TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-4489
miRNA Sequence: UGGGGCUAGUGAUGCAGGACG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51177 ------
NM_000035chr9------127
NM_000037chr871864 1782 1764 1695 1605 1567 1019 12256 42226 1951 180 29 --
NM_000051chr1152565 2435 1363 699 55 ------
NM_000081chr12624 246 --11609 --
NM_000084chrX106914 6558 6149 6067 5248 4483 2658 2468 1743 1646 15769 26694 6510 --
NM_000109chrX12319 1903 ----
NM_000115chr132263 216 ------
NM_000124chr10130 ------
NM_000125chr683501 3198 1298 1239 1211 1126 831 275 --11006 12918
NM_000129chr63435 259 80 ----1605
NM_000138chr1532207 1780 741 21707 782 ----
NM_000141chr1011084 21279 1163 ----
NM_000163chr521623 709 11802 ----
NM_000165chr621668 470 ------
NM_000168chr773319 3208 2635 2627 1291 1003 276 ------
NM_000176chr523235 856 --11369 --
NM_000183chr2----198 --
NM_000192chr122621 471 2974 249 ----
NM_000202chrX52759 2410 1537 1401 730 1474 ----
NM_000208chr1953801 1325 446 180 66 14460 --33931 1046 822
NM_000214chr202300 284 11735 ----
NM_000217chr1234653 3970 1599 131 24058 825 --
NM_000220chr112140 43 1877 ----
NM_000227chr181413 ------
NM_000237chr82605 343 1138 ----
NM_000238chr72138 126 ------
NM_000244chr114607 491 303 287 --2633 53 --
NM_000248chr322050 133 12888 --13064
NM_000252chrX11461 ------
NM_000259chr1575700 5004 4517 4141 2518 2405 1944 ------
NM_000264chr983328 3171 2115 1327 1195 1164 1120 769 ------
NM_000267chr171416 1546 --1987
NM_000278chr1072091 2017 1726 811 430 327 238 31769 925 128 ----
NM_000284chrX51866 1610 1248 784 329 ------
NM_000286chr171176 196 ----
NM_000304chr172252 91 ------
NM_000314chr1023102 2534 --12688 --
NM_000319chr1231090 396 209 ------
NM_000325chr41160 ------
NM_000330chrX52016 888 485 435 343 21406 707 11471 --
NM_000332chr696576 6412 6318 5478 4679 4361 2490 787 347 --15398 1803
NM_000334chr1761995 1841 1779 232 51 21 32005 609 442 42100 699 598 42 --
NM_000335chr362096 1545 1388 819 665 128 1897 1706 --
NM_000337chr565848 5348 5114 4707 1887 1626 15627 15781 --
NM_000340chr31268 ------
NM_000351chrX74089 3887 3747 3236 2943 1270 1161 --12992 --
NM_000358chr51398 1365 ----
NM_000362chr2242685 2212 1302 981 12923 33106 3084 1431 1183
NM_000376chr12112688 2644 2538 2394 2381 830 716 472 404 113 87 22696 633 ----
NM_000380chr9--1495 ----
NM_000388chr331257 878 850 ------
NM_000393chr211884 ------
NM_000399chr1031105 182 29 ------
NM_000408chr213420 22929 520 12536 --
NM_000411chr2142954 2811 2730 228 21315 1147 12389 1562
NM_000430chr1743032 2403 2375 1182 ------
NM_000434chr62406 359 ------
NM_000435chr195988 973 884 686 628 2891 730 ----
NM_000442chr172511 472 ------
NM_000445chr86848 723 635 317 196 190 3784 742 287 ----
NM_000461chr3143369 3353 3329 3205 3154 1818 1599 1206 1115 1062 885 289 128 68 --23335 1145 --
NM_000462chr151663 --1574 11176
NM_000476chr9141396 1364 1239 1222 1063 584 497 457 380 305 277 251 244 34 ------
NM_000478chr16645 582 464 292 101 62 ------
NM_000480chr1131583 401 366 1444 1542 --
NM_000489chrX33041 701 670 23380 2904 13146 --
NM_000493chr61193 ------
NM_000494chr10123 1303 ----
NM_000523chr21471 ------
NM_000525chr1171310 1256 1250 1050 639 105 61 2413 95 11479 --
NM_000527chr1942462 2003 487 391 ------
NM_000533chrX1104 1635 11483 --
NM_000539chr361578 1437 1264 1126 1080 1019 21214 223 ----
NM_000546chr1731019 884 34 ------
NM_000555chrX197594 6970 6458 5875 5807 5750 5698 2964 2888 2571 2529 2486 2292 2196 2011 1820 1445 494 268 1503 ----
NM_000578chr251833 1318 1306 1210 554 11159 11731 --
NM_000594chr61724 --1618 --
NM_000599chr2104130 4080 3611 2915 1447 1273 907 872 419 47 11397 --13404
NM_000609chr1042158 692 602 80 32818 375 101 --1363
NM_000612chr11113662 3576 3525 3197 3080 2630 2604 558 175 134 48 ------
NM_000615chr1142338 2323 2003 1965 12810 12009 --
NM_000618chr1285544 5410 5182 4253 2137 2127 2056 1049 26204 2416 22050 288 --
NM_000618chr1285544 5410 5182 4253 2137 2127 2056 1049 26204 2416 22050 288 --
NM_000625chr171153 1116 ----
NM_000633chr1884805 4236 3480 3474 3198 1955 1363 788 1275 ----
NM_000635chr1941527 1196 1085 502 31330 1018 253 --1317
NM_000637chr8----1476 --
NM_000671chr441102 934 415 89 ------
NM_000678chr205805 668 195 169 82 1331 1613 --
NM_000687chr202291 208 150 1530 --
NM_000688chr31120 ------
NM_000698chr101341 ------
NM_000719chr12116304 6070 4558 4439 2654 2083 2046 1272 609 397 266 24522 4466 25763 835 --
NM_000721chr162028 1931 1884 776 660 651 --21980 713 --
NM_000722chr7158 ------
NM_000725chr122999 108 1130 ----
NM_000738chr115913 885 647 369 35 2773 82 --1973
NM_000739chr7169 ------
NM_000757chr15889 665 244 162 121 ------
NM_000759chr173280 240 164 3760 97 62 ----
NM_000767chr1961459 1451 1243 1149 953 338 --1473 --
NM_000780chr8170 ------
NM_000793chr1444797 3416 1491 1102 54449 1925 224 149 89 11604 --
NM_000795chr1171050 1008 719 276 257 229 216 162 ----
NM_000801chr2011004 1790 126 --
NM_000813chr535371 4392 590 34564 1477 816 ----
NM_000814chr1533171 3125 3018 11378 ----
NM_000816chr52473 167 ------
NM_000829chr1162249 1900 1858 1627 443 62 ------
NM_000831chr1145964 5882 5104 4931 4722 4594 4357 4069 4016 3935 2021 580 325 133 95817 5742 5412 4759 4259 2136 1879 1234 877 35648 5489 1311 --
NM_000832chr93597 160 34 1330 --1296
NM_000836chr193851 690 364 1373 1345 --
NM_000837chr83480 380 205 --1197 --
NM_000838chr632610 558 543 ------
NM_000840chr7--166 ----
NM_000845chr71428 ------
NM_000868chrX12204 ------
NM_000875chr15114834 4370 2148 2108 2099 2030 1923 902 865 388 95 64849 2502 1713 1024 965 942 --1427
NM_000883chr74448 222 116 66 ------
NM_000883chr74448 222 116 66 ------
NM_000891chr17--2775 162 1636 --
NM_000901chr41545 ------
NM_000903chr1611354 11140 ----
NM_000908chr5--1697 ----
NM_000918chr171596 ------
NM_000919chr51410 ------
NM_000922chr112807 245 1936 ----
NM_000945chr211798 1141 ----
NM_000949chr52115 108 ------
NM_000961chr2062902 511 473 383 91 64 32501 843 539 13809 --
NM_000965chr3----1831 --
NM_000966chr126916 836 784 334 201 125 ------
NM_001001132chr2111146 11230 ----
NM_001001323chr122816 651 196 ----
NM_001001331chr332160 1900 264 ------
NM_001001342chr1051488 1310 1267 1191 1112 ------
NM_001001395chr1242656 2537 2085 1964 ----12578
NM_001001419chr523951 1167 21458 1221 --11056
NM_001001420chr523951 1167 21458 1221 --11056
NM_001001436chr161137 ------
NM_001001438chr211363 ------
NM_001001481chr8136 2918 292 --12193
NM_001001521chr2--1281 ----
NM_001001522chr115293 157 102 68 42 ------
NM_001001523chr121096 44 3987 900 222 ----
NM_001001549chr752778 2267 850 599 579 22215 1987 ----
NM_001001550chr752778 2267 850 599 579 22215 1987 ----
NM_001001555chr752778 2267 850 599 579 22215 1987 ----
NM_001001586chr12385 43 ------
NM_001001664chr224034 2634 --12554 1310
NM_001001668chr1944242 3736 722 68 ----21652 589
NM_001001701chr432314 2219 664 ------
NM_001001890chr2143912 1002 175 28 1271 ----
NM_001001924chr831313 619 461 ------
NM_001001925chr831313 619 461 ------
NM_001001931chr831313 619 461 ------
NM_001001974chr1022061 881 ------
NM_001002033chr17--1339 ----
NM_001002762chr1092657 2298 2161 2091 2083 1862 512 168 79 32203 2004 450 12811 --
NM_001002814chr8103168 2999 2823 2625 1358 1002 770 658 590 478 ------
NM_001002838chrX41444 1353 704 341 ------
NM_001002860chr1433448 3255 562 ----1997
NM_001002909chr1731627 844 706 11669 11401 --
NM_001003406chr22133258 3251 3144 3034 2983 2891 2504 2473 1244 809 680 185 175 32527 2224 766 --1791
NM_001003407chr1075004 1896 1793 1442 1366 837 608 34042 925 792 ----
NM_001003408chr1075004 1896 1793 1442 1366 837 608 34042 925 792 ----
NM_001003652chr1888664 7204 6325 5835 2442 1950 866 733 17586 --18187
NM_001003674chr1896464 6304 4477 2486 2054 1278 733 550 63 15585 12305 --
NM_001003675chr1896464 6304 4477 2486 2054 1278 733 550 63 15585 12305 --
NM_001003676chr1171040 928 769 730 722 649 277 1679 ----
NM_001003677chr115596 484 205 73 53 2235 130 1175 --
NM_001003679chr1----12078 --
NM_001003681chr2231543 1494 668 11925 ----
NM_001003682chr141371 1097 363 259 173 --1279
NM_001003698chr641625 1543 1422 174 1661 --11689
NM_001003699chr641625 1543 1422 174 1661 --11689
NM_001003799chr72634 578 ------
NM_001003800chr95908 604 597 303 196 2879 745 ----
NM_001003810chr41127 ------
NM_001003845chr2--1484 ----
NM_001003894chrY2208 88 ------
NM_001003940chr1573634 3547 3033 2886 2820 1305 609 53769 3572 3134 731 541 23149 2502 12553
NM_001003942chr1573634 3547 3033 2886 2820 1305 609 53769 3572 3134 731 541 23149 2502 12553
NM_001003943chr1573638 3551 3037 2890 2824 1309 613 53773 3576 3138 735 545 23153 2506 12557
NM_001003945chr941902 1863 1637 143 ------
NM_001004051chrX149 ------
NM_001004065chr933693 335 174 23229 2427 12890 --
NM_001004128chr13230 223 53 129 ----
NM_001004304chr1273037 2277 2129 2083 808 798 730 12637 2519 243 1160
NM_001004317chr623888 953 13556 13294 13082
NM_001004356chr431502 1175 1101 11214 1148 11463
NM_001004358chr431502 1175 1101 11214 1148 11463
NM_001004419chr1221809 615 33591 626 92 ----
NM_001004441chr52261 108 ------
NM_001005158chr3186 ------
NM_001005159chr3186 ------
NM_001005266chr152635 151 ------
NM_001005267chr152635 151 ------
NM_001005268chr152635 151 ------
NM_001005269chr152635 151 ------
NM_001005271chr175736 339 147 83 33 ------
NM_001005273chr175736 339 147 83 33 ------
NM_001005335chr19--123 ----
NM_001005336chr95482 449 386 174 62 2163 56 ----
NM_001005366chr121747 ------
NM_001005375chrY41784 1376 1188 1154 ------
NM_001005386chr242329 2212 2162 1713 ------
NM_001005408chr17--1175 ----
NM_001005415chr191459 ------
NM_001005416chr191459 ------
NM_001005417chr14284 251 208 135 3653 521 258 ----
NM_001005473chr521429 848 16137 ----
NM_001005502chr1275102 4931 4373 4185 3914 945 868 23187 1882 11036 --
NM_001005505chr32497 91 1166 ----
NM_001005609chrX43502 3201 2353 1029 22734 215 33476 3386 1061 --
NM_001005785chrY41784 1376 1188 1154 ------
NM_001005786chrY41784 1376 1188 1154 ------
NM_001005861chr31719 ------
NM_001006115chr3142603 2273 2234 2148 2070 2033 962 942 786 681 487 389 371 148 --11790 12179
NM_001006600chr52352 340 12198 ----
NM_001006626chr7169 ------
NM_001006627chr7169 ------
NM_001006628chr7169 ------
NM_001006629chr7169 ------
NM_001006630chr7169 ------
NM_001006631chr7169 ------
NM_001006632chr7169 ------
NM_001006634chr162525 21 ------
NM_001006946chr261675 1274 546 295 121 45 31532 1525 168 1780 11566
NM_001007023chr1444797 3416 1491 1102 54449 1925 224 149 89 11604 --
NM_001007067chr82698 192 ------
NM_001007068chr82698 192 ------
NM_001007069chr82698 192 ------
NM_001007070chr82698 192 ------
NM_001007097chr944265 3746 3210 1550 13599 21864 1050 --
NM_001007098chr11274 1642 ----
NM_001007156chr1541839 1611 1277 246 21270 392 ----
NM_001007214chr11114 ------
NM_001007226chr1741341 1155 493 274 --11022 1136
NM_001007227chr1741341 1155 493 274 --11022 1136
NM_001007228chr1741341 1155 493 274 --11022 1136
NM_001007229chr1741341 1155 493 274 --11022 1136
NM_001007230chr1741341 1155 493 274 --11022 1136
NM_001007237chr111030 1796 --1268
NM_001007246chr213378 286 29 11733 ----
NM_001007277chr112822 391 ------
NM_001007466chr6104284 3855 3793 3500 2069 1625 1520 1046 869 167 24839 3906 ----
NM_001007471chr9--144 ----
NM_001007559chr1831736 1352 184 ------
NM_001007565chr31365 ------
NM_001007794chr1--1181 ----
NM_001008220chr5143869 3711 3570 3273 2807 2530 1302 784 735 665 599 412 369 255 53654 3492 2568 954 918 1620 23501 2993
NM_001008222chrX31176 1068 316 11208 11242 --
NM_001008225chr71655 ------
NM_001008392chr362997 2278 1437 1323 1139 75 13194 ----
NM_001008393chr462837 2325 2268 1968 1808 423 ----11767
NM_001008405chr731326 1204 107 ------
NM_001008407chr7121793 1688 1606 675 562 529 496 452 229 192 97 62 ------
NM_001008408chr774482 4342 1716 1378 760 718 474 21605 1030 35555 3912 1893 --
NM_001008541chr1031949 757 192 1811 ----
NM_001008541chr1031949 757 192 1811 ----
NM_001008660chr111311 ------
NM_001008701chr19112958 2602 2280 2016 1226 1084 730 610 405 144 31 ------
NM_001008711chr841603 1187 226 48 ------
NM_001008738chr542219 2127 1920 1049 ------
NM_001008777chr17--1189 ----
NM_001009184chr83480 380 205 --1197 --
NM_001009554chr443714 2902 1711 505 --14472 --
NM_001009554chr443714 2902 1711 505 --14472 --
NM_001009567chr101164 ------
NM_001009899chr354693 4206 2273 2054 1446 32088 1647 1410 15212 --
NM_001009909chr1143862 3709 1013 134 ------
NM_001009955chr13525 501 417 ------
NM_001009955chr13525 501 417 ------
NM_001009958chr73115 67 33 ------
NM_001009993chr234139 3975 1300 24245 153 13355 --
NM_001010844chr6------1168
NM_001010846chr133102 256 21 11106 23817 3570 --
NM_001010854chr141470 ------
NM_001010861chr11171 1857 12360 --
NM_001010867chr1226115 5403 5256 4956 4320 4119 4089 2667 2617 2318 2272 2227 2099 1792 1457 1418 874 786 739 652 135 113 75789 5219 1536 1370 1077 372 180 --2221 161
NM_001010888chrX54308 3877 3021 2879 530 1279 14489 --
NM_001010891chr576803 6357 5625 5199 2616 2319 2300 ------
NM_001010908chr101748 ------
NM_001010924chr101773 ------
NM_001010926chr13721 285 186 1158 --1133
NM_001010942chr123415 214 22 ------
NM_001010986chrX21551 155 --1717 --
NM_001011513chr443760 3243 2941 114 ----11300
NM_001011515chr41187 ------
NM_001011516chr41187 ------
NM_001011546chr20--1156 1601 --
NM_001011551chrX1458 ------
NM_001011554chr2041823 626 239 140 21650 1406 1828 --
NM_001011658chrX41404 700 369 87 ------
NM_001011666chr796146 5685 5658 5347 5165 4491 4142 1259 1127 26257 4551 11697 15775
NM_001011708chr252742 2654 2611 1117 1073 ----22304 2092
NM_001012267chr951554 1252 1232 666 447 21924 313 11564 --
NM_001012329chr152126 1812 1688 829 85 21823 975 22224 1936 --
NM_001012393chr1114443 23519 370 1605 --
NM_001012398chr161414 ------
NM_001012410chr32160 40 ------
NM_001012415chr96702 659 280 242 206 77 3649 575 58 ----
NM_001012426chr6143351 2659 2478 1326 1108 941 914 563 505 433 392 336 140 82 73193 2898 2792 2402 1095 94 60 12382 --
NM_001012427chr6143351 2659 2478 1326 1108 941 914 563 505 433 392 336 140 82 73193 2898 2792 2402 1095 94 60 12382 --
NM_001012755chrX84551 3375 3141 1482 1301 1026 879 627 --14616 1232
NM_001012756chr1923062 2454 --1756 --
NM_001012980chrX1184 ------
NM_001013031chr1052666 2414 965 503 399 ------
NM_001013415chr41367 --1597 --
NM_001013635chr121959 11022 ----
NM_001013690chr1272156 1756 1701 701 604 452 35 --11931 --
NM_001013693chr172687 1073 439 403 305 254 28 32437 2294 1878 11130 --
NM_001013693chr172687 1073 439 403 305 254 28 32437 2294 1878 11130 --
NM_001014443chr13227 210 31 2188 51 ----
NM_001014797chr1087877 7657 7065 5807 2802 1979 1655 1079 77705 7681 7531 6020 2811 2395 2321 25867 366 --
NM_001014831chr195717 622 589 572 34 1770 2672 528 --
NM_001014832chr195717 622 589 572 34 1770 2672 528 --
NM_001014834chr195717 622 589 572 34 1770 2672 528 --
NM_001014835chr195717 622 589 572 34 1770 2672 528 --
NM_001015045chr462278 1925 959 581 113 95 1499 ----
NM_001015053chr1761478 1133 338 219 153 146 41465 1362 1285 431 ----
NM_001015877chrX32427 1974 165 1620 ----
NM_001015881chrX2861 240 ------
NM_001017368chr17143 ------
NM_001017395chr342859 2445 2316 2247 --1674 22468 1371
NM_001017396chr221637 1600 1283 21396 397 --
NM_001017440chr7177569 7492 7438 7280 7223 6697 6603 6362 5646 5244 5218 3259 3010 2843 2245 1825 571 46716 5891 5593 2872 --12970
NM_001017535chr12112688 2644 2538 2394 2381 830 716 472 404 113 87 22696 633 ----
NM_001017924chr103952 304 44 3912 468 71 ----
NM_001017970chr1442370 2326 1887 1063 1630 ----
NM_001017979chr41165 ------
NM_001018050chr22133108 3086 3063 2785 2712 2559 2509 2435 2190 1256 1170 1075 951 12314 22519 861 --
NM_001018052chr22133108 3086 3063 2785 2712 2559 2509 2435 2190 1256 1170 1075 951 12314 22519 861 --
NM_001018057chr112550 162 ------
NM_001018060chr222237 114 186 ----
NM_001018064chr931920 1513 724 ------
NM_001018065chr975696 4989 4333 2428 1690 1259 321 14423 23736 2408 --
NM_001018066chr975696 4989 4333 2428 1690 1259 321 14423 23736 2408 --
NM_001018067chr154402 4081 4046 2009 1764 ------
NM_001018068chr154402 4081 4046 2009 1764 ------
NM_001018069chr154402 4081 4046 2009 1764 ------
NM_001018074chr523235 856 --11369 --
NM_001018075chr523235 856 --11369 --
NM_001018076chr523235 856 --11369 --
NM_001018077chr523235 856 --11369 --
NM_001018108chr1531580 1396 891 21758 59 2772 171 12095
NM_001018111chr783336 1251 1200 1064 870 570 542 446 23254 41 ----
NM_001018676chr81173 ------
NM_001018677chr81173 ------
NM_001020658chr161380 1350 1051 436 403 47 ------
NM_001020658chr161380 1350 1051 436 403 47 ------
NM_001020818chr1961579 1435 639 551 400 320 1652 ----
NM_001020819chr1961579 1435 639 551 400 320 1652 ----
NM_001020820chr1961579 1435 639 551 400 320 1652 ----
NM_001020821chr1961579 1435 639 551 400 320 1652 ----
NM_001024094chr523235 856 --11369 --
NM_001024218chr14------1577
NM_001024380chr84837 625 42 21 12034 ----
NM_001024381chr84837 625 42 21 12034 ----
NM_001024401chr16132848 2591 2207 2174 2168 994 967 911 678 618 530 370 214 12786 --12778
NM_001024455chrX42238 997 760 601 11860 ----
NM_001024460chr641230 1216 1132 1109 ------
NM_001024649chr562881 2700 2269 976 831 685 12990 12470 --
NM_001024666chrX1194 ------
NM_001024845chr13943 882 395 1357 --2845 26
NM_001024847chr321548 348 2718 711 ----
NM_001024858chr14132924 2688 2527 2270 1900 977 956 620 538 504 339 236 123 42586 2475 549 132 ----
NM_001024912chr1941555 1196 519 81 --11542 --
NM_001024937chr173772 635 597 --1275 --
NM_001024947chr51407 ------
NM_001025076chr1045223 5052 5044 2249 35163 2204 2192 32323 2302 2006 --
NM_001025077chr1046581 6410 6402 4880 26521 54 ----
NM_001025105chr511340 --1195 --
NM_001025205chr34390 354 178 21 ------
NM_001025233chr1242125 486 309 48 11059 ----
NM_001025266chr384675 3831 3543 1910 1698 1321 1049 26 ------
NM_001025366chr63695 682 23 ------
NM_001025366chr63695 682 23 ------
NM_001025367chr63695 682 23 ------
NM_001025367chr63695 682 23 ------
NM_001025368chr63695 682 23 ------
NM_001025368chr63695 682 23 ------
NM_001025369chr63711 698 39 ------
NM_001025369chr63711 698 39 ------
NM_001025370chr63695 682 23 ------
NM_001025370chr63695 682 23 ------
NM_001025389chr1131583 401 366 1444 1542 --
NM_001025390chr1131583 401 366 1444 1542 --
NM_001025579chr175931 805 748 252 173 --2412 98 --
NM_001025580chrX23441 1087 13314 24024 2963 --
NM_001025596chr11--1400 ----
NM_001029858chr641310 781 731 656 1488 23182 851 --
NM_001029859chr1152174 1652 999 871 434 135 ----
NM_001029863chr613082 22259 452 ----
NM_001029875chr552518 1998 1177 889 370 ----12196
NM_001029882chr12207 105 ------
NM_001029882chr12207 105 ------
NM_001030007chr1672664 1279 766 581 524 301 80 13691 ----
NM_001030055chr1433762 1633 1007 ------
NM_001030272chr111369 ------
NM_001030273chr111369 ------
NM_001031679chr1243223 2802 2593 152 22517 1187 12656 21015 837
NM_001031690chr753045 2403 1133 722 293 11157 --1463
NM_001031695chr2265071 4991 4067 3901 851 34 --11137 --
NM_001031710chr72731 339 ------
NM_001031711chr571597 1462 1425 1164 539 378 75 21177 237 ----
NM_001031716chr22979 249 --1308 --
NM_001031723chr4------1401
NM_001031732chr42654 481 --13494 --
NM_001031804chr1623906 1506 14287 2140 131 --
NM_001032221chr941291 1131 498 104 ------
NM_001032279chr11147 --1291 --
NM_001032280chr641335 198 75 42 ------
NM_001032283chr121233 ------
NM_001032284chr121233 ------
NM_001032288chr203429 422 124 ------
NM_001032289chrX2232 219 ------
NM_001032296chr1352565 2509 2169 1143 211 12319 22604 2495 --
NM_001032380chr1011841 11371 ----
NM_001032730chr11681 ------
NM_001032999chr20165167 5075 4871 4641 4242 4221 3428 1882 1767 1718 1480 1070 402 310 286 160 34989 3933 451 1441 --
NM_001033044chr151855 1842 1741 530 29 11769 ----
NM_001033045chr224424 325 1108 --23220 1378
NM_001033056chr151855 1842 1741 530 29 11769 ----
NM_001033059chr61636 1124 1797 --
NM_001033081chr151390 1219 682 292 284 11278 11583 --
NM_001033082chr151390 1219 682 292 284 11278 11583 --
NM_001033087chr2062839 2072 1261 892 808 502 1102 1331 12593
NM_001033117chr374392 3898 1935 1863 1855 1442 30 41664 936 244 235 14162 --
NM_001033507chr131407 1384 152 ----21889 624
NM_001033551chr17194050 3777 3709 3671 3538 3478 3390 3301 3248 3187 2935 2686 1643 1635 1022 424 362 280 238 33080 287 90 42977 2554 2524 1431 21271 932
NM_001033557chr221378 564 ------
NM_001033566chr171371 --1692 --
NM_001033568chr171371 --1692 --
NM_001033602chr1372627 2469 2238 1756 1094 90 27 ------
NM_001033677chr123387 347 34 ------
NM_001033723chr882550 2331 2201 2194 2066 1047 849 119 22379 630 --1591
NM_001033756chr62629 616 ------
NM_001033756chr62629 616 ------
NM_001033925chr1011614 ------
NM_001033952chr112241 219 ------
NM_001034954chr1072748 1187 740 513 433 359 306 22644 2359 ----
NM_001034955chr1072748 1187 740 513 433 359 306 22644 2359 ----
NM_001034956chr1072748 1187 740 513 433 359 306 22644 2359 ----
NM_001034957chr1072748 1187 740 513 433 359 306 22644 2359 ----
NM_001035chr11363 ------
NM_001035003chr411137 ------
NM_001035004chr411137 ------
NM_001035260chr10--11634 ----
NM_001037131chr23500 86 48 ------
NM_001037163chr73654 254 93 ------
NM_001037174chr221875 266 --11936 --
NM_001037290chr11--1654 ----
NM_001037317chr11171 1857 12360 --
NM_001037324chr34753 557 526 206 --1116 --
NM_001037331chr182926 649 1129 ----
NM_001037339chr111620 --21499 1153 --
NM_001037340chr111620 --21499 1153 --
NM_001037341chr111620 --21499 1153 --
NM_001037341chr111620 --21499 1153 --
NM_001037494chr121192 ------
NM_001037495chr121192 ------
NM_001037582chr45626 589 321 283 67 11132 ----
NM_001037666chr22296 25 ------
NM_001037738chr5172 ------
NM_001037954chr1132917 2246 802 1417 --12830
NM_001038493chr231356 362 318 ------
NM_001038707chr192084 1763 1721 1574 848 778 559 431 261 --1186 --
NM_001038707chr192084 1763 1721 1574 848 778 559 431 261 --1186 --
NM_001039029chr1241950 1514 539 68 --11688 --
NM_001039141chr2282541 2484 2420 2058 1039 631 451 445 1959 11095 22303 624
NM_001039199chr2054807 4017 1740 1734 1625 21643 529 21036 703 11420
NM_001039350chr771437 1430 1279 1167 338 271 168 1313 1387 --
NM_001039459chr73768 403 162 1353 2305 146 --
NM_001039538chr212728 ------
NM_001039577chr164416 3708 3070 2771 1792 371 24217 862 ----
NM_001039590chrX53970 3123 2959 2606 397 --11160 --
NM_001039591chrX53970 3123 2959 2606 397 --11160 --
NM_001039618chr1155786 5148 3768 1777 536 ----14827
NM_001039619chr14--1254 1367 --
NM_001039690chr1662198 2159 2015 1811 1490 958 1378 11939 1933
NM_001039693chr224088 1068 ----23142 2959
NM_001039709chr20165167 5075 4871 4641 4242 4221 3428 1882 1767 1718 1480 1070 402 310 286 160 34989 3933 451 1441 --
NM_001039711chr131125 1025 821 ------
NM_001039712chr131125 1025 821 ------
NM_001039771chr1431086 386 35 2413 254 1857 --
NM_001039775chr1126 ------
NM_001039840chrX35899 1807 951 ------
NM_001039905chr1561010 572 403 348 288 254 21564 180 1201 --
NM_001039916chr126486 433 389 237 190 42 1418 1845 --
NM_001039917chr126486 433 389 237 190 42 1418 1845 --
NM_001039918chr126486 433 389 237 190 42 1418 1845 --
NM_001039919chr126486 433 389 237 190 42 1418 1845 --
NM_001039920chr126486 433 389 237 190 42 1418 1845 --
NM_001039937chr1333801 2666 948 --13699 --
NM_001040002chr1761226 514 200 189 103 39 ------
NM_001040092chr81312 ------
NM_001040108chr1412972 12616 12583 --
NM_001040110chr761667 1451 1377 1288 751 707 ------
NM_001040134chr19111464 1394 1243 1040 978 577 424 341 168 59 24 31515 1162 94 1506 --
NM_001040144chr1662198 2159 2015 1811 1490 958 1378 11939 1933
NM_001040146chr1662198 2159 2015 1811 1490 958 1378 11939 1933
NM_001040151chr1154536 4146 3493 1251 513 23551 101 ----
NM_001040152chr754460 4090 4041 3640 1068 1821 25017 3525 --
NM_001040159chr4159 ------
NM_001040214chr661590 776 765 698 270 136 2708 608 ----
NM_001040284chr1624446 4438 192 14521 --
NM_001040402chr4----1361 --
NM_001040424chr211908 ------
NM_001040429chr132923 509 ------
NM_001040439chr1681440 1266 1210 965 566 483 245 21 1899 1139 --
NM_001040446chr51102 1676 12173 1749
NM_001040450chr151540 ------
NM_001040453chr151540 ------
NM_001040624chr832730 2706 2694 1192 12285 --
NM_001040625chr832730 2706 2694 1192 12285 --
NM_001040626chr832730 2706 2694 1192 12285 --
NM_001040627chr832730 2706 2694 1192 12285 --
NM_001040628chr832730 2706 2694 1192 12285 --
NM_001040629chr832730 2706 2694 1192 12285 --
NM_001040630chr832730 2706 2694 1192 12285 --
NM_001040665chr734499 3173 1148 ----13907
NM_001040712chr912925 ------
NM_001040715chr1671168 937 886 799 791 179 54 144 1390 --
NM_001042355chr1675329 4822 1745 1611 818 339 330 --23584 1545 --
NM_001042361chr101177 ------
NM_001042364chr101177 ------
NM_001042365chr101177 ------
NM_001042387chr101177 ------
NM_001042393chr101177 ------
NM_001042396chr101177 ------
NM_001042397chr101177 ------
NM_001042412chr1675329 4822 1745 1611 818 339 330 --23584 1545 --
NM_001042413chr924008 3903 42508 1606 1389 260 23131 2926 1755
NM_001042424chr462066 1071 1027 1008 596 84 42990 2059 931 236 ----
NM_001042425chr641335 198 75 42 ------
NM_001042427chr101247 ------
NM_001042453chrX--290 46 ----
NM_001042471chr17130 ------
NM_001042479chrX31711 1676 26 21324 128 1409 1401
NM_001042480chrX31711 1676 26 21324 128 1409 1401
NM_001042481chr141112 1682 12072 --
NM_001042486chr2081550 1318 1276 1261 1172 1106 525 303 ------
NM_001042492chr171416 1546 --1987
NM_001042494chr1553471 2624 1298 574 167 1145 ----
NM_001042495chr1553471 2624 1298 574 167 1145 ----
NM_001042496chr1553471 2624 1298 574 167 1145 ----
NM_001042497chr1553471 2624 1298 574 167 1145 ----
NM_001042537chrX12394 178 ----
NM_001042539chr1661010 418 290 237 223 98 2956 183 ----
NM_001042555chr122551 356 ------
NM_001042599chr297057 6342 5250 3058 2635 2597 2516 2289 1003 15335 25793 5541 --
NM_001042600chr19129 --1104 --
NM_001042610chr1661195 365 304 235 154 24 41331 967 542 256 ----
NM_001042632chr2071041 950 883 767 583 488 370 1285 --12094
NM_001042633chr2071041 950 883 767 583 488 370 1285 --12094
NM_001042683chr611434 --11211 --
NM_001042728chr126916 836 784 334 201 125 ------
NM_001043318chr1483409 3213 2723 1453 1374 720 479 248 23588 931 ----
NM_001043351chr111512 ------
NM_001044305chr621261 301 11181 ----
NM_001046chr541919 652 325 24 ------
NM_001079874chr142087 1941 1437 281 11797 1136 --
NM_001083621chr194613 3845 3268 3010 1519 1491 496 410 189 154 2614 518 --
NM_001087chr21127 ------
NM_001092chr1771885 1833 1564 617 461 430 42 62543 2036 2028 2018 195 189 ----
NM_001095chr1231512 702 61 21700 544 21350 284 1412
NM_001099678chr354552 4257 4026 2557 833 1180 --14898
NM_001100108chr186861 5262 3158 3143 2272 1792 576 498 11708 1892 15574
NM_001106chr3108149 8132 6795 3768 3170 3141 2641 1945 840 823 27311 299 17278 16724
NM_001116chr1632332 2238 584 32761 2609 131 ----
NM_001117chr1822115 35 21555 998 ----
NM_001121chr102652 229 1423 ----
NM_001122679chr51177 ------
NM_001126chr1--1118 ----
NM_001128chr1672664 1279 766 581 524 301 80 13691 ----
NM_001148chr42789 125 11837 ----
NM_001149chr1021359 923 11097 ----
NM_001156chr101586 ------
NM_001157chr102481 224 --199 --
NM_001160chr1292472 2437 2378 2054 1125 989 871 691 564 1952 ----
NM_001172chr14--1520 ----
NM_001173chr1433762 1633 1007 ------
NM_001174chrX7814 754 527 474 402 182 27 ------
NM_001178chr111369 ------
NM_001189chr47971 927 765 733 364 255 77 1126 ----
NM_001191chr20--1935 1328 --
NM_001198chr61306 ------
NM_001204chr266336 2009 1991 1460 1238 1035 ----14985
NM_001206chr922809 183 186 --12852
NM_001219chr732201 617 337 11992 11617 11858
NM_001222chr1051639 589 466 298 163 11782 11653 --
NM_001225chr11128 ------
NM_001241chr211813 --1871 --
NM_001241chr211813 --1871 --
NM_001265chr131247 ------
NM_001270chr51804 ------
NM_001278chr101193 ------
NM_001289chrX1597 ------
NM_001292chr153986 972 159 11001 ----
NM_001293chr111384 ------
NM_001299chr193334 320 109 ------
NM_001329chr102409 301 ----11604
NM_001331chr1112504 32281 681 133 ----
NM_001356chrX3941 503 187 ------
NM_001364chr1123799 292 22944 1665 --24717 3681
NM_001387chr572867 2433 2267 2069 983 557 203 22950 125 ----
NM_001389chr21--1195 ----
NM_001397chr1132501 2232 2177 2002 1996 1921 1718 996 879 717 606 584 67 4938 752 482 275 ----
NM_001399chrX43502 3201 2353 1029 22734 215 33476 3386 1061 --
NM_001406chr1771644 676 550 271 115 97 36 ------
NM_001407chr331341 624 97 ------
NM_001408chr161460 1239 1193 1120 618 399 ------
NM_001412chrX33163 499 361 --33069 2395 1249 --
NM_001417chr1221462 517 ----1484
NM_001419chr19114381 3726 3651 3487 3232 3217 3049 1713 1272 527 276 1728 ----
NM_001420chr1962928 2826 2807 2741 2370 1169 2129 109 11183 --
NM_001427chr721715 593 2676 302 1423 --
NM_001429chr22193 ------
NM_001431chr6--11190 ----
NM_001438chr12746 582 11204 ----
NM_001447chr551238 1196 525 325 113 2397 200 1167 --
NM_001448chrX21684 1465 --11169 --
NM_001449chrX11052 --1862 --
NM_001454chr17--3273 228 150 --1632
NM_001478chr123874 747 113 ------
NM_001483chr71741 ------
NM_001494chr101716 ------
NM_001497chr952056 1802 1081 573 203 --11008 11834
NM_001533chr19--123 ----
NM_001541chr111154 ------
NM_001542chr111030 1796 --1268
NM_001567chr113695 459 37 1296 --168
NM_001616chr211361 1849 21367 266 12847
NM_001618chr12294 172 ------
NM_001619chr115852 350 255 131 125 1886 --1116
NM_001634chr61636 1124 1797 --
NM_001642chr1131018 972 23 1413 ----
NM_001655chr1141877 1373 605 471 ------
NM_001659chr1232415 1657 378 11707 1268 12004
NM_001660chr31263 1309 ----
NM_001663chr1422539 620 12048 ----
NM_001668chr11498 12026 ----
NM_001670chr225609 591 523 99 29 ------
NM_001678chr1731740 1670 747 1127 11445 --
NM_001681chr121234 ------
NM_001682chr122530 365 ------
NM_001683chr332160 1900 264 ------
NM_001693chr811057 ------
NM_001695chr853530 3127 2993 598 338 24310 2950 11111 13273
NM_001706chr32182 34 ------
NM_001717chr155540 420 211 190 62 ------
NM_001723chr61214 ------
NM_001731chr121208 ------
NM_001737chr5--124 ----
NM_001741chr112241 219 ------
NM_001743chr21242 ------
NM_001746chr562881 2700 2269 976 831 685 12990 12470 --
NM_001754chr2143912 1002 175 28 1271 ----
NM_001755chr1632097 1880 339 --1779 --
NM_001759chr1244362 3738 3331 1868 ------
NM_001761chr1651354 411 341 227 159 21754 331 11531 --
NM_001773chr191361 1350 1316 1272 1203 1151 230 141 115 1958 ----
NM_001783chr193324 286 91 149 ----
NM_001798chr1221133 378 126 1221 --
NM_001810chr205631 592 572 560 234 4712 682 182 104 ----
NM_001823chr14128 ------
NM_001829chr41388 ------
NM_001833chr9------1234
NM_001839chr1264 31 ------
NM_001842chr95534 457 400 189 171 ------
NM_001858chr634318 3344 1501 ------
NM_001859chr963934 2569 1556 1538 1258 523 11472 33126 3051 2611 --
NM_001873chr42668 618 --1153 --
NM_001874chr1275102 4931 4373 4185 3914 945 868 23187 1882 11036 --
NM_001892chr511340 --1195 --
NM_001893chr171297 ------
NM_001895chr2011162 1327 ----
NM_001901chr6------3897 718 397
NM_001904chr31826 ------
NM_001923chr112586 540 ------
NM_001927chr23293 169 118 199 1457 --
NM_001931chr111221 11135 2478 265 --
NM_001933chr142438 86 --1211 --
NM_001936chr771437 1430 1279 1167 338 271 168 1313 1387 --
NM_001938chr1--1691 ----
NM_001939chrX62756 1342 1193 976 250 34 1547 21058 350 42715 1490 622 100
NM_001949chr651297 1152 1065 976 220 11105 ----
NM_001954chr64687 572 336 230 --1561 --
NM_001955chr62750 47 --2688 34 --
NM_001962chr51220 ------
NM_001967chr31405 1528 ----
NM_001969chr1443919 2936 2701 1157 12577 ----
NM_001970chr174455 169 85 57 --2415 187 --
NM_001981chr132234 874 233 1639 --1601
NM_001987chr1263230 1666 1632 1111 865 699 ------
NM_001995chr421365 587 ------
NM_001999chr511138 ------
NM_002006chr434083 1485 96 1738 ----
NM_002010chr13127 1100 ----
NM_002015chr1382924 2399 2359 2304 2234 2117 1196 590 23112 2898 ----
NM_002023chr151568 1410 1081 1067 35 ------
NM_002025chrX88617 7972 6239 5798 2852 1985 1557 279 43526 2907 2820 1342 16203 --
NM_002027chr81173 ------
NM_002031chr62765 325 ------
NM_002039chr41892 --1227 --
NM_002040chr2122604 60 ----1298
NM_002041chr151114 ------
NM_002045chr32328 89 177 1140 --
NM_002046chr12169 122 ----
NM_002048chr92339 193 2531 246 ----
NM_002062chr631274 464 227 11353 11025 --
NM_002063chrX31004 950 493 ------
NM_002065chr151855 1842 1741 530 29 11769 ----
NM_002071chr183575 467 134 2270 59 ----
NM_002072chr9--1211 ----
NM_002077chr941732 1668 1333 26 21831 263 12033 11497
NM_002080chr162861 47 ------
NM_002083chr141115 ------
NM_002086chr1721494 323 21919 1453 11412 1790
NM_002092chr454642 4230 4043 3801 3113 --13249 --
NM_002114chr6--1159 ----
NM_002126chr1752930 954 530 469 299 11633 1238 --
NM_002135chr124384 357 159 64 ------
NM_002138chr41127 ------
NM_002145chr17168 ------
NM_002146chr1751337 1317 1078 927 139 --1565 --
NM_002148chr21604 ------
NM_002158chr21275 ------
NM_002161chr9132 ------
NM_002168chr15190 183 ----
NM_002193chr271819 1655 1282 380 276 66 45 --11175 --
NM_002202chr51375 1435 ----
NM_002203chr552872 2682 1547 984 266 ------
NM_002204chr1761394 899 554 527 497 347 31301 1034 1024 ----
NM_002205chr122114 42 2381 262 ----
NM_002214chr745420 1887 1818 1280 11497 24949 4890 --
NM_002222chr32893 515 --1397 --
NM_002223chr1243807 3153 3127 28 1786 23146 145 --
NM_002224chr65786 490 201 109 91 1175 ----
NM_002236chr21302 ------
NM_002241chr172413 2277 2129 2115 1140 685 388 1884 1659 --
NM_002247chr101274 11923 1100 --
NM_002249chr11470 ------
NM_002254chr2102170 1903 1857 1723 769 612 567 430 370 292 32328 548 527 1268 --
NM_002264chr314347 14123 ----
NM_002265chr171825 ------
NM_002267chr132856 436 1728 ----
NM_002268chr31559 ------
NM_002270chr545036 3940 1502 68 126 11012 --
NM_002271chr1341509 587 439 214 ------
NM_002293chr11966 --1345 22530 1084
NM_002312chr133669 176 28 ------
NM_002313chr1075004 1896 1793 1442 1366 837 608 34042 925 792 ----
NM_002319chr771086 1075 797 741 209 179 172 3770 145 94 --1201
NM_002332chr126701 641 588 85 70 35 1515 196 --
NM_002333chr1951102 979 962 812 32 --1129 --
NM_002334chr1161748 1713 1490 260 83 57 31736 535 303 ----
NM_002336chr1264941 4762 1539 877 630 451 13385 --1857
NM_002343chr3124 138 ----
NM_002351chrX1118 1339 ----
NM_002355chr12388 36 24 --1456 --
NM_002359chr1783979 3929 3814 3154 2801 1373 464 167 13659 44247 3848 3789 716 1442
NM_002372chr51285 ------
NM_002373chr1521165 43 ----11279
NM_002374chr212728 ------
NM_002382chr1461103 1046 404 352 343 78 ------
NM_002383chr166833 345 241 113 60 46 1779 ----
NM_002387chr574726 4443 3504 3450 942 517 266 24103 612 11053 --
NM_002390chr1761661 1634 1442 350 215 159 11595 2641 360 --
NM_002398chr231379 160 70 1259 --11188
NM_002401chr1771894 1874 1795 1717 866 457 199 62229 1972 533 289 224 185 ----
NM_002419chr112380 81 128 1485 --
NM_002429chr1251385 1346 1336 1038 294 11192 1261 --
NM_002430chr2242500 2236 2147 989 12025 ----
NM_002438chr101164 ------
NM_002442chr1281404 1165 1154 658 617 596 292 158 1525 ----
NM_002444chrX31807 1728 109 1604 41309 365 165 157 --
NM_002473chr2271060 414 398 328 282 204 51 ------
NM_002479chr13494 479 35 ------
NM_002480chr12--21000 292 ----
NM_002481chr1147092 7081 6893 6825 6361 6215 6031 5680 5517 2724 1975 1640 1545 667 13051 26606 1443 12210
NM_002500chr22210 79 ------
NM_002501chr19183724 3713 3640 3396 3374 3362 3055 1492 1456 1402 1388 950 862 689 654 397 240 178 3928 213 138 21571 1515 --
NM_002507chr1761813 1607 487 311 160 117 41877 1553 384 147 31854 1692 183 --
NM_002508chr171765 1602 1243 661 522 414 383 1131 1316 11721
NM_002522chr1793192 2844 2613 2513 2506 1373 803 707 170 43648 3278 964 199 22656 2579 --
NM_002545chr1114443 23519 370 1605 --
NM_002547chrX73961 2886 2805 1153 1055 121 111 ------
NM_002568chr81344 ------
NM_002569chr1561342 1324 1219 1003 309 267 21057 274 ----
NM_002576chr111862 21172 22 ----
NM_002577chr332879 2604 234 --1502 --
NM_002578chrX----1367 --
NM_002579chr19111464 1394 1243 1040 978 577 424 341 168 59 24 31515 1162 94 1506 --
NM_002581chr964516 4503 1534 758 441 259 43654 1815 1379 252 41492 1236 974 959 --
NM_002588chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_002595chr1221563 30 1692 ----
NM_002599chr115968 926 899 809 46 1829 ----
NM_002600chr111620 --21499 1153 --
NM_002607chr7141 ------
NM_002609chr581220 666 586 571 514 433 206 35 --1483 --
NM_002613chr16104821 4768 4530 4507 4274 3871 1447 1112 479 302 53945 2160 1795 855 283 21916 623 --
NM_002629chr102690 247 ----1637
NM_002642chr1----147 --
NM_002645chr1122425 384 ------
NM_002646chr152090 1509 861 593 223 11922 ----
NM_002648chr651238 1090 1071 415 156 ------
NM_002653chr581031 841 820 660 640 324 133 81 3897 685 96 1669 --
NM_002655chr884765 4314 4182 3961 977 908 897 704 --11059 11717
NM_002657chr2073193 2881 1568 1483 1131 633 281 1195 11045 --
NM_002687chr1411179 ------
NM_002698chr19112493 1904 1193 1182 815 808 721 690 159 52 42 32869 2567 2104 22453 1023 --
NM_002705chr164688 573 143 41 ------
NM_002706chr22661 128 ------
NM_002710chr12--1376 ----
NM_002715chr521230 159 ------
NM_002716chr1142544 1335 1113 892 12992 --11246
NM_002730chr1961305 1028 387 272 264 256 3892 423 95 ----
NM_002731chr12915 469 22566 2505 ----
NM_002736chr7156 ------
NM_002745chr2273996 3011 1785 1110 652 468 208 ------
NM_002747chr1841499 1448 357 176 2300 26 2473 342 1368
NM_002753chr41103 ------
NM_002755chr152571 30 ------
NM_002760chrY55771 4542 2121 1159 63 35742 4669 1258 --21095 951
NM_002763chr1144 ------
NM_002791chr141100 ------
NM_002811chr161478 1509 ----
NM_002822chr121477 ------
NM_002824chr12--2444 339 1308 --
NM_002826chr15357 263 234 174 56 1333 ----
NM_002832chr121376 23 21546 1485 --1225
NM_002834chr1232967 2806 1071 13593 22495 1497 --
NM_002836chr201177 ------
NM_002839chr912925 ------
NM_002840chr171245 602 322 222 201 89 59 --1366 --
NM_002846chr25479 420 168 116 34 ------
NM_002847chr74589 543 117 31 ------
NM_002855chr11153429 3373 2757 2529 1452 1443 1337 1235 687 662 430 348 296 127 45 32363 839 268 ----
NM_002857chr172551 1934 1892 1826 829 700 617 31775 1037 30 ----
NM_002859chr1281637 1219 1183 1173 635 215 196 188 11523 ----
NM_002866chr194408 203 116 75 --2258 226 --
NM_002868chr1261962 757 405 391 138 108 1940 12009 --
NM_002869chr1122193 1863 --31752 440 49 --
NM_002886chr331683 1021 928 --11297 --
NM_002895chr203779 613 235 2918 887 --184
NM_002896chr111113 ------
NM_002906chr112955 803 --1774 --
NM_002911chr1971335 1250 1052 446 253 184 39 --1317 --
NM_002912chr61177 ------
NM_002918chr1971037 704 424 417 350 312 268 2293 94 ----
NM_002924chr1157 ------
NM_002942chr31324 ------
NM_002955chr641625 1543 1422 174 1661 --11689
NM_002958chr31719 ------
NM_002959chr164112 4009 3642 3357 3163 545 --13410 --
NM_002971chr3--2329 206 ----
NM_002996chr1641300 787 320 148 5801 481 289 232 142 11447 --
NM_002997chr261675 1274 546 295 121 45 31532 1525 168 1780 11566
NM_002998chr822008 1561 1737 ----
NM_003011chr941125 680 344 52 ------
NM_003012chr8132 22740 2267 ----
NM_003013chr42284 75 ------
NM_003016chr172746 634 ------
NM_003020chr152388 77 ------
NM_003026chr91191 1123 ----
NM_003028chr9233733 3529 3495 3346 3233 3110 3086 3014 2848 2443 1514 1404 1338 1270 958 695 470 461 418 340 309 218 60 43472 3071 831 799 13383 --
NM_003035chr12343 227 ------
NM_003045chr13104300 3654 3413 3367 1783 1695 1021 491 296 36 53567 3473 434 313 153 --21306 860
NM_003047chr151213 1019 157 140 99 1987 11080 --
NM_003074chr32911 866 1116 ----
NM_003075chr122123 63 ------
NM_003076chr1251478 1314 1073 581 574 21171 564 11129 --
NM_003077chr17128 ------
NM_003079chr172807 376 1239 1221 --
NM_003081chr20----149 --
NM_003088chr7121180 1042 1027 1006 938 871 727 460 419 363 228 104 1899 ----
NM_003090chr15172 ------
NM_003091chr203230 198 187 --130 --
NM_003108chr295325 2867 2812 2688 2551 2529 2028 1960 1832 11342 ----
NM_003110chr178418 338 214 194 176 78 61 37 1108 ----
NM_003113chr2----1175 --
NM_003131chr6101872 859 832 536 459 427 404 198 142 28 ------
NM_003137chr61257 12187 ----
NM_003139chr11146 1369 ----
NM_003144chr652087 1871 1834 767 436 ------
NM_003145chr11190 1172 1115 --
NM_003146chr11195 --1340 --
NM_003155chr811942 12689 12035 --
NM_003156chr1131054 913 285 2557 293 --190
NM_003164chr113571 471 464 1403 ----
NM_003173chrX41110 1080 459 181 3326 315 201 ----
NM_003174chr10--125 ----
NM_003178chr31153 ------
NM_003181chr62689 261 2176 120 ----
NM_003186chr115293 157 102 68 42 ------
NM_003189chr142437 740 729 542 41096 910 481 265 1398 --
NM_003200chr1962098 763 656 298 189 41 21920 1464 12136 22129 55
NM_003202chr561287 507 157 147 131 22 --183 --
NM_003214chr651388 1118 1053 311 268 1901 ----
NM_003216chr2283245 3163 2970 2895 2882 1020 973 529 ------
NM_003220chr641335 198 75 42 ------
NM_003221chr663085 3031 1644 617 573 464 23135 1299 1820 --
NM_003234chr342412 1957 1883 703 12087 ----
NM_003242chr321548 348 2718 711 ----
NM_003253chr211545 ------
NM_003255chr1761688 640 535 454 290 43 2699 602 ----
NM_003269chr62394 116 171 ----
NM_003275chr931435 998 244 ----1298
NM_003286chr20--171 ----
NM_003288chr2041187 1011 635 325 147 ----
NM_003305chr41137 ------
NM_003317chr143712 705 25 ------
NM_003320chr1194107 4086 3630 528 506 377 137 118 72 --11466 --
NM_003325chr222224 149 1284 ----
NM_003326chr152175 858 658 139 95 22130 945 ----
NM_003335chr3238 27 ------
NM_003337chr51483 --11754 11360
NM_003338chr101405 --11514 --
NM_003340chr411172 11088 ----
NM_003342chr1732426 2110 972 ------
NM_003345chr16--1459 ----
NM_003349chr203429 422 124 ------
NM_003359chr44961 528 395 218 ------
NM_003371chr952064 1586 670 432 55 --174 1238
NM_003376chr63695 682 23 ------
NM_003376chr63695 682 23 ------
NM_003387chr232242 1168 355 1546 ----
NM_003392chr393780 3603 3139 2883 1605 1036 701 670 25 11093 ----
NM_003394chr124656 296 173 62 ------
NM_003404chr2011847 1127 11462 --
NM_003405chr222209 23 --1532 --
NM_003406chr841886 1493 1425 1337 ------
NM_003411chrY31828 1710 131 ------
NM_003413chrX11412 ------
NM_003416chr8146 ------
NM_003430chr191647 1333 --148
NM_003439chr773379 3333 3002 1017 1001 533 196 2410 93 ----
NM_003458chr3123729 3573 3289 3057 2934 2868 2798 1618 1234 542 309 132 ------
NM_003459chr2--7716 468 165 159 153 147 47 1500 --
NM_003466chr262453 976 866 780 618 511 3742 227 61 21614 284 --
NM_003470chr1641718 1565 609 376 --21397 47 --
NM_003478chr1112445 ----11026
NM_003482chr12112263 2111 2037 1109 1101 1023 734 463 370 130 32 21720 241 1901 --
NM_003483chr1222922 1901 32537 842 218 ----
NM_003489chr2121369 257 ------
NM_003498chr1682411 1843 1112 919 822 368 346 245 ------
NM_003505chr74679 505 273 148 ------
NM_003512chr6261 21 ------
NM_003557chr121331 65 ------
NM_003559chr1783649 3533 2996 2884 2847 2841 1099 1042 33427 2572 807 33409 3035 822 --
NM_003563chr1741341 1155 493 274 --11022 1136
NM_003564chr12269 105 190 ----
NM_003566chr1233325 3011 2156 --1221 --
NM_003574chr1854903 2041 1924 1146 91 14400 --13685
NM_003576chr1352565 2509 2169 1143 211 12319 22604 2495 --
NM_003583chr122383 75 1717 ----
NM_003587chr6134 ------
NM_003590chr233144 900 578 12549 ----
NM_003603chr421798 348 --21623 1509 --
NM_003607chr1114181 3916 3802 3796 3736 3456 3448 2706 585 383 372 ------
NM_003615chr333922 2478 1246 ------
NM_003624chr1951289 1276 425 354 335 11209 11282 --
NM_003629chr13915 623 341 12976 --13159
NM_003632chr172668 33 2266 189 ----
NM_003633chr562351 2137 1881 431 298 256 1369 12378 --
NM_003644chr17165927 5485 5398 4792 4434 2252 2084 2074 2052 1949 1332 1218 783 762 493 205 26137 343 1948 1658
NM_003648chr2112573 2003 1986 1730 1674 1630 1596 916 648 483 165 12059 2428 54 --
NM_003659chr2--1957 1364 --
NM_003660chr191728 ------
NM_003663chr363169 3000 2786 2259 1187 376 ------
NM_003671chr922735 270 11081 22771 2444 --
NM_003679chr132852 879 770 12251 ----
NM_003682chr112578 121 2824 665 149 --
NM_003704chr42215 172 ------
NM_003714chr542234 1972 408 347 --22788 677 --
NM_003735chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_003736chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_003737chr115360 179 151 84 21 2124 59 ----
NM_003743chr22473 369 --11833 1389
NM_003746chr121192 ------
NM_003759chr431557 1518 577 ------
NM_003768chr141448 1265 726 183 ------
NM_003780chr14284 251 208 135 3653 521 258 ----
NM_003795chr62250 214 ------
NM_003800chr611872 1611 12108 --
NM_003806chr121217 ------
NM_003822chr112550 2507 235 1484 1577
NM_003829chr9138 ------
NM_003861chr14139 22537 2382 12103 --
NM_003873chr1051713 889 845 819 383 ----1539
NM_003887chr23915 430 352 11787 --1556
NM_003893chr104456 375 178 108 2486 58 ----
NM_003916chrX178 ------
NM_003930chr731894 1847 83 1868 ----
NM_003938chr193892 223 58 ------
NM_003939chr1053642 3537 3415 3007 414 2812 527 33865 3742 567 --
NM_003941chr722339 670 --1447 --
NM_003949chr1791851 1845 1764 1711 1546 717 637 512 22 21242 728 ----
NM_003951chrX128 ----1316
NM_003957chr1151056 300 183 143 130 1922 1834 --
NM_003958chr663196 3164 2481 2437 174 143 12743 ----
NM_003966chr576968 6300 5590 4901 4759 1068 773 17506 --13077
NM_003983chr1664139 3906 1231 611 515 368 ----13354
NM_003987chr1072091 2017 1726 811 430 327 238 31769 925 128 ----
NM_003988chr1072168 2094 1803 888 507 404 315 21846 205 ----
NM_003989chr1072027 1953 1662 747 366 263 174 31705 861 64 ----
NM_003990chr1072027 1953 1662 747 366 263 174 31705 861 64 ----
NM_004006chrX12319 1903 ----
NM_004007chrX12319 1903 ----
NM_004009chrX12319 1903 ----
NM_004010chrX12319 1903 ----
NM_004011chrX12319 1903 ----
NM_004012chrX12319 1903 ----
NM_004013chrX12319 1903 ----
NM_004014chrX12319 1903 ----
NM_004015chrX12319 1903 ----
NM_004016chrX12233 1817 ----
NM_004017chrX12319 1903 ----
NM_004018chrX12233 1817 ----
NM_004020chrX12319 1903 ----
NM_004021chrX12233 1817 ----
NM_004022chrX12233 1817 ----
NM_004023chrX12233 1817 ----
NM_004034chr101586 ------
NM_004035chr1745053 4422 3627 1659 ----23436 1876
NM_004050chr1442343 1873 1777 317 ------
NM_004056chr8------11085
NM_004060chr511080 1101 ----
NM_004068chr34390 354 178 21 ------
NM_004075chr12----1486 --
NM_004077chr1251043 469 462 384 190 21272 1142 1280 --
NM_004081chrY41784 1376 1188 1154 ------
NM_004082chr2283 40 ------
NM_004083chr12121 ------
NM_004089chrX2861 240 ------
NM_004093chr1373159 2806 2049 1076 946 591 489 ----13206
NM_004096chr103756 266 109 11633 11518 --
NM_004100chr632075 409 385 ------
NM_004111chr112510 201 --1143 --
NM_004116chr2155 ------
NM_004117chr64639 622 157 41 21742 27 1609 --
NM_004132chr1061101 1034 975 771 750 90 --11051 --
NM_004171chr1198591 6979 6248 3765 2723 2535 2059 1678 461 26294 2794 13591 --
NM_004172chr521540 139 1581 ----
NM_004185chr12213 39 --1171 --
NM_004186chr36851 613 604 307 271 153 2745 346 139 --
NM_004187chrX51103 1036 201 187 140 --1227 --
NM_004193chr10----1378 1157
NM_004200chr11122863 2759 2233 2148 1234 942 541 515 394 196 154 87 23026 177 1435 --
NM_004209chr1681046 905 886 854 848 757 258 188 2893 54 1815 1204
NM_004225chr811103 11338 ----
NM_004227chr7103060 2650 2619 2197 2038 746 719 229 136 65 1399 --32559 2318 856
NM_004228chr19----1119 --
NM_004229chrX21708 343 ------
NM_004241chr101172 ------
NM_004247chr17123 ------
NM_004248chr103622 469 137 134 ----
NM_004253chr91870 ------
NM_004261chr12833 153 ------
NM_004263chr261670 1578 1418 1376 372 97 11588 1281 --
NM_004269chr91331 123 ----
NM_004272chr51764 ------
NM_004276chr123387 347 34 ------
NM_004286chr2272838 2804 2469 2247 883 122 96 11119 ----
NM_004288chr21926 ------
NM_004293chr933838 2793 2434 ------
NM_004295chr173960 470 175 --31239 1223 181 --
NM_004302chr12162776 2610 2537 2521 2251 2216 2153 2114 893 791 445 422 280 118 101 27 --22680 2480 --
NM_004308chr1171697 1660 1373 1192 82 39 25 61771 1587 1400 716 487 285 11712 --
NM_004311chr1062989 2691 2243 2212 2146 490 1107 ----
NM_004321chr293380 3180 3151 2949 2711 2539 2453 1024 84 63255 2265 2256 1338 1148 597 1421 13527
NM_004338chr1896464 6304 4477 2486 2054 1278 733 550 63 15585 12305 --
NM_004339chr2131821 437 22 --11299 --
NM_004342chr731956 1601 661 --11438 --
NM_004349chr8--11013 ----
NM_004370chr6--21649 285 --11528
NM_004379chr231298 390 356 ------
NM_004380chr1622111 1628 12540 11853 --
NM_004387chr5296 50 ------
NM_004392chr1332586 2409 1678 ------
NM_004393chr382150 2095 1864 1845 819 717 574 354 --1883 --
NM_004395chr56579 549 299 292 95 55 --1680 --
NM_004397chr1133837 2923 931 ----13159
NM_004398chr112441 152 ------
NM_004405chr26767 360 267 244 174 132 ------
NM_004408chr93406 373 98 187 ----
NM_004416chr122966 81 11053 2197 184 --
NM_004418chr24416 211 133 87 --1567 --
NM_004420chr11162413 2379 2367 2330 2271 2218 2207 2189 2108 2097 2079 1867 967 539 282 22 42161 2051 780 551 ----
NM_004421chr17685 627 609 334 228 162 23 1783 1746 --
NM_004423chr382584 1080 931 903 870 848 623 187 22709 23 1388 22333 207
NM_004427chr14891 876 397 27 2925 265 1278 --
NM_004428chr14837 665 97 90 1143 ----
NM_004429chrX81330 1247 1075 479 454 306 299 24 ------
NM_004430chr83261 127 56 --1780 1902
NM_004432chr91631 ------
NM_004433chr131462 624 214 --186 --
NM_004436chr13517 172 141 ------
NM_004437chr173600 3530 2761 1418 605 538 484 22939 1148 2799 306 --
NM_004438chr242606 2152 1113 853 32711 2622 640 --12878
NM_004441chr34871 514 440 299 ------
NM_004444chr73283 81 74 1891 ----
NM_004451chr115672 557 546 508 133 2148 60 ----
NM_004458chrX2267 40 ------
NM_004468chr13215 200 85 2559 177 ----
NM_004474chr1144 ------
NM_004475chr1771124 1104 1092 942 923 407 342 1486 1805 --
NM_004485chr173268 2738 1412 1200 1164 671 46 23502 1700 11716 --
NM_004491chr19124219 3726 3573 3403 3145 2758 1649 1632 1504 1338 943 308 11490 ----
NM_004494chr131288 499 25 --21234 1105 --
NM_004498chr152153 131 ------
NM_004500chr1431981 1882 403 ----1173
NM_004502chr172438 371 2547 480 ----
NM_004508chr10--1739 ----
NM_004514chr1742679 2532 2474 1879 --12538 --
NM_004519chr81157 ------
NM_004520chr51180 ------
NM_004527chr1761226 514 200 189 103 39 ------
NM_004528chr1--1107 ----
NM_004529chr92273 264 1218 ----
NM_004530chr163998 399 284 --1976 --
NM_004535chr2051654 1146 701 592 197 11705 ----
NM_004555chr16196 ------
NM_004560chr93959 147 37 ------
NM_004576chr51156 ------
NM_004583chr172643 520 ------
NM_004586chrX74680 3881 3778 1363 947 866 813 14356 ----
NM_004588chr1183969 3193 2933 2908 1052 606 258 23 33120 2859 716 ----
NM_004598chr573307 2577 2394 1012 898 846 260 1330 ----
NM_004606chrX1128 ------
NM_004613chr20111530 1521 1377 1244 1179 1065 413 236 165 154 32 2458 93 31390 546 355 --
NM_004621chr111447 1145 --11248
NM_004622chr22408 179 ------
NM_004643chr141812 ------
NM_004646chr19--196 --1436
NM_004650chrX31164 502 396 ------
NM_004654chrY21173 53 ------
NM_004656chr381139 1016 962 860 849 785 281 45 31093 1082 191 11226 1103
NM_004660chrY--1181 ----
NM_004663chr153998 212 38 ------
NM_004673chr131480 1232 1048 11017 ----
NM_004686chr81339 ------
NM_004687chr171268 ------
NM_004703chr1721563 25 22415 1694 22078 1680 --
NM_004711chr22193511 3371 3353 3216 3144 2701 2530 2279 1415 1306 1102 1069 1019 869 746 371 134 103 61 1823 23564 3194 11126
NM_004715chr183522 264 71 1127 ----
NM_004723chr131008 910 763 ------
NM_004726chrX35118 1947 1506 ------
NM_004730chr542110 1925 1516 737 1174 12129 --
NM_004734chr1342918 2202 71 28 --13232 --
NM_004742chr32215 69 --1179 --
NM_004745chr855497 4960 4375 4288 1590 36035 4637 1811 25006 1635 --
NM_004747chr1021427 389 ------
NM_004748chr1523744 706 11039 11141 --
NM_004756chr1921556 1345 1402 ----
NM_004762chr1761754 1424 1308 268 106 43 1685 ----
NM_004768chr12879 132 ------
NM_004772chr541269 598 375 345 ------
NM_004774chr1742741 2209 2095 1926 ------
NM_004783chr165626 212 167 119 83 1656 ----
NM_004786chr18148 ------
NM_004789chr91449 ------
NM_004796chr1411975 1976 ----
NM_004801chr21586 --11425 --
NM_004807chr252228 829 626 599 524 41669 949 680 463 41051 546 480 410 11695
NM_004808chr101516 33013 2623 2155 --1876
NM_004815chr134146 1488 1460 24482 1026 14129 --
NM_004822chr17163526 2836 2699 1528 1429 1384 1043 1032 947 802 747 627 536 165 90 70 43984 3678 2498 392 ----
NM_004834chr223347 1129 32591 2444 316 --12746
NM_004836chr22361 47 --1264 --
NM_004845chrX64100 3888 3081 3043 1321 547 ------
NM_004849chr631122 600 385 ------
NM_004856chr151399 ------
NM_004865chr6--1138 ----
NM_004874chr81469 ------
NM_004879chr112700 269 ------
NM_004884chr1531662 547 506 21616 1143 11566 --
NM_004891chr21255 --1231 --
NM_004896chr10--11549 ----
NM_004902chr201267 ------
NM_004904chr796146 5685 5658 5347 5165 4491 4142 1259 1127 26257 4551 11697 15775
NM_004911chr74625 474 193 50 2610 582 ----
NM_004924chr191885 3394 68 60 ----
NM_004926chr144487 449 247 38 1275 ----
NM_004932chr5------11433
NM_004936chr942141 609 545 197 ----12943
NM_004943chr1910920 882 767 454 394 383 162 150 123 43 1329 1186 --
NM_004947chr331793 967 75 2757 84 ----
NM_004949chr1811546 ------
NM_004956chr733575 3252 1604 ------
NM_004958chr11652 ------
NM_004959chr961496 1487 1451 1188 1180 490 3978 972 119 1597 --
NM_004961chrX51357 1133 302 181 57 1434 ----
NM_004964chr13555 143 36 ------
NM_004965chr212492 104 --1629 --
NM_004969chr101367 ------
NM_004973chr61102 ------
NM_004976chr11225059 4510 4288 4055 4048 3873 3767 3699 3678 3298 3284 3251 3216 2016 1887 1731 1658 1569 1428 1288 829 658 44989 1998 1666 1295 34332 4174 586 --
NM_004977chr198593 586 533 449 393 223 191 152 ------
NM_004978chr151561 1422 1268 447 56 11695 1400 11091
NM_004980chr1----1207 --
NM_004981chr22139 ------
NM_004985chr1211128 ------
NM_004992chrX218256 7970 6914 6493 6468 6441 5963 5919 2999 2974 2870 2860 1795 1660 1414 1351 1163 721 673 436 427 47362 2963 1398 587 46690 5274 1501 1061 26671 576
NM_004992chrX218256 7970 6914 6493 6468 6441 5963 5919 2999 2974 2870 2860 1795 1660 1414 1351 1163 721 673 436 427 47362 2963 1398 587 46690 5274 1501 1061 26671 576
NM_004995chr145469 437 244 116 102 2447 288 ----
NM_004998chr152929 677 139 1208 --
NM_005011chr761667 1451 1377 1288 751 707 ------
NM_005023chr5149 ------
NM_005027chr1951134 1026 976 387 352 1404 1215 1952
NM_005044chrX34327 4051 3061 24298 3188 11666 1820
NM_005052chr172340 44 1270 ----
NM_005056chr1254836 3482 1220 371 171 14050 --14094
NM_005060chr121096 44 3987 900 222 ----
NM_005080chr222107 30 ------
NM_005093chr20165167 5075 4871 4641 4242 4221 3428 1882 1767 1718 1480 1070 402 310 286 160 34989 3933 451 1441 --
NM_005095chr141981 1425 590 401 --11790 --
NM_005099chr13890 224 157 1295 1394 --
NM_005103chr112287 22 ------
NM_005110chr54709 652 623 574 ------
NM_005112chr421010 321 --2328 303 --
NM_005116chr2063855 3019 700 492 391 200 34080 3655 1694 11758 --
NM_005121chr1711123 11386 ----
NM_005126chr322278 2037 ------
NM_005133chr11147 --1291 --
NM_005135chr1553471 2624 1298 574 167 1145 ----
NM_005137chr22102326 2306 1879 1734 852 731 626 600 511 83 2900 794 22109 548 --
NM_005144chr851137 1012 1001 408 318 31185 948 929 ----
NM_005146chr11152 ----2968 700
NM_005155chr63602 462 448 1656 ----
NM_005156chr944912 4738 3791 1906 ----11789
NM_005165chr174356 266 30 24 ------
NM_005168chr21503 ------
NM_005169chr114507 250 99 69 ------
NM_005180chr10--11628 ----
NM_005184chr1971435 1063 586 475 393 300 276 1983 ----
NM_005187chr16111903 1871 1839 1807 1775 1631 1573 1485 1363 1349 277 31408 1380 56 11528 --
NM_005188chr11187956 7667 7530 7360 7283 7260 6781 6745 6609 6361 5954 5546 5531 2723 2363 1614 1271 1265 48004 6590 5569 3104 15557 --
NM_005197chr1455498 3812 1697 1427 804 22402 1997 ----
NM_005202chr192183 1870 777 548 428 406 345 262 124 11435 ----
NM_005219chr571563 1438 640 418 344 232 27 ----11325
NM_005229chrX41152 1002 441 217 11264 ----
NM_005230chr121247 ------
NM_005235chr297057 6342 5250 3058 2635 2597 2516 2289 1003 15335 25793 5541 --
NM_005238chr1143539 2904 1418 1046 ------
NM_005242chr51144 --1170 --
NM_005258chr152333 71 1132 ----
NM_005261chr81133 ------
NM_005263chr1153 1337 ----
NM_005264chr101765 ------
NM_005277chr421344 213 ------
NM_005281chr11702 4893 843 287 88 1964 --
NM_005295chr71290 ------
NM_005311chr752778 2267 850 599 579 22215 1987 ----
NM_005312chr9112346 2324 2213 1977 1829 860 735 615 129 99 52 32592 2019 395 --12173
NM_005324chr1721667 1379 ------
NM_005336chr2112108 1997 1850 1611 1592 1561 1454 862 472 314 263 ------
NM_005339chr423515 968 ------
NM_005342chrX22225 497 ------
NM_005359chr1865967 4823 4102 2197 1678 1165 16450 1298 --
NM_005370chr193444 64 25 1366 1815 --
NM_005373chr151589 1509 1325 273 221 ------
NM_005374chr17112155 2141 2119 926 848 799 725 611 604 496 128 32350 2344 833 21581 98 --
NM_005375chr61953 ------
NM_005376chr1187 1111 ----
NM_005378chr24749 263 211 202 ------
NM_005384chr91205 ------
NM_005388chr921409 1297 --1107 --
NM_005392chr941589 416 292 50 21635 385 1178 --
NM_005397chr783336 1251 1200 1064 870 570 542 446 23254 41 ----
NM_005399chr164080 1095 881 712 239 126 --22921 589 1248
NM_005400chr221933 946 32657 116 110 ----
NM_005407chr143632 505 82 31370 1364 520 31263 183 144 1549
NM_005412chr121486 ------
NM_005418chr113567 530 483 ------
NM_005433chr1842601 1943 1120 861 ------
NM_005436chr1053858 2921 2579 625 308 --1740 --
NM_005439chr124398 347 122 21 ----1419
NM_005440chr1751266 1198 471 355 336 1497 13321 11099
NM_005442chr31585 ------
NM_005445chr101122 ------
NM_005456chr115537 524 450 135 34 1691 --1716
NM_005461chr202540 407 1101 2316 21 167
NM_005465chr121803 79 --11910 --
NM_005474chr1761478 1133 338 219 153 146 41465 1362 1285 431 ----
NM_005477chr1552460 2392 1821 789 707 3824 455 406 --12258
NM_005477chr1552460 2392 1821 789 707 3824 455 406 --12258
NM_005486chr172616 261 ------
NM_005487chr2231543 1494 668 11925 ----
NM_005493chr6------1583
NM_005494chr71145 ------
NM_005497chr1784948 4813 4524 1993 1872 1729 1691 925 ------
NM_005501chr1761207 466 367 340 310 160 31114 847 837 ----
NM_005502chr933069 2632 199 ------
NM_005505chr125290 125 103 63 55 1112 ----
NM_005506chr452810 2229 1845 1103 667 ----22636 291
NM_005519chr101132 ------
NM_005522chr721280 133 ------
NM_005539chr104975 459 149 49 2172 132 ----
NM_005557chr17126 ------
NM_005575chr51134 --1793 --
NM_005578chr334701 3860 1835 ------
NM_005581chr192122 62 ------
NM_005587chr153802 689 372 ------
NM_005595chr11873 ------
NM_005596chr985335 4987 1343 1102 932 626 352 339 24703 3885 ----
NM_005598chr151459 1192 1093 87 41 31619 1488 109 ----
NM_005607chr8153 1110 ----
NM_005610chr12830 137 ------
NM_005613chr13887 810 109 186 1850 --
NM_005614chr73882 781 132 ------
NM_005619chr19249 40 --157 1339
NM_005625chr82698 192 ------
NM_005626chr11164 ------
NM_005627chr6161 ----1384
NM_005637chr1831736 1352 184 ------
NM_005638chrX31346 576 223 ------
NM_005643chr62580 171 ------
NM_005647chrX43424 2717 1134 725 11154 ----
NM_005652chr161203 --155 --
NM_005660chrX3194 186 55 1205 ----
NM_005677chr331397 1058 1034 --184 --
NM_005678chr151124 1683 ----
NM_005688chr341215 917 327 65 2895 846 ----
NM_005707chr152454 385 ----11053
NM_005711chr51307 11038 ----
NM_005717chr141129 1009 828 395 ------
NM_005719chr12134 ------
NM_005721chr231044 818 325 ------
NM_005722chr242329 2212 2162 1713 ------
NM_005736chr1061569 1546 1448 1195 1073 146 1419 --1383
NM_005737chr272913 2654 2579 2513 1923 1071 576 1340 ----
NM_005740chr224703 584 575 318 2361 70 ----
NM_005746chr712780 ------
NM_005748chr1213172 --13043 11103
NM_005776chr14194 ------
NM_005801chr171195 1287 ----
NM_005803chr6--130 ----
NM_005808chr362997 2278 1437 1323 1139 75 13194 ----
NM_005811chr12184 2397 77 155 --
NM_005813chr221004 231 --11855 1790
NM_005817chr192181 28 2756 214 ----
NM_005822chr642369 728 634 133 1345 --1672
NM_005828chr17145034 4706 4097 3904 3515 3116 1719 1539 1454 1356 777 728 611 556 23952 956 --1619
NM_005832chr3--1443 ----
NM_005834chrX1234 1201 186 --
NM_005839chr11831 ----1727
NM_005840chrX57310 6292 5535 2578 43 46040 2562 2133 1558 12595 --
NM_005843chr22760 295 ------
NM_005850chr1----179 --
NM_005852chr175736 339 147 83 33 ------
NM_005853chr16--1585 ----
NM_005864chr142602 46 ------
NM_005870chr131187 ------
NM_005871chr10----1760 --
NM_005877chr2252526 1848 685 78 26 11891 ----
NM_005880chr1621641 435 ------
NM_005884chr195717 622 589 572 34 1770 2672 528 --
NM_005898chr1122990 377 --12503 --
NM_005899chr17180 ----11009
NM_005901chr1888664 7204 6325 5835 2442 1950 866 733 17586 --18187
NM_005902chr1554638 3704 1762 503 296 14279 23563 1300 23413 221
NM_005903chr523951 1167 21458 1221 --11056
NM_005904chr1831098 973 582 1459 ----
NM_005909chr554028 3924 3270 838 689 1760 ----
NM_005910chr1772847 1624 1503 1348 1114 403 81 53999 3929 2868 2686 1238 11526 13951
NM_005911chr23526 430 109 1592 1408 --
NM_005920chr1113281 3136 2802 2622 2561 2413 895 826 384 370 28 --41173 1147 870 587 --
NM_005924chr7--122 1825 --
NM_005927chr521165 402 2285 245 ----
NM_005933chr1172843 2702 2451 2105 374 233 88 3932 461 415 --1176
NM_005934chr19122073 1983 1767 1693 1049 713 404 323 299 191 114 23 11734 ----
NM_005935chr444385 1924 1274 401 157 --1215
NM_005937chr17163738 3502 3256 3119 3097 3034 2727 2571 1329 1189 1085 1074 630 181 147 68 33057 1132 606 23786 195 --
NM_005941chr832671 1303 552 ------
NM_005943chr671483 1284 532 466 412 248 166 1616 21404 1389 11446
NM_005955chr165200 5190 3799 3765 1961 1484 11074 15111 --
NM_005957chr1144152 4031 3593 3491 3352 3117 1824 1519 1501 1362 1273 560 339 322 61850 1255 925 778 492 186 13466 24815 3870
NM_005962chr1031949 757 192 1811 ----
NM_005962chr1031949 757 192 1811 ----
NM_005966chr212300 ------
NM_005990chr582486 2477 2335 2010 965 465 393 123 31037 250 40 1883 12530
NM_005996chr1241001 538 166 131 11241 199 --
NM_006007chr944225 4061 3745 3488 22934 191 ----
NM_006011chr1594088 3470 3452 3374 2762 2646 1244 1232 408 53919 2753 1071 551 315 13146 11110
NM_006022chr131397 ------
NM_006030chr32497 91 1166 ----
NM_006036chr232297 843 519 1283 11855 --
NM_006037chr264359 4192 3313 3116 2972 517 21362 208 ----
NM_006038chr2042067 1857 1360 465 125 ----
NM_006039chr1781043 940 930 808 768 381 320 303 3968 859 434 169 --
NM_006040chr161282 --1405 --
NM_006047chr2033418 3203 1085 ------
NM_006051chr5181 ------
NM_006070chr31365 ------
NM_006076chr7113037 2266 2179 1168 665 458 440 322 291 174 43 32246 2187 808 --12470
NM_006077chr102661 73 1258 2541 101 --
NM_006079chr61209 ------
NM_006085chr121120 290 ------
NM_006089chrX11315 ------
NM_006090chr1--1181 ----
NM_006091chr1561605 1321 1103 505 220 189 11277 ----
NM_006094chr81815 ------
NM_006095chr434269 3947 1782 --11673 --
NM_006107chr171431 ------
NM_006108chr1121471 213 1359 ----
NM_006109chr14--1254 1367 --
NM_006113chr142087 1941 1437 281 11797 1136 --
NM_006121chr123331 127 26 ------
NM_006122chr1521100 891 22642 964 ----
NM_006133chr1182207 1779 1697 1568 866 573 479 47 22324 884 11647 2204 117
NM_006135chr11340 ----1132
NM_006141chr1652768 2709 2088 1022 722 --21843 853 --
NM_006145chr193771 290 258 1844 ----
NM_006154chr1542673 2555 2475 1851 ------
NM_006157chr111376 ------
NM_006164chr22418 60 ------
NM_006166chr1232618 2557 762 --12197 --
NM_006167chr842010 1954 656 448 ------
NM_006180chr931920 1513 724 ------
NM_006191chr122295 283 1171 ----
NM_006201chrX91152 1111 1071 878 832 367 323 283 65 1811 ----
NM_006202chr1941737 1397 1277 743 1571 11380 --
NM_006203chr564328 4216 4154 2200 2188 2130 15455 14500 --
NM_006209chr81312 ------
NM_006224chr1732394 855 709 32273 2199 63 1796 11952
NM_006228chr8--187 --1282
NM_006238chr671777 1753 1604 1467 1402 590 85 52025 1499 741 639 116 1803 --
NM_006243chr1--1826 2794 158 --
NM_006246chr1411099 --11028 --
NM_006252chr186656 5549 5437 2767 1833 1090 1065 878 ----35174 2392 2045
NM_006256chr1----1327 --
NM_006265chr81590 ------
NM_006268chr1151101 914 888 292 235 ----2486 183
NM_006275chr20--1596 2916 802 --
NM_006279chr13847 732 713 3607 186 108 ----
NM_006282chr2054284 4014 3568 3152 1257 41418 689 31 25 --14076
NM_006288chr1191222 1122 1008 996 974 925 880 848 769 2904 34 ----
NM_006289chr92327 147 3416 337 290 1137 --
NM_006293chr155968 883 413 118 69 ------
NM_006298chr642667 975 219 144 1704 12810 --
NM_006301chr123600 519 232 ------
NM_006306chrX84972 3698 3692 1710 1087 969 294 97 11220 14054 --
NM_006317chr51654 ------
NM_006321chr352044 2025 2018 1974 378 1114 1793 1532
NM_006336chr961443 1377 1344 613 97 82 ------
NM_006350chr52378 243 ------
NM_006352chr111617 11351 1404 --
NM_006357chr22485 71 ------
NM_006359chrX12394 178 ----
NM_006361chr1751898 1570 1354 237 104 11656 11378 1310
NM_006373chr1741338 889 312 88 1883 ----
NM_006378chr93912 287 113 11082 ----
NM_006380chr1763295 3064 2810 2671 1375 222 ------
NM_006389chr1141091 948 557 532 31173 458 224 ----
NM_006390chr1211445 ------
NM_006393chr1043151 3001 1684 861 14266 11398 --
NM_006401chr9----1176 --
NM_006421chr81162 1282 ----
NM_006424chr441889 1546 1298 619 1471 ----
NM_006434chr1072748 1187 740 513 433 359 306 22644 2359 ----
NM_006440chr222308 48 ------
NM_006451chr5--1877 ----
NM_006454chr4113037 2784 2622 2530 2139 839 782 244 204 84 55 21951 121 22228 812 12934
NM_006457chr443760 3243 2941 114 ----11300
NM_006458chr111330 ------
NM_006465chr15112237 2127 1706 1507 1453 1422 864 819 809 694 678 2586 438 ----
NM_006475chr13----1193 --
NM_006482chr122383 75 1717 ----
NM_006496chr111274 ------
NM_006497chr176700 666 298 268 173 47 --1750 1548
NM_006500chr114170 100 77 48 21135 250 21006 355 1974
NM_006504chr1042430 1999 1977 779 32283 2263 1098 ----
NM_006517chrX62257 1908 1816 1753 1461 481 3746 707 151 ----
NM_006520chrX1179 ------
NM_006521chrX4914 484 440 66 31348 282 141 ----
NM_006526chr2021941 1663 --11501 --
NM_006527chr42121 34 ------
NM_006532chr1991629 1491 629 582 269 255 201 147 131 ------
NM_006538chr243869 3749 3547 1177 23651 653 ----
NM_006544chr1475469 1475 1339 1248 901 589 68 ------
NM_006546chr1786015 5509 4862 4197 2131 2002 1134 199 85613 5550 5279 4728 4286 2026 285 179 34093 2667 1373 1999
NM_006547chr711955 ------
NM_006549chr1252511 2351 1947 522 111 ----11819
NM_006558chr8--1317 ----
NM_006559chr111240 ------
NM_006560chr11--1400 ----
NM_006561chr1045223 5052 5044 2249 35163 2204 2192 32323 2302 2006 --
NM_006562chr101232 ------
NM_006565chr162926 216 11074 ----
NM_006591chr11--1682 ----
NM_006593chr24201 72 51 23 ------
NM_006599chr1646323 6300 5648 2586 17866 --16260
NM_006601chr122701 88 ------
NM_006609chr21977 21939 463 136 --
NM_006614chr331206 577 282 ------
NM_006618chr121366 1034 ------
NM_006621chr11498 --21779 596 --
NM_006624chr101551 ----11550
NM_006625chr11148 ------
NM_006625chr11148 ------
NM_006625chr11148 ------
NM_006626chr952600 2020 964 955 926 ------
NM_006629chr1812012 ----1409
NM_006646chr1342633 2048 1197 899 22806 2696 2956 552 --
NM_006650chr5143869 3711 3570 3273 2807 2530 1302 784 735 665 599 412 369 255 53654 3492 2568 954 918 1620 23501 2993
NM_006651chr471492 950 307 92 67 32 22 1227 1515 1117
NM_006653chr62153 47 ------
NM_006654chr122551 356 ------
NM_006662chr162293 101 ------
NM_006675chr12123187 3133 3016 2967 2893 2666 2529 2478 2332 463 213 148 22361 911 --12301
NM_006690chr2041773 641 393 301 22269 346 ----
NM_006695chr17--1258 ----
NM_006698chr203542 420 95 --11262 --
NM_006706chr51591 ------
NM_006720chr1075004 1896 1793 1442 1366 837 608 34042 925 792 ----
NM_006722chr322050 133 12888 --13064
NM_006738chr15144648 4308 3801 3515 2853 1667 1597 1381 1135 1011 972 937 535 245 1133 ----
NM_006744chr10144 ------
NM_006754chr71812 ------
NM_006759chr2--1281 ----
NM_006762chr131286 1163 1025 122 176 11155
NM_006766chr862116 2100 1030 947 534 388 12438 ----
NM_006769chr1--1115 ----
NM_006772chr611185 31713 1319 1085 11552 --
NM_006775chr611207 ------
NM_006777chrX22417 516 ------
NM_006791chr15----1164 --
NM_006795chr1151456 1275 1220 1082 279 171 11176 --
NM_006805chr5142 2212 80 21443 1275 11331
NM_006809chr202602 114 ------
NM_006814chr202259 238 12454 2200 139 --
NM_006819chr11--1344 ----
NM_006823chr821143 1111 --2328 291 --
NM_006826chr2------1945
NM_006827chr1442829 2781 2737 2602 ------
NM_006832chr142998 989 ------
NM_006838chr1231706 1199 668 11700 11545 --
NM_006839chr2183 ------
NM_006851chr1262840 2077 1832 902 738 318 --12281 --
NM_006852chr1752859 1152 395 219 193 12653 12777 --
NM_006856chr1221101 202 1211 ----
NM_006861chr1241879 1411 563 512 41910 1653 1593 712 ----
NM_006870chr20--1156 1601 --
NM_006873chr223031 876 ------
NM_006874chr42936 854 ------
NM_006876chr113501 211 34 ------
NM_006885chr161968 1235 ----
NM_006888chr1432654 2442 2250 11010 --1530
NM_006896chr73386 180 139 21109 360 ----
NM_006897chr121631 ------
NM_006898chr2----1584 --
NM_006902chr122394 744 --160 --
NM_006908chr71472 ----1240
NM_006924chr1753181 2907 2875 2802 1644 ------
NM_006927chr1662188 1487 1459 688 471 382 1544 1868 --
NM_006931chr1231948 1549 1452 ------
NM_006940chr1211181 2161 46 ----
NM_006941chr2241057 800 775 36 2844 199 31132 1110 828 --
NM_006943chr2052892 2657 262 218 71 22371 659 1756 --
NM_006946chr112484 175 ------
NM_006947chr4--1391 ----
NM_006981chr942666 2042 766 117 12479 ----
NM_006990chr192489 2398 2327 1952 1716 1705 1637 859 592 11924 11590 --
NM_007007chr1254416 4371 4304 1005 174 --13234 --
NM_007008chr21365 ------
NM_007011chr15166654 4644 4592 4310 4206 2478 2346 2249 2203 1871 1802 1352 1239 632 462 33 22217 174 56364 4481 2313 1978 828 --
NM_007013chr8--1309 ----
NM_007014chr16101521 1379 1351 1233 468 210 108 94 83 42 --175 21205 229
NM_007019chr202150 139 ------
NM_007030chr5145063 4480 4451 4312 4283 1789 1625 1609 1562 1510 1437 1359 876 387 54249 3441 3260 1550 209 --1442
NM_007032chr2282541 2484 2420 2058 1039 631 451 445 1959 11095 22303 624
NM_007035chr121636 ------
NM_007038chr2135941 4606 1370 --14738 --
NM_007039chr1422129 1985 --11478 --
NM_007050chr20157921 7774 7541 7135 6811 5636 5626 5097 2729 1913 1680 1033 560 134 53 36711 1843 1817 16195 25897 1866
NM_007067chr1731434 1321 1226 ------
NM_007078chr1053076 2993 2402 692 121 --1748 --
NM_007084chr132557 427 ------
NM_007096chr9------1234
NM_007114chr311336 --12245 --
NM_007124chr62635 106 192 ----
NM_007125chrY31101 537 275 ------
NM_007126chr91373 ------
NM_007146chr171813 1772 ----
NM_007162chr64508 376 235 200 --1136 --
NM_007166chr111311 ------
NM_007174chr1292215 2048 1990 1710 620 551 502 291 285 --11779 --
NM_007178chr12------1132
NM_007181chr19167 --1166 --
NM_007189chr75439 326 311 255 126 132 ----
NM_007191chr12145 ------
NM_007192chr141892 126 --1196
NM_007197chr125720 397 307 280 223 --1240 --
NM_007200chr15144648 4308 3801 3515 2853 1667 1597 1381 1135 1011 972 937 535 245 1133 ----
NM_007203chr933693 335 174 23229 2427 12890 --
NM_007212chr12874 42 ------
NM_007213chrX3187 106 73 3551 256 159 ----
NM_007214chr6--1495 ----
NM_007217chr3195 ------
NM_007249chr13118855 8720 8626 6937 5890 5867 2885 2732 2389 1815 557 26904 1520 12914 12745
NM_007271chr611652 1553 1573 --
NM_007275chr341038 902 401 124 --21150 352 --
NM_007282chr3----1796 --
NM_007286chr532099 1867 1817 2588 96 1169 --
NM_007292chr1745053 4422 3627 1659 ----23436 1876
NM_007294chr1731033 493 80 1308 11284 --
NM_007295chr1731033 493 80 1308 11284 --
NM_007296chr1731033 493 80 1308 11284 --
NM_007297chr1731033 493 80 1308 11284 --
NM_007298chr1731033 493 80 1308 11284 --
NM_007299chr1731033 493 80 1308 11284 --
NM_007300chr1731033 493 80 1308 11284 --
NM_007302chr1731033 493 80 1308 11284 --
NM_007303chr1731033 493 80 1308 11284 --
NM_007304chr1731033 493 80 1308 11284 --
NM_007305chr1731033 493 80 1308 11284 --
NM_007322chr191425 ------
NM_007327chr98912 820 475 349 321 188 125 86 1747 ----
NM_007353chr7103029 2112 2034 1850 1179 734 624 617 611 39 1533 12247 --
NM_007358chr11141 163 ----
NM_007363chrX1943 ------
NM_007365chr181677 1640 1631 1592 1457 583 198 96 21716 1700 1245 --
NM_007371chr92638 582 1563 ----
NM_012081chr512358 ------
NM_012090chr111072 ------
NM_012095chr1022281 557 --12927 --
NM_012096chr353250 3035 2631 673 441 ------
NM_012097chr221875 266 --11936 --
NM_012098chr931115 330 215 21327 971 ----
NM_012099chr1951152 1132 805 476 219 ------
NM_012104chr1163664 2830 2446 1404 808 288 21371 946 11239 --
NM_012104chr1163664 2830 2446 1404 808 288 21371 946 11239 --
NM_012120chr61400 1906 ----
NM_012124chr112780 267 ------
NM_012129chr742268 2052 1931 226 ----22119 43
NM_012134chr151862 1727 1559 1544 1236 21741 368 ----
NM_012141chr1333801 2666 948 --13699 --
NM_012153chr112861 315 ------
NM_012164chr986893 6341 5936 5923 2961 2324 464 391 56371 6180 5660 2156 1174 26782 685 --
NM_012189chr181462 ------
NM_012193chr1164524 4176 4044 3673 1513 1427 35221 4496 3784 25079 1998 --
NM_012197chr921362 207 ------
NM_012199chr174301 4143 3751 3609 1045 692 246 22872 50 33099 1474 365 --
NM_012215chr10184 11450 ----
NM_012233chr22736 336 --1982 1463
NM_012234chr332605 761 595 --11055 1846
NM_012238chr1011211 ----11112
NM_012244chr1471473 1306 713 688 622 359 189 1218 11600 --
NM_012247chr101645 ------
NM_012249chr243270 2925 824 355 ------
NM_012250chr114141 118 92 41 11348 ----
NM_012252chr754375 3780 3714 3471 281 13670 ----
NM_012264chr2281966 1684 1330 836 796 664 625 208 3601 315 69 21312 355 --
NM_012264chr2281966 1684 1330 836 796 664 625 208 3601 315 69 21312 355 --
NM_012286chrX1170 ------
NM_012287chr332774 1352 1314 13593 11486 --
NM_012288chr6145539 5331 4853 4624 4579 4545 4365 4243 2211 2165 2136 984 701 67 31650 1058 875 11235 24651 4124
NM_012290chr211678 ------
NM_012297chr4------1740
NM_012300chr531639 821 661 ------
NM_012301chr72784 206 31647 1456 143 11529 --
NM_012306chr12173429 3405 3296 3131 3032 2587 2365 2283 1309 1225 1147 1005 964 706 653 353 148 53449 3149 982 949 361 13507 12332
NM_012307chr1811000 ------
NM_012309chr1184104 3351 1561 1408 1384 1360 427 342 1841 ----
NM_012311chr10------1600
NM_012316chr165487 4486 4454 4101 1599 61 35326 3661 2069 --14190
NM_012329chr1711140 ------
NM_012330chr1021670 330 --11252 --
NM_012334chr594143 3887 3690 3654 3585 3090 1711 1594 1556 13054 --24236 3405
NM_012343chr51290 1275 ----
NM_012382chr554208 3673 3251 1484 1302 --23449 2790 --
NM_012384chr20102119 1821 1708 1700 875 817 796 643 410 21 12091 1809 --
NM_012396chr12219 170 ------
NM_012398chr19102618 2611 2014 1928 587 436 343 185 175 160 32696 446 35 11983 12893
NM_012399chr221482 --11797 1538
NM_012402chr1121290 1264 2481 54 --11300
NM_012408chr202210 136 1737 ----
NM_012419chr61265 ------
NM_012420chr1021962 24 ------
NM_012421chr11172 ------
NM_012428chr15----1142 --
NM_012446chr5144 ------
NM_012461chr142285 188 ------
NM_012471chrX31657 1463 426 21722 327 ----
NM_012475chr13227 210 31 2188 51 ----
NM_012479chr752654 1762 936 455 336 21788 219 ----
NM_012482chr12273 162 ------
NM_013229chr1292472 2437 2378 2054 1125 989 871 691 564 1952 ----
NM_013233chr2----11147 --
NM_013235chr52812 70 ------
NM_013246chr116823 331 153 115 109 64 1847 ----
NM_013247chr22571 553 ------
NM_013253chr112550 162 ------
NM_013255chr776990 6302 6079 6040 3163 2505 1800 25509 68 16334 17290
NM_013261chr423657 2990 13765 11413 --
NM_013262chr61954 1449 ----
NM_013279chr11102283 2009 1532 1443 824 730 661 595 336 119 51796 1667 775 641 450 ----
NM_013281chr2011498 ------
NM_013305chr183761 200 73 1882 1213 --
NM_013309chr1532278 1763 986 ------
NM_013313chr22103538 3407 3398 2568 2404 2284 2232 2214 908 128 11237 11182 --
NM_013314chr10--173 ----
NM_013316chr7179 ------
NM_013335chr2369 28 21 ------
NM_013341chr252742 2654 2611 1117 1073 ----22304 2092
NM_013346chrX166 ------
NM_013353chr1186 ------
NM_013372chr1513382 254 44 ----
NM_013381chr12--1700 1548 --
NM_013382chr1462009 1869 1618 843 381 195 --1718 --
NM_013386chr1123 ------
NM_013390chr911451 ------
NM_013409chr5133 ------
NM_013411chr172455 2281 2021 1782 1727 1078 995 12468 1880 --
NM_013417chr9132 ------
NM_013423chrX3302 37 21 ------
NM_013427chrX3302 37 21 ------
NM_013433chr1951922 1459 1372 766 256 1735 ----
NM_013436chr2----1732 --
NM_013437chr81134 ------
NM_013438chr921286 319 ------
NM_013444chrX2454 156 ------
NM_013447chr1942438 1089 308 240 ------
NM_013449chr122826 527 22123 1025 --22923 2176
NM_013937chr611042 --2448 378 --
NM_013951chr262453 976 866 780 618 511 3742 227 61 21614 284 --
NM_013952chr252530 943 857 695 588 3819 304 138 21691 361 --
NM_013953chr252530 943 857 695 588 3819 304 138 21691 361 --
NM_013989chr1444797 3416 1491 1102 54449 1925 224 149 89 11604 --
NM_013992chr252530 943 857 695 588 3819 304 138 21691 361 --
NM_013993chr64687 572 336 230 --1561 --
NM_013994chr64687 572 336 230 --1561 --
NM_013995chrX21956 878 ------
NM_013999chr1771263 551 237 226 140 76 21 ------
NM_014011chr222572 2011 ------
NM_014014chr21530 --1437 --
NM_014016chr31383 --1345 --
NM_014028chr632662 2235 1144 --12593 --
NM_014030chr174984 466 289 167 1390 ----
NM_014045chr142400 82 ------
NM_014048chr1665002 3913 1654 1111 867 143 34725 1844 401 13540 13674
NM_014057chr911446 ------
NM_014071chr202181 118 --1131 --
NM_014096chr112264 26 ------
NM_014106chr1522327 687 --1411 1307
NM_014112chr855318 1221 855 708 639 34717 3758 1301 13859 --
NM_014141chr774692 4601 3940 3552 1594 1455 362 24571 4134 1417 13707
NM_014154chr31474 ------
NM_014155chr11107373 6911 6709 6552 6252 5867 5646 1365 1316 422 25474 5417 --12724
NM_014157chr1643342 2683 717 57 23235 348 2442 180 --
NM_014181chr272766 2671 2275 2151 1935 1078 896 32638 2435 2011 ----
NM_014190chr481290 493 461 359 281 198 175 159 5681 567 534 187 149 21282 503 --
NM_014191chr121757 --1721 --
NM_014232chr1751479 1454 1251 310 88 --1339 2546 304
NM_014232chr1751479 1454 1251 310 88 --1339 2546 304
NM_014233chr1751790 521 269 207 45 1193 ----
NM_014240chr353376 3338 2825 2585 1659 --171 --
NM_014246chr224859 750 354 118 1697 11641 --
NM_014250chr2231543 1494 668 11925 ----
NM_014263chr1031309 480 344 ------
NM_014268chr181963 1971 --177
NM_014272chr15165 ------
NM_014275chr56816 615 214 153 95 36 --1790 --
NM_014280chr12637 116 ------
NM_014289chrX61373 1342 936 581 488 410 --1424 --
NM_014292chr22121675 1601 1489 1401 1388 684 666 602 403 380 233 87 31282 463 258 11608 --
NM_014293chr22163736 3718 3698 3592 3431 3315 3305 2837 2549 1290 1022 990 841 625 537 23 43215 821 666 632 --11582
NM_014294chr811379 ------
NM_014299chr1931944 1544 130 --21382 183 --
NM_014309chr2265061 4981 4057 3891 841 24 --11127 --
NM_014317chr101216 ------
NM_014319chr12--11483 --1355
NM_014323chr22--1275 ----
NM_014325chr1211539 ------
NM_014332chrX160 ------
NM_014342chr11--11280 --138
NM_014360chr141192 2223 112 --1612
NM_014368chr931896 1725 1330 21861 1825 ----
NM_014381chr1412972 12616 12583 --
NM_014382chr3--1165 ----
NM_014393chr811983 ----142
NM_014405chr1792196 1885 1867 1810 1682 1529 1449 115 31 32036 1631 273 ----
NM_014409chr14399 156 100 46 ------
NM_014418chr1481968 1864 1365 1298 670 470 410 284 ------
NM_014423chr544583 4302 3754 172 --14970 --
NM_014426chr202661 299 ------
NM_014454chr61913 175 ----
NM_014469chr111221 ------
NM_014470chr122604 551 2627 330 ----
NM_014472chr10154 ------
NM_014480chr193590 564 324 1157 ----
NM_014489chr112553 349 2253 227 ----
NM_014491chr71151 1128 --1976
NM_014494chr161280 11937 ----
NM_014507chr2261216 821 404 191 119 80 ------
NM_014554chr1252141 661 546 309 92 1300 ----
NM_014563chrX41404 700 369 87 ------
NM_014567chr16152 ------
NM_014571chr142053 1076 826 138 22643 2627 --1903
NM_014572chr1321118 110 ------
NM_014574chr141613 1420 ----
NM_014575chr31427 ------
NM_014577chr221101 ------
NM_014591chr1051276 1265 449 148 55 ------
NM_014601chr19131463 1393 1377 1295 1187 669 646 635 477 457 450 321 22 2220 43 11284 --
NM_014615chr1643333 3102 2711 335 ------
NM_014620chr122608 182 ------
NM_014630chr1593906 3449 3251 2659 1079 841 567 471 293 1166 13456 1947
NM_014636chr9104231 3596 3466 3420 3279 3132 1382 1195 777 189 33838 3024 924 22868 610 11113
NM_014646chr18112828 2800 2789 2485 2217 2092 1061 687 673 612 189 1600 11105 11167
NM_014661chr10103618 3317 2380 1007 902 820 623 465 202 49 --21270 1234 33484 2711 2598
NM_014665chr8132792 2738 2601 2560 2493 1231 1159 1048 1042 673 437 223 150 33325 3099 2908 ----
NM_014667chr342457 2276 1739 1673 ------
NM_014670chr231334 1105 466 ------
NM_014676chr161380 1350 1051 436 403 47 ------
NM_014677chr83495 371 308 ----1556
NM_014683chr1711547 ------
NM_014686chr1942562 343 204 97 1162 --11602
NM_014689chr21245 ------
NM_014690chr753045 2403 1133 722 293 11157 --1463
NM_014693chr34753 557 526 206 --1116 --
NM_014701chr1522245 988 ----1640
NM_014702chr612277 1844 1530 142
NM_014705chr722101 104 11830 ----
NM_014709chr2132 ------
NM_014715chr112238 31 ------
NM_014720chr1021617 85 --11225 --
NM_014726chr1761378 904 876 860 531 382 11232 ----
NM_014730chr1294909 4347 2054 1954 1923 1876 1808 1732 167 11129 55027 3960 3713 3442 983 --
NM_014730chr1294909 4347 2054 1954 1923 1876 1808 1732 167 11129 55027 3960 3713 3442 983 --
NM_014731chr2081827 1531 1439 1420 1324 1316 571 54 --11428 1169
NM_014735chrX32082 1800 413 ------
NM_014736chr15------1895
NM_014742chr2041387 583 548 469 21490 515 ----
NM_014747chr1145630 5495 5027 4210 3951 3705 3682 3626 3609 3540 1954 1520 921 812 --21928 635 21633 55
NM_014751chr841721 1679 1381 119 1810 1658 --
NM_014752chr1131518 186 113 ------
NM_014755chr233437 3201 1199 23551 2838 13490 --
NM_014759chr881552 1534 1485 1062 357 221 182 60 11259 --1436
NM_014767chr10153546 3529 3195 3188 2867 2697 2656 2560 2499 1339 941 811 662 417 288 33264 1325 624 22455 1359 --
NM_014770chr1261166 1142 1136 1089 988 146 11011 1462 --
NM_014772chr18132955 2925 2866 2257 1423 1192 819 618 368 262 256 195 88 43272 3231 2915 628 12614 21387 1008
NM_014774chr142641 2545 264 90 22451 832 ----
NM_014788chr982623 2367 1225 1219 993 496 301 25 12060 22256 723 --
NM_014790chr51398 ------
NM_014798chr1791873 1625 1584 742 731 725 590 190 172 ----1757
NM_014800chr73768 403 162 1353 2305 146 --
NM_014806chr93509 386 65 ------
NM_014810chr133521 3454 601 ------
NM_014824chr1131960 330 264 --1515 --
NM_014826chr1114181 3916 3802 3796 3736 3456 3448 2706 585 383 372 ------
NM_014827chr111314 --21470 614 --
NM_014828chr1432386 1622 781 --12372 --
NM_014830chr12143208 2927 2552 2444 1403 1390 1351 1000 946 773 512 496 310 30 3563 367 192 --11256
NM_014836chr1011841 11371 ----
NM_014838chr2272423 2272 2260 2233 2026 943 698 12783 ----
NM_014847chr1--1366 ----
NM_014849chr131103 520 96 41165 841 817 270 11199 --
NM_014850chr374392 3898 1935 1863 1855 1442 30 41664 936 244 235 14162 --
NM_014858chr131087 883 126 3949 930 202 136 --
NM_014860chr222558 2470 ------
NM_014868chr123664 316 114 ------
NM_014870chr194613 3845 3268 3010 1519 1491 496 410 189 154 2614 518 --
NM_014872chr952259 2034 1924 1854 507 12186 ----
NM_014873chr143801 1319 770 628 ------
NM_014877chr1766999 6021 5831 2853 2413 2077 36964 6849 1665 ----
NM_014883chr462278 1925 959 581 113 95 1499 ----
NM_014893chrY1732 ------
NM_014897chr1732713 2580 536 ------
NM_014898chr1922444 2246 1717 ----
NM_014899chr533118 2193 771 1747 ----
NM_014901chr571896 1417 807 691 170 157 89 3603 478 188 --1353
NM_014902chr2081550 1318 1276 1261 1172 1106 525 303 ------
NM_014903chr12--32328 2010 240 --1936
NM_014905chr231521 682 676 ------
NM_014906chr1732912 1328 28 --11414 --
NM_014909chr14153969 3794 3355 3262 2965 2937 2606 2577 939 763 631 546 265 176 142 43739 2645 741 26 ----
NM_014912chr1043136 2850 1245 508 ------
NM_014914chr23500 86 48 ------
NM_014918chr1511531 ------
NM_014921chr19112958 2602 2280 2016 1226 1084 730 610 405 144 31 ------
NM_014923chr1311802 11951 ----
NM_014931chr193661 633 462 1603 186 --
NM_014932chr311748 ------
NM_014935chr163770 3136 3024 2894 2725 217 51358 964 502 313 45 21421 107 --
NM_014938chr1261849 797 522 191 98 81 1959 --1728
NM_014941chr22122 ------
NM_014947chr162594 2096 1208 1165 1030 722 --2860 228 --
NM_014948chr2042346 457 370 303 52176 2000 1694 271 95 ----
NM_014949chr1------1336
NM_014964chr1762214 1744 1716 1682 331 186 62379 2171 1881 381 153 119 2983 956 --
NM_014974chr1041585 1534 1455 1401 ------
NM_014978chr1061476 1390 1223 641 242 116 ------
NM_014982chr1433579 1017 854 13550 1659 --
NM_014988chr421064 256 12158 12519 --
NM_014991chr443266 2092 913 815 13022 ----
NM_014992chr14143 ------
NM_014994chr15122281 2191 1985 1949 1905 1525 772 729 554 320 222 57 --1361 --
NM_014997chr742130 1982 1854 922 11975 12179 --
NM_014999chr121351 1315 11575 --
NM_015008chr342859 2445 2316 2247 --1674 22468 1371
NM_015009chr31120 ------
NM_015017chr141304 517 340 302 ------
NM_015020chr1652648 1057 404 223 186 ------
NM_015023chr1121447 1295 1249 1206 1189 1175 634 628 556 443 212 26 --1457 --
NM_015026chr1233622 1295 1224 ----13351
NM_015032chr1321939 642 ------
NM_015033chr972271 2133 1209 1074 346 46 21 32143 909 112 ----
NM_015035chr20125836 4949 4715 4601 4242 2381 2236 2113 1281 1026 994 969 35799 5064 4185 32446 1700 1456 --
NM_015039chr144078 3924 3403 51 23564 616 31678 1385 33 14132
NM_015040chr222548 677 --13259 --
NM_015042chr15124072 3816 3686 3319 3279 3256 3237 1147 1023 648 377 348 1939 --13158
NM_015051chr922936 855 --1181 --
NM_015052chr71223 ------
NM_015054chr12133 ------
NM_015059chr15143798 3651 3118 2892 2870 2828 2791 1513 1155 667 631 595 125 38 22528 27 13277 12970
NM_015063chr1991232 529 519 508 495 488 292 205 177 21312 431 ----
NM_015064chr12103076 2757 2625 2449 2222 1458 1373 1015 698 51 ------
NM_015068chr763312 2942 2893 2492 1483 1101 21362 1256 13869 --
NM_015074chr164911 4587 4389 1849 1403 146 44369 3337 3187 1649 1859 14004
NM_015075chrX112083 2071 2004 1993 1852 1442 884 864 465 377 350 62040 1609 480 472 427 279 --11552
NM_015076chr652854 1423 1380 828 161 ------
NM_015077chr17234358 4129 4108 3967 3960 3894 3863 3727 3678 3529 3014 2873 1719 1116 874 826 807 708 647 563 152 67 23 41584 1272 575 375 23129 497 --
NM_015079chr1563198 2782 2544 702 395 53 22754 2287 22841 2470 --
NM_015080chr112265 206 ------
NM_015082chr551990 1919 761 401 44 32264 1962 60 ----
NM_015092chr1634319 3665 3657 166 --11677
NM_015093chr631681 1169 721 11605 ----
NM_015094chr22224295 4268 3903 3619 3263 3089 3045 2996 2975 2955 2895 1564 1496 1468 1282 1210 830 796 568 442 243 236 64026 3463 1727 1663 1402 788 42928 1606 130 121 --
NM_015100chr131641 500 217 1592 1798 --
NM_015107chrX102171 1974 1929 1805 1739 1648 1545 916 716 573 1777 11503 1415
NM_015113chr1731768 494 159 22139 1670 1552 --
NM_015115chr4----1361 --
NM_015120chr21256 ------
NM_015125chr192224 165 ------
NM_015129chrX41257 623 101 38 1179 ----
NM_015133chr1681440 1266 1210 965 566 483 245 21 1899 1139 --
NM_015138chr1572594 2010 1128 1006 407 355 195 21824 213 32426 853 80 --
NM_015144chr1623656 309 43492 1479 847 779 ----
NM_015147chr211153 --12323 12062
NM_015150chr31148 --1251 --
NM_015155chr1032386 889 308 --1816 --
NM_015162chr15154 167 ----
NM_015171chr161412 155 ----
NM_015176chr11559 ------
NM_015185chrX62623 2615 2094 967 597 550 12511 ----
NM_015193chr8101393 1281 1107 1087 522 507 424 190 126 98 31326 1068 602 1593 --
NM_015194chr1781846 1402 658 556 443 123 108 21 1409 --11855
NM_015199chr322191 2067 ------
NM_015205chr13204104 4009 3970 3892 3734 3697 3607 3520 3410 3203 1970 1923 1458 1404 1111 836 504 387 112 57 24258 4136 23939 248 --
NM_015208chr1853554 3356 2748 1116 910 ------
NM_015215chr122291 864 12203 ----
NM_015221chr1051410 1384 1375 580 518 1973 --1386
NM_015225chr962899 2792 2714 2591 2583 724 22331 754 --13161
NM_015229chr177981 920 901 879 357 283 35 1215 ----
NM_015233chr1372627 2469 2238 1756 1094 90 27 ------
NM_015234chr631231 1111 255 --11131 --
NM_015247chr1675329 4822 1745 1611 818 339 330 --23584 1545 --
NM_015252chr21643 ------
NM_015254chr8112146 917 846 623 527 475 467 427 68 53 42 12326 193 22477 362
NM_015265chr212371 11674 12051 12058
NM_015270chr1251893 1754 1585 385 97 --11577 2679 624
NM_015271chr433085 2944 572 11305 1956 --
NM_015277chr181283 ------
NM_015278chr622104 180 12888 11374 --
NM_015284chr1112023 1921 1808 1567 819 772 508 361 335 282 86 41644 1523 1403 97 1783 --
NM_015288chr553858 2749 2494 1221 945 23832 3789 --11209
NM_015293chr61104 --1125 --
NM_015299chr14123915 3735 3590 3176 3141 2891 2833 2827 648 425 74 59 139 ----
NM_015305chr1481444 1407 1336 762 740 415 236 204 11706 1615 1598
NM_015310chr8107107 6780 6605 6220 5182 2925 2599 1916 1396 1328 37035 6618 5711 33344 3205 1943 --
NM_015313chr1134475 3826 3630 21248 141 ----
NM_015315chr5143433 3422 2921 2876 2749 2360 2201 1213 987 637 511 444 347 186 2497 75 12777 --
NM_015317chr24990 956 444 208 ------
NM_015319chr123327 311 62 ------
NM_015326chr152524 652 432 330 163 --2538 131 --
NM_015327chr171206 1121 1052 955 514 269 244 ------
NM_015328chr762237 1969 812 415 341 178 1754 ----
NM_015335chr1222220 356 --1384 1259
NM_015336chr121730 --12648 --
NM_015338chr2031361 650 149 ------
NM_015343chr17155 ------
NM_015344chr81103 --1420 --
NM_015346chr1411695 --2462 434 --
NM_015347chr121760 --12062 --
NM_015349chr682759 2540 2510 2021 1895 1189 603 346 22323 247 ----
NM_015356chr8--149 ----
NM_015365chrX23441 1087 13314 24024 2963 --
NM_015375chr144052 4044 3979 3554 21174 542 11800 14279
NM_015381chr2271900 1557 708 333 296 275 24 1821 1585 --
NM_015382chr14154 ------
NM_015385chr1072748 1187 740 513 433 359 306 22644 2359 ----
NM_015393chr422375 107 ----12951
NM_015396chr321375 953 168 11399 --
NM_015397chr91328 1727 11197 --
NM_015401chr123838 810 432 1388 2284 72 --
NM_015435chr81954 ------
NM_015444chr32225 199 ------
NM_015455chr521130 446 --1642 12936
NM_015457chr1141074 972 847 775 153 1837 --
NM_015477chr151240 1102 1675 --
NM_015481chr1241057 797 310 266 --1842 --
NM_015483chr71739 --1280 --
NM_015484chr11106 1725 ----
NM_015493chr1972050 1999 1605 1525 894 159 85 1183 --1872
NM_015497chr151783 ------
NM_015503chr161571 1597 --1214
NM_015509chr12--2605 398 ----
NM_015526chr1981405 1231 1002 907 519 130 65 34 51256 1206 1200 1093 147 1238 --
NM_015531chr11143 ------
NM_015534chr12379 28 ------
NM_015542chr102882 166 ------
NM_015550chr723581 1347 22702 2647 13078 --
NM_015553chr6124825 4568 4152 4103 3535 3466 3346 3338 3280 1840 1557 428 ------
NM_015554chr1532778 458 30 ------
NM_015557chr1143352 3069 2967 2851 2833 2787 2684 2216 983 968 584 551 508 444 33498 3446 629 33512 798 566 11379
NM_015560chr352695 2434 2291 451 73 22500 1854 ----
NM_015564chr533601 2316 2183 13339 ----
NM_015565chr2151938 1656 1441 1433 385 ------
NM_015568chr2083989 3314 2688 1443 1292 540 140 69 12787 44199 3873 3285 3140 11460
NM_015569chr131235 1137 335 1253 1480 --
NM_015570chr721336 201 1110 ----
NM_015575chr283394 3129 3041 2528 2497 1372 1013 145 22573 1242 ----
NM_015576chr311156 1910 22222 867 1448
NM_015577chr541711 1633 289 214 ------
NM_015578chr1942085 1774 1480 40 ------
NM_015605chr101177 ------
NM_015609chr172834 2757 2676 2646 2455 1953 787 1751 --11145
NM_015638chr201154 1197 1508 --
NM_015640chr154402 4081 4046 2009 1764 ------
NM_015646chr123415 214 22 ------
NM_015678chr1321099 385 ------
NM_015686chrX61839 821 487 359 321 252 3588 167 46 12369 12052
NM_015691chrX62843 2329 2281 2167 2124 2075 32087 1909 1861 ----
NM_015713chr821399 789 --1853 12689
NM_015716chr173772 635 597 --1275 --
NM_015719chr194710 331 198 184 2267 37 1788 --
NM_015726chr13547 258 196 11526 ----
NM_015845chr182678 243 ----1280
NM_015850chr852299 2223 593 389 60 1608 ----
NM_015855chr112573 274 1166 ----
NM_015872chr151547 682 584 141 126 11677 21254 727 --
NM_015879chr18108546 8362 7565 6618 5653 2875 2653 1534 351 64 15856 16609 --
NM_015881chr112550 162 ------
NM_015898chr19112478 2462 2450 2284 1810 1669 1536 893 521 334 229 ------
NM_015902chr81900 ------
NM_015906chr121497 483 --24161 3342 --
NM_015955chr22154 66 ------
NM_015963chr2275 21 ------
NM_015980chr531427 1146 495 21265 68 ----
NM_015986chr171539 ------
NM_016009chr123214 1512 23072 268 14631 --
NM_016016chr171313 1131 ----
NM_016018chr811138 ------
NM_016032chrX31176 1068 316 11208 11242 --
NM_016037chr141110 897 860 332 ------
NM_016062chr16151 ------
NM_016072chr1222255 132 12371 ----
NM_016073chr152185 98 1759 ----
NM_016081chr421763 565 ------
NM_016083chr613045 --1742 --
NM_016131chr22411 275 ------
NM_016132chr1543349 2832 751 573 1633 ----
NM_016138chr1621505 1469 ----1397
NM_016147chr114409 403 315 293 --21070 257 --
NM_016152chr3----1831 --
NM_016172chr93423 106 40 ------
NM_016185chr17--1339 ----
NM_016201chr382065 1910 903 882 787 324 221 79 2850 579 ----
NM_016206chr377504 3297 2112 1391 882 697 383 ----12272
NM_016210chr351468 1361 428 271 59 11592 ----
NM_016231chr17--1559 ----
NM_016235chr1621257 1159 --1438 --
NM_016250chr143649 183 35 ------
NM_016257chr183167 2854 2780 2470 462 137 114 102 2690 473 --1220
NM_016260chr215619 16134 22945 1985 11852
NM_016271chr1811724 ------
NM_016272chr2292821 2510 1734 1110 1008 783 740 563 461 --11950 1700
NM_016277chr6--11244 ----
NM_016284chr165951 932 871 149 105 ----1379
NM_016287chr151935 1373 833 648 445 --11858 --
NM_016289chr222333 1973 1575 11559 11661
NM_016290chr5----1103 --
NM_016329chr3186 ------
NM_016376chr1774338 4230 3714 3304 2917 2901 399 33276 1027 1009 14282 --
NM_016396chr1512614 12288 12856 --
NM_016418chr22113684 3658 3403 3233 2947 1454 986 954 440 212 34 53384 3260 2752 1001 178 ----
NM_016423chr14--1116 --1364
NM_016424chr1731936 175 149 ------
NM_016441chr231668 1529 390 ------
NM_016453chr33668 226 64 2566 32 ----
NM_016484chrX3229 85 21 --2454 287 --
NM_016485chr642242 2015 1823 1495 1168 ----
NM_016496chr191459 ------
NM_016505chr1----195 --
NM_016506chr112126 63 173 ----
NM_016507chr1722332 2064 12118 ----
NM_016522chr1131405 1182 332 1125 11322 --
NM_016530chr1563993 1432 1282 1159 1072 309 2160 78 ----
NM_016531chr443948 3647 1328 391 --22600 462 --
NM_016538chr172430 151 ------
NM_016542chrX--290 46 ----
NM_016559chr321518 125 --1536 --
NM_016569chr1241001 538 166 131 11241 199 --
NM_016574chr1171050 1008 719 276 257 229 216 162 ----
NM_016577chr394319 4093 3539 3074 2961 1314 674 580 566 23575 1091 --1513
NM_016578chr11143 ------
NM_016588chr61244 ------
NM_016596chr123838 810 432 1388 2284 72 --
NM_016603chr51619 ------
NM_016605chr5112602 2191 1731 1725 1679 1034 731 598 463 392 69 32069 713 218 1331 --
NM_016607chrX1293 ------
NM_016613chr422750 1864 22176 1102 ----
NM_016621chr11194646 4429 4140 4114 3949 3788 3573 3549 3457 3327 3316 3272 3261 3002 2943 1835 1522 800 315 1883 14158 --
NM_016655chr151114 ------
NM_016824chr102652 229 1423 ----
NM_016834chr1772847 1624 1503 1348 1114 403 81 53999 3929 2868 2686 1238 11526 13951
NM_016835chr1772847 1624 1503 1348 1114 403 81 53999 3929 2868 2686 1238 11526 13951
NM_016841chr1772847 1624 1503 1348 1114 403 81 53999 3929 2868 2686 1238 11526 13951
NM_016936chr1642040 1530 794 426 ------
NM_016946chr153224 1366 1102 1024 121 --165 --
NM_016950chr4159 ------
NM_016952chr1154002 2768 1437 555 312 --23904 3503 14055
NM_017412chr81375 ------
NM_017415chr573953 3128 1703 1162 968 829 815 24061 3434 14068 13177
NM_017420chr1432957 2438 577 159 ----
NM_017423chr421590 277 ----1108
NM_017447chr2133637 3088 788 1865 ----
NM_017455chr15----1142 --
NM_017456chr1761754 1424 1308 268 106 43 1685 ----
NM_017457chr19----1119 --
NM_017491chr421010 321 --2328 303 --
NM_017550chr1971004 902 831 771 437 416 169 1204 1334 --
NM_017551chr1081844 1818 1772 1684 560 515 359 307 --1470 --
NM_017553chr1531043 811 485 1232 ----
NM_017563chr395944 4966 4141 3909 1725 1662 723 262 82 33873 1925 701 --11880
NM_017582chr151742 1324 322 279 123 11578 ----
NM_017590chr2282687 2283 400 294 206 196 126 119 32394 595 462 --1484
NM_017592chr19122509 2415 2122 1864 788 723 611 508 288 207 168 89 51060 989 895 845 693 1481 21943 823
NM_017594chr932789 832 521 12462 ----
NM_017596chr1174349 4214 3947 3773 3689 3489 2965 2862 1760 1752 1629 1433 997 921 907 771 309 54631 3402 2973 405 217 24170 691 43352 1131 1121 948
NM_017607chr192392 154 1402 1118 --
NM_017610chr1531881 1858 1348 ------
NM_017611chr112264 26 ------
NM_017623chr261851 1813 855 675 227 121 32462 2299 586 32698 806 613 --
NM_017628chr464960 3845 3806 3300 1847 214 11185 ----
NM_017629chr111759 148 ----
NM_017633chr643083 2941 2427 92 ----13231
NM_017634chr821916 1217 ------
NM_017635chr1141540 514 237 202 ------
NM_017637chr9108949 8638 8063 7910 7869 6510 6056 3679 653 537 37952 7857 1729 28138 2867 27140 341
NM_017643chr1712307 12077 ----
NM_017649chr1061122 991 840 473 463 44 ----11283
NM_017658chr142353 65 14256 --13225
NM_017668chr163806 776 549 --1209 1223
NM_017672chr151180 11061 ----
NM_017679chr173603 62 33 1477 ----
NM_017693chr1321507 1259 ------
NM_017709chr164166 3451 3055 2825 403 68 ------
NM_017728chr17132945 2606 2564 2441 2303 2258 2208 1232 1196 1012 780 656 615 52428 2420 2101 50 44 --32333 1209 577
NM_017736chr161150 12038 --13042
NM_017737chr11708 ------
NM_017739chr11582 --158 --
NM_017742chr1831333 775 183 1454 ----
NM_017744chr132453 2027 241 ------
NM_017747chr52381 26 ------
NM_017754chr674883 4618 3434 3380 955 830 504 ------
NM_017763chr171932 2390 191 21069 478 --
NM_017770chr632325 1901 34 ------
NM_017778chr841275 1071 1056 513 ------
NM_017780chr82808 51 ------
NM_017784chr331015 436 317 1847 135 --
NM_017789chr23617 565 199 1784 2663 46 --
NM_017798chr20--176 ----
NM_017801chr352242 2072 1674 616 60 ------
NM_017810chr16183 ------
NM_017811chr932299 2034 127 32179 2124 540 181 --
NM_017813chr875544 4219 2058 1523 1474 1080 49 15003 ----
NM_017827chr193320 132 21 1120 ----
NM_017847chr141553 1513 195 174 1855 --1522
NM_017848chrX44489 3570 1725 1333 14509 ----
NM_017849chr2113134 3045 2621 2393 928 722 673 440 74 53 33 1350 3942 896 875 --
NM_017851chr1551109 1022 836 367 296 --1202 --
NM_017856chrX31711 1676 26 21324 128 1409 1401
NM_017857chr112661 100 4485 202 180 126 1457 --
NM_017860chr12364 204 ------
NM_017873chr9142961 2928 2725 2671 2661 2322 2280 2075 2067 1933 1198 1027 569 231 4783 513 430 334 1551 1594
NM_017893chr1071445 1231 997 900 466 411 167 --11138 --
NM_017902chr10154684 4446 4314 3790 3560 1838 1533 1312 1151 1044 983 903 846 630 130 45635 5406 411 272 14770 --
NM_017911chr2281470 1378 1322 1110 995 520 146 38 ------
NM_017921chr1792340 2227 2014 746 522 423 271 105 44 12080 ----
NM_017923chr42681 100 --147 1819
NM_017933chr2--1294 ----
NM_017938chrX1431 ------
NM_017944chr1112272 22370 2325 --1351
NM_017946chr71413 ----11353
NM_017955chr143495 254 247 1160 1842 --
NM_017964chr2----1704 --
NM_017966chr1171128 484 390 376 213 56 23 1433 --135
NM_017999chr14--157 ----
NM_018003chr151273 11640 11669 11696
NM_018014chr231134 338 285 1238 1103 --
NM_018017chr1042746 2450 1010 557 ------
NM_018027chr1062788 2648 2444 860 382 210 12052 21007 845 --
NM_018032chr163689 607 42 1713 ----
NM_018043chr111937 ------
NM_018045chr152642 2413 1013 441 117 12036 12054 --
NM_018048chr1231832 1390 188 ------
NM_018054chr162525 21 ------
NM_018070chr13525 501 417 ------
NM_018071chr145759 614 565 317 84 ------
NM_018072chr11179 ------
NM_018084chr212857 12510 ----
NM_018085chr1157953 7772 7437 7141 6994 6654 5334 5239 2273 1255 1042 832 282 118 60 13063 1855 24977 1935
NM_018086chr2177 31938 1579 200 ----
NM_018092chr1621046 51 ------
NM_018095chr112126 63 173 ----
NM_018107chr1451043 974 885 769 164 ----173
NM_018110chr1661283 1234 1205 1190 871 397 179 ----
NM_018116chr11463 ------
NM_018117chr102608 271 ------
NM_018121chr1062887 2222 2176 2113 1081 687 ------
NM_018126chr41318 11500 ----
NM_018131chr101292 --1737 --
NM_018133chr3191 ------
NM_018137chr121378 1272 --1132 1250
NM_018150chr15774 665 316 191 54 139 ----
NM_018157chr1222889 1115 1552 1369 2502 59
NM_018178chr1------11670
NM_018182chr1752063 1946 786 384 285 ------
NM_018191chr131488 21521 423 --12065
NM_018193chr152199 84 1261 ----
NM_018207chr151522 338 203 134 55 21662 1349 ----
NM_018208chr151141 1118 1091 1007 887 2389 54 ----
NM_018237chr101184 ------
NM_018240chr12836 192 ------
NM_018244chr2061200 954 490 255 242 209 ----1134
NM_018247chr621909 286 ------
NM_018252chr11508 ------
NM_018254chr121712 200 --1211 --
NM_018266chr321046 1015 --1354 --
NM_018299chr8136 2918 292 --12193
NM_018307chr171371 --1692 --
NM_018312chr1141967 1638 1565 253 ------
NM_018315chr41367 --1597 --
NM_018323chr411452 188 ----
NM_018325chr941462 1314 618 56 --1575 --
NM_018327chr2021853 1214 --11151 --
NM_018330chr101620 1203 ----
NM_018354chr20------135
NM_018362chr1163286 3243 2776 2738 987 874 13466 ----
NM_018364chr123346 670 ------
NM_018371chr81133 ------
NM_018374chr733916 3630 640 --15064 1312
NM_018375chr1441886 1712 1352 639 --11185 --
NM_018398chr31109 ------
NM_018400chr1154536 4146 3493 1251 513 23551 101 ----
NM_018401chr43456 122 62 --1489 --
NM_018403chr353924 3066 3000 638 388 42830 365 39 33 ----
NM_018425chr1081914 1808 1701 619 579 293 232 112 22470 220 ----
NM_018426chr68450 443 424 212 201 178 110 95 ------
NM_018429chr51968 11831 --1721
NM_018440chr877676 5486 1594 1520 1294 701 28 --17107 16303
NM_018444chr832143 483 196 ------
NM_018448chr12----11246 --
NM_018449chr92687 258 ------
NM_018462chr33802 774 79 164 ----
NM_018482chr811823 1619 2786 193 1454
NM_018486chrX1432 ------
NM_018509chr1731461 1316 281 11526 --11379
NM_018557chr22540 504 ------
NM_018566chr134596 3539 1088 13192 ----
NM_018571chr2--1518 1169 --
NM_018590chr102452 56 ------
NM_018638chr1223851 2157 15492 14753 --
NM_018640chr1242656 2537 2085 1964 ----12578
NM_018644chr11111711 1463 861 716 703 637 529 411 351 300 21 32106 1424 814 ----
NM_018650chr11451 --11645 --
NM_018667chr1682258 2250 2064 1936 1808 797 209 33 ------
NM_018674chr25588 552 546 532 505 2575 450 ----
NM_018685chr7--1245 ----
NM_018695chr52352 340 12198 ----
NM_018699chr41221 ------
NM_018710chr811355 ------
NM_018712chr111416 11057 ----
NM_018715chr172003 1946 1929 1870 1622 905 890 11533 ----
NM_018717chr47932 899 755 450 375 318 286 32611 431 165 ----
NM_018718chr71734 ------
NM_018719chr731266 896 334 ------
NM_018844chr741568 1446 1368 349 --161 --
NM_018846chr72731 339 ------
NM_018890chr71472 ----1240
NM_018896chr17----155 --
NM_018898chr52291 102 ------
NM_018899chr52291 102 ------
NM_018900chr52291 102 ------
NM_018901chr52291 102 ------
NM_018902chr52291 102 ------
NM_018903chr52291 102 ------
NM_018904chr52291 102 ------
NM_018905chr52291 102 ------
NM_018906chr52291 102 ------
NM_018907chr52291 102 ------
NM_018908chr52291 102 ------
NM_018909chr52291 102 ------
NM_018910chr52291 102 ------
NM_018911chr52291 102 ------
NM_018912chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018913chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018914chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018915chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018916chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018917chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018918chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018919chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018920chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018921chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018922chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018923chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018924chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018925chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018926chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018927chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018928chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018929chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_018948chr111059 ------
NM_018952chr172564 169 1500 ----
NM_018958chr1553761 3710 3494 2895 700 11619 23697 780 22985 534
NM_018976chr1232104 1940 982 ------
NM_018979chr123764 156 78 12220 ----
NM_018993chr2021386 1028 ------
NM_018999chr1043247 1063 568 524 1582 ----
NM_019004chr731899 780 313 ------
NM_019005chr7164 ------
NM_019022chr181786 --1146 --
NM_019027chr432349 840 740 ------
NM_019044chr273756 3703 3131 2943 1222 594 444 54480 3396 3072 1581 968 11399 --
NM_019046chr101229 --1216 1691
NM_019062chr13278 49 32 ------
NM_019063chr22786 653 ------
NM_019071chr71232 ------
NM_019102chr72323 106 ----1415
NM_019102chr72323 106 ----1415
NM_019106chr2283111 3055 2496 2463 2326 2316 2277 243 43336 2660 2432 615 ----
NM_019116chr1693483 3320 2975 2874 2865 2731 1209 796 21 1910 11231 --
NM_019593chr2093132 3086 3069 2922 2862 2194 2123 2079 322 ------
NM_019594chr921243 106 --21583 180 --
NM_019600chr151580 ------
NM_019605chr1150 ------
NM_019609chr201120 122 ----
NM_019610chr121356 135 ------
NM_019842chr6174 ------
NM_019849chr191188 1144 ----
NM_019884chr196533 147 128 98 81 71 2163 42 1435 --
NM_019885chr272055 1128 1030 907 839 661 240 3972 627 167 21105 106 --
NM_019903chr102652 229 1423 ----
NM_020039chr1231512 702 61 21700 544 21350 284 1412
NM_020066chr11875 ------
NM_020122chr245133 3968 2289 1396 25511 3992 --11248
NM_020134chr28996 913 445 305 295 217 136 119 ----1982
NM_020141chr132358 2020 331 ------
NM_020144chr731601 768 762 ------
NM_020145chr94430 216 189 59 ------
NM_020150chr101546 12111 ----
NM_020151chr221590 161 11530 140 --
NM_020177chr542997 2908 2433 695 ------
NM_020179chr111534 ----1333
NM_020182chr2032964 735 113 23447 1213 ----
NM_020194chr21103 ------
NM_020200chr102443 276 21077 29 ----
NM_020210chr153866 273 171 ----1204
NM_020211chr1571373 1236 1028 401 340 296 240 31210 1202 1114 1107 1512
NM_020235chr32316 48 ------
NM_020239chr192084 1763 1721 1574 848 778 559 431 261 --1186 --
NM_020245chr6104190 3761 3699 3406 1975 1531 1426 952 775 73 24745 3812 ----
NM_020248chr152126 1812 1688 829 85 21823 975 22224 1936 --
NM_020310chr17152540 2247 2178 1927 1809 922 862 855 848 835 482 400 393 105 23 51110 565 421 263 76 22262 1989 --
NM_020318chr1--1357 ----
NM_020337chr4------11019
NM_020338chr10113291 2921 2416 2343 1384 1175 478 458 426 148 132 22575 467 11027 --
NM_020340chr61867 11405 --192
NM_020341chr201250 ------
NM_020357chr32622 574 ------
NM_020364chrY41784 1376 1188 1154 ------
NM_020381chr621501 649 21969 1419 ----
NM_020384chrX51221 1193 509 418 256 ------
NM_020390chr364340 1724 1217 1173 1036 86 --21866 612 --
NM_020408chr63681 280 97 2711 646 ----
NM_020416chr472584 2504 793 733 599 154 21 2764 36 ----
NM_020420chrY41784 1376 1188 1154 ------
NM_020423chr11184 ------
NM_020429chr752243 435 323 257 30 2833 813 11113 --
NM_020432chr7--31541 1530 693 128 --
NM_020438chr95884 253 180 39 27 ------
NM_020440chr162953 2917 2690 2080 741 689 ----12656
NM_020452chr141480 1461 839 454 21785 250 ----
NM_020456chr1321881 1748 ------
NM_020475chr871801 1719 1701 1632 1542 1504 956 12193 32163 1888 117 --
NM_020476chr871801 1719 1701 1632 1542 1504 956 12193 32163 1888 117 --
NM_020477chr871801 1719 1701 1632 1542 1504 956 12193 32163 1888 117 --
NM_020478chr871864 1782 1764 1695 1605 1567 1019 12256 42226 1951 180 29 --
NM_020480chr861801 1719 1701 1632 1542 956 12193 32163 1888 117 --
NM_020526chr141485 1428 1186 716 41523 1397 1335 96 11745 --
NM_020532chr21365 ------
NM_020546chr582740 2576 2060 851 564 482 361 116 12305 --13094
NM_020644chr111823 1893 ----
NM_020647chr8388 77 47 1300 11886 --
NM_020651chr22557 518 ------
NM_020654chr32370 52 21322 386 ----
NM_020689chr2041340 145 82 30 21100 259 ----
NM_020690chr51218 ------
NM_020699chr165069 4769 4284 1859 1512 312 24745 3589 13838 11000
NM_020703chr11233 ------
NM_020704chr731821 501 482 22213 44 ----
NM_020708chr2072196 1843 1764 988 342 201 56 11581 2220 117 --
NM_020713chr20143052 2738 2500 2479 2416 2184 2169 1183 1034 864 801 785 163 69 42858 2825 2039 1157 2328 24 --
NM_020718chr1695471 4988 4897 4529 2590 2437 1869 1800 75 46191 5870 2019 986 ----
NM_020724chr492518 2446 2357 2229 1948 1940 1896 834 273 1670 ----
NM_020727chr2143784 2938 713 35 ----12999
NM_020728chr763209 2521 1249 1119 244 37 ----12773
NM_020734chr1211345 ------
NM_020737chr62281 232 ------
NM_020738chr221278 192 ------
NM_020739chr1523744 706 11039 11141 --
NM_020740chr171112 ------
NM_020747chr51743 ------
NM_020748chr1721612 1550 --11816 1366
NM_020749chr831313 619 461 ------
NM_020753chr177751 708 507 264 230 129 68 ------
NM_020754chr32994 158 31082 1061 921 ----
NM_020755chr621181 1129 126 ----
NM_020760chr21383 2460 304 ----
NM_020766chrX44153 3301 488 160 ----13217
NM_020768chr542636 629 396 124 22893 1282 ----
NM_020771chr621306 1193 ------
NM_020772chr1737313 7147 525 --22296 1264 --
NM_020773chr482268 2060 981 945 796 742 186 54 142 1908 --
NM_020774chr1814068 14214 11528 16055
NM_020778chr15124924 4711 4679 4484 3624 3228 1251 753 434 349 246 191 23079 1149 --24307 1379
NM_020791chr17178 21418 561 ----
NM_020792chr3231 24 ------
NM_020794chr11214 ------
NM_020795chr1751942 1713 804 542 42 --21807 364 --
NM_020796chr522305 2246 ------
NM_020801chr531783 520 255 ------
NM_020805chr1811277 ----1322
NM_020806chr14------1577
NM_020807chr1631165 543 224 31387 441 104 176 --
NM_020818chr141323 ------
NM_020830chr263128 2797 2651 918 377 57 272 43 ----
NM_020831chr225909 439 214 157 116 ------
NM_020839chr321192 63 1233 --153
NM_020845chr12102386 1865 1846 1685 1670 875 595 518 263 56 42350 701 403 223 21934 986 22248 1729
NM_020850chr1662670 2170 1228 797 735 30 13041 --143
NM_020854chr181230 ------
NM_020856chr1921237 68 --1386 --
NM_020858chr151259 ------
NM_020871chrX22303 753 1721 ----
NM_020872chr31436 ------
NM_020888chr161909 1850 1624 1456 384 303 169 --1252
NM_020896chr118914 868 425 416 407 178 39 21 --1723 --
NM_020899chr1792458 748 462 423 319 271 126 94 67 1778 ----
NM_020905chr21118 ------
NM_020922chrX41444 1353 704 341 ------
NM_020927chr1641873 384 374 97 1304 ----
NM_020939chr691357 1315 1191 1155 903 542 428 379 237 167 --11006
NM_020940chr1032612 2446 1931 ------
NM_020948chr133004 1377 675 ------
NM_020951chr1922244 1578 ------
NM_020952chr9--144 ----
NM_020956chr19214597 4409 4401 4374 4362 4261 4001 3729 2987 1616 1584 1538 1415 1351 1268 1038 966 900 545 265 246 34463 4193 1063 1663 --
NM_020962chr158869 552 525 372 363 356 290 109 21883 445 ----
NM_020967chr2041146 1082 431 29 11040 ----
NM_020972chr42814 144 122 1165 1871
NM_020977chr42789 125 11837 ----
NM_020983chr1251893 1754 1585 385 97 --11577 2679 624
NM_020987chr1021359 923 11097 ----
NM_020988chr1641346 370 361 122 ------
NM_021003chr142588 159 ------
NM_021020chr8193360 3127 3056 3022 2798 2647 2631 2544 2257 2176 1264 1192 907 870 727 689 675 552 189 32826 1148 456 --23142 2819
NM_021033chr1352688 2382 830 242 120 ------
NM_021035chr20156 ------
NM_021045chr1021937 364 1878 ----
NM_021061chr824371 1256 13561 --14296
NM_021064chr661272 1235 567 443 416 342 ------
NM_021069chr421798 348 --21623 1509 --
NM_021072chr5197 --11006 --
NM_021079chr17103061 2868 2424 1278 1053 958 949 842 544 279 22209 2167 22537 2343 --
NM_021088chr221637 1600 1283 21396 397 --
NM_021090chr22114971 4804 4722 4156 3221 1846 1584 1479 1111 1032 556 14031 34663 4268 3813 --
NM_021096chr22133258 3251 3144 3034 2983 2891 2504 2473 1244 809 680 185 175 32527 2224 766 --1791
NM_021097chr242621 2534 818 766 1943 11972 --
NM_021120chrX52844 2251 1986 150 47 43089 2988 2856 2310 12574 --
NM_021131chr951466 1433 1396 1071 948 31331 1006 937 171 --
NM_021140chrX1381 ------
NM_021145chr71967 ------
NM_021149chr1641125 992 149 84 ------
NM_021151chr73805 716 202 1267 ----
NM_021155chr1982967 2893 2867 2470 2065 1200 1028 172 1688 ----
NM_021159chr42656 274 --11431 21105 422
NM_021161chr141100 ------
NM_021165chr12705 71 1243 ----
NM_021173chr112396 31 ------
NM_021177chr61230 158 ----
NM_021183chrX1889 ------
NM_021189chr151024 903 434 309 221 ------
NM_021191chr1242374 2156 1826 1664 21848 849 --12108
NM_021198chr281268 1232 1199 516 475 414 319 200 41481 599 194 147 1327 --
NM_021202chr2032709 2295 357 12553 22848 251 12647
NM_021216chr1931089 887 195 1182 1286 --
NM_021222chr1--21113 285 ----
NM_021238chr1231466 1294 195 ------
NM_021240chr91194 ------
NM_021242chrX1656 ------
NM_021253chr61903 ------
NM_021255chr1463633 2938 2788 2495 1610 697 22685 1210 --12586
NM_021260chr1451341 1316 961 523 469 --1436 --
NM_021569chr98912 820 475 349 321 188 125 86 1747 ----
NM_021622chr1022061 881 ------
NM_021627chr33418 157 86 ------
NM_021633chr121000 362 1533 ----
NM_021638chr4104335 3996 3712 3248 1925 1807 876 831 363 333 33419 1378 26 13960 --
NM_021639chr11347 ------
NM_021647chr443714 2902 1711 505 --14472 --
NM_021648chr652111 1786 1699 909 739 --1825 --
NM_021728chr141347 ------
NM_021738chr10--125 ----
NM_021783chrX62220 762 748 344 264 24 --2880 414 --
NM_021808chr122692 482 ------
NM_021813chr665401 4890 4091 1824 1447 326 21291 299 --11777
NM_021814chr621663 496 --11306 --
NM_021831chr21273 ----136
NM_021908chr72827 101 ------
NM_021911chr535371 4392 590 34564 1477 816 ----
NM_021912chr1533171 3125 3018 11378 ----
NM_021914chr1411634 ------
NM_021923chr431502 1175 1101 11214 1148 11463
NM_021925chr231461 1316 22 11440 1721 --
NM_021931chr204818 308 144 94 ------
NM_021940chr621261 301 11181 ----
NM_021943chr682132 1882 1860 1812 1775 1450 685 53 11401 --2671 456
NM_021945chr682906 2657 1355 1177 1059 824 413 116 ------
NM_021954chr1373606 2607 2526 446 426 401 351 3653 125 100 21486 360 --
NM_021959chr64305 169 72 39 1357 1885 1747
NM_021960chr131841 1771 593 22341 461 ----
NM_021961chr11106767 5643 5291 4729 4568 2986 2758 2397 613 323 25473 2135 25839 124 --
NM_021962chr1771885 1833 1564 617 461 430 42 62543 2036 2028 2018 195 189 ----
NM_021964chr356451 4555 2587 1650 1642 14227 ----
NM_021967chr531253 995 305 2467 258 ----
NM_021984chrX51357 1133 302 181 57 1434 ----
NM_021987chrX51357 1133 302 181 57 1434 ----
NM_021988chr203429 422 124 ------
NM_021990chrX51357 1133 302 181 57 1434 ----
NM_022003chr1161133 917 446 396 104 25 ------
NM_022048chr1576070 6019 5242 4673 4025 1075 61 35544 5220 2274 ----
NM_022051chr11603 ------
NM_022060chr1451096 1083 1071 900 553 2989 927 ----
NM_022062chr1151897 1222 730 468 353 2502 200 1318 --
NM_022085chr651415 1326 1101 985 36 165 ----
NM_022090chr51548 --1516 --
NM_022091chr622238 1834 ------
NM_022107chr62524 22 1461 ----
NM_022118chr131499 ------
NM_022121chr6--1896 ----
NM_022130chr521321 302 ------
NM_022166chr16175720 5223 4532 2522 2482 2274 2110 1943 1689 1524 1281 1025 695 684 567 449 214 33915 1902 1817 ----
NM_022169chr113191 44 29 4476 356 339 52 21296 380 --
NM_022337chr111502 ------
NM_022343chr951286 938 931 918 834 11202 ----
NM_022351chr833355 3023 179 1501 ----
NM_022368chrX2113 69 ------
NM_022442chr203429 422 124 ------
NM_022458chr752858 2768 1946 972 932 12872 22720 99 --
NM_022461chr3------1200
NM_022462chr1993304 3123 3027 2577 1257 963 708 152 105 12968 1233 13578
NM_022463chr1751167 1117 630 381 120 11394 --11379
NM_022465chr1282852 2497 2139 2008 1105 1049 508 401 1386 42214 2069 808 100 --
NM_022469chr172712 2680 2313 1153 681 439 27 --1372 --
NM_022470chr31316 1949 --11164
NM_022473chr1564386 4139 4069 3585 1785 895 --22951 57 --
NM_022474chr1422721 2294 ------
NM_022476chr161414 ------
NM_022477chr2041347 1212 181 134 11487 11460 --
NM_022485chr32112 47 1141 ----
NM_022497chr34909 661 84 73 2613 592 --11125
NM_022574chr7112023 1979 1971 1924 1732 1615 1474 1366 593 453 21 2856 566 31725 641 476 21497 692
NM_022648chr294070 3817 3485 3356 3038 1573 1330 1173 265 33807 3132 1381 11054 --
NM_022658chr1231320 1113 402 ------
NM_022659chr81171 ------
NM_022719chr2283698 3112 889 774 738 567 513 361 42528 1462 1277 302 1227 --
NM_022735chr11216 --1337 11505
NM_022737chr196924 478 400 345 278 134 21153 29 ----
NM_022739chr172446 55 ------
NM_022748chr772505 2255 2218 919 374 76 45 --22352 1809 --
NM_022753chr152290 1950 1123 1021 186 ------
NM_022755chr962292 1871 1831 986 930 252 ------
NM_022756chr121365 40 ------
NM_022758chr652523 2385 2105 1221 1016 22572 1129 12580 --
NM_022763chr332283 556 82 ------
NM_022771chr121194 ------
NM_022780chr221650 594 2608 566 --11691
NM_022781chr932778 1149 93 ----11065
NM_022802chr102409 301 ----11604
NM_022810chrX128 ----1316
NM_022822chr116710 645 621 164 106 61 1193 ----
NM_022824chr5121 ------
NM_022828chr511692 ------
NM_022829chr2041823 626 239 140 21650 1406 1828 --
NM_022831chr121493 63 --11316 --
NM_022841chr1512628 ------
NM_022842chr383178 2523 2459 1144 956 749 492 309 32773 2486 2124 22491 884 --
NM_022843chr1311130 ------
NM_022845chr1632051 1834 293 --1733 --
NM_022893chr211056 181 --1109
NM_022894chr221571 662 ------
NM_022897chr52152 86 1132 --1709
NM_022898chr1464444 3252 1856 1453 847 361 14460 ----
NM_022902chr52399 383 ------
NM_022912chr232836 892 437 1175 12959 --
NM_022970chr1011084 21279 1163 ----
NM_022977chrX2267 40 ------
NM_022978chr531253 995 305 2467 258 ----
NM_023008chr192691 51 --1558 2749 243
NM_023015chr14297 211 177 118 2668 595 2305 184 --
NM_023019chr2283 40 ------
NM_023033chr121514 ------
NM_023076chr1692632 2185 2089 2016 764 740 206 152 118 22825 2359 --11114
NM_023079chr1731746 321 139 140 ----
NM_023105chr852299 2223 593 389 60 1608 ----
NM_023106chr852299 2223 593 389 60 1608 ----
NM_023110chr852299 2223 593 389 60 1608 ----
NM_023111chr852299 2223 593 389 60 1608 ----
NM_023929chr82304 221 ----12469
NM_024007chr532799 2604 565 174 ----
NM_024015chr1761108 986 905 324 209 100 ------
NM_024017chr1771474 1378 1250 1142 510 288 33 11186 1326 11272
NM_024019chr42134 66 ------
NM_024034chr201103 21054 331 1843 --
NM_024043chr1661195 365 304 235 154 24 41331 967 542 256 ----
NM_024061chr73115 67 33 ------
NM_024071chr141455 ------
NM_024072chr1241330 1071 326 86 21464 1312 ----
NM_024077chr9--1573 ----
NM_024082chrX----1103 --
NM_024085chr24844 719 318 28 2283 172 1270 2223 104
NM_024090chr431401 1280 29 1746 --1645
NM_024294chr652523 2385 2105 1221 1016 22572 1129 12580 --
NM_024297chr17--159 ----
NM_024306chr164836 773 330 217 --145 1366
NM_024332chrX2658 269 ----11381
NM_024345chr946060 4915 1294 282 35687 3941 1396 ----
NM_024408chr153017 2954 1215 553 341 22275 1430 --1505
NM_024416chr911446 ------
NM_024423chr1821513 516 24197 1400 ----
NM_024494chr12213 39 --1171 --
NM_024511chr473455 2936 2500 1089 692 433 215 ------
NM_024522chr1121792 1759 1747 1710 1674 1431 1202 770 515 498 320 94 --11657 --
NM_024525chr1--1571 ----
NM_024529chr13820 805 191 1783 ----
NM_024536chr24400 295 121 81 ------
NM_024541chr1081823 1555 1199 1179 673 635 272 24 1344 21465 1161 --
NM_024551chr1262377 2071 2042 1921 231 113 22256 97 1634 1719
NM_024551chr1262377 2071 2042 1921 231 113 22256 97 1634 1719
NM_024607chr884020 4008 3258 3186 2952 841 113 50 23389 382 13380 11113
NM_024617chr93867 836 666 ------
NM_024624chr21638 ------
NM_024626chr131545 1364 416 ------
NM_024645chr811116 11441 ----
NM_024665chr324258 3907 ----186
NM_024674chr153089 2591 2430 2205 2167 1826 --11015
NM_024689chrX41320 233 143 60 --11511 --
NM_024698chr11101237 1079 1029 1016 450 387 316 168 103 69 31101 1051 365 1251 --
NM_024721chr822435 2300 ------
NM_024740chr1163308 3242 3044 1423 459 414 13663 ----
NM_024742chr16101626 1584 1515 1477 1359 737 586 211 143 132 21909 41 ----
NM_024744chr222537 1666 --1596 --
NM_024759chr82802 761 ------
NM_024761chr984265 1817 1495 1028 505 279 239 192 11826 ----
NM_024770chr266281 5149 4852 1533 846 137 11497 11364 --
NM_024780chr161449 ------
NM_024785chr231064 499 257 1219 ----
NM_024811chr1131556 535 274 --11537 --
NM_024817chr1595246 2131 1330 854 736 548 306 99 92 11814 24294 598 --
NM_024828chr91230 ----1131
NM_024830chr572074 1590 873 802 333 59 29 ----1763
NM_024854chr1221082 534 --11472 --
NM_024874chr141271 1257 312 222 2848 121 11088 11040
NM_024884chr1474472 3992 1220 1176 815 483 395 ----1708
NM_024887chr162102 1565 1355 391 370 130 11710 1739 --
NM_024909chr61517 127 ----
NM_024911chr1146 --1784 --
NM_024920chr411187 ----1401
NM_024922chr16111892 1764 1723 1495 1442 837 809 567 418 321 111 51595 1536 1340 1317 60 2739 676 --
NM_024923chr371288 1171 1135 314 177 94 42 3995 559 117 ----
NM_024939chr1681504 1278 670 498 424 304 281 237 31019 150 144 1569 --
NM_024944chr211120 --11009 --
NM_024946chr1651614 1369 497 169 27 21649 1537 ----
NM_024947chr3119636 8347 8304 5830 3272 2463 2377 2138 1484 1468 453 ----17086
NM_024948chr101692 ------
NM_024949chr443902 1488 1049 879 14347 ----
NM_024953chr1221917 996 --1375 --
NM_024969chr2--1309 ----
NM_024971chr9--144 ----
NM_024989chr266260 5700 3116 2295 1470 1345 ----16853
NM_024991chr1072748 1187 740 513 433 359 306 22644 2359 ----
NM_024993chr211421 21008 62 ----
NM_024997chr164896 384 227 107 ------
NM_025054chr814030 ------
NM_025073chr143979 3689 1556 547 ----1590
NM_025074chr472438 2167 1142 632 574 433 244 32352 2054 402 ----
NM_025076chr21166 ------
NM_025079chr14761 178 89 37 ------
NM_025083chr1591971 1873 1784 1743 1700 1601 1574 437 249 --11483 1540
NM_025104chr1711159 --1427 --
NM_025133chr2--1976 ----
NM_025134chr1632421 1708 369 --12389 --
NM_025140chr122450 412 ------
NM_025160chr133812 3091 529 ------
NM_025164chr1141781 1613 785 452 11880 ----
NM_025165chr152352 26 --1361 --
NM_025179chr164390 3781 3007 1813 1292 982 41658 1535 1514 95 13199 --
NM_025182chr91110 1946 ----
NM_025187chr1651253 888 854 512 172 11105 ----
NM_025191chr121364 373 ------
NM_025221chr411137 ------
NM_025235chr1031863 1538 426 --11427 --
NM_025248chr1793020 3006 2895 2767 2752 2132 2119 566 356 12970 11307 --
NM_025251chr85439 275 130 111 103 11107 2214 137 --
NM_030576chr17132530 2483 2459 2310 2040 2015 1948 1750 826 358 296 283 246 32603 662 634 22184 387 --
NM_030594chr151987 ------
NM_030621chr1453903 3435 2605 1261 387 ------
NM_030625chr10----12012 --
NM_030627chr512760 21456 830 ----
NM_030629chr1631401 1343 182 ------
NM_030634chr132348 878 338 1236 1599 --
NM_030647chr775811 4553 4540 4413 4296 2312 1791 --24913 2369 --
NM_030648chr435180 1658 194 21510 569 ----
NM_030665chr1761168 1098 445 318 181 83 11023 1504 --
NM_030674chr1265242 3886 3767 887 613 49 11129 13710 --
NM_030753chr17192 ------
NM_030758chr22121233 1191 1095 930 551 494 362 325 295 203 108 44 --1348 11379
NM_030761chr152493 2483 1785 566 40 22453 650 11928 --
NM_030784chr6----172 --
NM_030795chr8169 253 44 ----
NM_030802chr173286 171 142 1618 ----
NM_030806chr1148647 8342 8232 8043 7470 6568 3551 3379 3349 3105 1572 1171 865 837 47175 6438 3464 1945 15781 23260 3017
NM_030808chr175845 719 426 166 87 --1326 --
NM_030810chr651415 1326 1101 985 36 165 ----
NM_030815chr201603 1549 ----
NM_030816chr122729 417 12629 ----
NM_030820chr63397 331 194 ------
NM_030885chr332207 1967 1750 22050 218 ----
NM_030906chr112124 105 188 --1115
NM_030912chr103771 244 46 2964 618 ----
NM_030914chr91128 1369 1612 --
NM_030915chr232181 941 207 1847 ----
NM_030918chr1144557 4493 4326 4056 3897 3775 3349 2081 1893 1711 1120 819 535 87 1943 14979 24620 4143
NM_030920chr131916 693 289 ------
NM_030938chr171139 ------
NM_030952chr171018 979 938 861 381 204 136 ------
NM_030953chr511509 ------
NM_030957chr193194 78 52 1616 ----
NM_030962chr1121198 129 1198 ----
NM_030964chr583576 3354 2995 1390 1350 1185 628 351 23347 1269 192 --
NM_030979chr131369 ------
NM_030980chr1--290 81 --1475
NM_031205chr123387 347 34 ------
NM_031216chr1821674 72 ------
NM_031262chr91346 ------
NM_031268chr16104821 4768 4530 4507 4274 3871 1447 1112 479 302 53945 2160 1795 855 283 21916 623 --
NM_031289chr123884 815 78 1283 ----
NM_031306chr1------1852
NM_031309chr8122253 2081 1955 1854 1772 891 775 449 211 169 99 48 11973 ----
NM_031314chr1431981 1882 403 ----1173
NM_031369chr41127 ------
NM_031370chr41127 ------
NM_031372chr421364 309 --1628 --
NM_031411chr52291 102 ------
NM_031417chr1961869 1029 922 881 495 138 32205 1849 1127 12790 --
NM_031431chr1311548 1624 ----
NM_031438chr51461 ----1520
NM_031439chr851508 1358 252 201 29 1130 ----
NM_031442chrX2472 409 22366 666 ----
NM_031444chr22101941 1872 854 848 657 648 623 461 283 76 2139 119 --1764
NM_031445chr261176 1021 743 731 608 384 124 22665 2495 --
NM_031453chr103830 810 80 ------
NM_031468chr7177569 7492 7438 7280 7223 6697 6603 6362 5646 5244 5218 3259 3010 2843 2245 1825 571 46716 5891 5593 2872 --12970
NM_031469chr684079 3789 3666 3381 3262 1569 1470 871 23480 1074 ----
NM_031483chr2053333 1074 905 806 402 --12255 --
NM_031492chr113403 230 201 ------
NM_031845chr212728 ------
NM_031847chr212728 ------
NM_031849chr52291 102 ------
NM_031857chr52291 102 ------
NM_031858chr17180 ----11009
NM_031860chr52291 102 ------
NM_031862chr17180 ----11009
NM_031866chr104319 242 213 199 ------
NM_031890chr22112591 2523 2093 2077 2005 1911 1891 632 518 362 41 22536 1096 22869 2338 --
NM_031908chr511129 ----1114
NM_031922chr61537 ------
NM_031934chr171319 136 ----
NM_031938chr11--1654 ----
NM_031940chr84837 625 42 21 12034 ----
NM_031964chr173389 67 43 132 ----
NM_032012chr954685 4371 3244 125 70 --23653 3560 --
NM_032013chr2041347 1212 181 134 11487 11460 --
NM_032017chr1131990 1903 1809 1752 1328 1315 732 707 694 667 499 468 456 2419 48 ----
NM_032027chr1131 ------
NM_032028chr52554 105 2608 95 1170 --
NM_032041chr832730 2706 2694 1192 12285 --
NM_032050chr22--1275 ----
NM_032052chr225967 934 920 226 99 ------
NM_032088chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_032092chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_032144chr221719 501 --21608 289 --
NM_032153chr342002 1118 904 404 ------
NM_032174chr161463 1348 1310 1206 382 73 21091 217 1478 --
NM_032199chr1043670 2490 1388 182 1123 11274 --
NM_032211chr105770 429 350 344 253 181 ----
NM_032214chr2051142 1092 936 272 61 2378 348 1165 --
NM_032233chr141843 ------
NM_032242chr393041 2190 1088 906 893 878 787 738 66 42968 2929 2571 1261 32943 2060 985 11248
NM_032268chr1663231 2474 2389 2250 1241 487 --13294 --
NM_032281chr1962928 2826 2807 2741 2370 1169 2129 109 11183 --
NM_032289chr541306 487 344 218 2246 93 21602 779 --
NM_032293chr92211 100 ------
NM_032294chr1721870 1569 2289 113 ----
NM_032316chr352410 2057 1988 1769 181 --12114 11732
NM_032324chr12169 64 ------
NM_032325chr1141513 1500 1377 787 1452 142 --
NM_032348chr14900 672 597 220 1346 1189 --
NM_032364chr124886 641 268 225 ----1694
NM_032373chr1023590 833 --45464 3710 2029 658 --
NM_032376chr172202 72 ----1660
NM_032382chr16----1536 --
NM_032389chr1151148 1019 879 206 180 ------
NM_032403chr551350 1249 641 528 437 21267 1128 21702 1165 --
NM_032408chr73952 930 157 11233 ----
NM_032410chr821081 193 ------
NM_032420chr58613 571 213 203 151 59 49 24 1114 --1603
NM_032431chr115290 240 80 45 26 2340 184 2386 279 --
NM_032434chr231520 248 124 1350 ----
NM_032436chr131216 ------
NM_032440chr1062967 2330 2232 816 794 386 11058 ----
NM_032442chr17--1175 ----
NM_032444chr163404 241 43 11022 ----
NM_032445chr153792 767 66 1215 ----
NM_032452chr1421203 494 11265 --11052
NM_032457chr42526 167 ------
NM_032458chrX42757 2304 2133 495 1950 ----
NM_032466chr821199 151 ------
NM_032468chr821199 151 ------
NM_032505chr332714 2096 962 ------
NM_032510chr1832036 871 380 ----131
NM_032538chr6152746 2641 2592 2410 2360 2018 1816 1781 1047 798 515 462 203 77 45 62095 2026 535 488 284 120 ----
NM_032552chr9131853 1792 1773 1765 1733 1479 1457 1449 1429 502 341 324 176 21640 470 ----
NM_032560chr141120 ------
NM_032575chr16111741 1604 1491 762 554 480 435 258 229 171 41 51728 1689 1291 566 112 ----
NM_032581chr72610 105 --41663 1462 486 376 11714
NM_032622chr421133 1093 1265 ----
NM_032711chr1783979 3929 3814 3154 2801 1373 464 167 13659 44247 3848 3789 716 1442
NM_032728chr9244 26 2625 272 1879 --
NM_032737chr19102545 2534 2291 1890 1077 1031 901 884 732 146 1174 1550 --
NM_032786chr12175 1213 133 --
NM_032788chr221101 1039 ----11511
NM_032800chr182707 2610 2507 2488 2273 1706 977 566 1287 32519 2082 484 --
NM_032801chr1132271 2240 984 11859 ----
NM_032809chr961384 1259 1243 1169 360 128 --11482 11051
NM_032812chr101120 ------
NM_032828chr1994761 4415 4116 1752 1667 1313 840 416 251 --13366 13788
NM_032833chr131712 604 184 --12221 --
NM_032840chr1271148 987 394 212 198 141 100 --31020 874 774 --
NM_032842chr72498 449 1678 ----
NM_032871chr11111926 1802 1786 1339 1222 712 674 494 223 212 109 ----1365
NM_032876chr144797 672 565 59 ------
NM_032906chr42355 172 --1724 --
NM_032946chrX293 32 ------
NM_032961chr41299 ------
NM_032968chrX63283 2810 2614 1102 835 455 ------
NM_032969chrX63283 2810 2614 1102 835 455 ------
NM_032973chrY63278 2613 1102 835 763 455 ----12807
NM_032983chr752847 2496 2257 1010 994 32702 2086 336 13193 --
NM_032998chr131125 1025 821 ------
NM_033014chr911446 ------
NM_033018chrX91152 1111 1071 878 832 367 323 283 65 1811 ----
NM_033020chr121497 483 --24161 3342 --
NM_033030chr2--11484 ----
NM_033036chr1151077 315 154 116 92 2374 354 ----
NM_033044chr111072 ------
NM_033055chr11790 ------
NM_033058chr8--134 --1244
NM_033071chr61104 --1125 --
NM_033102chr151171 975 444 415 52 11097 1338 170
NM_033102chr151171 975 444 415 52 11097 1338 170
NM_033103chr1921088 952 ------
NM_033119chr165606 356 327 214 142 1623 --1335
NM_033129chr2051431 1365 414 87 54 31810 741 735 11624 --
NM_033132chr1322026 498 ----1127
NM_033138chr731956 1601 661 --11438 --
NM_033139chr731956 1601 661 --11438 --
NM_033140chr731956 1601 661 --11438 --
NM_033143chr454371 2893 868 136 98 11432 --1251
NM_033157chr731956 1601 661 --11438 --
NM_033181chr613045 --1742 --
NM_033219chr9125 ------
NM_033221chr972429 2173 1031 1025 799 302 107 11866 22062 529 --
NM_033224chr746890 6711 5554 2527 16442 15464 26166 5237
NM_033225chr843167 1095 935 573 ----1883
NM_033226chr162109 96 ------
NM_033240chr1591637 1590 1346 1254 1213 634 490 122 63 11271 1471 --
NM_033255chr13--289 51 ----
NM_033259chr34661 302 295 38 1257 1852 --
NM_033274chr562932 2704 1252 518 337 103 1239 33131 3109 300 --
NM_033278chr111330 ------
NM_033281chr52860 246 2900 807 ----
NM_033306chr11128 ------
NM_033310chr11182 ------
NM_033315chr17142028 1781 1542 1429 1422 830 679 576 460 449 340 185 167 119 11683 11733 --
NM_033326chr11--11543 11673 11995
NM_033331chr922735 270 11081 22771 2444 --
NM_033375chr1721117 1022 31301 1161 247 11330 --
NM_033389chr1774442 4225 3770 1684 1551 1378 510 44257 3404 3346 3024 ----
NM_033401chr162501 158 ------
NM_033407chr1------1517
NM_033419chr17101680 1426 1250 1237 1120 359 318 278 229 162 11468 --11358
NM_033420chr197490 239 212 185 171 151 89 21101 260 1977 --
NM_033421chr205633 385 294 227 111 1504 --11438
NM_033425chr1132917 2246 802 1417 --12830
NM_033429chr155962 873 613 340 22 ----11998
NM_033449chr5101823 1810 1749 1731 1634 1422 808 792 684 310 32153 2137 1505 ----
NM_033503chr1573634 3547 3033 2886 2820 1305 609 53769 3572 3134 731 541 23149 2502 12553
NM_033512chr81828 1775 21187 166 --
NM_033549chr57922 815 289 283 141 64 25 ------
NM_033551chr5143433 3422 2921 2876 2749 2360 2201 1213 987 637 511 444 347 186 2497 75 12777 --
NM_033631chr173918 3653 2791 2374 1052 373 302 43751 3482 1433 736 33623 2395 279 22848 943
NM_033632chr41367 --1597 --
NM_033637chr1053642 3537 3415 3007 414 2812 527 33865 3742 567 --
NM_033644chr531639 821 661 ------
NM_033645chr531639 821 661 ------
NM_033656chr2165481 5207 5034 4428 3970 1132 ----21490 1375
NM_044472chr11100 ------
NM_048368chr184641 530 190 65 1246 ----
NM_052827chr1221133 378 126 1221 --
NM_052845chr1283140 2928 2913 2886 2823 2394 1311 391 32447 2366 980 ----
NM_052847chr19113206 3111 3068 2992 2882 2866 2299 930 242 119 98 33792 2423 2351 ----
NM_052851chr134908 880 450 183 1488 ----
NM_052855chr172191 155 ------
NM_052874chr161552 1123 ----
NM_052875chr1172166 1540 835 668 465 267 248 11345 ----
NM_052879chr1211368 --11050 --
NM_052880chr2251222 998 330 252 156 ------
NM_052885chr1244819 3810 1108 444 ------
NM_052897chr123640 257 66 ----1565
NM_052899chr58912 881 251 224 189 149 117 65 1622 ----
NM_052910chr1331840 313 250 --31340 413 179 --
NM_052913chr6--1386 ----
NM_052934chr171832 1584 1445 734 658 274 183 32259 1918 1810 ----
NM_052937chr82586 225 ------
NM_052938chr131102 451 167 150 ----
NM_053001chr8--1163 1116 --
NM_053016chr977661 7043 6521 6328 5666 4924 308 ----37571 6753 1086
NM_053023chr1151078 1020 1006 646 518 1784 ----
NM_053024chr321063 330 ------
NM_053043chr774482 4342 1716 1378 760 718 474 21605 1030 35555 3912 1893 --
NM_053064chr1441163 279 83 27 11204 ----
NM_053067chr91319 ------
NM_053279chr862540 2482 1948 935 737 358 2570 135 ----
NM_054013chr56816 615 214 153 95 36 --1790 --
NM_054025chr11111711 1463 861 716 703 637 529 411 351 300 21 32106 1424 814 ----
NM_054033chr22386 184 ------
NM_054111chr62105 74 ------
NM_057178chr17143 ------
NM_058170chr111113 ------
NM_058175chr214720 713 555 294 --161 --
NM_058241chr211713 --1771 --
NM_058241chr211713 --1771 --
NM_078471chr1731077 331 24 ------
NM_078473chr84837 625 42 21 12034 ----
NM_078487chr942444 912 848 500 ----13246
NM_079834chr1961583 1424 1402 575 415 219 194 11661 --
NM_080391chr11540 ------
NM_080392chr11589 ------
NM_080538chr331397 1058 1034 --184 --
NM_080539chr331397 1058 1034 --184 --
NM_080541chr331397 1058 1034 --184 --
NM_080546chr91821 ------
NM_080588chr121376 23 21546 1485 --1225
NM_080599chr102882 166 ------
NM_080607chr207858 798 782 768 380 372 226 1172 --1708
NM_080616chr20----1623 --
NM_080617chr202765 138 1752 ----
NM_080621chr2081301 1168 1091 1064 1020 456 255 124 --21071 76 1229
NM_080645chr6--21649 285 --11528
NM_080647chr225375 174 156 139 42 1106 ----
NM_080667chr2162 ------
NM_080669chr17114248 4135 4050 3836 3428 1852 1824 1105 1017 726 182 54123 1707 1058 805 394 11588 --
NM_080670chr55873 811 611 318 97 --1668 --
NM_080676chr2062839 2072 1261 892 808 502 1102 1331 12593
NM_080717chr122621 471 2974 249 ----
NM_080738chr151840 1746 1596 1575 1504 1664 --1363
NM_080744chr74636 445 236 69 --1581 --
NM_080759chr1332586 2409 1678 ------
NM_080760chr1332586 2409 1678 ------
NM_080764chr2251064 762 551 538 362 11286 12605 --
NM_080792chr2032123 1862 193 22251 1601 ----
NM_080829chr202702 68 1156 ----
NM_080840chr201177 ------
NM_080841chr201177 ------
NM_080867chr1444037 3813 3680 1278 --1912 --
NM_080881chr56579 549 299 292 95 55 --1680 --
NM_080927chr343005 2688 1201 264 ------
NM_130385chr1152929 2645 606 515 282 13167 --22968 2568
NM_130391chr912925 ------
NM_130392chr912925 ------
NM_130393chr912925 ------
NM_130435chr1042430 1999 1977 779 32283 2263 1098 ----
NM_130438chr2143121 793 573 530 1962 2205 63 --
NM_130439chr1031949 757 192 1811 ----
NM_130439chr1031949 757 192 1811 ----
NM_130440chr171245 602 322 222 201 89 59 --1366 --
NM_130442chr73768 403 162 1353 2305 146 --
NM_130459chr961207 1048 674 487 215 70 --11358 1157
NM_130466chr1241376 1242 475 55 1353 1109 --
NM_130470chr112578 121 2824 665 149 --
NM_130471chr112578 121 2824 665 149 --
NM_130472chr112578 121 2824 665 149 --
NM_130473chr112578 121 2824 665 149 --
NM_130474chr114706 629 249 27 2952 793 1177 --
NM_130475chr114706 629 249 27 2952 793 1177 --
NM_130476chr112578 121 2824 665 149 --
NM_130797chr771437 1430 1279 1167 338 271 168 1313 1387 --
NM_130799chr114607 491 303 287 --2633 53 --
NM_130800chr114607 491 303 287 --2633 53 --
NM_130801chr114607 491 303 287 --2633 53 --
NM_130802chr114607 491 303 287 --2633 53 --
NM_130803chr114607 491 303 287 --2633 53 --
NM_130804chr114607 491 303 287 --2633 53 --
NM_130807chr1992101 2073 1868 886 757 598 496 404 380 31450 196 157 11693 --
NM_130808chr3----1170 --
NM_130811chr20----149 --
NM_130830chr3103960 3659 2953 2695 1374 1165 363 334 232 115 23900 2965 33102 790 409 --
NM_130831chr352695 2434 2291 451 73 22500 1854 ----
NM_130832chr352695 2434 2291 451 73 22500 1854 ----
NM_130833chr352695 2434 2291 451 73 22500 1854 ----
NM_130834chr352695 2434 2291 451 73 22500 1854 ----
NM_130835chr352695 2434 2291 451 73 22500 1854 ----
NM_130836chr352695 2434 2291 451 73 22500 1854 ----
NM_130837chr352695 2434 2291 451 73 22500 1854 ----
NM_130838chr151663 --1574 11176
NM_130839chr151663 --1574 11176
NM_133170chr20157921 7774 7541 7135 6811 5636 5626 5097 2729 1913 1680 1033 560 134 53 36711 1843 1817 16195 25897 1866
NM_133172chr5181 ------
NM_133173chr5181 ------
NM_133174chr5181 ------
NM_133264chr1793737 3334 3024 2532 1042 998 962 246 94 33240 2950 125 ----
NM_133330chr462066 1071 1027 1008 596 84 42990 2059 931 236 ----
NM_133331chr462066 1071 1027 1008 596 84 42990 2059 931 236 ----
NM_133334chr4125867 5633 5059 4518 3989 2014 1506 852 708 634 324 269 36263 2525 1773 --22082 1249
NM_133335chr462066 1071 1027 1008 596 84 42990 2059 931 236 ----
NM_133370chr42654 481 --13494 --
NM_133372chr542219 2127 1920 1049 ------
NM_133433chr51166 ------
NM_133443chr1661805 1757 1522 1442 476 426 1607 --11646
NM_133445chr933384 165 49 23017 1159 1327 --
NM_133452chr195922 872 467 307 246 2818 151 ----
NM_133476chr126486 433 389 237 190 42 1418 1845 --
NM_133645chr6--1586 ----
NM_133647chr1553471 2624 1298 574 167 1145 ----
NM_133650chr61104 --1125 --
NM_134268chr1761103 1023 933 868 328 308 ----1842
NM_134325chr161367 1119 609 497 269 193 31794 1453 1345 ----
NM_134442chr231298 390 356 ------
NM_138270chrX33041 701 670 23380 2904 13146 --
NM_138281chr171504 199 ----
NM_138285chr21161 ------
NM_138292chr1152565 2435 1363 699 55 ------
NM_138300chr151455 1326 1306 594 237 1398 21617 474 --
NM_138316chr102923 26 ------
NM_138317chr141100 ------
NM_138318chr141100 ------
NM_138328chr1773029 2411 1161 1137 790 437 277 12536 22271 427 --
NM_138338chr22133108 3086 3063 2785 2712 2559 2509 2435 2190 1256 1170 1075 951 12314 22519 861 --
NM_138356chr154559 488 290 41 --1232 --
NM_138370chr21220 1694 ----
NM_138373chr1961579 1435 639 551 400 320 1652 ----
NM_138391chr13227 42 31 ------
NM_138396chr124757 313 297 214 1322 --1136
NM_138426chr7--12038 ----
NM_138437chrX149 ------
NM_138444chr1333124 774 69 ------
NM_138453chr5175 126 ----
NM_138457chr6143351 2659 2478 1326 1108 941 914 563 505 433 392 336 140 82 73193 2898 2792 2402 1095 94 60 12382 --
NM_138468chr255854 5716 5671 4916 4745 14291 26218 4765 11520
NM_138471chr11--1382 ----
NM_138473chr1294086 3755 3725 3584 3562 1690 1432 1168 997 14318 25170 4655 --
NM_138479chr151628 1426 1325 146 130 ------
NM_138555chr151399 ------
NM_138559chr231124 328 275 1228 193 --
NM_138569chr61233 ------
NM_138576chr1464444 3252 1856 1453 847 361 14460 ----
NM_138578chr20--1935 1328 --
NM_138621chr243869 3749 3547 1177 23651 653 ----
NM_138638chr1411634 ------
NM_138713chr1646323 6300 5648 2586 17866 --16260
NM_138714chr1646323 6300 5648 2586 17866 --16260
NM_138717chr63602 462 448 1656 ----
NM_138727chr132453 2027 241 ------
NM_138728chr132453 2027 241 ------
NM_138730chr61291 ------
NM_138731chr1441710 1628 1513 355 ------
NM_138732chr112265 206 ------
NM_138734chr112265 206 ------
NM_138735chr21586 --11407 --
NM_138766chr51410 ------
NM_138782chr521886 1754 ------
NM_138795chr161512 1441 282 269 249 61 ----11291
NM_138799chr21171 11383 ----
NM_138811chr721148 32 1794 ----
NM_138821chr51410 ------
NM_138822chr51410 ------
NM_138923chrX1128 ------
NM_138927chr21--139 ----
NM_138931chr32182 34 ------
NM_138957chr221116 ------
NM_138959chr1156487 5333 5266 4941 4730 2724 1694 1379 1363 1307 1079 736 682 342 300 54913 1392 884 787 776 --14752
NM_138967chr15102508 2203 2073 1948 963 953 579 378 325 174 --2426 364 12052
NM_138970chr1411975 1976 ----
NM_138971chr1163664 2830 2446 1404 808 288 21371 946 11239 --
NM_138971chr1163664 2830 2446 1404 808 288 21371 946 11239 --
NM_138972chr1163664 2830 2446 1404 808 288 21371 946 11239 --
NM_138972chr1163664 2830 2446 1404 808 288 21371 946 11239 --
NM_138973chr1163664 2830 2446 1404 808 288 21371 946 11239 --
NM_138973chr1163664 2830 2446 1404 808 288 21371 946 11239 --
NM_138981chr41103 ------
NM_138994chr162501 158 ------
NM_139062chr171379 ------
NM_139067chr122123 63 ------
NM_139071chr1251478 1314 1073 581 574 21171 564 11129 --
NM_139136chr1211003 ------
NM_139157chr113567 530 483 ------
NM_139159chr198966 432 373 366 248 130 83 49 2917 93 ----
NM_139207chr123650 269 46 ------
NM_139239chr194275 238 209 37 ------
NM_139283chr1242082 991 705 186 ------
NM_139312chr1031309 480 344 ------
NM_139321chr2082838 2805 2612 1568 1483 1260 1197 1013 ------
NM_139323chr2011847 1127 11462 --
NM_144571chr432647 2557 1524 --1543 --
NM_144574chr141449 1253 ----
NM_144575chr24316 181 123 40 ------
NM_144578chr1441956 1871 1369 1257 23634 3478 11847 --
NM_144579chr2112861 2844 2597 2337 2201 1121 1014 758 689 589 118 32876 865 777 ----
NM_144583chr231767 1724 695 ------
NM_144586chr23946 328 45 --11037 --
NM_144590chr1031178 546 401 ----12398
NM_144600chr1631625 472 337 ------
NM_144601chr1641046 429 267 130 1141 ----
NM_144610chr17------153
NM_144618chr13651 488 232 ----11367
NM_144628chr2042700 2271 1950 508 22998 525 ----
NM_144631chr21255 ------
NM_144632chr21189 11587 1941 --
NM_144636chr32661 554 ------
NM_144641chr361136 1099 944 810 303 142 1910 ----
NM_144664chr1142432 2361 2178 67 12262 ----
NM_144667chr124989 729 718 370 ------
NM_144691chr194253 224 197 125 ------
NM_144704chr222237 114 186 ----
NM_144707chr24848 464 105 49 ------
NM_144712chr2165 ----138
NM_144726chr51461 ------
NM_144767chr15144648 4308 3801 3515 2853 1667 1597 1381 1135 1011 972 937 535 245 1133 ----
NM_144778chr1322121 457 ------
NM_144949chr222572 2011 ------
NM_144967chrX2234 166 ------
NM_144973chr1264549 4365 1563 1392 919 742 ----13313
NM_145010chr102507 138 1107 21951 302 --
NM_145013chr1162029 2020 882 867 172 39 1387 124 --
NM_145025chr62228 207 ------
NM_145071chr35854 391 341 129 76 2771 60 ----
NM_145074chr22571 553 ------
NM_145112chr1461103 1046 404 352 343 78 ------
NM_145113chr1471375 1318 624 615 350 255 155 1238 ----
NM_145119chrX2113 69 ------
NM_145174chr221472 ----1282
NM_145178chr10377 68 48 ------
NM_145185chr19101836 1808 1625 1458 331 323 302 285 177 53 2794 23 21574 558 --
NM_145201chr84321 142 116 22 ----140
NM_145203chr13----1194 --
NM_145206chr1052802 2518 2443 745 476 33209 2166 98 23312 305 1288
NM_145251chr1421263 494 ------
NM_145259chr236897 6194 620 12796 ----
NM_145260chr24546 519 283 163 ------
NM_145274chr17--1729 ----
NM_145279chr121292 125 11231 ----
NM_145313chr1041295 1242 1060 363 1472 ----
NM_145320chr723581 1347 22702 2647 13078 --
NM_145321chr723581 1347 22702 2647 13078 --
NM_145322chr723581 1347 22702 2647 13078 --
NM_145330chr21181 --1157 --
NM_145349chr17111868 1542 1535 1490 891 860 832 651 552 365 244 ------
NM_145638chr118914 868 425 416 407 178 39 21 --1723 --
NM_145686chr223347 1129 32591 2444 316 --12746
NM_145687chr223347 1129 32591 2444 316 --12746
NM_145690chr841886 1493 1425 1337 ------
NM_145716chr13525 501 417 ------
NM_145733chr227900 844 285 252 115 105 66 31125 449 221 ----
NM_145753chr321635 1100 ------
NM_145756chr1831125 560 37 11004 ----
NM_145793chr101765 ------
NM_145798chr172593 122 1902 1811 --
NM_145799chrX92588 1954 1185 796 666 587 480 364 263 11123 ----
NM_145800chrX21006 867 ------
NM_145802chrX2955 816 ------
NM_145808chr752642 457 451 317 233 ----21046 388
NM_145859chr3195 ------
NM_145860chr3195 ------
NM_145861chr151840 1746 1596 1575 1504 1664 --1363
NM_145868chr102481 224 --199 --
NM_145869chr102481 224 --199 --
NM_145912chr22254078 3938 3819 3615 3582 3572 2945 1871 1708 1644 1573 1566 1432 1150 1016 980 931 921 823 787 392 318 255 95 55 33563 1120 155 44124 3658 1211 1022 12973
NM_147150chr933693 335 174 23229 2427 12890 --
NM_147161chr181120 893 408 363 313 209 140 119 1240 1199 --
NM_147164chr95534 457 400 189 171 ------
NM_147181chr411137 ------
NM_147182chr411137 ------
NM_147183chr411137 ------
NM_147192chr151197 577 464 416 190 --151 --
NM_147202chr972351 2205 1699 839 484 403 100 11969 22124 714 1373
NM_147223chr23656 552 159 --12016 1572
NM_147233chr22473 369 --11833 1389
NM_148894chr41118 ------
NM_148898chr71151 1128 --1976
NM_148899chr71151 1128 --1976
NM_148921chr1762214 1744 1716 1682 331 186 62379 2171 1881 381 153 119 2983 956 --
NM_148977chr102923 26 ------
NM_148978chr102923 26 ------
NM_152222chr11111926 1802 1786 1339 1222 712 674 494 223 212 109 ----1365
NM_152227chr202661 299 ------
NM_152237chr22211759 1748 1574 1407 1311 1269 1251 1241 1228 1115 1100 1082 691 664 547 528 464 361 332 229 53 1702 1583 --
NM_152240chr31316 1949 --11164
NM_152247chr222743 685 ------
NM_152253chr22134129 4071 3908 3776 3338 2901 2845 2791 1576 1514 479 429 111 52949 2713 1069 759 603 1513 --
NM_152264chr116998 976 834 818 438 115 1722 ----
NM_152272chr831205 1059 274 ------
NM_152275chr251476 560 512 396 72 --12288 --
NM_152277chr541486 629 547 23 ------
NM_152280chr132884 644 343 22771 2584 12741 --
NM_152283chr511131 ------
NM_152330chr141112 1682 12072 --
NM_152344chr1751501 1243 1087 1000 247 ------
NM_152345chr172720 452 --1858 --
NM_152371chr181999 1335 1236 783 765 696 207 190 2409 259 ----
NM_152374chr171687 1556 1550 1438 1357 1306 422 ------
NM_152384chr2111687 1610 1561 1511 1434 1386 1336 1259 780 626 601 ------
NM_152390chr21115 ------
NM_152410chr6------1151
NM_152420chr92624 576 --1631 --
NM_152424chrX74658 3344 3226 1846 1400 1204 887 23139 1267 14578 --
NM_152437chr1272314 2039 1633 1555 855 621 437 --1487 --
NM_152470chr18113668 3608 3495 3471 3030 2970 1376 1299 1261 1248 330 43273 1439 857 561 162 1922
NM_152493chr141090 1015 542 150 166 ----
NM_152512chr221400 ------
NM_152519chr2159 ----11714
NM_152520chr21132 ------
NM_152529chr224424 325 1108 --23220 1378
NM_152545chr41496 ------
NM_152546chr5--1120 ----
NM_152554chr62215 169 1442 --1128
NM_152557chr771435 1206 1004 604 495 416 48 --122 1622
NM_152586chr102823 672 --1786 1221
NM_152594chr151767 ------
NM_152622chr5----12234 --
NM_152629chr924008 3903 42508 1606 1389 260 23131 2926 1755
NM_152653chr31582 --165 --
NM_152667chr2031177 1043 239 --11221 --
NM_152682chr43713 347 244 11685 ----
NM_152688chr6286 46 ------
NM_152692chrX1458 ------
NM_152694chrX--1313 ----
NM_152705chr1331078 495 26 --1455 --
NM_152716chr1131215 1084 348 ------
NM_152722chr1151542 1488 722 293 50 21423 1378 ----
NM_152733chr6236335 6217 5815 5756 5686 5667 5501 5397 5305 5296 4968 4962 4212 4078 2192 2166 2092 2067 1816 1790 1783 1205 284 25538 4689 25205 5104 24682 1598
NM_152739chr71775 --1104 --
NM_152740chr7264 54 ------
NM_152744chr7113164 3050 3038 3025 2904 1301 1165 758 730 404 310 23115 2832 ----
NM_152749chr721049 101 ------
NM_152756chr524324 515 32728 586 69 ----
NM_152758chr81472 ------
NM_152769chr194877 787 294 32 3655 648 369 ----
NM_152793chr764743 4370 3273 1728 1664 240 23755 36 --14181
NM_152835chr1--21007 973 ----
NM_152838chr2033418 3203 1085 ------
NM_152857chr6--141 ----
NM_152858chr6--141 ----
NM_152868chr22139 ------
NM_152879chr2112573 2003 1986 1730 1674 1630 1596 916 648 483 165 12059 2428 54 --
NM_152896chr91530 1241 ----
NM_152902chr131817 1323 117 ------
NM_152903chr1311780 ------
NM_152919chr1942438 1089 308 240 ------
NM_152924chr15166654 4644 4592 4310 4206 2478 2346 2249 2203 1871 1802 1352 1239 632 462 33 22217 174 56364 4481 2313 1978 828 --
NM_152989chr1211181 2161 46 ----
NM_152999chr734499 3173 1148 ----13907
NM_153033chr741453 981 296 136 125 1482 21427 159
NM_153035chr15626 618 587 434 21 1157 ----
NM_153038chr2--2580 540 --1564
NM_153050chr22114971 4804 4722 4156 3221 1846 1584 1479 1111 1032 556 14031 34663 4268 3813 --
NM_153051chr22114971 4804 4722 4156 3221 1846 1584 1479 1111 1032 556 14031 34663 4268 3813 --
NM_153188chr545036 3940 1502 68 126 11012 --
NM_153252chrX----1370 --
NM_153260chr152499 76 ----1342
NM_153261chr1621522 37 --11266 --
NM_153273chr3142603 2273 2234 2148 2070 2033 962 942 786 681 487 389 371 148 --11790 12179
NM_153321chr172252 91 ------
NM_153322chr172252 91 ------
NM_153332chr853089 670 459 434 76 ------
NM_153350chr1691496 1083 684 589 544 186 151 102 72 51461 1451 1258 611 503 ----
NM_153365chr412678 11702 ----
NM_153367chr10103913 3653 3586 3574 3403 1432 1229 702 326 293 43460 1185 745 560 33985 1257 1175 --
NM_153371chr1341874 718 584 547 ------
NM_153426chr41160 ------
NM_153427chr41160 ------
NM_153487chr6184791 4755 4553 4448 4019 3802 3548 3489 3393 3295 3129 3064 2998 1545 1282 1245 1134 469 14713 14389 1814
NM_153499chr1262609 2449 2045 620 209 34 ----11917
NM_153500chr1262609 2449 2045 620 209 34 ----11917
NM_153607chr513103 ------
NM_153616chr151259 ------
NM_153617chr151259 ------
NM_153618chr151259 ------
NM_153619chr154838 784 454 188 1878 ----
NM_153620chr721671 524 1407 ----
NM_153633chr122608 182 ------
NM_153649chr111512 ------
NM_153685chr124893 866 807 55 1151 ----
NM_153686chr441835 950 729 94 ------
NM_153687chr12154 ------
NM_153689chr212315 ------
NM_153712chr283397 3275 3141 2603 908 266 198 158 3593 367 335 --1349
NM_153747chr1----147 --
NM_153748chr1211003 ------
NM_153756chr14533 421 180 103 ----1774
NM_153764chr112140 43 1877 ----
NM_153765chr112140 43 1877 ----
NM_153766chr112140 43 1877 ----
NM_153767chr112140 43 1877 ----
NM_153827chr173772 635 597 --1275 --
NM_153828chr21365 ------
NM_153831chr8153 1110 ----
NM_153836chr231879 689 111 --1627 --
NM_170606chr711280 ------
NM_170607chr1781565 1364 1341 1196 424 402 312 297 41498 543 326 146 ----
NM_170663chr173772 635 597 --1275 --
NM_170665chr1294281 4069 3191 3146 3070 2832 1841 1359 932 ------
NM_170679chr53965 518 483 11325 ----
NM_170706chr144078 3924 3403 51 23564 616 31678 1385 33 14132
NM_170723chrY2208 88 ------
NM_170743chr152709 2330 2052 466 84 21168 964 1844 --
NM_170754chr123327 311 62 ------
NM_170782chr11470 ------
NM_171998chrX4861 261 231 118 1308 ----
NM_172016chr61903 ------
NM_172020chr731543 705 147 1183 1674 1799
NM_172057chr72138 126 ------
NM_172070chr211890 12052 ----
NM_172071chr166767 6201 5466 5404 4702 2312 27337 2124 ----
NM_172103chr632075 409 385 ------
NM_172105chr632075 409 385 ------
NM_172169chr1051639 589 466 298 163 11782 11653 --
NM_172170chr1051639 589 466 298 163 11782 11653 --
NM_172171chr1051639 589 466 298 163 11782 11653 --
NM_172173chr1051639 589 466 298 163 11782 11653 --
NM_172198chr1----1207 --
NM_172206chr1721870 1569 2289 113 ----
NM_172211chr15889 665 244 162 121 ------
NM_172216chr1252511 2351 1947 522 111 ----11819
NM_172219chr173280 240 164 3760 97 62 ----
NM_172220chr173280 240 164 3760 97 62 ----
NM_172225chr151197 577 464 416 190 --151 --
NM_172226chr1262609 2449 2045 620 209 34 ----11917
NM_172230chr115290 240 80 45 26 2340 184 2386 279 --
NM_172337chr141347 ------
NM_172375chr141204 ------
NM_173039chr11--1245 ----
NM_173064chr152709 2330 2052 466 84 21168 964 1844 --
NM_173082chr611171 ------
NM_173156chr191998 1816 1771 1681 861 551 95 78 68 32012 1596 726 ----
NM_173157chr124384 357 159 64 ------
NM_173172chr21189 --1445 --
NM_173191chr1051276 1265 449 148 55 ------
NM_173192chr1051276 1265 449 148 55 ------
NM_173193chr1051276 1265 449 148 55 ------
NM_173194chr1051276 1265 449 148 55 ------
NM_173195chr1051276 1265 449 148 55 ------
NM_173198chr942666 2042 766 117 12479 ----
NM_173200chr942666 2042 766 117 12479 ----
NM_173214chr1646323 6300 5648 2586 17866 --16260
NM_173354chr2152064 1363 730 722 300 ------
NM_173359chr341921 1436 1203 379 ------
NM_173462chr1461639 1394 1300 573 187 123 2744 24 --1153
NM_173465chr51378 31010 683 144 --1836
NM_173469chr151459 ------
NM_173470chrX42390 1907 1142 137 ------
NM_173473chr1031892 1671 1013 1711 ----
NM_173476chr16122296 2264 1833 1789 908 691 637 594 512 313 235 128 42204 829 372 44 11521 2873 676
NM_173478chr1721052 371 ------
NM_173492chr91203 ------
NM_173495chrX1989 22357 752 1513 1469
NM_173500chr15--1354 ----
NM_173511chr253730 1519 1179 911 199 ----11005
NM_173515chr6169 2897 86 ----
NM_173535chr26486 414 180 124 100 48 ----1567
NM_173536chr41881 33145 1155 1070 ----
NM_173543chr32215 36 ------
NM_173547chr1761132 680 669 638 631 22 --11249 1399
NM_173552chr331814 990 878 ------
NM_173554chr101283 1121 ----
NM_173563chr61100 ------
NM_173576chr103714 402 339 1279 ----
NM_173582chr1145535 5181 1321 424 15709 --11398
NM_173595chr12165201 4602 4373 4122 3782 3722 3685 3670 3579 2063 1626 1406 1361 739 322 130 34493 931 645 23232 745 --
NM_173602chr1213612 --13224 1945
NM_173609chr152635 151 ------
NM_173642chr178937 7490 6734 6486 6109 3274 323 32416 2369 2208 12320 38511 6684 2847
NM_173654chr31739 --1563 11512
NM_173674chr6141 ------
NM_173676chr62311 208 1167 ----
NM_173681chr7102014 1729 1490 1430 1312 251 223 123 117 41 41889 1831 806 448 21881 1354 21634 324
NM_173683chr821563 1103 ------
NM_173694chrX21617 221 --1783 --
NM_173808chr134454 4293 983 --11624 11776
NM_173809chr1051488 1310 1267 1191 1112 ------
NM_173822chr21580 ------
NM_173832chr8163315 3235 3186 3145 3096 2972 2923 2880 2720 1133 1089 802 684 630 509 42 52631 966 880 874 462 ----
NM_173851chr843674 2852 2836 2627 23657 3605 --13415
NM_173872chr41320 ------
NM_174911chr863354 1302 1127 1063 691 601 22812 104 2883 239 --
NM_174921chr41759 ------
NM_174934chr11133340 2783 1441 1342 1249 1219 1040 865 726 681 630 67 35 --22531 1263 --
NM_174963chr13847 732 713 3607 186 108 ----
NM_174964chr13847 732 713 3607 186 108 ----
NM_174965chr13866 751 732 3626 205 127 ----
NM_174966chr13847 732 713 3607 186 108 ----
NM_174967chr13866 751 732 3626 205 127 ----
NM_174968chr13847 732 713 3607 186 108 ----
NM_174969chr13847 732 713 3607 186 108 ----
NM_174970chr13866 751 732 3626 205 127 ----
NM_174971chr13847 732 713 3607 186 108 ----
NM_175058chr1141190 1081 383 53 ------
NM_175063chr193479 253 174 1357 --1347
NM_175077chr2061245 1195 1039 375 164 50 2481 451 1268 --
NM_175607chr311162 ------
NM_175612chr311162 ------
NM_175624chr1286482 6138 5809 5177 1589 1053 523 400 ------
NM_175625chr1286482 6138 5809 5177 1589 1053 523 400 ------
NM_175634chr8--11013 ----
NM_175635chr8--11013 ----
NM_175636chr8--11013 ----
NM_175747chr61128 ------
NM_175767chr521283 448 1481 ----
NM_175852chr1112962 2751 2358 2068 1940 1895 712 685 619 529 57 22241 2211 --12178
NM_175854chr1352397 2193 1820 1096 704 ------
NM_175856chr51649 ------
NM_175866chr12976 279 ------
NM_175875chr196620 566 550 450 224 139 175 ----
NM_175876chr12433 418 ------
NM_175898chr1591289 1231 1178 452 429 333 147 109 75 11067 1644 --
NM_175907chr1832503 2118 1102 22742 835 ----
NM_175920chr51134 --1793 --
NM_175931chr16111903 1871 1839 1807 1775 1631 1573 1485 1363 1349 277 31408 1380 56 11528 --
NM_176801chr481290 493 461 359 281 198 175 159 5681 567 534 187 149 21282 503 --
NM_176814chr71922 ------
NM_177398chr131407 1384 152 ----21889 624
NM_177399chr131407 1384 152 ----21889 624
NM_177401chr19389 83 67 1326 ----
NM_177438chr1453903 3435 2605 1261 387 ------
NM_177559chr2011162 1327 ----
NM_177560chr2011162 1327 ----
NM_177947chrX1293 ------
NM_177948chrX1293 ------
NM_177952chr142588 159 ------
NM_177968chr211485 ------
NM_177969chr22661 128 ------
NM_177972chr1194107 4086 3630 528 506 377 137 118 72 --11466 --
NM_177977chr1791851 1845 1764 1711 1546 717 637 512 22 21242 728 ----
NM_177985chr221875 266 --11936 --
NM_177990chr201250 ------
NM_177999chr9143524 3491 3288 3234 3224 2885 2843 2638 2630 2496 1132 794 493 81 72364 2294 2253 1346 1076 993 897 11114 11157
NM_178000chr951466 1433 1396 1071 948 31331 1006 937 171 --
NM_178001chr951466 1433 1396 1071 948 31331 1006 937 171 --
NM_178003chr951466 1433 1396 1071 948 31331 1006 937 171 --
NM_178006chr134908 880 450 183 1488 ----
NM_178007chr134908 880 450 183 1488 ----
NM_178010chr1211181 2161 46 ----
NM_178026chr20156 1425 ----
NM_178037chr12103076 2757 2625 2449 2222 1458 1373 1015 698 51 ------
NM_178038chr12103076 2757 2625 2449 2222 1458 1373 1015 698 51 ------
NM_178120chr231178 184 140 ------
NM_178126chr1771662 1539 878 841 550 397 90 --11737 --
NM_178140chr522693 2363 12069 ----
NM_178148chr62470 214 ------
NM_178151chrX197594 6970 6458 5875 5807 5750 5698 2964 2888 2571 2529 2486 2292 2196 2011 1820 1445 494 268 1503 ----
NM_178152chrX197594 6970 6458 5875 5807 5750 5698 2964 2888 2571 2529 2486 2292 2196 2011 1820 1445 494 268 1503 ----
NM_178153chrX197594 6970 6458 5875 5807 5750 5698 2964 2888 2571 2529 2486 2292 2196 2011 1820 1445 494 268 1503 ----
NM_178175chrX4579 571 104 48 ------
NM_178177chr3141 ------
NM_178313chr21107 1696 ----
NM_178426chr11598 12126 ----
NM_178427chr11498 12026 ----
NM_178441chr1451341 1316 961 523 469 --1436 --
NM_178450chr52496 90 ------
NM_178466chr201132 ------
NM_178505chr1011020 21002 539 13251 --
NM_178509chr1753957 3283 2797 1119 705 11480 1847 --
NM_178554chr3143134 3057 2948 2315 2280 1417 1256 1170 915 891 494 487 452 82 22530 1348 21425 957 --
NM_178568chr1771701 1539 1282 1197 538 378 228 1182 ----
NM_178578chr202259 238 12454 2200 139 --
NM_178585chr443266 2092 913 815 13022 ----
NM_178812chr811229 ------
NM_181077chr1522009 465 11776 ----
NM_181093chr11184 ------
NM_181302chr141449 1253 ----
NM_181308chr141449 1253 ----
NM_181336chr631063 992 222 21205 456 11284 --
NM_181349chr752243 435 323 257 30 2833 813 11113 --
NM_181351chr1142338 2323 2003 1965 12810 12009 --
NM_181358chr174014 3703 3222 2646 1696 379 47 --23437 3214 --
NM_181361chr3--1443 ----
NM_181427chr151114 ------
NM_181481chr1896464 6304 4477 2486 2054 1278 733 550 63 15585 12305 --
NM_181482chr1896464 6304 4477 2486 2054 1278 733 550 63 15585 12305 --
NM_181483chr1896464 6304 4477 2486 2054 1278 733 550 63 15585 12305 --
NM_181486chr122621 471 2974 249 ----
NM_181491chr9102905 2826 2764 2664 2620 2593 2569 2518 1194 131 33052 604 545 12552 12601
NM_181504chr521050 449 ------
NM_181521chr1697003 6457 6369 6262 1704 1327 1201 488 151 27119 7073 21948 1348 --
NM_181523chr521050 449 ------
NM_181524chr521050 449 ------
NM_181553chr1641046 429 267 130 1141 ----
NM_181554chr1641046 429 267 130 1141 ----
NM_181571chr1031148 452 265 --1936 --
NM_181575chr2156 ------
NM_181656chr172313 69 ------
NM_181672chrX11266 142 ----
NM_181673chrX11266 142 ----
NM_181674chr51156 ------
NM_181675chr51156 ------
NM_181676chr51156 ------
NM_181677chr51156 ------
NM_181678chr51156 ------
NM_181701chr951849 905 556 49 34 ----12089
NM_181702chr81133 ------
NM_181705chr533828 672 412 ----11598
NM_181713chr21877 ------
NM_181714chr62704 460 --1426 --
NM_181724chr125399 249 79 38 24 1222 11206 --
NM_181782chr632181 1955 53 182 ----
NM_181784chr252394 1903 828 642 125 ------
NM_181802chr202150 139 ------
NM_181828chr22113684 3658 3403 3233 2947 1454 986 954 440 212 34 53384 3260 2752 1001 178 ----
NM_181829chr22113684 3658 3403 3233 2947 1454 986 954 440 212 34 53384 3260 2752 1001 178 ----
NM_181830chr22113684 3658 3403 3233 2947 1454 986 954 440 212 34 53384 3260 2752 1001 178 ----
NM_181832chr22113699 3673 3418 3248 2962 1469 1001 969 455 227 49 53399 3275 2767 1016 193 ----
NM_181836chr532152 844 440 1448 ----
NM_181839chr821143 1111 --2328 291 --
NM_181844chr1732016 1516 1247 122 3477 311 297 11864
NM_181861chr1292472 2437 2378 2054 1125 989 871 691 564 1952 ----
NM_181868chr1292472 2437 2378 2054 1125 989 871 691 564 1952 ----
NM_181869chr1282557 2522 2463 2139 1074 956 776 649 11037 ----
NM_181873chr1--134 ----
NM_181876chr472584 2504 793 733 599 154 21 2764 36 ----
NM_181886chr411172 11088 ----
NM_181887chr411172 11088 ----
NM_181888chr411172 11088 ----
NM_181889chr411172 11088 ----
NM_181890chr411172 11088 ----
NM_181891chr411172 11088 ----
NM_181892chr411219 11135 ----
NM_181893chr411172 11088 ----
NM_182485chr432863 1146 161 --11135 --
NM_182488chr132253 162 ------
NM_182503chr675310 5021 4916 2124 1795 1035 994 11099 14576 14175
NM_182507chr124718 350 188 84 41591 957 623 228 ----
NM_182509chr1451371 1313 1201 157 98 --11634 11079
NM_182511chr1841140 1018 471 361 ------
NM_182526chr14152909 2858 2769 2758 2519 2435 2173 2068 1207 833 799 764 610 137 96 52980 2473 1248 119 113 ----
NM_182527chr22151923 1728 1568 877 829 759 745 736 654 553 533 522 413 140 45 41788 1664 1538 225 ----
NM_182553chr115486 178 122 89 61 1440 ----
NM_182557chr1171944 1931 1804 1665 1451 393 272 3873 734 434 --11517
NM_182577chr193417 185 163 1345 1383 --
NM_182580chr172234 2191 2062 1680 851 512 229 22109 955 ----
NM_182643chr81815 ------
NM_182646chr432863 1146 161 --11135 --
NM_182678chr22485 71 ------
NM_182685chr14837 665 97 90 1143 ----
NM_182691chr71568 --11253 --
NM_182692chr71568 --11253 --
NM_182706chr8--149 ----
NM_182715chr71812 ------
NM_182718chr1031148 452 265 --1936 --
NM_182719chr1031148 452 265 --1936 --
NM_182724chr1031148 452 265 --1936 --
NM_182725chr1031148 452 265 --1936 --
NM_182728chr1471473 1306 713 688 622 359 189 1218 11600 --
NM_182763chr131830 1760 582 22330 450 ----
NM_182765chr102567 67 ------
NM_182769chr1031148 452 265 --1936 --
NM_182770chr1031148 452 265 --1936 --
NM_182771chr1031148 452 265 --1936 --
NM_182772chr1031148 452 265 --1936 --
NM_182779chr17685 627 609 334 228 162 23 1783 1746 --
NM_182789chr5--1877 ----
NM_182798chr53535 471 310 ----11375
NM_182799chr54591 535 471 310 ----11375
NM_182801chr54591 535 471 310 ----11375
NM_182830chr1411824 <