TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4477b
miRNA Sequence: AUUAAGGACAUUUGUGAUUGAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr14272 211 173 76 1618 ----
NM_000038chr52428 285 42024 1818 302 82 ----
NM_000044chrX--1286 ----
NM_000045chr61413 --166 --
NM_000051chr11103489 2952 2561 2337 1236 1133 686 206 181 83 --12426 --
NM_000052chrX93188 3130 3109 2879 2854 2637 2486 576 570 43274 2920 1223 727 ----
NM_000067chr81272 2527 493 ----
NM_000081chr131409 620 36 21601 1416 1751 1275
NM_000084chrX166704 6526 6513 6158 4998 4826 4406 2728 2668 2548 2172 1999 1476 725 532 180 16015 11484 31967 1222 830
NM_000090chr22938 275 1670 ----
NM_000092chr263946 3184 1644 1633 1280 158 1510 24173 3135 11188
NM_000093chr912233 12460 ----
NM_000096chr32779 671 ----1958
NM_000097chr331000 934 103 --11025 1881
NM_000108chr7--1700 21858 1463 --
NM_000109chrX42512 2418 2162 344 --151 --
NM_000115chr1352235 2160 2124 267 34 1455 11811 --
NM_000125chr631161 439 160 23276 535 11606 --
NM_000135chr16------1966
NM_000141chr1041007 982 533 309 1971 2994 548 --
NM_000142chr421342 1129 ------
NM_000151chr1751777 1683 1364 723 604 ----11190
NM_000161chr1461831 1750 1688 1376 721 118 11210 ----
NM_000163chr542352 1924 1476 261 1829 --1422
NM_000165chr621700 1086 --1465 --
NM_000167chrX2322 74 11419 11394 --
NM_000176chr542708 2416 569 263 23359 28 --11031
NM_000202chrX83768 3315 3243 3015 2638 1256 877 185 43832 2858 767 562 ----
NM_000208chr1984511 4398 4019 1891 1855 766 546 146 11164 24261 4011 13454
NM_000210chr242352 1732 1691 851 31685 665 136 1403 137
NM_000214chr2021751 1316 1662 --156
NM_000217chr1295181 4806 4746 4120 2065 1607 1499 829 821 34507 1339 1143 21698 352 --
NM_000222chr421890 1605 ----32007 1466 1375
NM_000227chr181347 ------
NM_000242chr1052632 2545 2344 1831 27 12591 12058 22241 1881
NM_000245chr71158 168 --12106
NM_000248chr362039 1954 937 527 357 99 2993 493 32399 2215 1997 --
NM_000252chrX--2238 126 ----
NM_000254chr131939 1894 1174 22353 69 ----
NM_000259chr1596080 6010 4905 4872 4566 1635 1515 999 202 24208 1948 63885 2031 1906 1019 330 221 35769 2082 656
NM_000264chr913262 21220 335 --23016 1268
NM_000267chr1783461 3434 3006 2687 2444 728 692 71 --31155 627 194 --
NM_000276chrX42145 590 511 240 --1324 --
NM_000286chr17--1120 --2312 142
NM_000297chr461920 1826 1655 1622 1301 140 --12062 --
NM_000314chr1052982 2581 2427 749 591 22917 2813 ----
NM_000328chrX1325 ----198
NM_000330chrX42277 1594 626 250 ------
NM_000332chr686379 6266 6105 5499 5485 4413 2853 2064 35357 2023 1193 32298 1115 103 25890 2013
NM_000337chr5116469 5971 5351 5317 2289 2149 1710 1411 1212 1094 889 11516 --15091
NM_000340chr341413 1401 398 277 --31454 96 73 --
NM_000346chr1731869 1646 1640 21763 738 21296 1263 1148
NM_000351chrX94235 4149 3784 2939 2794 1636 519 497 360 33658 3483 334 13611 --
NM_000367chr631432 678 123 12209 12229 --
NM_000368chr954814 4120 3084 2957 490 13827 ----
NM_000390chrX93278 2847 2716 2674 2624 2574 2101 416 149 ------
NM_000393chr252129 1369 812 155 139 41969 1772 609 580 21418 567 1679
NM_000406chr452616 2379 1875 1150 273 --22079 1057 --
NM_000408chr272291 2269 2097 1058 809 800 140 32529 2151 816 ----
NM_000411chr2142904 2879 2301 334 43002 2294 2092 1111 2714 694 22334 772
NM_000421chr171346 --1288 --
NM_000428chr1462557 2267 2135 866 217 62 11994 12017 --
NM_000430chr1733571 1271 705 --23199 1179 13130
NM_000436chr511462 1347 11561 11087
NM_000439chr572299 2216 2136 1958 1859 96 46 12277 22546 1031 --
NM_000448chr1163071 2977 2235 1200 806 395 1872 ----
NM_000451chrX22013 443 ----22148 366
NM_000452chr1351932 1690 1345 664 338 --31360 319 173 145
NM_000454chr21133 2134 98 ----
NM_000461chr393849 3103 1764 1719 1675 1118 897 515 131 33394 355 161 --13857
NM_000480chr1131182 212 155 1422 --1525
NM_000484chr213382 320 204 --1959 --
NM_000489chrX143117 3049 3003 2650 2482 2449 2106 1129 826 697 661 413 385 208 23323 111 11267 1598
NM_000492chr721487 405 ----1239
NM_000493chr641017 792 747 220 --2785 230 --
NM_000495chrX51036 940 836 805 714 ------
NM_000508chr41121 1300 1900 1203
NM_000522chr72416 191 11267 1162 --
NM_000527chr1932326 815 678 11584 1553 12496
NM_000530chr131061 959 777 --1785 11113
NM_000544chr6_cox_hap193345 2936 2748 2553 2430 2232 2212 494 284 12088 ----
NM_000554chr1952882 1288 1136 1113 1067 1377 ----
NM_000555chrX186520 5886 5869 5854 5694 5641 5288 4830 4788 3004 2945 2710 2443 2358 2270 2042 1529 1360 --47147 6927 2309 1338 16689
NM_000574chr131318 189 58 21280 1029 21356 128 21333 921
NM_000578chr241221 545 502 236 ----11521
NM_000590chr51132 --152 --
NM_000599chr214364 24337 227 24591 1672 24536 1323
NM_000602chr731020 247 173 11313 --21507 1457
NM_000611chr11116928 6803 6403 6103 5079 2759 2250 1498 1240 699 340 11903 34784 908 509 25270 622
NM_000615chr11--22465 154 11097 --
NM_000618chr12116600 6021 5603 5156 5028 4437 4307 4064 1931 417 170 45626 4616 2222 1558 24449 1910 25846 4531
NM_000618chr12116600 6021 5603 5156 5028 4437 4307 4064 1931 417 170 45626 4616 2222 1558 24449 1910 25846 4531
NM_000621chr1321323 1152 1440 --2453 257
NM_000633chr1845229 3943 3729 783 41808 1689 1391 700 24913 1215 --
NM_000635chr1951586 1536 1298 327 272 11387 --11566
NM_000663chr1642454 1142 713 303 11903 --13122
NM_000684chr1031164 304 200 11036 ----
NM_000685chr3--1868 ----
NM_000685chr3--1868 ----
NM_000693chr1531543 726 487 1258 11595 --
NM_000702chr132258 2184 2150 ------
NM_000719chr1245503 4932 4593 1802 15661 36742 2177 999 --
NM_000721chr152659 1873 1679 909 398 --21691 723 12538
NM_000726chr22168 73 11436 --11116
NM_000743chr1571121 1021 946 474 453 387 36 ------
NM_000783chr10------1140
NM_000788chr431087 402 88 11457 21258 528 1389
NM_000793chr1463732 3665 3653 1264 753 211 --13317 33192 1792 463
NM_000794chr51271 1948 --1777
NM_000801chr204905 817 808 22 ----1894
NM_000806chr541548 525 463 118 31521 696 99 ----
NM_000809chr4209018 8613 8148 6969 6784 6760 6512 6147 6080 6023 3520 3326 2299 2197 1996 857 586 443 392 86 47660 6687 3097 2234 78425 7744 7415 7049 3214 2529 2376 49161 9086 8031 3628
NM_000813chr5115078 3783 1848 1666 1259 1207 470 409 313 193 117 24862 1150 55378 4626 4130 1370 1106 23981 1699
NM_000814chr1573628 2649 1448 1056 980 456 363 --23108 2979 13176
NM_000816chr53648 591 31 1457 ----
NM_000824chr41147 2805 741 ----
NM_000826chr442633 2382 1700 770 --1787 1282
NM_000827chr562115 776 577 438 431 383 ----12357
NM_000838chr682687 2613 2391 2360 1873 1736 546 158 22191 1960 --12059
NM_000859chr521375 1329 --11116 --
NM_000868chrX21866 82 --4949 787 719 64 12040
NM_000872chr1021389 1261 11039 ----
NM_000875chr15106962 6024 5590 4727 4377 2179 1365 251 242 225 12415 55173 4968 4432 1835 1204 --
NM_000876chr631210 1004 101 ------
NM_000891chr1773272 3260 2845 1241 1124 375 325 32735 829 789 12863 --
NM_000899chr1253946 3323 1365 817 122 53694 3618 2814 2723 82 13148 11708
NM_000901chr452577 2512 2027 603 31 12419 1793 12073
NM_000908chr5----143 --
NM_000912chr863465 3131 2333 1050 995 677 33500 3282 2549 13420 13180
NM_000917chr104917 842 766 70 2990 212 1680 --
NM_000919chr52406 209 ------
NM_000922chr114983 779 145 126 ----1205
NM_000935chr331156 979 343 2441 196 31207 775 176 --
NM_000944chr442320 2045 654 400 1548 1702 --
NM_000945chr262059 1919 1561 589 448 378 1202 ----
NM_000949chr53878 771 682 --1782 1593
NM_000950chrX93623 3503 3346 3131 3066 980 940 719 143 32523 518 330 33208 2304 2240 13380
NM_000956chr1441014 764 64 23 ------
NM_000958chr5--11026 1905 --
NM_000961chr2063709 3121 3096 2440 907 367 23191 516 --32585 787 488
NM_000962chr992934 2759 2417 2067 886 360 259 199 137 32643 973 82 --12162
NM_000989chr8158 ------
NM_001001323chr1253185 2937 1938 1253 790 ----11055
NM_001001330chr1011190 21147 813 11180 1475
NM_001001342chr1031274 1050 958 21097 537 1356 --
NM_001001344chrX32624 2415 2059 11967 ----
NM_001001395chr1242386 2333 2265 784 51968 883 739 686 660 22406 2076 --
NM_001001396chr194333 3549 3523 3412 2985 2733 1478 971 535 --11112 --
NM_001001419chr595237 5231 5195 4121 4108 3655 1700 935 927 44604 4310 3823 262 14686 34998 4578 4569
NM_001001420chr595237 5231 5195 4121 4108 3655 1700 935 927 44604 4310 3823 262 14686 34998 4578 4569
NM_001001433chr2031961 874 525 12741 --23033 413
NM_001001481chr893087 3080 2932 2784 2430 1093 1067 329 81 1489 --1569
NM_001001483chr11------1343
NM_001001484chr1031901 873 28 11967 1421 21649 964
NM_001001521chr2144 2243 220 ----
NM_001001556chr1521461 303 1189 --21630 1383
NM_001001557chr822229 343 1845 --12042
NM_001001664chr273758 3541 3360 3347 1327 930 251 41351 1174 212 180 31489 1390 1000 22859 435
NM_001001701chr452170 2086 1507 889 465 ----1207
NM_001001715chr133595 402 390 ------
NM_001001787chr11358 ------
NM_001001890chr2163686 3608 2880 2638 483 380 33671 3210 1728 1635 24022 1116
NM_001001924chr821673 1305 --21976 1681 --
NM_001001925chr821673 1305 --21976 1681 --
NM_001001928chr2278342 8180 7970 5436 1740 1169 104 47509 7148 868 111 25394 2737 37271 6098 2870
NM_001001931chr821673 1305 --21976 1681 --
NM_001001974chr10102357 2258 2095 1637 1525 838 753 414 292 131 21943 1513 --1187
NM_001001995chrX41219 764 521 182 --2353 332 --
NM_001002233chr852045 1953 1730 741 229 3662 412 390 ----
NM_001002255chr61329 ----142
NM_001002257chr2113524 3206 3147 3119 2874 2749 1360 1024 890 764 104 23326 1040 32765 1071 499 1302
NM_001002295chr1021116 782 ------
NM_001002814chr843695 954 741 229 51330 1291 662 412 390 ----
NM_001002838chrX41691 1448 1162 281 11428 11350 21629 408
NM_001002843chr151370 ----31217 1197 850
NM_001002860chr14104290 3451 3343 3332 3320 3064 1541 1231 449 275 ----24421 3041
NM_001002876chr22----1370 --
NM_001002909chr1711579 --32136 907 774 --
NM_001002919chr2177 ------
NM_001003406chr2253030 2476 702 677 52 22896 556 1736 --
NM_001003652chr18158332 7919 7637 7615 7475 7297 6605 6442 3416 3165 2886 2459 1859 1786 615 57289 7274 6144 3256 3144 78318 5722 5571 5371 5312 1364 609 17167
NM_001003674chr18136951 6276 5734 5364 4969 4720 4523 2637 2508 1954 1604 1263 592 35309 2064 1812 27046 2562 26246 1373
NM_001003675chr18136951 6276 5734 5364 4969 4720 4523 2637 2508 1954 1604 1263 592 35309 2064 1812 27046 2562 26246 1373
NM_001003679chr152081 1647 1590 1550 1383 1423 --1619
NM_001003681chr2231723 752 339 1283 ----
NM_001003688chr43991 355 99 ------
NM_001003698chr641993 760 583 225 --1727 31416 528 287
NM_001003699chr641993 760 583 225 --1727 31416 528 287
NM_001003712chr1283481 2965 2793 1552 1126 743 540 79 --43912 1562 1162 810 23390 1259
NM_001003760chr663683 3236 2790 2472 961 423 1153 11142 13530
NM_001003800chr993532 3512 3365 2957 2909 2400 1487 1047 90 --23195 803 --
NM_001003845chr21553 ------
NM_001004065chr943796 2902 2587 119 22601 1011 ----
NM_001004196chr321218 130 --11060 --
NM_001004303chr1--1678 ----
NM_001004303chr1--1678 ----
NM_001004317chr663923 3812 3795 958 648 318 23672 979 24226 3893 12845
NM_001004329chr1221498 544 --1351 1939
NM_001004342chr1146082 5801 5759 4827 4776 4523 4417 4202 1974 1875 1601 1319 905 528 14985 34237 3680 2022 1914
NM_001004360chr2--11569 11522 2696 623
NM_001004419chr1284213 4114 3536 3117 990 677 159 103 --54591 4536 4056 1430 714 --
NM_001004720chr22976 119 ----1303
NM_001004722chr221145 288 ----1472
NM_001005266chr151717 --1733 --
NM_001005267chr151717 --1733 --
NM_001005268chr151717 --1733 --
NM_001005269chr151717 --1733 --
NM_001005368chr10128 ------
NM_001005375chrY21710 238 ----11512
NM_001005386chr262208 1765 527 496 377 328 31974 1940 506 --12367
NM_001005404chr1753620 3329 1734 1507 1124 --1275 --
NM_001005463chr102999 797 22179 1697 --11713
NM_001005473chr5116525 6350 5288 5179 4568 2348 2168 1609 1545 1281 853 45331 4824 761 459 46603 6253 5203 4860 1841
NM_001005474chr341135 1059 652 428 --1370 1542
NM_001005527chr32833 410 --1927 1982
NM_001005732chr21169 ------
NM_001005733chr21169 ------
NM_001005746chr22168 73 11436 --11116
NM_001005747chr22168 73 11436 --11116
NM_001005845chr81763 11294 --11434
NM_001005849chr171398 --1512 142
NM_001005861chr31284 2405 130 1701 --
NM_001005910chr31226 1567 1520 --
NM_001005911chr31226 1567 1520 --
NM_001006115chr342173 985 559 247 22488 2023 1492 --
NM_001006600chr552227 2010 1814 1603 343 12155 11981 --
NM_001006605chr131166 473 327 1261 --1866
NM_001006605chr131166 473 327 1261 --1866
NM_001006610chr161384 ------
NM_001006617chr931111 415 335 11217 --2477 357
NM_001006619chr931111 415 335 11217 --2477 357
NM_001006620chr931111 415 335 11217 --2477 357
NM_001006621chr931111 415 335 11217 --2477 357
NM_001006623chr251620 835 675 364 335 32334 2271 872 32254 2225 200 --
NM_001006933chrX295 89 ------
NM_001006935chrX2371 37 ------
NM_001006936chrX2371 37 ------
NM_001006937chrX2371 37 ------
NM_001006944chr11--1705 ----
NM_001007023chr1463732 3665 3653 1264 753 211 --13317 33192 1792 463
NM_001007024chr1764182 4140 3755 3439 3155 3120 23056 3024 22960 1652 --
NM_001007025chr1764182 4140 3755 3439 3155 3120 23056 3024 22960 1652 --
NM_001007097chr963849 3841 3271 1605 1525 271 31777 1189 683 24869 692 --
NM_001007098chr12853 88 --1715 --
NM_001007099chr11623 --1127 1832
NM_001007100chr11623 --1127 1832
NM_001007102chr651680 1432 1240 668 163 21227 40 ----
NM_001007156chr1551778 721 260 145 22 1760 11957 --
NM_001007237chr142104 1993 751 329 1997 2535 386 --
NM_001007246chr2141882 1589 1536 1300 --1268 21710 336
NM_001007257chr121023 29 ------
NM_001007267chr25829 236 229 161 84 ----1865
NM_001007466chr665156 5131 5033 5017 4457 674 1428 ----
NM_001007538chr1331670 1645 277 ------
NM_001007544chr1144 183 1441 1468
NM_001007559chr1811413 ------
NM_001007794chr12520 127 1493 1768 --
NM_001008222chrX1124 ------
NM_001008225chr71185 ------
NM_001008226chr1521781 1402 21251 159 21279 199 --
NM_001008239chr1893689 3397 3388 3078 2718 1414 1198 663 463 13424 12681 23477 507
NM_001008391chr111695 ----1184
NM_001008392chr322667 993 12392 --2804 238
NM_001008401chr1911505 177 11296 11096
NM_001008408chr7105914 5685 5335 5174 4485 3965 2390 1896 1338 26 24927 2320 25542 4765 24455 2431
NM_001008495chr852094 638 514 323 211 1872 --22128 757
NM_001008540chr21131 --1368 --
NM_001008541chr1042273 1698 1499 724 21481 70 11801 1100
NM_001008541chr1042273 1698 1499 724 21481 70 11801 1100
NM_001008660chr1141529 1212 597 60 2102 93 21188 534 21108 1040
NM_001008707chr1461895 1433 1386 285 138 98 11185 ----
NM_001008726chr1431601 376 222 1265 1572 11086
NM_001008738chr562685 2428 2315 2182 806 433 32464 1022 632 12164 22299 906
NM_001008744chr1421422 1319 21137 90 1198 --
NM_001008777chr17----1616 --
NM_001008783chr62626 619 1909 ----
NM_001008801chr1942141 1984 1976 1970 1216 11772 --
NM_001008860chr153728 636 537 ----2840 102
NM_001008892chr153728 636 537 ----2840 102
NM_001008894chr153728 636 537 ----2840 102
NM_001008895chr1311379 21462 296 21288 411 --
NM_001008925chr483147 3108 2904 1101 1041 873 499 240 12721 23127 2459 --
NM_001009185chr5----1147 1529
NM_001009554chr4124755 4032 3651 3617 1611 1373 907 752 526 279 110 51 44063 1588 1396 132 14324 11067
NM_001009554chr4124755 4032 3651 3617 1611 1373 907 752 526 279 110 51 44063 1588 1396 132 14324 11067
NM_001009555chr461700 1138 589 464 56 25 ------
NM_001009814chr13------130
NM_001009880chr2254798 4431 4112 3566 3157 13858 14478 13141
NM_001009881chr11471 ----1423
NM_001009882chr11471 ----1423
NM_001009894chr1241615 1495 1380 426 21570 472 --1502
NM_001009899chr386282 5505 5257 4786 4393 2391 655 458 64621 4508 1954 1240 983 334 35728 4482 2382 34213 1740 692
NM_001009909chr1163846 3525 3173 3086 2871 378 22699 1039 21275 173 --
NM_001009923chr205841 692 595 377 51 ------
NM_001009959chr242447 1930 1635 535 1198 --1906
NM_001009960chr752389 2353 1041 295 205 ------
NM_001009993chr221798 847 23446 194 1102 --
NM_001010853chr632985 2396 919 33024 355 93 1292 12367
NM_001010861chr122141 2128 ----1282
NM_001010867chr156275 6041 5772 4199 2582 11553 34099 2315 1762 12242
NM_001010888chrX144442 3837 3646 3265 3170 3042 3017 2956 1699 1270 1247 1179 413 24 11729 ----
NM_001010891chr566747 6316 4809 832 393 273 46766 5798 1235 524 45650 4488 4337 1413 --
NM_001010895chr93720 491 108 --31560 785 537 --
NM_001010908chr103625 559 233 1524 --1667
NM_001010924chr101811 1864 1802 11215
NM_001010984chr152594 2279 2033 1964 779 11716 1594 --
NM_001010986chrX31668 416 129 1563 11962 1938
NM_001010989chr162226 210 1516 ----
NM_001010990chr162226 210 1516 ----
NM_001011513chr453785 3107 2905 2620 348 31417 396 139 14027 21120 451
NM_001011537chr352162 2139 1894 1843 425 11943 32174 1678 1590 1211
NM_001011546chr203829 320 203 --1800 --
NM_001011551chrX1349 ----1183
NM_001011553chr73875 759 630 1173 ----
NM_001011645chrX--1286 ----
NM_001011658chrX52105 1977 1797 1464 201 ----12145
NM_001011666chr7166361 6277 5710 5568 5473 4956 4536 4496 2583 2099 1847 958 629 509 431 303 25813 2384 11153 11722
NM_001011713chr14--11624 31226 645 375 21040 345
NM_001011720chr851063 602 305 103 29 --11426 --
NM_001011885chr154654 404 395 330 21658 1312 ----
NM_001012267chr931489 1415 700 --1441 1431
NM_001012279chr61524 ----1138
NM_001012333chr111117 ------
NM_001012334chr111117 ------
NM_001012393chr1174509 4348 3534 3378 2025 268 55 14962 34591 1399 463 11145
NM_001012410chr32164 70 2492 464 1512 125
NM_001012420chr1562821 2698 2028 1865 1020 439 12005 1987 --
NM_001012423chr1562821 2698 2028 1865 1020 439 12005 1987 --
NM_001012478chr192532 510 ------
NM_001012716chr181100 1107 1283 --
NM_001012732chr441265 1155 149 92 --21097 401 --
NM_001012751chr1061868 1610 1263 552 78 30 1729 ----
NM_001012754chr1321665 1484 21471 830 ----
NM_001012761chr552417 1825 1695 1078 572 22699 560 1917 12539
NM_001012968chrX92435 1940 1020 965 928 490 334 318 145 22470 1106 42637 2239 2025 828 --
NM_001012977chrX11372 --1570 --
NM_001012979chrX295 89 ------
NM_001012989chrX1457 ------
NM_001013031chr1043181 2478 1220 146 ------
NM_001013399chr6--1441 3924 287 156 --
NM_001013415chr431587 1063 302 11541 ----
NM_001013439chr34595 336 216 96 ------
NM_001013620chr1288444 6606 5337 5260 2011 1981 1785 1106 45247 2307 1258 711 27832 506 26941 2541
NM_001013659chr1943385 1570 1383 1065 34586 3335 1038 24658 359 13418
NM_001013699chr121437 1466 ----
NM_001013717chr51392 21106 1060 ----
NM_001013734chr63688 629 208 ------
NM_001014380chr13105817 5458 4811 4333 4230 1359 1173 1090 683 660 32197 2187 2178 34680 4017 3592 --
NM_001014434chr11192 1297 ----
NM_001014797chr1057952 7421 2150 710 202 43102 1507 1371 289 47267 3029 2499 487 11581
NM_001014839chr13951 881 734 ------
NM_001014841chr13951 881 734 ------
NM_001015045chr452414 1919 1643 1631 464 21932 165 ----
NM_001015048chr1443229 3071 2478 2426 22250 810 1757 12590
NM_001015049chr1443229 3071 2478 2426 22250 810 1757 12590
NM_001015877chrX32580 2320 1174 --12328 --
NM_001015880chr1061711 1605 1443 662 528 226 11552 21502 297 11428
NM_001015887chr341844 1721 1373 98 --1403 --
NM_001017368chr1752543 2512 1118 900 461 12307 3857 807 554 --
NM_001017369chr41136 1724 --1346
NM_001017371chr2173 21092 886 11318 --
NM_001017395chr3103580 2975 2556 1289 1250 813 598 592 268 240 22820 256 33028 1381 1300 --
NM_001017415chr12520 80 1703 1242 1818
NM_001017416chr12520 80 1703 1242 1818
NM_001017424chr13441 58 22 --1354 11691
NM_001017425chr13441 58 22 --1354 11691
NM_001017440chr7138062 7593 7565 5274 3212 3178 2820 1998 1452 1045 610 218 183 17228 38190 5477 2066 26218 2732
NM_001017523chr122722 616 --21784 1333 --
NM_001017923chr1421040 593 11666 ----
NM_001017926chr81628 21838 1317 --11538
NM_001017962chr104917 842 766 70 2990 212 1680 --
NM_001017977chr1170 ------
NM_001017995chr5104717 4588 4534 4265 4098 3589 1897 262 72 38 11488 ----
NM_001017999chr131695 761 605 11797 11720 --
NM_001017999chr131695 761 605 11797 11720 --
NM_001018000chr131695 761 605 11797 11720 --
NM_001018000chr131695 761 605 11797 11720 --
NM_001018001chr131695 761 605 11797 11720 --
NM_001018009chr331200 1172 138 1846 1988 2910 893
NM_001018038chr93572 454 167 154 ----
NM_001018064chr941835 561 364 300 ------
NM_001018065chr995976 5436 5168 4813 4721 4256 1103 895 225 33767 1776 1501 3426 309 134 21798 1571
NM_001018066chr995976 5436 5168 4813 4721 4256 1103 895 225 33767 1776 1501 3426 309 134 21798 1571
NM_001018067chr141027 782 679 614 11501 13511 15045
NM_001018068chr141027 782 679 614 11501 13511 15045
NM_001018069chr141027 782 679 614 11501 13511 15045
NM_001018072chr122722 616 --21784 1333 --
NM_001018074chr542708 2416 569 263 23359 28 --11031
NM_001018075chr542708 2416 569 263 23359 28 --11031
NM_001018076chr542708 2416 569 263 23359 28 --11031
NM_001018077chr542708 2416 569 263 23359 28 --11031
NM_001018090chr1592550 2476 2240 2219 2154 1927 851 563 329 --22058 287 22265 1094
NM_001018091chr15102660 2586 2350 2329 2264 2037 1802 961 673 439 --22168 397 12375
NM_001018100chr151701 ------
NM_001018102chr1592550 2476 2240 2219 2154 1927 851 563 329 --22058 287 22265 1094
NM_001018108chr1581892 1862 1484 1408 852 823 738 360 32000 1553 519 1278 11569
NM_001018111chr753986 3011 890 602 141 1684 ----
NM_001020658chr141676 1488 1367 1167 1370 ----
NM_001020658chr141676 1488 1367 1167 1370 ----
NM_001023560chr62938 846 ----1157
NM_001023567chr1542213 2085 1886 441 12369 1995 --
NM_001024024chr143885 804 742 1264 ----
NM_001024070chr143881 800 738 1260 ----
NM_001024094chr542708 2416 569 263 23359 28 --11031
NM_001024218chr141187 --2852 652 1331
NM_001024372chr882245 2057 2000 1658 1441 657 648 476 21727 183 2819 666 --
NM_001024647chr1296781 6722 6494 5039 4988 1798 1179 377 182 35501 4895 3006 12063 46875 6757 1987 1857
NM_001024649chr532206 884 84 32114 1938 157 22584 322 11840
NM_001024660chr351653 1423 1358 1045 334 1132 1454 --
NM_001024688chr862156 1799 1720 1598 1396 362 32183 1954 803 12211 --
NM_001024807chr191226 --1258 --
NM_001024808chr1291838 1815 1763 739 624 467 434 222 209 11801 2918 591 --
NM_001024847chr322252 1532 31770 791 371 1782 --
NM_001024916chr91318 1110 ----
NM_001024937chr171502 ------
NM_001024947chr52952 283 3210 63 55 --1356
NM_001024948chr162842 2757 2682 2671 2261 518 32171 1213 859 43455 3409 3295 529 13374
NM_001024956chr1155721 5566 3587 2092 199 24412 1333 64889 3638 2054 2047 1369 22 24960 4654
NM_001025068chr34668 391 338 144 --11672 1727
NM_001025069chr34668 391 338 144 --11672 1727
NM_001025076chr10106005 5525 4562 4387 2387 2368 2068 826 335 42 14867 14307 16088
NM_001025077chr10107363 6883 5920 5745 5113 2184 1693 1390 444 42 36225 5027 1338 15665 27446 713
NM_001025079chr342587 1567 1393 82 53563 3556 3152 1051 720 33462 3208 2660 --
NM_001025105chr51445 11567 11354 21248 497
NM_001025107chr132745 2682 480 1306 12157 12493
NM_001025107chr132745 2682 480 1306 12157 12493
NM_001025108chr274080 2891 2546 1626 1481 969 388 ------
NM_001025201chr21585 ------
NM_001025232chr12147 ----1353
NM_001025252chr883121 3004 2876 2489 2426 2373 1218 472 32939 2109 428 1409 --
NM_001025253chr883121 3004 2876 2489 2426 2373 1218 472 32939 2109 428 1409 --
NM_001025389chr1131182 212 155 1422 --1525
NM_001025390chr1131182 212 155 1422 --1525
NM_001025580chrX84042 3742 3487 997 990 455 322 260 24304 3269 33700 2784 599 23102 2907
NM_001025595chr431670 153 130 --1425 --
NM_001025780chr91600 1583 --11379
NM_001029863chr672645 2241 2096 1307 1136 1095 728 --11197 --
NM_001029875chr562818 2574 2191 1903 594 118 ----1418
NM_001029884chr662598 1730 723 478 315 35 22582 928 ----
NM_001030006chr1762632 2237 1820 620 247 59 ----11814
NM_001030007chr16103808 3763 3518 3015 2930 2862 2442 1014 785 26 31607 835 158 ----
NM_001030055chr14144702 4102 3853 3839 3758 3482 2966 1813 1758 1361 800 711 573 147 34624 4221 1012 23683 1716 2989 945
NM_001031623chr641747 1119 627 588 31728 1410 37 1344 --
NM_001031679chr1273577 3308 2878 2271 558 422 73 23457 3392 23327 2820 --
NM_001031681chr171405 1461 --11611
NM_001031684chr241471 1145 1124 404 11098 2499 274 --
NM_001031695chr2285329 5315 4578 4382 3565 1043 832 207 1194 ----
NM_001031710chr72890 727 --2864 165 --
NM_001031723chr42462 38 2490 162 ----
NM_001031732chr433505 800 286 43707 3677 3651 1433 --13528
NM_001031804chr1654072 3581 2910 1284 1227 12885 12862 13358
NM_001031812chr562025 1951 1886 1581 646 337 31787 813 207 21441 476 --
NM_001032280chr631687 1493 1405 11116 1608 11153
NM_001032288chr2051521 1139 999 535 147 11194 1528 --
NM_001032293chr171103 ------
NM_001032296chr1352726 1914 1872 777 376 22854 819 12924 21032 295
NM_001032363chr171879 1673 1560 1416 907 893 466 31989 207 121 ----
NM_001032363chr171879 1673 1560 1416 907 893 466 31989 207 121 ----
NM_001032380chr1031980 1697 727 ----1227
NM_001032394chr632641 1077 1062 12046 2670 142 --
NM_001033025chr181404 1261 1163 507 412 306 237 204 1980 21190 1097 --
NM_001033044chr121567 616 1599 1631 1428
NM_001033047chr451819 1741 853 433 322 1943 1633 1194
NM_001033056chr121567 616 1599 1631 1428
NM_001033057chr3181 ----1459
NM_001033059chr61479 --1566 1777
NM_001033085chr22122 73 ----3328 302 246
NM_001033087chr2042085 2038 251 204 12343 --11327
NM_001033112chr51726 1342 --1795
NM_001033117chr343550 3299 1260 893 13501 13262 24561 4526
NM_001033503chr52481 410 ------
NM_001033557chr211310 3406 174 53 11142 --
NM_001033564chr661259 530 400 358 345 123 1236 --11325
NM_001033566chr173667 605 63 ------
NM_001033568chr173667 605 63 ------
NM_001033576chr1752555 2440 2267 331 217 11791 12150 --
NM_001033578chr832186 2130 249 21906 1690 ----
NM_001033602chr13----1599 --
NM_001033723chr852707 2406 2205 1768 745 ----11811
NM_001033910chr151933 1499 1445 433 413 --21751 121 --
NM_001033925chr1041842 1342 309 219 11696 ----
NM_001034194chr4--1145 ----
NM_001034837chr53817 661 56 ------
NM_001034838chr53817 661 56 ------
NM_001034845chr4--2880 497 --21269 963
NM_001034850chr561163 1025 545 428 338 103 21205 1059 ----
NM_001034954chr1032653 2213 786 1352 12415 22301 2019
NM_001034955chr1032653 2213 786 1352 12415 22301 2019
NM_001034956chr1032653 2213 786 1352 12415 22301 2019
NM_001034957chr1032653 2213 786 1352 12415 22301 2019
NM_001035chr13530 521 367 ------
NM_001035260chr1021116 133 ----11378
NM_001035511chr161777 1481 1436 1387 582 27 11732 --1665
NM_001035512chr191884 1588 1543 1494 1430 689 134 98 71 11839 --1772
NM_001035513chr191884 1588 1543 1494 1430 689 134 98 71 11839 --1772
NM_001037132chr7--11989 1644 --
NM_001037133chr7--11989 1644 --
NM_001037163chr73940 778 96 2625 208 ----
NM_001037164chr721486 1300 1314 --1187
NM_001037165chr777378 7299 6902 6525 6409 5981 3366 18507 ----
NM_001037174chr21846 21743 1440 12019 11595
NM_001037317chr122141 2128 ----1282
NM_001037332chr532256 1947 1700 --12016 12480
NM_001037333chr532256 1947 1700 --12016 12480
NM_001037334chr1822063 686 1571 ----
NM_001037494chr12--1261 ----
NM_001037495chr12--1261 ----
NM_001037553chr2165163 4881 4523 3863 1080 104 --24042 1988 1317
NM_001037631chr211015 --1159 1466
NM_001037872chr21520 1744 ----
NM_001037954chr1173340 3190 3160 2640 875 656 226 1283 1732 1807
NM_001038707chr151534 718 685 547 532 21651 361 --2377 90
NM_001038707chr151534 718 685 547 532 21651 361 --2377 90
NM_001039199chr2094879 4023 3335 1737 699 561 309 176 98 11045 21242 27 23870 220
NM_001039395chr922233 481 22221 127 12209 22313 71
NM_001039538chr252488 1356 1225 844 89 ----12295
NM_001039547chr3137752 7193 7022 6423 6303 5219 4992 4887 3196 2505 828 625 615 23083 602 65130 4909 1831 1501 419 411 16577
NM_001039569chr233289 2668 990 1635 ----
NM_001039570chr2264509 4361 3483 1270 727 441 11762 --13130
NM_001039571chr2264509 4361 3483 1270 727 441 11762 --13130
NM_001039573chr172389 349 ----1489
NM_001039577chr133870 3506 1051 2286 242 11535 21818 432
NM_001039580chr453541 3302 1464 1142 266 23932 3606 13088 23634 3261
NM_001039585chr141234 1149 598 82 --23053 115 24173 205
NM_001039590chrX43966 2507 831 758 1535 33317 2477 274 --
NM_001039591chrX43966 2507 831 758 1535 33317 2477 274 --
NM_001039618chr11145880 5638 5127 4853 4446 4306 2228 1903 1586 1335 993 342 71 21 75821 4863 2159 1946 1221 778 131 15628 15295
NM_001039762chr1082378 1955 1711 776 728 377 194 35 11642 ----
NM_001039840chrX115928 5686 5179 4265 4258 4150 4094 3997 3867 106 49 55484 3730 3688 2027 1559 24953 1592 24743 2000
NM_001039937chr1384165 3707 3174 2547 1367 1073 1003 842 33907 797 319 33001 2685 1570 1307
NM_001039960chr1231437 272 116 11069 21059 650 11484
NM_001040020chr72986 44 --1595 11332
NM_001040057chr731503 1000 515 --1340 --
NM_001040100chr34432 402 361 170 ----1978
NM_001040142chr222404 2100 ------
NM_001040143chr222404 2100 ------
NM_001040152chr743107 1566 1399 805 33854 3222 1720 --14776
NM_001040159chr441211 435 407 202 --11351 --
NM_001040181chr341126 964 932 191 11057 ----
NM_001040182chr341126 964 932 191 11057 ----
NM_001040183chr341126 964 932 191 11057 ----
NM_001040199chr341126 964 932 191 11057 ----
NM_001040200chr341126 964 932 191 11057 ----
NM_001040202chr41954 2962 603 1322 1188
NM_001040214chr652048 1587 1488 815 563 ------
NM_001040284chr1695417 5392 4165 3673 1305 1225 1189 1157 641 35313 4942 4781 --13926
NM_001040402chr432546 2374 1018 32849 2329 2012 1760 52882 2450 2319 2038 725
NM_001040429chr1321374 115 13514 33371 3134 2622 --
NM_001040441chr134926 4158 1089 2349 111 14123 1689
NM_001040446chr542640 2618 1968 847 --22035 99 12069
NM_001040450chr1552500 2188 747 515 184 42639 901 894 544 12308 --
NM_001040453chr1552500 2188 747 515 184 42639 901 894 544 12308 --
NM_001040665chr7114810 4671 4569 4376 4236 3326 3080 1681 1226 867 676 13958 --24342 4265
NM_001040712chr943522 3359 3202 2754 --31050 496 95 11078
NM_001042355chr16115332 5156 4982 4237 4166 1892 1296 593 421 370 263 14453 15277 14014
NM_001042388chr184605 388 312 212 1259 1811 --
NM_001042403chr121256 21022 838 1360 --
NM_001042404chr141937 1591 1328 1286 --31379 445 127 11555
NM_001042412chr16115332 5156 4982 4237 4166 1892 1296 593 421 370 263 14453 15277 14014
NM_001042413chr953184 3045 2881 610 38 53975 3202 2761 2582 302 ----
NM_001042425chr631687 1493 1405 11116 1608 11153
NM_001042440chr54791 746 459 398 11575 11242 1302
NM_001042441chr54791 746 459 398 11575 11242 1302
NM_001042442chr54791 746 459 398 11575 11242 1302
NM_001042443chr54791 746 459 398 11575 11242 1302
NM_001042444chr54791 746 459 398 11575 11242 1302
NM_001042445chr54791 746 459 398 11575 11242 1302
NM_001042446chr54791 746 459 398 11575 11242 1302
NM_001042453chrX1314 --1277 1478
NM_001042459chr33313 279 250 ------
NM_001042473chr1031702 1678 1604 1262 ----
NM_001042481chr1472644 2455 1997 1869 169 120 70 22076 1805 22068 997 --
NM_001042492chr1783461 3434 3006 2687 2444 728 692 71 --31155 627 194 --
NM_001042494chr1573216 2383 1111 1079 965 663 515 23368 2828 --138
NM_001042495chr1573216 2383 1111 1079 965 663 515 23368 2828 --138
NM_001042496chr1573216 2383 1111 1079 965 663 515 23368 2828 --138
NM_001042497chr1573216 2383 1111 1079 965 663 515 23368 2828 --138
NM_001042510chr871867 1474 1458 546 419 225 57 11489 21960 845 --
NM_001042511chr871867 1474 1458 546 419 225 57 11489 21960 845 --
NM_001042517chr133870 252 207 --1324 --
NM_001042533chr383241 3071 2746 2608 2216 2204 729 96 ----21092 336
NM_001042537chrX42308 969 409 184 --11571 1311
NM_001042543chr42575 435 11457 21508 352 --
NM_001042548chr23701 330 155 --1799 --
NM_001042550chr961836 678 563 242 175 127 ------
NM_001042555chr1274540 4452 4019 3525 1783 1754 1128 21898 692 23380 140 1176
NM_001042599chr2117316 7295 7025 6447 6150 5856 2657 2338 1489 795 706 26897 2166 27034 5567 1811
NM_001042601chr373288 1260 1176 1148 532 519 221 11003 12080 1583
NM_001042603chr1241919 1687 132 55 24421 1318 55072 3888 3567 1984 1573 14789
NM_001042604chr394688 4556 4401 4306 1565 1266 1190 553 191 32955 1729 1331 --23936 3627
NM_001042681chr142148 1891 689 117 11792 1307 --
NM_001042682chr142148 1891 689 117 11792 1307 --
NM_001042682chr142148 1891 689 117 11792 1307 --
NM_001042683chr691569 1520 1300 1140 736 727 546 420 304 1703 1208 --
NM_001042749chrX41756 1411 727 220 ------
NM_001042750chrX41756 1411 727 220 ------
NM_001042751chrX41756 1411 727 220 ------
NM_001042762chr72247 46 --1376 --
NM_001042784chr4122 ------
NM_001043318chr1453828 1573 1378 1329 1067 --33217 3153 1539 24149 2921
NM_001043351chr152155 1874 605 404 83 --1101 31900 788 260
NM_001044385chr243755 3649 3636 205 33692 1558 297 23710 2871 23934 1617
NM_001044387chr1923904 376 11314 22933 1186 --
NM_001044388chr1923904 376 11314 22933 1186 --
NM_001044722chr562025 1951 1886 1581 646 337 31787 813 207 21441 476 --
NM_001044723chr562025 1951 1886 1581 646 337 31787 813 207 21441 476 --
NM_001046chr572983 2551 1081 1028 722 328 206 1438 11135 1786
NM_001048183chr173737 3442 3435 1468 1163 1136 505 1983 --33234 2894 2578
NM_001050chr172937 276 1206 ----
NM_001070chr17----1175 --
NM_001071775chr1351542 1402 412 290 268 11209 --31822 1349 774
NM_001079874chr141870 677 357 149 1510 1132 --
NM_001083620chr442631 2380 1699 769 --1786 1281
NM_001083621chr174422 3945 3226 1702 811 757 491 ------
NM_001099678chr394182 3961 1322 1180 1147 995 839 694 101 36455 5118 4031 36270 1251 786 22403 1523
NM_001100108chr1117767 7628 5340 3269 2430 2007 2001 1716 1280 1114 989 48305 3147 3014 1403 28192 1430 38007 3073 1386
NM_001106chr3118733 8613 8087 3374 3040 2542 2511 2449 1733 982 126 67719 5912 2476 2402 1950 1208 12465 18672
NM_001109977chr45680 659 627 257 99 ------
NM_001111chr132745 2682 480 1306 12157 12493
NM_001113490chrX33288 2388 803 11068 ----
NM_001117chr1842437 2154 2009 1649 ------
NM_001121chr1021212 123 1456 11449 --
NM_001122631chr111230 ------
NM_001123chr102168 126 --1543 --
NM_001126chr12703 195 --3760 352 32 158
NM_001128chr16103808 3763 3518 3015 2930 2862 2442 1014 785 26 31607 835 158 ----
NM_001146chr811747 1250 --32290 2021 869
NM_001148chr421504 1425 --1333 21359 742
NM_001153chr21721 1185 ----
NM_001156chr102259 166 1429 ----
NM_001160chr1252440 2187 527 186 96 42518 2388 2372 486 22467 225 22229 475
NM_001166chr111180 ----144
NM_001167chrX66410 5655 1812 1206 72 35 44709 4521 2312 1372 11200 46787 4539 2630 1514
NM_001172chr142714 104 ------
NM_001173chr14144702 4102 3853 3839 3758 3482 2966 1813 1758 1361 800 711 573 147 34624 4221 1012 23683 1716 2989 945
NM_001177chr1242062 465 371 267 32380 850 391 ----
NM_001186chr2173229 2680 2055 1130 581 469 138 22252 238 1160 12234
NM_001187chr211184 ----2516 390
NM_001200chr202973 100 ----1227
NM_001201chr473848 3589 3429 3239 1529 649 496 1426 33773 929 470 11015
NM_001204chr297738 5293 2776 2455 2013 2000 810 689 674 52978 2737 2364 2123 137 21327 355 46008 4805 2868 2617
NM_001206chr953012 2840 2252 598 488 1217 ----
NM_001233chr722223 378 41951 1670 890 570 --11926
NM_001237chr42941 785 ------
NM_001237chr42941 785 ------
NM_001241chr222427 276 21489 731 ----
NM_001241chr222427 276 21489 731 ----
NM_001253chr61262 ------
NM_001256chr1792900 1152 911 837 826 772 729 640 80 42679 940 718 532 22520 267 --
NM_001257chr1641371 444 198 142 ------
NM_001259chr785815 4852 4506 4227 4063 2412 1459 1441 33956 1051 309 35917 5249 4729 14449
NM_001282chr1762632 2237 1820 620 247 59 ----11814
NM_001289chrX1206 ----31066 486 362
NM_001290chr42719 65 ------
NM_001294chr191397 ------
NM_001298chr221285 356 --1496 --
NM_001304chr1742440 2371 646 495 43741 1206 426 197 32505 984 857 1179
NM_001310chr1282969 2480 2445 2118 2035 848 312 176 22948 985 --12642
NM_001315chr62908 402 31918 1399 613 ----
NM_001329chr1021483 413 21540 1047 11408 --
NM_001331chr1182846 2778 2436 2289 2213 1947 954 576 32511 2479 715 2731 430 12347
NM_001332chr531535 1267 640 ------
NM_001343chr541393 1344 393 52 21580 212 --2545 470
NM_001351chr321683 528 1151 --11450
NM_001356chrX32097 1982 318 --1661 11625
NM_001357chr1--2256 206 1234 --
NM_001358chr41129 143 ----
NM_001364chr1154531 3291 3115 973 125 23988 355 24406 457 11164
NM_001385chr81297 1267 ----
NM_001386chr821685 1637 11547 12413 12069
NM_001390chr1853115 2673 1321 1153 644 11087 11029 23311 885
NM_001395chrX----1983 --
NM_001396chr2132656 1753 1038 --1917 --
NM_001400chr161243 1139 886 508 429 36 11126 11098 --
NM_001402chr652060 1799 1418 559 34 11544 21720 1494 --
NM_001412chrX73581 2833 2413 1191 687 419 179 --12383 13635
NM_001415chrX31552 118 56 11626 --31828 1714 759
NM_001417chr1231444 1306 120 1175 --11981
NM_001419chr19134450 4433 4115 3214 3187 1785 1541 1316 1302 1103 309 225 202 --23655 3353 --
NM_001427chr742134 1770 1446 571 11762 ----
NM_001432chr463825 3244 3108 2625 1031 981 23115 3086 33102 3039 2673 --
NM_001438chr173251 3142 3112 1037 787 348 239 32978 2586 2369 21193 833 --
NM_001439chr181404 1261 1163 507 412 306 237 204 1980 21190 1097 --
NM_001440chr852816 2429 1123 774 644 --12249 1549
NM_001449chrX21304 58 ----1110
NM_001451chr16--11341 ----
NM_001453chr621777 387 1595 1196 --
NM_001482chr151362 2104 78 2780 119 --
NM_001483chr721099 349 1691 --1143
NM_001497chr952382 2244 546 373 199 32771 2151 2098 1471 1359
NM_001498chr631168 891 270 ----1417
NM_001530chr141906 --1183 --
NM_001542chr142104 1993 751 329 1997 2535 386 --
NM_001546chr61581 --11055 --
NM_001560chrX62636 2524 1002 832 143 37 ------
NM_001565chr43541 262 110 ------
NM_001584chr1131014 323 151 1893 --11182
NM_001587chrX42145 590 511 240 --1324 --
NM_001609chr1064385 1799 1502 679 348 131 43972 3715 3486 3172 13314 --
NM_001614chr171485 --1576 1132
NM_001614chr171485 --1576 1132
NM_001616chr252623 2354 1246 1075 571 11273 1332 1361
NM_001620chr113772 542 242 ------
NM_001621chr752849 1877 1146 930 395 12366 21109 852 11083
NM_001621chr752849 1877 1146 930 395 12366 21109 852 11083
NM_001629chr13191 ----1291
NM_001634chr61479 --1566 1777
NM_001635chr72312 91 ------
NM_001642chr1111351 1223 11300 --
NM_001650chr1852886 2564 1384 1108 381 --22554 229 22817 38
NM_001655chr1111914 --12189 --
NM_001656chr521693 554 21258 162 ----
NM_001663chr1442733 1853 553 417 22268 2209 12463 --
NM_001676chr131191 1172 ----
NM_001677chr12996 866 ------
NM_001682chr1252899 2651 1051 967 504 ----1769
NM_001684chr194050 3266 3240 3129 2702 1554 1195 688 252 --1829 --
NM_001690chr352545 2344 2227 2217 96 --12552 12109
NM_001693chr82249 55 1182 ----
NM_001695chr893893 3861 3307 1538 1511 1264 284 108 33 33982 3460 941 1872 --
NM_001701chr941497 1306 1115 43 --11168 1567
NM_001704chr62514 246 1461 ----
NM_001718chr611381 163 ----
NM_001730chr1321303 1257 21396 1130 --1446
NM_001730chr1321303 1257 21396 1130 --1446
NM_001731chr123941 749 711 2622 609 ----
NM_001742chr741209 716 490 321 ------
NM_001745chr531175 1140 912 ----11092
NM_001746chr532206 884 84 32114 1938 157 22584 322 11840
NM_001750chr54791 746 459 398 11575 11242 1302
NM_001753chr741669 1529 533 229 ----11448
NM_001754chr2163686 3608 2880 2638 483 380 33671 3210 1728 1635 24022 1116
NM_001755chr1692239 2072 1883 1845 775 495 355 173 81 11997 ----
NM_001759chr12125338 4367 4318 3833 3498 3429 3211 1984 1723 1427 1241 889 25010 4331 24832 3328 24789 3743
NM_001769chr121374 ----1348
NM_001777chr342587 1567 1393 82 53563 3556 3152 1051 720 33462 3208 2660 --
NM_001788chr73875 759 630 1173 ----
NM_001792chr183949 292 83 ------
NM_001795chr1631605 1349 1060 ------
NM_001797chr163769 676 26 1579 ----
NM_001798chr121747 1112 11090 1906
NM_001801chr5132 --1439 --
NM_001806chr1942797 1104 1012 867 11119 21890 282 --
NM_001822chr21585 ------
NM_001825chr51118 --1136 --
NM_001829chr4----168 --
NM_001830chrX63735 3495 1349 763 425 198 23621 154 ----
NM_001845chr13--1991 11266 11252
NM_001846chr131551 --143 193
NM_001854chr131344 1243 1016 ------
NM_001858chr6105117 5031 3581 1851 1077 955 930 410 59 41 34374 3217 881 14170 24924 4089
NM_001859chr973888 3467 3207 2826 1559 1325 235 ------
NM_001873chr4--126 --1141
NM_001884chr51444 ----1552
NM_001889chr12133 108 --2276 81 --
NM_001890chr41371 ------
NM_001891chr4130 --2368 326 --
NM_001892chr51445 11567 11354 21248 497
NM_001894chr22------156
NM_001902chr11144 ----1383
NM_001904chr32312 226 ------
NM_001918chr1179129 7913 6859 6624 6534 6435 6412 5739 5707 3717 3243 3193 3087 1274 671 660 81 32344 1028 881 36617 2764 234 --
NM_001921chr441265 1155 149 92 --21097 401 --
NM_001935chr26924 899 876 861 845 160 ----2365 95
NM_001938chr121740 1229 --21772 1484 --
NM_001939chrX93514 3404 2595 2504 1224 893 616 254 227 13841 1644 1750
NM_001941chr1853543 2917 2795 1349 351 1720 --11175
NM_001946chr124790 751 333 21 31163 1004 888 ----
NM_001949chr632455 1137 532 22564 2295 21272 403 127
NM_001951chr82516 143 --161 --
NM_001967chr32588 195 1424 ----
NM_001968chr42831 119 ------
NM_001973chr1--1277 ----
NM_001977chr451346 1340 441 435 243 4505 305 284 152 11419 --
NM_001980chr1221983 844 1261 131 11748
NM_001981chr172260 2192 956 892 843 741 187 22209 1541 11748 1394
NM_001982chr1241231 439 230 170 1941 ----
NM_001995chr421440 1073 2444 237 11387 11010
NM_001999chr51469 1967 ----
NM_002006chr4155152 4924 4694 4633 4613 4418 4363 4269 3840 3666 3519 1008 653 477 387 34640 2293 1490 23722 2213 --
NM_002009chr1532278 985 307 --31963 796 48 1292
NM_002015chr1343330 2912 2392 1083 1994 23064 2937 1817
NM_002017chr111314 176 11171 1136
NM_002024chrX41815 1435 698 49 1201 1351 --
NM_002025chrX87764 6335 2529 2092 1561 1486 1322 827 21990 594 18943 --
NM_002026chr22982 908 --1104 --
NM_002040chr2132852 2227 1214 22502 933 11032 33058 2875 38
NM_002044chr1521461 303 1189 --21630 1383
NM_002048chr931193 841 378 21254 1153 ----
NM_002051chr1021116 782 ------
NM_002056chr24814 573 116 73 2697 94 1663 2876 265
NM_002061chr11570 --1386 21207 208
NM_002063chrX4872 791 245 72 --21072 335 --
NM_002065chr121567 616 1599 1631 1428
NM_002069chr721676 683 11179 1616 31655 587 179
NM_002077chr931945 1564 665 --21492 574 1817
NM_002089chr41549 ------
NM_002092chr463486 3442 3380 1032 703 621 14003 --21210 355
NM_002099chr421737 801 11892 11492 21549 227
NM_002126chr1753612 3595 3150 1244 282 11666 34156 3984 1619 --
NM_002128chr1322061 170 11636 1840 22543 788
NM_002129chr41400 1426 ----
NM_002137chr74967 937 858 260 2830 443 --22025 1728
NM_002145chr172402 42 --1340 1270
NM_002146chr1711408 1452 ----
NM_002151chr19------1264
NM_002154chr52101 45 2410 385 ----
NM_002158chr263610 3456 1225 1048 486 42 23145 284 --13386
NM_002163chr1621299 413 --11235 --
NM_002166chr21262 --1497 --
NM_002187chr511019 1111 11089 --
NM_002190chr631254 533 257 --1121 --
NM_002193chr231799 1729 1659 21826 221 --11787
NM_002196chr201783 --11063 --
NM_002196chr201783 --11063 --
NM_002202chr5------11033
NM_002207chr32608 46 1207 ----
NM_002214chr7115457 5162 4691 4651 4200 3885 3534 1868 1672 984 545 35500 3669 552 23658 1768 11625
NM_002223chr1243085 2595 1195 548 22907 354 --11364
NM_002224chr62250 242 2764 205 --1289
NM_002226chr14195 --1155 --
NM_002233chr111436 ------
NM_002234chr121759 1686 ----
NM_002245chr12642 109 ------
NM_002247chr1062345 1997 802 695 676 184 ----11542
NM_002252chr21163 1331 ----
NM_002264chr374165 1136 1123 1076 543 400 356 24494 716 ----
NM_002266chr17------184
NM_002267chr1332074 1860 474 22008 1643 32232 1790 229 --
NM_002268chr331810 1586 1361 ------
NM_002270chr564954 4678 1751 1683 1641 764 45391 3575 1435 1103 ----
NM_002271chr1351580 1519 842 796 335 22372 591 11939 12351
NM_002285chr274080 2891 2546 1626 1481 969 388 ------
NM_002293chr172688 2487 2471 1079 868 792 68 ------
NM_002294chrX4357 147 109 55 1309 1170 188
NM_002296chr12283 259 11140 --31490 453 375
NM_002312chr13--2707 100 11060 --
NM_002336chr12104986 4831 4824 3725 3561 3250 3100 1266 1218 1046 34850 3160 288 13952 23918 190
NM_002355chr1231433 1247 177 --21153 375 --
NM_002356chr662380 2366 1930 1758 763 326 12137 12181 --
NM_002359chr1754302 3860 3714 3056 436 ------
NM_002370chr1----198 --
NM_002373chr151376 ------
NM_002374chr252488 1356 1225 844 89 ----12295
NM_002381chr21287 1928 1971 11056
NM_002382chr141102 ------
NM_002391chr111117 ------
NM_002395chr641237 1038 935 116 1588 --2246 43
NM_002397chr562053 1867 1639 785 377 62 --12164 --
NM_002398chr22972 581 1455 1269 --
NM_002399chr1541360 1058 946 918 ------
NM_002402chr711038 --1472 --
NM_002408chr142754 99 ------
NM_002422chr11--137 ----
NM_002430chr2242239 2093 443 354 22452 2228 12062 --
NM_002436chrX169 ------
NM_002444chrX61900 1775 1438 754 161 42 11881 --11624
NM_002467chr81296 ------
NM_002480chr1231006 352 92 1976 11420 --
NM_002481chr1197660 7586 7568 7085 6935 6700 6610 5502 5005 4958 2857 2277 1926 1674 1645 1539 1257 937 71 27399 1721 46693 5928 1570 984 15368
NM_002484chr162182 154 ------
NM_002485chr862156 1799 1720 1598 1396 362 32183 1954 803 12211 --
NM_002486chr942155 1602 610 488 144 2547 274 2698 110
NM_002487chr151144 1542 --1744
NM_002489chr71293 ------
NM_002492chr3137 --1425 --
NM_002493chr92279 88 ------
NM_002495chr5187 1112 ----
NM_002500chr2------1869
NM_002501chr1973877 3806 2803 1585 1279 1272 1149 --11613 --
NM_002508chr121469 513 1805 31985 480 418 21915 1684
NM_002518chr2137 ------
NM_002519chr1161354 1222 574 420 345 323 31331 1038 51 21391 1072 --
NM_002526chr631440 103 23 11386 11209 --
NM_002527chr12--138 ----
NM_002537chr1521000 871 1708 ----
NM_002538chr51132 1216 --1612
NM_002544chr172300 119 ------
NM_002545chr1174509 4348 3534 3378 2025 268 55 14962 34591 1399 463 11145
NM_002547chrX44267 3707 3184 1156 1421 24175 965 --
NM_002568chr82425 330 --1315 1440
NM_002577chr353129 2873 505 237 198 13696 ----
NM_002578chrX3399 134 108 ------
NM_002581chr963772 1556 1217 1211 459 135 35665 4524 933 1113 14807
NM_002594chr2021555 243 11656 1119 --
NM_002595chr1231201 528 42 --21772 551 --
NM_002610chr212185 23064 2171 12089 --
NM_002613chr16105080 4454 3622 3551 3471 3343 2166 2066 563 431 25211 3360 --13327
NM_002628chr32784 97 1222 ----
NM_002641chrX41840 1815 1644 397 --1528 21686 1493
NM_002645chr1163042 2379 2335 2310 1030 623 23094 2840 --21986 570
NM_002646chr141371 485 352 82 ----11784
NM_002648chr61833 ------
NM_002649chr731697 617 282 41577 1268 1211 1095 21069 478 2454 412
NM_002655chr8103810 3668 3389 2017 1236 1157 828 610 596 445 2322 83 1748 21674 1521
NM_002657chr2073362 2691 2468 1511 1274 189 50 33199 1054 637 23583 3096 12639
NM_002661chr161214 --1201 --
NM_002670chr3----21489 1050 --
NM_002687chr1471211 1182 840 435 94 74 22 --1321 --
NM_002698chr1922593 1059 12139 ----
NM_002699chr111472 ------
NM_002703chr4--31849 1536 302 21745 1428 1480
NM_002706chr21593 ------
NM_002709chr273110 3026 2599 2584 2342 2291 117 22251 145 --23356 3239
NM_002710chr122974 357 ------
NM_002711chr71616 126 2719 261 --
NM_002715chr511186 --1828 21155 1127
NM_002716chr1183488 3337 2627 895 856 743 222 196 33701 3199 2260 167 --
NM_002718chr382490 2462 2325 1915 1867 1726 942 870 --1533 1698
NM_002719chr1462018 1843 1494 954 927 750 2727 395 11869 --
NM_002726chr6------1358
NM_002729chr101177 3593 341 263 ----
NM_002731chr162732 2176 833 231 130 80 --2844 685 12752
NM_002734chr1722274 1784 32122 2007 1941 ----
NM_002736chr731895 1743 172 --1858 21966 770
NM_002737chr1775852 5802 5452 4461 2127 1270 671 14057 35369 5001 68 15467
NM_002738chr16--1881 ----
NM_002740chr352546 2195 1935 1024 467 12138 22525 2304 12832
NM_002745chr2274279 3798 3439 3105 939 580 453 13344 11245 23897 1017
NM_002747chr1831847 180 166 11614 11756 1157
NM_002748chr151965 1319 --1429
NM_002755chr153307 180 174 --1694 1716
NM_002815chr171179 ------
NM_002822chr122665 600 31647 656 359 --1273
NM_002823chr2--1251 --1240
NM_002835chr74225 215 120 25 --2694 83 --
NM_002836chr20140 ------
NM_002837chr1263588 3570 3274 3157 1703 1566 24363 2880 ----
NM_002839chr943522 3359 3202 2754 --31050 496 95 11078
NM_002844chr621024 165 1398 11259 --
NM_002847chr741584 1470 114 71 ----1266
NM_002849chr1251098 959 933 393 170 1764 ----
NM_002852chr31135 ------
NM_002869chr1162023 1748 1533 513 431 384 31733 1489 248 1268 --
NM_002874chr942412 2285 2098 253 ----22195 595
NM_002881chr2------21170 130
NM_002886chr384907 4791 4160 4027 3724 3240 2053 1199 34539 1805 1217 --13527
NM_002890chr51399 --1231 --
NM_002892chr1431168 1103 238 --11562 --
NM_002893chrX1119 ------
NM_002894chr18147 1163 ----
NM_002897chr23613 544 28 1192 ----
NM_002902chr153126 105 98 1453 ----
NM_002906chr1112221 31988 1856 1762 1680 --
NM_002912chr62795 185 2712 334 --1362
NM_002941chr321166 657 ----11242
NM_002942chr33348 200 182 ------
NM_002945chr171716 ------
NM_002955chr641993 760 583 225 --1727 31416 528 287
NM_002956chr1231425 1092 483 1334 ----
NM_002958chr31284 2405 130 1701 --
NM_002959chr174363 4244 4061 1403 1228 1025 242 --53940 3812 3130 969 235 12827
NM_002968chr163907 698 71 --11047 --
NM_002971chr321161 316 2970 811 ----
NM_002977chr233356 2250 933 1904 1194 11276
NM_002979chr11623 --1127 1832
NM_002994chr451954 1435 677 605 520 11590 21444 374 11582
NM_002998chr841934 538 163 119 21918 433 11925 1866
NM_003001chr191884 1588 1543 1494 1430 689 134 98 71 11839 --1772
NM_003010chr1742147 1558 631 172 1305 ----
NM_003013chr43792 705 683 2770 292 ----
NM_003016chr171692 2589 284 1581 21421 402
NM_003017chr641219 1001 968 237 ----21178 428
NM_003022chrX31218 859 21 21293 1180 ----
NM_003027chr152155 132 ------
NM_003031chr161384 ------
NM_003034chr1277911 7033 7004 5877 2918 2216 1641 33252 2300 2074 47582 7490 3058 1493 14931
NM_003038chr242573 639 462 275 12675 --21924 1833
NM_003045chr1334885 1373 342 --13701 14800
NM_003051chr171786 1660 806 318 299 286 160 ----1327
NM_003069chrX--1506 ----
NM_003074chr32505 325 --42067 1985 1610 850 1239
NM_003079chr171693 1363 1176 11041
NM_003099chr15136523 6042 5927 4755 2003 1513 1480 1142 983 613 215 189 68 21760 642 24259 1899 16214
NM_003100chr53455 359 327 ------
NM_003101chr121617 25 --21380 590 11649
NM_003104chr1521186 1179 1165 1141 --
NM_003106chr331039 889 407 ------
NM_003107chr622077 1911 22504 2037 --11894
NM_003108chr2146811 6351 5978 5216 5148 5078 5027 4997 4955 4478 2630 2132 1135 53 16509 55686 4417 867 692 551 14453
NM_003111chr2173 21092 886 11318 --
NM_003112chr7123219 2855 2786 2642 2157 952 785 713 590 340 318 285 12180 32342 469 123 22104 2073
NM_003114chr82332 197 ------
NM_003118chr52338 179 21990 308 136 --
NM_003128chr232699 1896 881 1764 --12857
NM_003133chr121048 807 --1846 2359 338
NM_003137chr62628 430 1297 ----
NM_003144chr642227 658 294 30 21970 403 1847 --
NM_003149chr311044 11517 ----
NM_003155chr842031 909 718 652 62454 1844 703 679 416 127 1690 --
NM_003157chr31267 ----1706
NM_003161chr1763009 2895 2603 1145 1082 917 21413 583 13363 33449 2672 1397
NM_003176chr13327 320 66 ------
NM_003176chr13327 320 66 ------
NM_003184chr821003 960 1863 ----
NM_003185chr2031133 217 96 1200 ----
NM_003189chr183344 3298 2845 2761 2635 1297 1067 40 22403 1180 ----
NM_003199chr1875664 5656 4951 4780 3693 2259 1625 170 4589 233 93 52 --
NM_003201chr101336 --1663 --
NM_003206chr61444 ------
NM_003211chr1231299 1286 1264 11571 21784 336 --
NM_003216chr2283171 2975 2912 2760 2046 914 508 250 ------
NM_003217chr1222005 1786 --12033 --
NM_003220chr631687 1493 1405 11116 1608 11153
NM_003221chr674132 3519 2953 2779 1453 1291 627 23723 77 23339 2898 23849 1138
NM_003222chr203921 241 168 1461 ----
NM_003236chr273325 3288 3252 3245 2396 649 499 --13446 --
NM_003242chr322252 1532 31770 791 371 1782 --
NM_003247chr661590 1419 704 118 112 76 ------
NM_003262chr3154362 4263 4160 3920 3838 3636 1927 1865 1845 1525 1449 1233 1006 977 945 55084 4064 1997 1806 353 2443 419 1101
NM_003270chrX41128 928 366 38 --1849 --
NM_003274chr2132586 865 819 22978 812 22126 2084 12718
NM_003275chr94472 459 199 122 ----11488
NM_003286chr202822 111 ------
NM_003288chr2021250 560 1964 --11543
NM_003291chr132814 697 --1207 --
NM_003297chr12--2211 103 ----
NM_003298chr385610 4982 4952 4820 4404 3864 378 130 54964 4894 4152 1221 1076 22454 2205 24728 1370
NM_003304chr331425 524 262 1276 11252 1126
NM_003309chr631883 1800 1305 --21926 1900 11274
NM_003317chr14----2263 107 --
NM_003320chr1154062 3584 1602 1501 1137 33363 3151 511 12879 1973
NM_003336chrX61009 919 825 770 297 131 1951 --1166
NM_003337chr541726 529 450 340 11451 --11616
NM_003338chr1051964 1481 1393 600 175 21897 1752 21456 1226 1584
NM_003340chr421060 77 151 ----
NM_003342chr1762377 2365 1215 496 434 411 1489 32979 969 803 --
NM_003348chr1241381 1212 1121 458 --11353 --
NM_003349chr2051521 1139 999 535 147 11194 1528 --
NM_003358chr9----1125 --
NM_003368chr12520 80 1703 1242 1818
NM_003372chrX165 149 1702 --
NM_003374chr51145 ------
NM_003387chr252805 2702 1812 952 935 12386 ----
NM_003400chr23845 199 126 ------
NM_003403chr143573 340 300 ------
NM_003406chr821518 418 21726 1684 11654 --
NM_003409chr1811320 1435 ----
NM_003410chrX32419 1187 317 32649 2408 41 --12770
NM_003411chrY31824 586 142 138 21504 187 --
NM_003412chr322934 2193 11076 22275 2101 11006
NM_003413chrX31903 387 231 1418 --21399 282
NM_003430chr1931271 1030 401 --21114 503 --
NM_003432chr51497 --175 --
NM_003455chr1171587 1320 1240 552 431 394 191 1449 ----
NM_003457chr171103 ------
NM_003463chr632684 2460 2359 12998 2836 679 13136
NM_003467chr21131 --1368 --
NM_003468chr263232 3017 1120 644 226 214 11169 3870 529 264 1421
NM_003469chr2------1108
NM_003471chr341439 780 443 207 --12304 --
NM_003472chr641506 269 231 99 11247 ----
NM_003473chr1031090 823 75 --11073 --
NM_003474chr1042160 2035 635 540 ----21964 1793
NM_003478chr1142523 1325 1108 966 23020 355 22262 643 --
NM_003483chr1232818 2531 2042 1173 1298 --
NM_003489chr2143028 1372 1064 782 33136 2159 689 12784 3931 630 424
NM_003505chr731690 1302 636 11342 11215 --
NM_003507chr2--22012 1545 --11460
NM_003518chr6--122 ----
NM_003528chr171728 1595 1331 358 315 248 117 11360 11156 --
NM_003557chr151653 1317 431 389 200 ----11075
NM_003559chr1763088 3064 2992 2507 1290 236 23907 3398 ----
NM_003566chr12133439 3008 2998 2713 2639 2619 2386 2305 1360 1264 1130 852 802 42745 2703 1041 583 --23188 761
NM_003574chr18115333 4285 2322 2144 1903 1773 1127 551 511 438 141 25113 351 55692 5097 4066 3943 921 24522 1333
NM_003576chr1352726 1914 1872 777 376 22854 819 12924 21032 295
NM_003581chr22976 119 ----1303
NM_003583chr1273554 3064 2948 2802 2471 387 191 22928 535 12867 11075
NM_003589chr1311379 21462 296 21288 411 --
NM_003590chr262581 1602 1048 474 264 219 23940 3656 12870 --
NM_003601chr4--133 148 --
NM_003603chr462135 2043 1805 1629 1591 1394 1584 ----
NM_003607chr174192 3853 3319 1274 848 492 444 24002 2824 --11617
NM_003613chr15------1216
NM_003615chr3113790 3395 2712 2500 2490 1520 983 780 568 532 332 31162 840 616 22743 206 1296
NM_003620chr171806 1757 --1852
NM_003626chr1151006 893 856 298 206 --195 --
NM_003629chr183190 2877 2817 2588 2233 2185 1395 587 22990 2773 1912 --
NM_003630chr63538 517 164 1628 1118 --
NM_003642chr22122 73 ----3328 302 246
NM_003644chr17135794 5203 4720 4535 4395 4351 4000 2545 2150 1864 981 502 294 --16123 --
NM_003645chr15175 ------
NM_003651chr123534 491 93 --1175 --
NM_003653chr17--1198 ----
NM_003659chr2------11165
NM_003663chr3103290 3273 2673 2384 1261 851 557 482 435 340 53107 2886 2754 1275 1114 --22131 256
NM_003668chr12----150 --
NM_003671chr932422 638 100 23082 2437 33237 2982 1418 --
NM_003672chr131318 506 112 3739 349 119 ----
NM_003679chr142735 2479 2212 1348 --22988 1207 1327
NM_003681chr2165927 5891 1241 820 525 472 24978 83 ----
NM_003688chrX1224 ----1241
NM_003692chr93694 384 246 1802 ----
NM_003702chr8------1817
NM_003711chr5--1103 ----
NM_003716chr3--1724 157 1235
NM_003722chr352097 768 486 190 118 1868 32293 1992 271 1800
NM_003725chr123390 339 310 ------
NM_003743chr231911 307 280 22027 876 ----
NM_003746chr12--1261 ----
NM_003749chr1322195 815 22164 1563 12424 1309
NM_003750chr10--135 1100 --
NM_003758chr1571500 1264 1083 1029 362 139 29 31058 459 50 21617 1527 1377
NM_003758chr1571500 1264 1083 1029 362 139 29 31058 459 50 21617 1527 1377
NM_003759chr454058 4051 4036 775 560 --13056 41113 358 323 161
NM_003760chr14722 710 693 198 ------
NM_003763chr2031961 874 525 12741 --23033 413
NM_003766chr172509 385 131 1225 --
NM_003768chr161791 1686 1579 1498 1438 1375 11535 1202 1337
NM_003769chr12126 ------
NM_003774chr1252577 2570 2123 1293 60 42931 2234 1222 1002 1787 1255
NM_003783chr1--1809 --1158
NM_003787chr1841514 1387 1253 1152 --2280 139 --
NM_003794chr3--1987 2732 130 --
NM_003796chr191183 1446 1530 --
NM_003800chr6----22040 1912 --
NM_003822chr113094 32607 2515 130 12416 --
NM_003825chr1531559 984 21 11309 --153
NM_003829chr93910 829 164 11154 ----
NM_003831chr1821728 505 --1229 1422
NM_003835chr171285 1263 ----
NM_003861chr1472332 2236 2037 1132 860 805 618 ----1581
NM_003872chr242634 643 634 485 22492 1881 12667 --
NM_003873chr1042447 2273 1692 721 32454 2121 1627 1828 --
NM_003877chr121307 1700 --1859
NM_003884chr361794 1739 1654 498 432 23 ----11672
NM_003885chr1732217 886 618 --12162 --
NM_003887chr231943 1928 348 1474 12258 --
NM_003895chr2142231 1738 537 277 31674 1409 446 ----
NM_003901chr1052421 2401 1952 802 337 ------
NM_003902chr1193 --1732 --
NM_003913chr664053 3949 2797 1099 764 325 33499 2966 1150 44160 3983 1679 1135 --
NM_003916chrX31012 598 265 2491 364 ----
NM_003919chr7------1251
NM_003932chr2251862 1420 614 300 288 41736 1326 631 232 --1495
NM_003934chr921178 1169 --1920 1440
NM_003939chr1084035 3634 3559 3533 3506 3465 3198 2862 23340 1101 11010 12726
NM_003941chr741940 442 434 309 1674 --22111 384
NM_003942chr11--1705 ----
NM_003947chr311299 ----11124
NM_003953chr142151 1108 627 336 32719 1013 642 ----
NM_003957chr1111099 1725 ----
NM_003971chr171517 ------
NM_003972chr103896 431 311 --1288 --
NM_003980chr651325 1056 1016 526 255 2346 227 --2915 284
NM_003981chr151868 ----11056
NM_003983chr1634192 3197 3190 2716 428 11565 12792
NM_003994chr1253946 3323 1365 817 122 53694 3618 2814 2723 82 13148 11708
NM_003998chr4--1633 ----
NM_004004chr1321355 226 2503 117 ----
NM_004006chrX42512 2418 2162 344 --151 --
NM_004007chrX42512 2418 2162 344 --151 --
NM_004009chrX42512 2418 2162 344 --151 --
NM_004010chrX42512 2418 2162 344 --151 --
NM_004011chrX42512 2418 2162 344 --151 --
NM_004012chrX42512 2418 2162 344 --151 --
NM_004013chrX42512 2418 2162 344 --151 --
NM_004014chrX42512 2418 2162 344 --151 --
NM_004015chrX42512 2418 2162 344 --151 --
NM_004016chrX42426 2332 2076 258 ------
NM_004017chrX42512 2418 2162 344 --151 --
NM_004018chrX42426 2332 2076 258 ------
NM_004020chrX42512 2418 2162 344 --151 --
NM_004021chrX42426 2332 2076 258 ------
NM_004022chrX42426 2332 2076 258 ------
NM_004023chrX42426 2332 2076 258 ------
NM_004028chr1852886 2564 1384 1108 381 --22554 229 22817 38
NM_004034chr102259 166 1429 ----
NM_004056chr81918 ----1898
NM_004060chr51944 --11174 --
NM_004061chr51491 ------
NM_004063chr82752 124 --2791 653 --
NM_004067chr7175 1304 21072 275 --
NM_004077chr1211079 2154 83 ----
NM_004081chrY21710 238 ----11512
NM_004086chr141269 1153 1644 --
NM_004087chr321327 308 --1285 21607 586
NM_004093chr1342862 1268 492 63 --12041 13265
NM_004094chr146891 749 723 614 591 491 32947 2790 631 32388 967 248 13072
NM_004098chr10--11040 11183 --
NM_004100chr692552 2193 2119 2079 2031 1859 1836 218 100 42158 1963 1949 659 2880 756 12215
NM_004109chr1142277 2213 1786 257 22092 2075 --163
NM_004112chr1721286 696 21228 188 21641 1258 11243
NM_004113chr31679 1354 ----
NM_004114chrX31262 798 157 ------
NM_004117chr631668 1371 643 22083 385 --12225
NM_004124chr1453028 2779 1309 633 200 32267 1051 815 13497 --
NM_004128chr131441 1416 1165 --
NM_004136chr1552917 2193 519 317 72 --2986 548 --
NM_004145chr191334 1319 ----
NM_004161chr25654 462 251 172 110 --21447 1365 --
NM_004171chr11169597 9542 8575 8394 8215 7275 7219 7085 6983 6563 6212 3166 2251 1855 1695 1684 43305 1262 614 481 32320 1402 569 39202 409 82
NM_004172chr541931 1848 1307 571 --11328 11343
NM_004175chr223482 457 109 ------
NM_004180chr21602 ------
NM_004181chr4--1263 ----
NM_004202chrY2569 53 ------
NM_004209chr1611173 ------
NM_004219chr5----154 --
NM_004225chr841027 603 571 457 --1611 --
NM_004229chrX82199 1693 1652 1618 671 456 323 106 --1600 --
NM_004232chr1863613 3340 3312 1285 1108 913 43429 1561 1463 513 11320 1192
NM_004236chr151189 --130 159
NM_004238chr21219 ------
NM_004251chrX1287 --1237 --
NM_004253chr91283 1930 --1919
NM_004270chr52108 75 1213 ----
NM_004272chr511264 --21654 550 --
NM_004274chr1462975 2907 2187 1040 759 219 22796 947 12266 1350
NM_004277chr621150 94 21516 24 ----
NM_004280chr61165 1297 ----
NM_004281chr103491 185 80 ------
NM_004293chr973755 3706 3635 1344 1210 1125 247 43049 2887 1019 785 42462 1439 1395 1304 11065
NM_004311chr1052969 2855 2782 2763 724 ----1803
NM_004316chr1241107 810 459 72 ----1447
NM_004329chr104955 892 357 199 --21108 511 --
NM_004331chr832004 891 867 31765 994 397 11651 12128
NM_004337chr852064 1634 1543 1434 700 2374 332 ----
NM_004338chr18136951 6276 5734 5364 4969 4720 4523 2637 2508 1954 1604 1263 592 35309 2064 1812 27046 2562 26246 1373
NM_004342chr752142 2107 1620 1448 645 ----1517
NM_004349chr831195 422 232 ------
NM_004354chr43828 602 248 3707 336 197 ----
NM_004370chr632070 1959 1897 21951 1567 11881 --
NM_004379chr231222 618 369 11431 2677 360 1627
NM_004384chr562025 1951 1886 1581 646 337 31787 813 207 21441 476 --
NM_004385chr51244 --1441 --
NM_004386chr1972039 1915 1897 1816 1670 1628 326 --1896 11464
NM_004392chr1341646 994 783 241 ----31912 697 132
NM_004393chr322410 379 ------
NM_004396chr17147 ------
NM_004397chr1144172 3291 572 331 ----13572
NM_004403chr72267 186 ----1174
NM_004411chr73716 658 210 ------
NM_004415chr65833 655 645 180 31 1192 1310 --
NM_004426chr126791 778 335 263 252 225 --11681 --
NM_004432chr921671 1569 21845 330 12061 1184
NM_004434chr1461895 1433 1386 285 138 98 11185 ----
NM_004438chr232769 2457 59 1797 ----
NM_004440chr631339 1227 265 ----1389
NM_004449chr2131323 306 277 11274 ----
NM_004454chr331934 1780 275 2492 156 11837 --
NM_004457chr21609 ------
NM_004458chrX72669 2258 2038 1789 1775 1065 169 32204 535 460 12284 --
NM_004459chr1731599 1349 459 1695 --11564
NM_004464chr4104134 4079 3846 3556 3329 3289 2951 1623 1119 462 --14253 33535 1537 433
NM_004480chr141675 --1183 --
NM_004481chr122473 1946 ----22626 83
NM_004482chr23779 141 129 --1675 1662
NM_004483chr162455 159 159 ----
NM_004491chr1944106 3932 1524 504 166 ----
NM_004496chr1441200 459 416 291 31361 1219 510 ----
NM_004500chr145648 559 253 128 42 ----11386
NM_004501chr193131 2710 1624 1543 1339 1165 939 772 68 34003 2824 2777 1978 23604 564
NM_004504chr243012 726 338 298 52472 2246 1148 679 99 --2716 118
NM_004505chr1751684 653 495 357 52 11491 11284 --
NM_004506chr6----1231 --
NM_004514chr173737 441 143 --22444 23 1154
NM_004521chr101304 1293 ----
NM_004523chr1041485 1254 1247 967 ------
NM_004525chr221103 1017 11264 11097 --
NM_004529chr921060 575 1277 1996 1169
NM_004537chr1291450 1363 1213 1043 448 344 187 171 22 1227 21555 1187 --
NM_004539chr182803 185 1635 1210 2850 54
NM_004540chr213897 705 86 ------
NM_004559chr1--2396 261 ----
NM_004571chr2132729 2656 2253 22829 285 --33418 2177 233
NM_004575chr431435 566 362 1447 ----
NM_004576chr5197 ------
NM_004577chr72587 549 1130 ----
NM_004580chr1531362 345 248 --1188 11685
NM_004586chrX85200 4982 4921 4726 4442 1108 951 869 75304 4954 3930 3672 1867 349 168 54913 4333 1941 851 503 45447 4619 835 713
NM_004593chr3--1675 --1690
NM_004598chr563034 2889 2786 2752 1056 572 2732 341 32734 2492 2272 22540 1129
NM_004600chr11580 ----1371
NM_004612chr9104809 4711 4449 4075 3134 1523 1357 1092 996 293 33855 1832 490 2445 330 --
NM_004616chr12--143 ----
NM_004619chr151933 1499 1445 433 413 --21751 121 --
NM_004622chr242108 718 485 300 12309 21726 120 11599
NM_004627chr211711 --1455 --
NM_004651chrX2339 249 ------
NM_004655chr172876 364 21135 424 ----
NM_004657chr211523 --41465 1209 1025 428 21343 1218
NM_004660chrY32022 447 316 1558 1657 --
NM_004670chr1061711 1605 1443 662 528 226 11552 21502 297 11428
NM_004673chr121562 1198 21464 56 21104 546 --
NM_004681chrY2678 181 ----1156
NM_004685chr1342979 842 516 509 22556 491 2369 321 --
NM_004686chr861771 569 559 311 162 117 ------
NM_004690chr6--1686 ----
NM_004696chr12831 788 --1815 1859
NM_004703chr1752352 1952 283 82 52 1566 ----
NM_004715chr18----1695 --
NM_004719chr1242444 2264 409 253 22864 2729 12032 --
NM_004725chr1021360 277 21024 359 21291 177 --
NM_004726chrX75306 3840 3641 1367 997 652 277 55619 5436 5049 4662 4049 21503 244 13894
NM_004730chr561807 1519 1469 775 412 357 11590 11989 --
NM_004736chr142248 1864 1718 561 12158 21430 829 --
NM_004738chr2041016 746 501 239 31780 343 125 --22302 1714
NM_004742chr34700 668 382 172 11836 ----
NM_004744chr473839 2735 2716 935 580 452 328 1734 11336 21286 1092
NM_004745chr8106635 6604 6593 5736 5522 2366 1563 1153 795 575 34468 2082 1844 35176 2246 863 21887 959
NM_004748chr15113872 3775 1436 1273 1247 988 735 683 557 304 284 1203 11430 --
NM_004757chr41278 140 ----
NM_004759chr122171 44 183 --11616
NM_004760chr732010 977 537 12481 --1315
NM_004768chr111071 21192 803 166 --
NM_004770chr8------159
NM_004774chr1732824 1149 548 22971 2578 22887 431 --
NM_004775chr1861913 1846 1517 801 682 611 2766 620 12181 --
NM_004779chr52461 400 ----21086 976
NM_004788chr1131056 632 537 12100 --11982
NM_004789chr92313 51 ----135
NM_004791chr13129 2732 708 ----
NM_004796chr1432397 1938 1641 11497 11617 --
NM_004797chr363658 3123 3007 2824 2688 1316 23622 161 21460 1177 --
NM_004798chr2041263 847 413 361 --12981 23509 719
NM_004799chr1--174 ----
NM_004801chr261538 1447 1410 1059 483 259 ------
NM_004815chr123471 1784 23106 1843 13244 44158 4039 3738 215
NM_004816chr91510 --1532 --
NM_004824chr611246 1182 11484 --
NM_004831chr192987 395 --1446 --
NM_004834chr262419 1132 1044 326 198 67 12160 1978 13421
NM_004835chr3--1868 ----
NM_004835chr3--1868 ----
NM_004839chr15--1476 ----
NM_004841chr11806 --11132 --
NM_004842chr651786 1409 1155 671 512 --21457 1123 --
NM_004844chr331200 1172 138 1846 1988 2910 893
NM_004845chrX53834 1095 738 626 232 --11389 1850
NM_004849chr631686 1285 1080 --21042 511 137
NM_004850chr211461 --1422 --
NM_004854chr2131 ------
NM_004857chr1464137 3426 3236 1920 609 73 --24257 1202 --
NM_004859chr1773001 2904 2826 2517 2475 2312 53 22511 360 --1267
NM_004863chr1494563 3958 3633 2027 2016 910 538 532 491 25303 210 ----
NM_004866chr573402 3169 1428 1245 611 357 154 13491 45063 3546 1346 183 --
NM_004867chrX260 24 1125 ----
NM_004869chr1841698 534 456 407 ----1589
NM_004871chr1764182 4140 3755 3439 3155 3120 23056 3024 22960 1652 --
NM_004873chr1443229 3071 2478 2426 22250 810 1757 12590
NM_004883chr5----146 --
NM_004884chr151159 --11418 1296
NM_004888chr951086 895 302 216 84 11121 ----
NM_004896chr1021031 48 ----11293
NM_004898chr422600 630 12758 21976 1941 --
NM_004904chr7166361 6277 5710 5568 5473 4956 4536 4496 2583 2099 1847 958 629 509 431 303 25813 2384 11153 11722
NM_004905chr11170 1643 ----
NM_004906chr61564 ------
NM_004922chr10----11034 --
NM_004926chr1421498 319 11293 ----
NM_004932chr541587 1103 594 60 21230 393 11335 --
NM_004937chr172770 224 1826 1246 11976
NM_004938chr92419 308 1380 ----
NM_004952chr1----1676 --
NM_004956chr744351 3811 3075 2978 11562 33229 3003 976 --
NM_004965chr211633 1685 ----
NM_004969chr10182 1213 ----
NM_004985chr1254221 3388 1342 302 293 53838 3374 1407 886 137 34238 1195 24 --
NM_004992chrX147243 7091 5826 5199 3233 2457 2303 2293 2237 2011 1689 507 191 66 1678 37525 6213 3050 17914
NM_004992chrX147243 7091 5826 5199 3233 2457 2303 2293 2237 2011 1689 507 191 66 1678 37525 6213 3050 17914
NM_004993chr1421019 419 --11248 --
NM_004999chr684304 3524 1732 1615 1103 1012 596 407 14360 ----
NM_005006chr21669 1231 1695 1273
NM_005010chr7--11989 1644 --
NM_005020chr71586 1441 ----
NM_005028chr1052314 2036 1634 1563 117 ----12327
NM_005033chr4--1145 ----
NM_005036chr2278342 8180 7970 5436 1740 1169 104 47509 7148 868 111 25394 2737 37271 6098 2870
NM_005054chr231304 1283 1143 21102 409 --31448 1414 1216
NM_005056chr1242163 1931 376 299 34665 1562 232 55316 4132 3811 2228 1817 15033
NM_005057chr12413 86 ----11800
NM_005063chr1053247 2902 2506 1340 848 --33131 830 388 11395
NM_005065chr14104747 4704 4302 3854 3686 2139 801 734 602 22 --2369 353 22070 983
NM_005076chr133578 3503 2973 33988 1244 127 --24216 203
NM_005079chr883121 3004 2876 2489 2426 2373 1218 472 32939 2109 428 1409 --
NM_005080chr221727 1637 ----
NM_005087chr34595 336 216 96 ------
NM_005102chr23701 330 155 --1799 --
NM_005109chr342479 653 420 132 11821 ----
NM_005116chr20114268 3195 2847 984 969 407 305 210 203 190 55 --24318 4150 14290
NM_005119chr131081 1018 866 21289 1070 ----
NM_005121chr17113512 3351 3312 3262 2738 2588 1494 820 572 196 116 23546 539 23067 487 22895 2849
NM_005124chr6----1116 2850 828
NM_005126chr362073 2041 1889 1840 675 103 --12014 12058
NM_005134chr184605 388 312 212 1259 1811 --
NM_005135chr1573216 2383 1111 1079 965 663 515 23368 2828 --138
NM_005146chr11159 1792 ----
NM_005151chr1822063 686 1571 ----
NM_005153chr16288 77 ------
NM_005154chr154676 630 603 538 ------
NM_005156chr954087 3787 1307 1046 890 33716 1934 625 24322 641 --
NM_005159chr1522065 1967 12185 11512 --
NM_005164chr1252661 2049 931 616 607 22675 656 32356 747 315 --
NM_005166chr191226 --1258 --
NM_005171chr1221050 817 1845 ----
NM_005180chr10----1367 11554
NM_005188chr11198184 8163 7952 7931 7889 7270 5908 5440 5407 3146 2579 2572 2167 1738 1712 1623 1237 715 401 47009 6845 3268 912 27287 5553 25162 2946
NM_005190chr6--1441 3924 287 156 --
NM_005197chr1464982 4384 2331 1430 427 186 12261 34570 2180 907 --
NM_005204chr103774 728 361 ------
NM_005207chr2263752 3555 3305 2313 1253 445 13329 --11277
NM_005214chr21978 --1122 1429
NM_005220chr1731481 1466 25 2427 299 --1326
NM_005233chr352220 1657 682 616 164 32499 2386 143 42257 2189 1802 590 --
NM_005235chr2117316 7295 7025 6447 6150 5856 2657 2338 1489 795 706 26897 2166 27034 5567 1811
NM_005238chr1143457 2819 1042 620 12329 --1609
NM_005254chr154996 901 477 322 11323 ----
NM_005256chr113946 814 797 1638 ----
NM_005257chr1821259 528 ------
NM_005259chr211496 21128 333 1302 2435 348
NM_005261chr82653 236 --1956 --
NM_005264chr101815 ------
NM_005277chr451730 1609 1276 614 357 177 1642 21696 652
NM_005295chr7--2312 294 ----
NM_005313chr152868 161 1322 ----
NM_005318chr221399 11282 1173 --
NM_005324chr1742128 1457 802 437 21432 466 ----
NM_005328chr82250 42 1534 --1617
NM_005339chr473841 1705 1123 573 467 404 214 21449 767 31432 777 227 24328 517
NM_005342chrX42144 447 438 24 --22841 2619 11885
NM_005347chr921484 638 1215 ----
NM_005358chr1341676 756 584 134 --11358 21497 371
NM_005359chr18116027 5503 5467 5349 5245 2397 2055 1684 643 240 25 45830 4621 671 303 --24441 1824
NM_005373chr131499 1381 1240 2468 263 21593 1439 --
NM_005380chr111081 ------
NM_005385chr322108 645 21951 326 42576 778 528 124 --
NM_005388chr921669 138 31413 1357 1146 1403 --
NM_005392chr951480 1363 1341 1276 274 ------
NM_005397chr753986 3011 890 602 141 1684 ----
NM_005399chr1124437 4270 3727 3296 3269 2927 2815 2725 1107 1023 582 368 13458 13584 1964
NM_005400chr222171 506 12837 12011 --
NM_005402chr761523 649 601 535 94 23 2399 165 --11566
NM_005406chr181142 --21517 63 --
NM_005407chr1421425 1277 --31356 990 110 --
NM_005410chr51270 2835 641 ----
NM_005433chr1862519 2375 908 822 515 93 11922 11968 --
NM_005436chr1043663 2872 1435 1206 1892 33478 1189 716 --
NM_005437chr101227 11064 11154 21045 309
NM_005443chr42554 522 --1127 --
NM_005455chr121527 1226 31419 641 128 ----
NM_005458chr93898 798 207 12373 1251 --
NM_005461chr2031575 1452 108 ------
NM_005465chr121405 268 ------
NM_005467chr11------1167
NM_005471chr531246 332 65 --189 --
NM_005475chr1272499 2263 2024 1204 1134 208 37 12829 12966 1595
NM_005476chr941444 299 210 65 --182 --
NM_005487chr2231723 752 339 1283 ----
NM_005493chr61759 1272 1200 --
NM_005494chr7--1617 --1214
NM_005497chr1794785 3927 1497 1336 1120 1078 920 403 203 1714 12220 25325 1984
NM_005502chr953022 2237 1264 1157 765 22975 778 --11089
NM_005503chr151185 11038 --1788
NM_005504chr12126574 5368 4483 4377 2446 2393 1627 1546 1189 859 805 432 45928 5696 4928 4668 34276 1768 329 --
NM_005509chr541686 434 284 139 31735 1475 156 ----
NM_005522chr75544 477 239 55 40 ----1395
NM_005542chr71199 1333 188 11673
NM_005546chr541757 1657 1608 317 11722 12034 1652
NM_005565chr5--1140 ----
NM_005573chr53718 137 46 --1614 --
NM_005578chr3124814 4512 4370 4340 3934 1940 1604 1285 1246 797 511 332 34717 896 127 21843 1815 24398 1439
NM_005584chr13149 3613 256 116 ----
NM_005587chr154966 633 277 206 1778 ----
NM_005593chr121202 --1442 --
NM_005596chr9125952 5500 5338 4785 4580 4148 4107 1596 1106 665 431 276 44236 1497 1418 706 13949 --
NM_005599chr121162 361 11379 ----
NM_005602chr31150 1187 --1312
NM_005603chr183485 142 128 --11778 --
NM_005604chr642530 1556 906 54 52467 2412 1724 191 134 11843 --
NM_005611chr1621101 54 --185 1170
NM_005637chr1811413 ------
NM_005638chrX71721 1661 1541 1521 602 544 409 21362 227 ----
NM_005639chr12145 31439 1280 506 ----
NM_005650chr2231253 1159 537 --1173 --
NM_005651chr41301 ------
NM_005652chr1631029 829 799 21213 820 ----
NM_005656chr2151482 1469 593 497 488 11307 122 --
NM_005659chr22--1440 ----
NM_005664chr152899 387 ----1187
NM_005665chr164453 3510 3402 3362 3074 186 13595 23454 1904 34933 4151 3341
NM_005668chr5134568 4494 4268 4189 3012 1830 1765 1718 1446 634 612 399 197 ------
NM_005688chr331295 1080 32 --1222 --
NM_005704chr11752 ----1989
NM_005711chr52921 216 1934 --1884
NM_005715chr632414 2016 1019 --174 --
NM_005717chr12851 167 1873 ----
NM_005721chr23831 717 200 --1823 1883
NM_005722chr262208 1765 527 496 377 328 31974 1940 506 --12367
NM_005725chr132253 772 171 11939 22430 441 --
NM_005734chr112711 205 3558 501 142 ----
NM_005736chr1011111 148 ----
NM_005737chr242256 2006 1855 527 12426 12283 --
NM_005738chr721486 1300 1314 --1187
NM_005739chr1531561 776 363 2113 100 --1330
NM_005742chr22534 313 ------
NM_005746chr72654 527 22438 2319 --32532 1821 1105
NM_005748chr1283481 3205 3021 1259 1019 1000 859 23 1477 22114 461 12859
NM_005749chr17--1473 170 1749
NM_005754chr531095 384 270 ----11144
NM_005756chrX41328 1252 533 210 11036 11557 11080
NM_005759chr2124699 4416 4403 4292 4109 3975 3481 1893 1866 1723 1331 1140 13055 --24553 4001
NM_005765chrX1129 179 ----
NM_005766chr132461 227 ------
NM_005776chr142620 132 1119 3781 627 276 --
NM_005779chr553673 3645 1398 1129 32 12353 33262 3198 1390 12656
NM_005795chr242991 2948 882 461 ----13018
NM_005802chr91114 1609 ----
NM_005808chr322667 993 12392 --2804 238
NM_005813chr251851 894 547 315 275 11753 22311 262 11645
NM_005819chr162604 1207 1165 779 684 487 --13471 --
NM_005822chr652310 2283 240 121 39 185 --12201
NM_005826chr1----196 --
NM_005832chr34426 171 119 75 ------
NM_005839chr11381 1301 ----
NM_005840chrX147296 7268 7142 6844 6236 5896 5814 5687 5226 2588 1317 1168 487 212 34729 4648 1719 66968 6253 6052 6004 4807 2599 25547 724
NM_005843chr241927 1736 1695 54 1524 --1586
NM_005857chr1------1175
NM_005859chr5--11492 ----
NM_005868chr732023 1839 836 1775 2997 186 1583
NM_005870chr132900 514 196 ----
NM_005872chr11222 ------
NM_005880chr16--11604 ----
NM_005885chr5--11587 1228 1276
NM_005891chr61146 ------
NM_005895chr1253711 2525 1370 1015 119 24111 214 22827 860 24160 3757
NM_005898chr1173079 2721 2699 2622 1283 863 832 ------
NM_005899chr172431 49 --1976 --
NM_005900chr43991 355 99 ------
NM_005901chr18158332 7919 7637 7615 7475 7297 6605 6442 3416 3165 2886 2459 1859 1786 615 57289 7274 6144 3256 3144 78318 5722 5571 5371 5312 1364 609 17167
NM_005902chr1563578 3471 3407 3142 2850 1798 14526 --34034 1014 687
NM_005903chr595237 5231 5195 4121 4108 3655 1700 935 927 44604 4310 3823 262 14686 34998 4578 4569
NM_005907chr681648 1563 683 505 378 316 176 51 ----1119
NM_005909chr583596 1670 1599 1187 944 680 601 543 12642 13379 23339 3182
NM_005923chr6--2220 107 ----
NM_005927chr531073 1007 65 1430 1415 1204
NM_005930chr144822 692 663 305 1285 ----
NM_005932chr13--2123 24 ----
NM_005933chr1182851 2611 2556 2518 2354 2259 1866 1846 ------
NM_005935chr4114812 4388 4260 4241 3826 3713 3219 2109 2100 1871 1065 23602 1402 34925 4201 1133 15269
NM_005941chr864118 3136 2988 2815 1678 694 1456 --1331
NM_005944chr321218 130 --11060 --
NM_005955chr194930 4866 4718 3353 1795 1491 814 752 140 25473 1340 34494 4268 3604 14094
NM_005962chr1042273 1698 1499 724 21481 70 11801 1100
NM_005962chr1042273 1698 1499 724 21481 70 11801 1100
NM_005966chr221710 76 1710 12047 12027
NM_005967chr12----1486 --
NM_005994chr171625 ------
NM_006003chr19139 ------
NM_006007chr933182 1372 992 34171 4065 3099 2933 456 11337
NM_006011chr1524223 3327 13850 --11031
NM_006016chr631660 1448 891 1660 1272 2483 112
NM_006024chr71246 1218 ----
NM_006033chr1852223 854 832 812 113 ------
NM_006037chr284574 4355 4260 3527 3396 3104 1191 741 23825 586 13871 --
NM_006039chr1711130 ------
NM_006047chr2043088 2177 1273 540 33352 3193 952 1531 --
NM_006054chr1151313 453 394 256 156 --1531 --
NM_006060chr774468 3392 2939 1688 1254 1088 835 --13128 --
NM_006063chr2158 ------
NM_006080chr752907 2301 1132 1104 973 22536 2448 1934 --
NM_006088chr9146 ------
NM_006089chrX41801 1783 654 273 ----1225
NM_006090chr12520 127 1493 1768 --
NM_006091chr15158 11235 ----
NM_006094chr852378 1760 978 250 197 21941 910 11915 2284 68
NM_006095chr474152 3978 3075 1745 1656 918 301 1904 43938 3010 1677 455 1278
NM_006106chr11103427 2845 2683 2658 2522 2373 1363 592 156 134 12942 23308 2404 12799
NM_006108chr1142045 847 809 461 --21847 1538 11689
NM_006113chr141870 677 357 149 1510 1132 --
NM_006136chr71241 --1940 --
NM_006141chr1632706 2602 1951 1124 1623 12376
NM_006143chr12147 ------
NM_006145chr191724 ------
NM_006154chr1531100 914 218 22908 868 1322 1366
NM_006156chr14124 ------
NM_006158chr821583 175 21158 474 ----
NM_006161chr51569 1116 ----
NM_006164chr2--1149 ----
NM_006166chr1232604 2553 318 12231 --11810
NM_006180chr941835 561 364 300 ------
NM_006191chr12--1225 ----
NM_006197chr861773 1758 1687 1642 191 34 ------
NM_006203chr5125385 5129 4495 4005 3646 3477 3471 1963 1949 1007 876 133 24220 1985 45528 5121 4401 1621 11708
NM_006206chr442941 2087 985 745 1520 --12556
NM_006210chr1931074 182 107 1939 --11174
NM_006216chr22653 126 ----1252
NM_006223chrX2488 127 ----147
NM_006226chr2----31390 1279 359 174
NM_006237chr1362117 1676 1490 1436 730 188 ------
NM_006241chr341855 1586 941 803 21932 791 ----
NM_006251chr533176 2216 1145 1929 23352 429 --
NM_006252chr1137183 7013 6900 4825 4806 4664 3038 2514 1468 908 895 684 347 106878 6482 6182 5389 4791 4651 1948 1171 883 497 43000 1672 1261 234 46258 1575 621 56
NM_006256chr142456 2416 1854 352 149 ----
NM_006258chr101183 ------
NM_006264chr41187 2593 403 142 --
NM_006267chr23752 531 433 11649 11564 1587
NM_006268chr1121175 898 ------
NM_006275chr2042180 1695 679 666 42515 1884 1683 531 1886 --
NM_006282chr2064521 4287 4234 3571 936 803 --44346 3579 3349 1412 23792 2999
NM_006283chr8134387 4320 3871 1722 1616 1584 1428 1019 766 603 315 293 261 11567 13967 --
NM_006290chr661792 1722 1299 1227 741 667 31779 1691 198 11824 --
NM_006292chr11------138
NM_006296chr2--1114 ----
NM_006298chr673198 2691 2642 2332 1136 1071 148 21249 402 11004 --
NM_006306chrX85937 5917 4948 4366 3965 1534 1392 765 14880 24991 1520 --
NM_006310chr17------21281 1190
NM_006313chr1241276 299 198 181 21136 610 ----
NM_006330chr831535 1407 197 11542 ----
NM_006333chr24545 254 171 104 ------
NM_006345chr431386 952 493 21319 1201 11279 --
NM_006348chr72798 149 ----1653
NM_006350chr5--175 ----
NM_006352chr161931 1776 1599 1376 1269 408 ------
NM_006353chr651363 1231 1211 253 135 ----1381
NM_006357chr2165 ------
NM_006358chr223776 176 79 --1284 2949 341
NM_006359chrX42308 969 409 184 --11571 1311
NM_006364chr142940 247 11033 1375 --
NM_006367chr1--2716 100 1252 --
NM_006371chr3124958 4857 4727 4293 4247 4217 3977 3323 1547 617 534 103 13583 --14913
NM_006372chr61501 --1361 --
NM_006375chrX31276 1221 393 ----1248
NM_006379chr73710 625 250 ------
NM_006380chr1764173 3802 2899 1363 459 360 --34138 3765 3151 --
NM_006382chr171273 ------
NM_006390chr1221590 1409 1687 ----
NM_006393chr1073820 3224 574 536 389 351 302 24237 326 13382 --
NM_006404chr201538 ------
NM_006407chr321344 951 2976 478 2897 273 --
NM_006409chr7----1234 --
NM_006413chr101221 ------
NM_006415chr921000 291 11243 2395 387 --
NM_006419chr44658 543 312 211 --1741 --
NM_006420chr2073343 3125 2671 2625 2506 2154 1181 --12966 43249 898 765 349
NM_006421chr81468 ----148
NM_006427chr141161 ------
NM_006434chr1032653 2213 786 1352 12415 22301 2019
NM_006451chr52827 135 2685 312 ----
NM_006457chr453785 3107 2905 2620 348 31417 396 139 14027 21120 451
NM_006459chr1031684 1640 1618 11854 --11652
NM_006460chr17--21422 1248 31408 506 243 31535 542 304
NM_006467chr532349 2246 293 41679 955 419 172 11752 22175 1541
NM_006472chr13804 795 115 3845 397 169 --2490 284
NM_006482chr1273554 3064 2948 2802 2471 387 191 22928 535 12867 11075
NM_006494chr193322 148 59 ------
NM_006495chr17157 ------
NM_006496chr181893 1776 1351 493 447 428 410 135 1259 2701 252 1341
NM_006504chr1082978 2779 2043 2003 550 524 312 248 52108 991 298 160 128 11137 32970 1994 1067
NM_006516chr121080 562 ------
NM_006520chrX11564 1118 11170 --
NM_006527chr42589 553 --1152 --
NM_006529chr42566 426 11448 21499 343 1674
NM_006534chr2053347 1218 1129 983 24 42811 2341 1193 347 12288 --
NM_006536chr13722 399 28 --2963 875 2240 226
NM_006538chr253693 3229 2893 1373 472 21513 1209 12627 --
NM_006544chr14105977 5680 5324 5138 4282 3920 3737 2415 785 699 25265 5103 23805 1322 --
NM_006546chr17136529 5674 5453 5122 5036 4937 4795 2515 1925 1845 962 496 401 22270 377 ----
NM_006547chr722121 1589 21565 209 31674 1419 320 --
NM_006548chr3--31533 1353 573 --11206
NM_006557chr931662 1170 114 --11462 --
NM_006561chr10106005 5525 4562 4387 2387 2368 2068 826 335 42 14867 14307 16088
NM_006572chr1783130 3075 3022 2788 2547 2301 921 105 22664 295 --22602 354
NM_006575chr1441202 472 333 98 --1382 --
NM_006577chr211262 ----11019
NM_006578chr1511267 1375 ----
NM_006595chr1131811 487 181 1143 --1582
NM_006599chr16137397 7144 6983 6897 6835 5883 5821 5651 3154 2169 1520 1242 948 47896 7498 6350 81 47294 5795 2244 819 1297
NM_006601chr121121 ------
NM_006602chr202850 231 1565 1304 --
NM_006603chrX41756 1411 727 220 ------
NM_006609chr2112632 2565 2448 2286 1981 1170 1066 1004 682 529 514 --12338 22962 2170
NM_006614chr312871 13479 ----
NM_006618chr131382 1155 131 --31626 1534 213 11083
NM_006620chr663658 3327 3268 878 671 637 ----24297 941
NM_006621chr1112016 1828 1641 1634 1562 1389 384 294 269 184 83 2485 369 ----
NM_006624chr1021605 415 2301 115 1434 2569 316
NM_006626chr942138 1937 367 107 --11703 21796 594
NM_006628chr1554323 2997 1244 537 331 1521 44096 4039 3141 50 --
NM_006644chr131163 2662 561 ----
NM_006654chr1274540 4452 4019 3525 1783 1754 1128 21898 692 23380 140 1176
NM_006660chr152278 267 ----1365
NM_006667chrX1163 1337 --171
NM_006682chr752708 2484 2380 1014 126 ----22544 989
NM_006699chr182541 2497 2461 2301 1006 913 850 699 1832 11822 --
NM_006704chr131116 --1293 --
NM_006706chr51708 1232 ----
NM_006708chr62918 537 11304 --1210
NM_006713chr52534 249 ------
NM_006716chr741373 1216 1020 79 1389 ----
NM_006717chr9103128 3048 3034 2722 2442 2137 1360 785 586 295 22621 690 --23389 2879
NM_006721chr102168 126 --1543 --
NM_006722chr362039 1954 937 527 357 99 2993 493 32399 2215 1997 --
NM_006729chrX75424 4851 4497 1606 1422 1407 930 2940 344 15004 33935 1629 1260
NM_006731chr995782 4668 4660 4230 3991 3910 3592 2054 987 --13827 --
NM_006734chr62270 253 --21113 521 21609 993
NM_006735chr71121 ------
NM_006738chr1563669 3342 3145 3113 3015 1166 43938 3367 2953 1747 11815 --
NM_006745chr41136 1724 --1346
NM_006750chr1688004 7082 6709 5001 2727 1472 401 28 36676 5934 5242 36602 2633 976 57226 6588 5625 4964 537
NM_006754chr761168 1162 437 304 297 64 --1987 --
NM_006756chr821315 301 21201 62 --2285 151
NM_006759chr2144 2243 220 ----
NM_006761chr171844 --1234 1181
NM_006763chr152144 1942 1762 1562 1504 21958 1772 ----
NM_006766chr862631 2076 1746 672 350 307 ----42407 2346 1061 539
NM_006769chr11134 ------
NM_006775chr652679 2557 2541 721 331 --1355 --
NM_006777chrX52926 2886 1017 910 896 22617 2605 2826 397 --
NM_006788chr181290 12135 --1833
NM_006791chr15154 ----1659
NM_006800chrX2572 88 ------
NM_006803chr83534 321 48 --1130 --
NM_006805chr521576 616 11741 ----
NM_006806chr21181 ----1158
NM_006807chr1711357 21141 157 ----
NM_006811chr202868 277 1380 ----
NM_006826chr231208 460 62 --2394 164 --
NM_006827chr1472252 1022 785 479 472 461 446 43176 928 593 535 12366 22791 2475
NM_006832chr141825 153 2908 218 --
NM_006838chr1241202 752 671 329 11839 ----
NM_006851chr1261088 912 874 455 302 178 --52777 2753 2613 940 928 12671
NM_006852chr1712014 --12447 --
NM_006870chr203829 320 203 --1800 --
NM_006873chr243345 3217 3144 3039 23303 1259 23274 3066 12443
NM_006874chr4--197 1788 --
NM_006877chr62356 337 ------
NM_006885chr1673103 2983 2850 1368 1154 1081 1054 11543 ----
NM_006888chr1453165 2904 2269 1171 246 12543 --1264
NM_006908chr731252 1003 968 --21195 1105 41516 1179 925 260
NM_006915chrX42510 2113 1656 266 1979 12261 --
NM_006916chr22408 300 ----1486
NM_006918chr1155721 5566 3587 2092 199 24412 1333 64889 3638 2054 2047 1369 22 24960 4654
NM_006920chr241933 1521 1294 200 --1126 21967 626
NM_006924chr1794218 3528 2956 1732 1647 1442 1036 612 331 23784 996 13841 1580
NM_006930chr571957 1872 1851 1739 1267 525 133 1109 11746 --
NM_006937chr171398 --1512 142
NM_006940chr1281584 762 672 638 546 109 61 29 2580 123 ----
NM_006943chr2032316 2207 696 ------
NM_006947chr421202 1180 2546 398 21696 487 --
NM_006948chr2142066 1904 1557 363 21866 253 ----
NM_006965chr182363 223 ------
NM_006973chr10128 ------
NM_006981chr942938 2708 2427 161 32053 445 430 1101 --
NM_006996chr131741 473 25 ------
NM_007005chr921420 1058 11217 2262 141 --
NM_007007chr1284736 4419 3758 3659 3544 3409 3359 630 64788 4522 4308 3470 1247 543 1979 13876
NM_007008chr23194 128 89 ----137
NM_007010chr1781610 765 743 617 537 453 399 269 --11463 11567
NM_007011chr1566504 5882 5090 2668 2175 408 45797 1544 767 421 16795 1514
NM_007017chr5188 ----1303
NM_007023chr21870 ----1697
NM_007026chr171237 ------
NM_007034chr121029 327 --1385 --
NM_007035chr123742 648 307 ------
NM_007038chr21105906 5475 4669 4135 4033 3846 2342 1560 836 379 36069 5714 1028 45312 1775 1236 332 --
NM_007039chr1411582 22256 367 21682 1669 11990
NM_007050chr20107383 5632 5302 2879 2378 2057 1778 1710 756 633 36418 5155 1186 56489 6380 5349 1454 389 36985 1372 1027
NM_007052chrX2586 117 ----2214 197
NM_007054chr563617 3610 3343 3278 3200 684 1952 23269 64 13745
NM_007064chr351653 1423 1358 1045 334 1132 1454 --
NM_007067chr171428 1526 11497 --
NM_007068chr22128 1154 ----
NM_007073chr644258 3354 1432 1130 43204 3046 2856 2706 ----
NM_007076chr121109 ------
NM_007099chr22231 131 1138 ----
NM_007106chr1372742 2606 2372 2324 980 761 678 12360 11729 2941 922
NM_007107chr321803 945 22404 117 2759 287 1581
NM_007111chr131767 1572 1266 --
NM_007114chr343229 2817 2413 452 22251 543 1842 3860 252 215
NM_007118chr51865 ------
NM_007123chr1------21281 1015
NM_007124chr651775 1769 1444 806 102 11782 ----
NM_007137chrX94244 4174 4100 3843 2065 1702 571 542 315 41837 997 882 174 13933 --
NM_007146chr1722398 1934 1890 11110 12713
NM_007157chrX62689 2292 795 567 224 216 12919 4908 758 648 287 21174 308
NM_007159chr32642 91 31417 144 100 ----
NM_007166chr1141529 1212 597 60 2102 93 21188 534 21108 1040
NM_007172chr2253184 2245 1045 996 701 43222 2371 158 60 22704 194 12145
NM_007173chr1152327 1887 388 146 45 1726 21895 470 12242
NM_007174chr1272385 1728 1520 926 684 594 368 --1456 --
NM_007175chr883256 2329 1278 981 827 804 618 44 12616 13182 12452
NM_007187chr13--1915 1936 --
NM_007195chr1863453 3329 2643 2595 2438 1496 11090 12490 23478 3246
NM_007197chr1211041 ----1637
NM_007200chr1563669 3342 3145 3113 3015 1166 43938 3367 2953 1747 11815 --
NM_007203chr943796 2902 2587 119 22601 1011 ----
NM_007207chr1--1359 ----
NM_007212chr14877 674 573 323 1218 32302 1780 52 1500
NM_007214chr611002 11312 ----
NM_007216chr114900 348 256 174 --2223 197 --
NM_007217chr31257 ----1283
NM_007218chr83881 857 368 --1172 --
NM_007222chr81628 21838 1317 --11538
NM_007231chrX52412 869 620 324 170 --32052 730 385 --
NM_007235chr121372 ----1449
NM_007236chr1542251 2133 1782 21 11925 ----
NM_007238chr2094289 3928 3465 3416 3149 3054 417 367 348 ------
NM_007246chr45780 374 294 261 106 31033 678 305 --1829
NM_007249chr13179331 8418 7708 6425 6346 5871 5782 5735 3751 3315 3217 2796 2120 1292 897 412 199 36381 3660 336 28616 6310 18893
NM_007257chr862513 557 519 332 294 221 22080 48 21964 64 1657
NM_007279chr192532 510 ------
NM_007282chr321024 768 134 1676 --
NM_007324chr1--174 ----
NM_007331chr432526 1901 1725 1499 --1266
NM_007345chr1862235 2006 1656 937 565 24 ----22172 1682
NM_007347chr1552718 2556 1053 693 184 --13094 --
NM_007350chr1264237 3660 3463 3320 1610 162 23807 3648 24465 4073 33308 3107 3035
NM_007353chr742770 2534 2493 839 12145 2369 89 --
NM_007358chr171914 1832 1784 1299 568 228 144 --11875 21492 94
NM_007359chr1751616 1151 653 413 29 21561 478 1420 --
NM_007363chrX--135 --1783
NM_007371chr9--1711 1114 --
NM_007373chr102402 57 --2670 439 --
NM_007374chr14--1378 1551 --
NM_007375chr182595 1984 1795 1709 1030 707 372 157 --1418 --
NM_009585chr3--1868 ----
NM_009585chr3--1868 ----
NM_012081chr553443 2671 2516 2480 640 22452 462 33023 1448 442 12871
NM_012084chrX3573 446 383 ------
NM_012089chr141554 1476 1410 35 1342 ----
NM_012090chr12935 370 ------
NM_012092chr231611 1426 1373 ----11403
NM_012095chr10103546 3480 2778 2702 2676 1391 1329 1052 1046 172 1362 42879 2502 1020 162 --
NM_012096chr353540 1480 1423 1263 697 22577 192 ----
NM_012097chr21846 21743 1440 12019 11595
NM_012102chr142148 1891 689 117 11792 1307 --
NM_012104chr1183533 2615 2476 2426 1382 1191 345 140 2815 314 23342 1408 22835 1098
NM_012104chr1183533 2615 2476 2426 1382 1191 345 140 2815 314 23342 1408 22835 1098
NM_012120chr642926 2486 2392 824 --22057 209 11919
NM_012124chr111704 1786 --1138
NM_012129chr762181 2165 971 956 386 205 12369 32516 2028 1007 --
NM_012137chr152735 2022 1911 1131 513 --2864 82 --
NM_012141chr1384165 3707 3174 2547 1367 1073 1003 842 33907 797 319 33001 2685 1570 1307
NM_012154chr8--1311 1844 --
NM_012158chr13126 --21466 192 21675 1370
NM_012164chr997361 7198 6932 6575 6309 5746 5479 2862 808 --37376 6466 6165 37148 6336 5358
NM_012176chr5--1226 ----
NM_012180chr41168 2673 546 ----
NM_012193chr1165083 4798 1627 1569 1436 1287 75232 4236 1694 1536 1135 1087 691 --14455
NM_012197chr911371 11207 ----
NM_012199chr174234 3305 3255 2832 1157 1078 467 11774 33103 1804 1190 13961
NM_012207chr103426 374 59 1869 ----
NM_012214chr276160 5455 5181 4565 2004 1224 530 46136 5920 4058 1154 45347 5096 908 638 56216 6192 2268 704 303
NM_012215chr1041681 1556 377 38 ------
NM_012218chr1942765 2327 2204 1930 ----2652 320
NM_012223chr211135 1335 ----
NM_012224chr42344 128 --1405 --
NM_012234chr343499 3304 1507 900 33718 3590 3150 13339 --
NM_012238chr1041406 1195 1182 617 11219 1491 --
NM_012242chr101165 1745 ----
NM_012247chr103933 267 118 ----1906
NM_012248chr162468 161 132 ----
NM_012249chr293174 3087 2534 2497 2441 2423 2296 1366 1333 --23103 930 32835 615 165
NM_012250chr111883 4463 228 122 96 --1432
NM_012252chr7135314 5132 5098 4742 3925 3647 3546 3531 1622 1611 1072 868 285 55347 3871 3494 3354 1706 --44991 4479 4161 105
NM_012257chr73862 813 394 1789 122 --
NM_012259chr621433 1218 ------
NM_012262chr164921 4527 4053 3845 3692 1850 44885 3307 1818 1595 45019 4404 3653 1424 --
NM_012281chr761811 1511 809 517 269 146 11529 12096 --
NM_012286chrX2472 57 1635 --189
NM_012287chr3134133 3792 3582 3281 2962 2756 2749 988 775 615 587 435 84 21207 854 --12975
NM_012290chr221388 1247 --21711 1471 11551
NM_012294chr773468 3231 2529 1541 944 775 264 --23027 736 13450
NM_012297chr462513 2438 2255 1998 854 628 1247 1828 11031
NM_012301chr751555 1429 1422 795 51 1409 ----
NM_012302chr12862 840 1402 ----
NM_012309chr1174587 4052 3803 3631 1679 1210 701 ----13381
NM_012316chr195615 1744 1683 1656 1460 1199 998 729 246 --1277 24596 2122
NM_012325chr201402 11643 11252 2132 86
NM_012328chr731329 1221 934 2328 108 21388 1378 1221
NM_012329chr17--11407 ----
NM_012330chr1031816 1115 543 --1529 11556
NM_012343chr5----1738 --
NM_012382chr593781 3591 3357 3205 3119 1744 840 724 585 33031 1441 857 11460 34066 3052 2888
NM_012383chr9------1280
NM_012388chr1552187 787 549 359 115 12311 1328 --
NM_012405chr163566 1167 478 470 411 192 21073 857 43361 2957 2654 94 13862
NM_012416chr9--1227 21081 442 --
NM_012425chr1022063 1965 --1217 1195
NM_012430chr32730 549 --1754 --
NM_012431chr732858 937 924 32628 1408 1218 2638 474 13379
NM_012434chr611443 11644 ----
NM_012443chr105762 708 621 572 251 1153 ----
NM_012463chr1211401 1340 31378 1259 1201 --
NM_012464chr422798 1092 --22470 704 11842
NM_012465chr1042540 2174 644 305 31283 138 76 1887 --
NM_012467chr16------128
NM_012471chrX31875 607 53 --11801 3641 592 321
NM_012479chr792695 2509 2149 1973 796 677 669 520 50 12024 11754 --
NM_013229chr1252440 2187 527 186 96 42518 2388 2372 486 22467 225 22229 475
NM_013230chrY21773 1621 1325 --21351 286
NM_013231chr1413212 2794 236 1321 11644
NM_013233chr251184 578 430 315 291 --21281 972 --
NM_013235chr53906 683 173 1646 --1259
NM_013249chr114417 209 166 28 151 ----
NM_013255chr7188727 8315 7243 6926 6617 6406 6338 5938 5920 2722 2284 1565 1488 1351 846 497 263 128 78518 6413 5901 5864 3103 1925 761 68881 7024 3392 3326 1606 509 23531 2006
NM_013257chr832186 2130 249 21906 1690 ----
NM_013261chr443583 2823 2432 1369 12742 32520 1199 877 --
NM_013262chr631278 511 240 11492 1359 11107
NM_013269chr1284140 4041 3463 3044 917 604 86 30 --54518 4463 3983 1357 641 --
NM_013272chr15------157
NM_013279chr1141917 1603 694 586 42163 1653 785 507 11740 --
NM_013281chr2041322 622 385 264 ----21379 1010
NM_013283chr52868 97 ----1262
NM_013293chr71614 1183 1102 1728
NM_013296chr11346 ----168
NM_013309chr1572637 2476 1931 1786 909 672 563 3862 749 309 --12682
NM_013313chr2273547 3364 3240 3173 1157 859 680 53012 2512 2160 1186 983 13071 1935
NM_013320chr12------1135
NM_013322chr731508 1294 83 --11390 1126
NM_013326chr18------170
NM_013352chr64872 751 312 69 --1657 --
NM_013354chr861488 1368 963 900 215 171 ------
NM_013357chr82708 184 1562 1587 --
NM_013358chr131762 1467 686 ------
NM_013372chr1552941 2365 1349 251 77 13005 1499 12966
NM_013377chr121110 ------
NM_013386chr161348 1196 516 433 411 338 --1240 21267 425
NM_013390chr941674 1536 659 355 ----11704
NM_013396chr2141279 1194 1030 955 11144 21567 49 --
NM_013411chr132834 2791 2244 --1852 --
NM_013423chrX21239 204 --11279 1974
NM_013427chrX21239 204 --11279 1974
NM_013437chr821424 117 1924 11220 --
NM_013438chr911585 3586 61 54 1710 --
NM_013444chrX4922 347 258 87 156 1281 164
NM_013943chr153203 2807 2349 829 732 22909 159 22765 236 12758
NM_013958chr81337 ------
NM_013959chr81337 ------
NM_013961chr81337 ------
NM_013962chr81337 ------
NM_013981chr5----146 --
NM_013982chr5----146 --
NM_013983chr5----146 --
NM_013989chr1463732 3665 3653 1264 753 211 --13317 33192 1792 463
NM_013995chrX72582 2452 2157 2045 874 566 106 12192 1929 --
NM_014010chr9----1498 --
NM_014011chr252639 1935 1902 698 317 22474 2062 11019 1623
NM_014016chr351647 612 183 172 62 ----31274 583 460
NM_014021chr183039 2648 2533 1230 1103 918 699 527 1159 1648 --
NM_014028chr6103349 3341 3266 3080 2589 1191 1044 624 321 104 43116 2928 2398 801 1865 --
NM_014031chr5267 35 --2240 120 --
NM_014034chr611145 ----1473
NM_014039chr1111095 1443 1373 1939
NM_014043chr321491 283 2606 515 --1636
NM_014044chr2------1166
NM_014048chr1644928 4474 1948 373 24637 3571 11275 11394
NM_014055chr121121 --1347 --
NM_014106chr1512648 22997 1882 32043 1908 335 12791
NM_014109chr851283 1082 465 262 27 --2844 99 --
NM_014112chr875451 5361 4908 4040 1860 1341 1153 --45152 5103 3813 3667 25013 2102
NM_014117chr1652757 2517 2105 767 291 --12557 22610 194
NM_014141chr753302 1868 980 453 194 44748 4341 992 366 --1100
NM_014145chr205841 692 595 377 51 ------
NM_014155chr11137511 6898 6693 5976 5728 5663 5637 4690 2994 2547 2228 2000 1597 46320 5312 4654 1760 32210 1546 806 37430 2159 760
NM_014181chr272859 2777 2660 2154 1096 829 144 21966 675 1860 --
NM_014182chr12--2633 104 ----
NM_014183chr20----2312 33 --
NM_014191chr121427 1390 --1826
NM_014208chr4----1291 --
NM_014217chr13441 58 22 --1354 11691
NM_014233chr1741918 1438 1406 1391 --11399 1129
NM_014246chr2211719 31647 436 74 ----
NM_014250chr2231723 752 339 1283 ----
NM_014253chrX32106 1927 557 32488 2359 2306 2363 180 --
NM_014268chr1851300 1264 1234 1177 1164 --11147 --
NM_014278chr41385 --198 --
NM_014283chr121570 1121 11427 2997 291 11079
NM_014284chr13951 881 734 ------
NM_014288chr1----1225 --
NM_014289chrX31191 483 88 ------
NM_014294chr831157 1149 444 1934 11018 --
NM_014296chr321535 596 21548 1016 21156 368 --
NM_014309chr2285319 5305 4568 4372 3555 1033 822 197 1184 ----
NM_014323chr223658 321 173 --1285 --
NM_014325chr1231904 1740 1503 1895 1495 --
NM_014326chr1541310 1244 1198 221 ------
NM_014331chr4167457 6182 6123 5996 5475 5111 4929 3044 3008 2628 2396 2048 1857 1227 1044 541 47010 6293 5186 508 34860 2105 666 27338 2429
NM_014333chr1132636 2080 1885 --32822 2476 776 1427
NM_014342chr111232 --11494 --
NM_014351chr2241069 913 442 82 --11474 --
NM_014363chr1331056 1050 170 1931 ----
NM_014372chr141630 1459 533 213 ----1118
NM_014376chr532256 1947 1700 --12016 12480
NM_014382chr351633 1531 643 392 149 --31795 1392 201 --
NM_014393chr862311 2045 1616 1520 858 505 1869 ----
NM_014394chr1011050 2754 308 11200 --
NM_014397chr941079 434 317 223 ------
NM_014411chr741491 1448 173 112 --31770 1352 1308 11689
NM_014415chr321409 1356 11398 ----
NM_014423chr554918 4530 1553 547 177 43656 3499 1438 1425 44452 2132 1875 959 14569
NM_014432chr651467 1308 1231 599 186 11137 1613 --
NM_014435chr41606 180 1646 --
NM_014445chr332161 1721 1696 --1976 11925
NM_014447chr431669 153 130 --1425 --
NM_014452chr651015 465 455 407 312 2923 344 --1416
NM_014454chr6--1899 --2918 674
NM_014455chr11439 ----1149
NM_014456chr102698 662 3692 540 474 1228 11414
NM_014458chr11950 1503 ----
NM_014504chr792144 2036 1830 1730 1582 1331 642 605 166 1746 1625 11590
NM_014521chr2--31877 1754 1723 21473 1368 --
NM_014552chr231328 411 129 ------
NM_014562chr22802 295 ------
NM_014563chrX52105 1977 1797 1464 201 ----12145
NM_014570chr221248 ----21013 45
NM_014572chr1361512 1377 1309 1213 1114 294 ----11505
NM_014574chr143992 378 153 1505 1275 --
NM_014577chr221318 --1106 1277
NM_014584chr1431505 212 90 11088 ----
NM_014585chr281288 1183 1177 1121 504 485 339 122 ------
NM_014588chr202219 146 1605 1208 1774
NM_014592chr53817 661 56 ------
NM_014606chr481473 1148 988 509 388 376 326 268 ------
NM_014607chr282141 2090 839 669 352 272 199 120 21880 492 --11768
NM_014612chr921557 1316 21157 973 2443 345 1503
NM_014613chr552699 2268 2043 889 759 33059 2759 1126 2643 158 2614 496
NM_014614chr231105 1039 465 ----11325
NM_014615chr1683389 3317 2997 2620 2313 836 607 169 22947 63 23378 282 23254 2727
NM_014616chr372598 1392 878 840 815 429 186 13421 --12401
NM_014630chr15123987 3878 3674 3608 3206 2476 2429 1329 1322 1301 707 514 ----13665
NM_014633chr111401 --1106 --
NM_014634chr2273587 3292 2753 2229 1341 812 41 ----12956
NM_014635chr231267 1246 1106 1373 --21382 1179
NM_014636chr9114348 4049 3902 2981 1612 1442 1337 1257 1092 599 593 21406 701 23973 3440 --
NM_014637chr8198 1535 21375 333 --
NM_014647chr1632209 2076 1915 11753 1253 --
NM_014655chr142089 2008 1489 923 --11802 --
NM_014660chr72992 802 1858 ----
NM_014667chr342460 1681 879 245 22484 806 ----
NM_014670chr231391 1080 76 11475 --1641
NM_014674chr373415 3209 1316 757 718 156 39 --21076 770 23989 374
NM_014676chr141676 1488 1367 1167 1370 ----
NM_014677chr831196 1184 916 11331 1847 --
NM_014679chr1131396 1176 324 --21190 993 --
NM_014683chr1722159 786 1281 31659 1463 105 2476 311
NM_014685chr162226 210 1516 ----
NM_014689chr2--1563 --1522
NM_014701chr1573424 3056 3040 2539 2345 991 726 33357 2363 268 13019 1414
NM_014702chr692225 1402 1371 1138 944 759 525 178 113 13434 43453 2287 912 610 32969 2396 1013
NM_014705chr742164 1377 421 88 21848 303 21906 570 --
NM_014707chr71878 32213 616 246 --11596
NM_014709chr22476 406 ------
NM_014711chr1621591 163 22132 447 21705 1463 --
NM_014713chr2------1549
NM_014715chr118871 793 770 692 679 356 322 210 1604 ----
NM_014720chr1071796 1733 1620 1351 696 358 267 1253 1616 1513
NM_014721chr686839 6159 5567 5540 2312 1451 694 273 37349 7051 6455 11960 22051 669
NM_014730chr12105022 4827 4122 3380 1712 1416 1292 1282 975 553 11053 33803 1764 787 --
NM_014730chr12105022 4827 4122 3380 1712 1416 1292 1282 975 553 11053 33803 1764 787 --
NM_014732chr16115859 5154 4954 4850 4319 2204 2002 1924 919 869 570 35518 5184 4069 25255 3553 --
NM_014733chr532097 322 131 32296 1643 872 1747 --
NM_014739chr6154093 4001 3865 3575 3289 3280 3227 3183 2963 2941 2836 2666 1372 1146 681 43781 3432 1395 1218 24039 1521 13068
NM_014746chr272826 2792 2704 1702 1640 1569 339 12735 1718 43780 3626 3419 1289
NM_014751chr821513 1385 11623 ----
NM_014752chr1121828 379 11802 1211 21392 407
NM_014755chr243729 3461 2782 823 11223 23537 1033 13655
NM_014761chr162833 73 2932 24 11145 --
NM_014764chr122404 268 --21088 394 --
NM_014765chr152116 1985 1863 819 616 12012 11063 1809
NM_014766chr773740 3361 3116 3078 1024 825 26 2334 157 13032 --
NM_014774chr172845 2592 2408 2057 2026 1141 1035 31283 892 376 --1420
NM_014776chr1273111 2963 2767 2451 2231 2070 1013 1318 22117 1003 11114
NM_014779chr331023 982 49 --1287 --
NM_014781chr831080 433 189 --21016 422 --
NM_014783chr1521104 219 21643 239 1196 --
NM_014787chr132069 869 700 ------
NM_014791chr93289 256 125 ------
NM_014795chr21276 1334 ----
NM_014802chr1241102 1088 1044 75 11008 ----
NM_014803chr1062710 2608 2385 1135 312 232 2878 44 --21829 532
NM_014810chr1103675 3458 3169 3051 2563 2486 2448 2319 1470 453 ----1119
NM_014812chr141937 1591 1328 1286 --31379 445 127 11555
NM_014819chr552338 2266 2259 778 220 --22323 640 --
NM_014820chr331580 1370 1293 21843 518 --1630
NM_014822chr41596 ------
NM_014824chr1131981 1745 1330 11410 21622 1574 11766
NM_014826chr174192 3853 3319 1274 848 492 444 24002 2824 --11617
NM_014827chr141576 364 159 94 3666 530 24 1319 --
NM_014828chr1472376 2166 1650 1618 702 564 534 1800 12355 1675
NM_014829chr552390 2096 614 430 226 ----41777 1754 877 719
NM_014830chr1223164 910 33700 2865 2449 --23659 2435
NM_014832chr131378 21618 674 --21636 38
NM_014836chr1031980 1697 727 ----1227
NM_014838chr2242645 2264 946 410 12837 22735 1800 11830
NM_014839chr162276 2237 2039 793 531 346 --41990 961 885 231 --
NM_014847chr11380 ------
NM_014848chr1532279 845 391 1209 12092 32453 2417 2291
NM_014850chr343550 3299 1260 893 13501 13262 24561 4526
NM_014860chr252658 2553 2524 1796 275 21915 878 --3539 105 80
NM_014862chr1554087 1506 1069 1045 985 34009 3931 1265 23057 281 --
NM_014864chr163921 3341 1534 983 714 270 33050 1505 914 ----
NM_014870chr174422 3945 3226 1702 811 757 491 ------
NM_014872chr952262 2131 1748 1451 225 3488 444 110 ----
NM_014873chr194578 4471 3805 3432 3370 3052 1898 668 615 --23259 3240 13755
NM_014874chr141783 1647 1173 409 ------
NM_014877chr17107614 7291 6918 2608 2506 2453 2363 1921 1322 937 46402 5006 2594 1209 16763 47536 7125 5884 2224
NM_014883chr452414 1919 1643 1631 464 21932 165 ----
NM_014888chr72986 44 --1595 11332
NM_014890chr33313 279 250 ------
NM_014892chr6--1140 1178 --
NM_014893chrY62306 1736 1595 917 743 245 --2776 431 --
NM_014897chr1783035 2313 2279 2258 1104 752 553 172 --33103 2970 83 1716
NM_014899chr553076 2779 2565 1100 639 31000 253 172 22362 725 --
NM_014900chr221051 205 3851 750 235 ----
NM_014903chr1221934 709 21683 829 --1331
NM_014904chr1053612 3559 2708 2488 1187 42800 2627 1358 925 33915 3219 247 --
NM_014906chr1774124 3986 3513 3464 3069 2877 834 --13387 53731 3141 3097 2715 126
NM_014912chr1043020 2884 2608 260 --13240 13363
NM_014917chr11975 ------
NM_014918chr1561443 1322 1153 655 133 117 --11307 --
NM_014923chr132485 269 12079 --11759
NM_014924chr1462717 1041 749 650 388 359 --22440 459 --
NM_014926chr32952 457 ------
NM_014927chrX1104 ------
NM_014934chr13123843 3322 3148 2961 2669 2640 1253 1205 983 780 540 389 2445 375 23084 149 2955 475
NM_014936chr692797 2132 2094 1960 1850 654 482 418 148 21764 669 --22867 340
NM_014939chr1831255 1054 273 ----2467 200
NM_014946chr272936 2777 2023 477 445 279 214 43022 2348 2254 1039 21008 959 1404
NM_014947chr11446 22307 1975 --1770
NM_014949chr12173 42 --1155 1143
NM_014950chr1411365 --31746 1181 58 --
NM_014951chr1032515 1882 739 22347 250 --12201
NM_014961chr461939 1564 1394 877 645 178 21841 1386 1354 2657 292
NM_014962chr2042078 1890 978 215 42641 2273 1160 334 12629 --
NM_014964chr174978 870 692 145 21795 552 ----
NM_014969chr121013 323 11044 1840 1825
NM_014978chr1051325 1227 731 289 166 ----11297
NM_014982chr1484756 4565 4100 3727 3582 672 542 415 21767 310 41362 1112 950 526 33372 757 276
NM_014988chr432100 1030 39 --22529 983 --
NM_014990chr1431348 1140 214 --1468 --
NM_014991chr462957 2800 2572 863 703 343 ----12199
NM_014997chr752832 2337 1141 1112 289 --32863 2156 1100 --
NM_014999chr1231033 652 154 11215 21597 581 --
NM_015000chr1252991 2381 2130 1076 571 22970 2686 12281 22694 2486
NM_015008chr3103580 2975 2556 1289 1250 813 598 592 268 240 22820 256 33028 1381 1300 --
NM_015017chr11133 ----11322
NM_015020chr1673805 3677 2593 1306 1162 934 693 --11558 --
NM_015023chr111396 ------
NM_015025chr242605 2279 1977 1059 21020 156 ----
NM_015026chr12134620 4532 4499 4329 4287 4246 3451 2947 2936 1459 1262 211 85 1126 23962 802 53759 3170 1719 1274 855
NM_015032chr1362767 1813 1034 787 558 391 1326 11936 --
NM_015035chr2066450 2432 1468 1215 1094 724 --11861 12575
NM_015039chr154122 3944 881 549 258 --13331 13433
NM_015040chr243419 2516 2177 672 13382 22531 238 --
NM_015042chr1573473 2782 1000 933 841 826 688 --14303 21347 1247
NM_015046chr922065 1812 --1136 1223
NM_015049chr242804 2671 2379 878 12425 12818 12033
NM_015051chr932967 2184 616 42757 2505 243 186 1546 13062
NM_015055chr1172990 2410 2158 1856 1846 1812 478 1976 12732 12268
NM_015059chr15113342 2947 2749 2628 1190 1042 996 882 738 598 363 14013 1827 --
NM_015068chr73966 418 251 32706 1505 572 21247 1013 13628
NM_015070chr1321321 60 --1569 1149
NM_015071chr5116478 6248 5899 5255 4279 4235 2252 2154 1935 1600 981 24843 1615 11744 12238
NM_015074chr143081 1994 476 127 34915 3060 3043 14291 24382 3030
NM_015076chr664062 3563 3422 1372 1362 168 2792 508 ----
NM_015087chr1342276 2242 2030 393 31796 956 196 12545 --
NM_015091chr14------1829
NM_015092chr1694471 4070 4042 3279 3074 2929 1624 1503 734 13514 33321 2947 2857 34327 1462 1379
NM_015093chr631347 693 662 ------
NM_015094chr2274554 4130 3519 3339 3311 1213 154 24662 3881 1490 --
NM_015097chr342215 1958 701 669 1368 1898 --
NM_015100chr141868 793 705 554 1684 --11403
NM_015101chr162137 2083 1029 965 884 101 --22484 2062 12287
NM_015107chrX52400 2223 1967 1523 306 ------
NM_015110chr952280 1566 980 362 345 1552 --2938 853
NM_015115chr432546 2374 1018 32849 2329 2012 1760 52882 2450 2319 2038 725
NM_015132chr731492 684 672 51801 1579 1379 542 202 21720 801 1499
NM_015138chr1542028 1836 755 257 ------
NM_015141chr342699 2411 2216 2184 32072 1863 774 ----
NM_015143chr431223 504 35 11304 ----
NM_015149chr1--22097 2088 11538 --
NM_015151chr211336 1900 ----
NM_015153chr61545 --1306 2796 100
NM_015156chr1441623 1503 355 158 13198 --12572
NM_015157chr1121082 56 ------
NM_015161chr1661192 1139 1127 246 201 124 --21347 1152 11244
NM_015170chr842135 2017 1898 1582 12129 22061 1792 --
NM_015176chr181642 1524 1418 1275 1195 1168 1132 95 21183 328 --11660
NM_015180chr14--1566 ----
NM_015186chr92384 330 ------
NM_015187chr43688 348 328 197 ----
NM_015191chr1131965 1064 528 ------
NM_015199chr362910 2761 2051 1148 1068 962 12096 --12176
NM_015200chr452296 2134 1772 389 256 2782 131 ----
NM_015205chr1375285 4745 4612 4595 3880 1897 1461 24638 2077 --11472
NM_015206chr1563617 1344 906 619 451 384 21005 915 22944 834 --
NM_015208chr1822556 1256 33656 3294 1346 ----
NM_015209chr131695 761 605 11797 11720 --
NM_015215chr162741 2504 2436 802 524 23 13143 ----
NM_015216chr541078 994 64 52 11300 ----
NM_015225chr94557 327 233 160 62989 2441 969 877 459 299 23135 2718 --
NM_015230chr42452 55 21639 1598 --21512 1278
NM_015231chr113980 939 625 ------
NM_015233chr13----1599 --
NM_015236chr42999 102 ------
NM_015245chr652804 2087 1909 562 349 1630 11108 --
NM_015247chr16115332 5156 4982 4237 4166 1892 1296 593 421 370 263 14453 15277 14014
NM_015250chr971834 1814 1667 1259 702 308 189 --21497 380 --
NM_015251chr1652324 2017 1977 588 506 --21633 1492 --
NM_015252chr24980 886 754 623 ----1231
NM_015256chr5----1147 1529
NM_015264chr2254798 4431 4112 3566 3157 13858 14478 13141
NM_015265chr242154 2092 322 150 21654 795 --2506 64
NM_015269chr11471 ----1423
NM_015271chr454305 4038 3936 3577 3097 43863 1655 1014 730 13250 1154
NM_015272chr1642052 2019 1488 305 ----2663 522
NM_015275chr1221327 466 2669 146 --1132
NM_015277chr1831837 1284 286 ------
NM_015278chr652945 2583 1370 598 540 11223 11055 13268
NM_015282chr242008 999 845 830 22727 2144 32042 489 415 11111
NM_015285chr1872365 2322 2227 1919 1609 646 587 --22507 1931 --
NM_015286chr1552114 847 577 537 64 52270 987 889 615 192 ----
NM_015291chr163239 2165 1192 982 693 289 ----13218
NM_015294chr173783 417 38 ------
NM_015296chr1351142 998 945 404 353 11106 1269 --
NM_015299chr1483739 3680 2818 2642 1389 561 234 215 23786 3253 13350 23985 2439
NM_015308chr113706 671 62 1801 1594 --
NM_015310chr8117773 7636 6369 6260 5983 5497 5163 3043 2464 902 778 56008 5149 2408 1523 1433 21198 1032 22396 1092
NM_015313chr1153658 3463 1781 1471 437 --13685 13725
NM_015314chr752431 2092 1854 641 490 22015 164 ----
NM_015315chr543291 2772 2271 515 ----1755
NM_015323chr631723 1449 1138 1166 11227 --
NM_015326chr192205 1989 1188 1139 1131 955 353 244 151 --12121 12876
NM_015328chr753072 1981 780 603 508 22487 2340 23142 2618 --
NM_015332chr783355 2776 2546 2499 2388 1038 513 505 1909 13340 13032
NM_015335chr122980 932 32163 1986 1680 21706 187 --
NM_015336chr1262653 2561 2447 2378 1750 1640 --1236 --
NM_015339chr2021002 920 --1731 --
NM_015347chr1262771 2213 1156 1046 732 72 22111 1924 41820 511 297 232 --
NM_015349chr641921 1086 748 222 --12696 --
NM_015353chr1761829 981 806 356 337 260 --12249 --
NM_015355chr1761880 1715 1605 1448 521 225 --31699 1518 1378 --
NM_015359chr832833 2197 1984 12784 22680 2139 32245 2051 1839
NM_015361chr21753 1641 2807 630 --
NM_015365chrX84042 3742 3487 997 990 455 322 260 24304 3269 33700 2784 599 23102 2907
NM_015378chr152623 2223 1830 1159 701 11899 --32449 2168 469
NM_015382chr142616 131 137 1561 --
NM_015385chr1032653 2213 786 1352 12415 22301 2019
NM_015387chr251909 1790 1384 724 401 --12085 --
NM_015393chr473607 2582 2435 1159 560 102 40 11189 --2380 197
NM_015401chr1231117 342 88 ------
NM_015423chr1171511 1355 1214 1144 665 640 337 2330 238 11093 --
NM_015431chr173290 2401 801 731 524 510 327 --33314 771 416 1372
NM_015435chr81301 1197 ----
NM_015436chr482966 2927 2723 920 860 692 318 59 12540 22946 2278 --
NM_015446chr121676 645 1372 --1638
NM_015453chr331830 1361 735 2839 539 --2489 103
NM_015455chr583959 3717 3457 2788 1479 707 683 27 --31247 902 856 --
NM_015458chr8105236 4325 4284 4266 3566 3485 1989 1906 899 61 24356 96 24588 1591 53891 1315 1289 866 525
NM_015460chr371970 1871 1544 1297 322 210 60 --11709 --
NM_015464chr73830 712 143 ----1269
NM_015465chr52533 286 ----1734
NM_015474chr202255 99 ------
NM_015475chr22854 258 ------
NM_015483chr72847 725 ------
NM_015484chr11783 ----1152
NM_015507chrX--1171 ----
NM_015508chr321154 574 --1193 --
NM_015509chr1231326 1205 52 11123 1347 --
NM_015532chr1592550 2476 2240 2219 2154 1927 851 563 329 --22058 287 22265 1094
NM_015534chr121047 424 2789 257 ----
NM_015535chr2104176 3349 3247 2920 2656 1261 1213 1187 340 127 22883 1392 44217 3975 3966 371 14056
NM_015541chr331046 377 271 --11443 --
NM_015550chr783225 3170 3069 1117 1012 293 214 165 12381 42674 792 774 136 1984
NM_015553chr6103856 3730 1973 1752 1713 1353 901 804 685 510 21385 1267 --24655 82
NM_015554chr1562676 2399 1967 1896 1155 913 32097 958 415 12382 22958 139
NM_015555chr641747 1119 627 588 31728 1410 37 1344 --
NM_015557chr142515 703 416 294 --13204 --
NM_015564chr583604 2773 2600 2427 1119 1016 729 615 --43392 3196 2460 646 12435
NM_015567chr1331209 477 256 1172 --1896
NM_015568chr2023206 2746 ----42862 1659 1646 1134
NM_015569chr154292 4161 1486 927 786 23652 975 64737 4682 3599 1203 1017 545 14406
NM_015570chr721299 734 ----1509
NM_015571chr642196 910 488 336 21789 1033 --12556
NM_015575chr263334 3289 3161 896 786 92 23637 1214 31098 773 166 --
NM_015576chr322389 1825 12227 1631 12068
NM_015577chr5--11518 11539 1653
NM_015578chr194774 723 577 250 1200 11363 21927 1376
NM_015601chr103861 361 106 ----1842
NM_015602chr121313 325 11789 1457 31390 701 251
NM_015627chr151851 1647 1622 1532 1364 31556 617 208 ----
NM_015630chr2--1814 1299 --
NM_015635chr941833 1815 742 138 --1623 --
NM_015640chr141027 782 679 614 11501 13511 15045
NM_015642chr33313 241 23 ------
NM_015657chr22294 258 --1951 --
NM_015676chr142255 146 ------
NM_015678chr1321095 540 --21648 506 --
NM_015687chr62433 82 ------
NM_015691chrX72970 2185 555 420 388 195 59 ----2370 82
NM_015695chr641857 1844 1485 622 --1605 --
NM_015702chr21275 ------
NM_015713chr8113589 3509 3306 3120 2672 2360 2250 2192 1444 1221 933 194 1643 42369 594 509 345
NM_015716chr171502 ------
NM_015726chr121545 1368 --21141 329 21198 542
NM_015840chr132745 2682 480 1306 12157 12493
NM_015841chr132745 2682 480 1306 12157 12493
NM_015866chr121023 29 ------
NM_015878chr881848 1780 1508 890 663 238 99 21 21870 1563 ----
NM_015879chr18148326 8160 7492 6766 5264 5223 3307 3230 3134 2374 2319 2299 1633 1354 36461 2326 2155 28057 6140 --
NM_015886chr8105705 4795 4142 3954 3932 3710 2221 1973 1836 616 15041 24368 500 25006 1162
NM_015888chr112236 1168 12332 157
NM_015891chr631862 1623 1420 --1564 --
NM_015904chr21523 ------
NM_015905chr71409 --1147 --
NM_015906chr184481 4324 4299 4033 3502 3049 1051 497 --43666 3539 3519 1763 34581 4183 125
NM_015932chr133819 727 207 --2692 568 1239
NM_015975chrX2724 150 195 31319 527 214 --
NM_015976chr1182 ----2300 260
NM_015984chr1----1136 --
NM_015986chr1721211 384 2359 77 1534 --
NM_015989chr124760 598 561 28 1725 ----
NM_015999chr1--1655 ----
NM_016009chr184852 4571 4493 4265 3863 3167 815 211 34944 1566 430 11955 11669
NM_016021chr642319 1980 213 127 --32391 2327 2199 22307 467
NM_016025chr1621601 224 --11747 --
NM_016032chrX1124 ------
NM_016039chr14----1160 --
NM_016040chr182653 2579 2106 2024 1847 1771 767 464 32766 2598 2084 12249 1660
NM_016048chr52737 80 1349 --1335
NM_016072chr12102258 2113 2099 1948 1557 1483 973 635 568 109 12363 11999 1312
NM_016075chr1342920 2596 2379 776 42830 2486 872 510 --12788
NM_016076chr1113175 3039 2851 2187 1957 1293 1244 1197 1112 833 689 22510 945 --12912
NM_016078chr1731001 731 371 ----1906
NM_016083chr683638 3491 908 887 867 860 603 79 13511 22633 1281 --
NM_016087chr721601 1294 --21658 593 1352
NM_016090chr114931 835 799 119 ------
NM_016096chr871867 1474 1458 546 419 225 57 11489 21960 845 --
NM_016098chr6----2368 356 --
NM_016100chr20--2387 112 ----
NM_016103chr52481 410 ------
NM_016120chrX1311 1298 --1342
NM_016121chr12398 291 ----11108
NM_016127chr8163 1765 ----
NM_016129chr4------1239
NM_016131chr282027 1812 1475 761 746 709 283 114 1481 12021 --
NM_016132chr1553352 3202 2480 2267 1065 --12203 22539 2160
NM_016133chr271501 1424 1192 1170 1150 464 114 11657 11623 --
NM_016141chr32749 621 ------
NM_016144chr53628 196 134 1241 ----
NM_016173chr3134513 4257 3973 3958 3750 3462 3240 3164 2949 1634 1487 1187 85 --11565 --
NM_016194chr1511267 1375 ----
NM_016206chr3168748 8563 8228 6860 6468 6264 6144 6111 5775 5635 3352 2279 1847 1748 1112 614 38847 8619 3509 67691 6876 3492 3391 3329 1655 17704
NM_016221chr542333 808 564 292 --32327 849 661 --
NM_016224chr622140 381 ----1420
NM_016227chr121570 1121 11427 2997 291 11079
NM_016235chr1611414 11422 ----
NM_016248chr1373613 3164 3020 2951 2915 737 571 23267 817 13012 --
NM_016255chr673158 2576 2422 2246 1349 1028 974 1340 41156 628 282 262 13116
NM_016257chr143119 2862 2579 868 23007 805 ----
NM_016258chr1----2535 92 --
NM_016260chr2146734 6528 6441 6087 6056 5734 5390 1865 1790 1480 1455 760 221 136 76268 6260 5595 4934 4904 2030 1135 16921 14673
NM_016269chr42950 900 11000 ----
NM_016271chr1811621 1207 148 21943 590
NM_016275chr352035 942 893 677 317 --1846 21723 1700
NM_016281chr1251051 972 451 350 162 11106 ----
NM_016284chr161670 ------
NM_016289chr242313 1923 1736 783 22238 709 --21776 558
NM_016297chr263318 3076 2523 1273 899 656 1993 33560 3535 209 1245
NM_016307chr9----1292 --
NM_016308chr171563 1273 763 721 491 401 207 31729 1263 790 --125
NM_016315chr231526 1488 73 31636 519 372 11426 --
NM_016316chr21520 1744 ----
NM_016322chr933208 3180 371 12294 4969 638 525 391 --
NM_016338chr52977 321 11069 ----
NM_016351chr7--2550 513 ----
NM_016352chr751434 1211 928 458 423 ------
NM_016356chr652810 2578 2478 2261 785 1164 1531 1416
NM_016357chr1241221 1186 1140 1054 127 --2511 145
NM_016373chr162644 151 1688 --1679
NM_016374chr131629 476 465 ----1573
NM_016374chr131629 476 465 ----1573
NM_016376chr1764138 3893 3849 3584 621 33 23453 1346 34254 1051 582 --
NM_016377chr651786 1409 1155 671 512 --21457 1123 --
NM_016395chr1541891 1438 347 51 --1688 11734
NM_016396chr1582887 2537 2498 2308 1954 1935 218 120 12646 12386 --
NM_016422chr1173141 2939 2870 2208 2019 926 533 11953 1882 13057
NM_016424chr1741405 1385 801 768 1430 11783 --
NM_016427chr182366 102 ------
NM_016433chr1241438 1432 1233 232 1392 11585 --
NM_016436chr2052518 2485 1996 1966 986 --42589 2559 768 540 --
NM_016441chr252104 1671 1508 963 213 21842 505 ----
NM_016442chr52577 191 1755 1606 22119 1964
NM_016447chr71203 139 ----
NM_016467chr231114 987 46 ------
NM_016470chr201185 129 ----
NM_016480chr51726 1342 --1795
NM_016485chr621675 1594 22105 768 ----
NM_016507chr1752603 2060 920 239 140 1460 22813 70 1648
NM_016530chr1593489 3428 2971 2886 2825 921 775 580 247 1656 1935 23316 508
NM_016531chr4113597 3463 3302 3224 2555 1672 1196 409 394 261 190 34158 3417 2659 1917 --
NM_016542chrX1314 --1277 1478
NM_016547chr1--1735 --1558
NM_016570chr12--1464 ----
NM_016577chr374277 4215 3304 1083 184 129 37 44398 3055 1068 723 --13339
NM_016591chr52895 469 1238 1340 1783
NM_016596chr1231117 342 88 ------
NM_016599chr421447 1437 21047 188 --11560
NM_016603chr531914 1440 421 --11383 149
NM_016607chrX31603 1310 155 ------
NM_016618chr22230 89 --1107 --
NM_016621chr1153870 3485 1182 398 179 --21012 984 11504
NM_016626chr1851688 1341 433 371 94 ------
NM_016631chr211204 ----2141 79
NM_016639chr16----1550 --
NM_016654chr154996 901 477 322 11323 ----
NM_016821chr31458 ----1487
NM_016824chr1021212 123 1456 11449 --
NM_016827chr31762 1582 --1791
NM_016831chr181879 1475 863 833 742 599 344 280 3963 659 388 ----
NM_016836chr23613 544 28 1192 ----
NM_016839chr23613 544 28 1192 ----
NM_016929chr6104499 4460 3942 3826 3795 3730 1200 936 433 92 --11367 --
NM_016931chr111114 ----1353
NM_016946chr1113660 3496 3331 2799 2708 2702 2517 1441 1320 1098 404 12633 ----
NM_016950chr441211 435 407 202 --11351 --
NM_016952chr1163908 3774 3168 2950 2909 87 31011 185 152 --24044 3386
NM_017409chr121525 --1787 --
NM_017412chr8------11193
NM_017415chr564572 3516 3498 1204 576 392 23598 1473 1696 --
NM_017420chr1453667 2712 934 927 740 23186 1098 --23314 1382
NM_017423chr442196 2047 1779 435 21595 211 ----
NM_017426chr4144 1232 2686 64 --
NM_017437chr145720 359 269 258 55 1335 ----
NM_017440chr123516 415 51 ------
NM_017447chr21103725 3575 3060 3034 2831 1681 1328 725 551 456 34175 1698 1403 21631 325 --
NM_017489chr811203 --1186 --
NM_017495chr203285 262 219 --1184 11481
NM_017519chr611324 1352 ----
NM_017545chr202580 535 ----2404 389
NM_017548chr33549 522 447 11868 ----
NM_017553chr151416 21314 268 ----
NM_017563chr396265 4589 4394 2526 2391 2089 1776 389 265 26379 1193 21969 832 15415
NM_017577chr351248 1223 607 201 179 --1633 --
NM_017580chr1032360 1486 745 2732 450 1671 --
NM_017582chr161149 739 479 326 283 258 ------
NM_017590chr2242684 2581 1975 303 22542 473 --12655
NM_017593chr41102 1506 ----
NM_017594chr921200 1020 1908 31221 546 141 13142
NM_017599chr1262057 1476 1370 758 564 324 1463 1271 1625
NM_017610chr1541870 406 371 253 --2548 486 --
NM_017628chr443809 3387 1594 1148 33545 714 314 43445 1778 1497 1359 32063 1464 878
NM_017629chr11515 --21950 1339 --
NM_017633chr622779 2512 ----33544 3011 2661
NM_017634chr841422 1294 631 49 --11473 1508
NM_017635chr1121444 207 139 2358 160 1582
NM_017637chr9158898 8749 8414 8202 7513 7439 6805 6669 6663 5738 3768 2458 540 480 457 49231 8274 1333 274 27394 163 36411 2227 876
NM_017640chr64854 771 279 124 ------
NM_017641chr12156 ------
NM_017643chr1742704 2575 2536 1974 --42525 1906 1104 784 11033
NM_017644chr395083 4916 4488 1971 1905 1719 1168 595 363 24542 4361 44203 1260 1105 800 14592
NM_017650chr795932 4514 3816 2340 2277 2143 677 509 175 15467 --25546 2254
NM_017658chr1474209 3966 3499 1572 1263 870 841 24300 1466 53936 3556 1627 1601 1542 11199
NM_017660chr1953110 2383 2323 2180 969 12554 --33221 1245 1107
NM_017661chr151370 ----31217 1197 850
NM_017664chr133875 822 793 ------
NM_017666chrX82032 1971 1809 1785 713 397 349 205 --31855 805 342 11669
NM_017672chr1521159 1121 ----11356
NM_017679chr171591 --1598 --
NM_017680chr921014 1003 ------
NM_017684chr151715 31586 1390 239 11363 --
NM_017693chr1321018 560 1428 11331 --
NM_017694chr22597 395 22070 1633 --11871
NM_017709chr174181 3447 2919 1636 1630 1316 832 33867 2939 1484 13619 1823
NM_017714chr203967 331 314 --1772 --
NM_017719chr342222 757 644 586 1551 ----
NM_017737chr171551 1466 1391 1380 494 398 198 1880 32164 2118 2004 12083
NM_017742chr1821869 1629 ----21973 324
NM_017745chrX3217 118 46 ------
NM_017747chr52435 22 ------
NM_017748chr174674 315 69 60 --1220 --
NM_017752chrX12153 --11818 11538
NM_017753chr91197 1355 ----
NM_017754chr674975 4771 3973 3796 3236 1553 166 34628 3463 3219 13680 --
NM_017762chr1521677 1542 2592 537 11652 11531
NM_017769chr1492546 2442 2363 2325 2296 2082 1208 1179 853 12947 --42588 2388 840 34
NM_017770chr652911 2858 2168 2043 281 12329 ----
NM_017772chr61137 1268 ----
NM_017779chr142583 2506 2435 1726 1573 12228 1332
NM_017786chr83477 268 110 1548 --1567
NM_017798chr2041258 1080 818 789 ----2306 268
NM_017799chr1411396 11863 12014 11980
NM_017811chr952996 2818 2802 226 177 1468 ----
NM_017813chr874907 4657 3886 1618 1534 1116 208 14732 1789 --
NM_017824chr1052497 2473 1841 1056 38 --32332 2213 563 --
NM_017831chr1864525 4349 4079 3255 203 162 --23105 195 44503 3318 1419 1004
NM_017845chr42832 524 --1164 --
NM_017848chrX64299 1818 1771 1695 1396 1197 13295 ----
NM_017880chr24431 293 99 55 165 ----
NM_017890chr841687 356 273 261 --11509 21758 580
NM_017893chr1011374 ------
NM_017896chr2063454 2961 2577 2541 427 83 12606 13529 --
NM_017902chr10105497 5313 5151 4592 4516 3782 3621 2158 2152 2061 24095 1303 ----
NM_017919chr9125047 5031 4902 4875 4437 3935 3615 2266 1852 1640 1315 371 65526 5151 4935 4087 3669 1601 35438 4269 3552 1630
NM_017933chr231596 1088 651 11388 21619 1205 11222
NM_017938chrX21852 1549 22075 1949 --11812
NM_017946chr71148 --21083 1052 160
NM_017958chr262557 2439 1855 1208 1138 721 33069 2616 730 12673 --
NM_017964chr22700 40 21006 205 1758 1237
NM_017987chr1061885 1482 1382 837 356 21 2367 282 188 1559
NM_017988chr122629 67 ------
NM_017994chr741994 1148 550 50 22697 2348 --22381 1977
NM_017998chr92233 173 --31391 987 70 --
NM_018000chr222245 1637 --1148 --
NM_018008chr31334 ------
NM_018014chr23971 942 893 --1440 11076
NM_018015chrX21098 462 21025 49 ----
NM_018018chr1221847 1619 ------
NM_018024chr8--1587 ----
NM_018027chr1042771 2726 2113 1320 1254 1593 12742
NM_018030chr181952 2973 48 ----
NM_018048chr1261921 1812 1577 620 613 160 --22061 1783 --
NM_018050chr12123 1705 ----
NM_018051chr72357 342 ------
NM_018061chr121346 1102 --11497 --
NM_018078chr41413 --1907 4426 383 328 83
NM_018084chr272925 2709 2297 1288 1161 896 810 43136 2965 2421 1065 22878 131 2577 194
NM_018085chr177850 7179 7173 6027 1553 900 72 37871 5914 5135 23234 1102 11057
NM_018086chr241663 580 424 139 --11613 --
NM_018087chr11240 ------
NM_018092chr1671472 1436 640 466 392 114 29 11666 11021 --
NM_018094chrX1298 ------
NM_018111chr19151 ----1193
NM_018117chr104698 534 504 264 1511 ----
NM_018121chr1033012 2217 655 --12839 11013
NM_018128chr1741089 432 209 142 ------
NM_018131chr102720 618 ----1781
NM_018133chr362087 1863 1761 1721 1706 208 22199 1966 1202 1548
NM_018155chr333220 3063 868 11234 1327 --
NM_018156chr152623 2223 1830 1159 701 11899 --32449 2168 469
NM_018157chr1252980 2928 2155 1295 449 11242 23253 2538 --
NM_018171chr124392 255 235 139 ------
NM_018181chr1831719 775 327 ----1315
NM_018184chr331823 1602 222 41499 297 258 239 ----
NM_018191chr1352086 1611 1311 657 470 --12055 --
NM_018195chr1181964 1936 1584 1436 1367 461 57 50 11402 11911 --
NM_018202chr11293 ----1371
NM_018211chr162223 1390 603 377 219 67 2362 96 1276 --
NM_018214chr631089 828 87 11015 ----
NM_018221chr23327 186 93 ------
NM_018227chr442559 1042 855 117 ------
NM_018241chr42959 837 --1209 1821
NM_018243chr473803 3651 3447 3280 2929 1100 77 33784 966 743 23757 718 --
NM_018247chr662689 2115 1231 1059 992 321 42912 1949 1107 747 ----
NM_018254chr152124 952 710 677 331 41801 1699 1560 603 51739 811 439 411 402 21772 821
NM_018263chr252434 2283 2128 2117 550 12628 --1566
NM_018270chr201745 ------
NM_018286chr173928 872 380 --1177 1761
NM_018290chr431024 297 157 11208 --1454
NM_018293chr353001 2859 2334 2172 98 --22049 1195 --
NM_018299chr893087 3080 2932 2784 2430 1093 1067 329 81 1489 --1569
NM_018302chr461982 1860 850 649 643 358 22089 715 ----
NM_018307chr173667 605 63 ------
NM_018313chr342425 1891 550 523 ----11816
NM_018314chr112769 36 1715 --1498
NM_018315chr431587 1063 302 11541 ----
NM_018319chr1421422 1319 21137 90 1198 --
NM_018323chr471900 1816 1508 757 467 414 358 1738 --1118
NM_018325chr921533 621 1454 11147 --
NM_018330chr101428 --11632 --
NM_018339chr921662 1500 11852 ----
NM_018362chr11123506 3126 3072 2860 2759 2634 1304 980 950 440 124 55 22981 1246 31571 695 328 --
NM_018364chr1103928 3598 3576 3075 2987 1608 1267 673 412 333 33984 3717 3621 23328 560 --
NM_018367chr1121949 1643 --52148 1021 775 375 291 172
NM_018373chr1496492 6155 6109 2201 1836 908 616 400 327 12487 25944 5692 --
NM_018374chr7114883 4488 3736 3719 3626 3382 3200 1677 1651 1625 1530 21509 90 24988 1062 14283
NM_018375chr1481301 1294 1244 743 584 389 268 241 11356 11837 --
NM_018385chr311273 ------
NM_018387chr93508 454 419 ------
NM_018388chrX31494 1400 1167 --11358 --
NM_018401chr451774 1680 1509 665 354 ----11542
NM_018403chr343665 2621 1408 203 24089 573 63821 1387 915 855 591 133 --
NM_018409chr462596 2540 2196 2079 1079 736 13195 --42401 632 402 301
NM_018416chr1251949 995 592 569 234 --12636 --
NM_018426chr6--1613 ----
NM_018427chr1641686 1457 1164 456 21397 1101 11207 --
NM_018429chr572434 2378 2354 2100 1841 814 108 --12024 12513
NM_018433chr23518 445 397 ----1206
NM_018439chr1862542 2526 2033 1814 1731 420 --193 --
NM_018440chr8137525 7289 7102 6869 6038 5415 2220 1834 1636 883 877 675 431 43286 2669 1872 449 27072 3112 --
NM_018442chr1170 ------
NM_018444chr832240 904 237 --1580 12151
NM_018445chr153516 379 46 ------
NM_018448chr122962 846 ----21255 919
NM_018449chr9--1695 ----
NM_018452chr6_random73774 3761 2437 2340 1011 605 245 23837 2610 13352 --
NM_018462chr3------2354 95
NM_018466chrX--124 ----
NM_018469chr1711377 11214 1940 1112
NM_018489chr142040 1634 1560 234 1475 --12359
NM_018490chr11--11250 3700 543 439 11186
NM_018553chr1741730 1615 1402 152 --1294 --
NM_018557chr221434 108 1544 --11308
NM_018566chr193974 3786 3352 3114 1252 424 317 252 150 65115 3886 3504 1817 1538 802 44938 3604 1399 692 34718 3831 907
NM_018569chr431411 1204 265 11362 21156 1098 --
NM_018590chr1031668 1429 380 --2566 457 --
NM_018602chr1521189 81 21708 507 21334 127 --
NM_018638chr1285082 4861 4505 3847 2014 1897 976 395 45275 3613 1640 1542 156 --
NM_018639chr1241476 1129 1074 418 --11139 11004
NM_018640chr1242386 2333 2265 784 51968 883 739 686 660 22406 2076 --
NM_018650chr182233 1765 1691 1608 681 578 393 121 1477 ----
NM_018667chr1682824 2780 2557 2173 1911 1746 353 333 ------
NM_018682chr72663 200 1166 ----
NM_018685chr761048 784 232 167 95 46 1956 ----
NM_018689chr1552490 2466 531 470 459 12730 12530 --
NM_018691chr531026 988 472 --1815 --
NM_018695chr552227 2010 1814 1603 343 12155 11981 --
NM_018698chrX41701 1396 741 229 1182 21214 111 --
NM_018710chr82906 467 21376 887 --21175 73
NM_018713chr121084 448 --1981 --
NM_018717chr452618 981 948 916 81 --12325 12692
NM_018718chr752224 1968 1756 1661 491 1763 ----
NM_018840chr20----1499 --
NM_018841chr182680 2456 1465 1259 980 502 404 390 1171 22636 1298 22974 62
NM_018844chr731585 521 202 21512 353 12058 --
NM_018846chr72890 727 --2864 165 --
NM_018890chr731252 1003 968 --21195 1105 41516 1179 925 260
NM_018898chr511512 11902 --21640 942
NM_018899chr511512 11902 --21640 942
NM_018900chr511512 11902 --21640 942
NM_018901chr511512 11902 --21640 942
NM_018902chr511512 11902 --21640 942
NM_018903chr511512 11902 --21640 942
NM_018904chr511512 11902 --21640 942
NM_018905chr511512 11902 --21640 942
NM_018906chr511512 11902 --21640 942
NM_018907chr511512 11902 --21640 942
NM_018908chr511512 11902 --21640 942
NM_018909chr511512 11902 --21640 942
NM_018910chr511512 11902 --21640 942
NM_018911chr511512 11902 --21640 942
NM_018931chr53666 653 320 172 ----
NM_018932chr54806 732 695 131 ------
NM_018934chr51148 ----1140
NM_018945chr663122 3105 2475 1446 966 440 23583 973 11481 13728
NM_018947chr763822 3296 1217 675 494 71 43166 1520 443 302 --34692 4431 718
NM_018970chr772615 2271 2093 1101 359 245 21 42808 824 532 425 12683 --
NM_018977chrX1922 3809 415 229 --11012
NM_018979chr1282461 1986 1820 1709 791 573 551 505 12088 11968 --
NM_018994chr11384 1506 1116 --
NM_018999chr10114742 4607 4530 3945 3418 3276 3118 1584 1364 1296 340 33993 1505 844 23057 1636 1759
NM_019000chr561163 1025 545 428 338 103 21205 1059 ----
NM_019001chr394688 4556 4401 4306 1565 1266 1190 553 191 32955 1729 1331 --23936 3627
NM_019004chr752289 2168 2087 1674 521 2387 145 ----
NM_019008chr2253295 3013 2564 1295 890 42930 1064 936 920 13733 23544 2499
NM_019010chr171259 ------
NM_019022chr1882980 2529 2497 2360 1952 704 457 86 ----1442
NM_019027chr462588 2120 1885 1743 1048 737 22306 744 2641 338 12620
NM_019028chr11------1343
NM_019030chr5--2155 29 ----
NM_019035chr431683 1640 788 1831 22015 416 --
NM_019041chr622108 1816 2772 575 21765 1621 11028
NM_019045chrX2672 594 ------
NM_019050chr42895 609 ----1620
NM_019063chr231412 657 572 1844 11960 1556
NM_019071chr7--163 --1769
NM_019072chr584149 3939 3576 1439 883 584 378 361 13373 53748 2832 783 697 552 1153
NM_019080chr1341421 614 75 30 --2404 182 --
NM_019083chr11201 2109 86 21458 382 --
NM_019084chr1011862 ----32380 1672 950
NM_019091chr23724 171 91 11104 --1297
NM_019094chr1253837 3573 3197 663 227 42910 1005 859 825 23653 3530 --
NM_019096chr61965 ------
NM_019106chr2243172 2357 1186 293 ----23322 2600
NM_019113chr19277 35 ------
NM_019114chr982152 1864 1784 1564 1030 677 594 427 --1480 21800 1661
NM_019116chr1693622 3385 3336 3174 2871 2573 2460 1497 293 13741 23059 1027 13573
NM_019555chr311176 41809 1532 1208 657 1697 --
NM_019556chrX11013 21505 272 ----
NM_019557chr14766 703 290 87 ----1607
NM_019590chr1021516 305 1991 ----
NM_019592chr9----181 1653
NM_019593chr20113136 3095 3080 2745 2250 1992 1034 803 548 368 203 --13187 --
NM_019600chr153726 678 585 --2706 303 --
NM_019605chr13694 254 187 ------
NM_019842chr6136 ------
NM_019852chr14190 ------
NM_019859chr1021420 1292 11070 ----
NM_019860chr1021468 1340 11118 ----
NM_019884chr19------1401
NM_019885chr222640 2429 22464 2039 ----
NM_019891chr131318 1204 1067 21352 329 1154 11311
NM_019895chr341126 964 932 191 11057 ----
NM_019903chr1021212 123 1456 11449 --
NM_020116chr431705 1610 1393 2472 263 1423 --
NM_020122chr295984 5691 5525 5113 4605 2315 1640 363 239 35728 5395 2293 33911 1035 678 --
NM_020123chr1021014 100 ------
NM_020127chr141564 1543 714 461 --11671 --
NM_020132chr2165163 4881 4523 3863 1080 104 --24042 1988 1317
NM_020135chr6------1339
NM_020144chr741609 1468 811 588 3793 699 477 11564 --
NM_020147chr1531085 983 48 ------
NM_020150chr1061769 1605 1586 1522 1430 752 --11906 --
NM_020156chr71117 3619 384 159 ----
NM_020159chr421521 1144 ----11161
NM_020177chr5103148 3073 3030 2930 2830 839 616 484 454 323 11186 --23003 2283
NM_020178chr172987 848 ------
NM_020180chr18--3983 874 311 ----
NM_020182chr202685 63 2898 352 ----
NM_020186chr7153 1497 ----
NM_020198chr1731428 1114 125 21472 91 ----
NM_020204chr11192 1297 ----
NM_020205chr183432 3260 3199 2205 1343 1167 652 409 1528 23155 746 12321
NM_020228chr1152403 933 927 389 171 1999 11978 11015
NM_020235chr3156 ------
NM_020239chr151534 718 685 547 532 21651 361 --2377 90
NM_020245chr665062 5037 4939 4923 4363 580 1334 ----
NM_020336chr2063886 3665 3343 2651 1264 707 --22994 2564 --
NM_020337chr442018 633 375 136 13129 12456 33061 2485 472
NM_020338chr10--13520 ----
NM_020340chr621556 864 31719 1523 1432 21502 250 --
NM_020341chr2061949 771 651 591 572 223 21366 172 21464 408 --
NM_020342chr272177 2097 2082 1693 753 299 63 1366 21642 434 --
NM_020346chr1121617 1611 11068 11279 --
NM_020347chr382279 2101 2018 1516 478 457 255 100 21816 621 ----
NM_020357chr361654 1512 1470 634 500 368 1579 --21276 1231
NM_020360chr171614 ------
NM_020374chr1221619 212 11376 1374 --
NM_020386chr3----1125 --
NM_020390chr394857 4679 4168 3730 3224 1902 1709 1667 618 44840 4740 3914 3138 23532 3398 34267 1288 484
NM_020403chr1351752 1592 1495 1470 1404 132 ----
NM_020420chrY21710 238 ----11512
NM_020424chr162586 566 2644 593 1844 1109
NM_020432chr752176 1675 751 192 145 11460 1384 --
NM_020440chr162130 921 744 738 590 376 --22598 1092 --
NM_020443chr1116077 5639 5144 5108 4262 4255 2465 2308 1636 1114 285 24641 1495 --14831
NM_020453chr432105 1621 1461 1365 11299 --
NM_020455chr632641 1077 1062 12046 2670 142 --
NM_020463chr221252 1228 --1523 --
NM_020466chr664306 3991 3773 3165 1408 154 1864 13490 23703 213
NM_020473chrX41840 1815 1644 397 --1528 21686 1493
NM_020532chr23194 128 89 ----137
NM_020546chr553161 2723 2262 1996 942 11195 22716 294 22581 2544
NM_020638chr1261755 1722 506 326 311 73 --2569 26 11328
NM_020640chr321663 137 ----22002 418
NM_020644chr111762 ------
NM_020647chr841889 1669 1469 587 182 --1838
NM_020651chr231561 1449 421 1440 1698 --
NM_020654chr321359 1331 --11524 --
NM_020655chr1621427 1158 ------
NM_020666chr53855 760 370 --1751 1357
NM_020673chr20147514 6897 6460 5907 5863 2751 2683 2670 2188 1697 1297 1185 1021 399 26489 1585 36402 5362 359 25506 1084
NM_020686chr1642454 1142 713 303 11903 --13122
NM_020699chr195017 4772 4643 4442 4254 4096 2130 1223 266 33279 1647 1517 25192 248 23774 33
NM_020708chr2022346 2125 --1658 --
NM_020711chr242447 1930 1635 535 1198 --1906
NM_020714chr1964580 4443 4342 4308 3368 1254 1879 --11568
NM_020718chr1665963 5587 2440 1267 947 426 24962 4304 34042 2613 1185 --
NM_020727chr2173877 3480 3428 3237 2579 502 403 22809 2493 33408 415 169 23691 3396
NM_020728chr792979 2718 2538 2459 2223 1177 733 371 121 12558 ----
NM_020732chr611324 1352 ----
NM_020734chr1232605 544 480 21266 1208 32388 850 613 --
NM_020739chr15113872 3775 1436 1273 1247 988 735 683 557 304 284 1203 11430 --
NM_020742chrX52687 2648 981 872 264 22461 1838 2837 449 --
NM_020747chr53848 251 95 1941 ----
NM_020748chr1742181 1820 340 333 11767 ----
NM_020749chr821673 1305 --21976 1681 --
NM_020752chr1082585 2539 2123 2058 1848 816 506 441 ------
NM_020754chr31443 11320 --11128
NM_020755chr63488 328 159 ----11565
NM_020766chrX94184 4131 4034 3617 3444 2969 1583 398 233 24570 558 11715 1662
NM_020768chr572385 1130 966 850 759 163 110 ----32294 2193 674
NM_020771chr631432 1260 1198 ------
NM_020772chr17158310 7243 6862 6665 6516 5852 2906 2878 2493 2272 1169 959 759 516 496 68148 7559 6916 5927 2064 552 57459 2859 2661 2056 204 25457 3285
NM_020773chr452635 2285 1949 610 189 21724 139 21972 107 11931
NM_020774chr18185644 5346 4816 4359 4153 3951 2420 2387 2335 2199 1558 1474 1073 778 568 269 113 53 56152 4765 2168 1456 1242 15213 34912 4129 1986
NM_020781chr742121 895 782 599 42866 2265 796 658 21067 684 --
NM_020782chr12124594 4051 3000 1529 1367 907 870 623 580 416 394 375 64195 3747 3576 3086 1755 819 1429 14308
NM_020783chr1822115 866 11613 --1433
NM_020792chr382417 2110 2043 2009 744 425 377 147 22558 1000 21945 404 --
NM_020794chr121049 332 21302 530 --1152
NM_020796chr543021 836 701 539 --1728 22478 2184
NM_020800chr321262 1042 21131 585 1101 --
NM_020801chr562637 2573 2343 1862 477 251 42330 2287 1820 422 ----
NM_020802chr1133264 2739 395 13051 --1475
NM_020803chr451994 1866 1848 805 619 12145 1861 --
NM_020805chr1831417 473 281 11965 --21770 1612
NM_020806chr141187 --2852 652 1331
NM_020808chr11440 1923 ----
NM_020809chr1151852 1804 558 219 150 11999 12017 --
NM_020810chr1453239 2923 713 490 150 11408 13635 --
NM_020818chr14------1391
NM_020819chr63818 320 272 ------
NM_020821chr151715 31586 1390 239 11363 --
NM_020824chr102694 489 ------
NM_020825chr16103736 3512 3100 3055 2860 2588 1128 1022 855 634 --12945 13049
NM_020834chr1431194 511 231 11841 11370 --
NM_020841chr1283481 2965 2793 1552 1126 743 540 79 --43912 1562 1162 810 23390 1259
NM_020844chr8116964 6487 6441 5824 4733 3090 3060 2575 2355 1730 1204 36978 5305 1316 27659 2317 11491
NM_020854chr1831105 562 59 11061 1462 --
NM_020856chr1941346 477 381 100 21159 547 ----
NM_020859chr483828 3660 3411 3319 1407 644 593 360 53333 2492 978 466 432 23754 1044 --
NM_020860chr44847 792 392 333 ------
NM_020866chr13----11050 1858
NM_020868chr2--11569 11522 2696 623
NM_020870chr431904 1610 1550 21680 774 21441 525 --
NM_020871chrX72433 2002 1926 1735 616 117 105 31965 771 666 ----
NM_020872chr31184 ----1253
NM_020873chr32719 226 1568 ----
NM_020888chr131498 247 124 --21318 818 11969
NM_020901chr112430 279 --1362 --
NM_020914chr1741788 1686 1025 557 1442 ----
NM_020918chr10149 1443 12997 --
NM_020921chr1451179 1140 1071 648 423 43142 2332 700 676 13439 --
NM_020922chrX41691 1448 1162 281 11428 11350 21629 408
NM_020925chr12972 453 11205 21068 362 --
NM_020935chr274533 4501 3164 1733 1483 748 522 63900 3258 3099 1141 901 336 33225 2901 483 24390 4124
NM_020940chr1072608 2417 2190 2028 1958 877 462 --21903 1831 --
NM_020948chr183664 3585 2722 878 626 495 266 123 43470 2615 177 77 43440 2329 751 725 2457 94
NM_020958chr142249 240 ------
NM_020961chr43374 111 45 ------
NM_020962chr1562496 2458 2440 2303 648 528 ------
NM_020977chr421504 1425 --1333 21359 742
NM_020993chr1291838 1815 1763 739 624 467 434 222 209 11801 2918 591 --
NM_021003chr143721 297 93 2545 334 ----
NM_021007chr222404 2100 ------
NM_021025chr51361 ------
NM_021032chr31679 1354 ----
NM_021033chr13113450 3206 3195 3160 2684 2548 1199 1167 991 776 232 12646 1626 22880 395
NM_021061chr811165 23462 455 1275 13761
NM_021069chr462135 2043 1805 1629 1591 1394 1584 ----
NM_021072chr522559 1816 12121 --1245
NM_021076chr222401 98 ------
NM_021079chr1732771 907 808 --1398 --
NM_021083chrX103666 2491 2348 2320 1131 1107 812 783 134 117 13511 1631 --
NM_021090chr2284913 4519 4441 3535 1220 999 622 247 11278 --25044 1202
NM_021096chr2253030 2476 702 677 52 22896 556 1736 --
NM_021097chr262944 2748 2580 2396 762 754 1486 22353 269 --
NM_021101chr311913 182 1968 1284
NM_021115chr221126 ------
NM_021116chr778579 7314 6904 5843 2401 2071 1595 27356 5586 59037 7450 2565 1854 985 --
NM_021129chr10--191 ----
NM_021132chr10--1437 --2542 414
NM_021133chr161653 1531 1334 644 271 52 21750 472 ----
NM_021137chr1742003 1996 1815 335 --22050 626 1585
NM_021144chr92472 463 ------
NM_021148chr772357 2072 1712 1693 178 101 29 22060 1642 ----
NM_021151chr73397 291 110 ------
NM_021183chrX52328 1883 1836 273 239 3496 426 193 2984 326 11780
NM_021190chr151328 1137 1062 549 149 1309 1865 --
NM_021205chr14671 652 449 160 12369 1974 11818
NM_021215chr2062260 2197 2128 2051 784 293 --1282 12355
NM_021227chr41453 ------
NM_021229chr122988 506 2868 807 2998 247 --
NM_021237chr31306 ------
NM_021238chr12--1294 21689 493 --
NM_021239chr1431444 203 193 1960 --1589
NM_021249chr145541 509 476 445 313 2591 340 21417 64 1270
NM_021252chr1011389 12003 21622 69 --
NM_021255chr1433260 1368 520 32574 790 332 --11542
NM_021269chr194390 119 113 102 21338 324 11411 21712 353
NM_021622chr10102357 2258 2095 1637 1525 838 753 414 292 131 21943 1513 --1187
NM_021624chr1882233 2215 2187 1999 302 236 221 203 12226 11768 --
NM_021629chr375039 5028 4880 4257 3931 3509 1077 34978 1061 468 24671 1127 34546 1227 1070
NM_021637chrX41232 1123 849 200 ------
NM_021638chr454708 4217 1513 834 727 21000 194 23368 659 13988
NM_021639chr12602 88 ----1800
NM_021644chr103426 374 59 1869 ----
NM_021647chr4124755 4032 3651 3617 1611 1373 907 752 526 279 110 51 44063 1588 1396 132 14324 11067
NM_021648chr662505 2301 1790 971 492 38 --1954 12197
NM_021722chr7--2509 472 ----
NM_021723chr7--2550 513 ----
NM_021809chr2021680 978 ------
NM_021813chr675607 5595 5089 4896 3736 1967 822 13532 --1891
NM_021814chr621604 1435 21055 420 ----
NM_021818chr1431203 1001 321 140 --1343
NM_021825chr113295 169 37 ------
NM_021911chr5115078 3783 1848 1666 1259 1207 470 409 313 193 117 24862 1150 55378 4626 4130 1370 1106 23981 1699
NM_021912chr1573628 2649 1448 1056 980 456 363 --23108 2979 13176
NM_021914chr142876 30 52323 2119 1680 777 347 12071 1624
NM_021935chr321060 229 --1816 1272
NM_021943chr651674 587 318 128 35 11376 1451 12077
NM_021949chrX32919 2710 2354 12262 ----
NM_021951chr94758 658 373 98 ----2794 132
NM_021954chr13103719 3450 3356 3146 2759 2531 931 258 181 47 --1970 22925 864
NM_021955chr7----1181 1241
NM_021960chr172255 1780 938 810 581 518 310 --2963 664 --
NM_021961chr11197315 7197 6771 5929 5850 5670 5541 5371 4695 4673 4662 2581 2490 2477 1552 1355 1144 616 498 17182 67051 6779 6480 5887 2124 747 46630 6599 5663 460
NM_021964chr386503 6253 4723 1973 1767 1327 545 328 35888 1363 646 11615 35751 5617 2336
NM_021967chr531267 1202 531 11023 142 --
NM_021970chr42199 68 --1588 --
NM_021977chr673679 3166 2479 933 861 793 52 22994 2414 13293 11309
NM_021988chr2051521 1139 999 535 147 11194 1528 --
NM_021998chrX11094 1138 31372 1348 230 --
NM_021999chr132711 247 1163 --2796 276
NM_022048chr1576345 4951 4028 2249 2009 666 339 25718 4757 16111 --
NM_022049chr13685 403 50 --21874 181 1593
NM_022051chr13610 570 503 ------
NM_022079chr103861 361 106 ----1842
NM_022085chr641435 1160 449 177 11424 ----
NM_022087chr72460 409 1486 ----
NM_022114chr184351 4132 3845 3081 1492 1448 1404 629 21789 1344 24678 1465 --
NM_022116chr72247 46 --1376 --
NM_022118chr131575 ----1616
NM_022123chr142563 74 1485 --1594
NM_022130chr511231 ------
NM_022132chr51191 2137 63 ----
NM_022133chr861333 719 665 628 548 408 ----21561 265
NM_022138chr631525 1204 938 1111 ----
NM_022140chr561962 1924 1587 816 753 81 --11440 --
NM_022143chr7--21478 627 1446 1334
NM_022166chr16136188 5625 5305 5131 5103 4827 2411 2140 1884 1270 700 668 270 24363 625 36084 5291 720 1899
NM_022336chr252357 2123 1905 681 125 22343 2302 31661 664 368 --
NM_022346chr461223 914 286 275 53 28 ------
NM_022351chr853339 3161 800 51 22 13098 --23491 1265
NM_022373chr74901 825 669 126 ----1308
NM_022442chr2051521 1139 999 535 147 11194 1528 --
NM_022456chr1296781 6722 6494 5039 4988 1798 1179 377 182 35501 4895 3006 12063 46875 6757 1987 1857
NM_022458chr782977 2615 2514 2046 1110 535 421 228 1644 --22725 545
NM_022459chr13136124 6088 4269 4158 2454 1976 1280 1205 896 870 683 584 455 11840 15612 15341
NM_022465chr1272714 2414 2236 1182 850 505 437 --11955 1783
NM_022474chr1462724 2105 1129 1103 164 129 --2747 383 22299 599
NM_022482chr2021006 322 1725 11877 11765
NM_022491chr1253419 3126 3007 282 146 13496 2356 75 --
NM_022494chr102379 28 ------
NM_022497chr342796 943 843 474 13585 23178 2442 12813
NM_022550chr5------158
NM_022648chr294558 3942 3863 1829 1738 1264 1050 661 348 22939 2808 11558 --
NM_022650chr51399 --1231 --
NM_022652chr124790 751 333 21 31163 1004 888 ----
NM_022658chr1241280 256 187 29 142 1860 --
NM_022659chr8------2544 480
NM_022716chr172884 2257 1069 921 772 465 432 22540 1204 11243 12176
NM_022725chr1162097 1913 1536 553 496 399 2591 312 ----
NM_022735chr151839 1714 714 706 167 1609 21458 158 --
NM_022739chr171200 1841 1920 --
NM_022753chr182768 1087 904 895 828 670 632 410 12441 12389 11865
NM_022756chr12426 283 11152 21369 980 11218
NM_022758chr683227 3098 2885 2388 2368 2091 743 444 12109 1630 --
NM_022763chr392962 2851 1022 938 781 722 612 581 258 1272 --12976
NM_022771chr122133 100 ----1762
NM_022778chr111510 1976 11244 1943
NM_022781chr952696 2322 967 743 229 --12835 22918 1316
NM_022802chr1021483 413 21540 1047 11408 --
NM_022818chr1621092 461 --11462 11629
NM_022824chr531792 1273 200 --21498 1463 1267
NM_022828chr541490 1272 407 316 11782 --11157
NM_022832chr462363 930 905 501 389 373 --1559 --
NM_022840chr1851099 1045 304 100 58 ------
NM_022841chr1551783 1108 600 288 61 --1170 21941 441
NM_022845chr1692193 2026 1837 1799 729 449 309 127 35 11951 ----
NM_022893chr231199 1112 817 22331 664 ----
NM_022894chr241647 1423 311 279 1134 21324 1140 --
NM_022898chr1494432 3861 3817 3668 3003 1735 1707 765 304 21606 1385 24747 3256 --
NM_022900chr72850 457 ------
NM_022912chr263089 2328 2093 704 297 240 22386 114 --12003
NM_022918chr1161710 1615 1427 557 345 140 21357 334 ----
NM_022965chr421342 1129 ------
NM_022970chr1041007 982 533 309 1971 2994 548 --
NM_022977chrX72669 2258 2038 1789 1775 1065 169 32204 535 460 12284 --
NM_022978chr531267 1202 531 11023 142 --
NM_023000chr1431168 1103 238 --11562 --
NM_023001chr1431168 1103 238 --11562 --
NM_023016chr282703 2618 2406 1042 320 199 107 42 22304 2211 ----
NM_023037chr1311149 --1982 1996
NM_023071chr1231132 163 152 --1198 --
NM_023923chr173737 3442 3435 1468 1163 1136 505 1983 --33234 2894 2578
NM_023929chr82886 335 22410 1955 22100 1801 1309
NM_023934chrX52216 1832 1358 725 429 --1205 --
NM_023940chr4--1960 ----
NM_024007chr583032 2872 2662 2608 2256 2103 649 609 22735 542 12041 11240
NM_024037chr11694 3878 844 34 ----
NM_024052chr1733054 2595 818 32999 2866 255 12509 --
NM_024060chr112226 32 ------
NM_024077chr91634 ------
NM_024086chr1773173 3003 2443 2403 1309 1155 536 12586 --11025
NM_024089chr13--1168 151 --
NM_024090chr441834 587 578 250 ----11442
NM_024094chr82303 130 1181 --1159
NM_024106chr19--160 ----
NM_024117chr931111 415 335 11217 --2477 357
NM_024294chr683227 3098 2885 2388 2368 2091 743 444 12109 1630 --
NM_024295chr852022 1999 1603 454 198 21876 1476 --1142
NM_024315chr71314 --1186 --
NM_024324chr22--2139 22 --1166
NM_024341chr1923904 376 11314 22933 1186 --
NM_024345chr9146042 4316 4284 4157 3926 2062 1513 1470 1320 1216 740 567 148 119 22156 1949 46064 5836 3832 2130 25811 4761
NM_024408chr183398 3049 2765 2386 1129 792 444 135 13066 43635 2337 1212 900 --
NM_024491chr32175 124 --142 --
NM_024511chr4103112 3037 3000 1385 1245 1178 897 815 671 24 23069 3016 ----
NM_024524chr323096 287 1707 11961 1150
NM_024529chr151122 893 816 800 276 11116 --11151
NM_024532chr2138 1122 ----
NM_024539chrX51018 502 382 362 297 ----11249
NM_024546chr131111 ----21173 416
NM_024548chr321690 1647 21667 350 21732 251 142
NM_024561chr135325 290 248 199 147 21136 929 1960 --
NM_024563chr551873 1258 569 447 327 ------
NM_024569chr142228 1185 704 413 32796 1090 719 ----
NM_024574chr4159 ------
NM_024581chr6----1233 --
NM_024582chr441021 422 267 177 2764 131 ----
NM_024590chr4242 32 31967 1579 482 ----
NM_024607chr8124124 3756 3719 3613 3330 3306 3247 2812 1469 1416 931 902 14451 11524 1154
NM_024612chr1731053 941 285 --1400 1390
NM_024613chr831286 1244 535 ------
NM_024616chr341479 1451 1317 425 ----11415
NM_024617chr9----1854 --
NM_024620chr191103 ------
NM_024638chr352357 2079 288 227 92 1309 ----
NM_024639chr652929 2910 2491 703 535 22803 286 11900 --
NM_024640chr11802 ----1948
NM_024646chr133825 470 309 12720 21178 1024 11094
NM_024657chrX3709 626 276 ------
NM_024665chr364409 3621 3124 3041 1208 1147 34429 3377 474 --34271 1455 572
NM_024670chr1011375 --21369 663 1652
NM_024680chr11--1386 1471 --
NM_024692chr241761 1629 340 151 1580 --21610 119
NM_024713chr1541515 1185 554 462 11408 21508 1265 --
NM_024721chr842258 1851 501 68 22453 412 21889 578 --
NM_024740chr1194119 3924 3867 3548 3492 2603 2538 1276 474 33607 3147 1053 --1560
NM_024744chr251987 1766 825 311 194 11040 21676 174 22543 451
NM_024749chr142226 1520 1509 246 22097 164 32157 1731 684 21634 695
NM_024759chr81693 ----1636
NM_024761chr9104623 4565 4558 4519 3992 3373 901 785 243 171 24996 4922 13950 13855
NM_024770chr2116656 6632 6513 6286 5141 4290 2668 1726 1399 1073 622 36095 5739 1344 1259 11875
NM_024812chr882139 1951 1894 1552 1335 551 542 370 21621 77 2713 560 --
NM_024814chr71159 ----1136
NM_024817chr15105004 4109 3731 2310 1731 1625 1079 1029 238 207 25420 3676 1602 22359 2215
NM_024828chr961379 1186 1144 475 373 312 1276 11019 --
NM_024834chr101397 31644 1310 774 21531 303 22004 1471
NM_024854chr1231482 1467 234 2414 392 21415 1044 1600
NM_024863chrX2371 37 ------
NM_024893chr201160 ------
NM_024913chr751673 1126 1102 456 175 41505 1403 1339 206 ----
NM_024915chr852773 2484 2174 1114 230 --12252 12842
NM_024920chr441190 529 462 38 51620 1484 1125 490 162 ----
NM_024921chrX21453 1343 ----1735
NM_024930chr522692 877 1971 32614 2058 47 12271
NM_024939chr1641585 1555 1522 284 11206 ----
NM_024941chr5------11286
NM_024946chr1631711 1694 1231 --1521 --
NM_024947chr3219622 9138 9109 9070 7910 7718 6953 6739 6276 6134 6046 3260 2899 2840 2598 2397 2291 1966 1802 1539 381 57805 6296 3574 2670 2455 16536 18607
NM_024949chr464298 1716 1595 634 176 44 33471 1441 1424 25023 564 11255
NM_024953chr1252227 2002 1006 999 940 22798 546 22768 417 --
NM_024969chr23848 829 693 --1629 --
NM_024979chr1331649 1053 403 ------
NM_024989chr2106954 6861 6312 5939 5569 5445 2650 1397 1233 555 56783 6745 6016 2831 2734 --37622 1984 446
NM_024991chr1032653 2213 786 1352 12415 22301 2019
NM_025054chr8114248 4209 4003 3538 3426 3371 2933 1600 1413 838 294 1468 23600 1064 21486 1092
NM_025057chr1461100 1055 918 903 59 48 2465 398 176 190
NM_025076chr22141 92 ------
NM_025107chr621731 442 1404 52270 2017 1785 1769 840 --
NM_025134chr1621956 469 22508 2160 3374 170 51 --
NM_025138chr131318 1338 1518 21470 1404
NM_025146chr351680 887 787 534 110 2868 173 --11736
NM_025147chr22932 829 ------
NM_025151chr852045 1953 1730 741 229 3662 412 390 ----
NM_025160chr133549 3196 1182 23136 1449 34030 3492 1172 14122
NM_025164chr1131755 1450 639 22069 1553 ----
NM_025191chr153343 2977 2665 848 103 11325 22260 604 22898 2224
NM_025195chr831693 657 220 11177 21468 33 --
NM_025202chr241031 917 286 242 1696 ----
NM_025208chr1142360 1529 517 403 31539 473 355 11699 --
NM_025222chr332752 2023 505 13051 ----
NM_025234chr153175 70 62 --1191 --
NM_025235chr1061583 1452 767 549 212 165 --12259 1360
NM_025238chr154451 201 192 127 21455 1109 ----
NM_030621chr14103703 3518 3292 3122 2749 1473 1305 1121 1100 271 21016 667 33562 1328 694 --
NM_030625chr1072066 2008 1884 945 721 267 21 31838 539 294 32448 2293 159 --
NM_030627chr534010 2620 286 1736 ----
NM_030634chr132443 1620 334 21776 605 2928 494 --
NM_030637chr141110 ------
NM_030647chr7115826 5234 4916 4798 4785 4529 4292 2373 2184 1357 920 56104 551 525 237 224 66119 4746 4597 2284 1869 1238 26320 4460
NM_030648chr4135224 5101 4796 3871 3727 3455 1978 1089 832 765 581 524 447 --1922 --
NM_030650chr263917 3853 3286 2651 1696 1218 --12885 11710
NM_030652chr61271 --1231 --
NM_030660chr1421019 419 --11248 --
NM_030664chr1031901 873 28 11967 1421 21649 964
NM_030674chr1295282 5206 5199 4839 4641 4538 2136 1644 702 34467 2085 1120 --11060
NM_030751chr1071867 1398 1332 683 650 291 62 --21743 402 --
NM_030751chr1071867 1398 1332 683 650 291 62 --21743 402 --
NM_030755chr1452909 2776 667 508 22 22616 1033 11067 21904 1238
NM_030758chr221967 ------
NM_030762chr1252008 1800 1780 96 58 21616 341 1105 --
NM_030766chr121206 ------
NM_030774chr1141103 984 30 24 --11466 --
NM_030780chr8--1366 --31469 1457 405
NM_030786chr131805 1453 47 1546 ----
NM_030797chr21270 ------
NM_030806chr1118287 8248 7281 7220 5739 5704 3749 3423 2016 776 646 38799 2982 300 35978 3694 157 --
NM_030809chr1242476 1732 997 197 11833 22100 668 --
NM_030810chr641435 1160 449 177 11424 ----
NM_030816chr183435 3365 3218 1182 784 678 436 402 22829 853 --11476
NM_030918chr1105383 4444 4405 4137 3371 2179 1807 1520 1126 826 33780 1907 1361 --11996
NM_030920chr151852 1357 767 447 345 ----12075
NM_030922chr153728 636 537 ----2840 102
NM_030927chr1051648 1481 1366 248 119 ------
NM_030934chr14756 616 555 462 11791 1341 --
NM_030938chr1721091 220 152 1779 --
NM_030949chr63511 359 92 --1389 1951
NM_030952chr131318 853 423 ------
NM_030953chr5151 1272 1197 --
NM_030964chr543484 2881 2545 757 23247 467 11216 --
NM_030979chr133450 355 340 ----1465
NM_031208chr163827 689 79 ------
NM_031216chr1852122 1777 1620 737 325 22199 159 1894 1402
NM_031217chr111468 1108 ----
NM_031243chr74967 937 858 260 2830 443 --22025 1728
NM_031268chr16105080 4454 3622 3551 3471 3343 2166 2066 563 431 25211 3360 --13327
NM_031271chr811180 11662 21234 514 31594 1250 268
NM_031291chr4------1616
NM_031296chr462607 2559 2039 1679 1090 477 12426 31990 1724 384 --
NM_031314chr145648 559 253 128 42 ----11386
NM_031371chr131629 476 465 ----1573
NM_031371chr131629 476 465 ----1573
NM_031372chr431350 457 273 --11403 11479
NM_031411chr511512 11902 --21640 942
NM_031418chr1172595 1884 1770 940 924 788 468 1201 22777 2120 --
NM_031419chr341135 1059 652 428 --1370 1542
NM_031427chr1464941 2216 1978 796 768 151 25317 996 23902 109 22026 1385
NM_031435chr1233063 2710 1326 53255 2807 2276 653 408 ----
NM_031438chr561818 1642 1524 1227 476 151 11872 ----
NM_031439chr841748 1279 160 55 11558 ----
NM_031442chrX32332 2116 1019 42970 998 752 476 22932 2549 --
NM_031445chr253427 3307 2969 2794 1275 1176 --13045
NM_031461chr882279 2011 1777 1708 611 575 552 243 21890 625 12072 11671
NM_031468chr7138062 7593 7565 5274 3212 3178 2820 1998 1452 1045 610 218 183 17228 38190 5477 2066 26218 2732
NM_031469chr643050 962 695 211 32938 1346 180 2378 279 14121
NM_031479chr122770 446 11091 1900 --
NM_031483chr2042380 1257 277 99 23027 2514 --12581
NM_031492chr112414 217 1359 1152 --
NM_031844chr193131 2710 1624 1543 1339 1165 939 772 68 34003 2824 2777 1978 23604 564
NM_031845chr252488 1356 1225 844 89 ----12295
NM_031847chr252488 1356 1225 844 89 ----12295
NM_031849chr511512 11902 --21640 942
NM_031850chr3--1868 ----
NM_031850chr3--1868 ----
NM_031857chr511512 11902 --21640 942
NM_031858chr172431 49 --1976 --
NM_031860chr511512 11902 --21640 942
NM_031862chr172431 49 --1976 --
NM_031922chr61411 ------
NM_031953chr42443 366 ------
NM_032021chr111857 11218 ----
NM_032042chr532765 2602 1106 12195 1393 --
NM_032048chr18158 ----1607
NM_032049chr3--1868 ----
NM_032049chr3--1868 ----
NM_032050chr223658 321 173 --1285 --
NM_032052chr2231043 558 337 ------
NM_032102chr1111987 11949 33048 2928 1150 1423
NM_032109chr511021 --11450 --
NM_032116chr13105817 5458 4811 4333 4230 1359 1173 1090 683 660 32197 2187 2178 34680 4017 3592 --
NM_032121chrX92702 2574 2434 2385 1901 597 444 215 163 11801 ----
NM_032124chr182507 42 ------
NM_032144chr251604 1390 362 280 234 31589 1346 98 1118 --
NM_032145chr641912 1744 1233 180 --21445 1392 2306 291
NM_032146chr3--1402 ----
NM_032147chr121256 21022 838 1360 --
NM_032153chr332585 2530 1888 ------
NM_032160chr1853282 2833 2718 434 86 22660 628 --1640
NM_032177chr5--1353 ----
NM_032182chr103166 127 106 2622 388 --1301
NM_032189chr1375087 4547 4414 4397 3682 1699 1263 24440 1879 --11274
NM_032195chr214347 173 138 125 ------
NM_032199chr1023124 55 22717 1188 --1549
NM_032208chr222981 606 ----23681 2480
NM_032217chr43963 219 204 --11022 --
NM_032221chr2041766 1727 574 44 ----11976
NM_032228chr1183546 3378 2874 2842 2800 2302 2266 348 11044 13478 --
NM_032239chr42313 291 --1918 1138
NM_032246chr1511211 ----1375
NM_032268chr1652801 2266 1218 731 574 --22990 1100 1296
NM_032288chr352162 2139 1894 1843 425 11943 32174 1678 1590 1211
NM_032291chr141692 1518 1379 795 11529 ----
NM_032293chr93285 37 28 ----158
NM_032305chr1132 ------
NM_032312chr22795 613 1886 1627 --
NM_032321chr263202 3161 3046 2876 2670 2425 2759 353 1518 --
NM_032329chr244273 4239 3461 3062 ----14093
NM_032333chr101876 ------
NM_032352chr1461358 1227 1136 955 313 197 ----1908
NM_032373chr10115566 5355 5069 4906 4539 4399 4318 1730 1598 1544 903 34345 3875 1281 --25769 2082
NM_032382chr16------1561
NM_032410chr831052 996 359 --1949 --
NM_032434chr241347 1048 504 160 21515 1376 ----
NM_032438chr651680 1432 1240 668 163 21227 40 ----
NM_032440chr1042534 2058 976 284 --21973 339 --
NM_032445chr153925 845 70 2507 396 --1492
NM_032446chr563837 3476 3122 2981 2452 1210 23516 1489 1484 12892
NM_032457chr443004 593 199 30 12844 13497 22415 547
NM_032458chrX22910 2650 --12658 --
NM_032466chr841639 1043 569 544 21595 478 ----
NM_032468chr831639 569 544 21595 478 ----
NM_032471chr651174 842 783 777 732 1935 ----
NM_032491chr122876 366 ------
NM_032494chr23574 445 45 ------
NM_032499chr1561665 1286 607 564 303 143 ------
NM_032505chr382800 2543 2431 2365 1851 1709 164 42 --21120 467 --
NM_032509chr882556 2252 2246 2033 1772 727 547 398 32498 856 68 11714 1478
NM_032520chr16--1227 ----
NM_032521chr2052992 2449 2032 2025 367 1437 --12796
NM_032523chr23556 133 72 ----1216
NM_032539chrX2556 248 1178 ----
NM_032547chr411150 ----154
NM_032557chr41358 1198 ----
NM_032558chr951206 1009 972 576 239 1491 1431 --
NM_032560chr14--1442 1814 --
NM_032569chr1621707 1292 11861 --11853
NM_032574chr2166 --1235 --
NM_032578chr1031151 1119 387 --11017 --
NM_032580chr171521 ------
NM_032581chr72583 60 1116 11882 --
NM_032582chr1751692 668 368 161 52 11514 1507 --
NM_032595chr1721126 182 ------
NM_032603chr2----1309 --
NM_032622chr441196 1148 1097 998 11060 --11383
NM_032632chr1431986 1550 455 2565 246 ----
NM_032646chr1711220 --2500 76 11663
NM_032664chr891722 1427 1411 1305 583 307 217 172 66 ------
NM_032682chr343258 3252 2986 271 23499 2476 ----
NM_032689chr191329 ------
NM_032711chr1754302 3860 3714 3056 436 ------
NM_032717chr43941 688 134 3896 783 42 ----
NM_032737chr1932031 76 32 ------
NM_032765chr52864 684 1906 ----
NM_032778chr383241 3071 2746 2608 2216 2204 729 96 ----21092 336
NM_032780chr111802 11107 ----
NM_032796chrX--1158 2221 30 --
NM_032800chr152711 2666 2269 930 749 --42637 2070 623 122 --
NM_032801chr1132289 456 154 21761 303 --1509
NM_032804chr1071917 1605 1039 786 544 412 364 1842 ----
NM_032810chr1021316 1049 1286 --21301 90
NM_032812chr10171 ------
NM_032813chr1321033 755 11132 11086 --
NM_032832chr651732 1224 1060 560 134 ----3627 420 163
NM_032833chr132422 2225 800 22356 1996 12509 12088
NM_032838chr194845 488 378 189 --1301 --
NM_032842chr741139 295 206 124 ------
NM_032857chr151178 ------
NM_032859chr1373552 3027 2449 1575 1519 1428 652 43616 2494 1309 431 33466 3164 369 1469
NM_032860chr61189 ------
NM_032866chr1543153 2946 2915 2161 11186 12873 --
NM_032870chr61560 1129 188 1520
NM_032873chr1153285 3165 1437 665 512 11406 23923 142 --
NM_032900chr1063845 2917 1143 1012 714 555 --13818 --
NM_032906chr43600 149 132 --148 --
NM_032926chrX295 89 ------
NM_032932chr17106029 5921 5649 5403 4599 1709 1693 1140 909 30 11238 25803 1287 --
NM_032960chr121544 298 ----1989
NM_032968chrX94256 3833 3594 3185 1396 854 775 696 148 13808 --23370 3080
NM_032969chrX94256 3833 3594 3185 1396 854 775 696 148 13808 --23370 3080
NM_032973chrY94248 3825 3590 3180 1396 854 775 696 148 13800 --23365 3075
NM_032975chr1853115 2673 1321 1153 644 11087 11029 23311 885
NM_032980chr1853115 2673 1321 1153 644 11087 11029 23311 885
NM_033020chr184481 4324 4299 4033 3502 3049 1051 497 --43666 3539 3519 1763 34581 4183 125
NM_033029chr32407 373 ----1392
NM_033044chr12935 370 ------
NM_033055chr16701 341 291 265 109 98 21109 794 1326 --
NM_033081chr2051369 562 200 164 146 ------
NM_033082chr121181 ------
NM_033083chr343305 3208 3023 2858 33418 695 467 32738 559 154 12388
NM_033089chr2051452 1210 384 307 50 ----1141
NM_033105chr82360 191 ------
NM_033121chr124665 488 447 131 1672 11750 11862
NM_033132chr1342160 740 502 47 11956 --21460 212
NM_033135chr1142360 1529 517 403 31539 473 355 11699 --
NM_033138chr752142 2107 1620 1448 645 ----1517
NM_033139chr752142 2107 1620 1448 645 ----1517
NM_033140chr752142 2107 1620 1448 645 ----1517
NM_033143chr4104465 4410 4177 3887 3660 3620 3282 1866 1450 793 --14584 23866 764
NM_033157chr752142 2107 1620 1448 645 ----1517
NM_033181chr683638 3491 908 887 867 860 603 79 13511 22633 1281 --
NM_033211chr561492 1427 1343 678 654 293 21854 828 22091 789 11933
NM_033224chr7168025 7709 7529 7251 6948 6359 6320 6064 6020 5022 2883 2742 2698 1150 1098 330 47399 6233 5691 5564 25446 506 16294
NM_033225chr832043 2014 939 11214 --13190
NM_033260chr61650 2716 132 1287 1670
NM_033261chr101182 1606 ----
NM_033274chr583601 3205 3166 3053 2929 1083 1049 176 --131 --
NM_033281chr53851 98 44 ------
NM_033285chr8124502 4033 3586 3408 3358 3234 3223 3178 2743 1419 190 89 13452 34173 1646 1142 1271
NM_033290chrX73693 3681 3142 630 500 402 190 33553 2993 2877 22649 202 12424
NM_033326chr1162529 2369 922 903 590 119 3938 649 608 ----
NM_033331chr932422 638 100 23082 2437 33237 2982 1418 --
NM_033360chr1254342 3509 1463 423 414 53959 3495 1528 1007 258 34359 1316 145 --
NM_033364chr331826 1820 240 ----21812 137
NM_033380chrX51036 940 836 805 714 ------
NM_033381chrX51036 940 836 805 714 ------
NM_033389chr1764333 4158 3296 3283 3233 1697 24323 550 44755 4313 1655 347 --
NM_033394chr22624 298 --21561 164 --
NM_033425chr1173340 3190 3160 2640 875 656 226 1283 1732 1807
NM_033426chr1472860 2635 1932 868 577 230 161 --1245 1650
NM_033429chr1543302 2950 892 368 22977 2519 1187 --
NM_033430chr493876 3766 3478 2926 2903 1218 1163 723 67 14066 11577 --
NM_033437chr493876 3766 3478 2926 2903 1218 1163 723 67 14066 11577 --
NM_033449chr532169 2098 1905 ----12122
NM_033505chr2116288 4648 4575 4246 4136 2531 2219 1137 1078 968 589 26262 1298 ----
NM_033512chr842425 1896 1226 1113 22676 2281 1311 13042
NM_033515chr62992 132 1140 ----
NM_033540chr32905 288 187 51151 1130 1096 459 189 --
NM_033551chr543291 2772 2271 515 ----1755
NM_033631chr173820 3294 1392 1254 1195 342 243 23731 2908 12570 --
NM_033632chr431587 1063 302 11541 ----
NM_033637chr1084035 3634 3559 3533 3506 3465 3198 2862 23340 1101 11010 12726
NM_033642chrX31262 798 157 ------
NM_033656chr2185161 4830 4722 4652 4036 3681 2398 1115 24432 881 54606 1921 1824 901 622 34797 4184 2251
NM_048368chr18----1814 --
NM_052818chr1332161 592 516 --1635 --
NM_052827chr121747 1112 11090 1906
NM_052832chr822035 33 22780 2523 ----
NM_052834chr1872365 2322 2227 1919 1609 646 587 --22507 1931 --
NM_052840chr1531115 571 509 21172 475 --1336
NM_052864chr431984 1840 1706 1716 ----
NM_052869chr1711220 --2500 76 11663
NM_052879chr1284059 3540 3298 3285 2785 2652 1130 864 13918 12713 --
NM_052885chr1284910 4221 4085 1981 1886 1432 1264 1166 14777 31094 852 232 11873
NM_052886chr82662 348 ----11907
NM_052898chr811581 11864 ----
NM_052900chr82607 510 1535 1420 --
NM_052904chr641365 306 265 88 21398 366 ----
NM_052905chr231830 1293 287 21614 90 21381 111 --
NM_052906chr2225102 262 14927 --1228
NM_052910chr1342199 2004 1775 1332 ----1188
NM_052911chr18166 --1341 --
NM_052913chr661123 1087 966 930 429 288 11039 --171
NM_052917chr253046 2947 2625 2503 265 11160 1798 --
NM_052918chr1043380 2677 1419 345 ------
NM_052923chr6--185 ----
NM_052927chr542196 1872 728 328 1166 2809 614 --
NM_052932chr1141995 958 446 203 22051 531 22271 2233 12352
NM_052936chrX1623 ----1658
NM_052937chr842151 1699 710 295 21845 552 --1200
NM_052971chr51165 1145 ----
NM_053001chr8------1382
NM_053016chr9116968 6122 5498 5060 2375 2309 1476 1470 1247 311 232 32968 1156 837 --14881
NM_053023chr1162446 1307 1275 850 522 215 22645 256 12840 13126
NM_053024chr341106 419 214 72 2544 44 ----
NM_053025chr341190 1141 1108 207 11098 21353 659 --
NM_053026chr341190 1141 1108 207 11098 21353 659 --
NM_053027chr341190 1141 1108 207 11098 21353 659 --
NM_053028chr341190 1141 1108 207 11098 21353 659 --
NM_053031chr341190 1141 1108 207 11098 21353 659 --
NM_053032chr341190 1141 1108 207 11098 21353 659 --
NM_053042chr462970 2741 1235 1102 1062 434 12321 12657 1696
NM_053043chr7105914 5685 5335 5174 4485 3965 2390 1896 1338 26 24927 2320 25542 4765 24455 2431
NM_053064chr1472852 2455 2327 2192 1146 911 390 --12886 --
NM_053067chr9--261 54 ----
NM_054016chr131906 1724 174 21970 1410 11783 11511
NM_054016chr131906 1724 174 21970 1410 11783 11511
NM_054016chr131906 1724 174 21970 1410 11783 11511
NM_057157chr10------1140
NM_057168chr721601 1294 --21658 593 1352
NM_057169chr1273111 2963 2767 2451 2231 2070 1013 1318 22117 1003 11114
NM_057170chr1273111 2963 2767 2451 2231 2070 1013 1318 22117 1003 11114
NM_057175chr462621 2552 2257 2117 1915 1855 1351 --1205
NM_057178chr1752543 2512 1118 900 461 12307 3857 807 554 --
NM_057749chr81294 1372 1999 --
NM_058170chr151287 1240 1027 220 188 ----1448
NM_058172chr421648 442 ------
NM_058237chr143725 665 288 --1858 --
NM_058240chr1421525 176 11459 11054 11302
NM_058241chr222327 176 1631 ----
NM_058241chr222327 176 1631 ----
NM_058243chr191564 ------
NM_078483chr551519 1370 645 432 329 33550 3205 663 1620 --
NM_078487chr932774 2041 344 42855 2794 2744 1337 1625 --
NM_078629chrX2572 88 ------
NM_078630chrX2572 88 ------
NM_080546chr931621 825 280 11572 --1665
NM_080552chr20--1111 ----
NM_080591chr992934 2759 2417 2067 886 360 259 199 137 32643 973 82 --12162
NM_080597chr181952 2973 48 ----
NM_080617chr202966 804 ----1975
NM_080629chr131344 1243 1016 ------
NM_080630chr131344 1243 1016 ------
NM_080645chr632070 1959 1897 21951 1567 11881 --
NM_080654chr1141120 419 354 191 ------
NM_080664chr1441899 1547 674 76 --22029 282 --
NM_080666chr1431601 376 222 1265 1572 11086
NM_080671chr212184 51982 1751 1446 664 47 ----
NM_080672chr20----2552 443 --
NM_080676chr2042085 2038 251 204 12343 --11327
NM_080678chr22608 242 ------
NM_080683chr41187 2593 403 142 --
NM_080684chr41187 2593 403 142 --
NM_080685chr41187 2593 403 142 --
NM_080743chr622155 1965 1359 277 33 1701
NM_080759chr1341646 994 783 241 ----31912 697 132
NM_080760chr1341646 994 783 241 ----31912 697 132
NM_080764chr2273217 2758 2553 2331 996 688 529 52909 2877 2847 2254 376 22704 2000 --
NM_080832chrX3516 307 32 1709 147 1222
NM_080840chr20140 ------
NM_080841chr20140 ------
NM_080867chr1474987 4182 3558 3348 3303 1856 1274 24501 1604 35032 291 266 1375
NM_080872chr873640 3143 3119 2552 696 629 220 33025 3013 55 13459 13288
NM_080874chr421872 1619 21555 29 ----
NM_080927chr393395 3376 774 741 652 619 610 540 168 22431 827 --22170 994
NM_130391chr943522 3359 3202 2754 --31050 496 95 11078
NM_130392chr943522 3359 3202 2754 --31050 496 95 11078
NM_130393chr943522 3359 3202 2754 --31050 496 95 11078
NM_130395chr6------1339
NM_130434chr153889 813 182 ----11152
NM_130435chr1082978 2779 2043 2003 550 524 312 248 52108 991 298 160 128 11137 32970 1994 1067
NM_130436chr2132656 1753 1038 --1917 --
NM_130439chr1042273 1698 1499 724 21481 70 11801 1100
NM_130439chr1042273 1698 1499 724 21481 70 11801 1100
NM_130446chr394257 4100 4056 3918 3581 2950 1000 934 126 13871 11624 --
NM_130798chr1531559 984 21 11309 --153
NM_130808chr32334 328 186 ----
NM_130809chr572948 2920 2756 1235 1191 980 944 --22421 1135 32343 2157 345
NM_130830chr363806 2575 2561 1475 794 512 13383 33298 2957 583 13447
NM_130846chr1251098 959 933 393 170 1764 ----
NM_130847chr1185840 4535 4236 4170 2147 595 384 364 24815 2279 2757 701 35910 4694 4221
NM_133170chr20107383 5632 5302 2879 2378 2057 1778 1710 756 633 36418 5155 1186 56489 6380 5349 1454 389 36985 1372 1027
NM_133177chr11752 ----1989
NM_133178chr11752 ----1989
NM_133264chr1743921 3085 1305 922 23843 820 ----
NM_133265chrX33288 2388 803 11068 ----
NM_133329chr231741 1657 672 1490 11829 1261
NM_133370chr433505 800 286 43707 3677 3651 1433 --13528
NM_133372chr562685 2428 2315 2182 806 433 32464 1022 632 12164 22299 906
NM_133433chr52639 365 --1320 --
NM_133445chr973505 3340 2785 2423 2375 870 52 13320 23603 3140 1122
NM_133473chr1921220 374 21842 541 21951 392 --
NM_133477chr442838 508 380 218 12250 11083 12921
NM_133493chr654364 4154 3259 1740 1304 --54341 1659 1105 511 344 11781
NM_133496chr184518 4292 4093 3939 3768 3336 1604 1325 ------
NM_133631chr321166 657 ----11242
NM_133638chr521317 1085 ------
NM_133646chr271878 1581 990 929 446 392 147 35253 4808 4265 13568 14302
NM_133647chr1573216 2383 1111 1079 965 663 515 23368 2828 --138
NM_134442chr231222 618 369 11431 2677 360 1627
NM_134447chr191183 1446 1530 --
NM_138270chrX143117 3049 3003 2650 2482 2449 2106 1129 826 697 661 413 385 208 23323 111 11267 1598
NM_138286chr1933541 2671 1705 21646 30 11725 --
NM_138292chr11103489 2952 2561 2337 1236 1133 686 206 181 83 --12426 --
NM_138316chr101407 --21333 1046 --
NM_138333chr972600 2259 2165 2054 1997 281 243 2939 183 12150 12294
NM_138335chr41799 --1901 --
NM_138340chr18--1518 --1246
NM_138347chr193588 541 27 ------
NM_138357chr1041151 630 220 113 21428 1158 --21767 642
NM_138389chr41216 ------
NM_138395chr231021 1012 1003 --21081 91 1726
NM_138396chr121287 ------
NM_138401chr191260 ------
NM_138415chr2221893 79 11867 ----
NM_138419chr6162 125 ----
NM_138423chr1532240 2001 138 12177 11718 --
NM_138426chr752252 1964 1942 661 620 21829 133 11534 --
NM_138444chr1374996 4039 4004 1953 1880 1388 777 --13874 23453 415
NM_138459chr672653 2251 1315 1297 593 433 418 --23448 1128 22414 2278
NM_138468chr2116096 5631 5546 4535 4274 4029 4010 1271 955 553 32 14335 ----
NM_138473chr12134891 4842 4328 4218 4110 1373 1363 1347 810 360 277 268 44 34157 3805 1955 1664 1840
NM_138494chr752389 2353 1041 295 205 ------
NM_138554chr952632 2138 2081 1069 507 ------
NM_138559chr23961 932 883 --1430 11066
NM_138569chr61237 ------
NM_138576chr1494432 3861 3817 3668 3003 1735 1707 765 304 21606 1385 24747 3256 --
NM_138621chr253693 3229 2893 1373 472 21513 1209 12627 --
NM_138633chr651786 1409 1155 671 512 --21457 1123 --
NM_138638chr142876 30 52323 2119 1680 777 347 12071 1624
NM_138689chr111244 ------
NM_138713chr16137397 7144 6983 6897 6835 5883 5821 5651 3154 2169 1520 1242 948 47896 7498 6350 81 47294 5795 2244 819 1297
NM_138714chr16137397 7144 6983 6897 6835 5883 5821 5651 3154 2169 1520 1242 948 47896 7498 6350 81 47294 5795 2244 819 1297
NM_138731chr1484107 3659 3215 3189 1412 832 400 86 1802 31222 462 280 23334 1654
NM_138735chr261520 1429 1392 1059 483 259 ------
NM_138766chr52406 209 ------
NM_138775chr112601 179 1139 ----
NM_138779chr13----1104 --
NM_138782chr552410 2051 1976 1817 1706 --12246 --
NM_138785chr6------176
NM_138798chr2136 ------
NM_138799chr2--31483 704 387 --2757 572
NM_138811chr721152 409 --2923 249 1987
NM_138821chr52406 209 ------
NM_138822chr52406 209 ------
NM_138959chr1136372 6037 5641 5506 5477 5337 4174 2336 1869 1830 527 392 246 25549 4460 14958 35969 4523 2688
NM_138970chr1432397 1938 1641 11497 11617 --
NM_138971chr1183533 2615 2476 2426 1382 1191 345 140 2815 314 23342 1408 22835 1098
NM_138971chr1183533 2615 2476 2426 1382 1191 345 140 2815 314 23342 1408 22835 1098
NM_138972chr1183533 2615 2476 2426 1382 1191 345 140 2815 314 23342 1408 22835 1098
NM_138972chr1183533 2615 2476 2426 1382 1191 345 140 2815 314 23342 1408 22835 1098
NM_138973chr1183533 2615 2476 2426 1382 1191 345 140 2815 314 23342 1408 22835 1098
NM_138973chr1183533 2615 2476 2426 1382 1191 345 140 2815 314 23342 1408 22835 1098
NM_139012chr62908 402 31918 1399 613 ----
NM_139035chrX--1506 ----
NM_139048chr33354 178 108 198 ----
NM_139072chr2------1685
NM_139078chr12----150 --
NM_139136chr1211064 --1849 1903
NM_139168chr511327 --11995 1584
NM_139169chr1082286 1995 1897 1831 1415 878 827 362 11695 --1446
NM_139182chr42452 55 21639 1598 --21512 1278
NM_139207chr1272124 2037 1887 1717 861 845 22 --22229 1861 1344
NM_139244chr63824 160 69 --1963 --
NM_139246chr922280 436 1925 11735 12064
NM_139280chr1721043 379 11419 ----
NM_139316chr72312 91 ------
NM_139321chr2043769 3592 3401 683 1805 22902 1130 12697
NM_144570chr1672266 1889 1201 978 926 767 301 1866 42668 2278 994 934 --
NM_144571chr4126972 6877 5525 4899 4880 2002 1963 1377 952 830 246 204 44310 1647 782 445 24552 93 15774
NM_144574chr143579 464 93 1181 1100 --
NM_144578chr14115356 4946 4796 4566 3346 1962 1852 1408 1048 974 951 14364 34241 4200 587 --
NM_144583chr231772 1421 283 21546 324 2626 349 --
NM_144596chr142407 27 2555 498 2489 118 --
NM_144599chr15105190 4565 4229 2157 1521 1302 1188 748 715 699 22051 1582 13974 --
NM_144600chr1621241 1159 2543 30 --1614
NM_144618chr13520 370 228 2408 248 1101 --
NM_144632chr22353 226 22314 660 --1388
NM_144633chr331488 600 562 --11212 --
NM_144635chr3------1286
NM_144642chr32893 357 ------
NM_144660chr10--1109 ----
NM_144664chr1162198 2023 1972 1827 286 29 171 11581 32311 1792 982
NM_144709chr2--1379 1275 --
NM_144721chr431117 1063 1036 32513 679 410 ----
NM_144723chr51311 --1105 --
NM_144728chr1--1359 ----
NM_144729chr1--1359 ----
NM_144767chr1563669 3342 3145 3113 3015 1166 43938 3367 2953 1747 11815 --
NM_144778chr1342125 1848 1764 1032 12446 1927 --
NM_144949chr252639 1935 1902 698 317 22474 2062 11019 1623
NM_144963chr882313 2003 937 814 733 611 596 226 22118 954 32283 1667 50 --
NM_144967chrX1306 1731 1830 --
NM_144973chr1285354 5274 4933 4613 1446 902 722 274 24719 3879 1240 --
NM_144988chr1122 ------
NM_145000chr5--1548 --1101
NM_145052chrX1980 ------
NM_145055chr1893689 3397 3388 3078 2718 1414 1198 663 463 13424 12681 23477 507
NM_145112chr141102 ------
NM_145113chr141374 ------
NM_145115chr772344 2295 2099 1749 1577 750 323 ------
NM_145117chr1142548 638 591 233 33303 1100 110 11167 --
NM_145159chr14195 --1155 --
NM_145165chr1442779 2732 1948 664 22469 1160 22515 793 2924 324
NM_145176chr642920 866 337 150 12395 23298 2957 23283 2326
NM_145203chr131620 ------
NM_145206chr1022622 2082 11036 12180 13097
NM_145251chr1441606 1146 636 630 1351 11018 1605
NM_145259chr2106582 6452 6207 5636 5192 4964 4686 2676 499 425 36516 4464 784 35009 2858 1019 11406
NM_145261chr33889 327 304 1740 ----
NM_145284chrX61584 819 703 447 341 274 11997 ----
NM_145303chr62493 375 ------
NM_145307chr10104614 4490 4235 3649 3452 3173 3059 963 713 463 43500 1623 1079 794 33935 2972 625 24099 587
NM_145320chr783225 3170 3069 1117 1012 293 214 165 12381 42674 792 774 136 1984
NM_145321chr783225 3170 3069 1117 1012 293 214 165 12381 42674 792 774 136 1984
NM_145322chr783225 3170 3069 1117 1012 293 214 165 12381 42674 792 774 136 1984
NM_145341chr102698 662 3692 540 474 1228 11414
NM_145658chr151154 ------
NM_145686chr262419 1132 1044 326 198 67 12160 1978 13421
NM_145687chr262419 1132 1044 326 198 67 12160 1978 13421
NM_145690chr821518 418 21726 1684 11654 --
NM_145698chr1031702 1678 1604 1262 ----
NM_145701chr142649 520 199 --1692
NM_145728chr1552114 847 577 537 64 52270 987 889 615 192 --</