2229 2003 1029 516 11092 1901 --
NM_012465chr10103033 2966 2843 2797 2273 2162 1043 844 475 289 ------
NM_012470chr72457 168 ------
NM_012473chr225507 244 232 216 62 --177 --
NM_012474chr1--186 ----
NM_012479chr772705 2368 2019 1971 1928 647 107 2987 413 31751 791 787 --
NM_012481chr174632 329 159 105 1573 1778 --
NM_012482chr11114 ------
NM_012486chr1----1104 --
NM_013227chr154756 727 281 86 ------
NM_013230chrY21328 282 11773 1587 --
NM_013231chr1463862 3433 3210 1143 665 318 13818 11027 --
NM_013233chr23400 86 75 1111 --11253
NM_013236chr2231117 791 478 ------
NM_013242chr162331 46 ------
NM_013243chr1531125 231 161 --1310 --
NM_013245chr164646 573 253 224 1218 1728 --
NM_013246chr115776 714 682 299 119 --1121 --
NM_013248chr202307 208 ------
NM_013254chr121609 ------
NM_013255chr7168655 7605 7570 7544 7149 6967 6923 6868 6805 6527 6404 5482 3370 2118 230 153 35920 2619 1878 25839 3523 46973 3514 1574 437
NM_013257chr832167 2032 952 ------
NM_013259chr35217 110 99 90 82 ------
NM_013261chr4103242 2921 2602 1352 977 916 786 676 268 63 22432 846 23426 1174 --
NM_013269chr1254515 4260 4086 1459 1257 ------
NM_013275chr164746 641 608 154 --1612 --
NM_013277chr122347 243 --1171 --
NM_013279chr1152300 1696 544 276 219 --32050 1601 229 --
NM_013280chr113857 835 731 1664 1120 --
NM_013281chr2031187 581 262 11199 ----
NM_013293chr7137 194 ----
NM_013302chr16114736 4469 3636 3332 3309 3055 3005 1478 956 900 829 11017 --1782
NM_013316chr731040 797 84 ------
NM_013336chr33599 576 301 ------
NM_013341chr222764 1076 11000 31160 1124 795 --
NM_013351chr174732 649 176 111 ------
NM_013352chr63792 749 654 1913 1897 --
NM_013353chr1289 69 --171 --
NM_013354chr84379 135 109 98 1326 ----
NM_013357chr84867 746 202 86 --1706 --
NM_013365chr223850 534 158 ------
NM_013368chr193465 200 183 --129 --
NM_013372chr1582919 2821 2407 2279 2215 1036 468 363 32365 771 498 31346 1038 470 --
NM_013374chr332031 1019 385 22218 306 ----
NM_013377chr122604 200 --1182 --
NM_013390chr941165 688 257 175 --11388 11501
NM_013396chr213337 318 306 --2271 62 --
NM_013400chr72841 762 --1968 1994
NM_013401chr115922 725 651 594 213 --3926 614 602 --
NM_013403chr197815 760 602 288 211 179 148 ------
NM_013411chr151986 1970 1749 778 604 --52480 1848 999 849 699 --
NM_013417chr93403 104 35 ------
NM_013423chrX198 ------
NM_013427chrX198 ------
NM_013433chr1991945 1929 1875 1783 1469 1361 1342 533 140 11355 ----
NM_013434chr251721 585 573 410 248 ------
NM_013434chr251721 585 573 410 248 ------
NM_013437chr81236 ------
NM_013438chr931692 1604 1295 1601 ----
NM_013442chr9150 ------
NM_013443chr92302 220 ------
NM_013444chrX5987 274 264 248 209 1203 5278 256 252 215 184 --
NM_013446chr741296 1014 997 162 ------
NM_013448chr142688 648 ------
NM_013449chr12142716 2132 843 831 820 811 709 551 531 336 322 225 180 47 22931 2535 22261 173 --
NM_013450chr24353 114 107 29 11014 ----
NM_013943chr132020 1218 36 2566 57 2715 74 --
NM_013951chr252488 2345 2011 888 550 1576 1857 --
NM_013952chr252565 2422 2088 965 627 1653 1934 --
NM_013953chr252565 2422 2088 965 627 1653 1934 --
NM_013958chr83335 144 27 ------
NM_013959chr83335 144 27 ------
NM_013960chr84569 517 257 148 --1519 --
NM_013961chr83335 144 27 ------
NM_013962chr83335 144 27 ------
NM_013992chr252565 2422 2088 965 627 1653 1934 --
NM_013995chrX22532 881 22392 2045 ----
NM_013999chr1741102 241 153 119 --1518 --
NM_014000chr1081951 1760 1580 1384 626 602 471 389 --41494 611 496 369 --
NM_014001chr1741463 1356 1321 314 ------
NM_014007chr92789 255 ------
NM_014011chr21409 --1481 --
NM_014015chr162788 26 ------
NM_014016chr32349 76 ------
NM_014021chr183256 3031 2343 1317 1205 916 280 137 12232 ----
NM_014028chr653338 3264 2992 2751 1231 3864 321 176 1160 11335
NM_014030chr1741136 829 745 298 ------
NM_014031chr53237 117 33 1306 ----
NM_014034chr641551 978 969 405 11330 11130 --
NM_014042chr11----1221 --
NM_014043chr3--1136 ----
NM_014048chr16114079 3469 3456 3415 2028 1708 1673 1118 989 742 217 24928 459 14200 --
NM_014057chr971494 998 647 581 501 454 364 --1366 --
NM_014059chr133344 120 23 --1273 --
NM_014071chr20--1126 ----
NM_014079chr33331 266 119 --1166 --
NM_014106chr1531905 1893 956 22648 1201 ----
NM_014110chr14884 412 262 88 2291 219 1276 1254
NM_014112chr864701 4378 3332 2172 814 148 --1134 --
NM_014117chr1682268 2262 2245 1972 844 374 190 93 --1765 --
NM_014141chr795180 3500 1531 1352 1181 821 496 431 213 11478 34197 3453 1535 --
NM_014145chr202578 142 1717 ----
NM_014149chr72674 593 ------
NM_014153chr162730 94 ------
NM_014154chr341569 1436 606 310 ------
NM_014155chr11146876 6775 6650 6380 6200 5973 5716 5629 2781 2362 2337 1802 756 415 36609 5745 444 45718 5375 617 548 16879
NM_014157chr16153767 3176 3002 1433 1383 1347 1270 1248 1219 1169 972 864 625 543 276 1661 1687 163
NM_014159chr3----175 --
NM_014165chr6--122 ----
NM_014166chr1351113 808 359 261 159 1827 1820 --
NM_014171chr22199 44 128 ----
NM_014178chr14191 2436 29 ----
NM_014181chr242857 857 779 522 11160 ----
NM_014182chr125724 291 273 127 71 ------
NM_014184chr11110 ------
NM_014186chr11102244 2116 1964 1811 824 728 692 601 207 198 21521 758 32162 2118 579 --
NM_014189chr431359 1259 335 --21496 337 --
NM_014190chr441711 1611 1151 687 --31848 689 321 --
NM_014191chr122845 68 ------
NM_014203chr191215 --1132 --
NM_014211chr561491 1448 1419 1217 1148 132 --11450 --
NM_014212chr124946 839 386 86 --1615 --
NM_014216chr1431606 490 446 --1480 11609
NM_014217chr181856 1500 1212 529 278 268 210 177 --11502 --
NM_014223chr11193 --177 --
NM_014231chr1261952 1902 1895 1546 740 734 12110 61954 1588 1583 1482 477 473 --
NM_014232chr1761633 1489 625 513 498 348 --9411 404 399 382 354 350 289 274 241 --
NM_014232chr1761633 1489 625 513 498 348 --9411 404 399 382 354 350 289 274 241 --
NM_014233chr1762041 1780 1525 1360 416 116 21811 645 21894 1729 --
NM_014234chr61171 ------
NM_014240chr374085 3089 1157 634 483 222 145 1954 31242 409 147 --
NM_014243chr432068 765 57 21928 153 ----
NM_014245chr3------1227
NM_014248chr22155 ------
NM_014250chr2251909 1782 1568 1483 482 --22023 1636 --
NM_014252chr131125 ------
NM_014253chrX31662 426 132 --2542 538 --
NM_014263chr1031124 347 83 11519 ----
NM_014264chr4------1106
NM_014267chr113323 292 239 ------
NM_014268chr1851444 1315 1274 304 289 --11337 --
NM_014270chr19170 ------
NM_014271chrX2589 342 ----1623
NM_014275chr51781 ----1665
NM_014279chr94819 357 246 167 ------
NM_014280chr16711 596 589 261 202 30 --273 49 --
NM_014283chr12354 323 1204 21370 1269 --
NM_014284chr13126 104 64 --1949 --
NM_014288chr11215 ------
NM_014289chrX31256 1205 121 ------
NM_014292chr2271861 1468 548 443 407 315 284 --31566 413 409 1614
NM_014294chr811362 21344 48 ----
NM_014299chr1971932 1772 1647 1629 578 83 51 --41803 1452 651 265 --
NM_014305chr132206 124 --1218 --
NM_014309chr22155190 5064 3992 3923 3904 3895 3464 1860 1632 1210 813 804 597 452 179 25100 3913 34069 3906 587 --
NM_014316chr1672192 1801 1748 1635 734 366 84 --11998 --
NM_014319chr1251641 1376 655 346 69 ------
NM_014325chr1252145 739 492 445 405 --1748 --
NM_014332chrX1154 1328 ----
NM_014333chr1162261 1101 1002 492 437 357 22821 239 1329 --
NM_014335chr1531101 283 52 11118 ----
NM_014342chr1141383 1321 1148 271 ------
NM_014344chr113838 698 173 --1152 --
NM_014345chr65951 934 426 176 164 --2936 166 --
NM_014352chr1171378 1014 964 330 270 142 68 --1250 --
NM_014363chr1311048 ------
NM_014368chr962106 1621 1612 399 351 161 --21794 1344 --
NM_014370chrX----1191 --
NM_014372chr181960 1940 1628 763 384 378 370 114 1354 --1766
NM_014374chr72841 762 --1968 1994
NM_014381chr1493316 2538 2243 1204 1157 884 476 422 153 --33309 3305 3301 --
NM_014382chr351082 589 486 390 288 --21340 1149 --
NM_014383chr191272 ------
NM_014388chr1206030 5902 5884 4996 4987 4979 4119 3863 3850 3739 3705 3681 1661 1487 1049 891 426 367 339 145 --11506 --
NM_014393chr851867 946 751 313 228 --32309 2299 232 --
NM_014397chr931421 1320 1197 --31423 1322 220 --
NM_014399chr73172 50 23 --2992 269 --
NM_014400chr193456 342 71 ------
NM_014410chr181344 1325 ----
NM_014417chr192951 88 ------
NM_014418chr1442017 1888 1417 384 --21890 1306 --
NM_014419chr19179 ------
NM_014421chr431391 344 310 11912 ----
NM_014423chr574721 4644 4385 3757 3641 2105 1550 41983 1874 781 513 ----
NM_014432chr631373 1306 31 11060 ----
NM_014437chr12602 58 --1596 --
NM_014445chr311694 12152 11549 1121
NM_014447chr421596 221 --11559 --
NM_014452chr641091 893 182 176 1414 --1312
NM_014455chr12347 145 ------
NM_014456chr101515 1227 1322 --
NM_014458chr141278 1271 1179 1119 --1254 --
NM_014460chr2221177 475 11739 2588 584 --
NM_014469chr112292 125 1258 ----
NM_014470chr122638 38 ------
NM_014478chr73483 267 57 --2697 680 --
NM_014488chr111103 ------
NM_014491chr72891 193 1276 ----
NM_014494chr1672301 2050 1909 1848 798 711 304 1861 1746 --
NM_014496chrX1279 163 ----
NM_014498chr3----1326 --
NM_014504chr752175 1380 1348 379 276 51730 1582 1515 266 151 11778 --
NM_014505chr122379 80 ------
NM_014515chr1221046 253 ------
NM_014517chr321615 1265 --41619 1233 530 375 1137
NM_014521chr261741 1470 1452 1389 623 577 21764 220 ----
NM_014547chr152197 79 1630 ----
NM_014547chr152197 79 1630 ----
NM_014552chr241136 574 561 236 --1596 --
NM_014554chr1282293 1708 1670 1430 693 563 262 162 21753 1687 62251 2147 2016 1680 551 164 1566
NM_014570chr2221009 26 --2211 185 --
NM_014572chr1321742 1501 ------
NM_014573chr1741567 1274 493 283 --1168 11836
NM_014574chr1421360 324 ------
NM_014575chr3--1153 ----
NM_014577chr222761 254 ------
NM_014584chr1431612 1354 1265 ------
NM_014586chr21184549 4503 4449 4135 4116 4061 3564 3397 3328 1683 1145 918 472 445 352 315 266 237 14243 33814 1204 242 --
NM_014587chr1651349 1187 267 212 204 11371 11528 --
NM_014591chr1041281 1092 74 28 --2920 235 --
NM_014592chr52204 197 1151 ----
NM_014603chr1761691 1486 1444 1267 480 290 --11279 --
NM_014604chr172635 192 --1147 1574
NM_014606chr461113 1043 986 973 383 374 --31258 1030 464 --
NM_014607chr221395 513 1272 ----
NM_014608chr151395 --143 --
NM_014612chr951220 1182 499 439 98 11316 ----
NM_014614chr221320 405 ------
NM_014615chr16113315 3160 3092 2919 2789 2343 2320 1277 900 605 374 23656 2738 2527 263 --
NM_014616chr373075 3058 2751 2410 1061 1036 41 ----33520 1068 44
NM_014618chr92403 29 ------
NM_014620chr121125 ------
NM_014628chr66415 335 150 123 96 47 --1315 --
NM_014630chr15173853 3799 3606 3501 3275 3200 3070 2810 2458 1107 1040 972 750 400 269 240 50 11020 31218 752 422 12678
NM_014633chr111161 ------
NM_014634chr2293578 2660 2593 2413 1058 641 626 118 48 --22726 31 13292
NM_014636chr9124177 4102 3191 3135 1701 1610 1363 1356 885 842 835 780 1326 11728 --
NM_014637chr831173 527 116 1913 ----
NM_014646chr18113018 2998 2831 2489 2320 2201 504 289 266 147 94 ----12058
NM_014647chr1662154 1570 716 205 192 183 1685 ----
NM_014659chr153399 365 128 ------
NM_014660chr75953 823 377 365 264 1253 --1133
NM_014661chr1093936 3640 2451 823 551 501 475 296 113 --21545 429 --
NM_014666chr52363 357 --191 --
NM_014667chr3112400 2349 2313 1899 1676 895 681 383 374 323 251 ----11902
NM_014670chr221162 296 186 ----
NM_014671chr72507 44 --2145 117 --
NM_014674chr3123667 3505 3301 3181 3174 3163 2836 1242 940 639 525 461 22656 951 73672 3464 3323 3294 2924 1604 615 --
NM_014676chr131486 1411 440 11250 11365 --
NM_014677chr841193 1055 1015 1009 1893 ----
NM_014679chr1121143 440 --1990 --
NM_014682chr84547 535 441 183 --1897 --
NM_014683chr1782014 1893 1656 1358 784 695 577 207 1104 ----
NM_014686chr1952250 2102 1851 820 692 ------
NM_014689chr2140 ------
NM_014690chr7132731 2569 2338 2250 2100 2068 1223 1116 1012 831 823 376 26 1664 52779 2775 2039 1126 413 --
NM_014701chr1573255 3237 2358 1353 1211 1000 410 2726 188 ----
NM_014702chr6113335 3240 3190 3105 2461 1009 992 523 161 119 92 22225 861 ----
NM_014705chr761918 1912 1903 1863 765 567 1782 1769 --
NM_014707chr732288 2272 1709 2134 44 42293 2265 479 475 --
NM_014709chr2--1196 ----
NM_014711chr1661956 708 667 479 427 158 11704 ----
NM_014715chr114954 768 181 159 3939 871 673 1351 --
NM_014717chr191749 ------
NM_014720chr1031482 125 113 1358 ----
NM_014721chr677491 6727 2793 1957 881 775 60 14562 15358 27070 778
NM_014723chr20112962 2766 2705 2659 2618 2339 881 710 697 427 72 11235 22622 712 12080
NM_014726chr1771224 1095 1007 978 411 186 153 --1297 --
NM_014727chr19----1245 --
NM_014729chr861969 1758 1575 213 172 23 ------
NM_014730chr12265223 4962 4852 4767 4680 4672 4326 4286 4221 3952 3946 3900 3878 3786 3742 3646 3538 3514 3420 3378 1321 1310 1022 784 551 235 23521 1282 75190 3425 3328 1490 568 276 242 --
NM_014730chr12265223 4962 4852 4767 4680 4672 4326 4286 4221 3952 3946 3900 3878 3786 3742 3646 3538 3514 3420 3378 1321 1310 1022 784 551 235 23521 1282 75190 3425 3328 1490 568 276 242 --
NM_014731chr2051797 1534 1352 343 83 --1278 --
NM_014733chr561930 1478 1461 804 798 203 --1806 --
NM_014735chrX61819 1505 1448 764 513 280 11360 12049 --
NM_014737chr20114073 3954 3287 2954 2769 1640 1499 1083 1037 848 77 13782 13821 --
NM_014739chr644009 3287 1141 331 43896 2887 1557 725 23338 2663 --
NM_014743chr4132876 2831 2460 2438 2040 2009 952 837 649 317 145 139 99 --1469 --
NM_014746chr2104002 3110 3043 1638 1547 821 715 331 284 93 21576 699 64066 4062 4057 3978 1752 554 --
NM_014747chr1195555 5471 5019 4886 4610 4437 4417 4115 4047 3732 3688 3651 3579 3509 1585 1301 698 589 89 15404 55285 5121 3977 1235 725 15676
NM_014751chr83761 385 220 --1765 --
NM_014752chr1151246 537 428 403 26 21390 752 1446 --
NM_014755chr294121 3982 3366 2874 1691 1298 1282 1183 1030 11513 43829 1668 1452 1106 13653
NM_014756chr111368 ----1325
NM_014757chr562045 1643 1634 1573 839 541 1703 62363 1541 949 932 915 748 --
NM_014761chr1651056 282 259 176 150 --21141 989 --
NM_014764chr125513 506 461 264 125 1356 ----
NM_014765chr142311 1861 718 539 --2548 475 --
NM_014766chr783712 3076 2971 1264 755 626 397 176 23195 2737 1196 2596 26
NM_014767chr1093553 3332 3095 2619 2512 1350 1283 1259 487 --42732 2649 2248 318 --
NM_014770chr1251322 1100 978 498 156 1125 ----
NM_014772chr1843600 2732 1456 248 12405 43435 3011 2216 272 --
NM_014774chr162825 2584 2288 1278 1139 864 32145 1176 212 32842 2320 281 12561
NM_014776chr12112956 2936 2727 2641 2449 2229 2048 1987 1243 968 448 11013 32961 2622 1220 --
NM_014779chr33391 155 70 2793 316 --1346
NM_014782chrX1114 ------
NM_014783chr154635 340 321 184 --1263 1541
NM_014786chr1141122 973 820 418 ------
NM_014787chr142317 1799 844 631 --1734 --
NM_014791chr92321 254 ------
NM_014795chr211275 21001 26 21346 482 --
NM_014800chr751139 880 462 294 28 --2743 324 --
NM_014802chr1211100 2812 75 ----
NM_014803chr1072882 2576 2562 2377 2096 860 362 --12300 --
NM_014807chr113714 657 56 --3591 340 68 --
NM_014810chr1103390 3155 2929 2636 2606 887 609 541 327 181 12591 33413 1384 53 --
NM_014812chr14521 404 284 174 2444 126 ----
NM_014819chr551928 1816 1664 1552 55 1751 --1146
NM_014820chr342052 1788 1662 598 1628 11910 --
NM_014822chr41120 --153 --
NM_014824chr1141978 1328 597 405 11573 ----
NM_014826chr193467 3208 1645 1373 1189 1011 964 204 70 23303 917 13851 --
NM_014827chr141473 1076 350 252 ------
NM_014830chr1293753 3667 3429 3418 3402 2777 2652 790 302 23369 627 ----
NM_014832chr1341882 1750 1378 839 ------
NM_014836chr1021230 128 ------
NM_014838chr2232237 623 165 --12428 --
NM_014839chr172315 1820 1783 1772 1601 669 316 42276 1972 1679 871 --11982
NM_014840chr1272923 2806 2544 2438 2199 1006 328 --32730 2293 838 --
NM_014841chr641335 967 401 131 ------
NM_014846chr8146 ------
NM_014847chr1----1378 --
NM_014848chr15112656 2513 2014 1931 1807 1756 1131 862 608 243 68 12415 12584 --
NM_014849chr161247 1186 887 343 336 277 1442 158 --
NM_014850chr3184694 4684 4553 4040 3882 3546 3495 3392 1915 1688 1611 1445 1322 1269 1086 813 690 316 24054 3459 54698 4557 4485 3548 1867 --
NM_014857chr1--182 ----
NM_014859chr1751339 987 563 394 201 --1108 --
NM_014860chr241791 1648 899 76 22153 123 1736 1537
NM_014862chr15104004 3466 3403 3009 2596 1469 1420 1132 1106 400 14087 43054 1473 1067 894 --
NM_014864chr1114287 3898 3653 3604 3252 1616 1495 1438 879 214 29 --43690 1163 1043 369 --
NM_014868chr124618 230 187 24 ------
NM_014869chr331295 985 53 --11326 --
NM_014870chr194495 4346 4155 2952 1172 785 746 731 657 --51317 807 523 501 28 --
NM_014871chr121571 173 1204 --
NM_014872chr961930 1676 1449 861 365 223 1357 ----
NM_014873chr1124629 3822 3751 3714 3301 3265 1607 1187 666 595 473 47 11457 14666 --
NM_014874chr131709 455 283 11302 21755 382 --
NM_014875chr13940 751 741 ------
NM_014876chr2242123 1800 1600 379 ------
NM_014877chr1797602 7367 5620 2580 2554 1864 1439 1421 1329 27057 2506 11707 16779
NM_014880chr282613 2107 2066 2043 928 763 714 321 12089 ----
NM_014883chr462461 2202 656 530 356 116 11839 2785 549 1290
NM_014887chr131642 ------
NM_014891chr721078 538 ------
NM_014892chr6----1134 --
NM_014893chrY1160 2775 430 ----
NM_014897chr1773070 2160 2084 596 526 365 80 --13100 --
NM_014901chr551887 1814 1588 470 292 ------
NM_014902chr2051526 1216 512 413 247 ------
NM_014903chr1282161 2111 1789 953 413 375 324 315 1806 1365 --
NM_014905chr22655 278 11698 1716 --
NM_014906chr1753369 2929 630 294 256 33729 2943 677 ----
NM_014909chr14113941 3747 3655 3452 3358 3164 2900 2567 2415 992 526 --33901 3141 2675 --
NM_014912chr1053252 2880 2603 2169 611 --12882 --
NM_014918chr1561280 1068 528 511 189 146 ------
NM_014920chr683816 3736 3483 3222 2540 2531 335 51 130 1512 --
NM_014921chr19192917 2877 2865 2838 2828 2738 2476 2284 2024 1229 1196 1178 1018 888 847 614 600 366 332 --62845 2754 2493 1198 1182 872 --
NM_014923chr1362277 1755 1713 573 239 228 21902 284 --21625 269
NM_014925chr123681 250 236 1778 2686 176 --
NM_014926chr32950 451 ----21153 119
NM_014932chr361813 1574 1463 1375 1280 709 --11608 --
NM_014933chr42381 264 ------
NM_014936chr662795 2342 2101 919 300 146 1461 22726 2130 --
NM_014939chr1851567 1351 1283 1193 442 --11355 --
NM_014945chr561719 1299 690 622 483 176 --41890 1339 1241 351 1300
NM_014946chr283017 2766 1905 1084 956 817 577 277 22637 534 12390 --
NM_014947chr11844 --142 --
NM_014949chr12709 672 21022 42 1139 --
NM_014950chr1421775 110 1334 1600 --
NM_014952chr1572061 2024 1372 830 549 374 235 1556 22026 584 1473
NM_014961chr441937 1750 765 287 21689 781 ----
NM_014964chr1751917 1537 971 174 126 --22059 975 --
NM_014974chr1091749 1548 708 558 536 522 308 278 264 ------
NM_014977chr142499 468 ------
NM_014978chr1051577 1293 287 280 233 1567 132 --
NM_014982chr1485194 4096 3616 3501 2137 1169 1143 663 31659 1441 290 43752 3276 2145 670 11930
NM_014988chr462584 2184 2068 815 315 171 ----12589
NM_014989chr631717 733 561 11998 1567 --
NM_014990chr142275 238 11358 --1437
NM_014991chr472798 2515 2374 2292 603 401 45 12319 1701 1863
NM_014992chr143290 251 105 ------
NM_014994chr1592324 2213 2154 1953 835 782 763 198 134 --1765 --
NM_014997chr792354 2268 2253 1030 860 652 250 190 178 12977 31126 194 140 --
NM_015000chr1272588 2219 2165 1138 1039 800 460 --11143 1266
NM_015001chr13925 165 34 2937 908 1269 --
NM_015002chr1282238 2013 1920 664 414 374 167 44 ------
NM_015008chr393281 3010 2546 2487 1297 897 811 530 238 12481 23140 2492 --
NM_015009chr31587 ------
NM_015015chr1931650 1643 266 1354 ----
NM_015017chr1--1133 ----
NM_015018chr6184 ------
NM_015020chr1693556 3523 3505 3350 3296 2606 1386 1218 1086 33598 1252 934 22368 606 --
NM_015023chr181672 1646 1453 1212 1125 676 309 90 --21566 1432 --
NM_015024chr821371 973 --21404 1335 --
NM_015025chr252425 2222 2030 887 853 --12050 11059
NM_015026chr1294600 4540 4530 4477 4464 4442 4285 3112 1715 24246 4135 13293 11220
NM_015027chr1641765 1738 1238 794 2308 157 ----
NM_015032chr1382798 2296 1933 896 807 703 516 23 22767 2757 ----
NM_015033chr962836 940 898 582 503 349 12567 42693 812 309 35 --
NM_015039chr1114111 3537 3514 3429 3234 2862 1340 950 677 480 437 12833 43415 3139 1522 195 --
NM_015042chr15214295 4251 4243 3916 3717 3680 3653 3636 3441 3431 3214 2874 2843 2804 1503 1432 1080 913 878 855 196 24302 826 34284 4261 3641 --
NM_015044chr16143259 3203 3146 2863 2674 2624 2554 2486 2237 2064 804 772 549 508 ------
NM_015045chr1021505 1424 11436 ----
NM_015046chr972396 2177 1777 1108 747 454 369 12262 11824 12145
NM_015051chr972849 1263 1121 859 368 345 29 12967 12959 --
NM_015052chr751098 1092 490 74 29 --31102 170 51 --
NM_015053chr162237 390 221 114 31 25 --2312 82 --
NM_015055chr11162884 2729 2452 2391 2031 963 920 853 782 775 730 606 573 555 488 430 --32264 2033 713 1478
NM_015056chr2162398 2102 931 880 756 697 52297 2084 1972 1820 669 21046 933 12460
NM_015057chr131205 1451 ----
NM_015059chr15153776 3644 3586 3260 3034 3010 2738 2429 1477 1140 866 575 513 413 337 ------
NM_015060chr72193 30 ------
NM_015063chr1991343 1263 1187 1142 498 387 192 185 127 ------
NM_015064chr1262838 2649 2334 922 896 819 1166 41037 576 544 449 --
NM_015068chr763909 2648 1586 1476 1244 290 ------
NM_015069chr162491 243 ------
NM_015071chr5126476 5880 5722 5272 4490 4320 2313 2285 2160 2083 1583 1476 12252 1905 --
NM_015072chr142400 394 1531 ----
NM_015074chr184288 3786 3705 3540 1739 1555 1022 356 --34598 3150 1743 --
NM_015075chrX82244 2052 1960 1570 843 357 194 140 --31901 1596 99 --
NM_015076chr6134474 4450 3523 3314 3275 2824 1815 1568 1360 1006 304 213 166 13812 24478 317 14227
NM_015079chr15113030 2403 2271 2165 1307 740 727 712 334 119 31 12827 3885 235 124 --
NM_015080chr1141013 895 386 372 --1174 --
NM_015082chr572167 2107 1809 876 677 511 499 1147 12395 --
NM_015086chr1271457 1064 616 555 95 79 66 ------
NM_015087chr1312251 32485 2338 2234 ----
NM_015089chr62134 109 ------
NM_015090chr1145891 5792 5164 5085 4259 4226 4080 2186 2097 1788 1239 1129 417 384 --66035 4742 4722 4712 657 581 15931
NM_015091chr14--163 ----
NM_015092chr16114584 4468 4133 4006 3909 3615 3542 3528 2853 1375 266 11875 ----
NM_015093chr63747 680 523 1634 ----
NM_015094chr2274470 3602 2885 1228 1116 863 668 14137 21125 800 14099
NM_015097chr352292 1473 689 561 292 --11480 --
NM_015100chr181909 1718 1645 1337 802 747 736 608 --1625 --
NM_015101chr162887 2239 2081 2002 1911 1860 --11885 --
NM_015102chr1198 --124 --
NM_015107chrX92447 1556 637 400 207 175 164 122 46 --41828 1521 1517 579 12450
NM_015115chr451046 1016 833 791 114 --12570 --
NM_015125chr192521 154 1488 ----
NM_015130chr461238 1229 1141 1087 971 81 1875 ----
NM_015132chr751752 1688 1280 726 276 11228 11574 --
NM_015137chr872550 2459 2336 1712 658 562 98 ------
NM_015138chr15112673 2412 1010 982 962 938 820 811 490 65 57 1755 4504 476 67 59 --
NM_015143chr431275 1131 326 ----135
NM_015144chr1683255 2565 2545 2513 1089 853 818 654 1125 ----
NM_015149chr182155 2107 1751 1689 1678 1348 657 529 ------
NM_015151chr212333 161 --21033 104 --
NM_015153chr61792 --1184 --
NM_015155chr1033306 2328 1188 ------
NM_015156chr14133630 3488 3153 3135 2993 1470 913 856 773 718 640 444 322 12570 13428 --
NM_015157chr1131112 779 446 --11004 --
NM_015161chr1631158 514 285 31462 1139 1031 ----
NM_015170chr81615 12017 ----
NM_015171chr162351 61 ------
NM_015172chr111187 --1596 --
NM_015176chr131471 1416 157 --11166 --
NM_015178chr842599 1060 426 66 1138 ----
NM_015186chr9--1124 --1330
NM_015191chr1162656 1851 1072 1046 827 167 ------
NM_015192chr2052988 1104 313 246 92 12528 ----
NM_015194chr1781689 1678 1668 1358 1325 617 172 141 --31817 1547 145 --
NM_015199chr372704 2577 2171 2088 2071 1952 617 1859 11959 11832
NM_015200chr492393 2267 1990 1769 638 545 516 241 154 ------
NM_015202chr1631706 1532 556 ------
NM_015206chr1543615 2978 2887 320 1240 22610 614 --
NM_015208chr1863510 2751 1516 1504 1254 505 1782 ----
NM_015209chr152273 2021 1769 1693 758 --21889 375 --
NM_015213chr111603 ------
NM_015215chr193181 3030 2777 2168 2126 746 549 331 307 ------
NM_015216chr531087 482 442 ------
NM_015225chr94944 661 378 252 22339 584 --1191
NM_015226chr1693453 3285 3200 2776 1358 1173 872 589 323 12392 52883 1369 920 695 591 11244
NM_015227chr21103256 3181 3114 2506 2311 2299 800 725 611 134 1836 13487 --
NM_015230chr431764 1592 1213 ----11804
NM_015235chr1061986 1875 1389 838 161 149 11997 --1781
NM_015236chr42979 227 --1218 --
NM_015238chr52734 539 1459 ----
NM_015242chr112544 49 --1497 --
NM_015245chr672574 2295 2245 2063 1751 589 580 11107 22025 1116 12066
NM_015246chr162233 169 ------
NM_015247chr16124930 4817 4573 4549 4068 3835 3645 2145 1035 878 675 368 23993 1206 44595 4307 2147 1193 25307 506
NM_015250chr961701 1650 1288 377 60 54 --21589 250 --
NM_015252chr25978 884 227 162 152 --1605 --
NM_015254chr863176 2907 2866 2235 404 97 22754 339 22933 406 --
NM_015256chr52621 129 ------
NM_015260chr1941580 1235 1052 471 --11552 --
NM_015263chr1551128 983 854 465 360 176 ----
NM_015264chr22134811 4542 4311 3999 3918 3587 3202 1804 1561 1303 910 886 190 24431 897 13332 --
NM_015265chr242464 2140 2119 1963 22154 667 --12067
NM_015267chr1221448 598 --21344 46 --
NM_015268chr31507 1667 192 --
NM_015270chr12112243 2220 2157 1881 1670 1540 931 405 349 255 216 --42245 1658 1644 389 --
NM_015271chr483095 2921 1637 1373 872 699 150 121 13717 1618 --
NM_015272chr1671985 1807 1692 655 514 244 192 12019 ----
NM_015277chr1831680 1147 190 ----1308
NM_015278chr673215 2450 2407 2209 2202 538 42 23415 574 11129 --
NM_015282chr2102686 2557 2486 1230 929 655 455 408 141 62 --12036 --
NM_015284chr1122101 2084 2074 2026 1896 1673 1571 1352 1311 276 262 89 11346 22086 1721 --
NM_015288chr5173478 3389 3199 3000 2834 2804 2718 2596 2508 2476 2459 1151 996 977 965 852 206 1941 42354 860 856 174 --
NM_015289chr1551925 1828 1727 594 553 --21883 1804 --
NM_015291chr193154 3025 2412 2280 1143 508 409 276 212 --3816 281 144 --
NM_015292chr125292 242 205 122 36 --1271 --
NM_015294chr1721084 781 ------
NM_015296chr132401 184 1280 ----
NM_015299chr1483814 3728 3365 2886 2814 1480 1270 986 --23292 63 --
NM_015305chr1491900 1892 1675 1615 1287 371 154 117 32 1210 21553 268 --
NM_015308chr112768 119 --1703 --
NM_015310chr8238026 7464 6719 6562 6535 6190 5886 5465 2822 2798 2730 2674 2638 2619 2490 1782 1711 1515 1231 983 880 273 62 35813 1987 1425 22737 1265 27469 989
NM_015313chr11214431 4410 4075 4051 3892 3656 3540 3471 3384 3326 3238 3184 3121 3087 2937 1907 1469 1458 1286 791 683 13636 13431 --
NM_015314chr731860 1650 488 1757 ----
NM_015315chr5173390 2944 2782 2683 2520 2334 2241 2173 2167 1033 995 962 861 745 572 237 199 --52946 2435 2184 2179 2175 --
NM_015317chr262789 2517 2465 2370 2127 457 22232 1003 22340 1114 --
NM_015320chr251015 409 385 378 62 --289 37 --
NM_015321chr19104416 4305 4128 4086 3988 3862 3571 3546 1780 919 13952 31888 1518 437 --
NM_015326chr1152809 2556 2373 2297 2118 2028 1987 1910 1816 1137 1014 907 741 726 183 166 22481 2069 --
NM_015327chr141245 975 508 479 --2371 258 1869
NM_015328chr7112683 2561 2318 1222 876 866 778 670 637 419 316 1715 52462 2322 619 601 506 12617
NM_015329chr19102919 2562 2058 969 922 899 764 540 424 92 12940 32105 1812 96 --
NM_015335chr1262472 2447 2439 1913 136 38 -----