TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4479
miRNA Sequence: CGCGCGGCCGUGCUCGGAGCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000032chrX136 ------
NM_000037chr831976 1791 1676 ------
NM_000084chrX1787 ------
NM_000188chr101713 --1574 --
NM_000259chr1524808 4324 ------
NM_000266chrX1861 ------
NM_000296chr16128 ------
NM_000332chr614492 ------
NM_000398chr222348 118 137 ----
NM_000430chr1712838 --12796 --
NM_000500chr6193 ------
NM_000533chrX164 ------
NM_000678chr202245 21 2594 88 ----
NM_000701chr1121 ------
NM_000814chr1512859 ------
NM_000834chr12154 ------
NM_000836chr194340 316 140 82 --1380 --
NM_000841chr63787 717 38 ------
NM_000842chr11129 --1615 --
NM_000864chr11974 ------
NM_000883chr71260 ------
NM_000883chr71260 ------
NM_000901chr41327 ------
NM_000944chr4152 ------
NM_001001331chr31173 ------
NM_001001342chr1011473 ------
NM_001001395chr12--12705 ----
NM_001001502chr52219 179 ------
NM_001001549chr722611 2232 ------
NM_001001550chr722611 2232 ------
NM_001001555chr722611 2232 ------
NM_001002031chr12135 ------
NM_001002762chr102613 404 ------
NM_001003407chr1035018 431 280 --1521 --
NM_001003408chr1035018 431 280 --1521 --
NM_001003694chr3----1507 --
NM_001003800chr911319 1308 ----
NM_001004342chr135669 1824 1629 --1406 --
NM_001004354chr94774 745 39 33 1347 ----
NM_001005291chr17--154 ----
NM_001005375chrY11277 ------
NM_001005408chr17139 ----1125
NM_001005463chr1011865 ------
NM_001005505chr31147 ------
NM_001005909chr3160 ------
NM_001006115chr322675 71 ------
NM_001006617chr91985 --1320 --
NM_001006619chr91985 --1320 --
NM_001006620chr91985 --1320 --
NM_001006621chr91985 --1320 --
NM_001007098chr1----198 --
NM_001007466chr623207 3187 ----148
NM_001007533chr17127 --156 --
NM_001007559chr1811907 ------
NM_001008392chr321005 105 ------
NM_001008938chr111118 ------
NM_001009554chr411630 13719 ----
NM_001009554chr411630 13719 ----
NM_001009566chr11274 --21404 189 --
NM_001009944chr16128 ------
NM_001010917chr101549 --169 --
NM_001010924chr102144 105 ------
NM_001010938chr31143 ------
NM_001010989chr161164 ------
NM_001010990chr161164 ------
NM_001011537chr3------12254
NM_001011666chr714612 ------
NM_001012644chr202131 60 ------
NM_001012755chrX23531 1474 ------
NM_001013661chr1----125 --
NM_001013690chr1242433 201 57 21 11783 ----
NM_001014336chr12183 ------
NM_001014809chr41675 ------
NM_001015053chr17196 ------
NM_001017440chr717197 141 23230 55 --
NM_001023567chr151352 ------
NM_001024226chr12771 126 ------
NM_001024227chr12771 126 ------
NM_001024228chr12771 126 ------
NM_001024401chr1631995 1886 93 --11977 --
NM_001024845chr1140 ------
NM_001024858chr1442965 202 164 112 ------
NM_001025076chr1014328 ------
NM_001025366chr6--1174 ----
NM_001025366chr6--1174 ----
NM_001025367chr6--1174 ----
NM_001025367chr6--1174 ----
NM_001025368chr6--1174 ----
NM_001025368chr6--1174 ----
NM_001025369chr6--1190 ----
NM_001025369chr6--1190 ----
NM_001025370chr6--1174 ----
NM_001025370chr6--1174 ----
NM_001025579chr173770 264 177 ------
NM_001025596chr111416 ------
NM_001025780chr911197 1194 ----
NM_001029998chr4----11399 --
NM_001030006chr17182 ------
NM_001031680chr132270 1873 101 ------
NM_001031690chr71228 ------
NM_001031695chr221304 ----11444
NM_001031804chr1614178 ------
NM_001032280chr62285 48 ------
NM_001032288chr2011322 ------
NM_001033057chr3--1604 ----
NM_001033117chr334858 1219 26 ------
NM_001033602chr1342634 952 387 113 ------
NM_001033756chr6--1108 ----
NM_001033756chr6--1108 ----
NM_001034954chr1011009 ------
NM_001034955chr1011009 ------
NM_001034956chr1011009 ------
NM_001034957chr1011009 ------
NM_001037967chrX136 ------
NM_001037969chrX136 ------
NM_001038493chr22354 47 ------
NM_001038702chr511872 ------
NM_001039140chr20168 ------
NM_001039457chr1----125 1214
NM_001039547chr327611 1891 ------
NM_001039960chr12133 ------
NM_001040151chr1111287 ------
NM_001040424chr2112795 12605 1884 --
NM_001042424chr41182 ------
NM_001042425chr62285 48 ------
NM_001042478chr1146 ------
NM_001042486chr201260 ------
NM_001042603chr1233521 3463 3405 ------
NM_001042632chr202407 268 --2224 137 --
NM_001042633chr202407 268 --2224 137 --
NM_001042692chr21562 ------
NM_001043318chr1442902 1081 238 185 1231 13447 --
NM_001065chr122207 162 ------
NM_001068chr3------1240
NM_001080418chr12222 96 --1207 --
NM_001092chr1742234 1009 572 251 ------
NM_001094chr171568 --1195 --
NM_001116chr161626 12243 22858 651 12410
NM_001122631chr111558 ------
NM_001127chr221204 ------
NM_001135chr15--2807 788 ----
NM_001144chr16133 ------
NM_001163chr92957 100 ------
NM_001174chrX1936 --1564 --
NM_001189chr4136 ------
NM_001194chr195578 466 433 202 172 1662 --1543
NM_001282chr17182 ------
NM_001300chr10158 ------
NM_001313chr41675 ------
NM_001331chr1121928 364 ------
NM_001332chr521513 564 ------
NM_001346chr31632 ------
NM_001397chr112311 ------
NM_001420chr1923126 2618 ------
NM_001426chr2128 --122 --
NM_001451chr1631052 888 172 1997 ----
NM_001454chr172920 260 ------
NM_001497chr922367 296 --12462 --
NM_001500chr6170 --1128 --
NM_001518chr72920 820 ------
NM_001619chr11----2967 948 --
NM_001642chr111101 ------
NM_001655chr112568 135 ------
NM_001658chr12771 126 ------
NM_001668chr1----1742 --
NM_001670chr22185 ------
NM_001679chr3----1323 --
NM_001683chr31173 ------
NM_001693chr821039 25 11150 ----
NM_001706chr311028 ------
NM_001707chr7----269 64 --
NM_001710chr6148 ------
NM_001711chrX1106 21096 931 ----
NM_001810chr201292 ------
NM_001949chr6----1421 --
NM_001958chr202232 87 --143 --
NM_001962chr5--1478 ----
NM_001981chr11870 ------
NM_002010chr131467 ------
NM_002048chr9470 53 40 27 ------
NM_002088chr193212 182 126 ------
NM_002103chr19----1197 --
NM_002145chr17136 ------
NM_002147chr17138 ------
NM_002226chr143840 647 239 ----1753
NM_002229chr191148 ------
NM_002264chr314396 ------
NM_002268chr311206 ------
NM_002313chr1035018 431 280 --1521 --
NM_002359chr1773919 1703 1649 1337 1168 1155 1056 14196 ----
NM_002360chr762361 2129 1793 1673 568 323 --12611 --
NM_002373chr1511291 ------
NM_002397chr5199 ------
NM_002398chr221012 149 ------
NM_002442chr122638 315 --1320 --
NM_002501chr1994088 3741 3545 3464 3426 3336 2964 2524 1111 --23484 1094 --
NM_002522chr1721029 449 ------
NM_002537chr151261 ------
NM_002553chr71347 ------
NM_002574chr1129 ------
NM_002589chr4187 ------
NM_002607chr711101 ------
NM_002653chr56939 908 673 410 258 107 1128 --1862
NM_002697chr11105 ------
NM_002698chr192616 145 ------
NM_002699chr13433 190 60 ------
NM_002716chr1111319 ------
NM_002717chr81658 ------
NM_002726chr61143 ------
NM_002730chr1911341 ------
NM_002806chr141244 ------
NM_002823chr2146 ------
NM_002824chr121171 --1498 --
NM_002885chr121028 69 ------
NM_002886chr3--133 125 --
NM_002896chr11142 ------
NM_002911chr1931181 275 237 --1492 11473
NM_002918chr1951042 1004 788 709 359 --2793 233 --
NM_002998chr812128 ------
NM_003012chr8197 ------
NM_003016chr171290 ------
NM_003021chr1941133 1017 351 27 ------
NM_003030chr3162 --126 --
NM_003034chr12--17528 ----
NM_003036chr12474 118 --1206 --
NM_003045chr1323791 233 --13425 --
NM_003074chr31132 ------
NM_003085chr52219 179 ------
NM_003107chr632486 191 146 ------
NM_003110chr171382 --1246 --
NM_003131chr61319 ------
NM_003200chr1911834 ------
NM_003214chr61175 ------
NM_003215chr411089 ------
NM_003220chr62285 48 ------
NM_003223chr161828 ------
NM_003253chr211449 --199 --
NM_003255chr1732203 849 688 12617 ----
NM_003270chrX1199 ------
NM_003300chr14183 ------
NM_003317chr14----1121 --
NM_003339chr51146 ------
NM_003345chr162488 144 ------
NM_003347chr2212323 147 ----
NM_003349chr2011322 ------
NM_003367chr191103 ------
NM_003371chr91275 --1795 --
NM_003376chr6--1174 ----
NM_003376chr6--1174 ----
NM_003378chr72138 27 --140 --
NM_003404chr201800 ------
NM_003412chr3----11919 --
NM_003413chrX1424 ------
NM_003418chr32245 125 ------
NM_003458chr31411 ------
NM_003468chr2----13176 --
NM_003485chr144215 209 197 89 ------
NM_003508chr71333 ------
NM_003547chr6----169 --
NM_003575chr741353 1239 1125 618 ----11484
NM_003586chr161161 1600 ----
NM_003590chr21250 13833 ----
NM_003644chr1726318 5009 15994 ----
NM_003655chr172317 280 ------
NM_003660chr194598 591 581 113 --1491 --
NM_003685chr192958 106 ------
NM_003714chr531054 243 182 ------
NM_003745chr16144 ------
NM_003749chr1321605 525 ------
NM_003750chr10--1632 ----
NM_003779chr1----1117 --
NM_003873chr101484 ------
NM_003924chr41142 11214 ----
NM_003936chr241135 893 258 172 ------
NM_003938chr192282 136 ------
NM_003947chr3145 ------
NM_004004chr13161 ------
NM_004047chr1----125 1214
NM_004078chr13809 312 38 ------
NM_004081chrY11277 ------
NM_004090chr1722644 46 ------
NM_004093chr132287 81 --2255 149 --
NM_004113chr31428 ------
NM_004176chr17--154 ----
NM_004227chr731191 257 165 12420 12494 1281
NM_004302chr1232669 707 550 --2470 58 --
NM_004309chr172919 110 ------
NM_004311chr1022828 31 12367 ----
NM_004321chr242959 2501 1034 675 --23414 3309 --
NM_004350chr132270 1873 101 ------
NM_004370chr611619 --11378 --
NM_004395chr5----176 --
NM_004405chr21118 ------
NM_004409chr191537 --173 --
NM_004420chr1132141 826 462 ------
NM_004427chr121108 855 ------
NM_004430chr8----2309 99 --
NM_004436chr11631 ------
NM_004449chr2111118 ------
NM_004454chr312273 12246 1900 --
NM_004472chr52133 114 ------
NM_004496chr1411323 ------
NM_004516chr19177 ------
NM_004529chr91543 ------
NM_004576chr51325 ------
NM_004577chr71508 ------
NM_004622chr21107 ------
NM_004625chr3170 ------
NM_004630chr1131164 1096 354 ------
NM_004634chr3----1507 --
NM_004643chr14--1269 ----
NM_004656chr3139 ------
NM_004664chr12158 ------
NM_004667chr151150 ------
NM_004726chrX--11605 ----
NM_004742chr321616 1172 ------
NM_004772chr51302 ------
NM_004807chr21123 ----11762
NM_004831chr193233 162 97 ------
NM_004860chr17181 ------
NM_004904chr714612 ------
NM_004947chr31151 ------
NM_004973chr61498 ------
NM_004991chr3----147 --
NM_004992chrX57492 6597 5780 1320 1119 ------
NM_004992chrX57492 6597 5780 1320 1119 ------
NM_005028chr10----11537 --
NM_005038chr41484 ------
NM_005056chr1233765 3707 3649 ------
NM_005099chr111061 ------
NM_005116chr2031720 1606 109 --23800 876 13709
NM_005153chr161760 ------
NM_005176chr12135 ------
NM_005187chr1641328 233 110 38 ------
NM_005198chr221181 ------
NM_005232chr7179 ------
NM_005238chr11153 ------
NM_005245chr42134 63 --1122 --
NM_005255chr4------124
NM_005273chr7170 ------
NM_005281chr11758 ------
NM_005311chr722611 2232 ------
NM_005354chr192259 241 ------
NM_005357chr192222 23 ------
NM_005369chrX--173 ----
NM_005386chr20------181
NM_005440chr1723274 65 ------
NM_005458chr92597 91 ------
NM_005461chr2051288 788 411 152 95 ------
NM_005465chr11514 ------
NM_005474chr17196 ------
NM_005503chr1521114 883 11150 ----
NM_005515chr71163 ------
NM_005520chr5------150
NM_005539chr1031284 518 61 ------
NM_005596chr915095 ------
NM_005599chr1192 ------
NM_005618chr61180 ------
NM_005634chrX3628 605 560 ------
NM_005637chr1811907 ------
NM_005639chr1211471 ------
NM_005647chrX3812 806 48 --11328 --
NM_005650chr221147 1109 ----
NM_005656chr21--169 ----
NM_005668chr51945 ------
NM_005678chr152659 406 ------
NM_005704chr111018 ------
NM_005736chr101140 ------
NM_005737chr251174 699 294 194 102 ------
NM_005759chr214778 ------
NM_005781chr31143 ------
NM_005808chr321005 105 ------
NM_005811chr121130 ------
NM_005819chr11395 ------
NM_005826chr11585 ------
NM_005883chr1992434 2230 953 876 749 446 195 165 73 --22751 2067 --
NM_005895chr1263674 3390 837 369 328 23 --13684 --
NM_005920chr11623 ------
NM_005964chr171351 ------
NM_006007chr913934 ------
NM_006022chr132107 32 ------
NM_006030chr31147 ------
NM_006037chr264661 4643 4635 4446 3309 299 --13253 14652
NM_006160chr171538 ------
NM_006166chr1212268 ------
NM_006178chr17----1222 --
NM_006186chr2186 ------
NM_006251chr51725 ------
NM_006272chr212644 101 1290 ----
NM_006277chr2166 ------
NM_006317chr51306 ------
NM_006322chr13127 ------
NM_006378chr931133 102 36 ------
NM_006380chr1713111 ------
NM_006387chr191812 --2170 22 --
NM_006434chr1011009 ------
NM_006454chr482967 2848 2817 2384 2274 2056 1049 335 --13066 --
NM_006517chrX--1105 ----
NM_006549chr1232532 493 63 --136 --
NM_006557chr911098 ------
NM_006560chr111416 ------
NM_006561chr1014328 ------
NM_006562chr10------1241
NM_006618chr1----11090 --
NM_006651chr4121469 1463 1419 1229 1219 600 548 522 467 394 198 135 11386 ----
NM_006717chr9----13140 --
NM_006720chr1035018 431 280 --1521 --
NM_006749chr83822 516 170 ----199
NM_006761chr171289 ------
NM_006763chr1146 --133 --
NM_006766chr812025 ------
NM_006788chr181414 149 1397 --
NM_006805chr511121 ------
NM_006807chr171248 ------
NM_006884chr3162 --126 --
NM_006898chr21557 ------
NM_006901chr15164 ------
NM_006927chr162529 167 --2572 556 --
NM_006950chrX----1785 --
NM_006981chr911196 ------
NM_006990chr1--1455 ----
NM_007011chr1536659 6359 48 ------
NM_007026chr171399 ------
NM_007042chr32930 242 ------
NM_007050chr2021509 184 ------
NM_007084chr13279 67 ------
NM_007106chr131552 ------
NM_007182chr3156 ------
NM_007185chr11708 1368 ----
NM_007192chr1411049 ------
NM_007249chr131257 ------
NM_007275chr31742 ------
NM_007326chr222348 118 137 ----
NM_007349chr7----175 --
NM_007375chr1----1667 --
NM_009588chr61443 ----1201
NM_012074chr1411168 --1916 --
NM_012083chr1041099 164 117 37 ------
NM_012154chr81569 ------
NM_012156chr2023389 107 ------
NM_012164chr9146 12245 --11280
NM_012193chr1114875 ------
NM_012218chr1932980 538 184 ------
NM_012282chrX2211 29 ------
NM_012293chr221607 73 ------
NM_012307chr181843 ------
NM_012308chr111518 12228 ----
NM_012321chr19--1478 126 --
NM_012384chr2022239 55 ------
NM_012414chr11563 ------
NM_012473chr22135 ------
NM_013227chr15--2807 788 ----
NM_013261chr413146 ------
NM_013275chr162593 210 ------
NM_013281chr201189 ------
NM_013351chr171254 ------
NM_013449chr1211930 --1485 --
NM_014071chr201337 ------
NM_014079chr31195 ------
NM_014154chr3----1140 --
NM_014188chr11345 ------
NM_014191chr121667 ------
NM_014233chr1711575 ------
NM_014240chr323683 2844 ------
NM_014268chr181150 ------
NM_014272chr15177 ------
NM_014278chr4--137 ----
NM_014292chr2221259 723 ------
NM_014309chr221294 ----11434
NM_014368chr9179 ------
NM_014454chr6------1843
NM_014507chr2231221 355 73 ------
NM_014577chr22----1237 --
NM_014613chr513011 ------
NM_014621chr2155 134 ----
NM_014661chr1033325 933 496 --43780 3262 2813 179 13457
NM_014665chr871433 1291 1236 1152 986 914 886 --33115 2998 1144 23072 3063
NM_014667chr3----12324 --
NM_014685chr161164 ------
NM_014686chr1911922 --12398 --
NM_014690chr71228 ------
NM_014712chr161453 ------
NM_014729chr812202 --1274 --
NM_014742chr201143 11293 ----
NM_014746chr21141 ------
NM_014756chr111118 ------
NM_014767chr1033561 3247 400 ------
NM_014828chr14--11695 ----
NM_014840chr1222138 446 ------
NM_014841chr61152 ------
NM_014850chr334858 1219 26 ------
NM_014869chr33603 127 91 --1100 --
NM_014902chr201260 ------
NM_014918chr1511515 ------
NM_014944chr11274 --21404 189 --
NM_014947chr111201 ------
NM_014974chr1011483 ------
NM_014975chr19275 24 ------
NM_014990chr141141 ------
NM_015012chr11158 ------
NM_015025chr212205 ------
NM_015069chr16152 ------
NM_015075chrX11387 ------
NM_015080chr113235 191 161 ------
NM_015092chr163426 327 306 ------
NM_015103chr3179 1334 ----
NM_015113chr1731774 304 164 --12116 --
NM_015144chr1623630 1191 ------
NM_015155chr10----1493 --
NM_015163chr1421857 78 ------
NM_015171chr16147 ------
NM_015172chr111139 ------
NM_015194chr171100 ------
NM_015215chr11954 ------
NM_015233chr1342634 952 387 113 ------
NM_015250chr93412 215 205 ------
NM_015267chr122746 715 ------
NM_015328chr722835 2595 --1114 --
NM_015385chr1011009 ------
NM_015388chr61126 ------
NM_015444chr3139 --1167 --
NM_015457chr11135 195 ----
NM_015483chr71390 ------
NM_015488chr211745 ------
NM_015497chr151870 ------
NM_015541chr3164 ------
NM_015564chr522813 980 ------
NM_015578chr191376 ------
NM_015589chr14348 33 25 ------
NM_015601chr101987 ------
NM_015609chr1176 ------
NM_015694chr71115 --145 --
NM_015695chr621974 413 ------
NM_015831chr7----1154 --
NM_015855chr116718 278 155 109 54 22 ------
NM_015892chr101461 ------
NM_015898chr1912344 ------
NM_015910chr21562 ------
NM_015981chr523016 23 ------
NM_016037chr121072 933 ------
NM_016075chr1312749 ----13027
NM_016083chr613501 ------
NM_016132chr1523279 1372 ------
NM_016169chr1023121 461 1121 ----
NM_016176chr1121 ------
NM_016231chr171584 ------
NM_016291chr3160 ------
NM_016358chr5136 ------
NM_016463chr5--134 ----
NM_016507chr1712994 ------
NM_016545chr12350 76 ------
NM_016588chr6124 ------
NM_016603chr51801 ------
NM_016621chr1151795 1554 1468 1415 677 --13288 1740
NM_016848chr9--130 ----
NM_017409chr121167 ------
NM_017413chrX1507 ------
NM_017420chr1411436 ------
NM_017450chr1751313 1258 1148 338 44 --1274 --
NM_017553chr15--185 ----
NM_017602chrX1896 ------
NM_017610chr15--188 ----
NM_017617chr921100 1093 --31443 1395 450 --
NM_017633chr623819 652 ------
NM_017643chr1712541 ------
NM_017650chr721377 370 ------
NM_017670chr111162 ------
NM_017681chrX152 ------
NM_017730chr31186 ------
NM_017737chr12433 422 ------
NM_017742chr18----11779 --
NM_017766chr12204 28 ------
NM_017778chr811016 ------
NM_017789chr2--1827 ----
NM_017845chr41654 ------
NM_017921chr1721548 279 --11761 --
NM_018014chr211283 ------
NM_018086chr2----11197 --
NM_018110chr16147 ------
NM_018120chr811037 ------
NM_018126chr41199 ------
NM_018198chr121407 1363 --11180 --
NM_018202chr11966 ------
NM_018254chr11110 ------
NM_018400chr1111287 ------
NM_018413chr121118 ------
NM_018419chr20167 ------
NM_018509chr1711468 ------
NM_018640chr12--12705 ----
NM_018667chr1621087 160 --1150 --
NM_018708chr1951659 1535 531 518 66 ------
NM_018836chr1146 ------
NM_018952chr171219 ------
NM_019058chr101625 ------
NM_019089chr123035 318 ----22466 397
NM_019102chr7--147 ----
NM_019102chr7--147 ----
NM_019595chr2166 ------
NM_019606chr7--1186 ----
NM_019885chr22503 429 --1390 --
NM_020148chr182645 47 ------
NM_020151chr211493 ------
NM_020155chr111123 ------
NM_020180chr1811303 --11369 --
NM_020182chr2053524 2298 301 57 30 ------
NM_020240chr511872 ------
NM_020310chr171493 ------
NM_020382chr12--1281 ----
NM_020420chrY11277 ------
NM_020431chr1412742 ------
NM_020432chr71353 ------
NM_020449chrX148 ------
NM_020475chr831913 1728 1613 ------
NM_020476chr831913 1728 1613 ------
NM_020477chr831913 1728 1613 ------
NM_020478chr831976 1791 1676 ------
NM_020480chr831913 1728 1613 ------
NM_020659chr191542 ------
NM_020689chr2021448 609 ------
NM_020693chr112534 35 --140 --
NM_020699chr124260 203 13655 ----
NM_020706chr211105 ------
NM_020708chr205971 762 490 393 378 11598 2455 64 1187
NM_020764chr163262 202 27 1236 ----
NM_020772chr1715233 ------
NM_020774chr1814973 ------
NM_020796chr5----1176 --
NM_020807chr162475 46 166 ----
NM_020815chr41386 ------
NM_020820chr2031510 1067 28 ------
NM_020836chr14125 ------
NM_020858chr1511489 ------
NM_020946chr931492 688 56 ------
NM_020956chr1954582 2938 1069 924 786 ------
NM_020958chr141137 ------
NM_020962chr152874 69 ----1901
NM_020964chr1823659 634 ------
NM_020967chr202809 95 ------
NM_021019chr12175 ------
NM_021020chr81513 161 23338 2285 --
NM_021025chr53183 156 77 ------
NM_021032chr31428 ------
NM_021064chr61448 ------
NM_021072chr511645 ------
NM_021079chr172247 179 ------
NM_021090chr22--185 ----
NM_021116chr738303 6774 3217 ------
NM_021120chrX33066 1978 907 --13052 --
NM_021155chr1931843 1035 860 ------
NM_021570chr9287 36 ------
NM_021625chr121391 ------
NM_021643chr2--11609 ----
NM_021647chr411630 13719 ----
NM_021814chr61219 ------
NM_021907chr21207 ------
NM_021912chr1512859 ------
NM_021962chr1742234 1009 572 251 ------
NM_021967chr511002 ------
NM_021973chr4190 ------
NM_021988chr2011322 ------
NM_021991chr171118 147 ----
NM_022048chr15----11603 --
NM_022055chr2141 ------
NM_022075chr1164 ------
NM_022079chr101987 ------
NM_022166chr161195 ------
NM_022170chr74349 341 322 96 ------
NM_022442chr2011322 ------
NM_022450chr16126 ------
NM_022469chr12404 31 ------
NM_022470chr311237 ------
NM_022552chr2--1920 ----
NM_022572chr211745 ------
NM_022648chr213042 ------
NM_022737chr192297 217 ------
NM_022763chr311221 ------
NM_022780chr221618 618 ------
NM_022822chr112605 569 166 ----
NM_022898chr141104 ------
NM_022978chr511002 ------
NM_023035chr19180 ----171
NM_023076chr1652790 2737 1187 811 160 ------
NM_024016chr172808 27 --3147 70 59 --
NM_024107chr171193 ------
NM_024117chr91985 --1320 --
NM_024293chr21273 ------
NM_024306chr1621129 285 ------
NM_024507chr16126 --1114 --
NM_024522chr13128 98 55 ------
NM_024567chr8----1532 --
NM_024645chr8152 ------
NM_024674chr1--1836 ----
NM_024676chr13394 359 183 --1200 --
NM_024704chr20--1275 ----
NM_024721chr8122 ------
NM_024742chr1631445 1341 757 ------
NM_024770chr221711 887 ------
NM_024830chr5137 1370 ----
NM_024835chr17152 ------
NM_024859chrX2978 190 --1813 --
NM_024871chr3171 ------
NM_024884chr141355 14247 ----
NM_024991chr1011009 ------
NM_025076chr21618 ------
NM_025140chr12124 --1518 --
NM_025164chr1122046 1903 ------
NM_025195chr811515 ------
NM_025237chr17274 52 ------
NM_025257chr62342 116 ------
NM_025263chr61614 ------
NM_030621chr1422846 1183 ------
NM_030629chr1621628 426 ------
NM_030651chr6130 ------
NM_030661chr721148 1089 --11110 11348
NM_030808chr173684 178 91 ------
NM_030913chr11546 ------
NM_031309chr832388 2237 354 --11444 11459
NM_031417chr192207 47 ------
NM_031439chr8134 ------
NM_031459chr1--11455 11396 --
NM_031468chr717197 141 23230 55 --
NM_031492chr11269 43 ------
NM_031890chr221789 ------
NM_031992chr74349 341 322 96 ------
NM_032017chr111851 ------
NM_032102chr1122033 590 ------
NM_032109chr52467 339 --2333 261 --
NM_032153chr331077 716 63 287 40 1589 --
NM_032192chr172737 111 ------
NM_032193chr1121381 28 ------
NM_032242chr352838 2737 830 618 609 ----1209
NM_032246chr15131 ------
NM_032281chr1923126 2618 ------
NM_032288chr3------12254
NM_032294chr1731411 1393 47 ------
NM_032375chr19----2179 30 --
NM_032430chr19150 --1154 --
NM_032442chr17139 ----1125
NM_032557chr41280 ------
NM_032594chr141336 ------
NM_032646chr1721617 67 ------
NM_032711chr1773919 1703 1649 1337 1168 1155 1056 14196 ----
NM_032765chr51728 ------
NM_032772chr10197 ------
NM_032869chr811884 ------
NM_032927chr41117 ------
NM_032983chr732293 2158 419 ------
NM_032999chr72920 820 ------
NM_033000chr72920 820 ------
NM_033001chr72920 820 ------
NM_033023chr711077 ------
NM_033129chr206340 303 257 94 64 22 --11565 --
NM_033147chr21207 ------
NM_033148chr21207 ------
NM_033181chr613501 ------
NM_033224chr725310 2213 ------
NM_033225chr8----1280 --
NM_033259chr32617 184 --2224 129 --
NM_033266chr16134 ------
NM_033309chr16169 ------
NM_033348chr112334 106 ------
NM_033420chr1951090 990 911 473 251 ------
NM_033496chr101713 --1574 --
NM_033497chr101713 --1574 --
NM_033498chr101713 --1574 --
NM_033500chr101713 --1574 --
NM_052845chr1252917 2054 1125 337 49 ------
NM_052864chr41484 ------
NM_052869chr1721617 67 ------
NM_052896chr11203 ------
NM_052910chr132338 100 ------
NM_052925chr192406 76 ------
NM_052933chr72297 93 ------
NM_052935chr172121 33 ------
NM_054027chr522245 355 ------
NM_058167chr14894 885 505 469 2858 44 11011 --
NM_058175chr213755 549 46 ------
NM_058243chr192879 617 ------
NM_078469chr101400 ------
NM_080415chr171768 ------
NM_080611chr202131 60 ------
NM_080645chr611619 --11378 --
NM_080664chr142584 496 ------
NM_080738chr121956 1511 ------
NM_080881chr5----176 --
NM_130386chr181262 ------
NM_133170chr2021509 184 ------
NM_133177chr111018 ------
NM_133178chr111018 ------
NM_133330chr41182 ------
NM_133331chr41182 ------
NM_133335chr41182 ------
NM_133452chr19--1847 ----
NM_133499chrX----1855 --
NM_138357chr1011229 ------
NM_138559chr211273 ------
NM_138576chr141104 ------
NM_138732chr113235 191 161 ------
NM_138734chr113235 191 161 ------
NM_138931chr311028 ------
NM_139323chr201800 ------
NM_144583chr211743 ------
NM_144586chr21494 ------
NM_144599chr15159 ------
NM_144667chr1211025 ------
NM_144976chr191442 ------
NM_144994chr2167 --2216 24 --
NM_145113chr14--192 ----
NM_145159chr143840 647 239 ----1753
NM_145173chr192387 337 ------
NM_145185chr1941413 613 253 209 --1605 --
NM_145260chr23653 579 176 ------
NM_145285chr102746 49 --1302 --
NM_145725chr14183 ------
NM_145726chr14183 ------
NM_145730chr221204 ------
NM_145861chr121956 1511 ------
NM_147189chr81323 ------
NM_147190chr121546 ------
NM_147193chr1--180 ----
NM_147202chr932680 2635 104 ------
NM_147204chr121391 ------
NM_152240chr311237 ------
NM_152253chr2233360 3174 1664 ----14043
NM_152344chr1711303 ------
NM_152345chr173458 170 77 ------
NM_152420chr91667 ------
NM_152462chr171285 ------
NM_152470chr1833689 3320 283 13501 ----
NM_152520chr21250 ------
NM_152589chr12--1251 ----
NM_152758chr8--12696 ----
NM_152787chrX2856 446 ------
NM_152924chr1536659 6359 48 ------
NM_153050chr22--185 ----
NM_153051chr22--185 ----
NM_153270chrX----145 --
NM_153273chr322675 71 ------
NM_153334chr223644 111 21 ------
NM_153350chr1641271 1155 107 24 ------
NM_153367chr10181 ------
NM_153499chr1232630 591 161 --1134 --
NM_153500chr1232630 591 161 --1134 --
NM_153616chr1511489 ------
NM_153617chr1511489 ------
NM_153618chr1511489 ------
NM_153619chr1522727 354 ------
NM_153631chr721148 1089 --11110 11348
NM_153632chr721148 1089 --11110 11348
NM_153686chr412356 ------
NM_153759chr2--1920 ----
NM_153832chr1175 ------
NM_170600chr9130 ------
NM_170712chr3156 ------
NM_170713chr3156 ------
NM_170714chr3156 ------
NM_171825chr523016 23 ------
NM_172070chr2--1831 ----
NM_172206chr1731411 1393 47 ------
NM_172216chr1232532 493 63 --136 --
NM_172226chr1232630 591 161 --1134 --
NM_172375chr142405 126 ------
NM_173171chr2186 ------
NM_173172chr21394 ------
NM_173173chr2186 ------
NM_173198chr911196 ------
NM_173200chr911196 ------
NM_173201chr161220 ------
NM_173491chr511430 ------
NM_173492chr9187 ------
NM_173642chr117768 ------
NM_173681chr73736 205 26 --11368 --
NM_173809chr1011473 ------
NM_173832chr853319 3195 2486 119 80 12896 33682 2462 103 --
NM_174911chr82857 25 ------
NM_174937chr101606 --1563 --
NM_175058chr111253 --1547 --
NM_175629chr2--1920 ----
NM_175747chr6154 --1274 --
NM_175884chr71170 ------
NM_175898chr1531459 299 162 ------
NM_175902chr17286 46 --1230 --
NM_175931chr1641328 233 110 38 ------
NM_177438chr1422846 1183 ------
NM_177441chr171193 ------
NM_177991chr202131 60 ------
NM_177996chr2023389 107 ------
NM_178135chr411184 ------
NM_178314chr121753 ------
NM_178427chr1----1742 --
NM_178554chr31473 ------
NM_178557chr41624 1449 ----
NM_178568chr17----11668 --
NM_178830chr192678 549 ------
NM_178835chr41784 ------
NM_178864chr112669 509 ------
NM_181492chr22185 147 ----
NM_181505chr172737 111 ------
NM_181670chr12278 70 ------
NM_181674chr51325 ------
NM_181675chr51325 ------
NM_181676chr51325 ------
NM_181677chr51325 ------
NM_181678chr51325 ------
NM_181689chr20------181
NM_181696chr1129 ------
NM_181697chr1129 ------
NM_181701chr931706 706 58 ------
NM_181746chr1164 ------
NM_181825chr22--174 ----
NM_181838chr51146 ------
NM_182526chr143585 512 172 ------
NM_182553chr111146 ------
NM_182557chr11193 1295 1593 --
NM_182687chr161204 ------
NM_182700chr72415 269 ------
NM_182760chr31292 ------
NM_182895chr223644 111 21 ------
NM_182898chr714612 ------
NM_182899chr714612 ------
NM_182918chr2111118 ------
NM_182970chr2014267 ------
NM_182972chr1----11087 --
NM_183006chr201260 ------
NM_183243chr71260 ------
NM_183243chr71260 ------
NM_183360chr21207 ------
NM_183361chr21207 ------
NM_183377chr171568 --1195 --
NM_183422chr132107 32 ------
NM_183425chr2041530 1186 451 419 --1213 --
NM_194259chr162488 144 ------
NM_194260chr162488 144 ------
NM_194261chr162488 144 ------
NM_194278chr1442902 1081 238 185 1231 13447 --
NM_194282chr4----11230 --
NM_194285chr1112662 ------
NM_194315chr14894 885 505 469 2858 44 11011 --
NM_194457chr14894 885 505 469 2858 44 11011 --
NM_194458chr14894 885 505 469 2858 44 11011 --
NM_198040chr121108 855 ------
NM_198074chr12506 418 ------
NM_198390chr1621628 426 ------
NM_198391chr201189 ------
NM_198492chr19----126 --
NM_198527chr151449 ------
NM_198700chr111416 ------
NM_198859chr335107 3506 2055 ------
NM_198880chr31186 ------
NM_198956chr72415 269 ------
NM_198973chr11155 ------
NM_198991chr181292 ------
NM_199131chr104957 934 642 566 ------
NM_199144chr2011322 ------
NM_199169chr2053524 2298 301 57 30 ------
NM_199170chr2053524 2298 301 57 30 ------
NM_199171chr2053524 2298 301 57 30 ------
NM_199203chr2011322 ------
NM_199282chr172272 31 ------
NM_199478chrX164 ------
NM_201432chr1726318 5009 15994 ----
NM_201433chr1726318 5009 15994 ----
NM_201995chr112735 667 ------
NM_201998chr112800 732 ------
NM_203327chr2031720 1606 109 --23800 876 13709
NM_203394chr12----12227 --
NM_206907chr51725 ------
NM_207042chr11631 ------
NM_207045chr11631 ------
NM_207046chr11631 ------
NM_207111chr742325 702 530 222 --12457 --
NM_207116chr742325 702 530 222 --12457 --
NM_207291chr191103 ------
NM_207518chr1911341 ------
NM_213654chr3----1140 --