TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4484
miRNA Sequence: AAAAGGCGGGAGAAGCCCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51863 ------
NM_000016chr12655 615 ------
NM_000018chr17137 ------
NM_000024chr51136 ------
NM_000033chrX1940 ------
NM_000037chr842267 1908 1883 355 --12390 --
NM_000044chrX2162 94 1284 ----
NM_000051chr1153415 1352 1268 1030 751 32425 58 37 ----
NM_000052chrX83079 2942 2527 1252 904 587 527 391 ------
NM_000055chr3166 1323 ----
NM_000074chrX1356 ------
NM_000080chr171276 1701 ----
NM_000084chrX96588 5896 5881 5407 5295 2333 1898 450 273 ------
NM_000089chr71326 ------
NM_000090chr22862 200 ------
NM_000093chr922363 538 --31739 1531 962 --
NM_000108chr761482 1452 1321 697 313 47 11599 ----
NM_000109chrX42632 1865 1830 559 ------
NM_000112chr5105365 5066 4963 4267 4213 3555 1473 759 683 517 44906 1772 1338 959 ----
NM_000125chr664045 3778 3205 3147 1566 916 1542 ----
NM_000129chr631309 392 165 ------
NM_000133chrX1121 ------
NM_000138chr1512096 ------
NM_000141chr102980 304 ------
NM_000142chr42371 274 1564 ----
NM_000146chr191137 ------
NM_000161chr1431492 757 719 11831 ----
NM_000163chr52362 133 --1333 --
NM_000168chr742872 2703 2538 1225 22386 433 ----
NM_000176chr573952 3767 3638 2645 995 497 25 151 ----
NM_000177chr9139 ------
NM_000188chr101703 ------
NM_000189chr21101 ------
NM_000190chr112225 169 ------
NM_000194chrX1104 ------
NM_000208chr1964609 4307 2912 1524 1337 47 14511 24713 2987 --
NM_000210chr232337 1665 229 1435 1708 --
NM_000214chr2041665 1314 432 293 ------
NM_000217chr12124744 4738 4320 4299 4095 3338 3250 2120 1759 1270 765 92 11659 ----
NM_000222chr431977 1943 129 21580 590 ----
NM_000227chr181290 ------
NM_000228chr1149 --143 1285
NM_000237chr81446 21921 1819 ----
NM_000248chr33841 586 490 1527 ----
NM_000252chrX31067 281 144 1517 ----
NM_000253chr42769 211 ------
NM_000254chr13317 66 21 12182 1361 --
NM_000259chr1596233 5853 5450 4903 4870 4671 4278 4015 1315 24566 2109 ----
NM_000264chr923006 2670 13211 ----
NM_000267chr1743134 1112 372 186 --12275 --
NM_000276chrX22182 612 ------
NM_000297chr452009 590 476 313 110 ------
NM_000310chr121185 497 --11133 --
NM_000314chr1033007 2254 2080 ------
NM_000319chr1251097 938 281 121 50 11104 ----
NM_000321chr1331719 1612 348 21386 620 ----
NM_000328chrX--196 ----
NM_000329chr11896 1296 ----
NM_000332chr6136942 4754 4617 4473 2847 2767 2492 1883 1709 991 738 286 177 16861 ----
NM_000333chr3189 1236 ----
NM_000335chr341363 839 652 42 12092 ----
NM_000337chr574826 4814 4791 4468 2257 1409 43 11212 ----
NM_000345chr43961 379 217 ------
NM_000346chr1751682 1504 1360 735 572 11869 ----
NM_000353chr161142 ------
NM_000362chr2282997 2348 1373 1289 1276 858 815 776 --13419 --
NM_000368chr953967 1522 1097 900 527 24646 490 ----
NM_000391chr1151662 1493 452 291 206 ------
NM_000397chrX32415 2295 1854 ------
NM_000399chr102912 864 ------
NM_000408chr263180 2471 2439 1275 1125 108 33423 2144 208 ----
NM_000424chr12124 1359 ----
NM_000428chr1442475 2348 2147 215 ------
NM_000430chr1743422 3001 2555 417 ------
NM_000434chr6246 32 ------
NM_000447chr11197 1431 ----
NM_000448chr1153113 2661 1163 511 432 1191 ----
NM_000461chr364580 4029 3143 1571 1477 454 ------
NM_000462chr1551558 1429 728 522 369 11730 ----
NM_000480chr1131492 1353 419 ------
NM_000484chr212828 679 --1125 --
NM_000486chr1272826 2484 1190 1000 882 365 246 ------
NM_000489chrX42888 2712 2426 2405 1317 ----
NM_000503chr81146 ------
NM_000522chr711227 ------
NM_000523chr22741 60 ------
NM_000533chrX41498 1243 403 88 ------
NM_000540chr19141 ------
NM_000555chrX105893 5711 5485 4858 4821 3158 1424 1396 1186 859 34788 1508 1337 ----
NM_000558chr16188 ------
NM_000590chr5--1132 ----
NM_000599chr264602 3903 3243 3086 1408 1191 11321 ----
NM_000601chr7144 ------
NM_000615chr113970 785 144 1152 ----
NM_000617chr1211504 12274 ----
NM_000618chr1255855 5698 5673 5093 1063 35156 4437 170 ----
NM_000618chr1255855 5698 5673 5093 1063 35156 4437 170 ----
NM_000633chr1865012 4936 4486 3857 374 292 1961 ----
NM_000635chr1931670 1631 584 21564 1385 ----
NM_000637chr81470 ------
NM_000676chr17--1218 ----
NM_000679chr51153 ------
NM_000685chr33762 311 167 ------
NM_000685chr33762 311 167 ------
NM_000693chr1531426 662 607 11594 ----
NM_000701chr11238 ------
NM_000719chr1264978 2376 1764 351 111 25 ------
NM_000721chr122305 1985 12231 ----
NM_000723chr1721065 122 --1402 --
NM_000724chr102495 77 ------
NM_000726chr231490 1328 1076 ------
NM_000792chr11322 2972 82 ----
NM_000793chr1474427 3829 3555 3508 3425 1070 399 13885 ----
NM_000800chr541342 1072 660 170 11473 ----
NM_000801chr2051127 990 718 294 97 ------
NM_000806chr51504 21452 726 --1463
NM_000807chr41215 ------
NM_000809chr4109037 8494 8113 7057 6208 5742 3393 1793 1167 52 49159 8148 6605 3678 ----
NM_000810chr152495 148 ------
NM_000813chr575458 5373 4394 1662 1175 897 626 ------
NM_000814chr1533825 3025 361 11196 1694 --
NM_000816chr51633 ------
NM_000817chr221030 37 ------
NM_000824chr41802 ------
NM_000826chr442588 1656 414 193 21689 589 ----
NM_000827chr562466 2275 2145 1847 1790 626 21979 1655 ----
NM_000828chrX1172 ------
NM_000829chr1152172 589 364 88 26 ------
NM_000836chr192695 266 --1651 --
NM_000837chr81362 ------
NM_000838chr642753 1978 1754 156 ------
NM_000841chr62369 239 ------
NM_000860chr421299 277 182 ----
NM_000868chrX32500 1797 709 ------
NM_000870chr561371 1320 1277 381 254 148 ------
NM_000875chr15117037 5884 4829 4612 2823 2350 1960 1733 1455 807 203 1241 11676 11203
NM_000876chr6--1100 11229 --
NM_000883chr71275 ------
NM_000883chr71275 ------
NM_000891chr1753613 1416 1067 786 373 1904 ----
NM_000895chr121108 ------
NM_000899chr1243795 3365 1634 702 22968 1273 1809 --
NM_000901chr492535 2271 1976 1959 1698 961 695 639 29 12191 ----
NM_000908chr53580 312 187 ------
NM_000909chr451336 1120 240 148 138 ------
NM_000912chr843539 2629 1357 275 ------
NM_000917chr103911 840 385 ------
NM_000919chr5--1209 ----
NM_000921chr121490 ------
NM_000922chr112442 433 1395 ----
NM_000933chr2021521 327 11196 ----
NM_000935chr311011 --163 --
NM_000937chr172380 120 ------
NM_000938chr42134 65 ------
NM_000944chr42360 231 ------
NM_000945chr231800 1384 268 1676 ----
NM_000949chr52853 776 ------
NM_000950chrX113619 3127 3121 2847 2757 2367 2312 1005 887 487 232 23011 2239 ----
NM_000958chr531206 393 138 1904 ----
NM_000960chr191496 ------
NM_000962chr932298 825 749 12384 --11113
NM_000963chr1----1255 --
NM_000964chr17256 47 ------
NM_000966chr122855 753 ------
NM_000983chr141581 1001 462 339 ------
NM_001001132chr2141156 538 361 133 ------
NM_001001323chr1273149 2885 1258 1198 477 386 348 22537 1938 ----
NM_001001330chr103913 353 327 1898 ----
NM_001001331chr32740 56 --1826 --
NM_001001395chr1252340 2300 2188 843 811 ------
NM_001001396chr184448 3966 3878 3687 3315 1746 1581 852 11078 ----
NM_001001419chr5115177 4681 4282 4117 4043 3783 2060 1901 1070 999 797 1278 ----
NM_001001420chr5115177 4681 4282 4117 4043 3783 2060 1901 1070 999 797 1278 ----
NM_001001433chr201565 ------
NM_001001438chr211125 ------
NM_001001481chr82280 72 1201 --1567
NM_001001483chr111373 ------
NM_001001484chr1031666 831 144 ------
NM_001001549chr732139 1813 966 --12615 --
NM_001001550chr732139 1813 966 --12615 --
NM_001001555chr732139 1813 966 --12615 --
NM_001001557chr861638 1446 777 764 54 21 ------
NM_001001560chr221529 ------
NM_001001567chr211191 ------
NM_001001568chr211191 ------
NM_001001571chr211191 ------
NM_001001572chr211191 ------
NM_001001573chr211191 ------
NM_001001574chr211191 ------
NM_001001575chr211191 ------
NM_001001576chr211191 ------
NM_001001577chr211191 ------
NM_001001579chr211191 ------
NM_001001580chr211191 ------
NM_001001581chr211191 ------
NM_001001582chr211191 ------
NM_001001584chr211191 ------
NM_001001585chr211191 ------
NM_001001664chr273174 2772 2670 1310 1140 894 270 --12620 --
NM_001001669chr522454 2152 1489 ----
NM_001001701chr431847 870 329 11564 11444 --
NM_001001852chr223147 138 40 ------
NM_001001890chr2173362 3297 3207 3110 3100 2977 43 11517 ----
NM_001001924chr821322 294 11680 ----
NM_001001925chr821322 294 11680 ----
NM_001001928chr2268340 7936 5749 5389 2395 551 26621 1250 1378 --
NM_001001931chr821322 294 11680 ----
NM_001001936chr1041122 993 471 391 ------
NM_001001995chrX31259 762 546 ------
NM_001002032chr172500 29 ------
NM_001002233chr861573 823 626 602 491 74 22089 228 ----
NM_001002243chr24909 366 274 32 ------
NM_001002257chr253323 3145 2346 875 789 21360 272 ----
NM_001002259chr122320 69 ------
NM_001002264chr131100 ------
NM_001002265chr102804 719 ------
NM_001002266chr102804 719 ------
NM_001002814chr8113693 3266 3249 1573 918 904 823 626 602 491 74 1228 ----
NM_001002838chrX----1356 --
NM_001002843chr151336 1824 ----
NM_001002860chr1484390 3951 3617 3290 3057 2949 1485 213 11230 ----
NM_001002876chr22--1369 ----
NM_001002909chr1782116 1838 1648 1430 1385 836 430 328 ------
NM_001002914chr1711292 ------
NM_001002919chr2146 ------
NM_001003406chr2263060 2255 1199 1020 644 367 ------
NM_001003652chr18148490 8013 7206 6932 6896 6639 2749 2288 1829 1792 1581 1144 553 474 47122 5901 3165 2886 11549 --
NM_001003665chr133245 2766 165 11086 ----
NM_001003674chr18106840 5627 5341 4964 4947 2690 1443 818 647 133 11655 1443 --
NM_001003675chr18106840 5627 5341 4964 4947 2690 1443 818 647 133 11655 1443 --
NM_001003676chr111334 ------
NM_001003679chr132177 2124 276 21877 892 ----
NM_001003681chr2251896 780 481 409 280 1182 ----
NM_001003682chr11586 ------
NM_001003698chr641679 1632 758 223 ------
NM_001003699chr641679 1632 758 223 ------
NM_001003712chr1273020 2783 1526 1400 607 319 234 32792 1021 79 ----
NM_001003792chr341132 958 944 36 ------
NM_001003793chr341132 958 944 36 ------
NM_001003800chr953610 2722 1475 1241 1137 23532 2284 ----
NM_001003805chr14163 148 ----
NM_001003810chr41656 ------
NM_001003891chr221131 1120 ----
NM_001003940chr1543796 1244 848 210 ------
NM_001003942chr1543796 1244 848 210 ------
NM_001003943chr1543800 1248 852 214 ------
NM_001003945chr921873 318 187 ----
NM_001004065chr953304 3080 2929 2736 944 --127 --
NM_001004196chr321081 502 ------
NM_001004304chr1243270 2901 2262 2165 1772 ----
NM_001004317chr634427 4165 679 24225 318 ----
NM_001004329chr12--11498 11387 --
NM_001004342chr186021 5795 5271 5018 4676 2043 1611 341 24024 528 ----
NM_001004346chr41987 11197 ----
NM_001004360chr232007 1889 1768 ------
NM_001004439chr1521236 841 ------
NM_001004441chr531411 1372 1071 11475 ----
NM_001004720chr22996 663 ------
NM_001004722chr221165 832 ------
NM_001005242chr1241547 664 231 94 21419 1283 ----
NM_001005266chr15165 ------
NM_001005267chr15165 ------
NM_001005268chr15165 ------
NM_001005269chr15165 ------
NM_001005353chr12885 182 ------
NM_001005353chr12885 182 ------
NM_001005360chr191577 ------
NM_001005361chr191577 ------
NM_001005362chr191577 ------
NM_001005366chr125760 749 649 247 23 172 ----
NM_001005372chr17150 ------
NM_001005375chrY41852 1740 1202 56 21610 1510 ----
NM_001005386chr221785 473 3389 351 328 ----
NM_001005404chr1743975 2797 1748 1685 ------
NM_001005463chr1031694 658 308 ------
NM_001005473chr596493 5560 5414 4941 4734 4651 4223 2333 276 24960 1728 ----
NM_001005474chr341057 279 261 82 ------
NM_001005502chr1274757 4293 4270 3439 2042 975 572 --13430 --
NM_001005505chr331390 150 83 --153 --
NM_001005609chrX63845 3732 3610 1259 1125 501 ------
NM_001005741chr11390 ------
NM_001005742chr11390 ------
NM_001005746chr231490 1328 1076 ------
NM_001005747chr231490 1328 1076 ------
NM_001005781chr21485 ------
NM_001005782chr21934 ------
NM_001005849chr171578 1511 ----
NM_001005861chr33721 360 127 ------
NM_001005910chr32648 428 ------
NM_001005911chr32648 428 ------
NM_001006600chr52662 479 1390 ----
NM_001006610chr1621009 851 ------
NM_001006612chrX2185 49 ------
NM_001006613chrX2185 49 ------
NM_001006614chrX2185 49 ------
NM_001006623chr262498 2464 539 514 484 431 2870 161 ----
NM_001006665chr14803 752 290 163 ------
NM_001006944chr111695 ------
NM_001006946chr241438 1382 1292 1192 --11389 --
NM_001007023chr1474427 3829 3555 3508 3425 1070 399 13885 ----
NM_001007024chr1783580 3385 3266 1512 731 386 248 37 14308 ----
NM_001007025chr1783580 3385 3266 1512 731 386 248 37 14308 ----
NM_001007075chr43905 841 36 ------
NM_001007097chr963817 3631 1774 974 908 341 ------
NM_001007098chr13825 211 133 1654 ----
NM_001007099chr11319 ------
NM_001007100chr11319 ------
NM_001007102chr6--1183 11319 --
NM_001007226chr1721135 1116 21378 99 ----
NM_001007227chr1721135 1116 21378 99 ----
NM_001007228chr1721135 1116 21378 99 ----
NM_001007229chr1721135 1116 21378 99 ----
NM_001007230chr1721135 1116 21378 99 ----
NM_001007237chr142377 2089 1932 585 1841 ----
NM_001007246chr2121927 1191 ------
NM_001007257chr11463 ------
NM_001007267chr21174 ------
NM_001007466chr665025 3949 1132 425 134 55 25131 515 ----
NM_001007527chr53676 548 229 ------
NM_001007553chr12411 234 ------
NM_001007565chr31332 ------
NM_001008222chrX1166 1124 ----
NM_001008225chr7--2184 88 ----
NM_001008239chr1873735 3502 3183 3133 2911 563 297 23020 2371 2915 798 --
NM_001008392chr33472 404 232 13230 ----
NM_001008407chr721826 1389 11718 ----
NM_001008408chr7105805 5277 5169 5082 4818 4697 4026 2317 1161 1067 24925 4715 --14112
NM_001008410chr232235 1755 844 ------
NM_001008495chr81436 2849 323 ----
NM_001008529chr1731323 1132 94 ------
NM_001008530chr143451 187 23 1334 ----
NM_001008541chr101605 11866 ----
NM_001008541chr101605 11866 ----
NM_001008564chr1342228 1877 1578 414 ------
NM_001008660chr1121601 239 ------
NM_001008701chr1952875 2836 2689 2153 1117 ------
NM_001008707chr141329 11775 ----
NM_001008726chr1411195 1376 ----
NM_001008800chr1----188 --
NM_001008883chr1----188 --
NM_001008938chr112457 331 ------
NM_001009184chr81362 ------
NM_001009185chr51125 2527 146 ----
NM_001009552chr8249 23 ------
NM_001009555chr421420 689 21656 1314 ----
NM_001009565chr23438 426 45 ------
NM_001009894chr1221547 1221 ------
NM_001009899chr3105383 5047 4992 4608 4505 4267 4256 1862 1831 1166 25257 546 ----
NM_001009958chr72461 234 ------
NM_001009959chr252657 2362 2236 495 81 21635 658 ----
NM_001009960chr742828 2273 1118 552 ------
NM_001010000chr1863452 3214 2814 2435 1283 990 ------
NM_001010853chr643241 2991 816 507 12396 ----
NM_001010861chr13870 638 191 ------
NM_001010862chrX33300 827 396 ------
NM_001010867chr176316 6103 4162 2630 2452 1744 53 22340 2240 26483 4349 --
NM_001010888chrX84235 4100 3678 3610 3477 3263 154 98 12901 ----
NM_001010891chr5126284 6259 6110 4985 765 742 663 546 438 424 293 271 36472 1412 1066 ----
NM_001010898chr163335 2816 2808 2560 2285 999 ------
NM_001010908chr101504 1665 ----
NM_001010924chr10----1781 --
NM_001010932chr7144 ------
NM_001010971chr12978 357 ------
NM_001010984chr161962 1753 1713 996 760 747 ------
NM_001010986chrX52494 2172 1639 931 833 1158 ----
NM_001010989chr162492 131 1210 ----
NM_001010990chr162492 131 1210 ----
NM_001011513chr484053 3996 2757 2533 2509 983 838 393 --13327 --
NM_001011515chr43953 786 94 11040 ----
NM_001011516chr43953 786 94 11040 ----
NM_001011537chr332055 1693 455 21843 595 ----
NM_001011553chr71170 ------
NM_001011645chrX2162 94 1284 ----
NM_001011666chr7116441 6051 5207 4751 4690 4503 812 488 230 221 155 34654 1926 355 ----
NM_001011713chr1431548 1158 652 1374 ----
NM_001011720chr831517 1470 582 ------
NM_001011885chr1541655 1139 497 449 ------
NM_001012264chr141666 ------
NM_001012267chr921413 698 ------
NM_001012393chr1124191 3684 34509 1340 158 1528 --
NM_001012410chr31362 ------
NM_001012426chr663144 3095 3063 2146 1043 464 12538 ----
NM_001012427chr663144 3095 3063 2146 1043 464 12538 ----
NM_001012732chr4264 43 ------
NM_001012751chr1031651 1526 1216 ------
NM_001012754chr1342003 1663 766 492 2828 759 ----
NM_001012755chrX34729 4652 1775 34099 3629 249 ----
NM_001012761chr542613 1928 1870 874 22537 445 ----
NM_001012968chrX72776 2662 2195 887 508 458 197 1714 1654 --
NM_001012977chrX31427 520 469 ------
NM_001012979chrX2166 56 ------
NM_001012989chrX--1258 ----
NM_001013031chr1073322 3032 2983 2221 1100 1081 1063 13282 ----
NM_001013399chr62313 266 ------
NM_001013415chr41542 ------
NM_001013437chr182381 67 ------
NM_001013438chr31368 1250 ----
NM_001013439chr31214 196 ----
NM_001013620chr12128426 8012 7041 6918 6807 5704 5312 2836 1657 1056 1029 1017 18335 ----
NM_001013635chr123904 342 38 --11041 --
NM_001013642chr14997 912 277 218 ------
NM_001013693chr152142 2112 903 616 232 ------
NM_001013693chr152142 2112 903 616 232 ------
NM_001013699chr121412 ------
NM_001013746chr7--8904 666 582 498 418 334 166 81 ----
NM_001013843chr152921 141 ------
NM_001014283chr1332114 1468 235 ------
NM_001014434chr11249 ------
NM_001014442chr132106 26 ------
NM_001014443chr1192 ------
NM_001014797chr10107510 7318 7153 2874 2839 2116 1497 1328 828 286 11075 17767 --
NM_001014839chr11133 ------
NM_001014841chr11133 ------
NM_001015045chr42546 162 21973 1630 ----
NM_001015508chr83647 518 240 ------
NM_001015877chrX92893 2550 2410 2193 1091 1007 900 628 543 --12446 --
NM_001015880chr1021603 1160 21550 1501 ----
NM_001015881chrX2883 813 ------
NM_001015885chr201347 ------
NM_001015887chr321462 1371 1402 1585 --
NM_001017368chr1732562 1963 28 32748 2305 1118 ----
NM_001017371chr221021 146 ------
NM_001017395chr343279 1069 887 396 11250 11022 --
NM_001017396chr251437 1374 1342 827 808 1452 ----
NM_001017402chr1149 --143 1285
NM_001017405chr42681 62 ------
NM_001017415chr13518 307 294 ------
NM_001017416chr13518 307 294 ------
NM_001017424chr14564 479 451 246 ------
NM_001017425chr14564 479 451 246 ------
NM_001017523chr1241430 1318 720 303 ------
NM_001017916chr1751846 1599 1547 469 63 ------
NM_001017917chr1751846 1599 1547 469 63 ------
NM_001017920chr21117 ------
NM_001017922chr131720 1067 423 ------
NM_001017923chr142305 257 164 ----
NM_001017926chr851665 1504 1440 1148 709 11782 ----
NM_001017962chr103911 840 385 ------
NM_001018008chr151483 1212 ----
NM_001018037chr921460 1323 ----11012
NM_001018050chr2252776 2661 2572 2533 1151 ------
NM_001018052chr2252776 2661 2572 2533 1151 ------
NM_001018053chr161969 1564 1451 1432 1327 555 11744 ----
NM_001018064chr93441 425 281 1627 ----
NM_001018065chr985471 5053 5034 4991 3817 1476 1405 167 24475 308 ----
NM_001018066chr985471 5053 5034 4991 3817 1476 1405 167 24475 308 ----
NM_001018072chr1241430 1318 720 303 ------
NM_001018074chr573952 3767 3638 2645 995 497 25 151 ----
NM_001018075chr573952 3767 3638 2645 995 497 25 151 ----
NM_001018076chr573952 3767 3638 2645 995 497 25 151 ----
NM_001018077chr573952 3767 3638 2645 995 497 25 151 ----
NM_001018078chr94444 176 158 77 ------
NM_001018090chr1562548 2485 751 359 316 149 11092 ----
NM_001018091chr1562658 2595 861 469 426 259 ------
NM_001018100chr151630 ------
NM_001018102chr1562548 2485 751 359 316 149 11092 ----
NM_001018108chr1521419 902 21490 417 ----
NM_001018111chr743845 3765 2450 429 13674 ----
NM_001018676chr81125 133 ----
NM_001018677chr81125 133 ----
NM_001020658chr12643 169 ------
NM_001020658chr12643 169 ------
NM_001020818chr1921497 688 --190 --
NM_001020819chr1921497 688 --190 --
NM_001020820chr1921497 688 --190 --
NM_001020821chr1921497 688 --190 --
NM_001020825chr541427 1242 1113 120 ------
NM_001023567chr1532366 572 356 ------
NM_001023587chr32866 820 ------
NM_001024094chr573952 3767 3638 2645 995 497 25 151 ----
NM_001024218chr141667 1282 ----
NM_001024226chr12235 163 ------
NM_001024227chr12235 163 ------
NM_001024228chr12235 163 ------
NM_001024372chr81730 11824 ----
NM_001024382chr112225 169 ------
NM_001024401chr1611903 ------
NM_001024463chr1511092 ------
NM_001024649chr552873 2457 2288 1975 703 1321 12019 --
NM_001024660chr321093 195 ------
NM_001024666chrX3675 645 248 ------
NM_001024668chr124887 790 699 331 1291 ----
NM_001024808chr122424 409 --1369 --
NM_001024809chr17256 47 ------
NM_001024847chr332457 579 190 ------
NM_001024855chr321334 161 --1335 --
NM_001024934chr61529 ------
NM_001024935chr61529 ------
NM_001024936chr61529 ------
NM_001024937chr17195 1102 ----
NM_001024947chr51751 ------
NM_001024948chr172922 2501 2435 2168 1348 275 223 ----1946
NM_001024956chr11125769 4734 4316 3792 2215 1718 1681 1560 1485 1452 589 344 35124 2046 1368 ----
NM_001024959chr33705 304 257 ------
NM_001024960chr33705 304 257 ------
NM_001025068chr361692 1591 1462 1133 653 486 1508 ----
NM_001025069chr361692 1591 1462 1133 653 486 1508 ----
NM_001025070chr5140 ------
NM_001025071chr5140 ------
NM_001025076chr1095672 5471 4673 4243 4208 3795 2018 1791 140 ------
NM_001025077chr10107030 6829 6031 5601 5566 5153 4951 1498 1007 307 --1548 --
NM_001025079chr333739 2691 302 34156 3445 1364 11470 --
NM_001025201chr21189 1710 ----
NM_001025205chr31110 ------
NM_001025232chr123347 254 141 ------
NM_001025252chr833201 3153 2874 1104 ----
NM_001025253chr833201 3153 2874 1104 ----
NM_001025266chr384918 4375 4274 3494 3435 260 164 45 1910 ----
NM_001025356chr1252888 2742 1083 987 593 ------
NM_001025366chr6----11798 --
NM_001025366chr6----11798 --
NM_001025367chr6----11798 --
NM_001025367chr6----11798 --
NM_001025368chr6----11798 --
NM_001025368chr6----11798 --
NM_001025369chr6----11814 --
NM_001025369chr6----11814 --
NM_001025370chr6----11798 --
NM_001025370chr6----11798 --
NM_001025389chr1131492 1353 419 ------
NM_001025390chr1131492 1353 419 ------
NM_001025579chr17--11079 ----
NM_001025580chrX53477 2627 1519 872 326 12783 --1455
NM_001025595chr421481 1468 1646 ----
NM_001025780chr931371 311 107 ------
NM_001029858chr652982 1063 772 696 658 ------
NM_001029863chr632624 2037 1134 1838 ----
NM_001029875chr532674 2407 716 1416 ----
NM_001029884chr632512 1077 950 --12218 --
NM_001030006chr1742432 587 526 286 ------
NM_001030007chr1693997 3655 2440 1381 1353 1281 698 583 529 12930 ----
NM_001030055chr1474126 3935 3764 3068 1219 1150 373 ------
NM_001030272chr11--2316 101 ----
NM_001030273chr11--2316 101 ----
NM_001031679chr1263454 2944 2825 2493 553 429 1639 11231 --
NM_001031681chr171458 ------
NM_001031690chr752566 990 432 374 24 ------
NM_001031692chr7--1309 ----
NM_001031695chr2285422 4879 4345 3569 2182 1599 594 503 45384 5322 1230 206 ----
NM_001031702chr32118 34 1346 ----
NM_001031723chr41371 ------
NM_001031732chr463229 2796 2566 1283 886 853 11298 ----
NM_001031738chr21383 ------
NM_001031804chr1642854 2734 1719 1432 13717 ----
NM_001031812chr522177 2129 11440 1675 --
NM_001032279chr111382 ------
NM_001032280chr621681 1371 21405 1151 ----
NM_001032282chr81505 1235 ----
NM_001032288chr2051583 1209 1087 376 93 11094 11327 --
NM_001032293chr171592 ------
NM_001032296chr1352721 2466 2358 1996 567 2574 293 ----
NM_001032367chr151445 ------
NM_001032380chr1021488 85 11979 ----
NM_001032393chrX2571 493 ------
NM_001033044chr121268 229 ------
NM_001033045chr223937 1552 13763 ----
NM_001033047chr442404 2080 242 159 1956 ----
NM_001033056chr121268 229 ------
NM_001033057chr311581 ------
NM_001033087chr2073262 3008 2690 2307 1015 998 265 ------
NM_001033088chr151324 ------
NM_001033112chr52721 300 ------
NM_001033117chr3104051 3910 3808 3653 3544 3427 3291 1589 1419 1198 23869 3299 13587 --
NM_001033503chr51455 ------
NM_001033506chr112388 158 ------
NM_001033518chr741958 1004 289 222 1196 ----
NM_001033519chr741958 1004 289 222 1196 ----
NM_001033520chr741958 1004 289 222 1196 ----
NM_001033602chr132830 635 --1569 --
NM_001033756chr6----11732 --
NM_001033756chr6----11732 --
NM_001033859chr17137 ------
NM_001033925chr1031616 522 175 1764 ----
NM_001034841chr1665219 5201 4836 3529 1859 44 33938 460 301 ----
NM_001034850chr521546 1471 ------
NM_001034954chr1032594 2451 261 22213 793 --12414
NM_001034955chr1032594 2451 261 22213 793 --12414
NM_001034956chr1032594 2451 261 22213 793 --12414
NM_001034957chr1032594 2451 261 22213 793 --12414
NM_001035chr11468 ------
NM_001035003chr411279 ------
NM_001035004chr411279 ------
NM_001035254chr932570 670 440 12403 ----
NM_001035260chr101322 ------
NM_001035511chr141750 1729 478 206 ------
NM_001035512chr141857 1836 585 313 ------
NM_001035513chr141857 1836 585 313 ------
NM_001037131chr211294 ------
NM_001037132chr751952 1514 839 514 464 ------
NM_001037133chr751952 1514 839 514 464 ------
NM_001037164chr73544 363 155 21680 1289 ----
NM_001037317chr13870 638 191 ------
NM_001037332chr53963 881 248 11012 ----
NM_001037333chr53963 881 248 11012 ----
NM_001037334chr1892269 2213 1875 784 770 559 431 323 284 ------
NM_001037339chr141182 404 195 116 21300 430 ----
NM_001037340chr141182 404 195 116 21300 430 ----
NM_001037341chr141182 404 195 116 21300 430 ----
NM_001037341chr141182 404 195 116 21300 430 ----
NM_001037631chr21454 1864 ----
NM_001037637chr5172 ------
NM_001037872chr21637 ------
NM_001037954chr1122152 456 12141 ----
NM_001038640chr153693 640 253 ------
NM_001038702chr572782 2590 1904 1066 961 297 136 12512 ----
NM_001038707chr112206 12231 ----
NM_001038707chr112206 12231 ----
NM_001039140chr203386 148 49 ------
NM_001039459chr72740 82 ------
NM_001039465chr144371 201 99 29 ------
NM_001039479chr1462286 2087 2001 1533 806 684 1162 22296 1824 --
NM_001039490chr111146 ------
NM_001039538chr242730 2625 2592 1352 ------
NM_001039547chr387789 6189 5846 5003 2556 866 815 613 65819 5129 3102 1830 946 141 1976 --
NM_001039550chr22359 52 ------
NM_001039570chr2244282 4102 4060 3367 24361 1112 ----
NM_001039571chr2244282 4102 4060 3367 24361 1112 ----
NM_001039573chr17--1487 ----
NM_001039577chr141709 1683 1331 32 ------
NM_001039580chr444066 3559 578 559 1922 ----
NM_001039590chrX73972 3544 3510 3235 3056 2811 597 1751 ----
NM_001039591chrX73972 3544 3510 3235 3056 2811 597 1751 ----
NM_001039618chr1175845 5767 5041 4035 1927 1649 793 25716 4240 ----
NM_001039690chr162849 648 ------
NM_001039711chr12302 107 ------
NM_001039712chr12302 107 ------
NM_001039715chr11322 2972 82 ----
NM_001039716chr11386 21036 146 ----
NM_001039762chr1031521 571 146 1727 --135
NM_001039775chr1136 ------
NM_001039840chrX105330 4959 4172 3888 1543 953 415 320 177 55 51984 1474 464 449 426 ----
NM_001039877chr191177 1321 ----
NM_001039916chr1211066 ------
NM_001039917chr1211066 ------
NM_001039918chr1211066 ------
NM_001039919chr1211066 ------
NM_001039920chr1211066 ------
NM_001039937chr1362636 2541 1372 1233 693 611 1951 ----
NM_001039960chr1211066 ------
NM_001040001chr631873 1437 1428 ------
NM_001040057chr731192 973 536 1486 ----
NM_001040110chr731858 1538 1361 ------
NM_001040113chr162876 813 ------
NM_001040142chr272240 2006 1922 1899 1817 1728 1586 --12215 --
NM_001040143chr272240 2006 1922 1899 1817 1728 1586 --12215 --
NM_001040144chr162849 648 ------
NM_001040146chr162849 648 ------
NM_001040152chr711734 35000 4583 3220 1416 --
NM_001040153chr131692 ------
NM_001040172chr561371 1320 1277 381 254 148 ------
NM_001040173chr561371 1320 1277 381 254 148 ------
NM_001040214chr622260 561 1958 --11828
NM_001040260chr441144 790 386 191 ------
NM_001040261chr441144 790 386 191 ------
NM_001040284chr16125868 5415 5322 5079 4120 3943 1930 1269 1242 1208 943 894 35392 4387 1623 14664 --
NM_001040402chr473009 2825 2529 2326 1242 1043 972 ------
NM_001040409chr23912 745 116 --1315 --
NM_001040429chr1343585 3123 2294 1159 53133 2896 2843 1386 123 --12871
NM_001040437chr6--164 ----
NM_001040438chr6--164 ----
NM_001040441chr123329 493 ------
NM_001040633chr71358 ------
NM_001040665chr764955 4808 4594 4209 1855 1424 44738 4263 3065 357 ----
NM_001040666chr73657 510 296 ------
NM_001040709chr12536 115 ------
NM_001040712chr933512 2709 2461 13359 ----
NM_001040875chr822329 2282 11886 ----
NM_001040876chr431438 1295 496 1605 ----
NM_001042355chr1674830 4257 1603 1190 419 159 106 24012 754 ----
NM_001042388chr182989 23 1810 ----
NM_001042404chr111894 11378 2692 238 --
NM_001042412chr1674830 4257 1603 1190 419 159 106 24012 754 ----
NM_001042424chr463287 2739 2222 827 393 367 ------
NM_001042425chr621681 1371 21405 1151 ----
NM_001042453chrX61126 502 403 375 348 98 1259 ----
NM_001042473chr1031902 344 109 21765 1604 ----
NM_001042481chr1452694 2314 1776 317 258 11856 ----
NM_001042486chr202318 159 ------
NM_001042492chr1743134 1112 372 186 --12275 --
NM_001042494chr1553348 3262 2762 2389 235 13018 23282 925 --
NM_001042495chr1553348 3262 2762 2389 235 13018 23282 925 --
NM_001042496chr1553348 3262 2762 2389 235 13018 23282 925 --
NM_001042497chr1553348 3262 2762 2389 235 13018 23282 925 --
NM_001042498chrX3981 292 121 ------
NM_001042506chrX51388 1061 579 520 469 ------
NM_001042510chr83544 371 80 ------
NM_001042511chr83544 371 80 ------
NM_001042517chr132678 159 182 ----
NM_001042533chr343055 2570 2202 1268 ------
NM_001042537chrX31964 673 467 ------
NM_001042543chr411388 ------
NM_001042555chr1264625 4390 4244 888 559 484 44367 1783 1754 337 ----
NM_001042599chr257822 7686 7158 6344 5138 27316 6292 ----
NM_001042601chr333175 836 314 22882 532 ----
NM_001042603chr12104656 4236 3707 3554 1405 1302 968 962 881 343 23874 1687 ----
NM_001042604chr384392 4134 4032 3999 3329 3041 1444 855 23625 553 ----
NM_001042632chr2022235 182 ------
NM_001042633chr2022235 182 ------
NM_001042681chr162362 2245 1889 1035 560 525 ------
NM_001042682chr162362 2245 1889 1035 560 525 ------
NM_001042682chr162362 2245 1889 1035 560 525 ------
NM_001042723chr19141 ------
NM_001042728chr122855 753 ------
NM_001042749chrX31409 282 260 ------
NM_001042750chrX31409 282 260 ------
NM_001042751chrX31409 282 260 ------
NM_001043318chr1484051 3917 3399 3180 1621 1327 1246 790 12919 13622 --
NM_001043351chr142068 1807 453 150 1258 ----
NM_001044305chr611607 ------
NM_001044385chr21448 13874 12676 --
NM_001044722chr522177 2129 11440 1675 --
NM_001044723chr522177 2129 11440 1675 --
NM_001046chr552965 2463 1179 403 336 1321 ----
NM_001065chr122147 49 ------
NM_001068chr31288 ------
NM_001070chr17131 ------
NM_001071775chr1311483 11207 ----
NM_001077628chr12261 206 ------
NM_001083620chr442586 1655 413 193 21688 588 ----
NM_001083621chr152921 1765 1051 963 729 34734 3226 1384 ----
NM_001092chr175832 657 541 388 333 --2635 153 --
NM_001094chr171769 1721 ----
NM_001099678chr386434 5699 5115 4332 2351 2252 1847 692 14569 ----
NM_001105518chr12897 802 ------
NM_001106chr3198428 7868 7269 7255 7208 7034 6740 6329 6164 3770 3074 2798 2444 2337 2061 1717 1548 564 337 ------
NM_001109977chr42577 174 ------
NM_001113490chrX32966 2876 2583 144 13549 --
NM_001117chr1812066 --12077 --
NM_001121chr1011711 ------
NM_001122631chr111561 --1171 --
NM_001122679chr51863 ------
NM_001128chr1693997 3655 2440 1381 1353 1281 698 583 529 12930 ----
NM_001131chr63336 212 69 ------
NM_001135chr151279 --195 --
NM_001148chr411692 ------
NM_001149chr1021067 415 ------
NM_001157chr102655 200 ------
NM_001160chr1262795 2056 1725 816 404 164 ------
NM_001167chrX64601 2456 2101 1938 1436 824 ------
NM_001172chr141102 ------
NM_001173chr1474126 3935 3764 3068 1219 1150 373 ------
NM_001174chrX21544 308 11672 ----
NM_001178chr11--2316 101 ----
NM_001186chr2132520 2352 58 11274 ----
NM_001191chr201403 ------
NM_001198chr622341 2064 ------
NM_001200chr2011079 ------
NM_001201chr463747 3372 1363 1190 1101 423 43724 1529 948 878 ----
NM_001204chr267492 7345 7289 7116 7070 4726 16572 ----
NM_001206chr962444 2369 2284 2136 1098 270 21051 598 ----
NM_001207chr5172 ------
NM_001233chr72171 156 ------
NM_001238chr191465 188 ----
NM_001241chr22834 458 1276 ----
NM_001241chr22834 458 1276 ----
NM_001254chr1721010 930 ------
NM_001256chr1742945 2179 1996 372 180 ----
NM_001257chr1631440 1367 1265 ------
NM_001259chr7135497 4976 4749 4707 2462 2292 2200 1949 1653 1596 1539 1096 826 31459 1441 894 ----
NM_001260chr131342 ------
NM_001262chr12336 259 ------
NM_001264chr62773 30 ------
NM_001265chr131220 ------
NM_001268chr136828 776 748 413 150 30 ------
NM_001270chr5172 --122 --
NM_001271chr1542732 2040 694 161 ------
NM_001278chr101290 11185 ----
NM_001280chr191446 ------
NM_001282chr1742432 587 526 286 ------
NM_001283chr72603 274 3671 487 263 ----
NM_001290chr41434 ------
NM_001293chr112450 92 ------
NM_001300chr101142 ------
NM_001304chr1763711 3687 3585 3252 2434 1343 11185 ----
NM_001310chr121982 1470 --12035
NM_001315chr672059 1694 1423 610 369 174 52 ------
NM_001316chr20------1403
NM_001319chr1921105 876 ------
NM_001326chr112410 80 ------
NM_001329chr102286 94 ------
NM_001331chr1161935 1784 1119 1079 316 145 12094 ----
NM_001332chr531368 476 396 ------
NM_001338chr212789 290 ------
NM_001343chr53318 167 131 11077 ----
NM_001351chr361831 1713 1483 1171 1158 1144 ------
NM_001356chrX1517 31956 660 317 ----
NM_001358chr41116 1103 ----
NM_001364chr1183809 2931 2896 1672 1584 1439 1040 346 181 ----
NM_001365chr173759 618 555 ------
NM_001386chr881910 1800 1730 1709 791 471 396 320 ------
NM_001389chr211172 ------
NM_001390chr1833089 1304 1151 23167 1028 ----
NM_001391chr182281 46 ------
NM_001396chr2182666 1751 1128 1109 956 902 818 287 ------
NM_001397chr122305 1966 11762 ----
NM_001399chrX63845 3732 3610 1259 1125 501 ------
NM_001400chr11920 ------
NM_001401chr921367 577 1475 ----
NM_001402chr611660 11798 ----
NM_001407chr34640 491 417 268 11611 ----
NM_001408chr141492 1468 1327 1164 ------
NM_001412chrX63414 3142 2947 953 335 285 ------
NM_001417chr123680 233 21 31631 1388 173 ----
NM_001418chr111548 ------
NM_001418chr111548 ------
NM_001419chr19104409 4346 4027 3508 3185 3162 1144 1101 990 111 11381 ----
NM_001420chr191260 ------
NM_001422chr1131057 1043 42 ------
NM_001424chr161630 ----1677
NM_001426chr21470 ------
NM_001427chr741908 1759 1464 1381 ------
NM_001429chr222310 230 ------
NM_001430chr22640 157 ------
NM_001431chr611142 1319 ----
NM_001432chr433269 3242 849 11168 ----
NM_001438chr133644 798 334 ------
NM_001448chrX51427 1154 521 353 85 ------
NM_001451chr1611275 11339 1518 --
NM_001453chr661301 605 461 379 335 229 ------
NM_001454chr173894 621 263 ------
NM_001457chr351169 1093 1035 138 44 ------
NM_001458chr72643 128 ------
NM_001460chr143260 2384 393 168 ------
NM_001465chr541883 1343 492 248 1823 ----
NM_001489chr92231 40 ------
NM_001493chrX2684 587 ------
NM_001494chr102230 89 ------
NM_001497chr952516 2095 1902 541 222 22769 1852 11694 --
NM_001511chr42607 587 ------
NM_001514chr12431 83 ------
NM_001518chr731151 923 48 ------
NM_001542chr142377 2089 1932 585 1841 ----
NM_001543chr553748 3636 3020 1936 659 14599 ----
NM_001552chr1711092 ------
NM_001554chr11549 ------
NM_001560chrX32669 1631 185 1143 ----
NM_001564chr4137 ------
NM_001587chrX22182 612 ------
NM_001609chr1043683 1775 154 81 ------
NM_001614chr171497 ------
NM_001614chr171497 ------
NM_001616chr233349 2578 2566 11386 ----
NM_001621chr772964 2828 2577 1037 836 804 496 31081 462 159 ----
NM_001621chr772964 2828 2577 1037 836 804 496 31081 462 159 ----
NM_001642chr1121138 1093 1432 ----
NM_001650chr1883609 3468 3333 3014 2975 2546 1338 1013 1871 ----
NM_001654chrX3455 332 149 ------
NM_001655chr1131879 1551 1356 11647 ----
NM_001656chr521884 428 ------
NM_001658chr12235 163 ------
NM_001660chr32682 661 ------
NM_001663chr142523 393 11791 ----
NM_001665chr115145 129 82 62 54 ------
NM_001668chr162264 1786 1734 857 643 346 22058 211 1735 --
NM_001677chr12717 317 1866 ----
NM_001678chr1731203 632 267 11486 1189 --
NM_001679chr3--1767 ----
NM_001682chr1272863 2599 972 912 191 100 62 12251 ----
NM_001683chr32740 56 --1826 --
NM_001684chr184165 3683 3595 3404 3032 1463 1298 569 1795 ----
NM_001693chr841042 955 928 803 ------
NM_001695chr823428 1356 53861 3689 1264 987 939 ----
NM_001699chr193524 329 93 ------
NM_001706chr31836 ------
NM_001707chr71222 ------
NM_001709chr1152652 2198 2180 1795 819 1460 ----
NM_001711chrX31075 774 285 ------
NM_001717chr1531377 222 36 ------
NM_001718chr651100 1011 128 60 36 ------
NM_001731chr121772 ------
NM_001742chr711393 ------
NM_001743chr22507 53 ------
NM_001746chr552873 2457 2288 1975 703 1321 12019 --
NM_001748chr12931 923 ------
NM_001753chr771431 1399 714 661 583 561 263 ------
NM_001754chr2173362 3297 3207 3110 3100 2977 43 11517 ----
NM_001755chr1632256 2237 773 --11832 --
NM_001759chr12105203 4768 4734 4525 3815 3466 3273 1597 1530 841 14602 12039 13498
NM_001760chr62914 371 --1240 --
NM_001769chr121167 1346 ----
NM_001773chr111287 ------
NM_001777chr333739 2691 302 34156 3445 1364 11470 --
NM_001788chr71170 ------
NM_001789chr32410 131 1566 ----
NM_001792chr181245 21079 403 1382 --
NM_001806chr1922795 2714 12261 ----
NM_001822chr21189 1710 ----
NM_001826chr1186 ------
NM_001839chr12181 132 ------
NM_001843chr121238 ------
NM_001845chr1341235 545 331 124 11313 ----
NM_001854chr12573 145 ------
NM_001858chr673499 3346 1463 1249 869 370 94 24922 1926 ----
NM_001859chr953886 850 818 319 261 ------
NM_001873chr4164 ------
NM_001874chr1274757 4293 4270 3439 2042 975 572 --13430 --
NM_001880chr21209 ------
NM_001894chr2211132 ------
NM_001901chr61674 1921 ----
NM_001903chr52732 615 1182 ----
NM_001904chr341007 828 303 246 ------
NM_001914chr182328 101 1415 ----
NM_001915chr1751846 1599 1547 469 63 ------
NM_001918chr189241 9025 8482 6888 6638 6530 6410 851 38834 7510 7337 ----
NM_001920chr121307 ------
NM_001921chr4264 43 ------
NM_001923chr113607 100 80 ------
NM_001932chr175749 649 620 359 303 ------
NM_001935chr211025 1739 ----
NM_001938chr121716 485 ------
NM_001939chrX43402 1473 322 59 ------
NM_001946chr122809 757 1751 ----
NM_001949chr632086 445 424 13153 ----
NM_001951chr81499 ------
NM_001964chr541164 791 775 767 ------
NM_001967chr3--2422 386 ----
NM_001968chr41965 --1155 --
NM_001969chr1473495 3157 2618 1019 990 886 697 13675 ----
NM_001977chr41583 2150 114 ----
NM_001980chr1252230 878 392 362 161 21746 674 ----
NM_001981chr13863 315 263 --1173 --
NM_001982chr122359 66 2147 52 ----
NM_001987chr1264269 3570 3533 1707 1566 681 1573 ----
NM_001995chr431225 969 174 ------
NM_001999chr52508 314 ------
NM_002006chr495791 4416 4034 3596 3578 1500 1396 1032 975 1287 ----
NM_002009chr1532769 2541 888 32583 1013 856 ----
NM_002010chr13----1384 --
NM_002015chr1333300 669 82 ------
NM_002023chr131263 531 70 11644 ----
NM_002024chrX21500 550 31928 1831 220 ----
NM_002025chrX108959 7609 6965 6757 6728 6249 3216 2887 1786 825 11560 ----
NM_002027chr81125 133 ----
NM_002028chr142943 910 ------
NM_002031chr61610 ------
NM_002036chr1144 ------
NM_002040chr2142215 1969 1254 32 12851 ----
NM_002041chr15196 ------
NM_002049chrX1119 ------
NM_002063chrX21124 349 172 ----
NM_002065chr121268 229 ------
NM_002067chr191243 --1271 --
NM_002069chr731684 1473 634 ------
NM_002072chr931014 933 783 ------
NM_002074chr1----1246 --
NM_002077chr941670 1515 688 498 1472 ----
NM_002083chr14171 ------
NM_002084chr53850 662 268 ------
NM_002086chr1752031 1911 528 481 262 ------
NM_002087chr171241 ------
NM_002088chr191136 ------
NM_002092chr473927 1155 937 890 739 636 267 1621 ----
NM_002094chr16170 ------
NM_002095chr81256 ------
NM_002103chr1941015 720 711 200 1347 ----
NM_002106chr41107 ------
NM_002114chr63437 196 25 ------
NM_002126chr1793260 3148 2737 2700 1260 956 944 813 578 33983 1618 282 1250 --
NM_002128chr1362344 1007 596 527 520 134 1170 ----
NM_002129chr41393 ------
NM_002135chr123376 362 177 160 ----
NM_002137chr742003 294 266 245 11764 ----
NM_002138chr41656 ------
NM_002139chrX2565 205 ------
NM_002141chr72600 43 ------
NM_002146chr171917 1172 ----
NM_002147chr173872 303 120 --1900 --
NM_002148chr22606 597 ------
NM_002163chr161112 1413 ----
NM_002190chr63893 837 345 1533 ----
NM_002193chr221719 401 21453 525 ----
NM_002196chr203903 329 36 ------
NM_002196chr203903 329 36 ------
NM_002198chr55844 757 686 664 287 ------
NM_002199chr41781 1964 ----
NM_002202chr531025 991 418 ------
NM_002204chr1711353 ------
NM_002207chr3152 ------
NM_002211chr102940 242 11103 ----
NM_002214chr753685 3520 1748 1153 566 25239 657 ----
NM_002222chr31233 ------
NM_002223chr1261443 1087 900 646 607 30 11362 ----
NM_002224chr62761 248 ------
NM_002226chr141804 ------
NM_002227chr11382 11109 ----
NM_002230chr1751072 441 178 164 40 ------
NM_002233chr111455 ------
NM_002234chr122683 600 1759 ----
NM_002240chr211537 ------
NM_002247chr102905 643 ------
NM_002252chr2--1163 ----
NM_002264chr384996 4445 1703 1294 1016 773 517 134 24523 4165 23089 756 --
NM_002265chr173428 337 329 --1854 --
NM_002267chr1321850 692 ------
NM_002268chr311619 ------
NM_002270chr573954 1909 1595 1397 570 451 222 11751 11850 --
NM_002271chr1332161 1642 417 ------
NM_002293chr172686 2667 2407 1687 981 876 66 1578 ----
NM_002294chrX2441 306 1147 ----
NM_002310chr5106354 5952 5659 5441 1934 1878 1448 1251 1061 715 45040 4184 735 159 ----
NM_002332chr121222 ------
NM_002333chr1931120 309 37 ------
NM_002336chr1244091 1669 971 285 --14524 --
NM_002355chr1241235 254 163 131 ------
NM_002356chr652698 2356 499 262 122 11821 11016 --
NM_002359chr1763511 2911 1611 1284 817 28 13859 ----
NM_002360chr782634 2509 2391 2252 2119 2096 978 575 ------
NM_002370chr1--197 ----
NM_002374chr242730 2625 2592 1352 ------
NM_002375chr331726 289 23 ------
NM_002381chr21781 1970 ----
NM_002382chr1421171 277 ------
NM_002383chr161796 ------
NM_002389chr121628 1424 131 ----
NM_002395chr63983 575 195 141 ----
NM_002397chr522235 745 --11430 --
NM_002401chr173873 853 594 ------
NM_002403chr1174 ------
NM_002419chr112450 36 ------
NM_002430chr2262104 1826 954 929 888 288 ------
NM_002436chrX3366 333 62 ------
NM_002442chr121354 1256 ----
NM_002465chr121225 ------
NM_002467chr81402 ------
NM_002473chr2241302 1040 1029 382 ------
NM_002480chr1231284 545 470 31360 1341 1035 ----
NM_002481chr1167851 7573 7267 7213 6705 5577 5459 5292 2880 2744 2429 1670 831 775 383 75 37660 6371 1719 ----
NM_002486chr912538 12308 ----
NM_002487chr15--2742 135 1236 --
NM_002499chr1592445 2412 1810 1763 1521 648 507 325 172 ------
NM_002500chr22922 153 ------
NM_002501chr1963448 3408 1538 1529 1312 350 11272 ----
NM_002505chr631507 463 190 ------
NM_002518chr22997 102 --1395 --
NM_002519chr1111100 11329 ----
NM_002520chr5140 ------
NM_002521chr1150 --173 --
NM_002522chr17103902 3813 2935 2820 1584 1328 551 495 359 269 ------
NM_002523chr73780 348 267 ------
NM_002537chr1521022 684 1706 ----
NM_002538chr51524 --1168 --
NM_002539chr2196 ------
NM_002540chr93694 587 438 ------
NM_002543chr1241368 1126 1039 35 ------
NM_002545chr1124191 3684 34509 1340 158 1528 --
NM_002546chr81301 ------
NM_002553chr71350 ------
NM_002556chr1152123 1634 1620 853 181 ------
NM_002569chr1511293 ------
NM_002576chr112414 96 ------
NM_002577chr3123963 3937 3886 3711 2806 1561 1063 457 423 405 243 52 12975 ----
NM_002581chr974445 4155 3906 2016 1471 930 821 1134 ----
NM_002583chr121242 ------
NM_002586chr62313 244 11183 ----
NM_002588chr521762 709 11534 ----
NM_002590chr132455 102 ------
NM_002594chr2031709 884 114 ------
NM_002595chr1251943 1524 1239 135 38 ------
NM_002600chr141182 404 195 116 21300 430 ----
NM_002606chr211191 ------
NM_002607chr72416 122 ------
NM_002608chr2221522 208 ------
NM_002613chr1643994 1877 876 220 --14934 --
NM_002628chr31346 ------
NM_002633chr12508 451 ------
NM_002636chr61460 ------
NM_002641chrX31732 473 74 ------
NM_002643chr21133 ------
NM_002645chr1192837 2330 2182 2155 2041 1959 621 576 554 32740 568 387 ----
NM_002648chr621196 447 1832 ----
NM_002651chr12833 313 ------
NM_002653chr51176 ------
NM_002655chr894676 4298 4255 3848 3738 3681 1487 834 106 2609 156 ----
NM_002656chr611078 1951 ----
NM_002657chr2063360 3324 2595 2507 2472 2460 1508 ----
NM_002677chr842211 793 103 29 ------
NM_002687chr1441204 511 359 92 1451 ----
NM_002693chr15186 ------
NM_002697chr12234 31 ------
NM_002699chr11526 ------
NM_002707chr2171 ------
NM_002709chr233563 2844 1278 11430 ----
NM_002710chr121735 ------
NM_002711chr71730 1718 ----
NM_002713chr121036 1014 --1108 --
NM_002714chr63936 830 719 ------
NM_002715chr511003 ------
NM_002716chr1153280 3001 989 916 191 127 ----
NM_002718chr332644 236 85 11660 ----
NM_002719chr1472324 1804 1783 1755 1664 430 392 ----21843 953
NM_002721chr92377 121 ------
NM_002731chr122653 251 1130 ----
NM_002734chr172698 285 1143 ----
NM_002737chr1796646 6599 6383 6339 6143 6047 2239 2016 1972 --1420 --
NM_002740chr332422 1004 501 32830 2524 2036 ----
NM_002742chr143623 288 73 ------
NM_002745chr2274588 4505 3598 3518 1528 1352 96 2660 160 1602 11015
NM_002747chr183531 164 100 1179 ----
NM_002748chr152316 53 ------
NM_002752chr51126 ------
NM_002758chr17--1492 ----
NM_002763chr12509 218 1208 ----
NM_002764chrX2854 22 ------
NM_002767chr171430 ------
NM_002773chr162169 70 ------
NM_002791chr141159 ------
NM_002806chr141231 ------
NM_002811chr16121 ------
NM_002819chr1971501 1343 968 956 349 335 265 ------
NM_002821chr64827 609 544 152 1656 ----
NM_002822chr1231806 540 433 151 ----
NM_002823chr21231 ------
NM_002827chr2041769 1478 1410 295 ------
NM_002829chr921233 267 ------
NM_002833chr153408 244 150 ------
NM_002835chr73652 213 150 ------
NM_002837chr1274360 4301 3546 3411 3155 1365 1215 ------
NM_002839chr933512 2709 2461 13359 ----
NM_002840chr121150 515 ------
NM_002841chr32467 65 ------
NM_002843chr1143398 3263 2777 523 ------
NM_002844chr61874 11023 ----
NM_002845chr181624 ------
NM_002849chr121894 ------
NM_002850chr192786 215 ------
NM_002851chr71168 ------
NM_002856chr191307 ------
NM_002868chr1262401 2261 2231 1843 671 381 1924 ----
NM_002869chr1132146 1405 389 22130 1915 ----
NM_002871chr131977 411 92 166 1323 --
NM_002873chr52388 84 ------
NM_002874chr972239 2231 1831 939 881 810 242 1253 ----
NM_002881chr211422 ------
NM_002886chr365199 3421 3298 1802 1049 930 33240 1215 979 ----
NM_002892chr1411661 ------
NM_002893chrX1251 ------
NM_002894chr182178 152 ------
NM_002895chr203844 216 141 ------
NM_002897chr24766 703 611 557 1728 ----
NM_002902chr152239 149 ------
NM_002906chr1152425 1742 730 530 64 12324 ----
NM_002911chr1921564 370 ------
NM_002912chr6174 ------
NM_002918chr1941130 1016 300 217 ------
NM_002923chr11639 ------
NM_002931chr62304 209 ------
NM_002940chr431438 1295 496 1605 ----
NM_002945chr172848 259 ------
NM_002951chr201253 ------
NM_002953chr14803 752 290 163 ------
NM_002955chr641679 1632 758 223 ------
NM_002956chr1211257 1535 ----
NM_002957chr953386 2611 1503 747 366 ------
NM_002958chr33721 360 127 ------
NM_002959chr164170 3121 2964 1759 498 278 12926 ----
NM_002968chr161757 ------
NM_002977chr252960 2190 713 421 305 ------
NM_002979chr11319 ------
NM_002997chr241438 1382 1292 1192 --11389 --
NM_002998chr861401 902 479 450 297 58 --1892 --
NM_003001chr141857 1836 585 313 ------
NM_003010chr1732289 1884 465 ------
NM_003011chr951562 1475 1192 374 73 ------
NM_003013chr41135 ------
NM_003016chr1742039 1713 1410 70 2580 400 ----
NM_003017chr61904 21213 426 ----
NM_003020chr152463 172 ------
NM_003022chrX11256 21218 53 ----
NM_003026chr931125 405 213 ------
NM_003031chr1621009 851 ------
NM_003036chr131193 1156 111 ------
NM_003038chr232672 838 478 ------
NM_003042chr322009 1567 1341 ----
NM_003043chr344281 4237 4173 1289 12892 ----
NM_003048chr262598 2389 2178 2047 805 490 1272 ----
NM_003051chr121651 284 2299 253 ----
NM_003060chr551296 1133 942 810 99 ------
NM_003068chr82849 445 ------
NM_003070chr93787 572 251 ------
NM_003071chr34822 309 258 98 ------
NM_003074chr362115 2100 1881 1840 1653 535 21984 325 ----
NM_003076chr1221412 79 ------
NM_003079chr173650 321 126 ------
NM_003081chr203888 169 60 1457 1429 --
NM_003088chr721085 112 ------
NM_003099chr1595596 5394 5294 4095 2615 2216 1871 752 41 31577 1530 1513 --15784
NM_003104chr152293 162 11178 ----
NM_003106chr31817 1407 ----
NM_003107chr642414 1946 891 654 11988 ----
NM_003108chr287026 6602 6479 5666 5142 4740 942 466 15109 12046 --
NM_003110chr172189 89 1965 ----
NM_003111chr221021 146 ------
NM_003112chr743082 2079 1986 1296 22642 2102 1512 --
NM_003114chr81174 1782 ----
NM_003115chr12425 80 143 ----
NM_003128chr21584 11100 ----
NM_003130chr741208 925 247 71 ------
NM_003131chr651586 1533 1481 590 60 ------
NM_003133chr1--2845 192 ----
NM_003135chr5187 ------
NM_003137chr622018 547 ------
NM_003139chr112800 33 ------
NM_003142chr21242 166 ----
NM_003144chr662104 1858 1395 879 527 400 2294 30 ----
NM_003146chr112165 32 ------
NM_003149chr331621 1503 1209 ------
NM_003150chr1752346 1658 1501 568 334 1205 ----
NM_003155chr852794 2472 2029 1925 917 11842 ----
NM_003156chr1111321 ------
NM_003161chr1763552 3514 3479 2644 1410 1246 ------
NM_003162chr211090 1755 --1254
NM_003173chrX11191 ------
NM_003174chr103698 308 284 ------
NM_003178chr361986 1905 1583 1441 494 488 ------
NM_003179chrX1117 ------
NM_003185chr2021230 1212 --149 --
NM_003188chr6196 1757 ----
NM_003189chr1113100 2768 2574 2263 1203 691 552 386 332 305 170 32761 393 149 ----
NM_003199chr1864195 3904 3815 1095 930 688 13649 ----
NM_003200chr1961584 828 610 585 399 34 ------
NM_003202chr521163 523 21736 1344 ----
NM_003204chr1721183 100 21721 1555 ----
NM_003211chr1241435 1308 233 203 11752 ----
NM_003214chr62951 178 ------
NM_003217chr1241759 595 322 115 ------
NM_003220chr621681 1371 21405 1151 ----
NM_003221chr623185 2999 13493 ----
NM_003223chr161831 ------
NM_003234chr332451 955 456 2155 141 ----
NM_003236chr243310 2953 2317 137 ------
NM_003242chr332457 579 190 ------
NM_003243chr121201 1187 1975 ----
NM_003244chr181435 ------
NM_003246chr1531989 1938 304 ------
NM_003248chr5128 ------
NM_003250chr171183 ------
NM_003253chr2121510 1281 1244 11543 --
NM_003255chr1742194 2051 710 296 12168 12097 --
NM_003262chr394173 4046 3634 3308 1332 1195 1172 975 322 13282 ----
NM_003263chr4148 ------
NM_003269chr611005 ------
NM_003270chrX2951 379 ------
NM_003274chr215567 501 404 356 201 1819 ----
NM_003275chr941230 1181 388 25 ------
NM_003286chr20--1964 ----
NM_003288chr2031248 1129 995 ------
NM_003290chr193214 99 53 ------
NM_003298chr3115605 5160 3922 2186 1941 1579 1572 1521 1402 497 205 12131 ----
NM_003304chr331367 568 203 ------
NM_003311chr112255 123 ------
NM_003317chr142784 299 --1171 --
NM_003319chr21775 ------
NM_003320chr1184374 4120 3148 3113 3060 3008 1651 1425 14456 ----
NM_003334chrX1152 ------
NM_003336chrX--1304 ----
NM_003337chr521131 324 21742 1614 ----
NM_003339chr551624 1393 649 481 276 ------
NM_003340chr4--1202 ----
NM_003342chr1743048 2654 2565 2476 21144 569 ----
NM_003344chr721258 421 11745 ----
NM_003345chr162451 206 ------
NM_003348chr1211680 2458 258 ----
NM_003349chr2051583 1209 1087 376 93 11094 11327 --
NM_003352chr21934 ------
NM_003368chr13518 307 294 ------
NM_003369chr1132068 293 207 ------
NM_003371chr92689 455 ------
NM_003373chr1011805 21664 696 ----
NM_003375chr10182 ------
NM_003376chr6----11798 --
NM_003376chr6----11798 --
NM_003380chr102262 87 ------
NM_003387chr272618 1959 1900 1143 1123 258 178 12702 ----
NM_003390chr1131098 308 240 ------
NM_003392chr353930 3147 3141 3086 1416 12861 ----
NM_003400chr23796 659 183 ------
NM_003404chr2022000 1474 ------
NM_003406chr811430 11724 ----
NM_003410chrX23074 2017 11187 ----
NM_003412chr362455 2298 1112 649 458 195 ------
NM_003413chrX3713 576 385 ------
NM_003430chr19--1400 1567 --
NM_003439chr752634 2203 1363 801 281 23363 159 11406 --
NM_003445chr192818 698 ------
NM_003452chr91661 ------
NM_003457chr171592 ------
NM_003458chr363365 3126 2778 2626 2518 262 --1381 --
NM_003463chr653301 2682 2288 1057 802 1678 ----
NM_003468chr253003 1116 1108 482 221 1419 ----
NM_003470chr16101790 1667 1648 1587 1557 1176 714 662 564 352 ------
NM_003472chr621229 961 1237 ----
NM_003478chr112333 125 ------
NM_003483chr1272387 2139 2061 1907 1178 1036 97 12155 ----
NM_003488chr17127 ------
NM_003489chr2142831 1237 844 366 22113 343 ----
NM_003496chr72791 664 163 ----
NM_003498chr1611004 --1257 --
NM_003503chr12818 495 ------
NM_003505chr721765 381 ----1257
NM_003506chr821195 1166 1496 ----
NM_003557chr131390 1315 1104 --1368 --
NM_003558chr92615 505 ------
NM_003563chr1721135 1116 21378 99 ----
NM_003566chr1263455 3303 951 882 743 496 22792 2713 ----
NM_003567chr1--1117 ----
NM_003574chr1875317 5051 3882 2291 1676 1488 1148 25096 140 ----
NM_003575chr741460 1273 1003 459 ------
NM_003576chr1352721 2466 2358 1996 567 2574 293 ----
NM_003581chr22996 663 ------
NM_003583chr1263052 2819 2668 2388 790 735 1636 ----
NM_003590chr243699 3588 2626 1510 21550 142 ----
NM_003591chr102307 274 ------
NM_003597chr232198 1853 538 ------
NM_003603chr42657 94 11591 ----
NM_003610chr201347 ------
NM_003615chr3103954 3660 3344 2780 2686 2498 1298 1288 822 754 13829 ----
NM_003618chr211134 ------
NM_003621chr112485 397 ------
NM_003626chr1131222 371 316 21242 1125 ----
NM_003629chr183454 3249 2271 2125 1335 1324 1265 359 1990 ----
NM_003637chr121358 276 1605 ----
NM_003644chr1785760 4413 4308 4230 3984 2062 1557 1028 --34553 4273 1163 --
NM_003654chr112179 76 ------
NM_003658chr111579 ------
NM_003659chr211073 1788 ----
NM_003663chr343044 2496 2433 309 ------
NM_003664chr5168 ------
NM_003670chr321123 297 21206 486 ----
NM_003671chr952609 1361 1067 1028 108 11417 ----
NM_003672chr11108 ------
NM_003677chr12169 ------
NM_003679chr122717 318 12479 ----
NM_003681chr2195279 5242 4903 2366 2348 1916 1239 407 80 15890 15540 --
NM_003685chr193997 643 204 ------
NM_003688chrX1295 ------
NM_003692chr92173 54 ------
NM_003701chr1331048 807 772 ------
NM_003704chr41670 ------
NM_003705chr2135 ------
NM_003710chr151445 ------
NM_003713chr121764 433 ------
NM_003716chr31981 1740 ----
NM_003718chr71476 ------
NM_003726chr173279 265 97 138 ----
NM_003735chr521762 709 11534 ----
NM_003736chr521762 709 11534 ----
NM_003741chr31103 ------
NM_003743chr231951 324 163 1795 ----
NM_003749chr1342138 1530 932 326 --1878 --
NM_003750chr102748 724 1660 ----
NM_003759chr432985 539 155 14058 ----
NM_003760chr1167 ------
NM_003762chr111234 ------
NM_003763chr201565 ------
NM_003766chr17128 2385 39 ----
NM_003768chr141682 1532 1496 1285 11353 ----
NM_003769chr121262 ------
NM_003774chr1242374 1026 601 204 22553 2060 ----
NM_003787chr1851481 1321 615 226 102 ------
NM_003794chr31437 ------
NM_003795chr62199 105 ------
NM_003797chr11--1193 ----
NM_003800chr662310 2304 2010 1897 1578 1544 ------
NM_003816chr821449 85 ------
NM_003818chr201110 ------
NM_003822chr133035 2894 914 12415 ----
NM_003825chr1541096 1025 375 189 1541 ----
NM_003827chr19129 ------
NM_003831chr1851829 700 673 449 123 11590 1415 --
NM_003835chr171260 ------
NM_003850chr131233 ------
NM_003861chr1452849 2323 2218 1951 1888 ------
NM_003870chr1512096 ------
NM_003872chr283037 2794 2718 1985 864 476 467 430 22967 633 ----
NM_003873chr1061940 1690 945 754 205 124 ------
NM_003884chr31157 11670 ----
NM_003885chr172856 613 12174 ----
NM_003888chr151323 ------
NM_003895chr2131671 1638 35 22231 1895 1770 --
NM_003908chr2041101 1055 896 230 --1924 --
NM_003909chr872685 2284 1905 1231 743 688 489 12897 ----
NM_003913chr673230 1634 1278 1129 1076 1030 747 13263 ----
NM_003916chrX--11510 ----
NM_003919chr7193 ------
NM_003924chr421318 116 11431 ----
NM_003927chr186769 266 226 145 123 82 ------
NM_003931chr61529 ------
NM_003932chr2231723 1310 469 ------
NM_003934chr921333 899 ------
NM_003939chr1053337 2821 1489 819 631 ------
NM_003940chr3----142 --
NM_003941chr742369 2341 133 123 ------
NM_003942chr111695 ------
NM_003947chr331337 1266 130 ------
NM_003953chr172716 2063 1985 1936 1855 383 334 1475 1962 1513
NM_003956chr10145 ------
NM_003957chr1111095 ------
NM_003958chr643550 2711 832 157 ------
NM_003968chr32674 107 ------
NM_003977chr11122 1100 ----
NM_003980chr631041 236 170 21325 1238 ----
NM_003983chr1633836 3188 101 ------
NM_003992chr152306 275 ------
NM_003993chr12316 69 ------
NM_003994chr1243795 3365 1634 702 22968 1273 1809 --
NM_003998chr41477 ------
NM_004006chrX42632 1865 1830 559 ------
NM_004007chrX42632 1865 1830 559 ------
NM_004009chrX42632 1865 1830 559 ------
NM_004010chrX42632 1865 1830 559 ------
NM_004011chrX42632 1865 1830 559 ------
NM_004012chrX42632 1865 1830 559 ------
NM_004013chrX42632 1865 1830 559 ------
NM_004014chrX42632 1865 1830 559 ------
NM_004015chrX42632 1865 1830 559 ------
NM_004016chrX42546 1779 1744 473 ------
NM_004017chrX42632 1865 1830 559 ------
NM_004018chrX42546 1779 1744 473 ------
NM_004020chrX42632 1865 1830 559 ------
NM_004021chrX42546 1779 1744 473 ------
NM_004022chrX42546 1779 1744 473 ------
NM_004023chrX42546 1779 1744 473 ------
NM_004028chr1883609 3468 3333 3014 2975 2546 1338 1013 1871 ----
NM_004035chr1764948 4910 4755 4300 3410 1624 ------
NM_004056chr81834 ------
NM_004061chr5------1491
NM_004067chr741251 1154 592 219 ------
NM_004068chr31110 ------
NM_004078chr1----142 --
NM_004079chr152851 2056 902 614 593 22791 2028 ----
NM_004081chrY41852 1740 1202 56 21610 1510 ----
NM_004085chrX1277 1594 ----
NM_004086chr142554 164 ------
NM_004089chrX2883 813 ------
NM_004093chr1322858 2688 ------
NM_004096chr1031607 674 135 1507 11659 --
NM_004099chr961977 1922 1373 437 420 82 21635 56 ----
NM_004100chr662661 2282 2258 2117 1976 656 ------
NM_004103chr83739 63 30 ------
NM_004114chrX1878 ------
NM_004116chr22307 84 ------
NM_004124chr1453552 3302 2170 797 626 12902 ----
NM_004130chr33607 208 135 ------
NM_004136chr1533010 708 49 12917 ----
NM_004156chr8249 23 ------
NM_004162chr32802 384 ------
NM_004163chr181109 ------
NM_004171chr11139510 9475 7391 6361 5844 2341 1836 1680 1372 841 650 430 183 48575 7219 6982 1855 --19524
NM_004181chr42260 130 ------
NM_004185chr1--1268 ----
NM_004187chrX1579 11491 ----
NM_004209chr162948 119 ------
NM_004225chr81140 ------
NM_004229chrX72114 1981 1548 1524 788 746 447 11693 ----
NM_004232chr1853320 2675 755 661 407 ------
NM_004235chr92754 714 ------
NM_004236chr151133 ------
NM_004237chr5127 1828 ----
NM_004238chr21101 ------
NM_004241chr101735 ------
NM_004242chr62346 162 ------
NM_004253chr9--1326 ----
NM_004263chr211145 ------
NM_004272chr52448 379 ------
NM_004273chr1084723 4613 3554 1558 1381 1353 1205 903 11334 151 --
NM_004274chr1442723 2459 2042 746 --1232 --
NM_004279chr772372 2349 2175 1883 1850 866 172 21866 356 ----
NM_004288chr24928 887 701 272 ------
NM_004290chr521156 1141 ------
NM_004293chr943457 2764 622 311 ------
NM_004295chr1731281 1088 269 ------
NM_004301chr32348 315 ------
NM_004311chr1062768 2512 2127 637 575 332 ------
NM_004316chr1221096 1073 ------
NM_004326chr14988 971 906 456 ------
NM_004329chr102402 240 ------
NM_004330chr151948 ------
NM_004331chr831788 794 726 1992 1624 --
NM_004338chr18106840 5627 5341 4964 4947 2690 1443 818 647 133 11655 1443 --
NM_004342chr742303 800 738 201 21448 515 ----
NM_004349chr8--11238 ----
NM_004356chr113470 439 124 ------
NM_004357chr111146 ------
NM_004360chr1631542 463 213 ------
NM_004362chr41569 ------
NM_004364chr194988 854 347 290 ------
NM_004369chr21592 ------
NM_004370chr652163 1948 1557 761 566 22129 1627 11442 --
NM_004379chr251300 578 367 246 156 ------
NM_004380chr1632438 2334 317 ------
NM_004383chr152616 119 ------
NM_004384chr522177 2129 11440 1675 --
NM_004385chr52527 62 2462 440 ----
NM_004389chr2128 ------
NM_004392chr1332341 1955 926 11910 ----
NM_004393chr352221 1825 1625 1466 232 22410 378 ----
NM_004395chr51177 ------
NM_004397chr1163654 2925 2726 1592 842 461 13462 ----
NM_004405chr23994 316 283 ------
NM_004411chr71263 ------
NM_004415chr61170 1655 ----
NM_004416chr1211080 ------
NM_004426chr121776 11517 ----
NM_004428chr11799 1270 ----
NM_004429chrX51459 1397 1209 379 206 1130 ----
NM_004430chr851100 872 285 266 204 ------
NM_004431chr12541 329 ------
NM_004432chr961809 1767 385 327 253 87 21671 766 ----
NM_004433chr171586 1552 1288 1161 722 677 667 ------
NM_004434chr141329 11775 ----
NM_004438chr243252 2239 414 90 1471 ----
NM_004440chr6--11339 ----
NM_004442chr131747 665 593 ------
NM_004447chr1211101 ------
NM_004451chr11----1728 --
NM_004454chr322312 1607 1380 ----
NM_004456chr72168 41 ------
NM_004457chr221629 406 ------
NM_004458chrX51700 1052 770 684 73 11749 ----
NM_004459chr172692 546 --1419 --
NM_004463chrX--1180 ----
NM_004472chr5160 --1173 --
NM_004475chr1751055 369 268 252 101 ------
NM_004481chr131904 961 757 ------
NM_004484chrX1301 ------
NM_004492chr152226 50 ------
NM_004496chr141404 ------
NM_004499chr51516 ------
NM_004500chr1411521 1236 ----
NM_004501chr133961 2675 329 23950 1419 ----
NM_004502chr172444 387 ------
NM_004504chr21997 2663 116 ----
NM_004505chr1731325 667 563 ------
NM_004506chr61141 ------
NM_004514chr1732639 2348 954 ----12443
NM_004516chr1981212 865 786 503 450 321 189 118 ------
NM_004525chr221027 148 ------
NM_004529chr91388 ------
NM_004554chr1421573 191 ------
NM_004566chr1032533 2056 807 1217 ----
NM_004571chr2143353 3096 3089 1021 23416 2752 1136 --
NM_004575chr431662 1627 1579 ------
NM_004576chr5--1272 ----
NM_004578chr11870 ------
NM_004586chrX42166 1382 517 165 13670 ----
NM_004588chr1174003 3863 3670 3351 2792 975 832 ------
NM_004593chr31672 2781 617 ----
NM_004596chr191202 ------
NM_004598chr543241 3090 1073 686 11170 ----
NM_004602chr2031175 434 330 ------
NM_004603chr731097 450 309 ------
NM_004606chrX2293 130 ------
NM_004612chr9124841 4620 4547 4101 3132 1485 1277 1170 924 824 665 619 34449 1594 1341 ----
NM_004622chr231920 716 110 21667 182 ----
NM_004626chr114619 523 472 143 ------
NM_004630chr1111139 ------
NM_004637chr331150 855 427 ------
NM_004643chr142733 567 ------
NM_004660chrY--11885 ----
NM_004661chr521214 271 1894 ----
NM_004663chr153522 187 136 ------
NM_004666chr621395 214 1526 ----
NM_004670chr1021603 1160 21550 1501 ----
NM_004671chr18146 ------
NM_004673chr121196 515 11103 ----
NM_004686chr81610 1525 ----
NM_004687chr1731825 1809 537 1502 ----
NM_004689chr141450 ------
NM_004690chr61711 ------
NM_004694chr171187 2819 786 1159 --
NM_004698chr1136 ------
NM_004705chr112731 633 ------
NM_004708chr19193 ------
NM_004709chrX1168 ------
NM_004716chr112901 216 ------
NM_004719chr1252678 2197 721 654 298 ------
NM_004723chr12819 233 ------
NM_004726chrX125522 5514 4714 3796 2170 2076 1782 1691 1444 1398 776 408 34794 1470 652 ----
NM_004730chr532112 1731 93 ------
NM_004733chr32611 184 ------
NM_004734chr1342372 2303 1055 487 12692 12954 --
NM_004736chr122029 1966 ------
NM_004737chr223985 343 98 1436 ----
NM_004738chr2042486 2125 2032 606 1123 ----
NM_004739chr112560 411 ------
NM_004742chr331833 1622 33 1382 ----
NM_004745chr845128 1561 199 39 24817 506 15514 16505
NM_004747chr1061087 1019 607 441 418 329 ------
NM_004748chr1583972 3725 3380 2682 1349 897 867 733 23872 683 ----
NM_004759chr151820 1692 778 503 351 12171 12062 --
NM_004762chr1741990 1522 772 139 ------
NM_004765chr16147 ------
NM_004768chr1--1170 --1930
NM_004772chr521518 328 11265 ----
NM_004774chr1733017 2497 2143 ----1768
NM_004775chr1872305 2285 2231 2171 815 650 584 1315 ----
NM_004776chr2092956 2674 2409 2402 2391 2028 1051 640 168 ------
NM_004779chr5--1974 ----
NM_004781chr151546 539 443 387 146 1210 ----
NM_004781chr151546 539 443 387 146 1210 ----
NM_004783chr161512 1668 ----
NM_004785chr162366 316 ------
NM_004788chr1162049 1905 1891 1849 868 650 22540 392 ----
NM_004789chr91311 ------
NM_004796chr1442380 1898 1693 604 11978 ----
NM_004798chr20103106 2572 2478 1469 1108 925 687 597 301 42 ------
NM_004799chr1193 ------
NM_004800chr13177 ------
NM_004801chr22550 416 1259 ----
NM_004804chr232762 459 327 12010 1172 --
NM_004808chr1022491 2328 12298 12195 --
NM_004817chr92603 218 ------
NM_004822chr1773479 3051 2783 1494 1346 1332 65 ------
NM_004824chr61482 21332 1074 ----
NM_004831chr191941 ------
NM_004835chr33762 311 167 ------
NM_004835chr33762 311 167 ------
NM_004836chr22640 602 ------
NM_004840chrX52358 347 283 94 32 --1794 --
NM_004841chr13760 189 151 ------
NM_004842chr611446 ------
NM_004850chr211445 ------
NM_004857chr141330 13265 11021 --
NM_004859chr1731953 694 244 12475 --153
NM_004862chr1651625 1609 495 393 355 21083 438 ----
NM_004863chr14104615 3485 3440 3337 3318 1437 549 436 235 58 25068 3519 ----
NM_004865chr61360 ------
NM_004866chr554888 3342 1093 1017 469 11345 ----
NM_004869chr1831586 1434 317 ------
NM_004871chr1783580 3385 3266 1512 731 386 248 37 14308 ----
NM_004872chr1--164 ----
NM_004886chr19131 ------
NM_004888chr951031 879 258 243 161 ------
NM_004896chr101237 ------
NM_004897chr101119 195 ----
NM_004898chr432673 2291 1994 ------
NM_004902chr202223 33 ------
NM_004904chr7116441 6051 5207 4751 4690 4503 812 488 230 221 155 34654 1926 355 ----
NM_004905chr13763 589 183 ------
NM_004906chr62201 92 ------
NM_004907chr192237 186 ------
NM_004924chr192402 259 ------
NM_004926chr1461770 1505 1311 1203 375 296 ------
NM_004929chr81469 11492 ----
NM_004930chr12604 271 ------
NM_004936chr962154 2036 1185 732 557 284 ------
NM_004937chr173823 222 170 ------
NM_004943chr1921153 428 ------
NM_004945chr191577 ------
NM_004949chr1822085 461 ------
NM_004955chr62573 538 ------
NM_004956chr754439 3907 1120 429 134 33549 3440 1271 2765 37 --
NM_004957chr94444 176 158 77 ------
NM_004958chr1143 ------
NM_004960chr16134 ------
NM_004961chrX2398 156 ------
NM_004962chr102163 45 1492 ----
NM_004965chr212709 167 ------
NM_004973chr661155 705 490 343 289 92 ------
NM_004975chr202770 79 ------
NM_004976chr1145027 3462 2022 385 1661 ----
NM_004982chr123629 553 27 ------
NM_004985chr1261542 1186 909 707 344 268 1130 ----
NM_004991chr3150 ------
NM_004992chrX128546 8348 7005 6202 5869 5694 5405 5394 3195 1851 1557 1238 37497 5419 2303 23124 3095 --
NM_004992chrX128546 8348 7005 6202 5869 5694 5405 5394 3195 1851 1557 1238 37497 5419 2303 23124 3095 --
NM_004999chr693665 3054 1657 1239 957 947 655 137 34 14188 --11614
NM_005010chr751952 1514 839 514 464 ------
NM_005011chr731858 1538 1361 ------
NM_005016chr121359 ------
NM_005020chr71593 ------
NM_005026chr131885 404 125 11362 ----
NM_005028chr1041752 1676 1551 163 32314 2081 2060 ----
NM_005036chr2268340 7936 5749 5389 2395 551 26621 1250 1378 --
NM_005056chr12114900 4480 3951 3798 1649 1546 1212 1206 1125 587 29 24118 1931 ----
NM_005057chr13450 400 379 --11214 --
NM_005063chr1093735 3501 3126 2940 2511 2449 481 363 302 1173 ----
NM_005065chr1454374 2158 1445 466 244 35163 1578 160 ----
NM_005066chr11731 ------
NM_005069chr2121706 291 1518 ----
NM_005078chr1531460 1142 566 ------
NM_005079chr833201 3153 2874 1104 ----
NM_005087chr31214 196 ----
NM_005094chr93721 213 161 ------
NM_005095chr122089 578 ------
NM_005096chrX2413 140 1161 ----
NM_005097chr101104 ------
NM_005103chr111255 ------
NM_005104chr63746 620 554 ------
NM_005109chr342353 1700 973 314 1132 ----
NM_005110chr52158 142 ------
NM_005112chr42997 772 ------
NM_005113chr142396 35 1121 ----
NM_005116chr2053061 1731 1073 843 469 ------
NM_005119chr141179 1091 1008 216 ------
NM_005121chr1763688 3368 3002 1344 570 528 1600 ----
NM_005124chr61869 ------
NM_005126chr362024 1974 1683 1637 1585 688 12073 ----
NM_005128chr213637 477 94 ------
NM_005132chr14--1154 ----
NM_005133chr111382 ------
NM_005134chr182989 23 1810 ----
NM_005135chr1553348 3262 2762 2389 235 13018 23282 925 --
NM_005151chr1892269 2213 1875 784 770 559 431 323 284 ------
NM_005156chr985381 4552 4072 3954 3911 3793 1442 1057 24773 4245 ----
NM_005159chr1521561 1458 --12281 --
NM_005160chr22116138 5812 5503 5307 5038 2275 1106 767 405 161 53 36235 5100 1297 ----
NM_005161chr1142200 1780 428 48 --1361 --
NM_005171chr123523 109 96 ------
NM_005174chr10149 ------
NM_005180chr1021215 418 11192 1654 --
NM_005186chr112474 101 ------
NM_005188chr11218309 7688 7612 7460 7192 6246 6186 6078 6000 5582 5576 5350 5049 2865 2682 2650 2545 2237 1705 1000 961 47888 1712 1070 910 ----
NM_005189chr1782391 2322 1847 1582 689 522 442 204 ------
NM_005190chr62313 266 ------
NM_005194chr201478 ------
NM_005197chr1454799 4337 4266 1680 257 ------
NM_005204chr102996 844 ------
NM_005206chr171899 ------
NM_005207chr2272319 2289 1233 819 642 487 418 23677 1012 ----
NM_005214chr21417 1827 ----
NM_005219chr561256 714 397 334 273 127 ------
NM_005221chr72217 125 ------
NM_005230chr121566 ------
NM_005231chr1121194 176 1150 ----
NM_005233chr342508 680 220 140 ------
NM_005235chr257822 7686 7158 6344 5138 27316 6292 ----
NM_005238chr1183374 2958 2817 2735 2346 1373 933 618 ------
NM_005239chr213775 724 365 42032 1912 1544 218 ----
NM_005241chr331349 944 93 1432 ----
NM_005244chr202611 52 ------
NM_005245chr43769 490 93 --1217 --
NM_005249chr141647 ------
NM_005252chr141712 ------
NM_005254chr1521014 870 ------
NM_005257chr182880 64 1121 ----
NM_005273chr71296 ------
NM_005275chr6144 ------
NM_005277chr441760 730 381 225 11797 ----
NM_005279chr2135 ------
NM_005308chr10--1529 ----
NM_005311chr732139 1813 966 --12615 --
NM_005316chr111330 ------
NM_005318chr2231263 1160 894 ------
NM_005324chr1742021 1372 833 412 --11699 --
NM_005327chr43658 257 44 1529 ----
NM_005329chr1642314 2044 1537 1445 22213 645 ----
NM_005339chr432856 627 564 33518 3120 1705 ----
NM_005349chr41506 ------
NM_005359chr18125700 5619 5378 4828 4104 4069 1733 1718 1270 319 310 138 34874 4227 1822 12573 --
NM_005369chrX2425 194 1175 ----
NM_005375chr621158 1093 ------
NM_005382chr81169 ------
NM_005385chr322498 1082 ----1777
NM_005386chr201731 ------
NM_005387chr111156 ------
NM_005388chr951611 1441 1299 217 87 ------
NM_005389chr62521 115 ------
NM_005392chr931461 1175 758 11276 1201 --
NM_005397chr743845 3765 2450 429 13674 ----
NM_005398chr102119 85 ------
NM_005399chr1124293 4258 3779 3547 1768 1613 1582 1052 1009 954 894 147 23275 2999 ----
NM_005400chr242359 1935 1106 608 ------
NM_005402chr751506 713 599 396 277 ------
NM_005406chr181278 ------
NM_005407chr1451577 1398 1337 134 94 ------
NM_005410chr53581 237 222 ------
NM_005415chr22155 105 ------
NM_005417chr2021409 418 ----11734
NM_005418chr112138 32 ------
NM_005429chr41122 ------
NM_005430chr122993 833 ------
NM_005433chr1822508 2502 ------
NM_005436chr1064103 3932 3661 2744 2602 1517 33137 2871 332 ----
NM_005437chr1031340 990 28 --1283 --
NM_005442chr35559 510 430 158 102 ------
NM_005443chr42494 151 ------
NM_005455chr161294 1143 638 528 232 221 ------
NM_005458chr922370 245 11833 12500 --
NM_005460chr51208 ------
NM_005471chr521252 49 21246 65 ----
NM_005475chr1242879 2826 2239 874 12024 ----
NM_005476chr9--165 ----
NM_005477chr1532073 1884 702 1190 ----
NM_005477chr1532073 1884 702 1190 ----
NM_005487chr2251896 780 481 409 280 1182 ----
NM_005488chr222735 643 ------
NM_005493chr63608 306 123 ------
NM_005494chr72602 247 1212 ----
NM_005497chr1765941 1965 1273 1260 918 28 --14201 --
NM_005499chr191265 ------
NM_005501chr1711166 ------
NM_005502chr932558 979 191 ------
NM_005509chr52729 153 11168 ----
NM_005520chr51603 1488 ----
NM_005522chr721253 944 1256 ----
NM_005523chr721380 593 ------
NM_005530chr1521150 128 ------
NM_005536chr8135 11020 ----
NM_005539chr1021400 905 11003 ----
NM_005541chr251186 1072 1057 989 900 ------
NM_005542chr721706 1401 ------
NM_005544chr211016 ------
NM_005552chr142577 531 ------
NM_005563chr11215 ------
NM_005570chr1821127 426 ------
NM_005574chr11168 ------
NM_005575chr51178 --167 --
NM_005578chr395029 4172 3591 1934 1863 946 328 212 124 44396 1909 1246 394 ----
NM_005581chr192363 88 ------
NM_005595chr11946 ------
NM_005596chr9105554 5517 4911 4747 4345 1940 1489 675 429 354 34367 1881 629 ----
NM_005598chr11674 --11357 --
NM_005602chr31184 ------
NM_005604chr632250 1874 853 22051 1842 ----
NM_005606chr143451 187 23 1334 ----
NM_005607chr82668 22 1277 ----
NM_005610chr12940 811 ------
NM_005614chr711006 ------
NM_005617chr5140 ------
NM_005618chr61205 ------
NM_005626chr1139 ------
NM_005627chr65392 359 258 159 63 ------
NM_005634chrX2111 79 1695 ----
NM_005638chrX51747 1359 416 236 75 ------
NM_005644chr12416 301 ------
NM_005647chrX63140 3065 952 819 697 669 --13347 --
NM_005652chr1621223 865 ------
NM_005655chr81505 1235 ----
NM_005664chr1521060 233 ------
NM_005665chr174924 4381 3987 3645 3145 165 64 23621 892 14219 --
NM_005667chr22161 50 ------
NM_005668chr563199 3063 2917 2810 2800 903 ------
NM_005682chr1621345 174 ------
NM_005688chr331293 936 96 ------
NM_005704chr141112 940 354 169 ------
NM_005711chr51171 1375 ----
NM_005715chr631790 979 210 ------
NM_005717chr141268 870 124 115 ------
NM_005718chr33705 304 257 ------
NM_005722chr221785 473 3389 351 328 ----
NM_005724chr152137 24 ------
NM_005725chr1--12392 ----
NM_005730chr12143455 3424 3280 3060 2917 2627 2307 1443 1148 968 680 642 468 420 160 ----
NM_005731chr21300 174 ----
NM_005734chr113555 280 187 ------
NM_005736chr1021145 57 ------
NM_005737chr262915 2689 2095 2051 948 764 ------
NM_005738chr73544 363 155 21680 1289 ----
NM_005740chr225612 338 121 108 36 ------
NM_005742chr22622 107 ------
NM_005746chr742693 492 424 213 ------
NM_005748chr1233447 2977 2426 23204 2156 13105 --
NM_005749chr171549 ------
NM_005751chr7175 ------
NM_005754chr56979 946 923 802 193 70 ------
NM_005759chr273758 3725 3679 3140 3075 1862 527 23552 1789 ----
NM_005761chr121126 1157 ----
NM_005766chr1321360 505 ------
NM_005767chr132307 65 1126 ----
NM_005768chr122534 194 ------
NM_005776chr141341 ------
NM_005778chr32391 92 ------
NM_005779chr563141 3110 2957 2778 2635 523 13208 ----
NM_005786chr182423 88 ------
NM_005789chr1731912 331 56 ------
NM_005795chr2--32505 2240 445 ----
NM_005801chr17------1127
NM_005808chr33472 404 232 13230 ----
NM_005813chr23924 779 213 12310 ----
NM_005819chr143498 3298 595 279 13004 ----
NM_005822chr642164 1828 940 49 2858 83 ----
NM_005826chr11161 1243 ----
NM_005828chr17124276 3878 3764 1934 1663 1393 1368 978 634 440 103 36 ------
NM_005832chr311149 1171 ----
NM_005840chrX116895 6889 6457 6047 5010 4696 2684 1433 383 170 29 57141 6844 556 234 212 ----
NM_005841chr44955 933 274 263 ------
NM_005842chr133499 143 120 1513 ----
NM_005851chr112394 354 ------
NM_005853chr161604 --1512 --
NM_005857chr131453 1435 1274 11391 11252 --
NM_005859chr511474 11510 ----
NM_005862chr31427 ------
NM_005864chr141179 1654 ----
NM_005868chr71170 ------
NM_005870chr1321385 512 194 ----
NM_005875chr32405 66 ------
NM_005882chr42681 62 ------
NM_005885chr541187 1113 1081 394 ------
NM_005895chr1294008 3177 2754 2733 1559 912 579 466 190 33755 859 118 ----
NM_005896chr22152 34 ------
NM_005898chr1152435 2126 970 626 479 ------
NM_005899chr17--1310 ----
NM_005901chr18148490 8013 7206 6932 6896 6639 2749 2288 1829 1792 1581 1144 553 474 47122 5901 3165 2886 11549 --
NM_005903chr5115177 4681 4282 4117 4043 3783 2060 1901 1070 999 797 1278 ----
NM_005904chr18189 ------
NM_005907chr631603 435 135 ------
NM_005909chr553582 1463 1311 1173 942 24229 3723 14008 --
NM_005910chr1733750 1483 144 --12649 --
NM_005911chr231414 1049 155 11161 ----
NM_005917chr2----155 --
NM_005920chr132866 346 199 ------
NM_005924chr72430 277 ------
NM_005927chr521167 1158 1839 1829 11073
NM_005930chr141700 1305 ----
NM_005933chr1132788 2225 69 ------
NM_005934chr1951965 1741 988 364 102 ------
NM_005935chr475104 4751 4236 3478 3284 1220 27 24007 939 11534 --
NM_005938chrX2563 358 ------
NM_005941chr843964 1378 252 227 ------
NM_005944chr321081 502 ------
NM_005955chr184746 1877 1576 1315 883 756 431 375 11709 ----
NM_005962chr101605 11866 ----
NM_005962chr101605 11866 ----
NM_005966chr222069 1650 ------
NM_005967chr12----1685 --
NM_005977chr133796 405 139 ------
NM_005986chr1341782 1102 729 92 12476 ----
NM_005996chr121580 --121 --
NM_005998chr1----188 --
NM_005999chr11224 21083 98 ----
NM_006003chr191240 139 ----
NM_006009chr12--130 ----
NM_006011chr1584182 4004 3689 3409 3349 1166 1139 1048 ------
NM_006016chr652054 1658 1414 1408 657 ------
NM_006020chr142555 142 ------
NM_006022chr132904 302 ------
NM_006030chr331390 150 83 --153 --
NM_006033chr1822243 529 ------
NM_006035chr1431254 501 386 ------
NM_006037chr2103854 3757 3118 2974 1826 1798 1079 739 676 149 ------
NM_006047chr2053492 2945 1292 1103 766 1950 ----
NM_006048chr11300 ------
NM_006054chr1131409 1294 118 1273 ----
NM_006070chr31332 ------
NM_006079chr62772 263 ------
NM_006080chr731899 284 182 12301 ----
NM_006089chrX1280 ------
NM_006091chr1541737 1625 1549 631 ------
NM_006094chr841909 1751 976 354 ------
NM_006095chr484453 3781 3656 3466 1463 1252 1005 227 11488 ----
NM_006106chr1133019 1361 1030 22940 2772 ----
NM_006108chr1141614 1527 738 565 11537 ----
NM_006135chr11186 ------
NM_006136chr74334 233 220 37 ------
NM_006141chr1642448 2366 1076 1027 32374 2259 1951 ----
NM_006145chr192874 343 ------
NM_006147chr11189 183 ----
NM_006148chr1742677 2646 2463 714 ------
NM_006152chr121210 ------
NM_006157chr111159 ------
NM_006158chr811401 ------
NM_006160chr172206 36 ------
NM_006162chr1861749 1695 1408 617 405 326 ------
NM_006166chr1241946 1857 1609 693 1436 ----
NM_006167chr852167 2129 1517 596 41 ------
NM_006178chr1711560 11417 ----
NM_006180chr93441 425 281 1627 ----
NM_006185chr112178 85 ------
NM_006186chr221201 1013 ------
NM_006191chr123712 297 275 ------
NM_006194chr142332 111 ------
NM_006195chr92435 35 ------
NM_006197chr832254 863 115 ------
NM_006201chrX2474 409 ------
NM_006203chr575471 4233 3469 3450 1174 1094 23 33555 1438 876 ----
NM_006206chr412707 ------
NM_006211chr8199 ------
NM_006216chr21432 ------
NM_006218chr31246 ------
NM_006224chr1752506 1012 945 356 342 11649 ----
NM_006226chr21445 21261 180 ----
NM_006237chr133927 906 169 ------
NM_006243chr141092 761 379 49 ------
NM_006245chr63944 746 685 ------
NM_006246chr142977 388 11268 ----
NM_006252chr1107579 7432 7344 6898 6172 5439 2689 2346 1009 743 11207 ----
NM_006256chr132265 614 350 ------
NM_006258chr104243 114 43 27 ------
NM_006259chr42831 224 ------
NM_006265chr82410 116 ------
NM_006267chr241754 1582 1537 88 ------
NM_006268chr1151159 1142 461 280 137 ------
NM_006270chr192175 50 ------
NM_006275chr2051953 1938 500 442 231 32421 885 666 ----
NM_006277chr21213 ------
NM_006282chr2094389 3664 2968 1603 1336 963 801 741 725 12997 --1234
NM_006283chr844427 1642 149 70 ------
NM_006287chr252209 2196 2137 586 162 191 ----
NM_006292chr11--1162 ----
NM_006301chr12--1608 ----
NM_006306chrX21414 521 22208 1364 ----
NM_006312chr121758 ------
NM_006313chr1211219 11275 ----
NM_006315chr453434 3059 2810 1598 442 33751 2766 475 1618 --
NM_006320chr43956 723 76 ------
NM_006321chr33831 622 84 ------
NM_006324chr16152 ------
NM_006334chr9183 ------
NM_006336chr941329 1225 1211 987 --1144 --
NM_006352chr161920 1597 1577 1374 830 319 1462 ----
NM_006353chr641419 1033 143 99 ------
NM_006357chr2--2122 74 ----
NM_006359chrX31964 673 467 ------
NM_006363chr202233 162 1576 ----
NM_006364chr14--1247 ----
NM_006366chr631156 822 200 1838 ----
NM_006367chr13298 215 138 ------
NM_006369chr11307 ------
NM_006371chr3115198 4855 4215 3814 3753 1545 917 752 612 457 168 12027 ----
NM_006372chr6--1360 ----
NM_006375chrX2564 462 31221 748 246 ----
NM_006379chr711491 1419 ----
NM_006380chr1763504 3309 3205 2765 2729 1226 ------
NM_006386chr2232290 150 60 1515 184 --
NM_006390chr1251636 684 640 576 361 194 ----
NM_006391chr111324 ------
NM_006393chr1094541 3967 3457 3219 2884 2871 1735 1615 430 23899 1253 ----
NM_006401chr92408 160 ------
NM_006403chr641812 1690 1548 260 ------
NM_006411chr6--1845 ----
NM_006434chr1032594 2451 261 22213 793 --12414
NM_006439chr41389 ------
NM_006457chr484053 3996 2757 2533 2509 983 838 393 --13327 --
NM_006459chr1021531 186 --11929 --
NM_006460chr1731594 632 210 ------
NM_006465chr1551976 1906 1695 470 389 ------
NM_006467chr51851 12173 ----
NM_006469chr13643 527 120 ------
NM_006471chr18189 ------
NM_006478chr221211 ------
NM_006482chr1263052 2819 2668 2388 790 735 1636 ----
NM_006496chr161960 1685 1566 1324 1276 1254 ------
NM_006497chr171168 ------
NM_006504chr1041813 920 169 125 42968 2779 2567 550 ----
NM_006516chr11359 11277 ----
NM_006517chrX42196 1510 257 212 1195 ----
NM_006521chrX1938 --172 11421
NM_006524chr71240 61074 829 409 325 157 73 ----
NM_006527chr42759 142 ------
NM_006529chr411379 ------
NM_006532chr1931988 1733 317 ------
NM_006534chr2062529 2199 1231 1169 883 327 12682 ----
NM_006536chr131021 720 681 2874 238 ----
NM_006538chr23998 470 239 --1726 --
NM_006539chr161538 ------
NM_006540chr811404 ------
NM_006544chr1496050 5357 2441 2206 1359 1333 1030 966 205 ------
NM_006546chr1785787 4793 4758 4210 2632 2428 2387 2182 --25473 4782 --
NM_006547chr731957 1848 769 ------
NM_006548chr341633 1151 586 561 ------
NM_006549chr1242939 2594 2560 277 ------
NM_006552chr11186 ------
NM_006557chr921301 533 ------
NM_006559chr12835 250 ------
NM_006561chr1095672 5471 4673 4243 4208 3795 2018 1791 140 ------
NM_006565chr162435 429 11119 ----
NM_006571chr83236 49 36 ------
NM_006572chr1793247 3203 3073 2686 2614 1167 740 415 153 1573 ----
NM_006574chr3--1137 ----
NM_006584chr171119 ------
NM_006587chr421335 461 ------
NM_006595chr1122049 157 11811 ----
NM_006599chr1688049 7288 5615 5038 2449 2376 1731 421 35243 5114 2169 ----
NM_006603chrX31409 282 260 ------
NM_006609chr242585 2383 2351 2217 ------
NM_006614chr333287 3049 2847 1839 ----
NM_006618chr111387 21533 1171 ----
NM_006620chr694844 3902 1515 1085 1001 833 635 441 226 ------
NM_006621chr11366 ------
NM_006622chr52545 400 ------
NM_006624chr1021828 1373 1113 ----
NM_006625chr11420 ------
NM_006625chr11420 ------
NM_006625chr11420 ------
NM_006626chr952302 1060 1004 615 55 11937 ----
NM_006628chr1564591 4557 3945 1168 932 848 13030 ----
NM_006629chr1832539 2388 1784 ------
NM_006633chr51157 1636 ----
NM_006636chr23912 745 116 --1315 --
NM_006640chr1741870 1840 1339 697 1634 ----
NM_006644chr131188 1163 ----
NM_006646chr1362585 2242 1980 1968 432 152 ------
NM_006654chr1264625 4390 4244 888 559 484 44367 1783 1754 337 ----
NM_006656chr1141197 843 235 155 ------
NM_006660chr15134 1128 ----
NM_006662chr161282 ------
NM_006667chrX11000 169 ----
NM_006675chr1242717 2384 2309 486 ------
NM_006682chr732830 2378 76 22708 1058 ----
NM_006698chr2011213 21437 181 2548 124 --
NM_006699chr172647 2512 1004 829 690 372 81 ------
NM_006700chr123597 521 145 ------
NM_006703chr61177 ------
NM_006704chr132426 317 1414 ----
NM_006706chr51172 ------
NM_006708chr62318 278 1918 ----
NM_006713chr53263 69 55 1341 ----
NM_006716chr751317 1265 1111 1018 386 11373 ----
NM_006717chr962531 2299 1159 1054 496 372 22239 1017 ----
NM_006718chr611078 1951 ----
NM_006722chr33841 586 490 1527 ----
NM_006726chr421223 151 ------
NM_006727chr5--1357 ----
NM_006729chrX105371 4785 4597 2155 2119 2034 1961 1878 1848 1587 14496 ----
NM_006734chr631412 538 246 2991 452 ----
NM_006735chr7163 ------
NM_006738chr15103739 3340 2899 1744 1733 1471 1445 1292 1286 365 ------
NM_006744chr101169 ------
NM_006749chr831034 884 457 ------
NM_006750chr16177631 7370 7326 7207 7067 7042 6582 6441 5546 2723 2194 1904 1893 1263 859 666 107 47779 4962 2402 728 ----
NM_006754chr761211 1075 421 277 157 137 11227 ----
NM_006761chr171263 1224 ----
NM_006763chr141888 1739 589 212 11762 ----
NM_006765chr8151 ------
NM_006766chr862576 2503 2325 2308 1003 841 ------
NM_006769chr12492 30 ------
NM_006773chr221551 602 1571 ----
NM_006775chr6102936 2517 2373 2177 1159 1108 1100 573 188 135 12948 186 --
NM_006788chr1831455 462 331 --1321 --
NM_006800chrX1567 188 ----
NM_006802chr131093 58 25 ------
NM_006805chr521513 101 ------
NM_006810chr3123 ------
NM_006811chr20--1848 ----
NM_006813chr6189 ------
NM_006815chr1231122 967 896 --1156 --
NM_006827chr1443139 3078 2972 2865 ------
NM_006828chr63197 181 89 ------
NM_006832chr141126 1824 ----
NM_006838chr122676 388 21913 1658 ----
NM_006846chr51131 1345 ----
NM_006852chr1762861 2693 2573 2471 1037 133 22492 120 12441 --
NM_006854chr761994 1753 1581 1436 361 188 ------
NM_006856chr124762 263 150 87 ------
NM_006861chr1232109 692 338 ------
NM_006885chr16124057 3949 3394 2981 1338 1145 1037 945 687 494 312 196 ------
NM_006887chr23575 541 205 ------
NM_006888chr1463542 2848 2800 2773 856 350 12269 ----
NM_006892chr2041365 1254 555 292 ------
NM_006892chr2041365 1254 555 292 ------
NM_006893chr1181 ------
NM_006895chr282086 1850 1763 1657 1460 739 600 589 ------
NM_006896chr71222 ----151
NM_006899chr201296 ------
NM_006908chr741290 964 585 52 --1388 --
NM_006915chrX22387 37 22529 2260 ----
NM_006918chr11125769 4734 4316 3792 2215 1718 1681 1560 1485 1452 589 344 35124 2046 1368 ----
NM_006920chr221607 1302 ------
NM_006922chr211017 ------
NM_006924chr1774228 4154 2793 632 358 347 171 1612 ----
NM_006925chr144371 201 99 29 ------
NM_006930chr551971 1877 1573 1364 447 1133 ----
NM_006931chr1231680 286 178 ------
NM_006937chr171578 1511 ----
NM_006939chr1461150 1055 890 358 324 207 21036 140 ----
NM_006943chr2062811 2770 2303 876 694 393 12315 --11183
NM_006946chr113580 386 379 ------
NM_006948chr2122199 1919 ------
NM_006951chr102830 769 ------
NM_006981chr932874 2826 2578 32881 2200 1944 ----
NM_006990chr151844 1788 632 536 50 ------
NM_006997chr102373 328 ------
NM_006999chr551447 1286 698 395 228 ------
NM_007002chr20186 ------
NM_007005chr921257 962 ------
NM_007007chr1284726 3914 1808 1737 1227 687 621 247 13874 ----
NM_007010chr1751227 1175 649 267 184 ------
NM_007011chr15116304 5933 5858 2672 2348 1843 1253 1144 945 586 354 1281 ----
NM_007013chr81814 ------
NM_007017chr51655 ------
NM_007019chr201126 --134 --
NM_007033chr152251 1566 591 370 64 1881 ----
NM_007039chr1422095 1754 ------
NM_007040chr193958 825 772 ------
NM_007045chr61110 ------
NM_007050chr20117649 7379 6584 6070 6022 5828 5317 1001 761 701 307 13000 ----
NM_007064chr321093 195 ------
NM_007067chr1721512 1355 ------
NM_007073chr664191 3765 362 315 261 227 44035 2969 191 82 ----
NM_007078chr102847 840 12907 ----
NM_007106chr1342601 2322 41 35 11736 ----
NM_007118chr51610 ------
NM_007121chr19--1356 ----
NM_007123chr131107 256 120 11013 ----
NM_007124chr6--11676 1346 --
NM_007125chrY31467 1060 277 1421 ----
NM_007126chr91465 ------
NM_007129chr134834 764 397 218 ------
NM_007146chr1722769 1862 ------
NM_007150chrX41394 529 231 131 11976 11635 --
NM_007158chr12411 234 ------
NM_007159chr321449 1384 ------
NM_007166chr1121601 239 ------
NM_007170chr11365 ------
NM_007174chr1262319 1937 826 778 672 522 11519 ----
NM_007175chr843550 3317 3215 893 ------
NM_007185chr131023 287 241 ------
NM_007187chr1321036 726 2300 30 ----
NM_007189chr721030 149 ----11107
NM_007195chr1832801 2636 914 12438 ----
NM_007197chr122754 54 ------
NM_007200chr15103739 3340 2899 1744 1733 1471 1445 1292 1286 365 ------
NM_007203chr953304 3080 2929 2736 944 --127 --
NM_007204chr12621 128 ------
NM_007207chr11657 ------
NM_007212chr11774 11779 ----
NM_007214chr64964 886 850 163 ------
NM_007216chr111380 ------
NM_007217chr31255 154 ----
NM_007218chr81276 ------
NM_007219chr202863 348 ------
NM_007221chr11173 1393 ----
NM_007222chr851665 1504 1440 1148 709 11782 ----
NM_007235chr12190 ------
NM_007236chr1562439 639 483 475 371 160 1960 ----
NM_007241chr172309 145 ------
NM_007246chr421053 190 2261 138 ----
NM_007249chr1369273 9100 8269 7940 6802 3180 15870 --1199
NM_007259chr11382 ------
NM_007260chr12730 538 ------
NM_007276chr71281 ------
NM_007292chr1764948 4910 4755 4300 3410 1624 ------
NM_007308chr41217 ------
NM_007322chr191405 ------
NM_007324chr1193 ------
NM_007325chrX1172 ------
NM_007327chr921111 223 ------
NM_007331chr432556 2539 1930 ------
NM_007345chr1832153 2079 149 11761 ----
NM_007346chr204326 299 252 25 ------
NM_007347chr151881 13093 ----
NM_007353chr783059 2542 2499 1943 1124 1019 578 411 2368 287 ----
NM_007358chr121680 566 31914 738 80 ----
NM_007363chrX21089 879 ------
NM_007365chr131683 855 145 11894 ----
NM_007368chr1331228 236 58 ------
NM_007372chr171773 1715 ----
NM_007373chr1031797 1591 719 11347 ----
NM_007374chr141375 ------
NM_007375chr122652 1780 --1671 --
NM_009585chr33762 311 167 ------
NM_009585chr33762 311 167 ------
NM_012073chr551564 550 475 290 196 ------
NM_012074chr142327 123 ------
NM_012081chr583694 3342 3274 2940 1363 638 459 407 23385 1447 ----
NM_012082chr8--1331 ----
NM_012084chrX2412 231 1572 ----
NM_012090chr12497 131 --1984 --
NM_012095chr1053328 2669 993 506 495 42702 1052 826 791 ----
NM_012102chr162362 2245 1889 1035 560 525 ------
NM_012105chr215658 155 138 110 90 ------
NM_012110chr4255 42 ------
NM_012115chr6--1392 ----
NM_012120chr62996 402 12926 ----
NM_012129chr762338 2173 1987 1947 1638 912 12027 ----
NM_012137chr182858 2716 2613 2425 2158 537 487 371 1863 ----
NM_012139chr11127 ------
NM_012141chr1362636 2541 1372 1233 693 611 1951 ----
NM_012154chr81150 1843 ----
NM_012155chr191182 ------
NM_012158chr13--11855 ----
NM_012174chr1252264 2098 1121 760 410 1553 1369 --
NM_012175chr112820 666 ------
NM_012176chr52260 96 ------
NM_012191chr3127 ------
NM_012193chr1195191 4251 1966 1715 1691 1567 1552 598 427 55342 4788 1467 1445 1133 ----
NM_012197chr931472 1109 54 ------
NM_012199chr194075 4050 3322 3279 2919 1053 954 779 122 ------
NM_012207chr1031025 993 271 ------
NM_012210chr921464 1066 ----1534
NM_012214chr256352 4862 2566 2291 535 24565 907 ----
NM_012215chr1041766 1679 1496 542 11785 ----
NM_012218chr1952913 2237 824 545 357 1318 ----
NM_012219chr343228 2698 1229 426 ------
NM_012223chr2--1107 ----
NM_012233chr22943 238 ------
NM_012234chr323104 1254 13499 13472 --
NM_012238chr1041651 1261 1216 688 1617 ----
NM_012247chr105894 748 410 296 165 --1978 --
NM_012248chr161671 1161 ----
NM_012249chr242589 2478 2421 1390 ------
NM_012250chr111451 11199 ----
NM_012252chr764736 4473 4037 3553 3446 456 ------
NM_012257chr73942 917 219 ------
NM_012259chr611392 11433 ----
NM_012262chr184682 4242 4008 3338 1996 1980 1815 393 13691 ----
NM_012281chr722197 2059 11511 ----
NM_012286chrX163 ------
NM_012287chr364105 1539 1260 1231 839 452 ------
NM_012288chr6175646 5638 4978 4322 4245 3948 3906 1960 1804 1302 890 861 765 342 327 271 154 --11227 --
NM_012294chr784074 3695 3352 2789 1530 1164 1150 333 ------
NM_012295chr221412 ------
NM_012297chr43899 411 98 32255 2031 854 ----
NM_012300chr522100 1781 ------
NM_012301chr741767 1745 891 406 ------
NM_012302chr121174 925 1840 ----
NM_012307chr181353 ------
NM_012308chr1122057 1995 ------
NM_012309chr11104953 4853 4735 3981 3738 3616 1762 1165 441 295 34587 4052 3315 ----
NM_012316chr1125288 5274 5261 4287 4062 3555 1914 1742 1605 1508 1082 1074 35441 4594 276 ----
NM_012323chr2221574 262 ------
NM_012325chr2031616 1557 400 1188 ----
NM_012327chr1831571 1128 1049 ------
NM_012328chr73909 547 248 ------
NM_012329chr1711041 11293 ----
NM_012330chr1041498 541 466 368 21554 406 ----
NM_012337chr1130 ------
NM_012339chr101496 ------
NM_012342chr102383 46 1200 ----
NM_012347chr642416 1941 561 365 1805 ----
NM_012382chr5114379 3675 3589 2841 1740 1709 1438 893 426 231 34 1774 ----
NM_012383chr9264 42 ------
NM_012384chr2032313 2242 1812 ------
NM_012388chr15123165 2951 2369 2041 1018 816 673 524 417 380 143 85 ------
NM_012399chr2221427 484 ------
NM_012413chr21136 ------
NM_012414chr12712 104 ------
NM_012416chr9--11080 ----
NM_012417chr171640 ------
NM_012419chr61138 ------
NM_012425chr102282 105 22158 193 ----
NM_012428chr153680 239 132 ------
NM_012432chr11353 ------
NM_012434chr63607 95 67 ------
NM_012446chr5----1650 --
NM_012448chr1761622 967 909 645 522 496 ------
NM_012453chr731344 218 91 ------
NM_012463chr1221824 110 ------
NM_012471chrX41931 1605 301 197 11363 ----
NM_012475chr1192 ------
NM_012478chr172649 93 ------
NM_012479chr742595 2587 2050 138 150 11838 --
NM_012482chr1--1626 ----
NM_012486chr11197 1431 ----
NM_013227chr151279 --195 --
NM_013229chr1262795 2056 1725 816 404 164 ------
NM_013230chrY41754 1527 1145 24 ------
NM_013231chr1443604 3569 1528 225 ------
NM_013232chr53386 376 290 1326 ----
NM_013233chr211339 ------
NM_013236chr222476 217 ------
NM_013255chr7128184 8077 7568 7060 6410 6287 5800 5643 5497 3100 2085 426 28568 1488 27368 53 --
NM_013261chr463669 3137 2961 2600 626 265 23386 2740 ----
NM_013262chr651465 1276 946 473 287 21379 511 ----
NM_013263chr16165 ------
NM_013264chr112158 90 ------
NM_013277chr1221096 967 2227 115 ----
NM_013279chr1131915 1650 692 ------
NM_013281chr2021447 1320 11349 ----
NM_013282chr1911289 ------
NM_013283chr51744 ------
NM_013286chr333008 1349 629 ------
NM_013293chr7--1280 ----
NM_013309chr1532177 988 28 --12662 --
NM_013316chr71246 1924 ----
NM_013322chr71511 11294 ----
NM_013336chr31174 ------
NM_013346chrX177 ------
NM_013351chr172264 258 ------
NM_013354chr821459 133 1963 ----
NM_013357chr81833 ------
NM_013363chr32394 42 ------
NM_013364chrX31869 770 539 ------
NM_013365chr221529 ------
NM_013372chr1543384 2871 1210 766 ------
NM_013377chr121573 1495 ----
NM_013390chr91477 21275 355 ----
NM_013396chr2141548 587 260 59 21039 294 ----
NM_013403chr191177 1321 ----
NM_013410chr12885 182 ------
NM_013423chrX1506 ------
NM_013427chrX1506 ------
NM_013436chr2143 ------
NM_013437chr831422 969 388 ------
NM_013438chr931683 1288 306 11817 ----
NM_013443chr91218 --1938 --
NM_013444chrX21117 972 ------
NM_013449chr1262907 2254 1986 1161 770 549 11855 ----
NM_013450chr221060 887 ------
NM_013943chr112675 13087 153 --
NM_013960chr82567 146 --1516 --
NM_013989chr1474427 3829 3555 3508 3425 1070 399 13885 ----
NM_014000chr1011805 21664 696 ----
NM_014010chr9--1497 ----
NM_014011chr252602 2120 478 94 39 12326 1565 --
NM_014016chr33170 95 74 2107 62 --11294
NM_014021chr112978 1375 ----
NM_014023chr1062273 1178 928 630 397 63 12077 ----
NM_014028chr622587 1237 33368 1147 668 ----
NM_014034chr641229 1039 367 344 11269 ----
NM_014038chr71423 ------
NM_014043chr341614 1146 603 418 ------
NM_014048chr1635105 1706 1630 15072 ----
NM_014057chr91362 1374 ----
NM_014059chr13--1292 ----
NM_014079chr34264 256 248 163 1750 ----
NM_014089chr1342228 1877 1578 414 ------
NM_014106chr1542229 1047 868 577 1393 ----
NM_014109chr83880 479 463 ------
NM_014110chr121036 1014 --1108 --
NM_014112chr875268 4073 4038 4032 2170 846 111 14681 14126 --
NM_014117chr1642515 2134 1953 352 ------
NM_014141chr735310 4210 3446 1247 13807 --
NM_014153chr162728 623 ------
NM_014154chr31168 11232 ----
NM_014155chr1186378 5896 5757 5715 5158 2947 2444 1000 27511 7440 ----
NM_014159chr32541 73 1438 ----
NM_014170chr34403 331 325 148 ------
NM_014171chr22177 49 ------
NM_014181chr242775 1130 821 739 ------
NM_014212chr12183 ------
NM_014217chr14564 479 451 246 ------
NM_014231chr1232102 610 247 ------
NM_014232chr1741415 1119 573 271 ------
NM_014232chr1741415 1119 573 271 ------
NM_014233chr1731666 1516 492 ------
NM_014240chr3114095 2998 2793 2651 2614 2599 1348 1112 917 202 143 ------
NM_014241chr102305 26 ------
NM_014243chr431917 763 587 ------
NM_014250chr2251896 780 481 409 280 1182 ----
NM_014253chrX42485 1698 424 130 32407 2338 790 ----
NM_014264chr41103 ------
NM_014267chr111605 ------
NM_014268chr1811282 ------
NM_014271chrX1196 ------
NM_014280chr12259 110 1841 ----
NM_014282chr941222 1127 931 106 1372 ----
NM_014283chr121064 370 21570 1077 11306 --
NM_014284chr11133 ------
NM_014286chr9103645 3125 2557 2384 1247 1226 1134 625 446 332 ------
NM_014289chrX31436 1422 325 ------
NM_014294chr81213 ------
NM_014299chr1951627 734 648 638 188 ------
NM_014309chr2295412 4869 4335 3559 2178 2172 1589 584 493 45374 5312 1220 196 ----
NM_014319chr1251506 1492 1279 84 61 --11752 --
NM_014320chr61140 1230 ----
NM_014323chr22--1173 ----
NM_014325chr1242156 392 232 217 ------
NM_014326chr1511477 11244 ----
NM_014329chr161342 187 ----
NM_014333chr1132652 1925 299 21885 775 ----
NM_014338chr22158 ------
NM_014342chr1121371 142 --193 --
NM_014345chr62795 765 ------
NM_014351chr222333 298 21069 913 --1188
NM_014352chr1151407 313 268 88 66 ------
NM_014361chr11124 1366 ----
NM_014368chr951889 1372 1341 461 160 1386 ----
NM_014372chr162032 1977 1958 1821 539 531 ------
NM_014376chr53963 881 248 11012 ----
NM_014382chr32691 216 11398 ----
NM_014390chr71503 ------
NM_014393chr841738 866 807 333 ------
NM_014394chr104800 451 295 162 21199 919 ----
NM_014396chr742273 908 466 199 ------
NM_014397chr951420 1319 399 59 45 ------
NM_014405chr1732365 608 463 ------
NM_014410chr181358 ------
NM_014415chr341616 1354 391 228 11265 ----
NM_014423chr565178 4719 4183 4056 1422 1083 34655 958 212 ----
NM_014426chr201708 ----1266
NM_014431chr1021239 149 11693 ----
NM_014432chr621229 22 ------
NM_014445chr341955 1651 1546 194 11665 ----
NM_014447chr421480 1467 1646 ----
NM_014452chr631193 308 237 1455 ----
NM_014454chr621050 238 1308 ----
NM_014458chr111393 ------
NM_014469chr113621 612 154 ------
NM_014470chr121752 ------
NM_014480chr191682 2542 270 ----
NM_014482chr21107 ------
NM_014494chr1652044 1500 503 387 282 11549 ----
NM_014498chr31360 ------
NM_014504chr732011 1501 312 21803 540 ----
NM_014515chr122658 168 ------
NM_014517chr33783 316 307 1393 ----
NM_014554chr1241623 1444 254 160 1601 ----
NM_014562chr22314 97 --187 --
NM_014569chr731040 614 378 1142 ----
NM_014572chr1351448 573 563 205 193 ------
NM_014573chr1741832 1818 1284 91 ------
NM_014574chr143598 432 376 2992 274 ----
NM_014585chr231119 1023 120 ------
NM_014586chr2164485 4133 3812 3326 3290 470 21805 1522 ----
NM_014587chr1631587 1517 299 11310 ----
NM_014603chr1731372 1150 357 ------
NM_014606chr421417 1063 11473 ----
NM_014607chr231877 1393 779 ------
NM_014608chr155405 379 181 117 40 ------
NM_014612chr911108 2344 298 ----
NM_014613chr532651 1015 884 21215 367 12076 --
NM_014615chr1643387 647 586 415 21267 966 ----
NM_014616chr33868 468 427 1815 ----
NM_014630chr15103980 3273 2933 2741 1401 970 748 730 367 229 1429 ----
NM_014633chr111579 1401 ----
NM_014636chr954135 3793 698 578 400 ------
NM_014637chr831000 532 173 11018 ----
NM_014644chr12978 203 ------
NM_014646chr1872996 2196 1254 1001 903 886 145 1798 ----
NM_014647chr1651675 588 458 410 181 11633 ----
NM_014659chr1511092 ------
NM_014660chr73363 273 161 ------
NM_014661chr1093652 3336 3010 1567 1487 1478 1346 1284 499 22475 1330 1283 --
NM_014665chr862888 2616 2297 795 359 61 --11240 --
NM_014666chr51397 2952 266 ----
NM_014667chr351648 679 370 362 321 ------
NM_014670chr221199 239 11596 ----
NM_014671chr741408 564 505 200 ------
NM_014674chr383321 2999 2739 2497 1292 1235 1116 894 1372 ----
NM_014676chr12643 169 ------
NM_014678chr221574 ------
NM_014682chr832201 1433 791 ------
NM_014683chr1752157 1549 829 186 50 11462 ----
NM_014685chr162492 131 1210 ----
NM_014686chr1962480 2366 1872 965 691 470 1170 ----
NM_014690chr752566 990 432 374 24 ------
NM_014701chr1522247 185 32345 165 137 ----
NM_014705chr731770 1764 580 11601 ----
NM_014707chr742270 2090 1888 131 ------
NM_014711chr1631989 1373 425 ------
NM_014713chr24191 149 112 40 --1170 --
NM_014720chr1011779 11172 ----
NM_014721chr6127189 7048 6406 6309 5645 5526 5503 5356 5305 5072 4800 1954 26138 730 15968 --
NM_014726chr172451 294 ------
NM_014729chr852217 2073 1529 725 289 ------
NM_014730chr1274670 4336 3791 3641 2116 1070 566 --11636 --
NM_014730chr1274670 4336 3791 3641 2116 1070 566 --11636 --
NM_014731chr201543 ------
NM_014733chr521912 577 ------
NM_014735chrX61817 1802 1694 1497 763 35 ------
NM_014739chr664007 3336 2928 1554 1131 690 24092 3779 ----
NM_014742chr2031773 1612 233 ------
NM_014743chr442163 563 466 290 ------
NM_014746chr264259 3944 767 551 375 99 33624 2703 1323 23143 846 --
NM_014747chr185632 5282 4113 4063 3829 1749 464 87 15433 ----
NM_014750chr141220 ------
NM_014751chr841880 1659 406 295 ------
NM_014752chr1141820 639 513 242 1559 ----
NM_014754chr82805 203 ------
NM_014755chr2114147 4097 3475 2872 2768 2652 1589 1028 474 165 95 23461 2932 --11063
NM_014756chr112457 331 ------
NM_014757chr572043 1874 1757 1538 930 912 558 ------
NM_014761chr1641139 1094 852 831 ------
NM_014764chr124456 410 303 123 2393 310 ----
NM_014770chr1221198 154 ------
NM_014774chr152606 862 432 412 373 ------
NM_014776chr1263026 2748 2095 2046 1924 188 12269 1519 --
NM_014779chr34955 822 152 119 1286 ----
NM_014781chr81907 ------
NM_014782chrX183 ------
NM_014787chr142807 2799 2092 533 1511 ----
NM_014791chr92212 74 ------
NM_014795chr211357 ------
NM_014800chr72740 82 ------
NM_014802chr121140 ------
NM_014803chr101918 12384 ----
NM_014807chr111655 ------
NM_014810chr183387 3056 1468 1381 1198 1117 174 51 12319 ----
NM_014811chr91193 ------
NM_014812chr111894 11378 2692 238 --
NM_014813chr11499 ------
NM_014819chr51441 ------
NM_014820chr331481 1274 451 2820 198 ----
NM_014822chr4--1596 ----
NM_014824chr1131598 418 178 11745 ----
NM_014827chr131589 496 342 ------
NM_014828chr1442543 2471 2206 201 ------
NM_014830chr1243307 1482 908 101 ------
NM_014836chr1021488 85 11979 ----
NM_014838chr224830 429 351 156 12279 ----
NM_014839chr132186 1865 1818 ------
NM_014840chr1263195 2767 2082 1255 850 386 12249 ----
NM_014841chr61282 ------
NM_014848chr1512346 ----12451
NM_014850chr3104051 3910 3808 3653 3544 3427 3291 1589 1419 1198 23869 3299 13587 --
NM_014853chr1741435 1009 553 237 ------
NM_014859chr1731046 238 221 ------
NM_014862chr1554194 3870 1418 1043 625 ------
NM_014864chr153688 3646 416 212 137 2982 585 ----
NM_014868chr123816 266 66 1194 ----
NM_014870chr152921 1765 1051 963 729 34734 3226 1384 ----
NM_014872chr952003 823 455 186 73 ------
NM_014873chr153686 3597 1509 1197 663 23804 3239 ----
NM_014877chr17127800 6637 6547 5666 5003 4929 2938 2642 1642 1144 935 521 37614 1969 216 15445 --
NM_014883chr42546 162 21973 1630 ----
NM_014893chrY21675 768 32348 671 457 ----
NM_014897chr1742760 2054 983 448 1322 ----
NM_014898chr1932043 249 165 ------
NM_014902chr202318 159 ------
NM_014903chr1262317 895 826 781 755 684 137 ----
NM_014904chr1063312 3073 3021 2929 1398 1086 43294 2618 1356 923 ----
NM_014906chr1741238 1191 919 722 ------
NM_014909chr1443449 2958 2727 990 ------
NM_014912chr1043138 2879 689 133 1553 ----
NM_014913chr1851071 1026 365 342 280 ------
NM_014914chr211294 ------
NM_014918chr1521441 174 --11295 --
NM_014921chr1952875 2836 2689 2153 1117 ------
NM_014923chr1331622 1468 265 2731 74 ----
NM_014924chr1452807 2110 643 228 133 ------
NM_014926chr33365 235 29 ------
NM_014931chr192531 456 ------
NM_014932chr321811 1278 ------
NM_014936chr662341 2127 1893 1106 284 30 1740 ----
NM_014937chr10--21212 33 ----
NM_014945chr541979 1938 1880 121 ------
NM_014946chr253050 2537 1240 1134 212 --12914 --
NM_014947chr152935 2544 1972 699 256 2474 171 ----
NM_014949chr12318 238 ------
NM_014952chr1541841 838 570 347 ------
NM_014953chr1344206 1202 1017 937 44185 3617 752 511 ----
NM_014956chr114947 852 314 74 1800 ----
NM_014961chr441934 1639 873 602 1339 ----
NM_014962chr2042566 2539 887 460 12453 --1185
NM_014964chr1772148 966 844 660 358 172 111 21617 145 ----
NM_014969chr11329 ------
NM_014974chr1041784 1756 1373 230 --11747 --
NM_014977chr141103 ------
NM_014978chr1081664 1374 1366 1313 558 495 250 90 11226 ----
NM_014982chr14105045 4384 4288 4093 3911 3684 1831 1125 996 646 15233 ----
NM_014988chr4--12821 ----
NM_014989chr6--12035 ----
NM_014991chr452718 992 765 596 444 1375 ----
NM_014992chr142772 77 ------
NM_014994chr1522267 252 ------
NM_014997chr742610 1123 1007 137 ------
NM_014999chr1221145 562 ------
NM_015001chr11352 ------
NM_015005chr1441719 1637 563 50 1325 ----
NM_015008chr343279 1069 887 396 11250 11022 --
NM_015011chr1321125 73 ------
NM_015017chr131127 867 218 11320 ----
NM_015023chr141799 1325 674 414 ------
NM_015024chr821235 320 ------
NM_015025chr2--22244 2161 1446 --
NM_015026chr1263010 1607 1451 979 637 470 23961 2936 ----
NM_015027chr1621583 365 2708 439 ----
NM_015032chr1332676 702 89 21034 312 ----
NM_015035chr2096076 5636 5212 4224 1729 1709 1331 747 632 31229 1094 315 ----
NM_015039chr174195 3536 1665 1355 1175 435 93 --14208 --
NM_015040chr273379 3206 2865 2633 2280 946 117 ------
NM_015042chr1584241 3764 3529 3306 3173 2848 1466 876 ------
NM_015045chr1042237 1422 485 479 1520 ----
NM_015046chr952689 2469 2176 1788 1698 --22362 363 --
NM_015051chr953278 2957 1118 362 28 12184 ----
NM_015052chr71167 ------
NM_015054chr12--1432 ----
NM_015056chr2162687 2552 628 180 80 34 ------
NM_015057chr13140 ------
NM_015059chr1542737 907 573 325 22985 2749 1983 --
NM_015068chr71586 23852 3435 ----
NM_015069chr16--2607 235 ----
NM_015071chr586409 5159 4336 4299 4207 2081 1277 437 56397 5898 5889 4235 1935 ----
NM_015074chr194716 4617 3776 938 722 667 553 523 30 ----13041
NM_015075chrX22238 1486 ------
NM_015076chr664456 4350 3725 3104 3046 2740 11056 ----
NM_015079chr1562771 1305 704 594 332 306 11989 ----
NM_015082chr572301 2043 684 505 341 210 113 ------
NM_015087chr1332379 2028 336 --1649 --
NM_015090chr174175 2199 2185 1549 1336 578 373 ------
NM_015091chr141787 ------
NM_015092chr1654502 4131 4012 3137 264 12946 --11624
NM_015093chr63723 630 516 ------
NM_015094chr2241460 1323 1114 860 11773 ----
NM_015097chr32905 813 1399 ----
NM_015100chr161978 1776 1727 1582 732 428 ----11401
NM_015101chr152885 2590 1858 743 505 11029 ----
NM_015107chrX92394 2335 2055 2035 1879 697 294 205 44 ------
NM_015110chr932396 976 767 2550 122 ----
NM_015115chr473009 2825 2529 2326 1242 1043 972 ------
NM_015116chr1341199 563 388 75 ------
NM_015129chrX51607 1439 1136 291 40 21583 1484 ----
NM_015130chr421168 387 ------
NM_015132chr731773 1344 102 ------
NM_015137chr842021 1838 477 234 ------
NM_015138chr1542805 1834 402 273 1257 ----
NM_015143chr411432 1286 ----
NM_015149chr122153 1687 12132 ----
NM_015156chr1463702 1249 1080 854 723 156 13309 21429 499 --
NM_015157chr1141194 1080 790 39 ------
NM_015158chr93826 615 199 ------
NM_015163chr14--3750 286 143 ----
NM_015172chr121400 1033 ------
NM_015176chr141616 1273 1143 497 ------
NM_015180chr141691 ------
NM_015185chrX3401 354 282 1708 ----
NM_015191chr1131044 634 69 11965 ----
NM_015192chr2022845 2484 12472 ----
NM_015197chr1443388 3107 2916 555 ------
NM_015199chr322213 50 ------
NM_015200chr421009 128 2934 389 ----
NM_015206chr1543714 3627 2575 912 ------
NM_015208chr1852750 2735 1118 962 71 195 13523 --
NM_015215chr162166 2092 2031 866 814 41 12018 12722 --
NM_015216chr52440 338 ------
NM_015221chr1041351 1046 272 34 ------
NM_015225chr942957 2901 646 30 13134 ----
NM_015230chr411749 ------
NM_015231chr114907 251 230 22 1938 ----
NM_015233chr132830 635 --1569 --
NM_015236chr41364 ------
NM_015247chr1674830 4257 1603 1190 419 159 106 24012 754 ----
NM_015250chr911912 21834 586 ----
NM_015251chr1672343 2322 2072 2015 251 235 139 1588 ----
NM_015254chr8113174 2930 2774 2295 2225 1977 1285 1072 831 402 123 ------
NM_015256chr51125 2527 146 ----
NM_015265chr262307 563 556 311 230 127 --12503 --
NM_015267chr1212032 --11355 --
NM_015268chr3189 ------
NM_015271chr443875 2757 727 357 11355 ----
NM_015272chr161653 ----11488
NM_015278chr682943 2779 2596 2466 1368 897 716 596 2610 588 ----
NM_015282chr282922 2678 2611 2322 1868 822 556 148 ------
NM_015288chr583484 2625 2595 2458 1149 928 404 171 ------
NM_015291chr152815 2714 1401 1004 813 12536 ----
NM_015292chr122149 42 1198 ----
NM_015296chr132111 31 1998 ----
NM_015299chr1421416 232 13349 ----
NM_015310chr8107993 6740 5658 5631 2885 1984 1843 1019 706 166 27696 2979 --1436
NM_015313chr1153469 3455 3100 2928 392 44457 4343 3700 437 1803 --
NM_015315chr553460 2422 919 859 125 1695 ----
NM_015317chr232346 2177 887 ------
NM_015320chr22809 169 ------
NM_015321chr1974898 4892 1909 1778 1105 577 434 11239 ----
NM_015326chr142158 811 654 351 1826 ----
NM_015328chr792878 2613 2459 2070 970 712 503 402 50 12762 12777 --
NM_015329chr1942787 2090 1895 1810 12849 ----
NM_015335chr1252025 1908 1842 1733 299 ------
NM_015336chr1242199 1638 138 65 ------
NM_015339chr203328 283 92 ------
NM_015344chr842048 1654 673 239 ------
NM_015346chr1451804 1641 1561 632 147 1482 ----
NM_015349chr632290 2065 671 1704 ----
NM_015353chr1772715 2556 2537 2439 979 841 297 ------
NM_015354chr91360 ------
NM_015355chr1711864 11377 ----
NM_015356chr8173 ------
NM_015358chr212839 315 ------
NM_015361chr22944 129 ----127
NM_015365chrX53477 2627 1519 872 326 12783 --1455
NM_015375chr174902 4701 4140 3793 1576 1132 311 24840 1396 ----
NM_015378chr143007 2523 734 490 --1562 --
NM_015379chr7--1214 ----
NM_015381chr221738 1447 ----
NM_015382chr141108 ------
NM_015385chr1032594 2451 261 22213 793 --12414
NM_015387chr251995 1518 1499 759 135 ------
NM_015393chr443613 2648 2395 1152 13606 12743 --
NM_015397chr931422 239 185 ------
NM_015401chr1221021 917 188 ----
NM_015416chr124887 790 699 331 1291 ----
NM_015429chr32925 757 ------
NM_015435chr811109 ------
NM_015443chr1731446 1427 957 ------
NM_015444chr3152 1640 1144 --
NM_015446chr121301 1268 21676 1135 ----
NM_015447chr9----1242 --
NM_015453chr351902 1682 1534 836 482 ------
NM_015455chr593709 2523 1575 1252 1240 1075 1057 351 233 44144 3638 3457 449 14107 --
NM_015460chr341610 629 208 58 ------
NM_015477chr15192 ------
NM_015481chr122762 221 ------
NM_015488chr241522 1503 1470 464 ------
NM_015516chr1121185 294 ------
NM_015523chr11--1242 ----
NM_015531chr111163 ------
NM_015532chr1562548 2485 751 359 316 149 11092 ----
NM_015535chr222651 1336 1340 1412 --
NM_015541chr31375 11442 ----
NM_015542chr1031031 930 217 1920 ----
NM_015548chr61144 ------
NM_015554chr1552926 2687 1988 1894 251 ------
NM_015556chr141174 ------
NM_015559chr1821067 737 ------
NM_015564chr542842 2574 1048 1014 ------
NM_015567chr133448 113 27 11209 ----
NM_015568chr2073201 2998 2842 1247 1082 1005 116 --11632 --
NM_015569chr134567 4469 4221 ------
NM_015570chr72657 625 ------
NM_015571chr652100 880 541 523 237 ------
NM_015575chr243159 2451 1060 134 ------
NM_015576chr322968 742 1612 ----
NM_015577chr551800 1713 560 420 43 ------
NM_015602chr111746 --11535 --
NM_015608chr102233 39 ------
NM_015609chr122427 2328 ------
NM_015610chr741958 1004 289 222 1196 ----
NM_015626chr1741150 929 888 290 1152 ----
NM_015627chr131374 1175 205 11364 ----
NM_015630chr22947 253 ------
NM_015634chr101202 ------
NM_015635chr942102 2011 1897 1749 1741 1180 --
NM_015652chr10195 177 ----
NM_015657chr21675 ------
NM_015658chr12385 368 ------
NM_015686chrX11988 11561 ----
NM_015691chrX22968 671 180 12387 --
NM_015695chr61597 ------
NM_015704chr222118 39 ------
NM_015713chr853275 2770 2190 1427 196 12622 ----
NM_015714chr11322 ------
NM_015716chr17195 1102 ----
NM_015723chr71479 1202 ----
NM_015726chr121862 1553 11196 ----
NM_015836chr141542 1223 37 30 ------
NM_015852chr712522 101417 1087 1003 919 751 583 499 331 247 163 ----
NM_015866chr11463 ------
NM_015872chr121737 1375 ------
NM_015874chr41506 ------
NM_015879chr1888590 7159 6100 2752 1725 1401 572 129 ------
NM_015886chr885729 5360 4868 4587 1885 1373 1295 670 13734 ----
NM_015888chr122066 261 23029 863 ----
NM_015889chr221131 1120 ----
NM_015902chr82902 327 ------
NM_015904chr21570 ------
NM_015906chr111604 33359 3142 142 ----
NM_015912chr842327 2214 152 23 170 ----
NM_015932chr132230 149 2567 237 ----
NM_015934chr21193 ------
NM_015955chr22405 354 169 ----
NM_015975chrX21285 275 ------
NM_015980chr521565 1081 ------
NM_015981chr532562 2397 795 ------
NM_015982chr172311 129 ------
NM_015984chr1--1135 ----
NM_015990chr43905 841 36 ------
NM_015995chr1551728 686 594 301 54 ------
NM_015999chr1--146 ----
NM_016003chr741958 1004 289 222 1196 ----
NM_016006chr31174 ------
NM_016009chr174609 4462 4252 4078 3824 319 135 13262 ----
NM_016018chr852522 2440 2417 1751 904 ------
NM_016019chr72910 299 ------
NM_016021chr663008 2993 2745 2248 1126 827 12557 ----
NM_016032chrX1166 1124 ----
NM_016037chr12246 140 ------
NM_016039chr141152 ------
NM_016047chr21169 ------
NM_016048chr511004 2382 236 ----
NM_016061chr231637 1606 662 ------
NM_016072chr121380 ------
NM_016073chr152331 187 ------
NM_016076chr132312 1291 471 1911 ----
NM_016083chr61329 1867 ----
NM_016087chr721406 692 ------
NM_016096chr83544 371 80 ------
NM_016098chr61173 1367 ----
NM_016103chr51455 ------
NM_016107chr52404 294 ------
NM_016120chrX3843 792 309 166 ----
NM_016131chr262002 1921 1672 1454 514 478 ------
NM_016132chr1523133 1132 1131 22512 2149 --
NM_016133chr21481 11434 ----
NM_016141chr32747 60 ------
NM_016156chr1122247 1496 ------
NM_016169chr1072635 2096 1246 1043 887 724 437 ------
NM_016192chr21101 ------
NM_016201chr331839 830 509 ------
NM_016203chr71358 ------
NM_016220chr7--8904 666 582 498 418 334 166 81 ----
NM_016221chr522359 2075 11444 ----
NM_016227chr121064 370 21570 1077 11306 --
NM_016228chr41483 ------
NM_016231chr1711303 1197 ----
NM_016235chr1631387 1101 63 11413 ----
NM_016252chr21637 1194 ----
NM_016257chr163294 3060 2860 1324 479 272 12579 ----
NM_016258chr12771 298 1534 ----
NM_016260chr267236 4983 4789 2703 2256 2101 ------
NM_016269chr421108 317 ------
NM_016270chr191311 ------
NM_016271chr1832045 691 312 12074 11636 --
NM_016274chr1170 ------
NM_016275chr362707 1999 1813 1757 675 641 32538 713 397 ----
NM_016279chr53458 375 159 ------
NM_016281chr12--11165 ----
NM_016287chr131489 310 86 1176 ----
NM_016289chr231975 1904 607 11736 ----
NM_016297chr243506 2851 990 675 33534 2523 837 ----
NM_016300chr3146 1208 ----
NM_016303chrX2185 49 ------
NM_016307chr91284 1291 ----
NM_016308chr142090 1849 1332 287 11861 ----
NM_016312chr121388 ------
NM_016315chr221598 279 11526 ----
NM_016316chr21637 ------
NM_016320chr113923 161 62 11019 ----
NM_016322chr993134 3061 2852 2762 2659 1052 1007 477 377 23180 1107 ----
NM_016338chr51390 ------
NM_016352chr721090 233 21411 423 ----
NM_016359chr15--1678 ----
NM_016374chr141042 630 271 185 ------
NM_016374chr141042 630 271 185 ------
NM_016376chr1753582 3450 3093 716 515 14262 ----
NM_016377chr611446 ------
NM_016396chr1541975 947 116 110 1218 ----
NM_016418chr2232859 290 231 ------
NM_016422chr1142771 2714 1253 471 1873 ----
NM_016424chr1751938 1493 1403 531 69 ------
NM_016436chr203638 608 266 12485 ----
NM_016441chr222132 776 22104 683 ----
NM_016448chr141898 679 503 122 1109 ----
NM_016467chr231379 1020 944 ------
NM_016480chr52721 300 ------
NM_016488chr1231962 751 367 11318 ----
NM_016506chr112272 163 ------
NM_016507chr1742430 2080 1963 501 1579 ----
NM_016519chr41358 ------
NM_016522chr1141428 1327 1188 205 ------
NM_016530chr1562855 1322 1177 501 477 311 23826 2970 ----
NM_016531chr431471 1037 615 23224 1102 ----
NM_016539chr192431 29 ------
NM_016542chrX61126 502 403 375 348 98 1259 ----
NM_016544chr253386 3364 1178 1068 715 1469 ----
NM_016545chr11830 1747 ----
NM_016569chr121580 --121 --
NM_016575chr12164518 4502 4281 4228 4054 4027 3756 3371 1802 1552 1497 1237 243 189 109 86 ------
NM_016578chr112551 146 ------
NM_016587chr71281 ------
NM_016588chr61249 1721 ----
NM_016596chr1221021 917 188 ----
NM_016598chr321350 590 ------
NM_016603chr531560 414 336 ------
NM_016604chr53815 249 40 ------
NM_016607chrX1213 1155 ----
NM_016612chr83269 238 130 ------
NM_016618chr21173 ------
NM_016621chr1144333 1709 1702 1171 ------
NM_016623chr8--1107 1407 --
NM_016626chr1841421 1339 1186 428 11687 ----
NM_016628chr102352 320 ------
NM_016630chr153556 209 81 1513 ----
NM_016631chr212840 390 ------
NM_016641chr1621516 665 11347 ----
NM_016644chr51385 ------
NM_016645chr151324 ------
NM_016651chr142982 110 1174 ----
NM_016654chr1521014 870 ------
NM_016655chr15196 ------
NM_016824chr1011711 ------
NM_016830chr121464 ------
NM_016831chr141877 1821 1505 948 ------
NM_016834chr1733750 1483 144 --12649 --
NM_016835chr1733750 1483 144 --12649 --
NM_016836chr24766 703 611 557 1728 ----
NM_016839chr24766 703 611 557 1728 ----
NM_016841chr1733750 1483 144 --12649 --
NM_016929chr634516 4388 90 ------
NM_016932chr26706 661 584 373 314 28 1937 ----
NM_016936chr1612139 1754 ----
NM_016937chrX21005 885 1359 1849 --
NM_016946chr152823 2337 1213 93 38 ------
NM_016952chr1173985 3180 2883 1482 821 414 182 ------
NM_016954chrX1147 2653 488 ----
NM_017409chr121584 1525 ----
NM_017410chr1231286 1168 43 1408 ----
NM_017412chr841036 1008 148 61 --1225 --
NM_017416chrX--1128 ----
NM_017420chr1463609 3110 2733 1004 987 194 13667 ----
NM_017423chr41512 3435 273 204 ----
NM_017433chr102561 415 ------
NM_017437chr142287 72 ------
NM_017449chr131747 665 593 ------
NM_017450chr174323 236 130 47 --11002 --
NM_017452chr2031175 434 330 ------
NM_017453chr2031175 434 330 ------
NM_017454chr2031175 434 330 ------
NM_017455chr153680 239 132 ------
NM_017456chr1741990 1522 772 139 ------
NM_017459chr1174 ------
NM_017481chr11141 ------
NM_017491chr42997 772 ------
NM_017514chrX2816 172 ------
NM_017525chr112223 196 ------
NM_017540chr573065 2999 2559 2078 2017 495 276 22927 441 ----
NM_017544chrX2718 211 ------
NM_017545chr201163 1387 ----
NM_017546chr22875 198 ------
NM_017548chr331756 824 792 ------
NM_017551chr1052669 2177 413 324 55 ------
NM_017553chr1521220 66 ------
NM_017580chr101953 31486 670 522 ----
NM_017610chr1531534 343 196 ------
NM_017615chr102149 118 ------
NM_017617chr92188 93 ------
NM_017628chr464827 4647 4600 4500 3234 1592 34549 3848 759 ----
NM_017629chr1--2785 514 ----
NM_017632chr41102 ------
NM_017633chr633447 3032 832 ------
NM_017634chr821974 244 1310 ----
NM_017635chr112536 452 ------
NM_017637chr9179361 9268 8848 8757 8626 8228 7963 7065 6797 3684 3538 3437 2706 1826 904 468 192 --11081 --
NM_017640chr61152 3795 770 278 ----
NM_017641chr121318 ------
NM_017643chr171229 31974 1103 979 ----
NM_017644chr3145182 4849 4711 4486 4358 3591 3432 1541 1337 1271 720 232 172 130 14032 ----
NM_017646chr12634 21 ------
NM_017649chr102959 377 ------
NM_017650chr735979 3873 1558 25804 5597 ----
NM_017657chr24909 366 274 32 ------
NM_017658chr14124349 4297 4192 3129 2879 1193 1115 1013 900 676 502 326 23214 619 ----
NM_017660chr1942321 473 464 440 33187 1208 268 ----
NM_017661chr151336 1824 ----
NM_017664chr132917 270 ------
NM_017666chrX42235 705 276 245 ------
NM_017672chr1521100 415 ------
NM_017673chr12897 802 ------
NM_017679chr172675 587 ------
NM_017686chr13985 697 106 ------
NM_017709chr184168 4145 3652 3422 3015 1428 851 124 195 ----
NM_017712chr19116241 6020 5304 5145 4983 4893 2346 1472 1239 1061 646 1403 ----
NM_017714chr203682 175 53 ------
NM_017715chr74579 478 271 243 ------
NM_017719chr32342 162 ------
NM_017728chr1711140 ------
NM_017730chr32579 119 --1739 --
NM_017737chr131631 877 57 2494 374 ----
NM_017740chr1621406 1271 21728 1167 ----
NM_017742chr184734 411 269 176 ------
NM_017744chr142206 729 438 243 12113 ----
NM_017747chr5--1435 ----
NM_017752chrX61612 1560 1486 1386 787 580 22153 1536 ----
NM_017753chr921026 706 1885 ----
NM_017754chr674076 3854 3460 3231 861 570 266 34296 3679 1046 ----
NM_017757chr182835 459 ------
NM_017758chr1731469 1154 943 ------
NM_017762chr1531745 746 652 1570 ----
NM_017770chr632882 2785 290 ------
NM_017772chr651232 497 403 355 32 ------
NM_017778chr831289 1169 437 ------
NM_017779chr142734 1104 727 570 ------
NM_017780chr82270 240 1941 ----
NM_017798chr2041103 787 361 119 ------
NM_017799chr1441691 1329 262 236 --11676 --
NM_017811chr943102 2137 1133 360 ------
NM_017813chr895721 5627 5202 3884 3657 1630 1251 1041 942 31057 788 208 ----
NM_017824chr1032692 2660 1709 11790 ----
NM_017831chr1874578 4267 4259 3431 3220 1616 1158 ------
NM_017842chr122677 536 ------
NM_017847chr11165 ------
NM_017848chrX54481 4411 4003 3318 655 13023 ----
NM_017851chr1581045 912 512 430 382 270 155 43 ------
NM_017866chr8166 1122 ----
NM_017873chr952943 2502 2170 631 87 ------
NM_017896chr20133349 2952 2931 2603 2450 2444 2369 2339 1342 815 777 570 158 12541 ----
NM_017902chr1085214 5149 4336 4092 2214 1300 612 278 24592 1078 ----
NM_017905chr131532 1151 ----
NM_017907chr112484 194 ------
NM_017915chr12--1325 ----
NM_017919chr974708 3920 3622 3590 1598 1400 432 --11413 --
NM_017923chr4--1285 ----
NM_017925chr941699 1529 1491 233 1536 ----
NM_017926chr143924 319 305 3938 808 371 ----
NM_017933chr21363 2593 529 ----
NM_017938chrX42181 1910 604 40 ------
NM_017944chr1142967 2200 2076 1082 12463 ----
NM_017952chr274381 4193 4000 2804 1555 854 370 23938 1630 13832 --
NM_017955chr141855 ------
NM_017964chr21849 ------
NM_017972chr143924 319 305 3938 808 371 ----
NM_017987chr1051938 1787 1657 1619 263 11971 ----
NM_017994chr7--21009 659 ----
NM_018000chr242116 2108 1791 196 1147 ----
NM_018004chr31307 ------
NM_018009chr122159 118 ------
NM_018010chr331325 1075 450 1161 --11440
NM_018015chrX31089 1022 160 ------
NM_018018chr121765 ------
NM_018027chr1022111 173 23237 2197 ----
NM_018028chr1941257 1016 877 168 ------
NM_018030chr181271 ------
NM_018036chr1474332 4214 3905 3016 2717 1043 321 34254 2958 1431 ----
NM_018046chr52695 563 1149 ----
NM_018061chr141183 407 150 56 ------
NM_018064chr6130 ------
NM_018084chr233032 2962 358 175 ----
NM_018087chr12213 194 ------
NM_018092chr161615 ------
NM_018095chr112272 163 ------
NM_018100chr663232 2975 890 798 789 181 11347 ----
NM_018105chr81847 --1784 --
NM_018115chr43746 694 664 ------
NM_018117chr102685 624 ------
NM_018120chr831011 505 431 ------
NM_018121chr1063210 2632 2503 2489 2470 53 ----12838
NM_018124chr1621807 434 1876 11604 --
NM_018131chr101842 ------
NM_018133chr321541 428 11721 ----
NM_018155chr363037 2956 1097 700 396 173 32206 1193 225 ----
NM_018156chr143007 2523 734 490 --1562 --
NM_018157chr1222362 1229 ------
NM_018171chr122228 137 ------
NM_018179chr121634 1617 ----
NM_018181chr182580 417 ------
NM_018182chr1761737 1682 1513 665 227 60 --12022 --
NM_018184chr341550 872 330 111 11588 ----
NM_018191chr1331907 468 171 ------
NM_018195chr1131934 1829 140 1461 ----
NM_018201chr931634 844 740 ------
NM_018202chr12694 280 ------
NM_018205chr1042223 2165 1689 875 ------
NM_018206chr162205 86 ------
NM_018211chr121543 65 --1731 --
NM_018214chr61157 ------
NM_018217chr20159 ------
NM_018222chr1151838 1754 1177 584 73 ------
NM_018234chr232235 1755 844 ------
NM_018239chr1042223 2165 1689 875 ------
NM_018241chr41763 ------
NM_018243chr473917 3781 645 460 300 246 41 13019 ----
NM_018244chr2021170 308 ------
NM_018246chr842482 2222 1901 814 12187 ----
NM_018247chr632909 253 135 ------
NM_018254chr12570 431 22124 864 ----
NM_018264chr71945 ------
NM_018266chr321017 327 1707 ----
NM_018279chr1232846 2525 1096 --1179 --
NM_018285chr152345 29 ------
NM_018290chr41295 ------
NM_018293chr322237 1881 22268 2048 ----
NM_018294chr102316 50 ----1632
NM_018298chr11172 2942 918 ----
NM_018299chr82280 72 1201 --1567
NM_018301chrX2140 34 ------
NM_018312chr1142005 1484 850 806 ------
NM_018313chr332664 1067 932 22424 1622 ----
NM_018315chr41542 ------
NM_018320chr111198 ------
NM_018323chr451539 1236 735 465 375 21279 116 ----
NM_018325chr91212 2452 364 ----
NM_018327chr2021802 679 --1622 --
NM_018328chr21520 ------
NM_018342chr421255 607 ------
NM_018361chr853950 2555 1298 935 737 ------
NM_018364chr184024 3872 3237 2569 1220 865 601 347 33854 3400 412 ----
NM_018367chr1121641 286 ------
NM_018371chr831047 183 156 ------
NM_018373chr1475876 5279 2509 2419 2041 1884 78 34314 1624 420 ----
NM_018374chr784856 3827 3708 3436 1693 1281 944 519 31507 753 499 ----
NM_018383chr231673 765 431 ------
NM_018386chr133387 127 47 ------
NM_018388chrX2336 55 11400 ----
NM_018403chr333620 2580 1531 ------
NM_018413chr12133 ------
NM_018416chr1241910 1777 1642 889 ------
NM_018424chr931705 1599 1504 1103 ----
NM_018425chr1032077 2041 462 ------
NM_018429chr552835 2112 1804 594 442 1150 ----
NM_018433chr21550 ------
NM_018434chr5136 ------
NM_018439chr1872366 2149 2127 683 407 317 138 ------
NM_018440chr8108695 7303 5655 5578 3378 2328 1737 664 505 438 ------
NM_018441chr23797 184 38 ------
NM_018444chr822145 1471 ------
NM_018445chr152568 65 --177 --
NM_018448chr1221174 992 ------
NM_018452chr6_random53796 2423 1360 788 410 12437 ----
NM_018454chr15--1678 ----
NM_018469chr172494 369 21377 284 ----
NM_018474chr20--134 ----
NM_018482chr84828 209 172 53 12599 ----
NM_018490chr1111549 11184 ----
NM_018534chr22625 616 ------
NM_018553chr1751691 1559 1209 378 315 ------
NM_018557chr211346 11542 ----
NM_018569chr451559 1488 206 198 84 1265 ----
NM_018571chr22570 55 ------
NM_018584chr121015 823 ------
NM_018593chr6136 ------
NM_018602chr153151 142 79 11189 ----
NM_018638chr1285616 5565 4969 4490 4468 1937 1797 1206 13658 ----
NM_018640chr1252340 2300 2188 843 811 ------
NM_018649chr104590 521 442 63 ------
NM_018650chr141756 1606 846 679 1454 ----
NM_018652chr153693 640 253 ------
NM_018657chr32267 203 ------
NM_018660chr822373 865 22503 933 13004 12044
NM_018667chr1622600 2586 12780 ----
NM_018682chr73614 575 151 ------
NM_018683chr201643 11706 ----
NM_018686chr12--158 ----
NM_018689chr1532563 2314 2057 22529 2109 ----
NM_018691chr531077 299 148 ------
NM_018695chr52662 479 1390 ----
NM_018698chrX51993 1885 1429 447 202 ------
NM_018700chr561427 1313 419 255 180 52 ------
NM_018704chr1--1507 ----
NM_018710chr82218 137 11173 ----
NM_018711chr1231495 1311 28 ------
NM_018712chr113377 236 114 ------
NM_018713chr12973 776 11083 ----
NM_018715chr141990 1859 1450 914 --1527 --
NM_018719chr721233 397 ------
NM_018841chr193622 3604 3485 2934 1455 1036 1024 471 273 ------
NM_018845chr12546 523 ------
NM_018847chr931213 234 121 1133 ----
NM_018890chr741290 964 585 52 --1388 --
NM_018898chr522200 1605 ------
NM_018899chr522200 1605 ------
NM_018900chr522200 1605 ------
NM_018901chr522200 1605 ------
NM_018902chr522200 1605 ------
NM_018903chr522200 1605 ------
NM_018904chr522200 1605 ------
NM_018905chr522200 1605 ------
NM_018906chr522200 1605 ------
NM_018907chr522200 1605 ------
NM_018908chr522200 1605 ------
NM_018909chr522200 1605 ------
NM_018910chr522200 1605 ------
NM_018911chr522200 1605 ------
NM_018912chr521762 709 11534 ----
NM_018913chr521762 709 11534 ----
NM_018914chr521762 709 11534 ----
NM_018915chr521762 709 11534 ----
NM_018916chr521762 709 11534 ----
NM_018917chr521762 709 11534 ----
NM_018918chr521762 709 11534 ----
NM_018919chr521762 709 11534 ----
NM_018920chr521762 709 11534 ----
NM_018921chr521762 709 11534 ----
NM_018922chr521762 709 11534 ----
NM_018923chr521762 709 11534 ----
NM_018924chr521762 709 11534 ----
NM_018925chr521762 709 11534 ----
NM_018926chr521762 709 11534 ----
NM_018927chr521762 709 11534 ----
NM_018928chr521762 709 11534 ----
NM_018929chr521762 709 11534 ----
NM_018945chr662293 1096 1036 1024 749 314 ------
NM_018948chr151450 1031 941 504 257 1497 ----
NM_018951chr721300 916 ------
NM_018953chr12----3144 71 58 --
NM_018959chr193687 582 133 ------
NM_018970chr73821 541 138 12806 ----
NM_018972chr822329 2282 11886 ----
NM_018976chr123967 592 497 ------
NM_018977chrX2930 362 ------
NM_018979chr1252655 2588 909 372 219 ------
NM_018992chr1631411 1165 100 ------
NM_018993chr2041394 1141 409 56 ------
NM_018994chr11565 136 ----
NM_018999chr103703 102 63 43118 1635 1263 349 ----
NM_019000chr521546 1471 ------
NM_019001chr384392 4134 4032 3999 3329 3041 1444 855 23625 553 ----
NM_019004chr731994 1662 210 ------
NM_019006chr151728 1258 ----
NM_019008chr2293651 3580 2791 1046 571 453 402 373 342 13542 ----
NM_019016chr17129 ------
NM_019027chr431789 735 235 32555 1884 864 ----
NM_019028chr111373 ------
NM_019035chr411947 ------
NM_019042chr721153 966 ------
NM_019045chrX2840 313 ------
NM_019049chr12762 525 1197 ----
NM_019050chr431929 1585 766 2895 618 ----
NM_019053chr1011016 2974 437 ----
NM_019054chr105598 495 196 84 58 ------
NM_019063chr22626 549 1842 ----
NM_019071chr71641 1496 ----
NM_019074chr151393 ------
NM_019080chr1321547 985 ------
NM_019084chr1042390 2117 765 407 12378 ----
NM_019087chr521581 1144 ------
NM_019091chr221033 821 ------
NM_019094chr1233800 1266 225 12989 ----
NM_019114chr952385 2007 1862 50 39 21030 479 ----
NM_019116chr1673456 3223 2957 2832 2809 2426 1126 --11354 --
NM_019117chrX21254 1006 21316 542 ----
NM_019555chr311340 11647 ----
NM_019557chr1159 ------
NM_019592chr9--2651 270 ----
NM_019593chr2063045 2887 2833 2039 343 88 --23152 2227 --
NM_019594chr921446 449 ------
NM_019595chr21213 ------
NM_019597chrX2571 493 ------
NM_019605chr11681 1647 ----
NM_019606chr72138 85 ------
NM_019610chr131558 574 211 ------
NM_019613chr172475 41 ------
NM_019843chr221379 189 ----
NM_019845chr23724 588 130 ------
NM_019854chr122614 123 ------
NM_019860chr102611 475 ------
NM_019891chr141324 1020 440 53 ------
NM_019903chr1011711 ------
NM_020062chr202719 221 1124 ----
NM_020116chr431482 587 469 ------
NM_020122chr285295 1781 1161 1094 999 893 736 512 15076 ----
NM_020144chr721559 846 ------
NM_020148chr1832840 1946 24 12998 ----
NM_020152chr211709 ------
NM_020156chr71381 ------
NM_020159chr431317 394 358 ------
NM_020177chr542502 1294 703 364 1323 ----
NM_020178chr1731189 1115 409 ------
NM_020180chr181390 ------
NM_020184chr222278 849 ------
NM_020188chr16123 ------
NM_020193chr111159 ------
NM_020198chr1721287 378 1316 ----
NM_020199chr551162 1100 1024 873 120 ------
NM_020204chr11249 ------
NM_020205chr122818 727 21343 745 ----
NM_020228chr113884 278 260 11740 ----
NM_020231chr31676 ------
NM_020235chr31268 2307 56 ----
NM_020239chr112206 12231 ----
NM_020240chr572782 2590 1904 1066 961 297 136 12512 ----
NM_020245chr664931 3855 2040 1038 331 40 25037 421 ----
NM_020246chr71257 ------
NM_020310chr172441 353 ------
NM_020336chr2063463 3412 2716 2583 2559 284 32993 2631 302 ----
NM_020337chr422359 170 ------
NM_020338chr1011405 --13481 --
NM_020340chr651813 1655 862 289 147 ------
NM_020341chr2032070 1459 551 11364 ----
NM_020342chr231599 819 185 ------
NM_020346chr1111676 ------
NM_020348chr1062806 2323 2120 371 247 116 ------
NM_020354chr101759 ------
NM_020357chr321348 493 11654 198 --
NM_020362chr13619 277 125 1810 ----
NM_020374chr1211408 ------
NM_020379chr12355 44 ------
NM_020382chr121142 --21403 628 --
NM_020390chr344821 3842 3648 1707 24703 792 11963 --
NM_020403chr1321192 372 11470 ----
NM_020416chr412690 1331 ----
NM_020420chrY41852 1740 1202 56 21610 1510 ----
NM_020429chr752507 2202 2170 637 259 ----11973
NM_020431chr1442745 1774 1737 1094 ------
NM_020432chr71363 22175 192 ----
NM_020438chr92124 51 ------
NM_020440chr153027 2860 608 326 249 1515 ----
NM_020443chr1196486 6472 5931 5765 5267 5227 5196 4880 4336 2518 2306 1756 1492 1446 1281 969 948 771 278 ------
NM_020452chr122164 510 1539 ----
NM_020457chr161439 ------
NM_020458chr25859 835 562 228 195 ------
NM_020463chr241025 991 546 211 ------
NM_020466chr643286 3147 3066 152 13078 ----
NM_020473chrX31732 473 74 ------
NM_020474chr183798 252 158 22009 675 ----
NM_020475chr842204 1845 1820 292 --12327 --
NM_020476chr842204 1845 1820 292 --12327 --
NM_020477chr842204 1845 1820 292 --12327 --
NM_020478chr842267 1908 1883 355 --12390 --
NM_020480chr842204 1845 1820 292 --12327 --
NM_020546chr52924 624 12173 ----
NM_020548chr2155 ------
NM_020630chr103731 650 45 ------
NM_020640chr362031 1961 1595 1444 818 428 1739 ----
NM_020644chr113973 623 221 ------
NM_020647chr832063 866 415 ------
NM_020651chr221209 269 ------
NM_020654chr321337 635 ------
NM_020655chr1681375 1361 1345 1170 918 534 344 163 ------
NM_020673chr20137373 7315 7277 6595 6533 6449 6342 5960 5473 5357 1878 1098 238 --15433 --
NM_020697chr831311 232 197 ------
NM_020699chr164158 3860 3814 1879 1359 832 24702 965 ----
NM_020708chr2032221 1894 1001 22481 2345 ----
NM_020711chr252657 2362 2236 495 81 21635 658 ----
NM_020717chrX63591 1805 860 453 392 298 13609 ----
NM_020718chr16166377 6111 5659 5510 5493 4996 4140 1978 1375 1331 1149 1052 701 536 186 85 34672 4041 1476 --12061
NM_020727chr2183919 3875 3657 3461 3143 2610 1323 1285 1189 ----
NM_020734chr1292939 2382 1299 1289 1134 927 792 760 328 ------
NM_020738chr221481 202 ------
NM_020739chr1583972 3725 3380 2682 1349 897 867 733 23872 683 ----
NM_020742chrX32685 829 731 42607 2421 715 686 ----
NM_020747chr54938 797 93 53 ------
NM_020748chr1741552 586 308 237 1332 ----
NM_020749chr821322 294 11680 ----
NM_020750chr63965 264 32 ------
NM_020752chr1042756 2375 1157 980 12058 ----
NM_020753chr172519 45 ------
NM_020754chr32450 137 ------
NM_020755chr631426 605 368 11542 ----
NM_020760chr241521 1247 528 52 --1223 --
NM_020762chr121122 ------
NM_020765chr1146 ------
NM_020766chrX74229 3834 3532 1575 1267 819 115 1636 ----
NM_020769chrX3884 712 102 ------
NM_020771chr621402 1233 ------
NM_020772chr17138417 8036 7988 7405 6448 6188 2509 2459 2270 2250 1962 899 549 47587 5538 1639 72 ----
NM_020774chr18135861 5516 5423 4762 4698 3928 1565 1470 1409 1105 974 773 62 55643 5456 4816 3951 2411 ----
NM_020777chr422567 22 22537 613 ----
NM_020778chr1574869 4850 4539 4000 3610 1713 620 24965 4495 23027 1529 --
NM_020792chr332074 492 317 1147 11904 --
NM_020794chr121198 584 1383 ----
NM_020796chr532816 2387 2267 32182 2145 1065 ----
NM_020801chr551845 931 779 629 212 11861 ----
NM_020803chr451990 564 498 350 205 1618 ----
NM_020804chr621959 1906 1115 ----
NM_020806chr141667 1282 ----
NM_020807chr16189 ------
NM_020809chr1131886 1869 214 ------
NM_020810chr1421347 115 ------
NM_020815chr41313 1380 ----
NM_020819chr621018 152 ------
NM_020820chr2021498 1259 ------
NM_020825chr1693687 2498 1528 1217 1182 1108 1020 941 361 --12647 --
NM_020832chr11498 ------
NM_020834chr141450 11839 --11369
NM_020839chr361608 1531 1221 450 406 249 ------
NM_020841chr1273020 2783 1526 1400 607 319 234 32792 1021 79 ----
NM_020845chr1232283 2082 1550 --1782 --
NM_020850chr1693190 2924 2505 2406 2006 976 875 255 129 ------
NM_020854chr1851481 1225 499 250 78 1151 ----
NM_020856chr1931593 1269 544 11157 ----
NM_020859chr473658 3612 3403 3172 2746 1490 153 ------
NM_020868chr232007 1889 1768 ------
NM_020870chr441987 1424 322 221 ------
NM_020871chrX32523 115 103 11023 ----
NM_020872chr341183 1112 711 182 ------
NM_020873chr3--2566 352 ----
NM_020888chr131982 692 197 11359 ----
NM_020897chr111189 ------
NM_020899chr1742326 1568 599 399 ------
NM_020918chr1043182 1236 751 141 ------
NM_020921chr1483650 3413 3398 3044 2722 2638 1431 684 12418 ----
NM_020922chrX----1356 --
NM_020927chr1642338 2321 2250 1486 --11943 --
NM_020935chr264341 3706 3567 3536 1731 671 34670 473 466 ----
NM_020940chr1062940 2539 2384 988 576 97 ------
NM_020943chr2132 ------
NM_020946chr91650 ------
NM_020948chr152264 1303 677 615 155 23664 455 ----
NM_020949chr31208 ------
NM_020956chr1944625 3398 1285 1104 13839 ----
NM_020958chr141379 ------
NM_020962chr1562301 2260 2221 1547 623 393 ------
NM_020977chr411692 ------
NM_020987chr1021067 415 ------
NM_020988chr1651262 1252 890 108 90 ------
NM_020993chr122424 409 --1369 --
NM_020998chr3125 ------
NM_021003chr142692 605 ------
NM_021005chr1531129 368 277 1739 ----
NM_021007chr272240 2006 1922 1899 1817 1728 1586 --12215 --
NM_021012chr1731142 1026 781 1770 ----
NM_021019chr12178 ------
NM_021020chr873451 3329 2288 971 407 290 153 ------
NM_021025chr52507 354 ------
NM_021033chr1353238 3000 2810 2643 1158 22323 776 --1990
NM_021035chr20122 11319 ----
NM_021047chr193736 482 132 2652 51 ----
NM_021069chr42657 94 11591 ----
NM_021072chr542606 2523 2249 1832 ------
NM_021076chr221419 198 ----
NM_021079chr1743263 2600 1066 860 1397 ----
NM_021088chr251437 1374 1342 827 808 1452 ----
NM_021090chr2254406 4343 3533 1067 215 24518 1018 ----
NM_021096chr2263060 2255 1199 1020 644 367 ------
NM_021101chr362321 2296 2272 1911 1863 508 ------
NM_021106chr91529 ------
NM_021109chrX149 ------
NM_021109chrX149 ------
NM_021111chr941378 1334 975 48 11355 ----
NM_021115chr221111 ------
NM_021116chr798933 8246 7695 7463 6767 3439 3233 2352 1944 ------
NM_021120chrX43133 1258 1020 800 ------
NM_021132chr10--1412 ----
NM_021133chr131142 269 77 --11088 --
NM_021136chr14191 ------
NM_021140chrX2425 341 ------
NM_021145chr741075 978 969 400 ------
NM_021155chr1943021 2413 2354 212 12000 ----
NM_021158chr201100 ------
NM_021159chr431635 1322 486 ------
NM_021161chr143618 523 82 ------
NM_021183chrX4995 832 386 167 12328 ----
NM_021188chr144441 370 123 72 ------
NM_021190chr12306 260 11055 ----
NM_021198chr281461 1248 1095 538 402 364 213 76 ------
NM_021202chr2052632 2623 2326 2097 591 21895 570 ----
NM_021205chr132835 2819 478 22234 159 ----
NM_021224chr93449 425 115 ------
NM_021229chr122993 324 ------
NM_021238chr1251792 1574 1543 598 499 ------
NM_021239chr1431287 555 78 ------
NM_021242chrX2293 70 ------
NM_021244chr6122 ------
NM_021249chr1441135 588 399 36 ------
NM_021252chr1032011 468 323 11477 ----
NM_021253chr651399 1113 1003 305 81 ------
NM_021255chr1483789 3635 3283 2653 1152 703 607 550 22869 900 11535 --
NM_021260chr141391 ------
NM_021269chr19--2615 101 ----
NM_021569chr921111 223 ------
NM_021614chr5--164 ----
NM_021627chr311219 ------
NM_021629chr354723 4716 3625 1083 187 35119 4880 1059 ----
NM_021637chrX11205 ------
NM_021638chr484490 4109 1770 1152 757 681 624 454 ----1192
NM_021639chr11161 ------
NM_021643chr221394 1341 ------
NM_021644chr1031025 993 271 ------
NM_021648chr652380 925 552 296 204 ------
NM_021705chr631507 463 190 ------
NM_021738chr103698 308 284 ------
NM_021800chr102162 66 ------
NM_021809chr2012481 21781 1556 ----
NM_021813chr665338 3746 3685 2186 1461 682 23705 943 ----
NM_021814chr62417 270 11604 ----
NM_021911chr575458 5373 4394 1662 1175 897 626 ------
NM_021912chr1533825 3025 361 11196 1694 --
NM_021913chr193524 329 93 ------
NM_021914chr1461521 866 648 452 344 222 11649 ----
NM_021940chr611607 ------
NM_021943chr62489 430 --1704 --
NM_021946chrX2127 66 ------
NM_021956chr6----140 --
NM_021958chr11319 ------
NM_021961chr11177424 7399 7289 6974 6872 6652 6442 6344 5096 5006 4942 4690 4660 2763 2679 2439 1782 36770 5680 386 --15886
NM_021962chr175832 657 541 388 333 --2635 153 --
NM_021964chr365359 4959 4608 2270 1660 189 46134 5694 4723 1397 ----
NM_021965chr92123 66 1208 ----
NM_021979chr142113 35 ------
NM_021980chr1021317 69 1863 ----
NM_021984chrX2398 156 ------
NM_021987chrX2398 156 ------
NM_021988chr2051583 1209 1087 376 93 11094 11327 --
NM_021990chrX2398 156 ------
NM_021991chr173775 172 144 ------
NM_021998chrX21103 459 ------
NM_021999chr131192 ------
NM_022037chr221034 209 ------
NM_022041chr1642619 1055 795 439 ------
NM_022044chr22198 ------
NM_022048chr15135693 5258 4736 4525 4471 4327 4130 2373 1949 1711 1411 1301 672 ------
NM_022049chr14614 481 401 385 ------
NM_022051chr11643 ------
NM_022060chr1451370 1217 911 370 334 ------
NM_022062chr1121717 393 ------
NM_022066chr1731001 738 388 ------
NM_022068chr181604 ------
NM_022075chr15968 958 386 351 269 1156 ----
NM_022085chr611421 ------
NM_022091chr622458 2299 11813 ----
NM_022114chr154806 4057 4028 3502 1832 ------
NM_022123chr142195 109 ------
NM_022130chr531205 320 136 ------
NM_022133chr821757 1161 1186 ----
NM_022143chr731235 1074 462 ------
NM_022154chr42538 230 2502 357 ----
NM_022156chr17168 ------
NM_022166chr16116186 6147 6078 5729 5713 4879 2100 1853 1474 745 183 26366 1674 --15290
NM_022173chr221034 209 ------
NM_022337chr111619 ------
NM_022340chr383681 3469 3401 3387 1248 752 420 230 ------
NM_022346chr42966 101 ------
NM_022351chr811171 23853 3161 ----
NM_022366chr12443 371 ------
NM_022371chr12274 31 ------
NM_022442chr2051583 1209 1087 376 93 11094 11327 --
NM_022459chr13135658 5221 4826 4415 4228 2079 951 894 717 678 608 313 221 12454 ----
NM_022463chr1731259 285 133 --11173 --
NM_022465chr1252970 2112 1121 841 279 ------
NM_022467chr192381 353 ------
NM_022475chr4--1685 ----
NM_022477chr2041647 1099 377 263 ------
NM_022483chr521251 1210 ------
NM_022484chr741246 895 334 132 ------
NM_022485chr31409 ------
NM_022494chr102451 185 ------
NM_022552chr22913 173 ------
NM_022566chr151431 ------
NM_022567chrX2777 193 ------
NM_022572chr241522 1503 1470 464 ------
NM_022574chr732105 1346 868 ------
NM_022652chr122809 757 1751 ----
NM_022658chr12--21280 98 --11133
NM_022716chr162873 1112 919 794 502 438 ------
NM_022719chr2223380 3222 --11543 --
NM_022730chr221074 912 ------
NM_022733chr111178 ------
NM_022735chr121846 1695 ------
NM_022743chr1249 37 ------
NM_022745chr152906 2794 2757 1943 1855 32599 1127 550 1653 --
NM_022748chr782776 2767 2269 1859 1125 581 229 184 11957 ----
NM_022750chr74230 61 40 25 ------
NM_022753chr152438 2228 1858 774 630 21087 904 ----
NM_022755chr962580 2091 2037 1876 905 21 1108 ----
NM_022763chr353027 2844 798 323 312 1974 ----
NM_022780chr221191 540 2736 350 ----
NM_022781chr933000 2451 2297 1331 ----
NM_022802chr102286 94 ------
NM_022817chr242296 2278 441 116 ------
NM_022818chr1611554 --1409 --
NM_022822chr111113 ------
NM_022824chr531353 638 193 21462 778 ----
NM_022826chr21449 ------
NM_022831chr131515 1280 582 11341 ----
NM_022843chr1311015 11161 ----
NM_022844chr162876 813 ------
NM_022845chr1632210 2191 727 --11786 --
NM_022893chr2113096 3073 2889 2837 2641 2225 2092 1122 730 549 312 ------
NM_022894chr241123 1108 622 277 ------
NM_022897chr53816 229 195 135 ----
NM_022898chr14144566 4540 4358 4294 3974 3835 3686 3503 3419 1603 1391 721 441 207 ------
NM_022900chr721012 251 11121 ----
NM_022901chr9121 ------
NM_022912chr242751 523 189 111 22133 531 ----
NM_022918chr112619 164 1345 ----
NM_022965chr42371 274 1564 ----
NM_022970chr102980 304 ------
NM_022977chrX51700 1052 770 684 73 11749 ----
NM_023000chr1411661 ------
NM_023001chr1411661 ------
NM_023009chr12619 90 ------
NM_023034chr84563 227 109 92 ------
NM_023037chr133845 731 131 1750 ----
NM_023071chr12--11132 ----
NM_023076chr1642193 1063 375 177 1925 ----
NM_023079chr1731427 508 276 11844 ----
NM_023925chr122320 69 ------
NM_023927chr541259 523 335 227 11173 ----
NM_023929chr832582 2268 496 12846 ----
NM_023934chrX32144 1490 101 1428 ----
NM_024007chr562101 2068 539 532 317 100 12733 ----
NM_024034chr202990 267 ------
NM_024046chr331087 251 243 ------
NM_024050chr192630 250 ------
NM_024056chr123643 525 494 ------
NM_024057chr12--1134 ----
NM_024061chr72461 234 ------
NM_024071chr141450 ------
NM_024077chr92527 67 1634 ----
NM_024087chrX2601 64 ------
NM_024090chr451896 1872 1332 531 513 ------
NM_024094chr82896 279 ------
NM_024107chr17133 ------
NM_024165chr61236 ------
NM_024312chr123392 376 75 ------
NM_024315chr71179 ------
NM_024326chr101136 ------
NM_024329chr161489 1437 1284 1009 560 544 ------
NM_024336chr161275 ------
NM_024337chr51143 ------
NM_024345chr975141 4752 4237 4213 1133 602 513 35809 5372 2129 ----
NM_024408chr173528 2701 2474 1469 1142 539 474 ------
NM_024411chr201589 11508 ----
NM_024416chr91362 1374 ----
NM_024421chr181880 ------
NM_024423chr1833425 1153 240 13232 ----
NM_024429chr71358 ------
NM_024430chr1821246 22 ------
NM_024494chr1--1268 ----
NM_024496chr142821 731 ------
NM_024519chr161319 ------
NM_024524chr31680 ------
NM_024539chrX21098 1016 1316 ----
NM_024551chr1232432 2317 669 ------
NM_024551chr1232432 2317 669 ------
NM_024556chr111422 ------
NM_024563chr51728 2569 447 ----
NM_024565chr54582 550 520 461 ------
NM_024567chr84701 694 269 165 ------
NM_024569chr172793 2140 2062 2013 1932 460 411 1552 11039 1590
NM_024581chr6--1232 ----
NM_024582chr4--1797 ----
NM_024595chr11279 ------
NM_024607chr884378 3965 3346 3114 2924 818 451 227 --12902 --
NM_024612chr1721073 1001 ------
NM_024613chr861390 492 471 400 207 169 11656 ----
NM_024624chr241360 1329 523 394 ------
NM_024626chr121579 580 ------
NM_024638chr322351 734 ------
NM_024639chr641176 1113 970 377 22680 1899 ----
NM_024646chr163803 3577 3263 3069 430 221 ------
NM_024665chr343301 1700 1422 771 14072 ----
NM_024674chr141030 972 937 290 12587 ----
NM_024676chr121238 1018 ------
NM_024686chr11404 ------
NM_024689chrX21251 1135 ------
NM_024692chr231446 1372 636 ------
NM_024700chr13130 122 51 ------
NM_024704chr2041098 752 247 38 ------
NM_024713chr1521134 552 11515 ----
NM_024721chr822048 1687 11888 12148 --
NM_024722chr173552 505 113 ------
NM_024740chr1154014 3888 3244 1590 707 43766 3548 2603 1061 ----
NM_024744chr211652 1125 ----
NM_024749chr11396 ------
NM_024755chr152921 141 ------
NM_024757chr911111 ------
NM_024766chr21374 ------
NM_024769chr11247 28 1225 ----
NM_024779chr122347 282 ------
NM_024785chr211109 11177 ----
NM_024787chr83749 365 276 ------
NM_024798chr1512312 12666 ----
NM_024806chr111265 ------
NM_024811chr1141937 1722 1612 1286 ------
NM_024812chr81624 11718 ----
NM_024816chr162404 92 --143 --
NM_024817chr15115448 5365 5279 5002 4312 1775 1694 1255 383 170 40 1879 ----
NM_024818chr331446 1389 280 ------
NM_024828chr911292 ------
NM_024835chr17255 23 ------
NM_024841chr1182043 694 655 648 543 405 288 106 ------
NM_024852chr1